Mariella, Jr., Raymond P.
2008-11-18
A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.
Formation of template-switching artifacts by linear amplification.
Chakravarti, Dhrubajyoti; Mailander, Paula C
2008-07-01
Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.
Enzyme-free detection and quantification of double-stranded nucleic acids.
Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Hänni, Catherine; Daniel, Isabelle
2012-08-01
We have developed a fully enzyme-free SERRS hybridization assay for specific detection of double-stranded DNA sequences. Although all DNA detection methods ranging from PCR to high-throughput sequencing rely on enzymes, this method is unique for being totally non-enzymatic. The efficiency of enzymatic processes is affected by alterations, modifications, and/or quality of DNA. For instance, a limitation of most DNA polymerases is their inability to process DNA damaged by blocking lesions. As a result, enzymatic amplification and sequencing of degraded DNA often fail. In this study we succeeded in detecting and quantifying, within a mixture, relative amounts of closely related double-stranded DNA sequences from Rupicapra rupicapra (chamois) and Capra hircus (goat). The non-enzymatic SERRS assay presented here is the corner stone of a promising approach to overcome the failure of DNA polymerase when DNA is too degraded or when the concentration of polymerase inhibitors is too high. It is the first time double-stranded DNA has been detected with a truly non-enzymatic SERRS-based method. This non-enzymatic, inexpensive, rapid assay is therefore a breakthrough in nucleic acid detection.
A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.
Razvi, F; Gargiulo, G; Worcel, A
1983-08-01
Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.
In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.
Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V
2017-09-22
Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.
Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.
2013-01-01
Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567
cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.
De Bruin, Lennart; Maddocks, John H
2018-06-14
The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sobottka, Marcelo, E-mail: sobottka@mtm.ufsc.br; Hart, Andrew G., E-mail: ahart@dim.uchile.cl
Highlights: {yields} We propose a simple stochastic model to construct primitive DNA sequences. {yields} The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. {yields} The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. {yields} We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. {yields} We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that themore » frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.« less
Mouw, M; Pintel, D J
1998-11-10
GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.
Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion
Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko
2011-01-01
Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143
NASA Astrophysics Data System (ADS)
Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao
2015-02-01
In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.
Strand-invading linear probe combined with unmodified PNA.
Asanuma, Hiroyuki; Niwa, Rie; Akahane, Mariko; Murayama, Keiji; Kashida, Hiromu; Kamiya, Yukiko
2016-09-15
Efficient strand invasion by a linear probe to fluorescently label double-stranded DNA has been implemented by employing a probe and unmodified PNA. As a fluorophore, we utilized ethynylperylene. Multiple ethynylperylene residues were incorporated into the DNA probe via a d-threoninol scaffold. The ethynylperylene did not significantly disrupt hybridization with complementary DNA. The linear probe self-quenched in the absence of target DNA and did not hybridize with PNA. A gel-shift assay revealed that linear probe and PNA combination invaded the central region of double-stranded DNA upon heat-shock treatment to form a double duplex. To further suppress the background emission and increase the stability of the probe/DNA duplex, a probe containing anthraquinones as well as ethynylperylene was synthesized. This probe and PNA invader pair detected an internal sequence in a double-stranded DNA with high sensitivity when heat shock treatment was used. The probe and PNA pair was able to invade at the terminus of a long double-stranded DNA at 40°C at 100mM NaCl concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mammalian DNA enriched for replication origins is enriched for snap-back sequences.
Zannis-Hadjopoulos, M; Kaufmann, G; Martin, R G
1984-11-15
Using the instability of replication loops as a method for the isolation of double-stranded nascent DNA, extruded DNA enriched for replication origins was obtained and denatured. Snap-back DNA, single-stranded DNA with inverted repeats (palindromic sequences), reassociates rapidly into stem-loop structures with zero-order kinetics when conditions are changed from denaturing to renaturing, and can be assayed by chromatography on hydroxyapatite. Origin-enriched nascent DNA strands from mouse, rat and monkey cells growing either synchronously or asynchronously were purified and assayed for the presence of snap-back sequences. The results show that origin-enriched DNA is also enriched for snap-back sequences, implying that some origins for mammalian DNA replication contain or lie near palindromic sequences.
RAP80, ubiquitin and SUMO in the DNA damage response.
Lombardi, Patrick M; Matunis, Michael J; Wolberger, Cynthia
2017-08-01
A decade has passed since the first reported connection between RAP80 and BRCA1 in DNA double-strand break repair. Despite the initial identification of RAP80 as a factor localizing BRCA1 to DNA double-strand breaks and potentially promoting homologous recombination, there is increasing evidence that RAP80 instead suppresses homologous recombination to fine-tune the balance of competing DNA repair processes during the S/G 2 phase of the cell cycle. RAP80 opposes homologous recombination by inhibiting DNA end-resection and sequestering BRCA1 into the BRCA1-A complex. Ubiquitin and SUMO modifications of chromatin at DNA double-strand breaks recruit RAP80, which contains distinct sequence motifs that recognize ubiquitin and SUMO. Here, we review RAP80's role in repressing homologous recombination at DNA double-strand breaks and how this role is facilitated by its ability to bind ubiquitin and SUMO modifications.
Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.
Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara
2017-02-20
The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.
Characterization of Bleomycin-Mediated Cleavage of a Hairpin DNA Library
Segerman, Zachary J.; Roy, Basab; Hecht, Sidney M.
2013-01-01
A study of BLM A5 was conducted using a previously isolated library of hairpin DNAs found to bind strongly to metal free BLM. The ability of Fe(II)•BLM to effect cleavage on both the 3' and 5'-arms of the hairpin DNAs was characterized. The strongly bound DNAs were found to be efficient substrates for Fe•BLM A5-mediated hairpin DNA cleavage. Surprisingly, the most prevalent site of BLM-mediated cleavage was found to be the 5′-AT-3′ dinucleotide sequence. This dinucleotide sequence, and other sequences generally not cleaved well by BLM when examined using arbitrarily chosen DNA substrates, were apparent when examining the library of ten hairpin DNAs. In total, 132 sites of DNA cleavage were produced by exposure of the hairpin DNA library to Fe•BLM A5. The existence of multiple sites of cleavage on both the 3′- and 5′-arms of the hairpin DNAs suggested that some of these might be double-strand cleavage events. Accordingly, an assay was developed with which to test the propensity of the hairpin DNAs to undergo double-strand DNA damage. One hairpin DNA was characterized using this method, and gave results consistent with earlier reports of double-strand DNA cleavage, but with a sequence selectivity different from those reported previously. PMID:23834496
Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities
Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi
2005-01-01
Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118
Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bates, R.C.; Snyder, C.E.; Banerjee, P.T.
1984-02-01
Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less
Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.
Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J
2016-03-04
Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange*
Borgogno, María V.; Monti, Mariela R.; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E.; Pezza, Roberto J.
2016-01-01
Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3′ end of the initiating DNA strand have a small effect, whereas most mismatches near the 5′ end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. PMID:26709229
Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA
NASA Astrophysics Data System (ADS)
Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan
2018-05-01
Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.
Quantitative analysis and prediction of G-quadruplex forming sequences in double-stranded DNA
Kim, Minji; Kreig, Alex; Lee, Chun-Ying; Rube, H. Tomas; Calvert, Jacob; Song, Jun S.; Myong, Sua
2016-01-01
Abstract G-quadruplex (GQ) is a four-stranded DNA structure that can be formed in guanine-rich sequences. GQ structures have been proposed to regulate diverse biological processes including transcription, replication, translation and telomere maintenance. Recent studies have demonstrated the existence of GQ DNA in live mammalian cells and a significant number of potential GQ forming sequences in the human genome. We present a systematic and quantitative analysis of GQ folding propensity on a large set of 438 GQ forming sequences in double-stranded DNA by integrating fluorescence measurement, single-molecule imaging and computational modeling. We find that short minimum loop length and the thymine base are two main factors that lead to high GQ folding propensity. Linear and Gaussian process regression models further validate that the GQ folding potential can be predicted with high accuracy based on the loop length distribution and the nucleotide content of the loop sequences. Our study provides important new parameters that can inform the evaluation and classification of putative GQ sequences in the human genome. PMID:27095201
Aliberti, A; Cusano, A M; Battista, E; Causa, F; Netti, P A
2016-02-21
A novel class of probes for fluorescence detection was developed and combined to microgel particles for a high sensitive fluorescence detection of nucleic acids. A double strand probe with an optimized fluorescent-quencher couple was designed for the detection of different lengths of nucleic acids (39 nt and 100 nt). Such probe proved efficient in target detection in different contests and specific even in presence of serum proteins. The conjugation of double strand probes onto polymeric microgels allows for a sensitive detection of DNA sequences from HIV, HCV and SARS corona viruses with a LOD of 1.4 fM, 3.7 fM and 1.4 fM, respectively, and with a dynamic range of 10(-9)-10(-15) M. Such combination enhances the sensitivity of the detection of almost five orders of magnitude when compared to the only probe. The proposed platform based on the integration of innovative double strand probe into microgels particles represents an attractive alternative to conventional sensitive DNA detection technologies that rely on amplifications methods.
Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.
Ricchetti, M; Fairhead, C; Dujon, B
1999-11-04
The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process.
NASA Technical Reports Server (NTRS)
Dar, M. E.; Jorgensen, T. J.
1995-01-01
Using the radiomimetic drug, bleomycin, we have determined the mutagenic potential of DNA strand breaks in the shuttle vector pZ189 in human fibroblasts. The bleomycin treatment conditions used produce strand breaks with 3'-phosphoglycolate termini as > 95% of the detectable dose-dependent lesions. Breaks with this end group represent 50% of the strand break damage produced by ionizing radiation. We report that such strand breaks are mutagenic lesions. The type of mutation produced is largely determined by the type of strand break on the plasmid (i.e. single versus double). Mutagenesis studies with purified DNA forms showed that nicked plasmids (i.e. those containing single-strand breaks) predominantly produce base substitutions, the majority of which are multiples, which presumably originate from error-prone polymerase activity at strand break sites. In contrast, repair of linear plasmids (i.e. those containing double-strand breaks) mainly results in deletions at short direct repeat sequences, indicating the involvement of illegitimate recombination. The data characterize the nature of mutations produced by single- and double-strand breaks in human cells, and suggests that deletions at direct repeats may be a 'signature' mutation for the processing of DNA double-strand breaks.
Häring, Monika; Peng, Xu; Brügger, Kim; Rachel, Reinhard; Stetter, Karl O; Garrett, Roger A; Prangishvili, David
2004-06-01
A novel virus, termed Pyrobaculum spherical virus (PSV), is described that infects anaerobic hyperthermophilic archaea of the genera Pyrobaculum and Thermoproteus. Spherical enveloped virions, about 100 nm in diameter, contain a major multimeric 33-kDa protein and host-derived lipids. A viral envelope encases a superhelical nucleoprotein core containing linear double-stranded DNA. The PSV infection cycle does not cause lysis of host cells. The viral genome was sequenced and contains 28337 bp. The genome is unique for known archaeal viruses in that none of the genes, including that encoding the major structural protein, show any significant sequence matches to genes in public sequence databases. Exceptionally for an archaeal double-stranded DNA virus, almost all the recognizable genes are located on one DNA strand. The ends of the genome consist of 190-bp inverted repeats that contain multiple copies of short direct repeats. The two DNA strands are probably covalently linked at their termini. On the basis of the unusual morphological and genomic properties of this DNA virus, we propose to assign PSV to a new viral family, the Globuloviridae.
Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*
Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko
2011-01-01
RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474
DNA - peptide polyelectrolyte complexes: Phase control by hybridization
NASA Astrophysics Data System (ADS)
Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew
DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.
Nakamura, Shigetaka; Kawabata, Hayato; Fujimoto, Kenzo
2016-08-17
An oligodeoxynucleotide (ODN) containing the ultrafast reversible 3-cyanovinylcarbazole ((CNV) K) photo-crosslinker was photo-crosslinked to a complementary strand upon exposure to 366 nm irradiation and photosplit by use of 312 nm irradiation. In this paper we report that the photoreaction of (CNV) K on irradiation at 366 nm involves a photostationary state and that its reaction can be controlled by temperature. Guided by this new insight, we proposed and have now demonstrated previously unknown photosplitting of (CNV) K aided by DNA strand displacement as an alternative to heating. The photo-crosslinked double-stranded DNA (dsDNA) underwent >80 % photosplitting aided by DNA strand displacement on irradiation at 366 nm without heating. In this photosplitting based on DNA strand displacement, the relative thermal stability of the invader strand with respect to the template strands plays an important role, and an invader strand/template strand system that is more stable than the passenger strand/template strand system induces photosplitting without heating. This new strand-displacement-aided photosplitting occurred in a sequence-specific manner through irradiation at 366 nm in the presence of an invader strand. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brégeon, Damien; Doetsch, Paul W
2004-11-01
Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.
Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H
1994-01-01
We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710
A paper-based device for double-stranded DNA detection with Zif268
NASA Astrophysics Data System (ADS)
Zhang, Daohong
2017-05-01
Here, a small analytical device was fabricated on both nitrocellulose membrane and filter paper, for the detection of biotinylated double-stranded DNA (dsDNA) from 1 nM. Zif268 was utilized for capturing the target DNA, which was a zinc finger protein that recognized only a dsDNA with specific sequence. Therefore, this detection platform could be utilized for PCR result detection, with the well-designed primers (interpolate both biotin and Zif268 binding sequence). The result of the assay could be recorded by a camera-phone, and analyzed with software. The whole assay finished within 1 hour. Due to the easy fabrication, operation and disposal of this device, this method can be employed in point-of-care detection or on-site monitoring.
Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo
2018-01-01
DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.
Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks
NASA Astrophysics Data System (ADS)
Singleton, Martin R.; Dillingham, Mark S.; Gaudier, Martin; Kowalczykowski, Stephen C.; Wigley, Dale B.
2004-11-01
RecBCD is a multi-functional enzyme complex that processes DNA ends resulting from a double-strand break. RecBCD is a bipolar helicase that splits the duplex into its component strands and digests them until encountering a recombinational hotspot (Chi site). The nuclease activity is then attenuated and RecBCD loads RecA onto the 3' tail of the DNA. Here we present the crystal structure of RecBCD bound to a DNA substrate. In this initiation complex, the DNA duplex has been split across the RecC subunit to create a fork with the separated strands each heading towards different helicase motor subunits. The strands pass along tunnels within the complex, both emerging adjacent to the nuclease domain of RecB. Passage of the 3' tail through one of these tunnels provides a mechanism for the recognition of a Chi sequence by RecC within the context of double-stranded DNA. Gating of this tunnel suggests how nuclease activity might be regulated.
Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks
Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael
2017-01-01
DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene’s first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks. PMID:28628606
Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J
2002-03-08
An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.
Mechanisms of radiation-induced gene responses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woloschak, G.E.; Paunesku, T.
1996-10-01
In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less
Kumala, Slawomir; Fujarewicz, Krzysztof; Jayaraju, Dheekollu; Rzeszowska-Wolny, Joanna; Hancock, Ronald
2013-01-01
To obtain an overall picture of the repair of DNA single and double strand breaks in a defined region of chromatin in vivo, we studied their repair in a ∼170 kb circular minichromosome whose length and topology are analogous to those of the closed loops in genomic chromatin. The rate of repair of single strand breaks in cells irradiated with γ photons was quantitated by determining the sensitivity of the minichromosome DNA to nuclease S1, and that of double strand breaks by assaying the reformation of supercoiled DNA using pulsed field electrophoresis. Reformation of supercoiled DNA, which requires that all single strand breaks have been repaired, was not slowed detectably by the inhibitors of poly(ADP-ribose) polymerase-1 NU1025 or 1,5-IQD. Repair of double strand breaks was slowed by 20–30% when homologous recombination was supressed by KU55933, caffeine, or siRNA-mediated depletion of Rad51 but was completely arrested by the inhibitors of nonhomologous end-joining wortmannin or NU7441, responses interpreted as reflecting competition between these repair pathways similar to that seen in genomic DNA. The reformation of supercoiled DNA was unaffected when topoisomerases I or II, whose participation in repair of strand breaks has been controversial, were inhibited by the catalytic inhibitors ICRF-193 or F11782. Modeling of the kinetics of repair provided rate constants and showed that repair of single strand breaks in minichromosome DNA proceeded independently of repair of double strand breaks. The simplicity of quantitating strand breaks in this minichromosome provides a usefull system for testing the efficiency of new inhibitors of their repair, and since the sequence and structural features of its DNA and its transcription pattern have been studied extensively it offers a good model for examining other aspects of DNA breakage and repair. PMID:23382828
Rogacheva, Maria V.; Manhart, Carol M.; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric
2014-01-01
Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair. PMID:24403070
Rogacheva, Maria V; Manhart, Carol M; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric
2014-02-28
Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair.
Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas
2010-08-01
We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.
Ultraaccurate genome sequencing and haplotyping of single human cells.
Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun
2017-11-21
Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.
sup 60 Co. gamma. -rays induce predominantly C/G to G/C transversions in double-stranded M13 DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoebee, B.; Loman, H.; Brouwer, J.
Upon irradiation with gamma rays of an oxygenated aqueous solution of double-stranded M13 DNA, a very specific mutation spectrum was found with respect to both the type and the positions in the DNA sequence. Of the 23 mutations, which were sequenced, 16 represent a C/G to G/C transversion. A C/G to T/A transition was found once and a G/C to T/A transversion twice. The remaining 4 mutations are frameshifts, 2 are identical and formed by the insertion of a G/C basepair; the other 2 mutations are due to a duplication of 10 basepairs situated at different positions but with amore » remarkable homology in base sequence. Fourteen mutations, including the 2 duplications are found in the neighborhood of a TGCT/ACGA sequence.« less
Why double-stranded RNA resists condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.
2014-09-15
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less
The Apis mellifera Filamentous Virus Genome
Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D.; de Miranda, Joachim R.; Neumann, Peter
2015-01-01
A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family. PMID:26184284
The Apis mellifera Filamentous Virus Genome.
Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D; de Miranda, Joachim R; Neumann, Peter
2015-07-09
A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family.
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
Mechanisms for RNA capture by ssDNA viruses: grand theft RNA.
Stedman, Kenneth
2013-06-01
Viruses contain three common types of packaged genomes; double-stranded DNA (dsDNA), RNA (mostly single and occasionally double stranded) and single-stranded DNA (ssDNA). There are relatively straightforward explanations for the prevalence of viruses with dsDNA and RNA genomes, but the evolutionary basis for the apparent success of ssDNA viruses is less clear. The recent discovery of four ssDNA virus genomes that appear to have been formed by recombination between co-infecting RNA and ssDNA viruses, together with the high mutation rate of ssDNA viruses provide possible explanations. RNA-DNA recombination allows ssDNA viruses to access much broader sequence space than through nucleotide substitution and DNA-DNA recombination alone. Multiple non-exclusive mechanisms, all due to the unique replication of ssDNA viruses, are proposed for this unusual RNA capture. RNA capture provides an explanation for the evolutionary success of the ssDNA viruses and may help elucidate the mystery of integrated RNA viruses in viral and cellular DNA genomes.
Switching bonds in a DNA gel: an all-DNA vitrimer.
Romano, Flavio; Sciortino, Francesco
2015-02-20
We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.
Gabsalilow, Lilia; Schierling, Benno; Friedhoff, Peter; Pingoud, Alfred; Wende, Wolfgang
2013-04-01
Targeted genome engineering requires nucleases that introduce a highly specific double-strand break in the genome that is either processed by homology-directed repair in the presence of a homologous repair template or by non-homologous end-joining (NHEJ) that usually results in insertions or deletions. The error-prone NHEJ can be efficiently suppressed by 'nickases' that produce a single-strand break rather than a double-strand break. Highly specific nickases have been produced by engineering of homing endonucleases and more recently by modifying zinc finger nucleases (ZFNs) composed of a zinc finger array and the catalytic domain of the restriction endonuclease FokI. These ZF-nickases work as heterodimers in which one subunit has a catalytically inactive FokI domain. We present two different approaches to engineer highly specific nickases; both rely on the sequence-specific nicking activity of the DNA mismatch repair endonuclease MutH which we fused to a DNA-binding module, either a catalytically inactive variant of the homing endonuclease I-SceI or the DNA-binding domain of the TALE protein AvrBs4. The fusion proteins nick strand specifically a bipartite recognition sequence consisting of the MutH and the I-SceI or TALE recognition sequences, respectively, with a more than 1000-fold preference over a stand-alone MutH site. TALE-MutH is a programmable nickase.
Derivatized versions of ligase enzymes for constructing DNA sequences
Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Tucker, James D [Novi, MN; Dzenitis, John M [Livermore, CA; Papavasiliou, Alexandros P [Oakland, CA
2006-08-15
A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.
Modeling DNA bubble formation at the atomic scale
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beleva, V; Rasmussen, K. O.; Garcia, A. E.
We describe the fluctuations of double stranded DNA molecules using a minimalist Go model over a wide range of temperatures. Minimalist models allow us to describe, at the atomic level, the opening and formation of bubbles in DNA double helices. This model includes all the geometrical constraints in helix melting imposed by the 3D structure of the molecule. The DNA forms melted bubbles within double helices. These bubbles form and break as a function of time. The equilibrium average number of broken base pairs shows a sharp change as a function of T. We observe a temperature profile of sequencemore » dependent bubble formation similar to those measured by Zeng et al. Long nuclei acid molecules melt partially through the formations of bubbles. It is known that CG rich sequences melt at higher temperatures than AT rich sequences. The melting temperature, however, is not solely determined by the CG content, but by the sequence through base stacking and solvent interactions. Recently, models that incorporate the sequence and nonlinear dynamics of DNA double strands have shown that DNA exhibits a very rich dynamics. Recent extensions of the Bishop-Peyrard model show that fluctuations in the DNA structure lead to opening in localized regions, and that these regions in the DNA are associated with transcription initiation sites. 1D and 2D models of DNA may contain enough information about stacking and base pairing interactions, but lack the coupling between twisting, bending and base pair opening imposed by the double helical structure of DNA that all atom models easily describe. However, the complexity of the energy function used in all atom simulations (including solvent, ions, etc) does not allow for the description of DNA folding/unfolding events that occur in the microsecond time scale.« less
Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L
2016-05-01
Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.
Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research
Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in
Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes
Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.
2015-01-01
Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076
Single-molecule dilution and multiple displacement amplification for molecular haplotyping.
Paul, Philip; Apgar, Josh
2005-04-01
Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.
Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease.
Liu, Yibin; Song, Chen; Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Makrigiorgos, G Mike
2017-04-07
Aberrant methylation changes, often present in a minor allelic fraction in clinical samples such as plasma-circulating DNA (cfDNA), are potentially powerful prognostic and predictive biomarkers in human disease including cancer. We report on a novel, highly-multiplexed approach to facilitate analysis of clinically useful methylation changes in minor DNA populations. Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) employs a double-strand-specific DNA nuclease (DSN) to remove excess DNA with normal methylation patterns. The technique utilizes oligonucleotide-probes that direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets, and leaving methylated targets intact; and vice versa. Subsequent amplification of the targeted regions results in enrichment of the targeted methylated or unmethylated minority-epigenetic-alleles. We validate MS-NaME by demonstrating enrichment of RARb2, ATM, MGMT and GSTP1 promoters in multiplexed MS-NaME reactions (177-plex) using dilutions of methylated/unmethylated DNA and in DNA from clinical lung cancer samples and matched normal tissue. MS-NaME is a highly scalable single-step approach performed at the genomic DNA level in solution that combines with most downstream detection technologies including Sanger sequencing, methylation-sensitive-high-resolution melting (MS-HRM) and methylation-specific-Taqman-based-digital-PCR (digital Methylight) to boost detection of low-level aberrant methylation-changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Translocation of double strand DNA into a biological nanopore
NASA Astrophysics Data System (ADS)
Chatkaew, Sunita; Mlayeh, Lamia; Leonetti, Marc; Homble, Fabrice
2009-03-01
Translocation of double strand DNA across a unique mitochondrial biological nanopore (VDAC) is observed by an electrophysiological method. Characteristics of opened and sub-conductance states of VDAC are studied. When the applied electric potential is beyond ± 20 mV, VDAC transits to a sub-conductance state. Plasmids (circular double strand DNA) with a diameter greater than that of the channel shows the current reduction into the channel during the interaction but the state with zero-current is not observed. On the contrary, the interaction of linear double strand DNA with the channel shows the current reduction along with the zero-current state. These show the passages of linear double strand DNA across the channel and the electrostatic effect due to the surface charges of double strand DNA and channel for circular and linear double strand DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cairns, S.S.
1987-01-01
In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less
Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.
2013-01-01
To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679
Bongini, Lorenzo; Melli, Luca; Lombardi, Vincenzo; Bianco, Pasquale
2014-01-01
Under a tension of ∼65 pN, double-stranded DNA undergoes an overstretching transition from its basic (B-form) conformation to a 1.7 times longer conformation whose nature is only recently starting to be understood. Here we provide a structural and thermodynamic characterization of the transition by recording the length transient following force steps imposed on the λ-phage DNA with different melting degrees and temperatures (10–25°C). The shortening transient following a 20–35 pN force drop from the overstretching force shows a sequence of fast shortenings of double-stranded extended (S-form) segments and pauses owing to reannealing of melted segments. The lengthening transients following a 2–35 pN stretch to the overstretching force show the kinetics of a two-state reaction and indicate that the whole 70% extension is a B-S transition that precedes and is independent of melting. The temperature dependence of the lengthening transient shows that the entropic contribution to the B-S transition is one-third of the entropy change of thermal melting, reinforcing the evidence for a double-stranded S-form that maintains a significant fraction of the interstrand bonds. The cooperativity of the unitary elongation (22 bp) is independent of temperature, suggesting that structural factors, such as the nucleic acid sequence, control the transition. PMID:24353317
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Tae Hoon; Chennakrishnaiah, Shilpa; Audemard, Eric
2014-08-22
Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellularmore » vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells.« less
Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.
Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi
2018-05-01
Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.
Why double-stranded RNA resists condensation
Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.
2014-01-01
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663
DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures
Barth, Anna; Kobbe, Daniela; Focke, Manfred
2016-01-01
Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051
Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O
2017-08-01
Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.
Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek
Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less
Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D
2014-05-27
We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.
NASA Astrophysics Data System (ADS)
Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.
2005-09-01
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J
2005-09-22
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
Andrews, Casey T; Campbell, Brady A; Elcock, Adrian H
2017-04-11
Given the ubiquitous nature of protein-DNA interactions, it is important to understand the interaction thermodynamics of individual amino acid side chains for DNA. One way to assess these preferences is to perform molecular dynamics (MD) simulations. Here we report MD simulations of 20 amino acid side chain analogs interacting simultaneously with both a 70-base-pair double-stranded DNA and with a 70-nucleotide single-stranded DNA. The relative preferences of the amino acid side chains for dsDNA and ssDNA match well with values deduced from crystallographic analyses of protein-DNA complexes. The estimated apparent free energies of interaction for ssDNA, on the other hand, correlate well with previous simulation values reported for interactions with isolated nucleobases, and with experimental values reported for interactions with guanosine. Comparisons of the interactions with dsDNA and ssDNA indicate that, with the exception of the positively charged side chains, all types of amino acid side chain interact more favorably with ssDNA, with intercalation of aromatic and aliphatic side chains being especially notable. Analysis of the data on a base-by-base basis indicates that positively charged side chains, as well as sodium ions, preferentially bind to cytosine in ssDNA, and that negatively charged side chains, and chloride ions, preferentially bind to guanine in ssDNA. These latter observations provide a novel explanation for the lower salt dependence of DNA duplex stability in GC-rich sequences relative to AT-rich sequences.
Complete Genome Sequences of 38 Gordonia sp. Bacteriophages
Montgomery, Matthew T.; Bonilla, J. Alfred; Dejong, Randall; Garlena, Rebecca A.; Guerrero Bustamante, Carlos; Klyczek, Karen K.; Russell, Daniel A.; Wertz, John T.; Jacobs-Sera, Deborah; Hatfull, Graham F.
2017-01-01
ABSTRACT We report here the genome sequences of 38 newly isolated bacteriophages using Gordonia terrae 3612 (ATCC 25594) and Gordonia neofelifaecis NRRL59395 as bacterial hosts. All of the phages are double-stranded DNA (dsDNA) tail phages with siphoviral morphologies, with genome sizes ranging from 17,118 bp to 93,843 bp and spanning considerable nucleotide sequence diversity. PMID:28057748
Yeast exonuclease 5 is essential for mitochondrial genome maintenance.
Burgers, Peter M; Stith, Carrie M; Yoder, Bonita L; Sparks, Justin L
2010-03-01
Yeast exonuclease 5 is encoded by the YBR163w (DEM1) gene, and this gene has been renamed EXO5. It is distantly related to the Escherichia coli RecB exonuclease class. Exo5 is localized to the mitochondria, and EXO5 deletions or nuclease-defective EXO5 mutants invariably yield petites, amplifying either the ori3 or ori5 region of the mitochondrial genome. These petites remain unstable and undergo continuous rearrangement. The mitochondrial phenotype of exo5Delta strains suggests an essential role for the enzyme in DNA replication and recombination. No nuclear phenotype associated with EXO5 deletions has been detected. Exo5 is a monomeric 5' exonuclease that releases dinucleotides as products. It is specific for single-stranded DNA and does not hydrolyze RNA. However, Exo5 has the capacity to slide across 5' double-stranded DNA or 5' RNA sequences and resumes cutting two nucleotides downstream of the double-stranded-to-single-stranded junction or RNA-to-DNA junction, respectively.
NASA Astrophysics Data System (ADS)
Rybenkov, Valentin V.
2016-09-01
The ability of living systems to defy thermodynamics without explicitly violating it is a continued source of inspiration to many biophysicists. The story of type-2 DNA topoisomerases is a beautiful example from that book. DNA topoisomerases catalyze a concerted DNA cleavage-religation reaction, which is interjected by a strand passage event. This sequence of events results in a seemingly unhindered transfer of one piece of DNA through another upon their random collision. An obvious consequence of such transfer is a change in the topological state of the colliding DNAs; hence the name of the enzymes, topoisomerases. There are several classes of topoisomerases, which differ in how they capture the cleaved and transported DNA segments (which are often referred to as the gate and transfer segments; or the G- and T-segments, to be short). Type-2 topoisomerases have two cleavage-religation centers. They open a gate in double stranded DNA and transfer another piece of double stranded DNA through it [1]. And in doing so, they manage to collect information about the rest of the DNA and perform strand passage in a directional manner so as to take the molecule away from the thermodynamic equilibrium [2].
Creating complex molecular topologies by configuring DNA four-way junctions
NASA Astrophysics Data System (ADS)
Liu, Di; Chen, Gang; Akhter, Usman; Cronin, Timothy M.; Weizmann, Yossi
2016-10-01
The realization of complex topologies at the molecular level represents a grand challenge in chemistry. This necessitates the manipulation of molecular interactions with high precision. Here we show that single-stranded DNA (ssDNA) knots and links can be created by utilizing the inherent topological properties that pertain to the DNA four-way junction, at which the two helical strands form a node and can be configured conveniently and connected for complex topological construction. Using this strategy, we produced series of ssDNA topoisomers with the same sequences. By finely designing the curvature and torsion, double-stranded DNA knots were accessed by hybridizing and ligating the complementary strands with the knotted ssDNA templates. Furthermore, we demonstrate the use of a constructed ssDNA knot both to probe the topological conversion catalysed by DNA topoisomerase and to study the DNA replication under topological constraint.
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-01-01
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-05-23
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.
Species-specific Typing of DNA Based on Palindrome Frequency Patterns
Lamprea-Burgunder, Estelle; Ludin, Philipp; Mäser, Pascal
2011-01-01
DNA in its natural, double-stranded form may contain palindromes, sequences which read the same from either side because they are identical to their reverse complement on the sister strand. Short palindromes are underrepresented in all kinds of genomes. The frequency distribution of short palindromes exhibits more than twice the inter-species variance of non-palindromic sequences, which renders palindromes optimally suited for the typing of DNA. Here, we show that based on palindrome frequency, DNA sequences can be discriminated to the level of species of origin. By plotting the ratios of actual occurrence to expectancy, we generate palindrome frequency patterns that allow to cluster different sequences of the same genome and to assign plasmids, and in some cases even viruses to their respective host genomes. This finding will be of use in the growing field of metagenomics. PMID:21429991
Grawunder, U; Lieber, M R
1997-01-01
The recombination activating gene (RAG) 1 and 2 proteins are required for initiation of V(D)J recombination in vivo and have been shown to be sufficient to introduce DNA double-strand breaks at recombination signal sequences (RSSs) in a cell-free assay in vitro. RSSs consist of a highly conserved palindromic heptamer that is separated from a slightly less conserved A/T-rich nonamer by either a 12 or 23 bp spacer of random sequence. Despite the high sequence specificity of RAG-mediated cleavage at RSSs, direct binding of the RAG proteins to these sequences has been difficult to demonstrate by standard methods. Even when this can be demonstrated, questions about the order of events for an individual RAG-RSS complex will require methods that monitor aspects of the complex during transitions from one step of the reaction to the next. Here we have used template-independent DNA polymerase terminal deoxynucleotidyl transferase (TdT) in order to assess occupancy of the reaction intermediates by the RAG complex during the reaction. In addition, this approach allows analysis of the accessibility of end products of a RAG-catalyzed cleavage reaction for N nucleotide addition. The results indicate that RAG proteins form a long-lived complex with the RSS once the initial nick is generated, because the 3'-OH group at the nick remains obstructed for TdT-catalyzed N nucleotide addition. In contrast, the 3'-OH group generated at the signal end after completion of the cleavage reaction can be efficiently tailed by TdT, suggesting that the RAG proteins disassemble from the signal end after DNA double-strand cleavage has been completed. Therefore, a single RAG complex maintains occupancy from the first step (nick formation) to the second step (cleavage). In addition, the results suggest that N region diversity at V(D)J junctions within rearranged immunoglobulin and T cell receptor gene loci can only be introduced after the generation of RAG-catalyzed DNA double-strand breaks, i.e. during the DNA end joining phase of the V(D)J recombination reaction. PMID:9060432
Excess single-stranded DNA inhibits meiotic double-strand break repair.
Johnson, Rebecca; Borde, Valérie; Neale, Matthew J; Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S H
2007-11-01
During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins.
Excess Single-Stranded DNA Inhibits Meiotic Double-Strand Break Repair
Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S. H
2007-01-01
During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1.We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Δ cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Δ cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins. PMID:18081428
Townsley, Brad T; Covington, Michael F; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R
2015-01-01
Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.
Method for producing labeled single-stranded nucleic acid probes
Dunn, John J.; Quesada, Mark A.; Randesi, Matthew
1999-10-19
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.
Recognition of the DNA sequence by an inorganic crystal surface
Sampaolese, Beatrice; Bergia, Anna; Scipioni, Anita; Zuccheri, Giampaolo; Savino, Maria; Samorì, Bruno; De Santis, Pasquale
2002-01-01
The sequence-dependent curvature is generally recognized as an important and biologically relevant property of DNA because it is involved in the formation and stability of association complexes with proteins. When a DNA tract, intrinsically curved for the periodical recurrence on the same strand of A-tracts phased with the B-DNA periodicity, is deposited on a flat surface, it exposes to that surface either a T- or an A-rich face. The surface of a freshly cleaved mica crystal recognizes those two faces and preferentially interacts with the former one. Statistical analysis of scanning force microscopy (SFM) images provides evidence of this recognition between an inorganic crystal surface and nanoscale structures of double-stranded DNA. This finding could open the way toward the use of the sequence-dependent adhesion to specific crystal faces for nanotechnological purposes. PMID:12361979
Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR
Miner, Brooks E.; Stöger, Reinhard J.; Burden, Alice F.; Laird, Charles D.; Hansen, R. Scott
2004-01-01
PCR amplification of limited amounts of DNA template carries an increased risk of product redundancy and contamination. We use molecular barcoding to label each genomic DNA template with an individual sequence tag prior to PCR amplification. In addition, we include molecular ‘batch-stamps’ that effectively label each genomic template with a sample ID and analysis date. This highly sensitive method identifies redundant and contaminant sequences and serves as a reliable method for positive identification of desired sequences; we can therefore capture accurately the genomic template diversity in the sample analyzed. Although our application described here involves the use of hairpin-bisulfite PCR for amplification of double-stranded DNA, the method can readily be adapted to single-strand PCR. Useful applications will include analyses of limited template DNA for biomedical, ancient DNA and forensic purposes. PMID:15459281
Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila
Saveliev, Sergei V.; Cox, Michael M.
2001-01-01
DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15–16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form. PMID:11406601
Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila.
Saveliev, S V; Cox, M M
2001-06-15
DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15-16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form.
Meira, L B; Henriques, J A; Magaña-Schwencke, N
1995-01-01
The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218
Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae
NASA Astrophysics Data System (ADS)
Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping
2010-12-01
Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.
RecA: Regulation and Mechanism of a Molecular Search Engine.
Bell, Jason C; Kowalczykowski, Stephen C
2016-06-01
Homologous recombination maintains genomic integrity by repairing broken chromosomes. The broken chromosome is partially resected to produce single-stranded DNA (ssDNA) that is used to search for homologous double-stranded DNA (dsDNA). This homology driven 'search and rescue' is catalyzed by a class of DNA strand exchange proteins that are defined in relation to Escherichia coli RecA, which forms a filament on ssDNA. Here, we review the regulation of RecA filament assembly and the mechanism by which RecA quickly and efficiently searches for and identifies a unique homologous sequence among a vast excess of heterologous DNA. Given that RecA is the prototypic DNA strand exchange protein, its behavior affords insight into the actions of eukaryotic RAD51 orthologs and their regulators, BRCA2 and other tumor suppressors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan
2014-09-02
A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.
Poltev, Valeri; Anisimov, Victor M; Danilov, Victor I; Garcia, Dolores; Sanchez, Carolina; Deriabina, Alexandra; Gonzalez, Eduardo; Rivas, Francisco; Polteva, Nina
2014-06-01
Our previous DFT computations of deoxydinucleoside monophosphate complexes with Na(+)-ions (dDMPs) have demonstrated that the main characteristics of Watson-Crick (WC) right-handed duplex families are predefined in the local energy minima of dDMPs. In this work, we study the mechanisms of contribution of chemically monotonous sugar-phosphate backbone and the bases into the double helix irregularity. Geometry optimization of sugar-phosphate backbone produces energy minima matching the WC DNA conformations. Studying the conformational variability of dDMPs in response to sequence permutation, we found that simple replacement of bases in the previously fully optimized dDMPs, e.g. by constructing Pyr-Pur from Pur-Pyr, and Pur-Pyr from Pyr-Pur sequences, while retaining the backbone geometry, automatically produces the mutual base position characteristic of the target sequence. Based on that, we infer that the directionality and the preferable regions of the sugar-phosphate torsions, combined with the difference of purines from pyrimidines in ring shape, determines the sequence dependence of the structure of WC DNA. No such sequence dependence exists in dDMPs corresponding to other DNA conformations (e.g., Z-family and Hoogsteen duplexes). Unlike other duplexes, WC helix is unique by its ability to match the local energy minima of the free single strand to the preferable conformations of the duplex. Copyright © 2013 Wiley Periodicals, Inc.
Shcherbakov, Victor P; Shcherbakova, Tamara; Plugina, Lidiya; Sizova, Svetlana; Kudryashova, Elena; Granovsky, Igor
2008-06-01
The experimental system combining double-strand breaks (DSBs), produced site-specifically by SegC endonuclease, with the famous advantages of the bacteriophage T4 rII mutant recombination analysis was used here to elucidate the origin of the recombination bias on two sides of the DSB, especially pronounced in gene 39 (topoisomerase II) and gene 59 (41-helicase loader) mutants. Three sources were found to contribute to the bias: (1) the SegC endonuclease may remain bound to the end of the broken DNA and thus protect it from exonuclease degradation; (2) in heteroduplex heterozygotes (HHs), arising as the recombinant products in the left-hand crosses, the transcribed strands are of rII mutant phenotype, so they, in contrast to the right-hand HHs, do not produce plaques on the lawn of the lambda-lysogenic host; and (3) the intrinsic polarity of T4 chromosome, reflected in transcription, may be a cause for discrimination of promoter-proximal and promoter-distal DNA sequences. It is shown that the apparent recombination bias does not imply one-sidedness of the DSB repair but just reflects a different depth of the end processing. It is inferred that the cause, underlying the "intrinsic" bias, might be interference between strand exchange and transcription. Topoisomerase and helicase functions are necessary to turn the process in favor of strand exchange. The idea is substantiated that the double-stranded to single-stranded DNA transition edge (not ss-DNA tip) serves as an actual recombinogenic element.
Method for introducing unidirectional nested deletions
Dunn, J.J.; Quesada, M.A.; Randesi, M.
1999-07-27
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.
Method for introducing unidirectional nested deletions
Dunn, John J.; Quesada, Mark A.; Randesi, Matthew
1999-07-27
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.
DNA purification by triplex-affinity capture and affinity capture electrophoresis
Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.
1996-01-01
The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.
Current-voltage characteristics of double stranded versus single stranded DNA molecules
NASA Astrophysics Data System (ADS)
Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.
2004-03-01
Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)
Kurian, P; Dunston, G; Lindesay, J
2016-02-21
Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism. Copyright © 2015 Elsevier Ltd. All rights reserved.
Singh, Sheetal; Shih, Shyh-Jen; Vaughan, Andrew T M
2014-01-01
Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter- and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks and rearrangements introduced into any identifiable genomic location. We have also applied parallel sequencing for the high-throughput analysis of inverse PCR products to facilitate the unbiased recording of all rearrangements located at a specific genomic location.
Kurian, P.; Dunston, G.; Lindesay, J.
2015-01-01
Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme’s displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations—a possible signature of quantum entanglement—may be explained by such a mechanism. PMID:26682627
Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.
There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less
Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA
Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.; ...
2017-10-27
There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less
Growing Bacteriophage M13 in Liquid Culture.
Green, Michael R; Sambrook, Joseph
2017-11-01
Stocks of bacteriophage M13 are usually grown in liquid culture. The infected bacteria do not lyse but, instead, grow at a slower than normal rate to form a dilute suspension. The inoculum of bacteriophage is almost always a freshly picked plaque or a suspension of bacteriophage particles obtained from a single plaque, as described here. Infected cells contain up to 200 copies of double-stranded, replicative-form DNA and extrude several hundred bacteriophage particles per generation. Thus, a 1-mL culture of infected cells can produce enough double-stranded viral DNA (1-2 mg) for restriction mapping and recovery of cloned DNA inserts and sufficient single-stranded DNA (∼5-10 mg) for site-directed mutagenesis, DNA sequencing, or synthesis of radiolabeled probes. The titer of bacteriophages in the supernatant from infected cells is so high (∼10 12 pfu/mL) that a small aliquot serves as a permanent stock of the starting plaque. © 2017 Cold Spring Harbor Laboratory Press.
RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.
Widmer, G
1993-03-01
Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.
Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research
Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in the architecture of eukaryotic genomes and are the evolutionary origin of retroviruses, including human immunodeficiency virus (HIV).
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Löbrich, M; Rydberg, B; Cooper, P K
1994-08-01
The initial yields of DNA double-strand breaks induced by energetic heavy ions (425 MeV/u neon and 250, 400 and 600 MeV/u iron) in comparison to X rays were measured in normal human diploid fibroblast cells within three small areas of the genome, defined by NotI fragments of 3.2, 2.0 and 1.2 Mbp. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated cells, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with probes recognizing single-copy sequences within the three NotI fragments. The gradual disappearance of the full-size NotI fragment with dose and the appearance of a smear of broken DNA molecules are quantified. Assuming Poisson statistics for the number of double-strand breaks induced per NotI fragment of known size, absolute yields of DNA double-strand breaks were calculated and determined to be linear with dose in all cases, with the neon ion (LET 32 keV/microns) producing 4.4 x 10(-3) breaks/Mbp/Gy and all three iron-ion beams (LETs from 190 to 350 keV/microns) producing 2.8 x 10(-3) breaks/Mbp/Gy, giving RBE values for production of double-strand breaks of 0.76 for neon and 0.48 for iron in comparison to our previously determined X-ray induction rate of 5.8 x 10(-3) breaks/Mbp/Gy. These RBE values are in good agreement with results of measurements over the whole genome as reported in the accompanying paper (B. Rydberg, M. Löbrich and P. Cooper, Radiat. Res. 139, 133-141, 1994). The distribution of broken DNA molecules was similar for the various radiations, supporting a random distribution of double-strand breaks induced by the heavy ions over Mbp distances; however, correlated breaks (clusters) over much smaller distances are not ruled out. Reconstitution of the 3.2 Mbp NotI fragment was studied during postirradiation incubation of the cells as a measure of rejoining of correct DNA ends. The proportion of breaks repaired decreased with increasing LET.
Qin, Qin; Xie, Hong; Wise, Sandra S.; Browning, Cynthia L.; Thompson, Kelsey N.; Holmes, Amie L.; Wise, John Pierce
2014-01-01
The aim of this study was to focus on hexavalent chromium, [Cr(VI)], a chemical carcinogen and major public health concern, and consider its ability to impact DNA double strand break repair. We further focused on particulate Cr(VI), because it is the more potent carcinogenic form of Cr(VI). DNA double strand break repair serves to protect cells against the detrimental effects of DNA double strand breaks. For particulate Cr(VI), data show DNA double strand break repair must be overcome for neoplastic transformation to occur. Acute Cr(VI) exposures reveal a robust DNA double strand break repair response, however, longer exposures have not been considered. Using the comet assay, we found longer exposures to particulate zinc chromate induced concentration-dependent increases in DNA double strand breaks indicating breaks were occurring throughout the exposure time. Acute (24 h) exposure induced DNA double strand break repair signaling by inducing Mre11 foci formation, ATM phosphorylation and phosphorylated ATM foci formation, Rad51 protein levels and Rad51 foci formation. However, longer exposures reduced the Rad51 response. These data indicate a major chemical carcinogen can simultaneously induce DNA double strand breaks and alter their repair and describe a new and important aspect of the carcinogenic mechanism for Cr(VI). PMID:25173789
Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong
2013-05-07
We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Linacre, Adrian; Ellis, Amanda V
2014-07-21
This paper reports on the modification of magnetic beads with oligonucleotide capture probes with a specially designed pendant toehold (overhang) aimed specifically to capture double-stranded PCR products. After capture, the PCR products were selectively released from the magnetic beads by means of a toehold-mediated strand displacement reaction using short artificial oligonucleotide triggers and analysed using capillary electrophoresis. The approach was successfully shown on two genes widely used in human DNA genotyping, namely human c-fms (macrophage colony-stimulating factor) proto-oncogene for the CSF-1 receptor (CSF1PO) and amelogenin.
Sequencing of adenine in DNA by scanning tunneling microscopy
NASA Astrophysics Data System (ADS)
Tanaka, Hiroyuki; Taniguchi, Masateru
2017-08-01
The development of DNA sequencing technology utilizing the detection of a tunnel current is important for next-generation sequencer technologies based on single-molecule analysis technology. Using a scanning tunneling microscope, we previously reported that dI/dV measurements and dI/dV mapping revealed that the guanine base (purine base) of DNA adsorbed onto the Cu(111) surface has a characteristic peak at V s = -1.6 V. If, in addition to guanine, the other purine base of DNA, namely, adenine, can be distinguished, then by reading all the purine bases of each single strand of a DNA double helix, the entire base sequence of the original double helix can be determined due to the complementarity of the DNA base pair. Therefore, the ability to read adenine is important from the viewpoint of sequencing. Here, we report on the identification of adenine by STM topographic and spectroscopic measurements using a synthetic DNA oligomer and viral DNA.
DNA purification by triplex-affinity capture and affinity capture electrophoresis
Cantor, C.R.; Ito, Takashi; Smith, C.L.
1996-01-09
The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.
2012-10-25
The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealedmore » that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.« less
Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.
Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard
2015-09-01
Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.
IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.
Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav
2016-01-01
Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.
RNA-dependent RNA targeting by CRISPR-Cas9
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less
RNA-dependent RNA targeting by CRISPR-Cas9
Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine; ...
2018-01-05
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less
RNA-dependent RNA targeting by CRISPR-Cas9
Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A
2018-01-01
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo. We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. These results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications. PMID:29303478
Nozeret, Karine; Bonan, Marc; Yarmoluk, Serguiy M; Novopashina, Darya S; Boutorine, Alexandre S
2015-09-01
Synthetic minor groove-binding pyrrole-imidazole polyamides labeled by fluorophores are promising candidates for fluorescence imaging of double-stranded DNA in isolated chromosomes or fixed and living cells. We synthesized nine hairpin and two head-to-head tandem polyamides targeting repeated sequences from mouse major satellites. Their interaction with synthetic target dsDNA has been studied by physico-chemical methods in vitro before and after coupling to various fluorophores. Great variability in affinities and fluorescence properties reveals a conclusion that these properties do not only rely on recognition rules, but also on other known and unknown structural factors. Individual testing of each probe is needed before cellular applications. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vega-Arroyo, M.; LeBreton, P. R.; Zapol, P.
Photoinduced charge separation in triads of DNA covalently linked to an anatase nanoparticle via a dopamine bridge was studied by ab initio calculations of the oxidation potentials of carboxyl-DNA trimers and the TiO2/dopamine complex. Conjugation of dopamine to the TiO2 surface results in a lower oxidation potential of the complex relative to the surface and in localization of photogenerated holes on dopamine, while photogenerated electrons are excited into the conduction band of TiO2. Linking dopamine to the DNA trimers at the 5? end of the oligonucleotide may lead to further hole migration to the DNA. Calculations show that for severalmore » different sequences hole migration is favorable in double stranded DNA and unfavorable in single-stranded DNA. This extended charge separation was shown to follow from the redox properties of DNA sequence rather than from the modification of DNA's electron donating properties by the dopamine linker, which explains experimental observations.« less
Complete Genome Sequences of Bacillus Phages Janet and OTooleKemple52
2018-01-01
ABSTRACT We report here the genome sequences of two novel Bacillus cereus group-infecting bacteriophages, Janet and OTooleKemple52. These bacteriophages are double-stranded DNA-containing Myoviridae isolated from soil samples. While their genomes share a high degree of sequence identity with one another, their host preferences are unique. PMID:29748396
Recombinational Repair of DNA Damage in Escherichia coli and Bacteriophage λ
Kuzminov, Andrei
1999-01-01
Although homologous recombination and DNA repair phenomena in bacteria were initially extensively studied without regard to any relationship between the two, it is now appreciated that DNA repair and homologous recombination are related through DNA replication. In Escherichia coli, two-strand DNA damage, generated mostly during replication on a template DNA containing one-strand damage, is repaired by recombination with a homologous intact duplex, usually the sister chromosome. The two major types of two-strand DNA lesions are channeled into two distinct pathways of recombinational repair: daughter-strand gaps are closed by the RecF pathway, while disintegrated replication forks are reestablished by the RecBCD pathway. The phage λ recombination system is simpler in that its major reaction is to link two double-stranded DNA ends by using overlapping homologous sequences. The remarkable progress in understanding the mechanisms of recombinational repair in E. coli over the last decade is due to the in vitro characterization of the activities of individual recombination proteins. Putting our knowledge about recombinational repair in the broader context of DNA replication will guide future experimentation. PMID:10585965
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Quantitative, non-invasive imaging of radiation-induced DNA double strand breaks in vivo
Li, Wenrong; Li, Fang; Huang, Qian; Shen, Jingping; Wolf, Frank; He, Yujun; Liu, Xinjian; Hu, Y. Angela; Bedford, Joel. S.; Li, Chuan-Yuan
2011-01-01
DNA double strand breaks is a major form of DNA damage and a key mechanism through which radiotherapy and some chemotherapeutic agents kill cancer cells. Despite its importance, measuring DNA double strand breaks is still a tedious task that is normally carried out by gel electrophoresis or immunofluorescence staining. Here we report a novel approach to image and quantify DNA double strand breaks in live mammalian cells through bi-fragment luciferase reconstitution. N- and C- terminal fragments of firefly luciferase gene were fused with H2AX and MDC1 genes, respectively. Our strategy was based on the established fact that at the sites of DNA double strand breaks, H2AX protein is phosphoryated and physically associates with the MDC1 protein, thus bringing together N- and C- luciferase fragments and reconstituting luciferase activity. Our strategy allowed serial, non-invasive quantification of DNA double strand breaks in cells irradiated with x-rays and 56Fe ions. Furthermore, it allowed for the evaluation of DNA double strand breaks (DSBs) non-invasively in vivo in irradiated tumors over two weeks. Surprisingly, we detected a second wave of DSB induction in irradiated tumor cells days after radiation exposure in addition to the initial rapid induction of DSBs. We conclude that our new split-luciferase based method for imaging γ-H2AX-MDC1 interaction is a powerful new tool to study DNA double strand break repair kinetics in vivo with considerable advantage for experiments requiring observations over an extended period of time. PMID:21527553
Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin
2016-04-19
G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.
Cannan, Wendy J; Tsang, Betty P; Wallace, Susan S; Pederson, David S
2014-07-18
Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Cannan, Wendy J.; Tsang, Betty P.; Wallace, Susan S.; Pederson, David S.
2014-01-01
Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. PMID:24891506
Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z
2011-02-01
We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.
Tohala, Luma; Oukacine, Farid; Ravelet, Corinne; Peyrin, Eric
2017-05-01
We recently reported that a great variety of DNA oligonucleotides (ONs) used as chiral selectors in partial-filling capillary electrophoresis (CE) exhibited interesting enantioresolution properties toward low-affinity DNA binders. Herein, the sequence prerequisites of ONs for the CE enantioseparation process were studied. First, the chiral resolution properties of a series of homopolymeric sequences (Poly-dT) of different lengths (from 5 to 60-mer) were investigated. It was shown that the size increase-dependent random coil-like conformation of Poly-dT favorably acted on the apparent selectivity and resolution. The base-unpairing state constituted also an important factor in the chiral resolution ability of ONs as the switch from the single-stranded to double-stranded structure was responsible for a significant decrease in the analyte selectivity range. Finally, the chemical diversity enhanced the enantioresolution ability of single-stranded ONs. The present work could lay the foundation for the design of performant ON chiral selectors for the CE separation of weak DNA binder enantiomers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA damage induced by ascorbate in the presence of Cu2+.
Kobayashi, S; Ueda, K; Morita, J; Sakai, H; Komano, T
1988-01-25
DNA damage induced by ascorbate in the presence of Cu2+ was investigated by use of bacteriophage phi X174 double-stranded supercoiled DNA and linear restriction fragments as substrates. Single-strand cleavage was induced when supercoiled DNA was incubated with 5 microM-10 mM ascorbate and 50 microM Cu2+ at 37 degrees C for 10 min. The induced DNA damage was analyzed by sequencing of fragments singly labeled at their 5'- or 3'-end. DNA was cleaved directly and almost uniformly at every nucleotide by ascorbate and Cu2+. Piperidine treatment after the reaction showed that ascorbate and Cu2+ induced another kind of DNA damage different from the direct cleavage. The damage proceeded to DNA cleavage by piperidine treatment and was sequence-specific rather than random. These results indicate that ascorbate induces two classes of DNA damage in the presence of Cu2+, one being direct strand cleavage, probably via damage to the DNA backbone, and the other being a base modification labile to alkali treatment. These two classes of DNA damage were inhibited by potassium iodide, catalase and metal chelaters, suggesting the involvement of radicals generated from ascorbate hydroperoxide.
Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli
NASA Astrophysics Data System (ADS)
Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz
1981-02-01
Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.
DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.
Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani
2018-01-01
Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.
Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.
Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph
2018-01-23
Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.
Genome-Wide Profiling of DNA Double-Strand Breaks by the BLESS and BLISS Methods.
Mirzazadeh, Reza; Kallas, Tomasz; Bienko, Magda; Crosetto, Nicola
2018-01-01
DNA double-strand breaks (DSBs) are major DNA lesions that are constantly formed during physiological processes such as DNA replication, transcription, and recombination, or as a result of exogenous agents such as ionizing radiation, radiomimetic drugs, and genome editing nucleases. Unrepaired DSBs threaten genomic stability by leading to the formation of potentially oncogenic rearrangements such as translocations. In past few years, several methods based on next-generation sequencing (NGS) have been developed to study the genome-wide distribution of DSBs or their conversion to translocation events. We developed Breaks Labeling, Enrichment on Streptavidin, and Sequencing (BLESS), which was the first method for direct labeling of DSBs in situ followed by their genome-wide mapping at nucleotide resolution (Crosetto et al., Nat Methods 10:361-365, 2013). Recently, we have further expanded the quantitative nature, applicability, and scalability of BLESS by developing Breaks Labeling In Situ and Sequencing (BLISS) (Yan et al., Nat Commun 8:15058, 2017). Here, we first present an overview of existing methods for genome-wide localization of DSBs, and then focus on the BLESS and BLISS methods, discussing different assay design options depending on the sample type and application.
Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.
1998-01-01
Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480
RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.
Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing
2017-01-27
DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.
Bandyopadhyay, D; Bhattacharyya, D
2006-10-15
It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.
Lau, Kai Lin; Sleiman, Hanadi F
2016-07-26
Given its highly predictable self-assembly properties, DNA has proven to be an excellent template toward the design of functional materials. Prominent examples include the remarkable complexity provided by DNA origami and single-stranded tile (SST) assemblies, which require hundreds of unique component strands. However, in many cases, the majority of the DNA assembly is purely structural, and only a small "working area" needs to be aperiodic. On the other hand, extended lattices formed by DNA tile motifs require only a few strands; but they suffer from lack of size control and limited periodic patterning. To overcome these limitations, we adopt a templation strategy, where an input strand of DNA dictates the size and patterning of resultant DNA tile structures. To prepare these templating input strands, a sequential growth technique developed in our lab is used, whereby extended DNA strands of defined sequence and length may be generated simply by controlling their order of addition. With these, we demonstrate the periodic patterning of size-controlled double-crossover (DX) and triple-crossover (TX) tile structures, as well as intentionally designed aperiodicity of a DX tile structure. As such, we are able to prepare size-controlled DNA structures featuring aperiodicity only where necessary with exceptional economy and efficiency.
Double stranded nucleic acid biochips
Chernov, Boris; Golova, Julia
2006-05-23
This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.
Complete Genome Sequences of Bacillus Phages Janet and OTooleKemple52.
Kent, Brenna; Raymond, Thomas; Mosier, Philip D; Johnson, Allison A
2018-05-10
We report here the genome sequences of two novel Bacillus cereus group-infecting bacteriophages, Janet and OTooleKemple52. These bacteriophages are double-stranded DNA-containing Myoviridae isolated from soil samples. While their genomes share a high degree of sequence identity with one another, their host preferences are unique. Copyright © 2018 Kent et al.
The Human L1 Element Causes DNA Double-Strand Breaks in Breast Cancer
2006-08-01
cancer is complex. However, defects in DNA repair genes in the double-strand break repair pathway are cancer predisposing. My lab has characterized...a new potentially important source of double-strand breaks (DSBs) in human cells and are interested in characterizing which DNA repair genes act on...this particular source of DNA damage. Selfish DNA accounts for 45% of the human genome. We have recently demonstrated that one particular selfish
Can a double stranded DNA be unzipped by pulling a single strand?: phases of adsorbed DNA.
Kapri, Rajeev
2009-04-14
We study the unzipping of a double stranded DNA (dsDNA) by applying an external force on a single strand while leaving the other strand free. We find that the dsDNA can be unzipped to two single strands if the external force exceeds a critical value. We obtain the phase diagram, which is found to be different from the phase diagram of unzipping by pulling both the strands in opposite directions. In the presence of an attractive surface near DNA, the phase diagram gets modified drastically and shows richer surprises including a critical end point and a triple point.
Programmable RNA recognition and cleavage by CRISPR/Cas9.
O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A
2014-12-11
The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.
Saunders, K; Lucy, A; Stanley, J
1991-01-01
We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773
Saveliev, S V; Cox, M M
1996-01-01
We provide a molecular description of key intermediates in the deletion of two internal eliminated sequences (IES elements), the M and R regions, during macronuclear development in Tetrahymena thermophila. Using a variety of PCR-based methods in vivo, double-strand breaks are detected that are generated by hydrolytic cleavage and correspond closely to the observed chromosomal junctions left behind in the macronuclei. The breaks exhibit a temporal and structural relationship to the deletion reaction that provides strong evidence that they are intermediates in the deletion pathway. Breaks in the individual strands are staggered by 4 bp, producing a four nucleotide 5' extension. Evidence is presented that breaks do not occur simultaneously at both ends. The results are most consistent with a deletion mechanism featuring initiation by double-strand cleavage at one end of the deleted element, followed by transesterification to generate the macronuclear junction on one DNA strand. An adenosine residue is found at all the nucleophilic 3' ends used in the postulated transesterification step. Evidence for the transesterification step is provided by detection of a 3' hydroxyl that would be liberated by such a step at a deletion boundary where no other DNA strand ends are detected. Images PMID:8654384
NASA Astrophysics Data System (ADS)
Loo, Adeline Huiling; Bonanni, Alessandra; Ambrosi, Adriano; Pumera, Martin
2014-09-01
The detection of specific DNA sequences plays a critical role in the areas of medical diagnostics, environmental monitoring, drug discovery and food safety. This has therefore become a strong driving force behind the ever-increasing demand for simple, cost-effective, highly sensitive and selective DNA biosensors. In this study, we report for the first time, a novel approach for the utilization of molybdenum disulfide nanoflakes, a member of the transition metal dichalcogenides family, in the detection of DNA hybridization. Herein, molybdenum disulfide nanoflakes serve as inherently electroactive labels, with the inherent oxidation peak exploited as the analytical signal. The principle of detection is based on the differential affinity of molybdenum disulfide nanoflakes towards single-stranded DNA and double-stranded DNA. The employment of transition metal dichalcogenide nanomaterials for sensing and biosensing purposes represents an upcoming research area which holds great promise. Hence, our findings are anticipated to have significant contributions towards the fabrication of future DNA biosensors.The detection of specific DNA sequences plays a critical role in the areas of medical diagnostics, environmental monitoring, drug discovery and food safety. This has therefore become a strong driving force behind the ever-increasing demand for simple, cost-effective, highly sensitive and selective DNA biosensors. In this study, we report for the first time, a novel approach for the utilization of molybdenum disulfide nanoflakes, a member of the transition metal dichalcogenides family, in the detection of DNA hybridization. Herein, molybdenum disulfide nanoflakes serve as inherently electroactive labels, with the inherent oxidation peak exploited as the analytical signal. The principle of detection is based on the differential affinity of molybdenum disulfide nanoflakes towards single-stranded DNA and double-stranded DNA. The employment of transition metal dichalcogenide nanomaterials for sensing and biosensing purposes represents an upcoming research area which holds great promise. Hence, our findings are anticipated to have significant contributions towards the fabrication of future DNA biosensors. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr03795b
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Transposition of an intron in yeast mitochondria requires a protein encoded by that intron.
Macreadie, I G; Scott, R M; Zinn, A R; Butow, R A
1985-06-01
The optional 1143 bp intron in the yeast mitochondrial 21S rRNA gene (omega +) is nearly quantitatively inserted in genetic crosses into 21S rRNA alleles that lack it (omega -). The intron contains an open reading frame that can encode a protein of 235 amino acids, but no function has been ascribed to this sequence. We previously found an in vivo double-strand break in omega - DNA at or close to the intron insertion site only in zygotes of omega + X omega - crosses that appears with the same kinetics as intron insertion. We now show that mutations in the intron open reading frame that would alter the translation product simultaneously inhibit nonreciprocal omega recombination and the in vivo double-strand break in omega - DNA. These results provide evidence that the open reading frame encodes a protein required for intron transposition and support the role of the double-strand break in the process.
Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean
2002-07-01
The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.
Left-handed Z-DNA: structure and function
NASA Technical Reports Server (NTRS)
Herbert, A.; Rich, A.
1999-01-01
Z-DNA is a high energy conformer of B-DNA that forms in vivo during transcription as a result of torsional strain generated by a moving polymerase. An understanding of the biological role of Z-DNA has advanced with the discovery that the RNA editing enzyme double-stranded RNA adenosine deaminase type I (ADAR1) has motifs specific for the Z-DNA conformation. Editing by ADAR1 requires a double-stranded RNA substrate. In the cases known, the substrate is formed by folding an intron back onto the exon that is targeted for modification. The use of introns to direct processing of exons requires that editing occurs before splicing. Recognition of Z-DNA by ADAR1 may allow editing of nascent transcripts to be initiated immediately after transcription, ensuring that editing and splicing are performed in the correct sequence. Structural characterization of the Z-DNA binding domain indicates that it belongs to the winged helix-turn-helix class of proteins and is similar to the globular domain of histone-H5.
Ling, Feng; Hori, Akiko; Shibata, Takehiko
2007-02-01
Hypersuppressiveness, as observed in Saccharomyces cerevisiae, is an extremely biased inheritance of a small mitochondrial DNA (mtDNA) fragment that contains a replication origin (HS [rho(-)] mtDNA). Our previous studies showed that concatemers (linear head-to-tail multimers) are obligatory intermediates for mtDNA partitioning and are primarily formed by rolling-circle replication mediated by Mhr1, a protein required for homologous mtDNA recombination. In this study, we found that Mhr1 is required for the hypersuppressiveness of HS [ori5] [rho(-)] mtDNA harboring ori5, one of the replication origins of normal ([rho(+)]) mtDNA. In addition, we detected an Ntg1-stimulated double-strand break at the ori5 locus. Purified Ntg1, a base excision repair enzyme, introduced a double-stranded break by itself into HS [ori5] [rho(-)] mtDNA at ori5 isolated from yeast cells. Both hypersuppressiveness and concatemer formation of HS [ori5] [rho(-)] mtDNA are simultaneously suppressed by the ntg1 null mutation. These results support a model in which, like homologous recombination, rolling-circle HS [ori5] [rho(-)] mtDNA replication is initiated by double-stranded breakage in ori5, followed by Mhr1-mediated homologous pairing of the processed nascent DNA ends with circular mtDNA. The hypersuppressiveness of HS [ori5] [rho(-)] mtDNA depends on a replication advantage furnished by the higher density of ori5 sequences and on a segregation advantage furnished by the higher genome copy number on transmitted concatemers.
Flow cytomeric measurement of DNA and incorporated nucleoside analogs
Dolbeare, Frank A.; Gray, Joe W.
1989-01-01
A method is provided for simultaneously measuring total cellular DNA and incorporated nucleoside analog. The method entails altering the cellular DNA of cells grown in the presence of a nucleoside analog so that single stranded and double stranded portions are present. Separate stains are used against the two portions. An immunochemical stain is used against the single stranded portion to provide a measure of incorporated nucleoside analog, and a double strand DNA-specific stain is used against the double stranded portion to simultaneously provide a measure of total cellular DNA. The method permits rapid flow cytometric analysis of cell populations, rapid identification of cycling and noncycling subpopulations, and determination of the efficacy of S phase cytotoxic anticancer agents.
Development of novel decoy oligonucleotides: advantages of circular dumb-bell decoy.
Tomita, Naruya; Tomita, Tetsuya; Yuyama, Kazuhiko; Tougan, Takahiro; Tajima, Tsuyoshi; Ogihara, Toshio; Morishita, Ryuichi
2003-04-01
The inhibition of specific transcription regulatory proteins is a novel approach to regulate gene expression. The transcriptional activities of DNA binding proteins can be inhibited by the use of double-stranded oligonucleotides (ODNs) that compete for binding to their specific target sequences in promoters and enhancers. Transfection of this cis-element double-stranded ODN, referred to as decoy ODN, has been reported to be a powerful tool that provides a new class of anti-gene strategies to gene therapy and permits examination of specific gene regulation. We have demonstrated the usefulness of this decoy ODN strategy in animal models of restenosis, myocardial infarction, glomerulonephritis and rheumatoid arthritis. However, one of the major limitations of decoy ODN technology is the rapid degradation of phosphodiester ODNs by intracellular nucleases. To date, several different types of double-stranded decoy ODNs have been developed to overcome this issue. Circular dumb-bell (CD) double-stranded decoy ODNs that were developed to resolve this issue have attracted a high level of interest. In this review, the applications of decoy ODN strategy and the advantages of modified CD double-stranded decoy ODNs will be discussed.
Inclán, Mario; Guijarro, Lluis; Pont, Isabel; Frías, Juan C; Rotger, Carmen; Orvay, Francisca; Costa, Antoni; García-España, Enrique; Albelda, M Teresa
2017-11-13
The interaction of a polyazacyclophane ligand having an ethylamine pendant arm functionalized with an anthryl group (L), with the single-stranded polynucleotides polyA, polyG, polyU, and polyC as well as with the double-stranded polynucleotides polyA-polyU, poly(dAT) 2 , and poly(dGC) 2 has been followed by UV/Vis titration, steady state fluorescence spectroscopy, and thermal denaturation measurements. In the case of the single-stranded polynucleotides, the UV/Vis and fluorescence titrations permit to distinguish between sequences containing purine and pyrimidine bases. For the double-stranded polynucleotides the UV/Vis measurements show for all of them hypochromicity and bathochromic shifts. However, the fluorescence studies reveal that both polyA-polyU and poly(dAT) 2 induce a twofold increase in the fluorescence, whereas interaction of poly(dGC) 2 with the ligand L induces a quenching of the fluorescence. Cu 2+ modulates the interaction with the double-stranded polynucleotides due to the conformation changes that its coordination induces in compound L. In general, the spectroscopic studies show that intercalation seems to be blocked by the formation of the metal complex. All these features suggest the possibility of using compound L as a sequence-selective fluorescence probe. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Paull, T T; Cortez, D; Bowers, B; Elledge, S J; Gellert, M
2001-05-22
The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein-DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription.
A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein
Sepulveda, Edgardo; Vogelmann, Jutta
2011-01-01
Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692
A simple method for the computation of first neighbour frequencies of DNAs from CD spectra
Marck, Christian; Guschlbauer, Wilhelm
1978-01-01
A procedure for the computation of the first neighbour frequencies of DNA's is presented. This procedure is based on the first neighbour approximation of Gray and Tinoco. We show that the knowledge of all the ten elementary CD signals attached to the ten double stranded first neighbour configurations is not necessary. One can obtain the ten frequencies of an unknown DNA with the use of eight elementary CD signals corresponding to eight linearly independent polymer sequences. These signals can be extracted very simply from any eight or more CD spectra of double stranded DNA's of known frequencies. The ten frequencies of a DNA are obtained by least square fit of its CD spectrum with these elementary signals. One advantage of this procedure is that it does not necessitate linear programming, it can be used with CD data digitalized using a large number of wavelengths, thus permitting an accurate resolution of the CD spectra. Under favorable case, the ten frequencies of a DNA (not used as input data) can be determined with an average absolute error < 2%. We have also observed that certain satellite DNA's, those of Drosophila virilis and Callinectes sapidus have CD spectra compatible with those of DNA's of quasi random sequence; these satellite DNA's should adopt also the B-form in solution. PMID:673843
Wang, Wei; Liu, Juan; Sun, Lin
2016-07-01
Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin
2015-10-01
Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.
Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M
1985-01-01
A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478
Mechanisms of double-strand-break repair during gene targeting in mammalian cells.
Ng, P; Baker, M D
1999-01-01
In the present study, the mechanism of double-strand-break (DSB) repair during gene targeting at the chromosomal immunoglobulin mu-locus in a murine hybridoma was examined. The gene-targeting assay utilized specially designed insertion vectors genetically marked in the region of homology to the chromosomal mu-locus by six diagnostic restriction enzyme site markers. The restriction enzyme markers permitted the contribution of vector-borne and chromosomal mu-sequences in the recombinant product to be determined. The use of the insertion vectors in conjunction with a plating procedure in which individual integrative homologous recombination events were retained for analysis revealed several important features about the mammalian DSB repair process:The presence of the markers within the region of shared homology did not affect the efficiency of gene targeting.In the majority of recombinants, the vector-borne marker proximal to the DSB was absent, being replaced with the corresponding chromosomal restriction enzyme site. This result is consistent with either formation and repair of a vector-borne gap or an "end" bias in mismatch repair of heteroduplex DNA (hDNA) that favored the chromosomal sequence. Formation of hDNA was frequently associated with gene targeting and, in most cases, began approximately 645 bp from the DSB and could encompass a distance of at least 1469 bp.The hDNA was efficiently repaired prior to DNA replication.The repair of adjacent mismatches in hDNA occurred predominantly on the same strand, suggesting the involvement of a long-patch repair mechanism. PMID:10049929
Complete Genome Sequence of the Streptomyces Phage Nanodon.
Erill, Ivan; Caruso, Steven M
2016-10-06
Streptomyces phage Nanodon is a temperate double-stranded DNA Siphoviridae belonging to cluster BD1. It was isolated from soil collected in Kilauea, HI, using Streptomyces griseus subsp. griseus as a host. Copyright © 2016 Erill et al.
Detecting the Length of Double-stranded DNA with Solid State Nanopores
NASA Astrophysics Data System (ADS)
Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene
2003-03-01
We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).
XPD-dependent activation of apoptosis in response to triplex-induced DNA damage
Kaushik Tiwari, Meetu; Rogers, Faye A.
2013-01-01
DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. Using triplex-forming oligonucleotides to synthetically create altered helical distortions, we have determined that pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Here, we show that triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of γH2AX foci. XPD was subsequently recruited to the triplex-induced double strand breaks and co-localized with γH2AX at the damage site. Furthermore, phosphorylation of H2AX tyrosine 142 was found to stimulate the signaling pathway of XPD-dependent apoptosis. We suggest that this mechanism may play an active role in minimizing genomic instability induced by naturally occurring noncanonical structures, perhaps protecting against cancer initiation. PMID:23913414
Automated sample-preparation technologies in genome sequencing projects.
Hilbert, H; Lauber, J; Lubenow, H; Düsterhöft, A
2000-01-01
A robotic workstation system (BioRobot 96OO, QIAGEN) and a 96-well UV spectrophotometer (Spectramax 250, Molecular Devices) were integrated in to the process of high-throughput automated sequencing of double-stranded plasmid DNA templates. An automated 96-well miniprep kit protocol (QIAprep Turbo, QIAGEN) provided high-quality plasmid DNA from shotgun clones. The DNA prepared by this procedure was used to generate more than two mega bases of final sequence data for two genomic projects (Arabidopsis thaliana and Schizosaccharomyces pombe), three thousand expressed sequence tags (ESTs) plus half a mega base of human full-length cDNA clones, and approximately 53,000 single reads for a whole genome shotgun project (Pseudomonas putida).
Solid phase sequencing of biopolymers
Cantor, Charles; Koster, Hubert
2010-09-28
This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.
Method for promoting specific alignment of short oligonucleotides on nucleic acids
Studier, F. William; Kieleczawa, Jan; Dunn, John J.
1996-01-01
Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.
Molecular architecture of classical cytological landmarks: Centromeres and telomeres
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meyne, J.
1994-11-01
Both the human telomere repeat and the pericentromeric repeat sequence (GGAAT)n were isolated based on evolutionary conservation. Their isolation was based on the premise that chromosomal features as structurally and functionally important as telomeres and centromeres should be highly conserved. Both sequences were isolated by high stringency screening of a human repetitive DNA library with rodent repetitive DNA. The pHuR library (plasmid Human Repeat) used for this project was enriched for repetitive DNA by using a modification of the standard DNA library preparation method. Usually DNA for a library is cut with restriction enzymes, packaged, infected, and the library ismore » screened. A problem with this approach is that many tandem repeats don`t have any (or many) common restriction sites. Therefore, many of the repeat sequences will not be represented in the library because they are not restricted to a viable length for the vector used. To prepare the pHuR library, human DNA was mechanically sheared to a small size. These relatively short DNA fragments were denatured and then renatured to C{sub o}t 50. Theoretically only repetitive DNA sequences should renature under C{sub o}t 50 conditions. The single-stranded regions were digested using S1 nuclease, leaving the double-stranded, renatured repeat sequences.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, O.P.
Potato leafroll virus (PLRV) was aphid-transmitted from potato (Solanum tuberosum cultivar Russett Burbank) to ground cherry (Physalis floridana), where it was maintained by serial aphid transmission. Serological and plant differential tests indicated that the isolate was not contaminated with beet western yellows virus. Purified PLRV RNA was poly(A)-tailed in vitro and used as a template for reverse transcriptase, primed with oligo(dT). Alkaline gel electrophoresis of /sup 32/P-labeled first-strand complementary DNA (cDNA) indicated a major size range of 0.1 to 3.5 kilobases (kb). A small percentage of transcripts corresponded to full length PLRV RNA. Following RNase H and DNA polymerase I-mediatedmore » second strand synthesis, double-stranded cDNA was cloned into the Pst I site of the plasmid pUC9 using oligo (dC)-oligo(dG) tailing methodology. Escherichia coli JM109 transformants were screened with first-strand /sup 32/P-cDNA in colony hybridization experiments to confirm that recombinants contained PLRV-specific sequences.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.
Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less
Caffeine inhibits gene conversion by displacing Rad51 from ssDNA
Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.
2015-01-01
Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181
Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J
2013-03-01
The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing radiation.
BplI, a new BcgI-like restriction endonuclease, which recognizes a symmetric sequence.
Vitkute, J; Maneliene, Z; Petrusyte, M; Janulaitis, A
1997-01-01
Bcg I and Bcg I-like restriction endonucleases cleave double stranded DNA specifically on both sides of their asymmetric recognition sequences which are interrupted by several ambiguous base pairs. Their heterosubunit structure, bifunctionality and stimulation by AdoMet make them different from other classified restriction enzymes. Here we report on a new Bcg I-like restriction endonuclease, Bpl I from Bacillus pumilus , which in contrast to all other Bcg I-like enzymes, recognizes a symmetric interrupted sequence, and which, like Bcg I, cleaves double stranded DNA upstream and downstream of its recognition sequence (8/13)GAGN5CTC(13/8). Like Bcg I, Bpl I is a bifunctional enzyme revealing both DNA cleavage and methyltransferase activities. There are two polypeptides in the homogeneous preparation of Bpl I with molecular masses of approximately 74 and 37 kDa. The sizes of the Bpl I subunits are close to those of Bcg I, but the proportion 1:1 in the final preparation is different from that of 2:1 in Bcg I. Low activity observed with Mg2+increases >100-fold in the presence of AdoMet. Even with AdoMet though, specific cleavage is incomplete. S -adenosylhomocysteine (AdoHcy) or sinefungin can replace AdoMet in the cleavage reaction. AdoHcy activated Bpl I yields complete cleavage of DNA. PMID:9358150
Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko
2015-01-01
In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575
Geng, Jia; Wang, Shaoying; Fang, Huaming; Guo, Peixuan
2013-01-01
Nanopores have been utilized to detect the conformation and dynamics of polymers, including DNA and RNA. Biological pores are extremely reproducible at the atomic level with uniform channel sizes. The channel of the bacterial virus phi29 DNA packaging motor is a natural conduit for the transportation of double-stranded DNA (dsDNA), and has the largest diameter among the well-studied biological channels. The larger channel facilitates translocation of dsDNA, and offers more space for further channel modification and conjugation. Interestingly, the relatively large wild type channel, which translocates dsDNA, cannot detect single-stranded nucleic acids (ssDNA or ssRNA) under the current experimental conditions. Herein, we reengineered this motor channel by removing the internal loop segment of the channel. The modification resulted in two classes of channels. One class was the same size as the wild type channel, while the other class had a cross-sectional area about 60% of the wild type. This smaller channel was able to detect the real-time translocation of single stranded nucleic acids at single-molecule level. While the wild type connector exhibited a one-way traffic property with respect to dsDNA translocation, the loop deleted connector was able to translocate ssDNA and ssRNA with equal competencies from both termini. This finding of size alterations in reengineered motor channels expands the potential application of the phi29 DNA packaging motor in nanomedicine, nanobiotechnology, and high-throughput single pore DNA sequencing. PMID:23488809
Datta, Simanti; Costantino, Nina; Zhou, Xiaomei; Court, Donald L.
2008-01-01
We report the identification and functional analysis of nine genes from Gram-positive and Gram-negative bacteria and their phages that are similar to lambda (λ) bet or Escherichia coli recT. Beta and RecT are single-strand DNA annealing proteins, referred to here as recombinases. Each of the nine other genes when expressed in E. coli carries out oligonucleotide-mediated recombination. To our knowledge, this is the first study showing single-strand recombinase activity from diverse bacteria. Similar to bet and recT, most of these other recombinases were found to be associated with putative exonuclease genes. Beta and RecT in conjunction with their cognate exonucleases carry out recombination of linear double-strand DNA. Among four of these foreign recombinase/exonuclease pairs tested for recombination with double-strand DNA, three had activity, albeit barely detectable. Thus, although these recombinases can function in E. coli to catalyze oligonucleotide recombination, the double-strand DNA recombination activities with their exonuclease partners were inefficient. This study also demonstrated that Gam, by inhibiting host RecBCD nuclease activity, helps to improve the efficiency of λ Red-mediated recombination with linear double-strand DNA, but Gam is not absolutely essential. Thus, in other bacterial species where Gam analogs have not been identified, double-strand DNA recombination may still work in the absence of a Gam-like function. We anticipate that at least some of the recombineering systems studied here will potentiate oligonucleotide and double-strand DNA-mediated recombineering in their native or related bacteria. PMID:18230724
Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce
2015-06-17
We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.
Complete Genome Sequence of Pseudomonas aeruginosa Phage AAT-1
Andrade-Domínguez, Andrés
2016-01-01
Aspects of the interaction between phages and animals are of interest and importance for medical applications. Here, we report the genome sequence of the lytic Pseudomonas phage AAT-1, isolated from mammalian serum. AAT-1 is a double-stranded DNA phage, with a genome of 57,599 bp, containing 76 predicted open reading frames. PMID:27563032
[DNA structure from A to Z--biological implications of structural diversity of DNA].
Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A
2006-01-01
Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.
Homing endonucleases: from basics to therapeutic applications.
Marcaida, Maria J; Muñoz, Inés G; Blanco, Francisco J; Prieto, Jesús; Montoya, Guillermo
2010-03-01
Homing endonucleases (HE) are double-stranded DNAses that target large recognition sites (12-40 bp). HE-encoding sequences are usually embedded in either introns or inteins. Their recognition sites are extremely rare, with none or only a few of these sites present in a mammalian-sized genome. However, these enzymes, unlike standard restriction endonucleases, tolerate some sequence degeneracy within their recognition sequence. Several members of this enzyme family have been used as templates to engineer tools to cleave DNA sequences that differ from their original wild-type targets. These custom HEs can be used to stimulate double-strand break homologous recombination in cells, to induce the repair of defective genes with very low toxicity levels. The use of tailored HEs opens up new possibilities for gene therapy in patients with monogenic diseases that can be treated ex vivo. This review provides an overview of recent advances in this field.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gottlieb, J.; Muzyczka, N.
1988-06-01
When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less
Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi
2014-05-28
The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.
Effect of sequence-dependent rigidity on plectoneme localization in dsDNA
NASA Astrophysics Data System (ADS)
Medalion, Shlomi; Rabin, Yitzhak
2016-04-01
We use Monte-Carlo simulations to study the effect of variable rigidity on plectoneme formation and localization in supercoiled double-stranded DNA. We show that the presence of soft sequences increases the number of plectoneme branches and that the edges of the branches tend to be localized at these sequences. We propose an experimental approach to test our results in vitro, and discuss the possible role played by plectoneme localization in the search process of transcription factors for their targets (promoter regions) on the bacterial genome.
Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W
2017-08-10
DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gruenig, Marielle C.; Lu, Duo; Won, Sang Joon
2012-03-16
The bacteriophage P1-encoded Ref protein enhances RecA-dependent recombination in vivo by an unknown mechanism. We demonstrate that Ref is a new type of enzyme; that is, a RecA-dependent nuclease. Ref binds to ss- and dsDNA but does not cleave any DNA substrate until RecA protein and ATP are added to form RecA nucleoprotein filaments. Ref cleaves only where RecA protein is bound. RecA functions as a co-nuclease in the Ref/RecA system. Ref nuclease activity can be limited to the targeted strands of short RecA-containing D-loops. The result is a uniquely programmable endonuclease activity, producing targeted double-strand breaks at any chosenmore » DNA sequence in an oligonucleotide-directed fashion. We present evidence indicating that cleavage occurs in the RecA filament groove. The structure of the Ref protein has been determined to 1.4 {angstrom} resolution. The core structure, consisting of residues 77-186, consists of a central 2-stranded {beta}-hairpin that is sandwiched between several {alpha}-helical and extended loop elements. The N-terminal 76 amino acid residues are disordered; this flexible region is required for optimal activity. The overall structure of Ref, including several putative active site histidine residues, defines a new subclass of HNH-family nucleases. We propose that enhancement of recombination by Ref reflects the introduction of directed, recombinogenic double-strand breaks.« less
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
Direct observation of single flexible polymers using single stranded DNA†
Brockman, Christopher; Kim, Sun Ju
2012-01-01
Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9
NASA Astrophysics Data System (ADS)
Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.
2014-03-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feyereisen-Koener, J.M.
Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.
Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood
2016-01-01
c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif. Copyright © 2015 Elsevier B.V. All rights reserved.
Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes
Chand, Mahesh Kumar; Nirwan, Neha; Diffin, Fiona M.; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D.; Saikrishnan, Kayarat
2015-01-01
Endonucleolytic double-strand DNA break production requires separate strand cleavage events. Although catalytic mechanisms for simple dimeric endonucleases are available, there are many complex nuclease machines which are poorly understood in comparison. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide following convergent ATP-driven translocation. We report the 2.7 Angstroms resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are unexpectedly located upstream of the direction of translocation, inconsistent with simple nuclease domain-dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex where the nuclease domains are distal. Sequencing of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand nicking events combine to produce DNA scission. PMID:26389736
Chromosome demise in the wake of ligase-deficient replication.
Kouzminova, Elena A; Kuzminov, Andrei
2012-06-01
Bacterial DNA ligases, NAD⁺-dependent enzymes, are distinct from eukaryotic ATP-dependent ligases, representing promising targets for broad-spectrum antimicrobials. Yet, the chromosomal consequences of ligase-deficient DNA replication, during which Okazaki fragments accumulate, are still unclear. Using ligA251(Ts), the strongest ligase mutant of Escherichia coli, we studied ligase-deficient DNA replication by genetic and physical approaches. Here we show that replication without ligase kills after a short resistance period. We found that double-strand break repair via RecA, RecBCD, RuvABC and RecG explains the transient resistance, whereas irreparable chromosomal fragmentation explains subsequent cell death. Remarkably, death is mostly prevented by elimination of linear DNA degradation activity of ExoV, suggesting that non-allelic double-strand breaks behind replication forks precipitate DNA degradation that enlarge them into allelic double-strand gaps. Marker frequency profiling of synchronized replication reveals stalling of ligase-deficient forks with subsequent degradation of the DNA synthesized without ligase. The mechanism that converts unsealed nicks behind replication forks first into repairable double-strand breaks and then into irreparable double-strand gaps may be behind lethality of any DNA damaging treatment. © 2012 Blackwell Publishing Ltd.
ORF157 from the Archaeal Virus Acidianus Filamentous Virus 1 Defines a New Class of Nuclease▿
Goulet, Adeline; Pina, Mery; Redder, Peter; Prangishvili, David; Vera, Laura; Lichière, Julie; Leulliot, Nicolas; van Tilbeurgh, Herman; Ortiz-Lombardia, Miguel; Campanacci, Valérie; Cambillau, Christian
2010-01-01
Acidianus filamentous virus 1 (AFV1) (Lipothrixviridae) is an enveloped filamentous virus that was characterized from a crenarchaeal host. It infects Acidianus species that thrive in the acidic hot springs (>85°C and pH <3) of Yellowstone National Park, WY. The AFV1 20.8-kb, linear, double-stranded DNA genome encodes 40 putative open reading frames whose sequences generally show little similarity to other genes in the sequence databases. Because three-dimensional structures are more conserved than sequences and hence are more effective at revealing function, we set out to determine protein structures from putative AFV1 open reading frames (ORF). The crystal structure of ORF157 reveals an α+β protein with a novel fold that remotely resembles the nucleotidyltransferase topology. In vitro, AFV1-157 displays a nuclease activity on linear double-stranded DNA. Alanine substitution mutations demonstrated that E86 is essential to catalysis. AFV1-157 represents a novel class of nuclease, but its exact role in vivo remains to be determined. PMID:20200253
Characterization of a periplasmic S1-like nuclease coded by the Mesorhizobium loti symbiosis island
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pimkin, Maxim; Miller, C. Glenn; Blakesley, Lauryn
DNA sequences encoding hypothetical proteins homologous to S1 nuclease from Aspergillus oryzae are found in many organisms including fungi, plants, pathogenic bacteria, and eukaryotic parasites. One of these is the M1 nuclease of Mesorhizobium loti which we demonstrate herein to be an enzymatically active, soluble, and stable S1 homolog that lacks the extensive mannosyl-glycosylation found in eukaryotic S1 nuclease homologs. We have expressed the cloned M1 protein in M. loti and purified recombinant native M1 to near homogeneity and have also isolated a homogeneous M1 carboxy-terminal hexahistidine tag fusion protein. Mass spectrometry and N-terminal Edman degradation sequencing confirmed the proteinmore » identity. The enzymatic properties of the purified M1 nuclease are similar to those of S1. At acidic pH M1 is 25 times more active on single-stranded DNA than on double-stranded DNA and 3 times more active on single-stranded DNA than on single-stranded RNA. At neutral pH the RNase activity of M1 exceeds the DNase activity. M1 nicks supercoiled RF-I plasmid DNA and rapidly cuts the phosphodiester bond across from the nick in the resultant relaxed RF-II plasmid DNA. Therefore, M1 represents an active bacterial S1 homolog in spite of great sequence divergence. The biochemical characterization of M1 nuclease supports our sequence alignment that reveals the minimal 21 amino acid residues that are necessarily conserved for the structure and functions of this enzyme family. The ability of M1 to degrade RNA at neutral pH implies previously unappreciated roles of these nucleases in biological systems.« less
Triple helix purification and sequencing
Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.
1995-01-01
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.
Triple helix purification and sequencing
Wang, R.; Smith, L.M.; Tong, X.E.
1995-03-28
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.
Tabor, Stanley; Richardson, Charles C.
1995-04-25
A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.
Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.
Mukherjee, Anirban; Vasquez, Karen M
2011-08-01
Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Tunable graphene quantum point contact transistor for DNA detection and characterization
Girdhar, Anuj; Sathe, Chaitanya; Schulten, Klaus; Leburton, Jean-Pierre
2015-01-01
A graphene membrane conductor containing a nanopore in a quantum point contact (QPC) geometry is a promising candidate to sense, and potentially sequence, DNA molecules translocating through the nanopore. Within this geometry, the shape, size, and position of the nanopore as well as the edge configuration influences the membrane conductance caused by the electrostatic interaction between the DNA nucleotides and the nanopore edge. It is shown that the graphene conductance variations resulting from DNA translocation can be enhanced by choosing a particular geometry as well as by modulating the graphene Fermi energy, which demonstrates the ability to detect conformational transformations of a double-stranded DNA, as well as the passage of individual base pairs of a single-stranded DNA molecule through the nanopore. PMID:25765702
Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.
Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R
2004-06-01
The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.
Savic, Velibor
2013-01-01
In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions.
Feuillie, Cécile; Merheb, Maxime M.; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine
2014-01-01
The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction – based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage. PMID:25502338
Feuillie, Cécile; Merheb, Maxime M; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine
2014-01-01
The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction - based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage.
Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J
2013-04-01
The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry
NASA Astrophysics Data System (ADS)
Fu, Rongxin; Li, Qi; Zhang, Junqi; Wang, Ruliang; Lin, Xue; Xue, Ning; Su, Ya; Jiang, Kai; Huang, Guoliang
2016-10-01
Label free point mutation detection is particularly momentous in the area of biomedical research and clinical diagnosis since gene mutations naturally occur and bring about highly fatal diseases. In this paper, a label free and high sensitive approach is proposed for point mutation detection based on hyperspectral interferometry. A hybridization strategy is designed to discriminate a single-base substitution with sequence-specific DNA ligase. Double-strand structures will take place only if added oligonucleotides are perfectly paired to the probe sequence. The proposed approach takes full use of the inherent conformation of double-strand DNA molecules on the substrate and a spectrum analysis method is established to point out the sub-nanoscale thickness variation, which benefits to high sensitive mutation detection. The limit of detection reach 4pg/mm2 according to the experimental result. A lung cancer gene point mutation was demonstrated, proving the high selectivity and multiplex analysis capability of the proposed biosensor.
Complete Genome Sequence of EtG, the First Phage Sequenced from Erwinia tracheiphila.
Andrade-Domínguez, Andrés; Kolter, Roberto; Shapiro, Lori R
2018-02-22
Erwinia tracheiphila is the causal agent of bacterial wilt of cucurbits. Here, we report the genome sequence of the temperate phage EtG, which was isolated from an E. tracheiphila -infected cucumber plant. Phage EtG has a linear 30,413-bp double-stranded DNA genome with cohesive ends and 45 predicted open reading frames. Copyright © 2018 Andrade-Domínguez et al.
Diversity and distribution of single-stranded DNA phages in the North Atlantic Ocean
Tucker, Kimberly P; Parsons, Rachel; Symonds, Erin M; Breitbart, Mya
2011-01-01
Knowledge of marine phages is highly biased toward double-stranded DNA (dsDNA) phages; however, recent metagenomic surveys have also identified single-stranded DNA (ssDNA) phages in the oceans. Here, we describe two complete ssDNA phage genomes that were reconstructed from a viral metagenome from 80 m depth at the Bermuda Atlantic Time-series Study (BATS) site in the northwestern Sargasso Sea and examine their spatial and temporal distributions. Both genomes (SARssφ1 and SARssφ2) exhibited similarity to known phages of the Microviridae family in terms of size, GC content, genome organization and protein sequence. PCR amplification of the replication initiation protein (Rep) gene revealed narrow and distinct depth distributions for the newly described ssDNA phages within the upper 200 m of the water column at the BATS site. Comparison of Rep gene sequences obtained from the BATS site over time revealed changes in the diversity of ssDNA phages over monthly time scales, although some nearly identical sequences were recovered from samples collected 4 years apart. Examination of ssDNA phage diversity along transects through the North Atlantic Ocean revealed a positive correlation between genetic distance and geographic distance between sampling sites. Together, the data suggest fundamental differences between the distribution of these ssDNA phages and the distribution of known marine dsDNA phages, possibly because of differences in host range, host distribution, virion stability, or viral evolution mechanisms and rates. Future work needs to elucidate the host ranges for oceanic ssDNA phages and determine their ecological roles in the marine ecosystem. PMID:21124487
An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.
Lee, C K; Knipe, D M
1985-06-01
An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.
Jette, Nicholas; Lees-Miller, Susan P.
2015-01-01
The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082
Complete Genome Sequences of 44 Arthrobacter Phages.
Klyczek, Karen K; Jacobs-Sera, Deborah; Adair, Tamarah L; Adams, Sandra D; Ball, Sarah L; Benjamin, Robert C; Bonilla, J Alfred; Breitenberger, Caroline A; Daniels, Charles J; Gaffney, Bobby L; Harrison, Melinda; Hughes, Lee E; King, Rodney A; Krukonis, Gregory P; Lopez, A Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C; Rinehart, Claire A; Staples, Amanda K; Stowe, Emily L; Garlena, Rebecca A; Russell, Daniel A; Cresawn, Steven G; Pope, Welkin H; Hatfull, Graham F
2018-02-01
We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae , Myoviridae , and Podoviridae ) are represented. Copyright © 2018 Klyczek et al.
Complete Genome Sequences of 44 Arthrobacter Phages
Klyczek, Karen K.; Adair, Tamarah L.; Adams, Sandra D.; Ball, Sarah L.; Benjamin, Robert C.; Bonilla, J. Alfred; Breitenberger, Caroline A.; Daniels, Charles J.; Gaffney, Bobby L.; Harrison, Melinda; Hughes, Lee E.; King, Rodney A.; Krukonis, Gregory P.; Lopez, A. Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C.; Staples, Amanda K.; Stowe, Emily L.; Garlena, Rebecca A.; Russell, Daniel A.
2018-01-01
ABSTRACT We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae, Myoviridae, and Podoviridae) are represented. PMID:29437090
Bloom DNA Helicase Facilitates Homologous Recombination between Diverged Homologous Sequences*
Kikuchi, Koji; Abdel-Aziz, H. Ismail; Taniguchi, Yoshihito; Yamazoe, Mitsuyoshi; Takeda, Shunichi; Hirota, Kouji
2009-01-01
Bloom syndrome caused by inactivation of the Bloom DNA helicase (Blm) is characterized by increases in the level of sister chromatid exchange, homologous recombination (HR) associated with cross-over. It is therefore believed that Blm works as an anti-recombinase. Meanwhile, in Drosophila, DmBlm is required specifically to promote the synthesis-dependent strand anneal (SDSA), a type of HR not associating with cross-over. However, conservation of Blm function in SDSA through higher eukaryotes has been a matter of debate. Here, we demonstrate the function of Blm in SDSA type HR in chicken DT40 B lymphocyte line, where Ig gene conversion diversifies the immunoglobulin V gene through intragenic HR between diverged homologous segments. This reaction is initiated by the activation-induced cytidine deaminase enzyme-mediated uracil formation at the V gene, which in turn converts into abasic site, presumably leading to a single strand gap. Ig gene conversion frequency was drastically reduced in BLM−/− cells. In addition, BLM−/− cells used limited donor segments harboring higher identity compared with other segments in Ig gene conversion event, suggesting that Blm can promote HR between diverged sequences. To further understand the role of Blm in HR between diverged homologous sequences, we measured the frequency of gene targeting induced by an I-SceI-endonuclease-mediated double-strand break. BLM−/− cells showed a severer defect in the gene targeting frequency as the number of heterologous sequences increased at the double-strand break site. Conversely, the overexpression of Blm, even an ATPase-defective mutant, strongly stimulated gene targeting. In summary, Blm promotes HR between diverged sequences through a novel ATPase-independent mechanism. PMID:19661064
Lenglez, Sandrine; Hermand, Damien; Decottignies, Anabelle
2010-01-01
Chromosomal double-strand breaks (DSBs) threaten genome integrity and repair of these lesions is often mutagenic. How and where DSBs are formed is a major question conveniently addressed in simple model organisms like yeast. NUMTs, nuclear DNA sequences of mitochondrial origin, are present in most eukaryotic genomes and probably result from the capture of mitochondrial DNA (mtDNA) fragments into chromosomal breaks. NUMT formation is ongoing and was reported to cause de novo human genetic diseases. Study of NUMTs is likely to contribute to the understanding of naturally occurring chromosomal breaks. We show that Schizosaccharomyces pombe NUMTs are exclusively located in noncoding regions with no preference for gene promoters and, when located into promoters, do not affect gene transcription level. Strikingly, most noncoding regions comprising NUMTs are also associated with a DNA replication origin (ORI). Chromatin immunoprecipitation experiments revealed that chromosomal NUMTs are probably not acting as ORI on their own but that mtDNA insertions occurred directly next to ORIs, suggesting that these loci may be prone to DSB formation. Accordingly, induction of excessive DNA replication origin firing, a phenomenon often associated with human tumor formation, resulted in frequent nucleotide deletion events within ORI3001 subtelomeric chromosomal locus, illustrating a novel aspect of DNA replication-driven genomic instability. How mtDNA is fragmented is another important issue that we addressed by sequencing experimentally induced NUMTs. This highlighted regions of S. pombe mtDNA prone to breaking. Together with an analysis of human NUMTs, we propose that these fragile sites in mtDNA may correspond to replication pause sites. PMID:20688779
Slieman, Tony A.; Nicholson, Wayne L.
2000-01-01
The loss of stratospheric ozone and the accompanying increase in solar UV flux have led to concerns regarding decreases in global microbial productivity. Central to understanding this process is determining the types and amounts of DNA damage in microbes caused by solar UV irradiation. While UV irradiation of dormant Bacillus subtilis endospores results mainly in formation of the “spore photoproduct” 5-thyminyl-5,6-dihydrothymine, genetic evidence indicates that an additional DNA photoproduct(s) may be formed in spores exposed to solar UV-B and UV-A radiation (Y. Xue and W. L. Nicholson, Appl. Environ. Microbiol. 62:2221–2227, 1996). We examined the occurrence of double-strand breaks, single-strand breaks, cyclobutane pyrimidine dimers, and apurinic-apyrimidinic sites in spore DNA under several UV irradiation conditions by using enzymatic probes and neutral or alkaline agarose gel electrophoresis. DNA from spores irradiated with artificial 254-nm UV-C radiation accumulated single-strand breaks, double-strand breaks, and cyclobutane pyrimidine dimers, while DNA from spores exposed to artificial UV-B radiation (wavelengths, 290 to 310 nm) accumulated only cyclobutane pyrimidine dimers. DNA from spores exposed to full-spectrum sunlight (UV-B and UV-A radiation) accumulated single-strand breaks, double-strand breaks, and cyclobutane pyrimidine dimers, whereas DNA from spores exposed to sunlight from which the UV-B component had been removed with a filter (“UV-A sunlight”) accumulated only single-strand breaks and double-strand breaks. Apurinic-apyrimidinic sites were not detected in spore DNA under any of the irradiation conditions used. Our data indicate that there is a complex spectrum of UV photoproducts in DNA of bacterial spores exposed to solar UV irradiation in the environment. PMID:10618224
Characterization of biochemical properties of Bacillus subtilis RecQ helicase.
Qin, Wei; Liu, Na-Nv; Wang, Lijun; Zhou, Min; Ren, Hua; Bugnard, Elisabeth; Liu, Jie-Lin; Zhang, Lin-Hu; Vendôme, Jeremie; Hu, Jin-Shan; Xi, Xu Guang
2014-12-01
RecQ family helicases function as safeguards of the genome. Unlike Escherichia coli, the Gram-positive Bacillus subtilis bacterium possesses two RecQ-like homologues, RecQ[Bs] and RecS, which are required for the repair of DNA double-strand breaks. RecQ[Bs] also binds to the forked DNA to ensure a smooth progression of the cell cycle. Here we present the first biochemical analysis of recombinant RecQ[Bs]. RecQ[Bs] binds weakly to single-stranded DNA (ssDNA) and blunt-ended double-stranded DNA (dsDNA) but strongly to forked dsDNA. The protein exhibits a DNA-stimulated ATPase activity and ATP- and Mg(2+)-dependent DNA helicase activity with a 3' → 5' polarity. Molecular modeling shows that RecQ[Bs] shares high sequence and structure similarity with E. coli RecQ. Surprisingly, RecQ[Bs] resembles the truncated Saccharomyces cerevisiae Sgs1 and human RecQ helicases more than RecQ[Ec] with regard to its enzymatic activities. Specifically, RecQ[Bs] unwinds forked dsDNA and DNA duplexes with a 3'-overhang but is inactive on blunt-ended dsDNA and 5'-overhung duplexes. Interestingly, RecQ[Bs] unwinds blunt-ended DNA with structural features, including nicks, gaps, 5'-flaps, Kappa joints, synthetic replication forks, and Holliday junctions. We discuss these findings in the context of RecQ[Bs]'s possible functions in preserving genomic stability. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Henrich, Oliver; Gutiérrez Fosado, Yair Augusto; Curk, Tine; Ouldridge, Thomas E
2018-05-10
During the last decade coarse-grained nucleotide models have emerged that allow us to study DNA and RNA on unprecedented time and length scales. Among them is oxDNA, a coarse-grained, sequence-specific model that captures the hybridisation transition of DNA and many structural properties of single- and double-stranded DNA. oxDNA was previously only available as standalone software, but has now been implemented into the popular LAMMPS molecular dynamics code. This article describes the new implementation and analyses its parallel performance. Practical applications are presented that focus on single-stranded DNA, an area of research which has been so far under-investigated. The LAMMPS implementation of oxDNA lowers the entry barrier for using the oxDNA model significantly, facilitates future code development and interfacing with existing LAMMPS functionality as well as other coarse-grained and atomistic DNA models.
Li, Ping; Jin, Hui; Yu, Hong-Guo
2014-01-01
During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240
Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles
2016-09-12
We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.
Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work
NASA Astrophysics Data System (ADS)
Kowalczykowski, Stephen
2013-03-01
We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.
Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance
Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan
2014-01-01
Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. PMID:25389272
Fresco, Jacques R.; Johnson, Marion D.
2002-01-01
Disclosed are methods for detecting in situ the presence of a target sequence in a substantially double-stranded nucleic acid segment, which comprises: a) contacting in situ under conditions suitable for hybridization a substantially double-stranded nucleic acid segment with a detectable third strand, said third strand being capable of hybridizing to at least a portion of the target sequence to form a triple-stranded structure, if said target sequence is present; and b) detecting whether hybridization between the third strand and the target sequence has occured.
Fedoseeva, Daria M.; Sosin, Dmitri V.; Grachev, Sergei A.; Serebraykova, Marina V.; Romanenko, Svetlana A.; Vorobieva, Nadezhda V.; Kravatsky, Yuri V.
2013-01-01
Genome instability plays a key role in multiple biological processes and diseases, including cancer. Genome-wide mapping of DNA double-strand breaks (DSBs) is important for understanding both chromosomal architecture and specific chromosomal regions at DSBs. We developed a method for precise genome-wide mapping of blunt-ended DSBs in human chromosomes, and observed non-random fragmentation and DSB hot spots. These hot spots are scattered along chromosomes and delimit protected 50–250 kb DNA domains. We found that about 30% of the domains (denoted forum domains) possess coordinately expressed genes and that PARP1 and HNRNPA2B1 specifically bind DNA sequences at the forum domain termini. Thus, our data suggest a novel type of gene regulation: a coordinated transcription or silencing of gene clusters delimited by DSB hot spots as well as PARP1 and HNRNPa2B1 binding sites. PMID:23593027
2015-10-01
TERMS Cancer Testis Antigen (CTA), Fanconia- Anemia (FA), DNA Damage, Genomic Instability, DNA Double Strand Break (DSB) 16. SECURITY CLASSIFICATION OF...Cancer Testis Antigen (CTA) o Fanconia- Anemia (FA) o DNA Damage o Genomic Instability o DNA Double Strand Break (DSB) 3. Accomplishments • What
NASA Astrophysics Data System (ADS)
Ghobadi, Ahmadreza F.; Jayaraman, Arthi
DNA hybridization is the basis of various bio-nano technologies, such as DNA origami and assembly of DNA-functionalized nanoparticles. A hybridized double stranded (ds) DNA is formed when complementary nucleobases on hybridizing strands exhibit specific and directional hydrogen bonds through canonical Watson-Crick base-pairing interactions. In recent years, the need for cheaper alternatives and significant synthetic advances have driven design of DNA mimics with new backbone chemistries. However, a fundamental understanding of how these backbone modifications in the oligo-nucleic acids impact the hybridization and melting behavior of the duplex is still lacking. In this talk, we present our recent findings on impact of varying backbone chemistry on hybridization of oligo-nucleic acid duplexes. We use coarse-grained molecular dynamics simulations to isolate the effect of strand flexibility, electrostatic interactions and nucleobase spacing on the melting curves for duplexes with various strand sequences and concentrations. Since conjugation of oligo-nucleic acids with polymers serve as building blocks for thermo-responsive polymer networks and gels, we also present the effect of such conjugation on hybridization thermodynamics and polymer conformation.
[Investigation of RNA viral genome amplification by multiple displacement amplification technique].
Pang, Zheng; Li, Jian-Dong; Li, Chuan; Liang, Mi-Fang; Li, De-Xin
2013-06-01
In order to facilitate the detection of newly emerging or rare viral infectious diseases, a negative-strand RNA virus-severe fever with thrombocytopenia syndrome bunyavirus, and a positive-strand RNA virus-dengue virus, were used to investigate RNA viral genome unspecific amplification by multiple displacement amplification technique from clinical samples. Series of 10-fold diluted purified viral RNA were utilized as analog samples with different pathogen loads, after a series of reactions were sequentially processed, single-strand cDNA, double-strand cDNA, double-strand cDNA treated with ligation without or with supplemental RNA were generated, then a Phi29 DNA polymerase depended isothermal amplification was employed, and finally the target gene copies were detected by real time PCR assays to evaluate the amplification efficiencies of various methods. The results showed that multiple displacement amplification effects of single-strand or double-strand cDNA templates were limited, while the fold increases of double-strand cDNA templates treated with ligation could be up to 6 X 10(3), even 2 X 10(5) when supplemental RNA existed, and better results were obtained when viral RNA loads were lower. A RNA viral genome amplification system using multiple displacement amplification technique was established in this study and effective amplification of RNA viral genome with low load was achieved, which could provide a tool to synthesize adequate viral genome for multiplex pathogens detection.
Areeshi, Mohammed Yahya
2013-01-01
DNA repair capacity is crucial in maintaining cellular functions and homeostasis. However, it can be altered based on DNA sequence variations in DNA repair genes and this may lead to the development of many diseases including malignancies. Identification of genetic polymorphisms responsible for reduced DNA repair capacity is necessary for better prevention. Homologous recombination (HR), a major double strand break repair pathway, plays a critical role in maintaining the genome stability. The present study was performed to determine the frequency of the HR gene XRCC3 Exon 7 (C18067T, rs861539) polymorphisms in Saudi Arabian population in comparison with epidemiological studies by "MEDLINE" search to equate with global populations. The variant allelic (T) frequency of XRCC3 (C>T) was found to be 39%. Our results suggest that frequency of XRCC3 (C>T) DNA repair gene exhibits distinctive patterns compared with the Saudi Arabian population and this might be attributed to ethnic variation. The present findings may help in high-risk screening of humans exposed to environmental carcinogens and cancer predisposition in different ethnic groups.
Mladenov, Emil; Iliakis, George
2011-06-03
A defining characteristic of damage induced in the DNA by ionizing radiation (IR) is its clustered character that leads to the formation of complex lesions challenging the cellular repair mechanisms. The most widely investigated such complex lesion is the DNA double strand break (DSB). DSBs undermine chromatin stability and challenge the repair machinery because an intact template strand is lacking to assist restoration of integrity and sequence in the DNA molecule. Therefore, cells have evolved a sophisticated machinery to detect DSBs and coordinate a response on the basis of inputs from various sources. A central function of cellular responses to DSBs is the coordination of DSB repair. Two conceptually different mechanisms can in principle remove DSBs from the genome of cells of higher eukaryotes. Homologous recombination repair (HRR) uses as template a homologous DNA molecule and is therefore error-free; it functions preferentially in the S and G2 phases. Non-homologous end joining (NHEJ), on the other hand, simply restores DNA integrity by joining the two ends, is error prone as sequence is only fortuitously preserved and active throughout the cell cycle. The basis of DSB repair pathway choice remains unknown, but cells of higher eukaryotes appear programmed to utilize preferentially NHEJ. Recent work suggests that when the canonical DNA-PK dependent pathway of NHEJ (D-NHEJ), becomes compromised an alternative NHEJ pathway and not HRR substitutes in a quasi-backup function (B-NHEJ). Here, we outline aspects of DSB induction by IR and review the mechanisms of their processing in cells of higher eukaryotes. We place particular emphasis on backup pathways of NHEJ and summarize their increasing significance in various cellular processes, as well as their potential contribution to carcinogenesis. 2011 Elsevier B.V. All rights reserved.
Method for in vitro recombination
Gibson, Daniel Glenn; Smith, Hamilton O
2013-05-07
The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.
Izui, S; Lambert, P H; Carpentier, N; Miescher, P A
1976-01-01
One hundred and seventy-five sera from thirty-three patients with acute myeloid leukaemia, forty-two patients with chronic myeloid leukaemia and twelve patients with acute lymphatic leukaemia were examined by a radioimmunological technique for the presence of antibodies against single-stranded and double-stranded DNA. The levels of single-stranded DNA binding activity was significantly higher in all three types of leukaemia compared to those of healthy controls. In contrast, none of these sera exhibited a positive reaction with double-stranded DNA. In some cases the level of serum anti-DNA antibodies increased after the decrease of the leucocyte count. The presence of anti-DNA antibodies in leukaemic patients may have some biological significance. PMID:780020
Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M
2017-06-01
The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange events and exploring cellular heterogeneity. Strand-seq is a single-cell sequencing technology that resolves the individual homologs within a cell by restricting sequence analysis to the DNA template strands used during DNA replication. This protocol, which takes up to 4 d to complete, relies on the directionality of DNA, in which each single strand of a DNA molecule is distinguished based on its 5'-3' orientation. Culturing cells in a thymidine analog for one round of cell division labels nascent DNA strands, allowing for their selective removal during genomic library construction. To preserve directionality of template strands, genomic preamplification is bypassed and labeled nascent strands are nicked and not amplified during library preparation. Each single-cell library is multiplexed for pooling and sequencing, and the resulting sequence data are aligned, mapping to either the minus or plus strand of the reference genome, to assign template strand states for each chromosome in the cell. The major adaptations to conventional single-cell sequencing protocols include harvesting of daughter cells after a single round of BrdU incorporation, bypassing of whole-genome amplification, and removal of the BrdU + strand during Strand-seq library preparation. By sequencing just template strands, the structure and identity of each homolog are preserved.
Rackwitz, Jenny; Bald, Ilko
2018-03-26
During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (<20 eV) electrons, which are able to damage DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Double-stranded telomeric DNA binding proteins: Diversity matters.
Červenák, Filip; Juríková, Katarína; Sepšiová, Regina; Neboháčová, Martina; Nosek, Jozef; Tomáška, L'ubomír
2017-01-01
Telomeric sequences constitute only a small fraction of the whole genome yet they are crucial for ensuring genomic stability. This function is in large part mediated by protein complexes recruited to telomeric sequences by specific telomere-binding proteins (TBPs). Although the principal tasks of nuclear telomeres are the same in all eukaryotes, TBPs in various taxa exhibit a surprising diversity indicating their distinct evolutionary origin. This diversity is especially pronounced in ascomycetous yeasts where they must have co-evolved with rapidly diversifying sequences of telomeric repeats. In this article we (i) provide a historical overview of the discoveries leading to the current list of TBPs binding to double-stranded (ds) regions of telomeres, (ii) describe examples of dsTBPs highlighting their diversity in even closely related species, and (iii) speculate about possible evolutionary trajectories leading to a long list of various dsTBPs fulfilling the same general role(s) in their own unique ways.
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
Soares, Marcelo Bento; Bonaldo, Maria de Fatima
1998-01-01
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.
Soares, M.B.; Fatima Bonaldo, M. de
1998-12-08
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.
Xie, Fuqian; Wu, Colin G.; Weiland, Elizabeth; Lohman, Timothy M.
2013-01-01
Repair of double-stranded DNA breaks in Escherichia coli is initiated by the RecBCD helicase that possesses two superfamily-1 motors, RecB (3′ to 5′ translocase) and RecD (5′ to 3′ translocase), that operate on the complementary DNA strands to unwind duplex DNA. However, it is not known whether the RecB and RecD motors act independently or are functionally coupled. Here we show by directly monitoring ATP-driven single-stranded DNA translocation of RecBCD that the 5′ to 3′ rate is always faster than the 3′ to 5′ rate on DNA without a crossover hotspot instigator site and that the translocation rates are coupled asymmetrically. That is, RecB regulates both 3′ to 5′ and 5′ to 3′ translocation, whereas RecD only regulates 5′ to 3′ translocation. We show that the recently identified RecBC secondary translocase activity functions within RecBCD and that this contributes to the coupling. This coupling has implications for how RecBCD activity is regulated after it recognizes a crossover hotspot instigator sequence during DNA unwinding. PMID:23192341
Bacolla, Albino; Tainer, John A; Vasquez, Karen M; Cooper, David N
2016-07-08
Gross chromosomal rearrangements (including translocations, deletions, insertions and duplications) are a hallmark of cancer genomes and often create oncogenic fusion genes. An obligate step in the generation of such gross rearrangements is the formation of DNA double-strand breaks (DSBs). Since the genomic distribution of rearrangement breakpoints is non-random, intrinsic cellular factors may predispose certain genomic regions to breakage. Notably, certain DNA sequences with the potential to fold into secondary structures [potential non-B DNA structures (PONDS); e.g. triplexes, quadruplexes, hairpin/cruciforms, Z-DNA and single-stranded looped-out structures with implications in DNA replication and transcription] can stimulate the formation of DNA DSBs. Here, we tested the postulate that these DNA sequences might be found at, or in close proximity to, rearrangement breakpoints. By analyzing the distribution of PONDS-forming sequences within ±500 bases of 19 947 translocation and 46 365 sequence-characterized deletion breakpoints in cancer genomes, we find significant association between PONDS-forming repeats and cancer breakpoints. Specifically, (AT)n, (GAA)n and (GAAA)n constitute the most frequent repeats at translocation breakpoints, whereas A-tracts occur preferentially at deletion breakpoints. Translocation breakpoints near PONDS-forming repeats also recur in different individuals and patient tumor samples. Hence, PONDS-forming sequences represent an intrinsic risk factor for genomic rearrangements in cancer genomes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chromosome rearrangements via template switching between diverged repeated sequences
Anand, Ranjith P.; Tsaponina, Olga; Greenwell, Patricia W.; Lee, Cheng-Sheng; Du, Wei; Petes, Thomas D.
2014-01-01
Recent high-resolution genome analyses of cancer and other diseases have revealed the occurrence of microhomology-mediated chromosome rearrangements and copy number changes. Although some of these rearrangements appear to involve nonhomologous end-joining, many must have involved mechanisms requiring new DNA synthesis. Models such as microhomology-mediated break-induced replication (MM-BIR) have been invoked to explain these rearrangements. We examined BIR and template switching between highly diverged sequences in Saccharomyces cerevisiae, induced during repair of a site-specific double-strand break (DSB). Our data show that such template switches are robust mechanisms that give rise to complex rearrangements. Template switches between highly divergent sequences appear to be mechanistically distinct from the initial strand invasions that establish BIR. In particular, such jumps are less constrained by sequence divergence and exhibit a different pattern of microhomology junctions. BIR traversing repeated DNA sequences frequently results in complex translocations analogous to those seen in mammalian cells. These results suggest that template switching among repeated genes is a potent driver of genome instability and evolution. PMID:25367035
Holsclaw, Julie Korda; Sekelsky, Jeff
2017-05-01
DNA double-strand breaks (DSBs) pose a serious threat to genomic integrity. If unrepaired, they can lead to chromosome fragmentation and cell death. If repaired incorrectly, they can cause mutations and chromosome rearrangements. DSBs are repaired using end-joining or homology-directed repair strategies, with the predominant form of homology-directed repair being synthesis-dependent strand annealing (SDSA). SDSA is the first defense against genomic rearrangements and information loss during DSB repair, making it a vital component of cell health and an attractive target for chemotherapeutic development. SDSA has also been proposed to be the primary mechanism for integration of large insertions during genome editing with CRISPR/Cas9. Despite the central role for SDSA in genome stability, little is known about the defining step: annealing. We hypothesized that annealing during SDSA is performed by the annealing helicase SMARCAL1, which can anneal RPA-coated single DNA strands during replication-associated DNA damage repair. We used unique genetic tools in Drosophila melanogaster to test whether the fly ortholog of SMARCAL1, Marcal1, mediates annealing during SDSA. Repair that requires annealing is significantly reduced in Marcal1 null mutants in both synthesis-dependent and synthesis-independent (single-strand annealing) assays. Elimination of the ATP-binding activity of Marcal1 also reduced annealing-dependent repair, suggesting that the annealing activity requires translocation along DNA. Unlike the null mutant, however, the ATP-binding defect mutant showed reduced end joining, shedding light on the interaction between SDSA and end-joining pathways. Copyright © 2017 by the Genetics Society of America.
Genomic differentiation among wild cyanophages despite widespread horizontal gene transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gregory, Ann C.; Solonenko, Sergei A.; Ignacio-Espinoza, J. Cesar
Genetic recombination is a driving force in genome evolution. Among viruses it has a dual role. For genomes with higher fitness, it maintains genome integrity in the face of high mutation rates. Conversely, for genomes with lower fitness, it provides immediate access to sequence space that cannot be reached by mutation alone. Understanding how recombination impacts the cohesion and dissolution of individual whole genomes within viral sequence space is poorly understood across double-stranded DNA bacteriophages (a.k.a phages) due to the challenges of obtaining appropriately scaled genomic datasets. Here in this study we explore the role of recombination in both maintainingmore » and differentiating whole genomes of 142 wild double-stranded DNA marine cyanophages. Phylogenomic analysis across the 51 core genes revealed ten lineages, six of which were well represented. These phylogenomic lineages represent discrete genotypic populations based on comparisons of intra- and inter- lineage shared gene content, genome-wide average nucleotide identity, as well as detected gaps in the distribution of pairwise differences between genomes. McDonald-Kreitman selection tests identified putative niche-differentiating genes under positive selection that differed across the six well-represented genotypic populations and that may have driven initial divergence. Concurrent with patterns of recombination of discrete populations, recombination analyses of both genic and intergenic regions largely revealed decreased genetic exchange across individual genomes between relative to within populations. Lastly, these findings suggest that discrete double-stranded DNA marine cyanophage populations occur in nature and are maintained by patterns of recombination akin to those observed in bacteria, archaea and in sexual eukaryotes.« less
Genomic differentiation among wild cyanophages despite widespread horizontal gene transfer
Gregory, Ann C.; Solonenko, Sergei A.; Ignacio-Espinoza, J. Cesar; ...
2016-11-16
Genetic recombination is a driving force in genome evolution. Among viruses it has a dual role. For genomes with higher fitness, it maintains genome integrity in the face of high mutation rates. Conversely, for genomes with lower fitness, it provides immediate access to sequence space that cannot be reached by mutation alone. Understanding how recombination impacts the cohesion and dissolution of individual whole genomes within viral sequence space is poorly understood across double-stranded DNA bacteriophages (a.k.a phages) due to the challenges of obtaining appropriately scaled genomic datasets. Here in this study we explore the role of recombination in both maintainingmore » and differentiating whole genomes of 142 wild double-stranded DNA marine cyanophages. Phylogenomic analysis across the 51 core genes revealed ten lineages, six of which were well represented. These phylogenomic lineages represent discrete genotypic populations based on comparisons of intra- and inter- lineage shared gene content, genome-wide average nucleotide identity, as well as detected gaps in the distribution of pairwise differences between genomes. McDonald-Kreitman selection tests identified putative niche-differentiating genes under positive selection that differed across the six well-represented genotypic populations and that may have driven initial divergence. Concurrent with patterns of recombination of discrete populations, recombination analyses of both genic and intergenic regions largely revealed decreased genetic exchange across individual genomes between relative to within populations. Lastly, these findings suggest that discrete double-stranded DNA marine cyanophage populations occur in nature and are maintained by patterns of recombination akin to those observed in bacteria, archaea and in sexual eukaryotes.« less
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Shafirovich, V; Dourandin, A; Luneva, N P; Singh, C; Kirigin, F; Geacintov, N E
1999-03-01
The excitation of pBr322 supercoiled plasmid DNA with intense near-IR 810 nm fs laser pulses by a simultaneous multiphoton absorption mechanism results in single-strand breaks after treatment of the irradiated samples with Micrococcus luteus UV endonuclease. This enzyme cleaves DNA strands at sites of cyclobutane dimers that are formed by the simultaneous absorption of three (or more) 810 nm IR photons (pulse width approximately 140 fs, 76 MHz pulse repetition, average power output focused through 10x microscope objective is approximately 1.2 MW/cm2). Direct single-strand breaks (without treatment with M. luteus) were not observed under these conditions. However, in the presence of 6 microM of the intercalator proflavine (PF), both direct single- and double-strand breaks are observed under conditions where substantial fractions of undamaged supercoiled DNA molecules are still present. The fraction of direct double-strand breaks is 30 +/- 5% of all measurable strand cleavage events, is independent of dosage (up to 6.4 GJ/cm2) and is proportional to In, where I is the average power/area of the 810 nm fs laser pulses, and n = 3 +/- 1. The nicking of two DNA strands in the immediate vicinity of the excited PF molecules gives rise to this double-strand cleavage. In contrast, excitation of the same samples under low-power, single-photon absorption conditions (approximately 400-500 nm) gives rise predominantly to single-strand breaks, but some double-strand breaks are observed at the higher dosages. Thus, single-photon excitation with 400-500 nm light and multiphoton activation of PF by near-IR fs laser pulses produces different distributions of single- and double-strand breaks. These results suggest that DNA strand cleavage originates from unrelaxed, higher excited states when PF is excited by simultaneous IR multiphoton absorption processes.
Odom, Obed W; Baek, Kwang-Hyun; Dani, Radhika N; Herrin, David L
2008-03-01
Certain group I introns insert into intronless DNA via an endonuclease that creates a double-strand break (DSB). There are two models for intron homing in phage: synthesis-dependent strand annealing (SDSA) and double-strand break repair (DSBR). The Cr.psbA4 intron homes efficiently from a plasmid into the chloroplast psbA gene in Chlamydomonas, but little is known about the mechanism. Analysis of co-transformants selected using a spectinomycin-resistant 16S gene (16S(spec)) provided evidence for both pathways. We also examined the consequences of the donor DNA having only one-sided or no homology with the psbA gene. When there was no homology with the donor DNA, deletions of up to 5 kb involving direct repeats that flank the psbA gene were obtained. Remarkably, repeats as short as 15 bp were used for this repair, which is consistent with the single-strand annealing (SSA) pathway. When the donor had one-sided homology, the DSB in most co-transformants was repaired using two DNAs, the donor and the 16S(spec) plasmid, which, coincidentally, contained a region that is repeated upstream of psbA. DSB repair using two separate DNAs provides further evidence for the SDSA pathway. These data show that the chloroplast can repair a DSB using short dispersed repeats located proximally, distally, or even on separate molecules relative to the DSB. They also provide a rationale for the extensive repertoire of repeated sequences in this genome.
Stein, Alexis; Kalifa, Lidza; Sia, Elaine A
2015-11-01
Mitochondria contain an independently maintained genome that encodes several proteins required for cellular respiration. Deletions in the mitochondrial genome have been identified that cause several maternally inherited diseases and are associated with certain cancers and neurological disorders. The majority of these deletions in human cells are flanked by short, repetitive sequences, suggesting that these deletions may result from recombination events. Our current understanding of the maintenance and repair of mtDNA is quite limited compared to our understanding of similar events in the nucleus. Many nuclear DNA repair proteins are now known to also localize to mitochondria, but their function and the mechanism of their action remain largely unknown. This study investigated the contribution of the nuclear double-strand break repair (DSBR) proteins Rad51p, Rad52p and Rad59p in mtDNA repair. We have determined that both Rad51p and Rad59p are localized to the matrix of the mitochondria and that Rad51p binds directly to mitochondrial DNA. In addition, a mitochondrially-targeted restriction endonuclease (mtLS-KpnI) was used to produce a unique double-strand break (DSB) in the mitochondrial genome, which allowed direct analysis of DSB repair in vivo in Saccharomyces cerevisiae. We find that loss of these three proteins significantly decreases the rate of spontaneous deletion events and the loss of Rad51p and Rad59p impairs the repair of induced mtDNA DSBs.
Stein, Alexis; Kalifa, Lidza; Sia, Elaine A.
2015-01-01
Mitochondria contain an independently maintained genome that encodes several proteins required for cellular respiration. Deletions in the mitochondrial genome have been identified that cause several maternally inherited diseases and are associated with certain cancers and neurological disorders. The majority of these deletions in human cells are flanked by short, repetitive sequences, suggesting that these deletions may result from recombination events. Our current understanding of the maintenance and repair of mtDNA is quite limited compared to our understanding of similar events in the nucleus. Many nuclear DNA repair proteins are now known to also localize to mitochondria, but their function and the mechanism of their action remain largely unknown. This study investigated the contribution of the nuclear double-strand break repair (DSBR) proteins Rad51p, Rad52p and Rad59p in mtDNA repair. We have determined that both Rad51p and Rad59p are localized to the matrix of the mitochondria and that Rad51p binds directly to mitochondrial DNA. In addition, a mitochondrially-targeted restriction endonuclease (mtLS-KpnI) was used to produce a unique double-strand break (DSB) in the mitochondrial genome, which allowed direct analysis of DSB repair in vivo in Saccharomyces cerevisiae. We find that loss of these three proteins significantly decreases the rate of spontaneous deletion events and the loss of Rad51p and Rad59p impairs the repair of induced mtDNA DSBs. PMID:26540255
Single nucleotide-level mapping of DNA double-strand breaks in human HEK293T cells.
Pope, Bernard J; Mahmood, Khalid; Jung, Chol-Hee; Georgeson, Peter; Park, Daniel J
2017-03-01
Constitutional biological processes involve the generation of DNA double-strand breaks (DSBs). The production of such breaks and their subsequent resolution are also highly relevant to neurodegenerative diseases and cancer, in which extensive DNA fragmentation has been described Stephens et al. (2011), Blondet et al. (2001). Tchurikov et al. Tchurikov et al. (2011, 2013) have reported previously that frequent sites of DSBs occur in chromosomal domains involved in the co-ordinated expression of genes. This group report that hot spots of DSBs in human HEK293T cells often coincide with H3K4me3 marks, associated with active transcription Kravatsky et al. (2015) and that frequent sites of DNA double-strand breakage are likely to be relevant to cancer genomics Tchurikov et al. (2013, 2016) . Recently, they applied a RAFT (rapid amplification of forum termini) protocol that selects for blunt-ended DSB sites and mapped these to the human genome within defined co-ordinate 'windows'. In this paper, we re-analyse public RAFT data to derive sites of DSBs at the single-nucleotide level across the built genome for human HEK293T cells (https://figshare.com/s/35220b2b79eaaaf64ed8). This refined mapping, combined with accessory ENCODE data tracks and ribosomal DNA-related sequence annotations, will likely be of value for the design of clinically relevant targeted assays such as those for cancer susceptibility, diagnosis, treatment-matching and prognostication.
Browning, Cynthia L.; Qin, Qin; Kelly, Deborah F.; Prakash, Rohit; Vanoli, Fabio; Jasin, Maria
2016-01-01
Abstract Genomic instability is one of the primary models of carcinogenesis and a feature of almost all cancers. Homologous recombination (HR) repair protects against genomic instability by maintaining high genomic fidelity during the repair of DNA double strand breaks. The defining step of HR repair is the formation of the Rad51 nucleofilament, which facilitates the search for a homologous sequence and invasion of the template DNA strand. Particulate hexavalent chromium (Cr(VI)), a human lung carcinogen, induces DNA double strand breaks and chromosome instability. Since the loss of HR repair increases Cr(VI)-induced chromosome instability, we investigated the effect of extended Cr(VI) exposure on HR repair. We show acute (24 h) Cr(VI) exposure induces a normal HR repair response. In contrast, prolonged (120 h) exposure to particulate Cr(VI) inhibited HR repair and Rad51 nucleofilament formation. Prolonged Cr(VI) exposure had a profound effect on Rad51, evidenced by reduced protein levels and Rad51 mislocalization to the cytoplasm. The response of proteins involved in Rad51 nuclear import and nucleofilament formation displayed varying responses to prolonged Cr(VI) exposure. BRCA2 formed nuclear foci after prolonged Cr(VI) exposure, while Rad51C foci formation was suppressed. These results suggest that particulate Cr(VI), a major chemical carcinogen, inhibits HR repair by targeting Rad51, causing DNA double strand breaks to be repaired by a low fidelity, Rad51-independent repair pathway. These results further enhance our understanding of the underlying mechanism of Cr(VI)-induced chromosome instability and thus, carcinogenesis. PMID:27449664
The HTLV-1 Tax Oncoprotein Represses Ku80 Gene Expression
Ducu, Razvan I.; Dayaram, Tajhal; Marriott, Susan J.
2011-01-01
The HTLV-I oncoprotein Tax interferes with DNA double strand break repair. Since non-homologous end joining (NHEJ) is a major pathway used to repair DNA double strand breaks we examined the effect of Tax on this pathway, with particular interest in the expression and function of Ku80, a critical component of the NHEJ pathway. Tax expression decreased Ku80 mRNA and protein levels, and repressed transcription from the Ku80 promoter. Conversely, Ku80 mRNA increased following siRNA knockdown of Tax in HTLV-I infected cells. Tax expression was associated with an elevated number of micronuclei and nucleoplasmic bridges, hallmarks of improper DNA double strand break repair. Our studies identified Tax as a transcriptional repressor of Ku80 that correlates with decreased DNA repair function. The reduction of Ku80 transcription by Tax may deplete the cell of an essential DNA break binding protein, resulting in reduced repair of DNA double strand breaks and accumulation genomic mutations. PMID:21571351
DNA Sequencing Using capillary Electrophoresis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dr. Barry Karger
2011-05-09
The overall goal of this program was to develop capillary electrophoresis as the tool to be used to sequence for the first time the Human Genome. Our program was part of the Human Genome Project. In this work, we were highly successful and the replaceable polymer we developed, linear polyacrylamide, was used by the DOE sequencing lab in California to sequence a significant portion of the human genome using the MegaBase multiple capillary array electrophoresis instrument. In this final report, we summarize our efforts and success. We began our work by separating by capillary electrophoresis double strand oligonucleotides using cross-linkedmore » polyacrylamide gels in fused silica capillaries. This work showed the potential of the methodology. However, preparation of such cross-linked gel capillaries was difficult with poor reproducibility, and even more important, the columns were not very stable. We improved stability by using non-cross linked linear polyacrylamide. Here, the entangled linear chains could move when osmotic pressure (e.g. sample injection) was imposed on the polymer matrix. This relaxation of the polymer dissipated the stress in the column. Our next advance was to use significantly lower concentrations of the linear polyacrylamide that the polymer could be automatically blown out after each run and replaced with fresh linear polymer solution. In this way, a new column was available for each analytical run. Finally, while testing many linear polymers, we selected linear polyacrylamide as the best matrix as it was the most hydrophilic polymer available. Under our DOE program, we demonstrated initially the success of the linear polyacrylamide to separate double strand DNA. We note that the method is used even today to assay purity of double stranded DNA fragments. Our focus, of course, was on the separation of single stranded DNA for sequencing purposes. In one paper, we demonstrated the success of our approach in sequencing up to 500 bases. Other application papers of sequencing up to this level were also published in the mid 1990's. A major interest of the sequencing community has always been read length. The longer the sequence read per run the more efficient the process as well as the ability to read repeat sequences. We therefore devoted a great deal of time to studying the factors influencing read length in capillary electrophoresis, including polymer type and molecule weight, capillary column temperature, applied electric field, etc. In our initial optimization, we were able to demonstrate, for the first time, the sequencing of over 1000 bases with 90% accuracy. The run required 80 minutes for separation. Sequencing of 1000 bases per column was next demonstrated on a multiple capillary instrument. Our studies revealed that linear polyacrylamide produced the longest read lengths because the hydrophilic single strand DNA had minimal interaction with the very hydrophilic linear polyacrylamide. Any interaction of the DNA with the polymer would lead to broader peaks and lower read length. Another important parameter was the molecular weight of the linear chains. High molecular weight (> 1 MDA) was important to allow the long single strand DNA to reptate through the entangled polymer matrix. In an important paper, we showed an inverse emulsion method to prepare reproducibility linear polyacrylamide polymer with an average MWT of 9MDa. This approach was used in the polymer for sequencing the human genome. Another critical factor in the successful use of capillary electrophoresis for sequencing was the sample preparation method. In the Sanger sequencing reaction, high concentration of salts and dideoxynucleotide remained. Since the sample was introduced to the capillary column by electrokinetic injection, these salt ions would be favorably injected into the column over the sequencing fragments, thus reducing the signal for longer fragments and hence reading read length. In two papers, we examined the role of individual components from the sequencing reaction and then developed a protocol to reduce the deleterious salts. We demonstrated a robust method for achieving long read length DNA sequencing. Continuing our advances, we next demonstrated the achievement of over 1000 bases in less than one hour with a base calling accuracy of between 98 and 99%. In this work, we implemented energy transfer dyes which allowed for cleaner differentiation of the 4 dye labeled terminal nucleotides. In addition, we developed improved base calling software to help read sequencing when the separation was only minimal as occurs at long read lengths. Another critical parameter we studied was column temperature. We demonstrated that read lengths improved as the column temperature was increased from room temperature to 60 C or 70 C. The higher temperature relaxed the DNA chains under the influence of the high electric field.« less
2016-10-01
Antigen (CTA), Fanconia- Anemia (FA), DNA Damage, Genomic Instability, DNA Double Strand Break (DSB) 16. SECURITY CLASSIFICATION OF: 17. LIMITATION...Fanconia- Anemia (FA) o DNA Damage o Genomic Instability o DNA Double Strand Break (DSB) 3. Accomplishments • What were the major goals and objectives of
Complete Genome Sequence of Pseudomonas aeruginosa Phage AAT-1.
Andrade-Domínguez, Andrés; Kolter, Roberto
2016-08-25
Aspects of the interaction between phages and animals are of interest and importance for medical applications. Here, we report the genome sequence of the lytic Pseudomonas phage AAT-1, isolated from mammalian serum. AAT-1 is a double-stranded DNA phage, with a genome of 57,599 bp, containing 76 predicted open reading frames. Copyright © 2016 Andrade-Domínguez and Kolter.
Radar Absorbing Colloidal Solutions (RACS)
2007-08-01
fig.5 sloiws te W-b yskm tinder test (a) and the two W- and D-band homi (b). The sytm ut~u4 tapol Ogm ingpi~s uVsmsso thepeanemptyeietm eone Twele...Because there is a very well defined relationship between DNA sequence and the thermodynamics of double-stranded DNA (dsDNA) formation, it is possible...to test device performance. The mass flow rate basically increases with heat input from the heat son=v though the exact relationship would be
The Apis mellifera filamentous virus genome
USDA-ARS?s Scientific Manuscript database
A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double strand DNA molecule of approximately 498’500 nucleotides with a GC content of 50.8%. It encompasses 251 non overlapping open reading frames (ORFs), e...
A new restriction endonuclease from Citrobacter freundii
Janulaitis, A.A.; Stakenas, P.S.; Lebedenko, E.N.; Berlin, Yu.A.
1982-01-01
CfrI, a new restriction endonuclease of unique substrate specificity, has been isolated from a Citrobacter freundii strain. The enzyme recognizes a degenerated sequence PyGGCCPu in double-strand DNA and cleaves it between Py and G residues to yield 5′ -protruding tetranucleotide ends GGCC. Images PMID:6294607
75 FR 62820 - Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-13
... I. Summary Synthetic biology, the developing interdisciplinary field that focuses on both the design and fabrication of novel biological components and systems as well as the re-design and fabrication of... develop, maintain, and document protocols to determine if a sequence ``hit'' qualifies as a true...
Nuclear ARP2/3 drives DNA break clustering for homology-directed repair.
Schrank, Benjamin R; Aparicio, Tomas; Li, Yinyin; Chang, Wakam; Chait, Brian T; Gundersen, Gregg G; Gottesman, Max E; Gautier, Jean
2018-06-20
DNA double-strand breaks repaired by non-homologous end joining display limited DNA end-processing and chromosomal mobility. By contrast, double-strand breaks undergoing homology-directed repair exhibit extensive processing and enhanced motion. The molecular basis of this movement is unknown. Here, using Xenopus laevis cell-free extracts and mammalian cells, we establish that nuclear actin, WASP, and the actin-nucleating ARP2/3 complex are recruited to damaged chromatin undergoing homology-directed repair. We demonstrate that nuclear actin polymerization is required for the migration of a subset of double-strand breaks into discrete sub-nuclear clusters. Actin-driven movements specifically affect double-strand breaks repaired by homology-directed repair in G2 cell cycle phase; inhibition of actin nucleation impairs DNA end-processing and homology-directed repair. By contrast, ARP2/3 is not enriched at double-strand breaks repaired by non-homologous end joining and does not regulate non-homologous end joining. Our findings establish that nuclear actin-based mobility shapes chromatin organization by generating repair domains that are essential for homology-directed repair in eukaryotic cells.
Activation of a yeast replication origin near a double-stranded DNA break.
Raghuraman, M K; Brewer, B J; Fangman, W L
1994-03-01
Irradiation in the G1 phase of the cell cycle delays the onset of DNA synthesis and transiently inhibits the activation of replication origins in mammalian cells. It has been suggested that this inhibition is the result of the loss of torsional tension in the DNA after it has been damaged. Because irradiation causes DNA damage at an undefined number of nonspecific sites in the genome, it is not known how cells respond to limited DNA damage, and how replication origins in the immediate vicinity of a damage site would behave. Using the sequence-specific HO endonuclease, we have created a defined double-stranded DNA break in a centromeric plasmid in G1-arrested cells of the yeast Saccharomyces cerevisiae. We show that replication does initiate at the origin on the cut plasmid, and that the plasmid replicates early in the S phase after linearization in vivo. These observations suggest that relaxation of a supercoiled DNA domain in yeast need not inactivate replication origins within that domain. Furthermore, these observations rule out the possibility that the late replication context associated with chromosomal termini is a consequence of DNA ends.
Method for assaying clustered DNA damages
Sutherland, Betsy M.
2004-09-07
Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.
NASA Technical Reports Server (NTRS)
Kohli, M.; Jorgensen, T. J.
1999-01-01
The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.
Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris
2014-06-17
Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.
Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud
2017-11-01
The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.
The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.
2015-01-01
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667
Confirming the 3D Solution Structure of a Short Double-Stranded DNA Sequence Using NMR Spectroscopy
ERIC Educational Resources Information Center
Ruhayel, Rasha A.; Berners-Price, Susan J.
2010-01-01
2D [superscript 1]H NOESY NMR spectroscopy is routinely used to give information on the closeness of hydrogen atoms through space. This work is based on a 2D [superscript 1]H NOESY NMR spectrum of a 12 base-pair DNA duplex. This 6-h laboratory workshop aims to provide advanced-level chemistry students with a basic, yet solid, understanding of how…
Lan, Susan; Kamel, Wael; Punga, Tanel; Akusjärvi, Göran
2017-02-28
The adenovirus L4-22K protein both activates and suppresses transcription from the adenovirus major late promoter (MLP) by binding to DNA elements located downstream of the MLP transcriptional start site: the so-called DE element (positive) and the R1 region (negative). Here we show that L4-22K preferentially binds to the RNA form of the R1 region, both to the double-stranded RNA and the single-stranded RNA of the same polarity as the nascent MLP transcript. Further, L4-22K binds to a 5΄-CAAA-3΄ motif in the single-stranded RNA, which is identical to the sequence motif characterized for L4-22K DNA binding. L4-22K binding to single-stranded RNA results in an enhancement of U1 snRNA recruitment to the major late first leader 5΄ splice site. This increase in U1 snRNA binding results in a suppression of MLP transcription and a concurrent stimulation of major late first intron splicing. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Probabilistic simple sticker systems
NASA Astrophysics Data System (ADS)
Selvarajoo, Mathuri; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod
2017-04-01
A model for DNA computing using the recombination behavior of DNA molecules, known as a sticker system, was introduced by by L. Kari, G. Paun, G. Rozenberg, A. Salomaa, and S. Yu in the paper entitled DNA computing, sticker systems and universality from the journal of Acta Informatica vol. 35, pp. 401-420 in the year 1998. A sticker system uses the Watson-Crick complementary feature of DNA molecules: starting from the incomplete double stranded sequences, and iteratively using sticking operations until a complete double stranded sequence is obtained. It is known that sticker systems with finite sets of axioms and sticker rules generate only regular languages. Hence, different types of restrictions have been considered to increase the computational power of sticker systems. Recently, a variant of restricted sticker systems, called probabilistic sticker systems, has been introduced [4]. In this variant, the probabilities are initially associated with the axioms, and the probability of a generated string is computed by multiplying the probabilities of all occurrences of the initial strings in the computation of the string. Strings for the language are selected according to some probabilistic requirements. In this paper, we study fundamental properties of probabilistic simple sticker systems. We prove that the probabilistic enhancement increases the computational power of simple sticker systems.
Gubaev, Airat; Weidlich, Daniela; Klostermeier, Dagmar
2016-01-01
The topological state of DNA is important for replication, recombination and transcription, and is regulated in vivo by DNA topoisomerases. Gyrase introduces negative supercoils into DNA at the expense of ATP hydrolysis. It is the accepted view that gyrase achieves supercoiling by a strand passage mechanism, in which double-stranded DNA is cleaved, and a second double-stranded segment is passed through the gap, converting a positive DNA node into a negative node. We show here that gyrase with only one catalytic tyrosine that cleaves a single strand of its DNA substrate can catalyze DNA supercoiling without strand passage. We propose an alternative mechanism for DNA supercoiling via nicking and closing of DNA that involves trapping, segregation and relaxation of two positive supercoils. In contrast to DNA supercoiling, ATP-dependent relaxation and decatenation of DNA by gyrase lacking the C-terminal domains require both tyrosines and strand passage. Our results point towards mechanistic plasticity of gyrase and might pave the way for finding novel and specific mechanism-based gyrase inhibitors. PMID:27557712
Prevalent and persistent viral infection in cultures of the coral algal endosymbiont Symbiodinium
NASA Astrophysics Data System (ADS)
Weynberg, Karen D.; Neave, Matthew; Clode, Peta L.; Voolstra, Christian R.; Brownlee, Christopher; Laffy, Patrick; Webster, Nicole S.; Levin, Rachel A.; Wood-Charlson, Elisha M.; van Oppen, Madeleine J. H.
2017-09-01
Reef corals are under threat from bleaching and disease outbreaks that target both the host animal and the algal symbionts within the coral holobiont. A viral origin for coral bleaching has been hypothesized, but direct evidence has remained elusive. Using a multifaceted approach incorporating flow cytometry, transmission electron microscopy, DNA and RNA virome sequencing, we show that type C1 Symbiodinium cultures host a nucleocytoplasmic large double-stranded DNA virus (NCLDV) related to Phycodnaviridae and Mimiviridae, a novel filamentous virus of unknown phylogenetic affiliation, and a single-stranded RNA virus related to retroviruses. We discuss implications of these findings for laboratory-based experiments using Symbiodinium cultures.
Tian, Jingqi; Li, Hailong; Luo, Yonglan; Wang, Lei; Zhang, Yingwei; Sun, Xuping
2011-02-01
In this Letter, we demonstrate that chemical oxidation polymerization of o-phenylenediamine (OPD) by potassium bichromate at room temperature results in the formation of submicrometer-scale poly(o-phenylenediamine) (POPD) colloids. Such colloids can absorb and quench dye-labeled single-stranded DNA (ssDNA) very effectively. In the presence of a target, a hybridization event occurs, which produces a double-stranded DNA (dsDNA) that detaches from the POPD surface, leading to recovery of dye fluorescence. With the use of an oligonucleotide (OND) sequence associated with human immunodeficiency virus (HIV) as a model system, we demonstrate the proof of concept that POPD colloid-quenched fluorescent OND can be used as a probe for fluorescence-enhanced nucleic acid detection with selectivity down to single-base mismatch.
The contribution of alu elements to mutagenic DNA double-strand break repair.
Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L
2015-03-01
Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both the rate and nature of DNA repair events.
Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.
Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng
2015-10-07
To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niyogi, S.K.; Mitra, S.
With precise conditions of digestion with single-strand-specific nucleases, namely, endonuclease S1 of Aspergillus oryzae and exonuclease I of Escherichia coli, nuclease-resistant DNA cores can be obtained reproducibly from single-stranded M13 DNA. The DNA cores are composed almost exclusively of two sizes (60 and 44 nucleotides long). These have high (G + C)-contents relative to that of intact M13 DNA, and arise from restricted regions of the M13 genome. The resistance of these fragments to single-strand-specific nucleases and their nondenaturability strongly suggest the presence of double-stranded segments in these core pieces. That the core pieces are only partially double-stranded is shownmore » by their lack of complete base complementarity and their pattern of elution from hydroxyapatite.« less
Wu, Jian; Dai, Wei; Wu, Lin; Wang, Jinke
2018-02-13
Next-generation sequencing (NGS) is fundamental to the current biological and biomedical research. Construction of sequencing library is a key step of NGS. Therefore, various library construction methods have been explored. However, the current methods are still limited by some shortcomings. This study developed a new NGS library construction method, Single strand Adaptor Library Preparation (SALP), by using a novel single strand adaptor (SSA). SSA is a double-stranded oligonucleotide with a 3' overhang of 3 random nucleotides, which can be efficiently ligated to the 3' end of single strand DNA by T4 DNA ligase. SALP can be started with any denatured DNA fragments such as those sheared by Tn5 tagmentation, enzyme digestion and sonication. When started with Tn5-tagmented chromatin, SALP can overcome a key limitation of ATAC-seq and become a high-throughput NGS library construction method, SALP-seq, which can be used to comparatively characterize the chromatin openness state of multiple cells unbiasly. In this way, this study successfully characterized the comparative chromatin openness states of four different cell lines, including GM12878, HepG2, HeLa and 293T, with SALP-seq. Similarly, this study also successfully characterized the chromatin openness states of HepG2 cells with SALP-seq by using 10 5 to 500 cells. This study developed a new NGS library construction method, SALP, by using a novel kind of single strand adaptor (SSA), which should has wide applications in the future due to its unique performance.
Zinc Chromate Induces Chromosome Instability and DNA Double Strand Breaks in Human Lung Cells
Xie, Hong; Holmes, Amie L.; Young, Jamie L.; Qin, Qin; Joyce, Kellie; Pelsue, Stephen C.; Peng, Cheng; Wise, Sandra S.; Jeevarajan, Antony S.; Wallace, William T.; Hammond, Dianne; Wise, John Pierce
2014-01-01
Hexavalent chromium Cr(VI) is a respiratory toxicant and carcinogen, with solubility playing an important role in its carcinogenic potential. Zinc chromate, a water insoluble or ‘particulate’ Cr(VI) compound, has been shown to be carcinogenic in epidemiology studies and to induce tumors in experimental animals, but its genotoxicity is poorly understood. Our study shows that zinc chromate induced concentration-dependent increases in cytotoxicity, chromosome damage and DNA double strand breaks in human lung cells. In response to zinc chromate-induced breaks, MRE11 expression was increased and ATM and ATR were phosphorylated, indicating that the DNA double strand break repair system was initiated in the cells. In addition, our data show that zinc chromate-induced double strand breaks were only observed in the G2/M phase population, with no significant amount of double strand breaks observed in G1 and S phase cells. These data will aid in understanding the mechanisms of zinc chromate toxicity and carcinogenesis. PMID:19027772
Nagarajan, Prabha; Prevost, Christopher T; Stein, Alexis; Kasimer, Rachel; Kalifa, Lidza; Sia, Elaine A
2017-06-01
The structure-specific nuclease, Rad27p/FEN1, plays a crucial role in DNA repair and replication mechanisms in the nucleus. Genetic assays using the rad27-∆ mutant have shown altered rates of DNA recombination, microsatellite instability, and point mutation in mitochondria. In this study, we examined the role of Rad27p in mitochondrial mutagenesis and double-strand break (DSB) repair in Saccharomyces cerevisiae Our findings show that Rad27p is essential for efficient mitochondrial DSB repair by a pathway that generates deletions at a region flanked by direct repeat sequences. Mutant analysis suggests that both exonuclease and endonuclease activities of Rad27p are required for its role in mitochondrial DSB repair. In addition, we found that the nuclease activities of Rad27p are required for the prevention of mitochondrial DNA (mtDNA) point mutations, and in the generation of spontaneous mtDNA rearrangements. Overall, our findings underscore the importance of Rad27p in the maintenance of mtDNA, and demonstrate that it participates in multiple DNA repair pathways in mitochondria, unlinked to nuclear phenotypes. Copyright © 2017 by the Genetics Society of America.
Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.
Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104
Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A
2016-04-28
Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.
Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.
2016-01-01
Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135
Giehr, Pascal; Walter, Jörn
2018-01-01
The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.
Holton, Nathaniel W; Andrews, Joel F; Gassman, Natalie R
2017-09-05
Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular biology techniques have clarified structure, enzymatic functions, and kinetics of repair proteins, there is still a need to understand how repair is coordinated within the nucleus. Laser micro-irradiation offers a powerful tool for inducing DNA damage and monitoring the recruitment of repair proteins. Induction of DNA damage by laser micro-irradiation can occur with a range of wavelengths, and users can reliably induce single strand breaks, base lesions and double strand breaks with a range of doses. Here, laser micro-irradiation is used to examine repair of single and double strand breaks induced by two common confocal laser wavelengths, 355 nm and 405 nm. Further, proper characterization of the applied laser dose for inducing specific damage mixtures is described, so users can reproducibly perform laser micro-irradiation data acquisition and analysis.
Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun
2015-07-08
We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.
Sequencing small genomic targets with high efficiency and extreme accuracy
Schmitt, Michael W.; Fox, Edward J.; Prindle, Marc J.; Reid-Bayliss, Kate S.; True, Lawrence D.; Radich, Jerald P.; Loeb, Lawrence A.
2015-01-01
The detection of minority variants in mixed samples demands methods for enrichment and accurate sequencing of small genomic intervals. We describe an efficient approach based on sequential rounds of hybridization with biotinylated oligonucleotides, enabling more than one-million fold enrichment of genomic regions of interest. In conjunction with error correcting double-stranded molecular tags, our approach enables the quantification of mutations in individual DNA molecules. PMID:25849638
Induction of homologous recombination in Saccharomyces cerevisiae.
Simon, J R; Moore, P D
1988-09-01
We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Savic, Velibor
2013-01-01
In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions. PMID:23882282
Unifying the DNA End-processing Roles of the Artemis Nuclease
Chang, Howard H. Y.; Watanabe, Go; Lieber, Michael R.
2015-01-01
Artemis is a member of the metallo-β-lactamase protein family of nucleases. It is essential in vertebrates because, during V(D)J recombination, the RAG complex generates hairpins when it creates the double strand breaks at V, D, and J segments, and Artemis is required to open the hairpins so that they can be joined. Artemis is a diverse endo- and exonuclease, and creating a unified model for its wide range of nuclease properties has been challenging. Here we show that Artemis resects iteratively into blunt DNA ends with an efficiency that reflects the AT-richness of the DNA end. GC-rich ends are not cut by Artemis alone because of a requirement for DNA end breathing (and confirmed using fixed pseudo-Y structures). All DNA ends are cut when both the DNA-dependent protein kinase catalytic subunit and Ku accompany Artemis but not when Ku is omitted. These are the first biochemical data demonstrating a Ku dependence of Artemis action on DNA ends of any configuration. The action of Artemis at blunt DNA ends is slower than at overhangs, consistent with a requirement for a slow DNA end breathing step preceding the cut. The AT sequence dependence, the order of strand cutting, the length of the cuts, and the Ku-dependence of Artemis action at blunt ends can be reconciled with the other nucleolytic properties of both Artemis and Artemis·DNA-PKcs in a model incorporating DNA end breathing of blunt ends to form transient single to double strand boundaries that have structural similarities to hairpins and fixed 5′ and 3′ overhangs. PMID:26276388
Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost
Benoit, Roger M.; Ostermeier, Christian; Geiser, Martin; Li, Julia Su Zhou; Widmer, Hans; Auer, Manfred
2016-01-01
Seamless cloning methods, such as co-transformation cloning, sequence- and ligation-independent cloning (SLIC) or the Gibson assembly, are essential tools for the precise construction of plasmids. The efficiency of co-transformation cloning is however low and the Gibson assembly reagents are expensive. With the aim to improve the robustness of seamless cloning experiments while keeping costs low, we examined the importance of complementary single-stranded DNA ends for co-transformation cloning and the influence of single-stranded gaps in circular plasmids on SLIC cloning efficiency. Most importantly, our data show that single-stranded gaps in double-stranded plasmids, which occur in typical SLIC protocols, can drastically decrease the efficiency at which the DNA transforms competent E. coli bacteria. Accordingly, filling-in of single-stranded gaps using DNA polymerase resulted in increased transformation efficiency. Ligation of the remaining nicks did not lead to a further increase in transformation efficiency. These findings demonstrate that highly efficient insert-plasmid assembly can be achieved by using only T5 exonuclease and Phusion DNA polymerase, without Taq DNA ligase from the original Gibson protocol, which significantly reduces the cost of the reactions. We successfully used this modified Gibson assembly protocol with two short insert-plasmid overlap regions, each counting only 15 nucleotides. PMID:27073895
Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang
2015-10-01
The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.
An improved DNA force field for ssDNA interactions with gold nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Xiankai; Huai, Ping; Fan, Chunhai
The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones “protecting” hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thusmore » the “protection” by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.« less
An improved DNA force field for ssDNA interactions with gold nanoparticles
NASA Astrophysics Data System (ADS)
Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo
2014-06-01
The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.
An improved DNA force field for ssDNA interactions with gold nanoparticles.
Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo
2014-06-21
The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.
Ends-in Vs. Ends-Out Recombination in Yeast
Hastings, P. J.; McGill, C.; Shafer, B.; Strathern, J. N.
1993-01-01
Integration of linearized plasmids into yeast chromosomes has been used as a model system for the study of recombination initiated by double-strand breaks. The linearized plasmid DNA recombines efficiently into sequences homologous to the ends of the DNA. This efficient recombination occurs both for the configuration in which the break is in a contiguous region of homology (herein called the ends-in configuration) and for ``omega'' insertions in which plasmid sequences interrupt a linear region of homology (herein called the ends-out configuration). The requirements for integration of these two configurations are expected to be different. We compared these two processes in a yeast strain containing an ends-in target and an ends-out target for the same cut plasmid. Recovery of ends-in events exceeds ends-out events by two- to threefold. Possible causes for the origin of this small bias are discussed. The lack of an extreme difference in frequency implies that cooperativity between the two ends does not contribute to the efficiency with which cut circular plasmids are integrated. This may also be true for the repair of chromosomal double-strand breaks. PMID:8307337
Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.
Charbonnel, Cyril; Gallego, Maria E; White, Charles I
2010-10-01
Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.
Synthetic transcripts of double-stranded Birnavirus genome are infectious.
Mundt, E; Vakharia, V N
1996-01-01
We have developed a system for generation of infectious bursal disease virus (IBDV), a segmented double-stranded RNA virus of the Birnaviridae family, with the use of synthetic transcripts derived from cloned cDNA. Independent full-length cDNA clones were constructed that contained the entire coding and noncoding regions of RNA segments A and B of two distinguishable IBDV strains of serotype I. Segment A encodes all of the structural (VP2, VP4, and VP3) and nonstructural (VP5) proteins, whereas segment B encodes the RNA-dependent RNA polymerase (VP1). Synthetic RNAs of both segments were produced by in vitro transcription of linearized plasmids with T7 RNA polymerase. Transfection of Vero cells with combined plus-sense transcripts of both segments generated infectious virus as early as 36 hr after transfection. The infectivity and specificity of the recovered chimeric virus was ascertained by the appearance of cytopathic effect in chicken embryo cells, by immunofluorescence staining of infected Vero cells with rabbit anti-IBDV serum, and by nucleotide sequence analysis of the recovered virus, respectively. In addition, transfectant viruses containing genetically tagged sequences in either segment A or segment B of IBDV were generated to confirm the feasibility of this system. The development of a reverse genetics system for double-stranded RNA viruses will greatly facilitate studies of the regulation of viral gene expression, pathogenesis, and design of a new generation of live vaccines. Images Fig. 2 Fig. 3 Fig. 4 PMID:8855321
Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.
Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi
2003-03-01
A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.
Prasinoviruses reveal a complex evolutionary history and a patchy environmental distribution
NASA Astrophysics Data System (ADS)
Finke, J. F.; Suttle, C.
2016-02-01
Prasinophytes constitute a group of eukaryotic phytoplankton that has a global distribution and is a major component of coastal and oceanic communities. Members of this group are infected by large double-stranded DNA viruses that can be significant agents of mortality, and which show evidence of substantial horizontal transfer of genes from their hosts and other organisms. However, information on the genetic diversity of these viruses and their environmental distribution is limited. This study examines the genetic repertoire, phylogeny and environmental distribution of large double-stranded DNA viruses infecting Micromonas pusilla and other prasinophytes. The genomes of viruses infecting M. pusilla were sequenced and compared to those of viruses infecting other prasinophytes, revealing a relatively small set of core genes and a larger flexible pan genome. Comparing genomes among prasinoviruses highlights their variable genetic content and complex evolutionary history. While some of the pan genome is clearly host derived, many open reading frames are most similar to those found in other eukaryotes and bacteria. Gene content of the viruses is is congruent with phylogenetic analysis of viral DNA polymerase sequences and indicates that two clades of M. pusilla viruses are less related to each other than to other prasinoviruses. Moreover, the environmental distribution of prasinovirus DNA polymerase sequences indicates a complex pattern of virus-host interactions in nature. Ultimately, these patterns are influenced by the genetic repertoire encoded by prasinoviruses, and the distribution of the hosts they infect.
Wang, Yan; Xu, Chang; Du, Li Qing; Cao, Jia; Liu, Jian Xiang; Su, Xu; Zhao, Hui; Fan, Fei-Yue; Wang, Bing; Katsube, Takanori; Fan, Sai Jun; Liu, Qiang
2013-01-01
Dose- and time-response curves were combined to assess the potential of the comet assay in radiation biodosimetry. The neutral comet assay was used to detect DNA double-strand breaks in lymphocytes caused by γ-ray irradiation. A clear dose-response relationship with DNA double-strand breaks using the comet assay was found at different times after irradiation (p < 0.001). A time-response relationship was also found within 72 h after irradiation (p < 0.001). The curves for DNA double-strand breaks and DNA repair in vitro of human lymphocytes presented a nice model, and a smooth, three-dimensional plane model was obtained when the two curves were combined. PMID:24240807
Inhibition of APOBEC3G activity impedes double-stranded DNA repair.
Prabhu, Ponnandy; Shandilya, Shivender M D; Britan-Rosich, Elena; Nagler, Adi; Schiffer, Celia A; Kotler, Moshe
2016-01-01
The cellular cytidine deaminase APOBEC3G (A3G) was first described as an anti-HIV-1 restriction factor, acting by directly deaminating reverse transcripts of the viral genome. HIV-1 Vif neutralizes the activity of A3G, primarily by mediating degradation of A3G to establish effective infection in host target cells. Lymphoma cells, which express high amounts of A3G, can restrict Vif-deficient HIV-1. Interestingly, these cells are more stable in the face of treatments that result in double-stranded DNA damage, such as ionizing radiation and chemotherapies. Previously, we showed that the Vif-derived peptide (Vif25-39) efficiently inhibits A3G deamination, and increases the sensitivity of lymphoma cells to ionizing radiation. In the current study, we show that additional peptides derived from Vif, A3G, and APOBEC3F, which contain the LYYF motif, inhibit deamination activity. Each residue in the Vif25-39 sequence moderately contributes to the inhibitory effect, whereas replacing a single residue in the LYYF motif completely abrogates inhibition of deamination. Treatment of A3G-expressing lymphoma cells exposed to ionizing radiation with the new inhibitory peptides reduces double-strand break repair after irradiation. Incubation of cultured irradiated lymphoma cells with peptides that inhibit double-strand break repair halts their propagation. These results suggest that A3G may be a potential therapeutic target that is amenable to peptide and peptidomimetic inhibition. © 2015 FEBS.
Vogel, Stefanie; Rackwitz, Jenny; Schürman, Robin; Prinz, Julia; Milosavljević, Aleksandar R; Réfrégiers, Matthieu; Giuliani, Alexandre; Bald, Ilko
2015-11-19
We have characterized ultraviolet (UV) photon-induced DNA strand break processes by determination of absolute cross sections for photoabsorption and for sequence-specific DNA single strand breakage induced by photons in an energy range from 6.50 to 8.94 eV. These represent the lowest-energy photons able to induce DNA strand breaks. Oligonucleotide targets are immobilized on a UV transparent substrate in controlled quantities through attachment to DNA origami templates. Photon-induced dissociation of single DNA strands is visualized and quantified using atomic force microscopy. The obtained quantum yields for strand breakage vary between 0.06 and 0.5, indicating highly efficient DNA strand breakage by UV photons, which is clearly dependent on the photon energy. Above the ionization threshold strand breakage becomes clearly the dominant form of DNA radiation damage, which is then also dependent on the nucleotide sequence.
Browning, Cynthia L; Qin, Qin; Kelly, Deborah F; Prakash, Rohit; Vanoli, Fabio; Jasin, Maria; Wise, John Pierce
2016-09-01
Genomic instability is one of the primary models of carcinogenesis and a feature of almost all cancers. Homologous recombination (HR) repair protects against genomic instability by maintaining high genomic fidelity during the repair of DNA double strand breaks. The defining step of HR repair is the formation of the Rad51 nucleofilament, which facilitates the search for a homologous sequence and invasion of the template DNA strand. Particulate hexavalent chromium (Cr(VI)), a human lung carcinogen, induces DNA double strand breaks and chromosome instability. Since the loss of HR repair increases Cr(VI)-induced chromosome instability, we investigated the effect of extended Cr(VI) exposure on HR repair. We show acute (24 h) Cr(VI) exposure induces a normal HR repair response. In contrast, prolonged (120 h) exposure to particulate Cr(VI) inhibited HR repair and Rad51 nucleofilament formation. Prolonged Cr(VI) exposure had a profound effect on Rad51, evidenced by reduced protein levels and Rad51 mislocalization to the cytoplasm. The response of proteins involved in Rad51 nuclear import and nucleofilament formation displayed varying responses to prolonged Cr(VI) exposure. BRCA2 formed nuclear foci after prolonged Cr(VI) exposure, while Rad51C foci formation was suppressed. These results suggest that particulate Cr(VI), a major chemical carcinogen, inhibits HR repair by targeting Rad51, causing DNA double strand breaks to be repaired by a low fidelity, Rad51-independent repair pathway. These results further enhance our understanding of the underlying mechanism of Cr(VI)-induced chromosome instability and thus, carcinogenesis. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N.
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures. PMID:23285245
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures.
Manthey, Glenn M.; Naik, Nilan; Bailis, Adam M.
2009-01-01
Chromosomal translocations are frequently observed in cells exposed to agents that cause DNA double-strand breaks (DSBs), such as ionizing radiation and chemotherapeutic drugs, and are often associated with tumors in mammals. Recently, translocation formation in the budding yeast, Saccharomyces cerevisiae, has been found to occur at high frequencies following the creation of multiple DSBs adjacent to repetitive sequences on non-homologous chromosomes. The genetic control of translocation formation and the chromosome complements of the clones that contain translocations suggest that translocation formation occurs by single-strand annealing (SSA). Among the factors important for translocation formation by SSA is the central mismatch repair (MMR) and homologous recombination (HR) factor, Msh2. Here we describe the effects of several msh2 missense mutations on translocation formation that suggest that Msh2 has separable functions in stabilizing annealed single strands, and removing non-homologous sequences from their ends. Additionally, interactions between the msh2 alleles and a null allele of RAD1, which encodes a subunit of a nuclease critical for the removal of non-homologous tails suggest that Msh2 blocks an alternative mechanism for removing these sequences. These results suggest that Msh2 plays multiple roles in the formation of chromosomal translocations following acute levels of DNA damage. PMID:19834615
Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le
2014-01-10
A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346
Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R.; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard
2006-01-01
We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment. PMID:16473909
Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard
2006-05-15
We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.
Ahour, F; Shamsi, A
2017-09-01
Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11 M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.
Structure of an XPF endonuclease with and without DNA suggests a model for substrate recognition
Newman, Matthew; Murray-Rust, Judith; Lally, John; Rudolf, Jana; Fadden, Andrew; Knowles, Philip P; White, Malcolm F; McDonald, Neil Q
2005-01-01
The XPF/Mus81 structure-specific endonucleases cleave double-stranded DNA (dsDNA) within asymmetric branched DNA substrates and play an essential role in nucleotide excision repair, recombination and genome integrity. We report the structure of an archaeal XPF homodimer alone and bound to dsDNA. Superposition of these structures reveals a large domain movement upon binding DNA, indicating how the (HhH)2 domain and the nuclease domain are coupled to allow the recognition of double-stranded/single-stranded DNA junctions. We identify two nonequivalent DNA-binding sites and propose a model in which XPF distorts the 3′ flap substrate in order to engage both binding sites and promote strand cleavage. The model rationalises published biochemical data and implies a novel role for the ERCC1 subunit of eukaryotic XPF complexes. PMID:15719018
A critical role for topoisomerase IIb and DNA double strand breaks in transcription
Calderwood, Stuart K.
2016-01-01
ABSTRACT Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb. PMID:27100743
A critical role for topoisomerase IIb and DNA double strand breaks in transcription.
Calderwood, Stuart K
2016-05-26
Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.
Stacked-unstacked equilibrium at the nick site of DNA.
Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D
2004-09-17
Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.
Mechanism of Microhomology-Mediated End-Joining Promoted by Human DNA Polymerase Theta
Kent, Tatiana; Chandramouly, Gurushankar; McDevitt, Shane Michael; Ozdemir, Ahmet Y.; Pomerantz, Richard T.
2014-01-01
Microhomology-mediated end-joining (MMEJ) is an error-prone alternative double-strand break repair pathway that utilizes sequence microhomology to recombine broken DNA. Although MMEJ is implicated in cancer development, the mechanism of this pathway is unknown. We demonstrate that purified human DNA polymerase θ (Polθ) performs MMEJ of DNA containing 3’ single-strand DNA overhangs with two or more base-pairs of homology, including DNA modeled after telomeres, and show that MMEJ is dependent on Polθ in human cells. Our data support a mechanism whereby Polθ facilitates end-joining and microhomology annealing then utilizes the opposing overhang as a template in trans which stabilizes the DNA synapse. Polθ exhibits a preference for DNA containing a 5’-terminal phosphate, similar to polymerases involved in non-homologous end-joining. Lastly, we identify a conserved loop domain that is essential for MMEJ and higher-order structures of Polθ which likely promote DNA synapse formation. PMID:25643323
Craig, R K; Hall, L; Parker, D; Campbell, P N
1981-01-01
A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038
Molas, M; Bartrons, R; Perales, J C
2002-08-15
Nonviral gene transfer vectors have been actively studied in the past years in order to obtain structural entities with minimum size and defined shape. The final size of a gene transfer vector, which is compacted into unimolecular complexes, is directly proportional to the mass of the nucleic acid to be compacted. Thus, the purpose of this study was to assess the possibility of producing ssDNA vectors and their biophysical and biological characterization. We have obtained ssDNA/poly-L-lysine complexes that are significantly smaller than their double-stranded counterparts. We have also identified a lesser aggregative behavior of compacted single-stranded vs. double-stranded DNA vectors in the presence of physiological NaCl concentrations. Expression of compacted ssDNA is observed in hepatoma cell lines. Moreover, we have successfully delivered galactosylated ssDNA complexes into cells that express the asialoglycoprotein receptor via receptor-mediated endocytosis. The reduced size and biophysical behavior of ssDNA vectors may provide an advantage for transfection of eukaryotic cells.
Fadrosh, Douglas W.; Andrews-Pfannkoch, Cynthia; Williamson, Shannon J.
2011-01-01
Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community’s genetic signature. Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography. PMID:21989424
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chojnowski, Grzegorz, E-mail: gchojnowski@genesilico.pl; Waleń, Tomasz; University of Warsaw, Banacha 2, 02-097 Warsaw
2015-03-01
A computer program that builds crystal structure models of nucleic acid molecules is presented. Brickworx is a computer program that builds crystal structure models of nucleic acid molecules using recurrent motifs including double-stranded helices. In a first step, the program searches for electron-density peaks that may correspond to phosphate groups; it may also take into account phosphate-group positions provided by the user. Subsequently, comparing the three-dimensional patterns of the P atoms with a database of nucleic acid fragments, it finds the matching positions of the double-stranded helical motifs (A-RNA or B-DNA) in the unit cell. If the target structure ismore » RNA, the helical fragments are further extended with recurrent RNA motifs from a fragment library that contains single-stranded segments. Finally, the matched motifs are merged and refined in real space to find the most likely conformations, including a fit of the sequence to the electron-density map. The Brickworx program is available for download and as a web server at http://iimcb.genesilico.pl/brickworx.« less
Previsani, N; Fontana, S; Hirt, B; Beard, P
1997-10-01
Two murine parvoviruses with genomic sequences differing only in 33 nucleotides (8 amino acids) in the region coding for the capsid proteins show different host cell specificities: MVMi grows in EL4 T lymphocytes and MVMp3 grows in A9 fibroblasts. In this study we compared the courses of infections with these two viruses in EL4 cells in order to investigate at which step(s) the infection process of MVMp3 is interrupted. The two viruses bound equally well to EL4 cells, and similar amounts of MVMi and MVMp3 input virion DNA appeared in the nuclear fractions of EL4 cells 1 h after infection. However, double-stranded replicative-form (RF) DNA of the two viruses appeared at different times, at 10 h postinfection with MVMi and at 24 h postinfection with MVMp3. The amount of MVMp3 RF DNA detected at 24 h was very small because it was produced only in a tiny subset of the population of EL4 cells that proved to be permissive for MVMp3. Replication of double-stranded viral DNA in EL4 cells was measured after transfection of purified RF DNA, cloned viral DNA, and cloned viral DNA with a mutation preventing synthesis of the capsid proteins. In each of these cases, DNA replication was comparable for MVMi and MVMp3. Production of virus particles also appeared to be similar after transfection of the two types of RF DNA into EL4 cells. Conversion of incoming 32P-labeled single-stranded MVM DNA to 32P-labeled double-stranded RF DNA was detected only after RF DNA amplification, indicating that few molecules serve as templates for viral DNA amplification. We showed that extracts of EL4 cells contain a factor which can destabilize MVMi virions but not MVMp3 by testing the sensitivity of viral DNA to DNase and by CsCl gradient analyses of viral particles. We therefore conclude that the MVMp3 life cycle is arrested after the transport of virions to the nucleus and prior to the replication of RF DNA, most likely at the stage of viral decapsidation.
Solid phase sequencing of double-stranded nucleic acids
Fu, Dong-Jing; Cantor, Charles R.; Koster, Hubert; Smith, Cassandra L.
2002-01-01
This invention relates to methods for detecting and sequencing of target double-stranded nucleic acid sequences, to nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probe comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include nucleic acids in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated determination of molecular weights and identification of the target sequence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vanderschans, G.P.; Vanrijn, C.J.S.; Bleichrodt, J.F.
1975-11-01
When an aqueous solution of double-stranded deoxyribonucleic acid (DNA) of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma rays, radiation induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA most of the phenylalanine radicals bound are nonlethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. Theremore » are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules. (Author) (GRA)« less
Continuous in vitro evolution of bacteriophage RNA polymerase promoters
NASA Technical Reports Server (NTRS)
Breaker, R. R.; Banerji, A.; Joyce, G. F.
1994-01-01
Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.
Yoshida, Mitsuhiro; Mochizuki, Tomohiro; Urayama, Syun-Ichi; Yoshida-Takashima, Yukari; Nishi, Shinro; Hirai, Miho; Nomaki, Hidetaka; Takaki, Yoshihiro; Nunoura, Takuro; Takai, Ken
2018-01-01
Previous studies on marine environmental virology have primarily focused on double-stranded DNA (dsDNA) viruses; however, it has recently been suggested that single-stranded DNA (ssDNA) viruses are more abundant in marine ecosystems. In this study, we performed a quantitative viral community DNA analysis to estimate the relative abundance and composition of both ssDNA and dsDNA viruses in offshore upper bathyal sediment from Tohoku, Japan (water depth = 500 m). The estimated dsDNA viral abundance ranged from 3 × 106 to 5 × 106 genome copies per cm3 sediment, showing values similar to the range of fluorescence-based direct virus counts. In contrast, the estimated ssDNA viral abundance ranged from 1 × 108 to 3 × 109 genome copies per cm3 sediment, thus providing an estimation that the ssDNA viral populations represent 96.3–99.8% of the benthic total DNA viral assemblages. In the ssDNA viral metagenome, most of the identified viral sequences were associated with ssDNA viral families such as Circoviridae and Microviridae. The principle components analysis of the ssDNA viral sequence components from the sedimentary ssDNA viral metagenomic libraries found that the different depth viral communities at the study site all exhibited similar profiles compared with deep-sea sediment ones at other reference sites. Our results suggested that deep-sea benthic ssDNA viruses have been significantly underestimated by conventional direct virus counts and that their contributions to deep-sea benthic microbial mortality and geochemical cycles should be further addressed by such a new quantitative approach. PMID:29467725
The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F
2015-05-15
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Alternative polyadenylation of the gene transcripts encoding a rat DNA polymerase beta.
Konopiński, R; Nowak, R; Siedlecki, J A
1996-10-17
Rat cells produce two different transcripts of DNA polymerase beta (beta-Pol). The low-molecular-weight transcript (1.4 kb) was already sequenced. We report here the cloning and sequencing of the full-length cDNA, corresponding to the high-molecular-weight (HMW) transcript (4.0 kb) of beta-Pol. Sequence data strongly suggest that both transcripts are produced from a single gene by alternative polyadenylation. The HMW transcript contains the entire 1.4 kb transcript sequence and additional 2.2 kb on the 3' end. The 3' UTR of the HMW transcript contains some regulatory sequences which are not present in the 1.4-kb transcript. The A + U-rich fragment and (GU)21 sequence are believed to influence the stability of the mRNA. The functional significance of the A-rich region locally destabilizing double-stranded secondary structure remains unknown.
Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao
2017-05-19
A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.
ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.
Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A
2017-10-05
Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).
Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo
2016-02-02
The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.
Moktar, Afsoon; Ravoori, Srivani; Vadhanam, Manicka V; Gairola, C Gary; Gupta, Ramesh C
2009-12-01
Human papillomavirus (HPV) is the causative factor in the development and progression of cervical cancers in >97% of the cases, although insufficient. Epidemiological studies suggest an elevated risk of cervical cancer for cigarette smokers; therefore, we examined cigarette smoke-induced DNA damage and repair in HPV16-transformed human ectocervical cells (ECT1/E6 E7). Cells were treated with cigarette smoke condensate (CSC) for 72 h to assess the formation of single- and double-strand DNA breaks, measured by alkaline and neutral single cell gel electrophoresis assays, respectively. The mean tail length of cells with single-strand breaks was increased by 1.8-, 2.7- and 3.7-fold (p<0.001) after treatment with 4, 8 and 12 microg/ml CSC, respectively. The tail length with double-strand breaks was also increased dose-dependently. These results were further supported by measurement of the mean tail moment: the increase in both single- and double-strand breaks were much more pronounced with increasing concentration of CSC, by up to 23.5-fold (p<0.0001 for both assays). To examine the DNA repair, cells were treated with CSC for 72 h, followed by CSC withdrawal and re-incubation of the cells with fresh medium for 24, 48, or 72 h. Both single- and double-strand DNA breaks were removed during the initial 24 h but no further removal of the damage was observed. Up to 80% of residual single- and double-strand DNA breaks (p<0.05) were found to persist at all CSC concentrations examined. Ellagic acid, a known antioxidant and free-radical scavenger, was found to significantly inhibit DNA breaks induced by CSC. Thus, free radicals may be a plausible source of CSC-induced DNA damage. These data show that CSC-mediated DNA strand breaks are highly persistent, and suggest that persistence of cigarette smoke-associated DNA damage in the presence of HPV infection may lead to increased mutations in cervical cells and ultimately higher cancer risk.
Equilibrious Strand Exchange Promoted by DNA Conformational Switching
NASA Astrophysics Data System (ADS)
Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang
2013-01-01
Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.
Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim
2016-04-01
The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.
Potential in vivo roles of nucleic acid triple-helices
Buske, Fabian A
2011-01-01
The ability of double-stranded DNA to form a triple-helical structure by hydrogen bonding with a third strand is well established, but the biological functions of these structures remain largely unknown. There is considerable albeit circumstantial evidence for the existence of nucleic triplexes in vivo and their potential participation in a variety of biological processes including chromatin organization, DNA repair, transcriptional regulation and RNA processing has been investigated in a number of studies to date. There is also a range of possible mechanisms to regulate triplex formation through differential expression of triplex-forming RNAs, alteration of chromatin accessibility, sequence unwinding and nucleotide modifications. With the advent of next generation sequencing technology combined with targeted approaches to isolate triplexes, it is now possible to survey triplex formation with respect to their genomic context, abundance and dynamical changes during differentiation and development, which may open up new vistas in understanding genome biology and gene regulation. PMID:21525785
Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells.
Ju, Young Seok; Tubio, Jose M C; Mifsud, William; Fu, Beiyuan; Davies, Helen R; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J; Tan, Benita K T; Aparicio, Samuel; Span, Paul N; Martens, John W M; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Myklebost, Ola; Flanagan, Adrienne M; Foster, Christopher; Neal, David E; Cooper, Colin; Eeles, Rosalind; Bova, Steven G; Lakhani, Sunil R; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L; Purdie, Colin A; Thompson, Alastair M; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J; Stratton, Michael R
2015-06-01
Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. © 2015 Ju et al.; Published by Cold Spring Harbor Laboratory Press.
Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells
Ju, Young Seok; Tubio, Jose M.C.; Mifsud, William; Fu, Beiyuan; Davies, Helen R.; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S.; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R.; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J.; Tan, Benita K.T.; Aparicio, Samuel; Span, Paul N.; Martens, John W.M.; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Flanagan, Adrienne M.; Foster, Christopher; Neal, David E.; Cooper, Colin; Eeles, Rosalind; Lakhani, Sunil R.; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L.; Purdie, Colin A.; Thompson, Alastair M.; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J.; Stratton, Michael R.
2015-01-01
Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. PMID:25963125
Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong
2014-11-21
By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.
Moving beyond Watson-Crick models of coarse grained DNA dynamics.
Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D
2011-11-28
DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.
Melting of DNA double strand after binding to geroprotective tetrapeptide.
Khavinson, V Kh; Solovyov, A Yu; Shataeva, L K
2008-11-01
Experimental relationship between the hyperchromic effect of DNA [poly(dA-dT):poly(dA-dT)] interacting with Ala-Glu-Asp-Gly peptide is presented by a saturation isotherm. The free DNA double strand is melting (the strands separate) at 69.5 degrees C and at higher energy expenditures (enthalpy increase by 976.4 kJ/mol b.p.) in comparison with melting of the DNA-peptide complex (28 degrees C and 444.6 kJ/mol b.p.). The detected regularities of melting of duplex DNA and the thermodynamic parameters of this process indicate the natural mechanism of interaction between DNA and regulatory peptides underlying functioning of the living matter.
Portin, P; Rantanen, M
2000-01-01
Analysis of the interchromosomal effects of In(2L + 2R)Cy, In(3L + 3R)LVM and their joint effect on the frequencies of single and double crossovers in the cv-v-f region of the X chromosome as well as interference showed that both inversions, occurring separately, increased the frequency of single as well as double crossovers and the coefficient of coincidence. However, when the inversions occurred together the frequencies of single crossovers no longer increased, but the frequency of double crossovers, as well as the coefficient of coincidence did increase. These results indicate firstly that the interchromosomal effects influence some precondition of exchange, but that this precondition is not an occurrence of double strand DNA breaks. Thus, the occurrence of double strand DNA breaks is not the sole condition for crossing over in Drosophila melanogaster.
Zhou, Qian; Lin, Youxiu; Lin, Yuping; Wei, Qiaohua; Chen, Guonan; Tang, Dianping
2016-01-01
Biomolecular immobilization and construction of the sensing platform are usually crucial for the successful development of a high-efficiency detection system. Herein we report on a novel and label-free signal-amplified aptasensing for sensitive electrochemical detection of small molecules (adenosine triphosphate, ATP, used in this case) by coupling with target-induced hybridization chain reaction (HCR) and the assembly of electroactive silver nanotags. The system mainly consisted of two alternating hairpin probes, a partial-pairing trigger-aptamer duplex DNA and a capture probe immobilized on the electrode. Upon target ATP introduction, the analyte attacked the aptamer and released the trigger DNA, which was captured by capture DNA immobilized on the electrode to form a newly partial-pairing double-stranded DNA. Thereafter, the exposed domain at trigger DNA could be utilized as the initator strand to open the hairpin probes in sequence, and propagated a chain reaction of hybridization events between two alternating hairpins to form a long nicked double-helix. The electrochemical signal derived from the assembled silver nanotags on the nicked double-helix. Under optimal conditions, the electrochemical aptasensor could exhibit a high sensitivity and a low detection limit, and allowed the detection of ATP at a concentration as low as 0.03 pM. Our design showed a high selectivity for target ATP against its analogs because of the high-specificity ATP-aptamer reaction, and its applicable for monitoring ATP in the spiking serum samples. Improtantly, the distinct advantages of the developed aptasensor make it hold a great potential for the development of simple and robust sensing strategies for the detection of other small molecules by controlling the apatmer sequence. Copyright © 2015 Elsevier B.V. All rights reserved.
Click nucleic acid ligation: applications in biology and nanotechnology.
El-Sagheer, Afaf H; Brown, Tom
2012-08-21
Biochemical strategies that use a combination of synthetic oligonucleotides, thermostable DNA polymerases, and DNA ligases can produce large DNA constructs up to 1 megabase in length. Although these ambitious targets are feasible biochemically, comparable technologies for the chemical synthesis of long DNA strands lag far behind. The best available chemical approach is the solid-phase phosphoramidite method, which can be used to assemble DNA strands up to 150 bases in length. Beyond this point, deficiencies in the chemistry make it impossible to produce pure DNA. A possible alternative approach to the chemical synthesis of large DNA strands is to join together carefully purified synthetic oligonucleotides by chemical methods. Click ligation by the copper-catalyzed azide-alkyne (CuAAC) reaction could facilitate this process. In this Account, we describe the synthesis, characterization, and applications of oligonucleotides prepared by click ligation. The alkyne and azide oligonucleotide strands can be prepared by standard protocols, and the ligation reaction is compatible with a wide range of chemical modifications to DNA and RNA. We have employed click ligation to synthesize DNA constructs up to 300 bases in length and much longer sequences are feasible. When the resulting triazole linkage is placed in a PCR template, various DNA polymerases correctly copy the entire base sequence. We have also successfully demonstrated both in vitro transcription and rolling circle amplification through the modified linkage. This linkage has shown in vivo biocompatibility: an antibiotic resistance gene containing triazole linkages functions in E. coli . Using click ligation, we have synthesized hairpin ribozymes up to 100 nucleotides in length and a hammerhead ribozyme with the triazole linkage located at the substrate cleavage site. At the opposite end of the length scale, click-ligated, cyclic mini-DNA duplexes have been used as models to study base pairing. Cyclic duplexes have potential therapeutic applications. They have extremely high thermodynamic stability, have increased resistance to enzymatic degradation, and have been investigated as decoys for regulatory proteins. For potential nanotechnology applications, we have synthesized double stranded DNA catenanes by click ligation. Other researchers have studied covalently fixed multistranded DNA constructs including triplexes and quadruplexes.
New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.
Lama, Lodoe; Seidl, Christine I; Ryan, Kevin
2014-01-01
Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.
Genomic and chromatin features shaping meiotic double-strand break formation and repair in mice
Jasin, Maria; Lange, Julian
2017-01-01
ABSTRACT The SPO11-generated DNA double-strand breaks (DSBs) that initiate meiotic recombination occur non-randomly across genomes, but mechanisms shaping their distribution and repair remain incompletely understood. Here, we expand on recent studies of nucleotide-resolution DSB maps in mouse spermatocytes. We find that trimethylation of histone H3 lysine 36 around DSB hotspots is highly correlated, both spatially and quantitatively, with trimethylation of H3 lysine 4, consistent with coordinated formation and action of both PRDM9-dependent histone modifications. In contrast, the DSB-responsive kinase ATM contributes independently of PRDM9 to controlling hotspot activity, and combined action of ATM and PRDM9 can explain nearly two-thirds of the variation in DSB frequency between hotspots. DSBs were modestly underrepresented in most repetitive sequences such as segmental duplications and transposons. Nonetheless, numerous DSBs form within repetitive sequences in each meiosis and some classes of repeats are preferentially targeted. Implications of these findings are discussed for evolution of PRDM9 and its role in hybrid strain sterility in mice. Finally, we document the relationship between mouse strain-specific DNA sequence variants within PRDM9 recognition motifs and attendant differences in recombination outcomes. Our results provide further insights into the complex web of factors that influence meiotic recombination patterns. PMID:28820351
NASA Astrophysics Data System (ADS)
Upadhyaya, Anurag; Nath, Shesh; Kumar, Sanjay
2018-06-01
DNA intra-strand cross-link (ICL) agents are widely used in the treatment of cancer. ICLs are thought to form a link between the same strand (intra-strand) or complimentary strand (inter-strand) and thereby increase the stability of DNA, which forbids the processes like replication and transcription. As a result, cell death occurs. In this work, we have studied the enhanced stability of a double stranded DNA in the presence of ICLs and compared our findings with the results obtained in the absence of these links. Using atomistic simulations with explicit solvent, a force is applied along and perpendicular to the direction of the helix and we measured the rupture force and the unzipping force of DNA-ICL complexes. Our results show that the rupture and the unzipping forces increase significantly in the presence of these links. The ICLs bind to the minor groove of DNA, which enhance the DNA stabilisation. Such information may be used to design alternative drugs that can stall replication and transcription that are critical to a growing number of anticancer drug discovery efforts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.
1982-12-01
Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-daltonmore » DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.« less
Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.
Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J
2011-01-21
In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.
Pannunzio, Nicholas R; Lieber, Michael R
2017-12-07
DNA double-strand breaks (DSBs) occurring within fragile zones of less than 200 base pairs account for the formation of the most common human chromosomal translocations in lymphoid malignancies, yet the mechanism of how breaks occur remains unknown. Here, we have transferred human fragile zones into S. cerevisiae in the context of a genetic assay to understand the mechanism leading to DSBs at these sites. Our findings indicate that a combination of factors is required to sensitize these regions. Foremost, DNA strand separation by transcription or increased torsional stress can expose these DNA regions to damage from either the expression of human AID or increased oxidative stress. This damage causes DNA lesions that, if not repaired quickly, are prone to nuclease cleavage, resulting in DSBs. Our results provide mechanistic insight into why human neoplastic translocation fragile DNA sequences are more prone to enzymes or agents that cause longer-lived DNA lesions. Copyright © 2017 Elsevier Inc. All rights reserved.
Double-strand break repair processes drive evolution of the mitochondrial genome in Arabidopsis.
Davila, Jaime I; Arrieta-Montiel, Maria P; Wamboldt, Yashitola; Cao, Jun; Hagmann, Joerg; Shedge, Vikas; Xu, Ying-Zhi; Weigel, Detlef; Mackenzie, Sally A
2011-09-27
The mitochondrial genome of higher plants is unusually dynamic, with recombination and nonhomologous end-joining (NHEJ) activities producing variability in size and organization. Plant mitochondrial DNA also generally displays much lower nucleotide substitution rates than mammalian or yeast systems. Arabidopsis displays these features and expedites characterization of the mitochondrial recombination surveillance gene MSH1 (MutS 1 homolog), lending itself to detailed study of de novo mitochondrial genome activity. In the present study, we investigated the underlying basis for unusual plant features as they contribute to rapid mitochondrial genome evolution. We obtained evidence of double-strand break (DSB) repair, including NHEJ, sequence deletions and mitochondrial asymmetric recombination activity in Arabidopsis wild-type and msh1 mutants on the basis of data generated by Illumina deep sequencing and confirmed by DNA gel blot analysis. On a larger scale, with mitochondrial comparisons across 72 Arabidopsis ecotypes, similar evidence of DSB repair activity differentiated ecotypes. Forty-seven repeat pairs were active in DNA exchange in the msh1 mutant. Recombination sites showed asymmetrical DNA exchange within lengths of 50- to 556-bp sharing sequence identity as low as 85%. De novo asymmetrical recombination involved heteroduplex formation, gene conversion and mismatch repair activities. Substoichiometric shifting by asymmetrical exchange created the appearance of rapid sequence gain and loss in association with particular repeat classes. Extensive mitochondrial genomic variation within a single plant species derives largely from DSB activity and its repair. Observed gene conversion and mismatch repair activity contribute to the low nucleotide substitution rates seen in these genomes. On a phenotypic level, these patterns of rearrangement likely contribute to the reproductive versatility of higher plants.
Real-time study of a DNA strand displacement reaction using dual polarization interferometry.
Xu, Pingping; Huang, Fujian; Liang, Haojun
2013-03-15
A DNA strand displacement reaction on a solid-liquid interface was investigated using dual polarization interferometry. This effective analytical technique allows the real-time, simultaneous determination of the thickness, density, and mass of a biological layer. The displacement process was examined, and the changes in thickness, density, and mass were determined. Injection of the displacement DNA resulted in an increase in density and a decrease in mass and thickness, which indicated that a portion of the target DNA was displaced from the double-stranded DNA (dsDNA). The effects of the displacement DNA concentration and toehold length on the displacement efficiency were also examined. Increasing the displacement DNA concentration and the toehold length increased the changes in mass and the displacement efficiency. At the concentration of 0.2 μM, the toeholds with 4, 5, 6, and 7 bases had displacement percentages of 24.54%, 25.99%, 30.16%, and 70.41%, respectively. At displacement DNA concentrations exceeding that of the dsDNA, the displacement percentage was not concentration-dependent. Above a certain concentration, the percentage remained stable with increasing concentration. Comparison using different toehold sequences showed that the displacement efficiency increases with increasing bonding force between the base pairs. Copyright © 2012. Published by Elsevier B.V.
Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Cornière, Axelle; Takahashi, Masayuki; Nordén, Bengt
2012-06-01
Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.
Adelman, K; Salmon, B; Baines, J D
2001-03-13
The product of the herpes simplex virus type 1 U(L)28 gene is essential for cleavage of concatemeric viral DNA into genome-length units and packaging of this DNA into viral procapsids. To address the role of U(L)28 in this process, purified U(L)28 protein was assayed for the ability to recognize conserved herpesvirus DNA packaging sequences. We report that DNA fragments containing the pac1 DNA packaging motif can be induced by heat treatment to adopt novel DNA conformations that migrate faster than the corresponding duplex in nondenaturing gels. Surprisingly, these novel DNA structures are high-affinity substrates for U(L)28 protein binding, whereas double-stranded DNA of identical sequence composition is not recognized by U(L)28 protein. We demonstrate that only one strand of the pac1 motif is responsible for the formation of novel DNA structures that are bound tightly and specifically by U(L)28 protein. To determine the relevance of the observed U(L)28 protein-pac1 interaction to the cleavage and packaging process, we have analyzed the binding affinity of U(L)28 protein for pac1 mutants previously shown to be deficient in cleavage and packaging in vivo. Each of the pac1 mutants exhibited a decrease in DNA binding by U(L)28 protein that correlated directly with the reported reduction in cleavage and packaging efficiency, thereby supporting a role for the U(L)28 protein-pac1 interaction in vivo. These data therefore suggest that the formation of novel DNA structures by the pac1 motif confers added specificity on recognition of DNA packaging sequences by the U(L)28-encoded component of the herpesvirus cleavage and packaging machinery.
Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K
2017-05-23
A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Havert, Michael B.; Ji, Lin; Loeb, Daniel D.
2002-01-01
The synthesis of the hepadnavirus relaxed circular DNA genome requires two template switches, primer translocation and circularization, during plus-strand DNA synthesis. Repeated sequences serve as donor and acceptor templates for these template switches, with direct repeat 1 (DR1) and DR2 for primer translocation and 5′r and 3′r for circularization. These donor and acceptor sequences are at, or near, the ends of the minus-strand DNA. Analysis of plus-strand DNA synthesis of duck hepatitis B virus (DHBV) has indicated that there are at least three other cis-acting sequences that make contributions during the synthesis of relaxed circular DNA. These sequences, 5E, M, and 3E, are located near the 5′ end, the middle, and the 3′ end of minus-strand DNA, respectively. The mechanism by which these sequences contribute to the synthesis of plus-strand DNA was unclear. Our aim was to better understand the mechanism by which 5E and M act. We localized the DHBV 5E element to a short sequence of approximately 30 nucleotides that is 100 nucleotides 3′ of DR2 on minus-strand DNA. We found that the new 5E mutants were partially defective for primer translocation/utilization at DR2. They were also invariably defective for circularization. In addition, examination of several new DHBV M variants indicated that they too were defective for primer translocation/utilization and circularization. Thus, this analysis indicated that 5E and M play roles in both primer translocation/utilization and circularization. In conjunction with earlier findings that 3E functions in both template switches, our findings indicate that the processes of primer translocation and circularization share a common underlying mechanism. PMID:11861843
GENESUS: a two-step sequence design program for DNA nanostructure self-assembly.
Tsutsumi, Takanobu; Asakawa, Takeshi; Kanegami, Akemi; Okada, Takao; Tahira, Tomoko; Hayashi, Kenshi
2014-01-01
DNA has been recognized as an ideal material for bottom-up construction of nanometer scale structures by self-assembly. The generation of sequences optimized for unique self-assembly (GENESUS) program reported here is a straightforward method for generating sets of strand sequences optimized for self-assembly of arbitrarily designed DNA nanostructures by a generate-candidates-and-choose-the-best strategy. A scalable procedure to prepare single-stranded DNA having arbitrary sequences is also presented. Strands for the assembly of various structures were designed and successfully constructed, validating both the program and the procedure.
Design of the hairpin ribozyme for targeting specific RNA sequences.
Hampel, A; DeYoung, M B; Galasinski, S; Siwkowski, A
1997-01-01
The following steps should be taken when designing the hairpin ribozyme to cleave a specific target sequence: 1. Select a target sequence containing BN*GUC where B is C, G, or U. 2. Select the target sequence in areas least likely to have extensive interfering structure. 3. Design the conventional hairpin ribozyme as shown in Fig. 1, such that it can form a 4 bp helix 2 and helix 1 lengths up to 10 bp. 4. Synthesize this ribozyme from single-stranded DNA templates with a double-stranded T7 promoter. 5. Prepare a series of short substrates capable of forming a range of helix 1 lengths of 5-10 bp. 6. Identify these by direct RNA sequencing. 7. Assay the extent of cleavage of each substrate to identify the optimal length of helix 1. 8. Prepare the hairpin tetraloop ribozyme to determine if catalytic efficiency can be improved.
Development of biometric DNA ink for authentication security.
Hashiyada, Masaki
2004-10-01
Among the various types of biometric personal identification systems, DNA provides the most reliable personal identification. It is intrinsically digital and unchangeable while the person is alive, and even after his/her death. Increasing the number of DNA loci examined can enhance the power of discrimination. This report describes the development of DNA ink, which contains synthetic DNA mixed with printing inks. Single-stranded DNA fragments encoding a personalized set of short tandem repeats (STR) were synthesized. The sequence was defined as follows. First, a decimal DNA personal identification (DNA-ID) was established based on the number of STRs in the locus. Next, this DNA-ID was encrypted using a binary, 160-bit algorithm, using a hashing function to protect privacy. Since this function is irreversible, no one can recover the original information from the encrypted code. Finally, the bit series generated above is transformed into base sequences, and double-stranded DNA fragments are amplified by the polymerase chain reaction (PCR) to protect against physical attacks. Synthesized DNA was detected successfully after samples printed in DNA ink were subjected to several resistance tests used to assess the stability of printing inks. Endurance test results showed that this DNA ink would be suitable for practical use as a printing ink and was resistant to 40 hours of ultraviolet exposure, performance commensurate with that of photogravure ink. Copyright 2004 Tohoku University Medical Press
Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R
1992-01-01
A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484
Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P
2000-05-01
Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.
Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B.
2015-01-01
Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing. PMID:26053390
Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B
2015-01-01
Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing.
NASA Technical Reports Server (NTRS)
Dar, M. E.; Winters, T. A.; Jorgensen, T. J.
1997-01-01
Ataxia-telangiectasia (A-T) is an autosomal-recessive lethal human disease. Homozygotes suffer from a number of neurological disorders, as well as very high cancer incidence. Heterozygotes may also have a higher than normal risk of cancer, particularly for the breast. The gene responsible for the disease (ATM) has been cloned, but its role in mechanisms of the disease remain unknown. Cellular A-T phenotypes, such as radiosensitivity and genomic instability, suggest that a deficiency in the repair of DNA double-strand breaks (DSBs) may be the primary defect; however, overall levels of DSB rejoining appear normal. We used the shuttle vector, pZ189, containing an oxidatively-induced DSB, to compare the integrity of DSB rejoining in one normal and two A-T fibroblast cells lines. Mutation frequencies were two-fold higher in A-T cells, and the mutational spectrum was different. The majority of the mutations found in all three cell lines were deletions (44-63%). The DNA sequence analysis indicated that 17 of the 17 plasmids with deletion mutations in normal cells occurred between short direct-repeat sequences (removing one of the repeats plus the intervening sequences), implicating illegitimate recombination in DSB rejoining. The combined data from both A-T cell lines showed that 21 of 24 deletions did not involve direct-repeats sequences, implicating a defect in the illegitimate recombination pathway. These findings suggest that the A-T gene product may either directly participate in illegitimate recombination or modulate the pathway. Regardless, this defect is likely to be important to a mechanistic understanding of this lethal disease.
Extending the spectrum of DNA sequences retrieved from ancient bones and teeth
Glocke, Isabelle; Meyer, Matthias
2017-01-01
The number of DNA fragments surviving in ancient bones and teeth is known to decrease with fragment length. Recent genetic analyses of Middle Pleistocene remains have shown that the recovery of extremely short fragments can prove critical for successful retrieval of sequence information from particularly degraded ancient biological material. Current sample preparation techniques, however, are not optimized to recover DNA sequences from fragments shorter than ∼35 base pairs (bp). Here, we show that much shorter DNA fragments are present in ancient skeletal remains but lost during DNA extraction. We present a refined silica-based DNA extraction method that not only enables efficient recovery of molecules as short as 25 bp but also doubles the yield of sequences from longer fragments due to improved recovery of molecules with single-strand breaks. Furthermore, we present strategies for monitoring inefficiencies in library preparation that may result from co-extraction of inhibitory substances during DNA extraction. The combination of DNA extraction and library preparation techniques described here substantially increases the yield of DNA sequences from ancient remains and provides access to a yet unexploited source of highly degraded DNA fragments. Our work may thus open the door for genetic analyses on even older material. PMID:28408382
UV-vis spectroscopy and dynamic light scattering study of gold nanorods aggregation.
Kanjanawarut, Roejarek; Yuan, Bo; XiaoDi, Su
2013-08-01
Gold nanorods (AuNRs) were used as spectroscopic sensing elements to detect specific DNA sequences with a single-base mismatch sensitivity. The assay was based on the observation that the stabilizing repulsive forces between CTA(+)-coated AuNRs can be removed by citrate ions, which causes aggregation among AuNRs; whereas nucleic acids of different structures[ i.e., peptide nucleic acid (PNA), single-stranded DNA (ssDNA), PNA-DNA complex, and double-stranded DNA (dsDNA)] can retard the aggregation. Moreover, the dsDNA PNA-DNA duplexes provide larger retardation than that by unhybridized ssDNA and PNA probe. This assay can differentiate single-base mismatched targets with base substitution at different locations (center and end) with AuNRs of a larger aspect ratio. Besides ultraviolet-visable spectroscopy measurement of particle assembly-induced plasmonic coupling that in turn provides a spectroscopic detection of the specific DNA, dynamic light scattering and transmission electron microscope (TEM) were used to measure smaller degree of aggregation that can reveal sodium citrate- and dsDNA-AuNRs interactions in fine detail.
Triplex-forming oligonucleotides: a third strand for DNA nanotechnology
2018-01-01
Abstract DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical (‘triplex’) structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone. PMID:29228337
Kedinger, C; Brison, O; Perrin, F; Wilhelm, J
1978-01-01
Deoxyribonucleoprotein complexes released 17 h postinfection from adenovirus type 1 (Ad2)-infected HeLa cell nuclei were shown by electron microscopy to contain filaments much thicker (about 200 A [20 nm]) than double-stranded DNA (about 20 A [2 nm]). The complexes were partially purified through a linear sucrose gradient, concentrated, and further purified in a metrizamide gradient. The major protein present in the complexes was identified as the 72,000-dalton (72K), adenovirus-coded single-stranded DNA-binding protein (72K DBP). Three types of complexes have been visualized by electron microscopy. Some linear complexes were uniformly thick, and their length corresponded roughly to that of the adenovirus genome. Other linear genome-length complexes appeared to consist of a thick filament connected to a thinner filament with the diameter of double-stranded DNA. Forked complexes consisting of one thick filament connected to a genome-length, thinner double-stranded DNA filament were also visualized. Both thick and thin filaments were sensitive to DNase and not to RNase, but only the thick filaments were digested by the single-strand-specific Neurospora crassa nuclease, indicating that they correspond to a complex of 72K DBP and Ad2 single-stranded DNA. Experiments with anti-72K DBP immunoglobulins indicated that these nucleoprotein complexes, containing the 72K DBP, correspond to replicative intermediates. Both strands of the Ad2 genome were found associated to the 72K DBP. Altogether, our results establish the in vivo association of the 72K DBP with adenovirus single-stranded DNA, as previously suggested from in vitro studies, and support a strand displacement mechanism for Ad2 DNA replication, in which both strands can be displaced. In addition, our results indicate that, late in infection, histones are not bound to adenovirus DNA in the form of a nucleosomal chromatine-like structure. Images PMID:207893
Kedinger, C; Brison, O; Perrin, F; Wilhelm, J
1978-05-01
Deoxyribonucleoprotein complexes released 17 h postinfection from adenovirus type 1 (Ad2)-infected HeLa cell nuclei were shown by electron microscopy to contain filaments much thicker (about 200 A [20 nm]) than double-stranded DNA (about 20 A [2 nm]). The complexes were partially purified through a linear sucrose gradient, concentrated, and further purified in a metrizamide gradient. The major protein present in the complexes was identified as the 72,000-dalton (72K), adenovirus-coded single-stranded DNA-binding protein (72K DBP). Three types of complexes have been visualized by electron microscopy. Some linear complexes were uniformly thick, and their length corresponded roughly to that of the adenovirus genome. Other linear genome-length complexes appeared to consist of a thick filament connected to a thinner filament with the diameter of double-stranded DNA. Forked complexes consisting of one thick filament connected to a genome-length, thinner double-stranded DNA filament were also visualized. Both thick and thin filaments were sensitive to DNase and not to RNase, but only the thick filaments were digested by the single-strand-specific Neurospora crassa nuclease, indicating that they correspond to a complex of 72K DBP and Ad2 single-stranded DNA. Experiments with anti-72K DBP immunoglobulins indicated that these nucleoprotein complexes, containing the 72K DBP, correspond to replicative intermediates. Both strands of the Ad2 genome were found associated to the 72K DBP. Altogether, our results establish the in vivo association of the 72K DBP with adenovirus single-stranded DNA, as previously suggested from in vitro studies, and support a strand displacement mechanism for Ad2 DNA replication, in which both strands can be displaced. In addition, our results indicate that, late in infection, histones are not bound to adenovirus DNA in the form of a nucleosomal chromatine-like structure.
Evidence for degenerate tetraploidy in bdelloid rotifers.
Mark Welch, David B; Mark Welch, Jessica L; Meselson, Matthew
2008-04-01
Rotifers of class Bdelloidea have evolved for millions of years apparently without sexual reproduction. We have sequenced 45- to 70-kb regions surrounding the four copies of the hsp82 gene of the bdelloid rotifer Philodina roseola, each of which is on a separate chromosome. The four regions comprise two colinear gene-rich pairs with gene content, order, and orientation conserved within each pair. Only a minority of genes are common to both pairs, also in the same orientation and order, but separated by gene-rich segments present in only one or the other pair. The pattern is consistent with degenerate tetraploidy with numerous segmental deletions, some in one pair of colinear chromosomes and some in the other. Divergence in 1,000-bp windows varies along an alignment of a colinear pair, from zero to as much as 20% in a pattern consistent with gene conversion associated with recombinational repair of DNA double-strand breaks. Although pairs of colinear chromosomes are a characteristic of sexually reproducing diploids and polyploids, a quite different explanation for their presence in bdelloids is suggested by the recent finding that bdelloid rotifers can recover and resume reproduction after suffering hundreds of radiation-induced DNA double-strand breaks per oocyte nucleus. Because bdelloid primary oocytes are in G(1) and therefore lack sister chromatids, we propose that bdelloid colinear chromosome pairs are maintained as templates for the repair of DNA double-strand breaks caused by the frequent desiccation and rehydration characteristic of bdelloid habitats.
Weyler, Linda; Engelbrecht, Mattias; Mata Forsberg, Manuel; Brehwens, Karl; Vare, Daniel; Vielfort, Katarina; Wojcik, Andrzej; Aro, Helena
2014-01-01
The host epithelium is both a barrier against, and the target for microbial infections. Maintaining regulated cell growth ensures an intact protective layer towards microbial-induced cellular damage. Neisseria gonorrhoeae infections disrupt host cell cycle regulation machinery and the infection causes DNA double strand breaks that delay progression through the G2/M phase. We show that intracellular gonococci upregulate and release restriction endonucleases that enter the nucleus and damage human chromosomal DNA. Bacterial lysates containing restriction endonucleases were able to fragment genomic DNA as detected by PFGE. Lysates were also microinjected into the cytoplasm of cells in interphase and after 20 h, DNA double strand breaks were identified by 53BP1 staining. In addition, by using live-cell microscopy and NHS-ester stained live gonococci we visualized the subcellular location of the bacteria upon mitosis. Infected cells show dysregulation of the spindle assembly checkpoint proteins MAD1 and MAD2, impaired and prolonged M-phase, nuclear swelling, micronuclei formation and chromosomal instability. These data highlight basic molecular functions of how gonococcal infections affect host cell cycle regulation, cause DNA double strand breaks and predispose cellular malignancies. PMID:25460012
Weyler, Linda; Engelbrecht, Mattias; Mata Forsberg, Manuel; Brehwens, Karl; Vare, Daniel; Vielfort, Katarina; Wojcik, Andrzej; Aro, Helena
2014-01-01
The host epithelium is both a barrier against, and the target for microbial infections. Maintaining regulated cell growth ensures an intact protective layer towards microbial-induced cellular damage. Neisseria gonorrhoeae infections disrupt host cell cycle regulation machinery and the infection causes DNA double strand breaks that delay progression through the G2/M phase. We show that intracellular gonococci upregulate and release restriction endonucleases that enter the nucleus and damage human chromosomal DNA. Bacterial lysates containing restriction endonucleases were able to fragment genomic DNA as detected by PFGE. Lysates were also microinjected into the cytoplasm of cells in interphase and after 20 h, DNA double strand breaks were identified by 53BP1 staining. In addition, by using live-cell microscopy and NHS-ester stained live gonococci we visualized the subcellular location of the bacteria upon mitosis. Infected cells show dysregulation of the spindle assembly checkpoint proteins MAD1 and MAD2, impaired and prolonged M-phase, nuclear swelling, micronuclei formation and chromosomal instability. These data highlight basic molecular functions of how gonococcal infections affect host cell cycle regulation, cause DNA double strand breaks and predispose cellular malignancies.
A label-free, fluorescence based assay for microarray
NASA Astrophysics Data System (ADS)
Niu, Sanjun
DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same intensity of excitation light. The fluorescence contrast is used to quantify the amount of probe-target hybridization. A mathematical model that considers multiple reflections and scattering is developed to explain the mechanism of the fluorescence contrast which depends on the thickness of the PS film. Scattering is the dominant factor that contributes to the contrast. The potential of this assay to detect single nucleotide polymorphism is also tested.
Triple Helix Formation in a Topologically Controlled DNA Nanosystem.
Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki
2016-04-11
In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Emerging critical roles of Fe-S clusters in DNA replication and repair
Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.
2015-01-01
Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665
Kashino, Genro; Liu, Yong; Suzuki, Minoru; Masunaga, Shin-ichiro; Kinashi, Yuko; Ono, Koji; Tano, Keizo; Watanabe, Masami
2010-01-01
The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, i.e., 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in CHO, but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action.
Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V
2014-08-01
In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Two-Tailed Comet Assay (2T-Comet): Simultaneous Detection of DNA Single and Double Strand Breaks.
Cortés-Gutiérrez, Elva I; Fernández, José Luis; Dávila-Rodríguez, Martha I; López-Fernández, Carmen; Gosálvez, Jaime
2017-01-01
A modification of the original comet assay was developed for the simultaneous evaluation of DNA single strand breaks (SSBs) and double strand breaks (DSBs) in human spermatozoa. The two-dimensional perpendicular tail comet assay (2T-comet) combines non-denaturing and denaturant conditions to the same sperm nucleoid. In this case, the species-specific deproteinized sperm is first subjected to an electrophoretic field under non-denaturing conditions to mobilize isolated free discrete DNA fragments produced from DSBs; this is then followed by a second electrophoresis running perpendicular to the first one but under alkaline conditions to produce DNA denaturation, exposing SSBs on the same linear DNA chain or DNA fragments flanked by DSBs. This procedure results in a two dimensional comet tail emerging from the core where two types of original DNA affected molecule can be simultaneously discriminated. The 2T-comet is a fast, sensitive, and reliable procedure to distinguish between single and double strand DNA damage within the same cell. It is an innovative method for assessing sperm DNA integrity, which has important implications for human fertility and andrological pathology. This technique may be adapted to assess different DNA break types in other species and other cell types.
SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA
Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia
1973-01-01
Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165
UV-Vis Spectroscopy and Dynamic Light Scattering Study of Gold Nanorods Aggregation
Kanjanawarut, Roejarek; Yuan, Bo
2013-01-01
Gold nanorods (AuNRs) were used as spectroscopic sensing elements to detect specific DNA sequences with a single-base mismatch sensitivity. The assay was based on the observation that the stabilizing repulsive forces between CTA+-coated AuNRs can be removed by citrate ions, which causes aggregation among AuNRs; whereas nucleic acids of different structures[ i.e., peptide nucleic acid (PNA), single-stranded DNA (ssDNA), PNA-DNA complex, and double-stranded DNA (dsDNA)] can retard the aggregation. Moreover, the dsDNA PNA-DNA duplexes provide larger retardation than that by unhybridized ssDNA and PNA probe. This assay can differentiate single-base mismatched targets with base substitution at different locations (center and end) with AuNRs of a larger aspect ratio. Besides ultraviolet–visable spectroscopy measurement of particle assembly-induced plasmonic coupling that in turn provides a spectroscopic detection of the specific DNA, dynamic light scattering and transmission electron microscope (TEM) were used to measure smaller degree of aggregation that can reveal sodium citrate– and dsDNA–AuNRs interactions in fine detail. PMID:23902360
Chakraborty, Ujani; George, Carolyn M.; Lyndaker, Amy M.; Alani, Eric
2016-01-01
Single-strand annealing (SSA) is an important homologous recombination mechanism that repairs DNA double strand breaks (DSBs) occurring between closely spaced repeat sequences. During SSA, the DSB is acted upon by exonucleases to reveal complementary sequences that anneal and are then repaired through tail clipping, DNA synthesis, and ligation steps. In baker’s yeast, the Msh DNA mismatch recognition complex and the Sgs1 helicase act to suppress SSA between divergent sequences by binding to mismatches present in heteroduplex DNA intermediates and triggering a DNA unwinding mechanism known as heteroduplex rejection. Using baker’s yeast as a model, we have identified new factors and regulatory steps in heteroduplex rejection during SSA. First we showed that Top3-Rmi1, a topoisomerase complex that interacts with Sgs1, is required for heteroduplex rejection. Second, we found that the replication processivity clamp proliferating cell nuclear antigen (PCNA) is dispensable for heteroduplex rejection, but is important for repairing mismatches formed during SSA. Third, we showed that modest overexpression of Msh6 results in a significant increase in heteroduplex rejection; this increase is due to a compromise in Msh2-Msh3 function required for the clipping of 3′ tails. Thus 3′ tail clipping during SSA is a critical regulatory step in the repair vs. rejection decision; rejection is favored before the 3′ tails are clipped. Unexpectedly, Msh6 overexpression, through interactions with PCNA, disrupted heteroduplex rejection between divergent sequences in another recombination substrate. These observations illustrate the delicate balance that exists between repair and replication factors to optimize genome stability. PMID:26680658
Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven
2015-03-31
Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.
Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro
2011-01-01
By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.
Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro
2011-01-01
By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p. PMID:21660142
Time-lapse crystallography snapshots of a double-strand break repair polymerase in action.
Jamsen, Joonas A; Beard, William A; Pedersen, Lars C; Shock, David D; Moon, Andrea F; Krahn, Juno M; Bebenek, Katarzyna; Kunkel, Thomas A; Wilson, Samuel H
2017-08-15
DNA polymerase (pol) μ is a DNA-dependent polymerase that incorporates nucleotides during gap-filling synthesis in the non-homologous end-joining pathway of double-strand break repair. Here we report time-lapse X-ray crystallography snapshots of catalytic events during gap-filling DNA synthesis by pol μ. Unique catalytic intermediates and active site conformational changes that underlie catalysis are uncovered, and a transient third (product) metal ion is observed in the product state. The product manganese coordinates phosphate oxygens of the inserted nucleotide and PP i . The product metal is not observed during DNA synthesis in the presence of magnesium. Kinetic analyses indicate that manganese increases the rate constant for deoxynucleoside 5'-triphosphate insertion compared to magnesium. The likely product stabilization role of the manganese product metal in pol μ is discussed. These observations provide insight on structural attributes of this X-family double-strand break repair polymerase that impact its biological function in genome maintenance.DNA polymerase (pol) μ functions in DNA double-strand break repair. Here the authors use time-lapse X-ray crystallography to capture the states of pol µ during the conversion from pre-catalytic to product complex and observe a third transiently bound metal ion in the product state.
An internalin a probe-based genosensor for Listeria monocytogenes detection and differentiation.
Bifulco, Laura; Ingianni, Angela; Pompei, Raffaello
2013-01-01
Internalin A (InlA), a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide) on the surfaces of screen-printed gold electrodes (Au-SPEs) by means of a mercaptan-activated self-assembled monolayer (SAM). The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV) using methylene blue (MB) as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV) upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.
Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Song, Chen; Adalsteinsson, Viktor A; Parsons, Heather A; Lin, Nancy U; Wagle, Nikhil; Makrigiorgos, G Mike
2017-10-01
The use of clinical samples and circulating cell-free DNA (cfDNA) collected from liquid biopsies for diagnostic and prognostic applications in cancer is burgeoning, and improved methods that reduce the influence of excess wild-type (WT) portion of the sample are desirable. Here we present enrichment of mutation-containing sequences using enzymatic degradation of WT DNA. Mutation enrichment is combined with high-resolution melting (HRM) performed in multiplexed closed-tube reactions as a rapid, cost-effective screening tool before targeted resequencing. We developed a homogeneous, closed-tube approach to use a double-stranded DNA-specific nuclease for degradation of WT DNA at multiple targets simultaneously. The No Denaturation Nuclease-assisted Minor Allele Enrichment with Probe Overlap (ND-NaME-PrO) uses WT oligonucleotides overlapping both strands on putative DNA targets. Under conditions of partial denaturation (DNA breathing), the oligonucleotide probes enhance double-stranded DNA-specific nuclease digestion at the selected targets, with high preference toward WT over mutant DNA. To validate ND-NaME-PrO, we used multiplexed HRM, digital PCR, and MiSeq targeted resequencing of mutated genomic DNA and cfDNA. Serial dilution of KRAS mutation-containing DNA shows mutation enrichment by 10- to 120-fold and detection of allelic fractions down to 0.01%. Multiplexed ND-NaME-PrO combined with multiplexed PCR-HRM showed mutation scanning of 10-20 DNA amplicons simultaneously. ND-NaME-PrO applied on cfDNA from clinical samples enables mutation enrichment and HRM scanning over 10 DNA targets. cfDNA mutations were enriched up to approximately 100-fold (average approximately 25-fold) and identified via targeted resequencing. Closed-tube homogeneous ND-NaME-PrO combined with multiplexed HRM is a convenient approach to efficiently enrich for mutations on multiple DNA targets and to enable prescreening before targeted resequencing. © 2017 American Association for Clinical Chemistry.
Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel
2007-04-10
For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.
Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J
2001-06-29
The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher-order DNA architectures. Further, these two small unimolecular G-quadruplexes, which are distinct from each other and from parallel-stranded G-quadruplexes, provide novel targets for ligand recognition. Our results demonstrate that the double chain reversal loop connectivity identified previously by our laboratory within the Tetrahymena telomere d(T2G4)4 quadruplex, is a robust folding topology, since it has now also been observed within the d(G2T4G2CAG2GT4G2T) quadruplex. The identification of a G-(T-T) triad and a T-T-T triple, expands on the available recognition alignments for base triads and triples. Copyright 2001 Academic Press.
Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun
2017-03-01
Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.
G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.
Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-02-06
The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.
Dewar Lesion Formation in Single- and Double-Stranded DNA is Quenched by Neighboring Bases.
Bucher, Dominik B; Pilles, Bert M; Carell, Thomas; Zinth, Wolfgang
2015-07-16
UV-induced Dewar lesion formation is investigated in single- and double-stranded oligonucleotides with ultrafast vibrational spectroscopy. The quantum yield for the conversion of the (6-4) lesion to the Dewar isomer in DNA strands is reduced by a factor of 4 in comparison to model dinucleotides. Time resolved spectroscopy reveals a fast process in the excited state with spectral characteristics of bases which are adjacent to the excited (6-4) lesion. These kinetic components have large amplitudes and indicate that an additional quenching channel acts in the stranded DNA systems and reduces the Dewar formation yield. Presumably relaxation evolves via a charge transfer to the neighboring guanine and the paired cytosine participates in a double-stranded oligomer. Changes in the decay of the relaxed excited electronic state of the (6-4) chromophore point to modifications in the excited state energy landscape which may lead to an additional reduction of the Dewar formation yield.
Ivanov, E. L.; Sugawara, N.; Fishman-Lobell, J.; Haber, J. E.
1996-01-01
HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. PMID:8849880
Stretching chimeric DNA: A test for the putative S-form
NASA Astrophysics Data System (ADS)
Whitelam, Stephen; Pronk, Sander; Geissler, Phillip L.
2008-11-01
Double-stranded DNA "overstretches" at a pulling force of about 65 pN, increasing in length by a factor of 1.7. The nature of the overstretched state is unknown, despite its considerable importance for DNA's biological function and technological application. Overstretching is thought by some to be a force-induced denaturation and by others to consist of a transition to an elongated, hybridized state called S-DNA. Within a statistical mechanical model, we consider the effect upon overstretching of extreme sequence heterogeneity. "Chimeric" sequences possessing halves of markedly different AT composition elongate under fixed external conditions via distinct, spatially segregated transitions. The corresponding force-extension data vary with pulling rate in a manner that depends qualitatively and strikingly upon whether the hybridized S-form is accessible. This observation implies a test for S-DNA that could be performed in experiment.
2011-01-01
Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341
Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr
2011-08-24
Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.
Barone, Giampaolo; Fonseca Guerra, Célia; Bickelhaupt, F Matthias
2013-01-01
We have computationally investigated the structure and stability of all 16 combinations of two out of the four natural DNA bases A, T, G and C in a di-2′-deoxyribonucleoside-monophosphate model DNA strand as well as in 10 double-strand model complexes thereof, using dispersion-corrected density functional theory (DFT-D). Optimized geometries with B-DNA conformation were obtained through the inclusion of implicit water solvent and, in the DNA models, of sodium counterions, to neutralize the negative charge of the phosphate groups. The results obtained allowed us to compare the relative stability of isomeric single and double strands. Moreover, the energy of the Watson–Crick pairing of complementary single strands to form double-helical structures was calculated. The latter furnished the following increasing stability trend of the double-helix formation energy: d(TpA)2
An in silico DNA cloning experiment for the biochemistry laboratory.
Elkins, Kelly M
2011-01-01
This laboratory exercise introduces students to concepts in recombinant DNA technology while accommodating a major semester project in protein purification, structure, and function in a biochemistry laboratory for junior- and senior-level undergraduate students. It is also suitable for forensic science courses focused in DNA biology and advanced high school biology classes. Students begin by examining a plasmid map with the goal of identifying which restriction enzymes may be used to clone a piece of foreign DNA containing a gene of interest into the vector. From the National Center for Biotechnology Initiative website, students are instructed to retrieve a protein sequence and use Expasy's Reverse Translate program to reverse translate the protein to cDNA. Students then use Integrated DNA Technologies' OligoAnalyzer to predict the complementary DNA strand and obtain DNA recognition sequences for the desired restriction enzymes from New England Biolabs' website. Students add the appropriate DNA restriction sequences to the double-stranded foreign DNA for cloning into the plasmid and infecting Escherichia coli cells. Students are introduced to computational biology tools, molecular biology terminology and the process of DNA cloning in this valuable single session, in silico experiment. This project develops students' understanding of the cloning process as a whole and contrasts with other laboratory and internship experiences in which the students may be involved in only a piece of the cloning process/techniques. Students interested in pursuing postgraduate study and research or employment in an academic biochemistry or molecular biology laboratory or industry will benefit most from this experience. Copyright © 2010 Wiley Periodicals, Inc.
BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks.
Yan, Winston X; Mirzazadeh, Reza; Garnerone, Silvano; Scott, David; Schneider, Martin W; Kallas, Tomasz; Custodio, Joaquin; Wernersson, Erik; Li, Yinqing; Gao, Linyi; Federova, Yana; Zetsche, Bernd; Zhang, Feng; Bienko, Magda; Crosetto, Nicola
2017-05-12
Precisely measuring the location and frequency of DNA double-strand breaks (DSBs) along the genome is instrumental to understanding genomic fragility, but current methods are limited in versatility, sensitivity or practicality. Here we present Breaks Labeling In Situ and Sequencing (BLISS), featuring the following: (1) direct labelling of DSBs in fixed cells or tissue sections on a solid surface; (2) low-input requirement by linear amplification of tagged DSBs by in vitro transcription; (3) quantification of DSBs through unique molecular identifiers; and (4) easy scalability and multiplexing. We apply BLISS to profile endogenous and exogenous DSBs in low-input samples of cancer cells, embryonic stem cells and liver tissue. We demonstrate the sensitivity of BLISS by assessing the genome-wide off-target activity of two CRISPR-associated RNA-guided endonucleases, Cas9 and Cpf1, observing that Cpf1 has higher specificity than Cas9. Our results establish BLISS as a versatile, sensitive and efficient method for genome-wide DSB mapping in many applications.
Mak, Sarah Siu Tze; Gopalakrishnan, Shyam; Carøe, Christian; Geng, Chunyu; Liu, Shanlin; Sinding, Mikkel-Holger S; Kuderna, Lukas F K; Zhang, Wenwei; Fu, Shujin; Vieira, Filipe G; Germonpré, Mietje; Bocherens, Hervé; Fedorov, Sergey; Petersen, Bent; Sicheritz-Pontén, Thomas; Marques-Bonet, Tomas; Zhang, Guojie; Jiang, Hui; Gilbert, M Thomas P
2017-01-01
Abstract Ancient DNA research has been revolutionized following development of next-generation sequencing platforms. Although a number of such platforms have been applied to ancient DNA samples, the Illumina series are the dominant choice today, mainly because of high production capacities and short read production. Recently a potentially attractive alternative platform for palaeogenomic data generation has been developed, the BGISEQ-500, whose sequence output are comparable with the Illumina series. In this study, we modified the standard BGISEQ-500 library preparation specifically for use on degraded DNA, then directly compared the sequencing performance and data quality of the BGISEQ-500 to the Illumina HiSeq2500 platform on DNA extracted from 8 historic and ancient dog and wolf samples. The data generated were largely comparable between sequencing platforms, with no statistically significant difference observed for parameters including level (P = 0.371) and average sequence length (P = 0718) of endogenous nuclear DNA, sequence GC content (P = 0.311), double-stranded DNA damage rate (v. 0.309), and sequence clonality (P = 0.093). Small significant differences were found in single-strand DNA damage rate (δS; slightly lower for the BGISEQ-500, P = 0.011) and the background rate of difference from the reference genome (θ; slightly higher for BGISEQ-500, P = 0.012). This may result from the differences in amplification cycles used to polymerase chain reaction–amplify the libraries. A significant difference was also observed in the mitochondrial DNA percentages recovered (P = 0.018), although we believe this is likely a stochastic effect relating to the extremely low levels of mitochondria that were sequenced from 3 of the samples with overall very low levels of endogenous DNA. Although we acknowledge that our analyses were limited to animal material, our observations suggest that the BGISEQ-500 holds the potential to represent a valid and potentially valuable alternative platform for palaeogenomic data generation that is worthy of future exploration by those interested in the sequencing and analysis of degraded DNA. PMID:28854615
NASA Astrophysics Data System (ADS)
Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.
2014-09-01
Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.
1995-04-11
A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.
1995-01-01
Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.
Histone H3 and the histone acetyltransferase Hat1p contribute to DNA double-strand break repair.
Qin, Song; Parthun, Mark R
2002-12-01
The modification of newly synthesized histones H3 and H4 by type B histone acetyltransferases has been proposed to play a role in the process of chromatin assembly. The type B histone acetyltransferase Hat1p and specific lysine residues in the histone H3 NH(2)-terminal tail (primarily lysine 14) are redundantly required for telomeric silencing. As many gene products, including other factors involved in chromatin assembly, have been found to participate in both telomeric silencing and DNA damage repair, we tested whether mutations in HAT1 and the histone H3 tail were also sensitive to DNA-damaging agents. Indeed, mutations both in specific lysine residues in the histone H3 tail and in HAT1 resulted in sensitivity to methyl methanesulfonate. The DNA damage sensitivity of the histone H3 and HAT1 mutants was specific for DNA double-strand breaks, as these mutants were sensitive to the induction of an exogenous restriction endonuclease, EcoRI, but not to UV irradiation. While histone H3 mutations had minor effects on nonhomologous end joining, the primary defect in the histone H3 and HAT1 mutants was in the recombinational repair of DNA double-strand breaks. Epistasis analysis indicates that the histone H3 and HAT1 mutants may influence DNA double-strand break repair through Asf1p-dependent chromatin assembly.
Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.
Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg
2015-11-25
DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.
Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA
Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev
2012-01-01
B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350
Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins
NASA Astrophysics Data System (ADS)
Gaspar, Miguel; Shenk, Thomas
2006-02-01
The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway. ionizing radiation | ataxia-telangiectasia mutated pathway
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-10-30
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-01-01
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434
Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.
Kimoto, Michiko; Hirao, Ichiro
2017-10-20
Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.
Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip
2016-03-22
Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.
NASA Astrophysics Data System (ADS)
Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip
2016-03-01
Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pobegalov, Georgii, E-mail: george.pobegalov@nanobio.spbstu.ru; Cherevatenko, Galina; Alekseev, Aleksandr
2015-10-23
Deinococcus radiodurans can survive extreme doses of ionizing radiation due to the very efficient DNA repair mechanisms that are able to cope even with hundreds of double-strand breaks. RecA, the critical protein of homologous recombination in bacteria, is one of the key components of the DNA-repair system. Repair of double-strand breaks requires RecA binding to DNA and assembly of the RecA nucleoprotein helical filaments. The Escherichia coli RecA protein (EcRecA) and its interactions with DNA have been extensively studied using various approaches including single-molecule techniques, while the D. radiodurans RecA (DrRecA) remains much less characterized. However, DrRecA shows some remarkable differencesmore » from E. coli homolog. Here we combine microfluidics and single-molecule DNA manipulation with optical tweezers to follow the binding of DrRecA to long double-stranded DNA molecules and probe the mechanical properties of DrRecA nucleoprotein filaments at physiological pH. Our data provide a direct comparison of DrRecA and EcRecA binding to double-stranded DNA under identical conditions. We report a significantly faster filaments assembly as well as lower values of persistence length and contour length for DrRecA nucleoprotein filaments compared to EcRecA. Our results support the existing model of DrRecA forming more frequent and less continuous filaments relative to those of EcRecA. - Highlights: • We investigate Deinococcus radiodurans RecA interactions with long double-stranded DNA at the single-molecule level. • At physiological pH D. radiodurans RecA forms nucleoprotein filaments significantly faster relative to Escherichia coli RecA. • D. radiodurans RecA-dsDNA nucleoprotein filaments are more flexible and slightly shorter compared to those of E. coli RecA.« less
Zaboikin, Michail; Zaboikina, Tatiana; Freter, Carl; Srinivasakumar, Narasimhachar
2017-01-01
Genome editing using transcription-activator like effector nucleases or RNA guided nucleases allows one to precisely engineer desired changes within a given target sequence. The genome editing reagents introduce double stranded breaks (DSBs) at the target site which can then undergo DNA repair by non-homologous end joining (NHEJ) or homology directed recombination (HDR) when a template DNA molecule is available. NHEJ repair results in indel mutations at the target site. As PCR amplified products from mutant target regions are likely to exhibit different melting profiles than PCR products amplified from wild type target region, we designed a high resolution melting analysis (HRMA) for rapid identification of efficient genome editing reagents. We also designed TaqMan assays using probes situated across the cut site to discriminate wild type from mutant sequences present after genome editing. The experiments revealed that the sensitivity of the assays to detect NHEJ-mediated DNA repair could be enhanced by selection of transfected cells to reduce the contribution of unmodified genomic DNA from untransfected cells to the DNA melting profile. The presence of donor template DNA lacking the target sequence at the time of genome editing further enhanced the sensitivity of the assays for detection of mutant DNA molecules by excluding the wild-type sequences modified by HDR. A second TaqMan probe that bound to an adjacent site, outside of the primary target cut site, was used to directly determine the contribution of HDR to DNA repair in the presence of the donor template sequence. The TaqMan qPCR assay, designed to measure the contribution of NHEJ and HDR in DNA repair, corroborated the results from HRMA. The data indicated that genome editing reagents can produce DSBs at high efficiency in HEK293T cells but a significant proportion of these are likely masked by reversion to wild type as a result of HDR. Supplying a donor plasmid to provide a template for HDR (that eliminates a PCR amplifiable target) revealed these cryptic DSBs and facilitated the determination of the true efficacy of genome editing reagents. The results indicated that in HEK293T cells, approximately 40% of the DSBs introduced by genome editing, were available for participation in HDR.
Li, Ping; Jin, Hui; Yu, Hong-Guo
2014-10-01
During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. © 2014 Li et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
The complete DNA sequence of lymphocystis disease virus.
Tidona, C A; Darai, G
1997-04-14
Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, which has been reported to occur in over 100 different fish species worldwide. LCDV is a member of the family Iridoviridae and the type species of the genus Lymphocystivirus. The virions contain a single linear double-stranded DNA molecule, which is circularly permuted, terminally redundant, and heavily methylated at cytosines in CpG sequences. The complete nucleotide sequence of LCDV-1 (flounder isolate) was determined by automated cycle sequencing and primer walking. The genome of LCDV-1 is 102.653 bp in length and contains 195 open reading frames with coding capacities ranging from 40 to 1199 amino acids. Computer-assisted analyses of the deduced amino acid sequences led to the identification of several putative gene products with significant homologies to entries in protein data banks, such as the two major subunits of the viral DNA-dependent RNA polymerase, DNA polymerase, several protein kinases, two subunits of the ribonucleoside diphosphate reductase, DNA methyltransferase, the viral major capsid protein, insulin-like growth factor, and tumor necrosis factor receptor homolog.
RNA-programmed genome editing in human cells
Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer
2013-01-01
Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978
Dna2 initiates resection at clean DNA double-strand breaks
Paudyal, Sharad C.; Li, Shan; Yan, Hong; Hunter, Tony
2017-01-01
Abstract Nucleolytic resection of DNA double-strand breaks (DSBs) is essential for both checkpoint activation and homology-mediated repair; however, the precise mechanism of resection, especially the initiation step, remains incompletely understood. Resection of blocked ends with protein or chemical adducts is believed to be initiated by the MRN complex in conjunction with CtIP through internal cleavage of the 5′ strand DNA. However, it is not clear whether resection of clean DSBs with free ends is also initiated by the same mechanism. Using the Xenopus nuclear extract system, here we show that the Dna2 nuclease directly initiates the resection of clean DSBs by cleaving the 5′ strand DNA ∼10–20 nucleotides away from the ends. In the absence of Dna2, MRN together with CtIP mediate an alternative resection initiation pathway where the nuclease activity of MRN apparently directly cleaves the 5′ strand DNA at more distal sites. MRN also facilitates resection initiation by promoting the recruitment of Dna2 and CtIP to the DNA substrate. The ssDNA-binding protein RPA promotes both Dna2- and CtIP–MRN-dependent resection initiation, but a RPA mutant can distinguish between these pathways. Our results strongly suggest that resection of blocked and clean DSBs is initiated via distinct mechanisms. PMID:28981724
Ribeiro, S C; Monteiro, G A; Prazeres, D M F
2009-04-01
Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.
Rousseau, Beth A; Hou, Zhonggang; Gramelspacher, Max J; Zhang, Yan
2018-03-01
The microbial CRISPR systems enable adaptive defense against mobile elements and also provide formidable tools for genome engineering. The Cas9 proteins are type II CRISPR-associated, RNA-guided DNA endonucleases that identify double-stranded DNA targets by sequence complementarity and protospacer adjacent motif (PAM) recognition. Here we report that the type II-C CRISPR-Cas9 from Neisseria meningitidis (Nme) is capable of programmable, RNA-guided, site-specific cleavage and recognition of single-stranded RNA targets and that this ribonuclease activity is independent of the PAM sequence. We define the mechanistic feature and specificity constraint for RNA cleavage by NmeCas9 and also show that nuclease null dNmeCas9 binds to RNA target complementary to CRISPR RNA. Finally, we demonstrate that NmeCas9-catalyzed RNA cleavage can be blocked by three families of type II-C anti-CRISPR proteins. These results fundamentally expand the targeting capacities of CRISPR-Cas9 and highlight the potential utility of NmeCas9 as a single platform to target both RNA and DNA. Copyright © 2018 Elsevier Inc. All rights reserved.
Villalobos, Michael J; Betti, Christopher J; Vaughan, Andrew T M
2006-01-01
Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks introduced into any identifiable genomic location.
NASA Technical Reports Server (NTRS)
Rydberg, B.; Chatterjee, A. (Principal Investigator)
1996-01-01
The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.
Barlev, Adam; Sekhon, Gurpreet S; Bennet, Andrew J; Sen, Dipankar
2016-11-01
UV1C, a 42-nt DNA oligonucleotide, is a deoxyribozyme (DNAzyme) that optimally uses 305 nm wavelength light to catalyze photoreactivation of a cyclobutane thymine dimer placed within a gapped, unnatural DNA substrate, TDP. Herein we show that UV1C is also capable of photoreactivating thymine dimers within an authentic single-stranded DNA substrate, LDP. This bona fide UV1C substrate enables, for the first time, investigation of whether UV1C catalyzes only photoreactivation or also the de novo formation of thymine dimers. Single-turnover experiments carried out with LDP and UV1C, relative to control experiments with LDP alone in single-stranded and double-stranded contexts, show that while UV1C does modestly promote thymine dimer formation, its major activity is indeed photoreactivation. Distinct photostationary states are reached for LDP in its three contexts: as a single strand, as a constituent of a double-helix, and as a 1:1 complex with UV1C. The above results on the cofactor-independent photoreactivation capabilities of a catalytic DNA reinforce a series of recent, unexpected reports that purely nucleotide-based photoreactivation is also operational within conventional double-helical DNA.
Li, Junlong; Chen, Zhongping; Xiang, Yu; Zhou, Lili; Wang, Ting; Zhang, Zhang; Sun, Kexin; Yin, Dan; Li, Yi; Xie, Guoming
2016-12-15
Wnt7B gene plays an important role in the development and progression of breast cancer, gastric cancer, esophageal cancer and pancreatic cancer. While, the natural state of DNA is double stranded, which makes it difficult to be directly detected. Here, we develop an electrochemical biosensor method for Wnt7B gene detection without the need to denature the target. This method firstly used nicking enzyme for exploiting in the double-stranded DNA (dsDNA). Then, long single-stranded DNA (ssDNA) was generated from the cutting site through polymerase extension reaction. Whereafter, the long ssDNA triggered a hairpin self-assembly recycling reaction, which gave rise to another isothermal amplification reaction. Last, short ssDNA was formed after the this amplification process, which could hybridize with the capture probe immobilized on Au electrode and result in signal variation. This method showed excellent analytical performance for dsDNA, of which the linear range was 2fM to 500pM and the detection limit was 1.6fM (S/N=3). It also showed an good results when applied to the real sample of Wnt7B gene detection. Copyright © 2016 Elsevier B.V. All rights reserved.
Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes
NASA Astrophysics Data System (ADS)
Roxbury, Daniel
It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.
Mechanism for CCC DNA synthesis in hepadnaviruses.
Sohn, Ji A; Litwin, Samuel; Seeger, Christoph
2009-11-30
Hepadnavirus replication requires the synthesis of a covalently closed circular (CCC) DNA from the relaxed circular (RC) viral genome by an unknown mechanism. CCC DNA formation could require enzymatic activities of the viral reverse transcriptase (RT), or cellular DNA repair enzymes, or both. Physical mapping of the 5' and 3' ends of RC DNA and sequence analysis of CCC DNA revealed that CCC DNA synthesis requires the removal of the RT and an RNA oligomer from the 5' ends of minus and plus strand DNA, respectively, removal of sequences from the terminally redundant minus strand, completion of the less than full-length plus strand, and ligation of the ends. Two models have been proposed that could explain CCC DNA formation. The first (model 1) invokes a role for the RT to catalyze a cleavage-ligation reaction leading to the formation of a unit length minus strand in CCC DNA and a DNA repair reaction for the completion and ligation of plus strand DNA; the second (model 2) predicts that CCC DNA formation depends entirely on cellular DNA repair enzymes. To determine which mechanism is utilized, we developed cell lines expressing duck hepatitis B virus genomes carrying mutations permitting us to follow the fate of viral DNA sequences during their conversion from RC to CCC DNA. Our results demonstrated that the oligomer at the 5' end of minus strand DNA is completely or at least partially removed prior to CCC DNA synthesis. The results indicated that both RC DNA strands undergo DNA repair reactions carried out by the cellular DNA repair machinery as predicted by model 2. Thus, our study provided the basis for the identification of the cellular components required for CCC DNA formation.
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
A non-canonical DNA structure enables homologous recombination in various genetic systems.
Masuda, Tokiha; Ito, Yutaka; Terada, Tohru; Shibata, Takehiko; Mikawa, Tsutomu
2009-10-30
Homologous recombination, which is critical to genetic diversity, depends on homologous pairing (HP). HP is the switch from parental to recombinant base pairs, which requires expansion of inter-base pair spaces. This expansion unavoidably causes untwisting of the parental double-stranded DNA. RecA/Rad51-catalyzed ATP-dependent HP is extensively stimulated in vitro by negative supercoils, which compensates for untwisting. However, in vivo, double-stranded DNA is relaxed by bound proteins and thus is an unfavorable substrate for RecA/Rad51. In contrast, Mhr1, an ATP-independent HP protein required for yeast mitochondrial homologous recombination, catalyzes HP without the net untwisting of double-stranded DNA. Therefore, we questioned whether Mhr1 uses a novel strategy to promote HP. Here, we found that, like RecA, Mhr1 induced the extension of bound single-stranded DNA. In addition, this structure was induced by all evolutionarily and structurally distinct HP proteins so far tested, including bacterial RecO, viral RecT, and human Rad51. Thus, HP includes the common non-canonical DNA structure and uses a common core mechanism, independent of the species of HP proteins. We discuss the significance of multiple types of HP proteins.
[Establishment of systemic lupus erythematosus-like murine model with Sm mimotope].
Xie, Hong-Fu; Feng, Hao; Zeng, Hai-Yan; Li, Ji; Shi, Wei; Yi, Mei; Wu, Bin
2007-04-01
To establish systemic lupus erythematosus (SLE) -like murine model by immunizing BALB/C mice with Sm mimotope. Sm mimotope was identified by screening a 12-mer random peptide library with monoclonal anti-Smith antibody. Sm mimotope was initially defined with sandwich ELISA, DNA sequencing, and deduced amino acid sequence; and BALB/C mice were subcutaneously injected with mixture phages clones. Sera Sm antibody, anti-double stranded DNA (dsDNA) antibody, and antinuclear antibody (ANA) of mice were detected using direct immunofluorescence; kidney histological changes were examined by HE staining. Five randomly selected peptides were sequenced and the amino acid sequences IR, SQ, and PP were detected in a higher frequency. High-titer IgG autoantibodies of dsDNA, Sm, and ANA in the sera of experiment group were detected by ELISA 28 days after having been immunized by Sm mimotope. Proteinuria was detected 33 days later; immune complex and nephritis were observed in kidney specimens. SLE-like murine model can be successfully induced by Sm phage mimotope.
Berger, Cordula; Parson, Walther
2009-06-01
The degradation state of some biological traces recovered from the crime scene requires the amplification of very short fragments to attain a useful mitochondrial (mt)DNA sequence. We have previously introduced two mini-multiplex assays that amplify 10 overlapping control region (CR) fragments in two separate multiplex PCRs, which brought successful CR consensus sequences from even highly degraded DNA extracts. This procedure requires a total of 20 sequencing reactions per sample, which is laborious and cost intensive. For only moderately degraded samples that we encounter more frequently with typical mtDNA casework material, we developed two new multiplex assays that use a subset of the mini-amplicon primers but embrace larger fragments (midis) and require only 10 sequencing reactions to build a double-stranded CR consensus sequence. We used a preceding mtDNA quantitation step by real-time PCR with two different target fragments (143 and 283 bp) that roughly correspond to the average fragment sizes of the different multiplex approaches to estimate size-dependent mtDNA quantities and to aid the choice of the appropriate PCR multiplexes with respect to quality of the results and required costs.
Hong, Feng; Chen, Xixue; Cao, Yuting; Dong, Youren; Wu, Dazhen; Hu, Futao; Gan, Ning
2018-07-30
It is critically important to detect antibiotic residues for monitoring food safety. In this study, an enzyme- and label-free electrochemical aptasensor for antibiotics, with kanamycin (Kana) as a typical analyte, was developed based on a double stir bar-assisted toehold-mediated strand displacement reaction (dSB-TMSDR) for dual-signal amplification. First, we modified two gold electrodes (E-1 and E-2) with different DNA probes (S1/S2 hybrid probe in E-1 and DNA fuel strand S3 in E-2). In the presence of Kana, an S1/S2 probe can be disassembled from E-1 to form an S2/Kana complex in supernatant. The S2/Kana could react with S3 on E-2 to form S2/S3 hybrid and release Kana through TMSDR. After then, the target recycling was triggered. Subsequently, the formed S2/S3 hybrid can also trigger a hybridization chain reaction (HCR). Consequently, the dual-signal amplification strategy was established, which resulted in many long dsDNA chains on E-2. The chains can associate with methylene blue (MB) as redox probes to produce a current response for the quantification of Kana. The assay exhibited high sensitivity and specificity with a detection limit at 16 fM Kana due to the dual-signal amplification. The double stir bars system can both increase phase separation and prevent leakage of DNA fuel to reduce background interference. Moreover, it allows flexible sequence design of the TMSDR probes. The assay was successfully employed to detect Kana residues in food and showed potential application value in food safety detection. Copyright © 2018 Elsevier B.V. All rights reserved.
Wen, Guangming; Dong, Wenxia; Liu, Bin; Li, Zhongping; Fan, Lifang
2018-05-29
A novel cascade photoelectrochemical (PEC) signal amplification biosensing tactics was developed for DNA detection based on a target-driven DNA association to induce cyclic hairpin assembly. In the circulatory system there are two ssDNA (A and B) and two hairpins (C and D). The hybridization of these ssDNA led to the formation of an A-target-B structure. The close proximity of their toehold and branch-migration regions was able to induce the cyclic hairpin assembly. Afterwards, the assembly result further causes the separation of a double-stranded probe DNA (Q:F) to switch the PEC signal via toehold-mediated strand replacement. As such, the signal stranded DNA-CdS QDs (F) as the signal tag was released in the presence of the target DNA. The signal DNA-CdS QDs was then coated to F-doped tin oxide (FTO) electrode leading to the "signal-on" PEC signal. The designed biosensing strategy showed a low detection limit of 21.3 pM for target DNA and a broad linear range from 50 pM to 100 nM. This signal amplification PEC sensing method exhibited a potential application to detect protein molecules, RNA or metal ions via changing the sequence of A and B recognition. Copyright © 2018 Elsevier B.V. All rights reserved.
Koshland, Douglas
2012-01-01
DNA double-strand breaks impact genome stability by triggering many of the large-scale genome rearrangements associated with evolution and cancer. One of the first steps in repairing this damage is 5′→3′ resection beginning at the break site. Recently, tools have become available to study the consequences of not extensively resecting double-strand breaks. Here we examine the role of Sgs1- and Exo1-dependent resection on genome stability using a non-selective assay that we previously developed using diploid yeast. We find that Saccharomyces cerevisiae lacking Sgs1 and Exo1 retains a very efficient repair process that is highly mutagenic to genome structure. Specifically, 51% of cells lacking Sgs1 and Exo1 repair a double-strand break using repetitive sequences 12–48 kb distal from the initial break site, thereby generating a genome rearrangement. These Sgs1- and Exo1-independent rearrangements depend partially upon a Rad51-mediated homologous recombination pathway. Furthermore, without resection a robust cell cycle arrest is not activated, allowing a cell with a single double-strand break to divide before repair, potentially yielding multiple progeny each with a different rearrangement. This profusion of rearranged genomes suggests that cells tolerate any dangers associated with extensive resection to inhibit mutagenic pathways such as break-distal recombination. The activation of break-distal recipient repeats and amplification of broken chromosomes when resection is limited raise the possibility that genome regions that are difficult to resect may be hotspots for rearrangements. These results may also explain why mutations in resection machinery are associated with cancer. PMID:22479212
Zhou, Ligang; Zhou, Meixian; Sun, Chaomin; Han, Jing; Lu, Qiuhe; Zhou, Jian; Xiang, Hua
2008-08-01
The precise nick site in the double-strand origin (DSO) of pZMX201, a 1,668-bp rolling-circle replication (RCR) plasmid from the haloarchaeon Natrinema sp. CX2021, was determined by electron microscopy and DSO mapping. In this plasmid, DSO nicking occurred between residues C404 and G405 within a heptanucleotide sequence (TCTC/GGC) located in the stem region of an imperfect hairpin structure. This nick site sequence was conserved among the haloarchaeal RCR plasmids, including pNB101, suggesting that the DSO nick site might be the same for all members of this plasmid family. Interestingly, the DSOs of pZMX201 and pNB101 were found to be cross-recognized in RCR initiation and termination in a hybrid plasmid system. Mutation analysis of the DSO from pZMX201 (DSO(Z)) in this hybrid plasmid system revealed that: (i) the nucleotides in the middle of the conserved TCTCGGC sequence play more-important roles in the initiation and termination process; (ii) the left half of the hairpin structure is required for initiation but not for termination; and (iii) a 36-bp sequence containing TCTCGGC and the downstream sequence is essential and sufficient for termination. In conclusion, these haloarchaeal plasmids, with novel features that are different from the characteristics of both single-stranded DNA phages and bacterial RCR plasmids, might serve as a good model for studying the evolution of RCR replicons.
Trifluorothymidine exhibits potent antitumor activity via the induction of DNA double-strand breaks.
Suzuki, Norihiko; Nakagawa, Fumio; Nukatsuka, Mamoru; Fukushima, Masakazu
2011-05-01
TAS-102 is an oral anticancer drug composed of trifluorothymidine (TFT) and TPI (an inhibitor of thymidine phosphorylase that strongly inhibits the biodegradation of TFT). Similar to 5-fluorouracil (5FU) and 5-fluoro-2'-deoxyuridine (FdUrd), TFT also inhibits thymidylate synthase (TS), a rate-limiting enzyme of DNA biosynthesis, and is incorporated into DNA. TFT exhibits an anticancer effect on colorectal cancer cells that have acquired 5FU and/or FdUrd resistance as a result of the overexpression of TS. Therefore, we examined the mode of action of TFT-induced DNA damage after its incorporation into DNA. When HeLa cells were treated with TFT, the number of ring-open aldehyde forms at apurinic/apyrimidinic sites increased in a dose-dependent manner, although we previously reported that no detectable excisions of TFT paired to adenine were observed using uracil DNA glycosylases, thymine DNA glycosylase or methyl-CpG binding domain 4 and HeLa whole cell extracts. To investigate the functional mechanism of TFT-induced DNA damage, we measured the phosphorylation of ATR, ATM, BRCA2, chk1 and chk2 in nuclear extracts of HeLa cells after 0, 24, 48 or 72 h of exposure to an IC(50) concentration of TFT, FdUrd or 5FU using Western blot analysis or an enzyme-linked immunosorbent assay (ELISA). Unlike FdUrd and 5FU, TFT resulted in an earlier phosphorylation of ATR and chk1 proteins after only 24 h of exposure, while phosphorylated ATM, BRCA2 and chk2 proteins were detected after more than 48 h of exposure to TFT. These results suggest that TFT causes single-strand breaks followed by double-strand breaks in the DNA of TFT-treated cells. TFT (as TAS-102) showed a more potent antitumor activity than oral 5FU on CO-3 colon cancer xenografts in mice, and such antitumor potency was supported by the increased number of double-strand breaks occurring after single-strand breaks in the DNA of the TFT-treated tumors. These results suggest that TFT causes single-strand breaks after its incorporation into DNA followed by double-strand breaks, resulting in DNA damage. This effect of TFT on DNA may explain its potent anticancer activity in cancer therapy.
Trifluorothymidine exhibits potent antitumor activity via the induction of DNA double-strand breaks
SUZUKI, NORIHIKO; NAKAGAWA, FUMIO; NUKATSUKA, MAMORU; FUKUSHIMA, MASAKAZU
2011-01-01
TAS-102 is an oral anticancer drug composed of trifluorothymidine (TFT) and TPI (an inhibitor of thymidine phosphorylase that strongly inhibits the biodegradation of TFT). Similar to 5-fluorouracil (5FU) and 5-fluoro-2′-deoxyuridine (FdUrd), TFT also inhibits thymidylate synthase (TS), a rate-limiting enzyme of DNA biosynthesis, and is incorporated into DNA. TFT exhibits an anticancer effect on colorectal cancer cells that have acquired 5FU and/or FdUrd resistance as a result of the overexpression of TS. Therefore, we examined the mode of action of TFT-induced DNA damage after its incorporation into DNA. When HeLa cells were treated with TFT, the number of ring-open aldehyde forms at apurinic/apyrimidinic sites increased in a dose-dependent manner, although we previously reported that no detectable excisions of TFT paired to adenine were observed using uracil DNA glycosylases, thymine DNA glycosylase or methyl-CpG binding domain 4 and HeLa whole cell extracts. To investigate the functional mechanism of TFT-induced DNA damage, we measured the phosphorylation of ATR, ATM, BRCA2, chk1 and chk2 in nuclear extracts of HeLa cells after 0, 24, 48 or 72 h of exposure to an IC50 concentration of TFT, FdUrd or 5FU using Western blot analysis or an enzyme-linked immunosorbent assay (ELISA). Unlike FdUrd and 5FU, TFT resulted in an earlier phosphorylation of ATR and chk1 proteins after only 24 h of exposure, while phosphorylated ATM, BRCA2 and chk2 proteins were detected after more than 48 h of exposure to TFT. These results suggest that TFT causes single-strand breaks followed by double-strand breaks in the DNA of TFT-treated cells. TFT (as TAS-102) showed a more potent antitumor activity than oral 5FU on CO-3 colon cancer xenografts in mice, and such antitumor potency was supported by the increased number of double-strand breaks occurring after single-strand breaks in the DNA of the TFT-treated tumors. These results suggest that TFT causes single-strand breaks after its incorporation into DNA followed by double-strand breaks, resulting in DNA damage. This effect of TFT on DNA may explain its potent anticancer activity in cancer therapy. PMID:22977515
Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia
2011-05-17
Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.
Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E
2018-02-27
Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.
Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert
Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less
Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase
Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...
2015-06-02
Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less
DNA hybridization kinetics: zippering, internal displacement and sequence dependence.
Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A
2013-10-01
Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.
New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III
Lama, Lodoe; Seidl, Christine I; Ryan, Kevin
2014-01-01
Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3′ end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells. PMID:25764216
Ferrocene-oligonucleotide conjugates for electrochemical probing of DNA.
Ihara, T; Maruo, Y; Takenaka, S; Takagi, M
1996-01-01
Toward the development of a universal, sensitive and convenient method of DNA (or RNA) detection, electrochemically active oligonucleotides were prepared by covalent linkage of a ferrocenyl group to the 5'-aminohexyl-terminated synthetic oligonucleotides. Using these electrochemically active probes, we have been able to demonstrate the detection of DNA and RNA at femtomole levels by HPLC equipped with an ordinary electrochemical detector (ECD) [Takenaka,S., Uto,Y., Kondo,H., Ihara,T. and Takagi,M. (1994) Anal. Biochem., 218, 436-443]. Thermodynamic and electrochemical studies of the interaction between the probes and the targets are presented here. The thermodynamics obtained revealed that the conjugation stabilizes the triple-helix complexes by 2-3 kcal mol-1 (1-2 orders increment in binding constant) at 298 K, which corresponds to the effect of elongation of additional several base triplets. The main cause of this thermodynamic stabilization by the conjugation is likely to be the overall conformational change of whole structure of the conjugate rather than the additional local interaction. The redox potential of the probe was independent of the target structure, which is either single- or double stranded. However, the potential is slightly dependent (with a 10-30 mV negative shift on complexation) on the extra sequence in the target, probably because the individual sequence is capable of contacting or interacting with the ferrocenyl group in a slightly different way from each other. This small potential shift itself, however, does not cause any inconvenience on practical applications in detecting the probes by using ECD. These results lead to the conclusion that the redox-active probes are very useful for the microanalysis of nucleic acids due to the stability of the complexes, high detection sensitivity and wide applicability to the target structures (DNA and RNA; single- and double strands) and the sequences. PMID:8932383
Genome Sequence of Saccharomyces cerevisiae Double-Stranded RNA Virus L-A-28.
Konovalovas, Aleksandras; Serviené, Elena; Serva, Saulius
2016-06-16
We cloned and sequenced the complete genome of the L-A-28 virus from the Saccharomyces cerevisiae K28 killer strain. This sequence completes the set of currently identified L-A helper viruses required for expression of double-stranded RNA-originated killer phenotypes in baking yeast. Copyright © 2016 Konovalovas et al.
Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage
Black, Paul J.; Miller, Adam S.; Hayes, Jeffrey J.
2016-01-01
Purpose As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. Materials and methods To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. Results We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines, and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. Conclusions These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation. PMID:27349757
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Preparation of metagenomic libraries from naturally occurring marine viruses.
Solonenko, Sergei A; Sullivan, Matthew B
2013-01-01
Microbes are now well recognized as major drivers of the biogeochemical cycling that fuels the Earth, and their viruses (phages) are known to be abundant and important in microbial mortality, horizontal gene transfer, and modulating microbial metabolic output. Investigation of environmental phages has been frustrated by an inability to culture the vast majority of naturally occurring diversity coupled with the lack of robust, quantitative, culture-independent methods for studying this uncultured majority. However, for double-stranded DNA phages, a quantitative viral metagenomic sample-to-sequence workflow now exists. Here, we review these advances with special emphasis on the technical details of preparing DNA sequencing libraries for metagenomic sequencing from environmentally relevant low-input DNA samples. Library preparation steps broadly involve manipulating the sample DNA by fragmentation, end repair and adaptor ligation, size fractionation, and amplification. One critical area of future research and development is parallel advances for alternate nucleic acid types such as single-stranded DNA and RNA viruses that are also abundant in nature. Combinations of recent advances in fragmentation (e.g., acoustic shearing and tagmentation), ligation reactions (adaptor-to-template ratio reference table availability), size fractionation (non-gel-sizing), and amplification (linear amplification for deep sequencing and linker amplification protocols) enhance our ability to generate quantitatively representative metagenomic datasets from low-input DNA samples. Such datasets are already providing new insights into the role of viruses in marine systems and will continue to do so as new environments are explored and synergies and paradigms emerge from large-scale comparative analyses. © 2013 Elsevier Inc. All rights reserved.
DNA Scrunching in the Packaging of Viral Genomes.
Waters, James T; Kim, Harold D; Gumbart, James C; Lu, Xiang-Jun; Harvey, Stephen C
2016-07-07
The motors that drive double-stranded DNA (dsDNA) genomes into viral capsids are among the strongest of all biological motors for which forces have been measured, but it is not known how they generate force. We previously proposed that the DNA is not a passive substrate but that it plays an active role in force generation. This "scrunchworm hypothesis" holds that the motor proteins repeatedly dehydrate and rehydrate the DNA, which then undergoes cyclic shortening and lengthening motions. These are captured by a coupled protein-DNA grip-and-release cycle to rectify the motion and translocate the DNA into the capsid. In this study, we examined the interactions of dsDNA with the dodecameric connector protein of bacteriophage ϕ29, using molecular dynamics simulations on four different DNA sequences, starting from two different conformations (A-DNA and B-DNA). In all four simulations starting with the protein equilibrated with A-DNA in the channel, we observed transitions to a common, metastable, highly scrunched conformation, designated A*. This conformation is very similar to one recently reported by Kumar and Grubmüller in much longer MD simulations on B-DNA docked into the ϕ29 connector. These results are significant for four reasons. First, the scrunched conformations occur spontaneously, without requiring lever-like protein motions often believed to be necessary for DNA translocation. Second, the transition takes place within the connector, providing the location of the putative "dehydrator". Third, the protein has more contacts with one strand of the DNA than with the other; the former was identified in single-molecule laser tweezer experiments as the "load-bearing strand". Finally, the spontaneity of the DNA-protein interaction suggests that it may play a role in the initial docking of DNA in motors like that of T4 that can load and package any sequence.
Apelgot, S
1980-04-01
The experiments show the lethal effect of the beta decay of 33P incorporated in DNA of bacteriophage S 13. The lethal efficiency is high, 0.72 at 0 degrees C and 0.55 at--197 degrees C. The presence of a radical scavenger like AET has no influence. It was found previously that for such phages with single-stranded DNA, the lethal efficiency of 32P decay is unity, and that the lethal event is a DNA single-strand break, owing to the high energy of the nucleogenic 32S atom. As the recoil energy of the 33S atom is too low to account for such a break, it is suggested that the reorganization of the phosphate molecule into sulphate is able to bring about a DNA single-strand break with an efficiency as high as 0.7, at 0 degrees C. A model for the DNA double-strand-break produced by a transmutation processes is suggested.
DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay
Park, Sojin; Choi, Seoyun; Ahn, Byungchan
2016-01-01
DNA damage responses are important for the maintenance of genome stability and the survival of organisms. Such responses are activated in the presence of DNA damage and lead to cell cycle arrest, apoptosis, and DNA repair. In Caenorhabditis elegans, double-strand breaks induced by DNA damaging agents have been detected indirectly by antibodies against DSB recognizing proteins. In this study we used a comet assay to detect DNA strand breaks and to measure the elimination of DNA strand breaks in mitotic germline nuclei of C. elegans. We found that C. elegans brc-1 mutants were more sensitive to ionizing radiation and camptothecin than the N2 wild-type strain and repaired DNA strand breaks less efficiently than N2. This study is the first demonstration of direct measurement of DNA strand breaks in mitotic germline nuclei of C. elegans. This newly developed assay can be applied to detect DNA strand breaks in different C. elegans mutants that are sensitive to DNA damaging agents. PMID:26903030
Katz, Samantha S.; Gimble, Frederick S.; Storici, Francesca
2014-01-01
Genetic modification of a chromosomal locus to replace an existing dysfunctional allele with a corrected sequence can be accomplished through targeted gene correction using the cell's homologous recombination (HR) machinery. Gene targeting is stimulated by generation of a DNA double-strand break (DSB) at or near the site of correction, but repair of the break via non-homologous end-joining without using the homologous template can lead to deleterious genomic changes such as in/del mutations, or chromosomal rearrangements. By contrast, generation of a DNA single-strand break (SSB), or nick, can stimulate gene correction without the problems of DSB repair because the uncut DNA strand acts as a template to permit healing without alteration of genetic material. Here, we examine the ability of a nicking variant of the I-SceI endonuclease (K223I I-SceI) to stimulate gene targeting in yeast Saccharomyces cerevisiae and in human embryonic kidney (HEK-293) cells. K223I I-SceI is proficient in both yeast and human cells and promotes gene correction up to 12-fold. We show that K223I I-SceI-driven recombination follows a different mechanism than wild-type I-SceI-driven recombination, thus indicating that the initial DNA break that stimulates recombination is not a low-level DSB but a nick. We also demonstrate that K223I I-SceI efficiently elevates gene targeting at loci distant from the break site in yeast cells. These findings establish the capability of the I-SceI nickase to enhance recombination in yeast and human cells, strengthening the notion that nicking enzymes could be effective tools in gene correction strategies for applications in molecular biology, biotechnology, and gene therapy. PMID:24558436
Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA
NASA Astrophysics Data System (ADS)
Kringle, Loni; Sawaya, Nicolas P. D.; Widom, Julia; Adams, Carson; Raymer, Michael G.; Aspuru-Guzik, Alán; Marcus, Andrew H.
2018-02-01
Understanding the properties of electronically interacting molecular chromophores, which involve internally coupled electronic-vibrational motions, is important to the spectroscopy of many biologically relevant systems. Here we apply linear absorption, circular dichroism, and two-dimensional fluorescence spectroscopy to study the polarized collective excitations of excitonically coupled cyanine dimers (Cy3)2 that are rigidly positioned within the opposing sugar-phosphate backbones of the double-stranded region of a double-stranded (ds)-single-stranded (ss) DNA fork construct. We show that the exciton-coupling strength of the (Cy3)2-DNA construct can be systematically varied with temperature below the ds-ss DNA denaturation transition. We interpret spectroscopic measurements in terms of the Holstein vibronic dimer model, from which we obtain information about the local conformation of the (Cy3)2 dimer, as well as the degree of static disorder experienced by the Cy3 monomer and the (Cy3)2 dimer probe locally within their respective DNA duplex environments. The properties of the (Cy3)2-DNA construct we determine suggest that it may be employed as a useful model system to test fundamental concepts of protein-DNA interactions and the role of electronic-vibrational coherence in electronic energy migration within exciton-coupled bio-molecular arrays.
Dynamics of single-stranded DNA tethered to a solid
NASA Astrophysics Data System (ADS)
Radiom, Milad; Paul, Mark R.; Ducker, William A.
2016-06-01
Tethering is used to deliver specific biological and industrial functions. For example, single-stranded DNA (ssDNA) is tethered to polymerases and long sequences of double-stranded DNA (dsDNA) during replication, and to solids in DNA microarrays. However, tethering ssDNA to a large object limits not only the available ssDNA conformations, but also the range of time-scales over which the mechanical responses of ssDNA are important. In this work we examine the effect of tethering by measurement of the mechanical response of ssDNA that is tethered at each end to two separate atomic force microscope cantilevers in aqueous solution. Thermal motion of the cantilevers drives the ends of the ssDNA chain at frequencies near 2 kHz. The presence of a tethered molecule makes a large difference to the asymmetric cross-correlation of two cantilevers, which enables resolution of the mechanical properties in our experiments. By analysis of the correlated motion of the cantilevers we extract the friction and stiffness of the ssDNA. We find that the measured friction is much larger than the friction that is usually associated with the unencumbered motion of ssDNA. We also find that the measured relaxation time, ∼30 μs, is much greater than prior measurements of the free-molecule relaxation time. We attribute the difference to the loss of conformational possibilities as a result of constraining the ends of the ssDNA.
Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.
Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W
2018-03-05
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1 s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Technical Reports Server (NTRS)
Fouladi, B.; Waldren, C. A.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)
2000-01-01
We have optimized a pulsed-field gel electrophoresis assay that measures induction and repair of double-strand breaks (DSBs) in specific regions of the genome (Lobrich et al., Proc. Natl. Acad. Sci. USA 92, 12050-12054, 1995). The increased sensitivity resulting from these improvements makes it possible to analyze the size distribution of broken DNA molecules immediately after the introduction of DSBs and after repair incubation. This analysis shows that the distribution of broken DNA pieces after exposure to sparsely ionizing radiation is consistent with the distribution expected from randomly induced DSBs. It is apparent from the distribution of rejoined DNA pieces after repair incubation that DNA ends continue to rejoin between 3 and 24 h postirradiation and that some of these rejoining events are in fact misrejoining events, since novel restriction fragments both larger and smaller than the original fragment are generated after repair. This improved assay was also used to study the kinetics of DSB rejoining and the extent of misrejoining in identical DNA sequences in human GM38 cells and human-hamster hybrid A(L) cells containing a single human chromosome 11. Despite the numerous differences between these cells, which include species and tissue of origin, levels of TP53, expression of telomerase, and the presence or absence of a homologous chromosome for the restriction fragments examined, the kinetics of rejoining of radiation-induced DSBs and the extent of misrejoining were similar in the two cell lines when studied in the G(1) phase of the cell cycle. Furthermore, DSBs were removed from the single-copy human chromosome in the hamster A(L) cells with similar kinetics and misrejoining frequency as at a locus on this hybrid's CHO chromosomes.
SAMHD1 Sheds Moonlight on DNA Double-Strand Break Repair.
Cabello-Lobato, Maria Jose; Wang, Siyue; Schmidt, Christine Katrin
2017-12-01
SAMHD1 (sterile α motif and histidine (H) aspartate (D) domain-containing protein 1) is known for its antiviral activity of hydrolysing deoxynucleotides required for virus replication. Daddacha et al. identify a hydrolase-independent, moonlighting function of SAMHD1 that facilitates homologous recombination of DNA double-strand breaks (DSBs) by promoting recruitment of C-terminal binding protein interacting protein (CTIP), a DNA-end resection factor, to damaged DNA. These findings could benefit anticancer treatment. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Berns, K. I.; Rose, J. A.
1970-01-01
Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749
Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.
2016-01-01
DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869
Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.
2013-01-01
The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544
Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen
2015-10-29
Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.
Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis
Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf
2011-01-01
Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections. PMID:21687530
Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte
2011-01-01
Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections.
Crossovers are associated with mutation and biased gene conversion at recombination hotspots.
Arbeithuber, Barbara; Betancourt, Andrea J; Ebner, Thomas; Tiemann-Boege, Irene
2015-02-17
Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination.
Crossovers are associated with mutation and biased gene conversion at recombination hotspots
Arbeithuber, Barbara; Betancourt, Andrea J.; Ebner, Thomas; Tiemann-Boege, Irene
2015-01-01
Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination. PMID:25646453
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poeschla, Eric, E-mail: poeschla.eric@mayo.edu
Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins,more » and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import.« less
Datta, Kamal; Weinfeld, Michael; Neumann, Ronald D; Winters, Thomas A
2007-02-01
End groups contribute to the structural complexity of radiation-induced DNA double-strand breaks (DSBs). As such, end-group structures may affect a cell's ability to repair DSBs. The 3'-end groups of strand breaks caused by gamma radiation, or oxidative processes, under oxygenated aqueous conditions have been shown to be distributed primarily between 3'-phosphoglycolate and 3'-phosphate, with 5'-phosphate ends in both cases. In this study, end groups of the high-LET-like DSBs caused by 125I decay were investigated. Site-specific DNA double-strand breaks were produced in plasmid pTC27 in the presence or absence of 2 M DMSO by 125I-labeled triplex-forming oligonucleotide targeting. End-group structure was assessed enzymatically as a function of the DSB end to serve as a substrate for ligation and various forms of end labeling. Using this approach, we have demonstrated 3'-hydroxyl (3'-OH) and 3'-phosphate (3'-P) end groups and 5'-ends (> or = 42%) terminated by phosphate. A 32P postlabeling assay failed to detect 3'-phosphoglycolate in a restriction fragment terminated by the 125I-induced DNA double-strand break, and this is likely due to restricted oxygen diffusion during irradiation as a frozen aqueous solution. Even so, end-group structure and relative distribution varied as a function of the free radical scavenging capacity of the irradiation buffer.
Paugh, Steven W.; Coss, David R.; Bao, Ju; ...
2016-02-04
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paugh, Steven W.; Coss, David R.; Bao, Ju
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick
2017-01-01
Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652
Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit
Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu
2013-01-01
Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822
UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.
Baldock, Brandi L; Hutchison, James E
2016-12-20
DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.
Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel
2014-01-01
Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104
Winding single-molecule double-stranded DNA on a nanometer-sized reel
You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki
2012-01-01
A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992
Yeast Pif1 Accelerates Annealing of Complementary DNA Strands
2015-01-01
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406
Yeast Pif1 accelerates annealing of complementary DNA strands.
Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D
2014-12-09
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.
Gardner, Andrew F; Prangishvili, David; Jack, William E
2011-09-01
The hyperthermophilic Sulfolobus islandicus rod-shaped virus 2 (SIRV2) encodes a 25-kDa protein (SIRV2gp19) annotated as a hypothetical protein with sequence homology to the RecB nuclease superfamily. Even though SIRV2gp19 homologs are conserved throughout the rudivirus family and presumably play a role in the viral life cycle, SIRV2gp19 has not been functionally characterized. To define the minimal requirements for activity, SIRV2gp19 was purified and tested under varying conditions. SIRV2gp19 is a single-strand specific endonuclease that requires Mg(2+) for activity and is inactive on double-stranded DNA. A conserved aspartic acid in RecB nuclease superfamily Motif II (D89) is also essential for SIRV2gp19 activity and mutation to alanine (D89A) abolishes activity. Therefore, the SIRV2gp19 cleavage mechanism is similar to previously described RecB nucleases. Finally, SIRV2gp19 single-stranded DNA endonuclease activity could play a role in host chromosome degradation during SIRV2 lytic infection.
Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.
Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato
2018-01-01
CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.
Martin, Peter R; Couvé, Sophie; Zutterling, Caroline; Albelazi, Mustafa S; Groisman, Regina; Matkarimov, Bakhyt T; Parsons, Jason L; Elder, Rhoderick H; Saparbaev, Murat K
2017-12-12
Interstrand cross-links (ICLs) are highly cytotoxic DNA lesions that block DNA replication and transcription by preventing strand separation. Previously, we demonstrated that the bacterial and human DNA glycosylases Nei and NEIL1 excise unhooked psoralen-derived ICLs in three-stranded DNA via hydrolysis of the glycosidic bond between the crosslinked base and deoxyribose sugar. Furthermore, NEIL3 from Xenopus laevis has been shown to cleave psoralen- and abasic site-induced ICLs in Xenopus egg extracts. Here we report that human NEIL3 cleaves psoralen-induced DNA-DNA cross-links in three-stranded and four-stranded DNA substrates to generate unhooked DNA fragments containing either an abasic site or a psoralen-thymine monoadduct. Furthermore, while Nei and NEIL1 also cleave a psoralen-induced four-stranded DNA substrate to generate two unhooked DNA duplexes with a nick, NEIL3 targets both DNA strands in the ICL without generating single-strand breaks. The DNA substrate specificities of these Nei-like enzymes imply the occurrence of long uninterrupted three- and four-stranded crosslinked DNA-DNA structures that may originate in vivo from DNA replication fork bypass of an ICL. In conclusion, the Nei-like DNA glycosylases unhook psoralen-derived ICLs in various DNA structures via a genuine repair mechanism in which complex DNA lesions can be removed without generation of highly toxic double-strand breaks.
Flexible DNA Path in the MCM Double Hexamer Loaded on DNA.
Hizume, Kohji; Kominami, Hiroaki; Kobayashi, Kei; Yamada, Hirofumi; Araki, Hiroyuki
2017-05-16
The formation of the pre-replicative complex (pre-RC) during the G1 phase, which is also called the licensing of DNA replication, is the initial and essential step of faithful DNA replication during the subsequent S phase. It is widely accepted that in the pre-RC, double-stranded DNA passes through the holes of two ring-shaped minichromosome maintenance (MCM) 2-7 hexamers; however, the spatial organization of the DNA and proteins involved in pre-RC formation is unclear. Here we reconstituted the pre-RC from purified DNA and proteins and visualized the complex using atomic force microscopy (AFM). AFM revealed that the MCM double hexamers formed elliptical particles on DNA. Analysis of the angle of binding of DNA to the MCM double hexamer suggests that the DNA does not completely pass through both holes of the MCM hexamers, possibly because the DNA exited from the gap between Mcm2 and Mcm5. A DNA loop fastened by the MCM double hexamer was detected in pre-RC samples reconstituted from purified proteins as well as those purified from yeast cells, suggesting a higher-order architecture of the loaded MCM hexamers and DNA strands.
Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.
2016-01-01
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
Janssen, Aniek; Breuer, Gregory A.; Brinkman, Eva K.; ...
2016-07-15
Repair of DNA double-strand breaks (DSBs) must be properly orchestrated in diverse chromatin regions to maintain genome stability. The choice between two main DSB repair pathways, nonhomologous end-joining (NHEJ) and homologous recombination (HR), is regulated by the cell cycle as well as chromatin context. Pericentromeric heterochromatin forms a distinct nuclear domain that is enriched for repetitive DNA sequences that pose significant challenges for genome stability. Heterochromatic DSBs display specialized temporal and spatial dynamics that differ from euchromatic DSBs. Although HR is thought to be the main pathway used to repair heterochromatic DSBs, direct tests of this hypothesis are lacking. Here,more » we developed an in vivo single DSB system for both heterochromatic and euchromatic loci in Drosophila melanogaster. Live imaging of single DSBs in larval imaginal discs recapitulates the spatio-temporal dynamics observed for irradiation (IR)-induced breaks in cell culture. Importantly, live imaging and sequence analysis of repair products reveal that DSBs in euchromatin and heterochromatin are repaired with similar kinetics, employ both NHEJ and HR, and can use homologous chromosomes as an HR template. This direct analysis reveals important insights into heterochromatin DSB repair in animal tissues and provides a foundation for further explorations of repair mechanisms in different chromatin domains.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Janssen, Aniek; Breuer, Gregory A.; Brinkman, Eva K.
Repair of DNA double-strand breaks (DSBs) must be properly orchestrated in diverse chromatin regions to maintain genome stability. The choice between two main DSB repair pathways, nonhomologous end-joining (NHEJ) and homologous recombination (HR), is regulated by the cell cycle as well as chromatin context. Pericentromeric heterochromatin forms a distinct nuclear domain that is enriched for repetitive DNA sequences that pose significant challenges for genome stability. Heterochromatic DSBs display specialized temporal and spatial dynamics that differ from euchromatic DSBs. Although HR is thought to be the main pathway used to repair heterochromatic DSBs, direct tests of this hypothesis are lacking. Here,more » we developed an in vivo single DSB system for both heterochromatic and euchromatic loci in Drosophila melanogaster. Live imaging of single DSBs in larval imaginal discs recapitulates the spatio-temporal dynamics observed for irradiation (IR)-induced breaks in cell culture. Importantly, live imaging and sequence analysis of repair products reveal that DSBs in euchromatin and heterochromatin are repaired with similar kinetics, employ both NHEJ and HR, and can use homologous chromosomes as an HR template. This direct analysis reveals important insights into heterochromatin DSB repair in animal tissues and provides a foundation for further explorations of repair mechanisms in different chromatin domains.« less
Push back to respond better: regulatory inhibition of the DNA double-strand break response.
Panier, Stephanie; Durocher, Daniel
2013-10-01
Single DNA lesions such as DNA double-strand breaks (DSBs) can cause cell death or trigger genome rearrangements that have oncogenic potential, and so the pathways that mend and signal DNA damage must be highly sensitive but, at the same time, selective and reversible. When initiated, boundaries must be set to restrict the DSB response to the site of the lesion. The integration of positive and, crucially, negative control points involving post-translational modifications such as phosphorylation, ubiquitylation and acetylation is key for building fast, effective responses to DNA damage and for mitigating the impact of DNA lesions on genome integrity.
Murthy, Vaibhav; Dacus, Dalton; Gamez, Monica; Hu, Changkun; Wendel, Sebastian O; Snow, Jazmine; Kahn, Andrew; Walterhouse, Stephen H; Wallace, Nicholas A
2018-06-08
The repair of double-stranded breaks (DSBs) in DNA is a highly coordinated process, necessitating the formation and resolution of multi-protein repair complexes. This process is regulated by a myriad of proteins that promote the association and disassociation of proteins to these lesions. Thanks in large part to the ability to perform functional screens of a vast library of proteins, there is a greater appreciation of the genes necessary for the double-strand DNA break repair. Often knockout or chemical inhibitor screens identify proteins involved in repair processes by using increased toxicity as a marker for a protein that is required for DSB repair. Although useful for identifying novel cellular proteins involved in maintaining genome fidelity, functional analysis requires the determination of whether the protein of interest promotes localization, formation, or resolution of repair complexes. The accumulation of repair proteins can be readily detected as distinct nuclear foci by immunofluorescence microscopy. Thus, association and disassociation of these proteins at sites of DNA damage can be accessed by observing these nuclear foci at representative intervals after the induction of double-strand DNA breaks. This approach can also identify mis-localized repair factor proteins, if repair defects do not simultaneously occur with incomplete delays in repair. In this scenario, long-lasting double-strand DNA breaks can be engineered by expressing a rare cutting endonuclease (e.g., I-SceI) in cells where the recognition site for the said enzyme has been integrated into the cellular genome. The resulting lesion is particularly hard to resolve as faithful repair will reintroduce the enzyme's recognition site, prompting another round of cleavage. As a result, differences in the kinetics of repair are eliminated. If repair complexes are not formed, localization has been impeded. This protocol describes the methodology necessary to identify changes in repair kinetics as well as repair protein localization.
Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping
2017-03-15
This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Rydberg, Bjorn; Heilbronn, Lawrence; Holley, William R.; Lobrich, Markus; Zeitlin, Cary; Chatterjee, Aloke; Cooper, Priscilla K.
2002-01-01
Accelerated helium ions with mean energies at the target location of 3-7 MeV were used to simulate alpha-particle radiation from radon daughters. The experimental setup and calibration procedure allowed determination of the helium-ion energy distribution and dose in the nuclei of irradiated cells. Using this system, the induction of DNA double-strand breaks and their spatial distributions along DNA were studied in irradiated human fibroblasts. It was found that the apparent number of double-strand breaks as measured by a standard pulsed-field gel assay (FAR assay) decreased with increasing LET in the range 67-120 keV/microm (corresponding to the energy of 7-3 MeV). On the other hand, the generation of small and intermediate-size DNA fragments (0.1-100 kbp) increased with LET, indicating an increased intratrack long-range clustering of breaks. The fragment size distribution was measured in several size classes down to the smallest class of 0.1-2 kbp. When the clustering was taken into account, the actual number of DNA double-strand breaks (separated by at least 0.1 kbp) could be calculated and was found to be in the range 0.010-0.012 breaks/Mbp Gy(-1). This is two- to threefold higher than the apparent yield obtained by the FAR assay. The measured yield of double-strand breaks as a function of LET is compared with theoretical Monte Carlo calculations that simulate the track structure of energy depositions from helium ions as they interact with the 30-nm chromatin fiber. When the calculation is performed to include fragments larger than 0.1 kbp (to correspond to the experimental measurements), there is good agreement between experiment and theory.
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
NASA Astrophysics Data System (ADS)
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta
2016-09-01
Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.
Mechanism for accurate, protein-assisted DNA annealing by Deinococcus radiodurans DdrB
Sugiman-Marangos, Seiji N.; Weiss, Yoni M.; Junop, Murray S.
2016-01-01
Accurate pairing of DNA strands is essential for repair of DNA double-strand breaks (DSBs). How cells achieve accurate annealing when large regions of single-strand DNA are unpaired has remained unclear despite many efforts focused on understanding proteins, which mediate this process. Here we report the crystal structure of a single-strand annealing protein [DdrB (DNA damage response B)] in complex with a partially annealed DNA intermediate to 2.2 Å. This structure and supporting biochemical data reveal a mechanism for accurate annealing involving DdrB-mediated proofreading of strand complementarity. DdrB promotes high-fidelity annealing by constraining specific bases from unauthorized association and only releases annealed duplex when bound strands are fully complementary. To our knowledge, this mechanism provides the first understanding for how cells achieve accurate, protein-assisted strand annealing under biological conditions that would otherwise favor misannealing. PMID:27044084
Evaluating the role of coherent delocalized phonon-like modes in DNA cyclization
Alexandrov, Ludmil B.; Rasmussen, Kim Ã.; Bishop, Alan R.; ...
2017-08-29
The innate flexibility of a DNA sequence is quantified by the Jacobson-Stockmayer’s J-factor, which measures the propensity for DNA loop formation. Recent studies of ultra-short DNA sequences revealed a discrepancy of up to six orders of magnitude between experimentally measured and theoretically predicted J-factors. These large differences suggest that, in addition to the elastic moduli of the double helix, other factors contribute to loop formation. We develop a new theoretical model that explores how coherent delocalized phonon-like modes in DNA provide single-stranded ”flexible hinges” to assist in loop formation. We also combine the Czapla-Swigon-Olson structural model of DNA with ourmore » extended Peyrard-Bishop-Dauxois model and, without changing any of the parameters of the two models, apply this new computational framework to 86 experimentally characterized DNA sequences. Our results demonstrate that the new computational framework can predict J-factors within an order of magnitude of experimental measurements for most ultra-short DNA sequences, while continuing to accurately describe the J-factors of longer sequences. Furthermore, we demonstrate that our computational framework can be used to describe the cyclization of DNA sequences that contain a base pair mismatch. Overall, our results support the conclusion that coherent delocalized phonon-like modes play an important role in DNA cyclization.« less
Evaluating the role of coherent delocalized phonon-like modes in DNA cyclization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alexandrov, Ludmil B.; Rasmussen, Kim Ã.; Bishop, Alan R.
The innate flexibility of a DNA sequence is quantified by the Jacobson-Stockmayer’s J-factor, which measures the propensity for DNA loop formation. Recent studies of ultra-short DNA sequences revealed a discrepancy of up to six orders of magnitude between experimentally measured and theoretically predicted J-factors. These large differences suggest that, in addition to the elastic moduli of the double helix, other factors contribute to loop formation. We develop a new theoretical model that explores how coherent delocalized phonon-like modes in DNA provide single-stranded ”flexible hinges” to assist in loop formation. We also combine the Czapla-Swigon-Olson structural model of DNA with ourmore » extended Peyrard-Bishop-Dauxois model and, without changing any of the parameters of the two models, apply this new computational framework to 86 experimentally characterized DNA sequences. Our results demonstrate that the new computational framework can predict J-factors within an order of magnitude of experimental measurements for most ultra-short DNA sequences, while continuing to accurately describe the J-factors of longer sequences. Furthermore, we demonstrate that our computational framework can be used to describe the cyclization of DNA sequences that contain a base pair mismatch. Overall, our results support the conclusion that coherent delocalized phonon-like modes play an important role in DNA cyclization.« less
Theory of high-force DNA stretching and overstretching.
Storm, C; Nelson, P C
2003-05-01
Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not satisfactorily describe recent high-force stretching data. We instead propose a model (the discrete persistent chain) that borrows features from both the FJC and the wormlike chain, and show that it resembles the data more closely. We find that most of the high-force behavior previously attributed to stretch elasticity is really a feature of the corrected entropic elasticity; the true stretch compliance of single-stranded DNA is several times smaller than that found by previous authors. Next we elaborate our model to allow coexistence of two conformational states of DNA, each with its own stretch and bend elastic constants. Our model is computationally simple and gives an excellent fit through the entire overstretching transition of nicked, double-stranded DNA. The fit gives the first value for the bend stiffness of the overstretched state. In particular, we find the effective bend stiffness for DNA in this state to be about 12 nm k(B)T, a value quite different from either the B-form or single-stranded DNA.
NASA Astrophysics Data System (ADS)
Ngaojampa, C.; Nimmanpipug, P.; Yu, L. D.; Anuntalabhochai, S.; Lee, V. S.
2011-02-01
In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.
Uncovering the self-assembly of DNA nanostructures by thermodynamics and kinetics.
Wei, Xixi; Nangreave, Jeanette; Liu, Yan
2014-06-17
CONSPECTUS: DNA nanotechnology is one of the most flourishing interdisciplinary research fields. DNA nanostructures can be designed to self-assemble into a variety of periodic or aperiodic patterns of different shapes and length scales. They can be used as scaffolds for organizing other nanoparticles, proteins, and chemical groups, leveraging their functions for creating complex bioinspired materials that may serve as smart drug delivery systems, in vitro or in vivo biomolecular computing platforms, and diagnostic devices. Achieving optimal structural features, efficient assembly protocols, and precise functional group positioning and modification requires a thorough understanding of the thermodynamics and kinetics of the DNA nanostructure self-assembly process. The most common real-time measurement strategies include monitoring changes in UV absorbance based on the hyperchromic effect of DNA, and the emission signal changes of DNA intercalating dyes or covalently conjugated fluorescent dyes/pairs that accompany temperature dependent structural changes. Thermodynamic studies of a variety of DNA nanostructures have been performed, from simple double stranded DNA formation to more complex origami assembly. The key parameters that have been evaluated in terms of stability and cooperativity include the overall dimensions, the folding path of the scaffold, crossover and nick point arrangement, length and sequence of single strands, and salt and ion concentrations. DNA tile-tile interactions through sticky end hybridization have also been analyzed, and the steric inhibition and rigidity of tiles turn out to be important factors. Many kinetic studies have also been reported, and most are based on double stranded DNA formation. A two-state assumption and the hypothesis of several intermediate states have been applied to determine the rate constant and activation energy of the DNA hybridization process. A few simulated models were proposed to represent the structural, mechanical, and kinetic properties of DNA hybridization. The kinetics of strand displacement reactions has also been studied as a special case of DNA hybridization. The thermodynamic and kinetic characteristics of DNA nanostructures have been exploited to develop rapid and isothermal annealing protocols. It is conceivable that a more thorough understanding of the DNA assembly process could be used to guide the structural design process and optimize the conditions for assembly, manipulation, and functionalization, thus benefiting both upstream design and downstream applications.
Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marrot, L.; Leng, M.
The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less
Ye, Yu-Dan; Xia, Li; Xu, Dang-Dang; Xing, Xiao-Jing; Pang, Dai-Wen; Tang, Hong-Wu
2016-11-15
Based on the remarkable difference between the interactions of carbon nanoparticles (CNPs) oxide with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), and the fact that fluorescence of DNA-stabilized silver nanoclusters (AgNCs) can be quenched by CNPs oxide, DNA-functionalized AgNCs were applied as label-free fluorescence probes and a novel fluorescence resonance energy transfer (FRET) sensor was successfully constructed for the detection of human immunodeficiency virus (HIV) DNA sequences. CNPs oxide were prepared with the oxidation of candle soot, hence it is simple, time-saving and low-cost. The strategy of dual AgNCs probes was applied to improve the detection sensitivity by using dual- probe capturing the same target DNA in a sandwich mode and as the fluorescence donor, and using CNPs oxide as the acceptor. In the presence of target DNA, a dsDNA hybrid forms, leading to the desorption of the ssDNA-AgNCs probes from CNPs oxide, and the recovering of fluorescence of the AgNCs in a HIV-DNA concentration-dependent manner. The results show that HIV-DNA can be detected in the range of 1-50nM with a detection limit of 0.40nM in aqueous buffer. The method is simple, rapid and sensitive with no need of labeled fluorescent probes, and moreover, the design of fluorescent dual-probe makes full use of the excellent fluorescence property of AgNCs and further improves the detection sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.
Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Cucinotta, Francis A.
2010-01-01
Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Recent Advances in Chemical Modification of Peptide Nucleic Acids
Rozners, Eriks
2012-01-01
Peptide nucleic acid (PNA) has become an extremely powerful tool in chemistry and biology. Although PNA recognizes single-stranded nucleic acids with exceptionally high affinity and sequence selectivity, there is considerable ongoing effort to further improve properties of PNA for both fundamental science and practical applications. The present paper discusses selected recent studies that improve on cellular uptake and binding of PNA to double-stranded DNA and RNA. The focus is on chemical modifications of PNA's backbone and heterocyclic nucleobases. The paper selects representative recent studies and does not attempt to provide comprehensive coverage of the broad and vibrant field of PNA modification. PMID:22991652