Synthesis of DNA

DOEpatents

Mariella, Jr., Raymond P.

2008-11-18

A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

Two-Tailed Comet Assay (2T-Comet): Simultaneous Detection of DNA Single and Double Strand Breaks.

PubMed

Cortés-Gutiérrez, Elva I; Fernández, José Luis; Dávila-Rodríguez, Martha I; López-Fernández, Carmen; Gosálvez, Jaime

2017-01-01

A modification of the original comet assay was developed for the simultaneous evaluation of DNA single strand breaks (SSBs) and double strand breaks (DSBs) in human spermatozoa. The two-dimensional perpendicular tail comet assay (2T-comet) combines non-denaturing and denaturant conditions to the same sperm nucleoid. In this case, the species-specific deproteinized sperm is first subjected to an electrophoretic field under non-denaturing conditions to mobilize isolated free discrete DNA fragments produced from DSBs; this is then followed by a second electrophoresis running perpendicular to the first one but under alkaline conditions to produce DNA denaturation, exposing SSBs on the same linear DNA chain or DNA fragments flanked by DSBs. This procedure results in a two dimensional comet tail emerging from the core where two types of original DNA affected molecule can be simultaneously discriminated. The 2T-comet is a fast, sensitive, and reliable procedure to distinguish between single and double strand DNA damage within the same cell. It is an innovative method for assessing sperm DNA integrity, which has important implications for human fertility and andrological pathology. This technique may be adapted to assess different DNA break types in other species and other cell types.

Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

PubMed

Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Cornière, Axelle; Takahashi, Masayuki; Nordén, Bengt

2012-06-01

Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

An electrochemical biosensor for double-stranded Wnt7B gene detection based on enzymatic isothermal amplification.

PubMed

Li, Junlong; Chen, Zhongping; Xiang, Yu; Zhou, Lili; Wang, Ting; Zhang, Zhang; Sun, Kexin; Yin, Dan; Li, Yi; Xie, Guoming

2016-12-15

Wnt7B gene plays an important role in the development and progression of breast cancer, gastric cancer, esophageal cancer and pancreatic cancer. While, the natural state of DNA is double stranded, which makes it difficult to be directly detected. Here, we develop an electrochemical biosensor method for Wnt7B gene detection without the need to denature the target. This method firstly used nicking enzyme for exploiting in the double-stranded DNA (dsDNA). Then, long single-stranded DNA (ssDNA) was generated from the cutting site through polymerase extension reaction. Whereafter, the long ssDNA triggered a hairpin self-assembly recycling reaction, which gave rise to another isothermal amplification reaction. Last, short ssDNA was formed after the this amplification process, which could hybridize with the capture probe immobilized on Au electrode and result in signal variation. This method showed excellent analytical performance for dsDNA, of which the linear range was 2fM to 500pM and the detection limit was 1.6fM (S/N=3). It also showed an good results when applied to the real sample of Wnt7B gene detection. Copyright © 2016 Elsevier B.V. All rights reserved.

Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

PubMed

Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

2002-07-01

The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

Single- and double-strand break formation in DNA irradiated in aqueous solution: dependence on dose and OH radical scavenger concentration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siddiqi, M.A.; Bothe, E.

The yields of single- and double-strand breaks (SSB and DSB) in calf thymus DNA, after /sup 60/Co gamma irradiation in dilute aqueous solution, have been determined via molecular weight measurements using a low-angle laser light scattering technique. The irradiations were administered to N/sub 2/O-containing solutions of DNA in the absence and presence of oxygen and with different concentrations of the OH radical scavengers phenol, tertiary butanol, and methanol. OH radicals were found to produce SSB linearly with dose with a G value of 55 nmol J-1 and 54 nmol J-1 in deoxygenated and oxygenated solutions, respectively. DSB were formed accordingmore » to a linear-quadratic dose relationship and the G value of linearly formed DSB were GDSB alpha(r.t.) = 3.5 nmol J-1 in deoxygenated and 3.2 nmol J-1 in oxygenated solution. The ratio of GSSB/GDSB alpha(r.t.) = gamma of 19 +/- 6 was independent of the scavenger concentration in the case of tertiary butanol and methanol-containing solutions. GDSB alpha(r.t.) is interpreted to result from a radical site transferred from a sugar moiety of the cleaved strand to the complementary intact strand. This process of radical transfer and subsequent cleavage of the second strand occurs with a probability of about 6 +/- 2% in the presence of oxygen at all scavenger concentrations studied. These data on scavenging capacity on GDSB alpha(r.t.) suggest that the double-strand breakage produced via radical transfer remains higher than that resulting from direct effect, up to scavenging capacities of about 10(9) s-1.« less

Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA

NASA Astrophysics Data System (ADS)

Kringle, Loni; Sawaya, Nicolas P. D.; Widom, Julia; Adams, Carson; Raymer, Michael G.; Aspuru-Guzik, Alán; Marcus, Andrew H.

2018-02-01

Understanding the properties of electronically interacting molecular chromophores, which involve internally coupled electronic-vibrational motions, is important to the spectroscopy of many biologically relevant systems. Here we apply linear absorption, circular dichroism, and two-dimensional fluorescence spectroscopy to study the polarized collective excitations of excitonically coupled cyanine dimers (Cy3)2 that are rigidly positioned within the opposing sugar-phosphate backbones of the double-stranded region of a double-stranded (ds)-single-stranded (ss) DNA fork construct. We show that the exciton-coupling strength of the (Cy3)2-DNA construct can be systematically varied with temperature below the ds-ss DNA denaturation transition. We interpret spectroscopic measurements in terms of the Holstein vibronic dimer model, from which we obtain information about the local conformation of the (Cy3)2 dimer, as well as the degree of static disorder experienced by the Cy3 monomer and the (Cy3)2 dimer probe locally within their respective DNA duplex environments. The properties of the (Cy3)2-DNA construct we determine suggest that it may be employed as a useful model system to test fundamental concepts of protein-DNA interactions and the role of electronic-vibrational coherence in electronic energy migration within exciton-coupled bio-molecular arrays.

Programmable motion of DNA origami mechanisms.

PubMed

Marras, Alexander E; Zhou, Lifeng; Su, Hai-Jun; Castro, Carlos E

2015-01-20

DNA origami enables the precise fabrication of nanoscale geometries. We demonstrate an approach to engineer complex and reversible motion of nanoscale DNA origami machine elements. We first design, fabricate, and characterize the mechanical behavior of flexible DNA origami rotational and linear joints that integrate stiff double-stranded DNA components and flexible single-stranded DNA components to constrain motion along a single degree of freedom and demonstrate the ability to tune the flexibility and range of motion. Multiple joints with simple 1D motion were then integrated into higher order mechanisms. One mechanism is a crank-slider that couples rotational and linear motion, and the other is a Bennett linkage that moves between a compacted bundle and an expanded frame configuration with a constrained 3D motion path. Finally, we demonstrate distributed actuation of the linkage using DNA input strands to achieve reversible conformational changes of the entire structure on ∼ minute timescales. Our results demonstrate programmable motion of 2D and 3D DNA origami mechanisms constructed following a macroscopic machine design approach.

Programmable motion of DNA origami mechanisms

PubMed Central

Marras, Alexander E.; Zhou, Lifeng; Su, Hai-Jun; Castro, Carlos E.

2015-01-01

DNA origami enables the precise fabrication of nanoscale geometries. We demonstrate an approach to engineer complex and reversible motion of nanoscale DNA origami machine elements. We first design, fabricate, and characterize the mechanical behavior of flexible DNA origami rotational and linear joints that integrate stiff double-stranded DNA components and flexible single-stranded DNA components to constrain motion along a single degree of freedom and demonstrate the ability to tune the flexibility and range of motion. Multiple joints with simple 1D motion were then integrated into higher order mechanisms. One mechanism is a crank–slider that couples rotational and linear motion, and the other is a Bennett linkage that moves between a compacted bundle and an expanded frame configuration with a constrained 3D motion path. Finally, we demonstrate distributed actuation of the linkage using DNA input strands to achieve reversible conformational changes of the entire structure on ∼minute timescales. Our results demonstrate programmable motion of 2D and 3D DNA origami mechanisms constructed following a macroscopic machine design approach. PMID:25561550

Human Immunodeficiency Virus Integration Protein Expressed in Escherichia Coli Possesses Selective DNA Cleaving Activity

NASA Astrophysics Data System (ADS)

Sherman, Paula A.; Fyfe, James A.

1990-07-01

The human immunodeficiency virus (HIV) integration protein, a potential target for selective antiviral therapy, was expressed in Escherichia coli. The purified protein, free of detectable contaminating endonucleases, selectively cleaved double-stranded DNA oligonucleotides that mimic the U3 and the U5 termini of linear HIV DNA. Two nucleotides were removed from the 3' ends of both the U5 plus strand and the U3 minus strand; in both cases, cleavage was adjacent to a conserved CA dinucleotide. The reaction was metal-ion dependent, with a preference for Mn2+ over Mg2+. Reaction selectivity was further demonstrated by the lack of cleavage of an HIV U5 substrate on the complementary (minus) strand, an analogous substrate that mimics the U3 terminus of an avian retrovirus, and an HIV U5 substrate in which the conserved CA dinucleotide was replaced with a TA dinucleotide. Such an integration protein-mediated cleavage reaction is expected to occur as part of the integration event in the retroviral life cycle, in which a double-stranded DNA copy of the viral RNA genome is inserted into the host cell DNA.

The influence of DNA inhibitor synthesis on the induction and repair of double-strand DNA breaks in human lymphocytes under action of radiation with a different linear energy transfer

NASA Astrophysics Data System (ADS)

Boreyko, A. V.; Chausov, V. N.; Krasavin, E. A.; Ravnachka, I.; Stukova, S. I.

2011-07-01

The influence that inhibitors of repair and replicative DNA synthesis, 1-β-D-arabinofuranosyl-cytosine and hydroxyurea, have on the formation and repair kinetics of double-strand breaks (DSBs) in peripheral human blood lymphocytes under the influence of radiation with a different linear energy transfer (LET) (gamma quanta and accelerated heavy ions) is studied. It is demonstrated that lithium and boron ions with LETs of 20 and 40 keV/μm, respectively, possess higher biological effectiveness with respect to the DNA DSB induction criterion. The value of the relative biological effectiveness of accelerated lithium and boron ions is 1.5 ± 0.1 and 1.6 ± 0.1, respectively. It is found that, upon cell irradiation by gamma quanta in the absence of inhibitors, efficient DNA DSB repair is observed during incubation. Under the conditions of cell incubation and in the presence of inhibitors, some growth in the number of DNA DSBs, rather than a reduction, is observed after 5-h incubation. In the case of the action of accelerated boron ions (as well as gamma quanta), under normal conditions, the efficient repair of induced DNA lesions takes place. Unlike the action of gamma quanta, in the case of cell incubation in the presence of radiomodifiers, the number of induced DNA DSBs falls. These results may testify to the fact that the repair of double-strand DNS breaks takes place under the action of ionizing radiation with a different LET on mammalian cells in the presence of DNA synthesis inhibitors Ara-C and HU. It is concluded that, for cells subject to gamma irradiation, no DNA DSB repair is observed due to the large contribution of single-strand incision DNA breaks formed in the postradiation period in the course of excision nucleotide repair.

DNA purification by triplex-affinity capture and affinity capture electrophoresis

DOEpatents

Cantor, Charles R.; Ito, Takashi; Smith, Cassandra L.

1996-01-01

The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel.

Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

NASA Astrophysics Data System (ADS)

Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

2015-02-01

In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

NASA Technical Reports Server (NTRS)

Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

2000-01-01

Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

DNA double-strand breaks induced by high-energy neon and iron ions in human fibroblasts. II. Probing individual notI fragments by hybridization.

PubMed

Löbrich, M; Rydberg, B; Cooper, P K

1994-08-01

The initial yields of DNA double-strand breaks induced by energetic heavy ions (425 MeV/u neon and 250, 400 and 600 MeV/u iron) in comparison to X rays were measured in normal human diploid fibroblast cells within three small areas of the genome, defined by NotI fragments of 3.2, 2.0 and 1.2 Mbp. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated cells, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with probes recognizing single-copy sequences within the three NotI fragments. The gradual disappearance of the full-size NotI fragment with dose and the appearance of a smear of broken DNA molecules are quantified. Assuming Poisson statistics for the number of double-strand breaks induced per NotI fragment of known size, absolute yields of DNA double-strand breaks were calculated and determined to be linear with dose in all cases, with the neon ion (LET 32 keV/microns) producing 4.4 x 10(-3) breaks/Mbp/Gy and all three iron-ion beams (LETs from 190 to 350 keV/microns) producing 2.8 x 10(-3) breaks/Mbp/Gy, giving RBE values for production of double-strand breaks of 0.76 for neon and 0.48 for iron in comparison to our previously determined X-ray induction rate of 5.8 x 10(-3) breaks/Mbp/Gy. These RBE values are in good agreement with results of measurements over the whole genome as reported in the accompanying paper (B. Rydberg, M. Löbrich and P. Cooper, Radiat. Res. 139, 133-141, 1994). The distribution of broken DNA molecules was similar for the various radiations, supporting a random distribution of double-strand breaks induced by the heavy ions over Mbp distances; however, correlated breaks (clusters) over much smaller distances are not ruled out. Reconstitution of the 3.2 Mbp NotI fragment was studied during postirradiation incubation of the cells as a measure of rejoining of correct DNA ends. The proportion of breaks repaired decreased with increasing LET.

Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

NASA Technical Reports Server (NTRS)

Rydberg, B.; Chatterjee, A. (Principal Investigator)

1996-01-01

The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

Homologous Recombination Repair Signaling in Chemical Carcinogenesis: Prolonged Particulate Hexavalent Chromium Exposure Suppresses the Rad51 Response in Human Lung Cells

PubMed Central

Qin, Qin; Xie, Hong; Wise, Sandra S.; Browning, Cynthia L.; Thompson, Kelsey N.; Holmes, Amie L.; Wise, John Pierce

2014-01-01

The aim of this study was to focus on hexavalent chromium, [Cr(VI)], a chemical carcinogen and major public health concern, and consider its ability to impact DNA double strand break repair. We further focused on particulate Cr(VI), because it is the more potent carcinogenic form of Cr(VI). DNA double strand break repair serves to protect cells against the detrimental effects of DNA double strand breaks. For particulate Cr(VI), data show DNA double strand break repair must be overcome for neoplastic transformation to occur. Acute Cr(VI) exposures reveal a robust DNA double strand break repair response, however, longer exposures have not been considered. Using the comet assay, we found longer exposures to particulate zinc chromate induced concentration-dependent increases in DNA double strand breaks indicating breaks were occurring throughout the exposure time. Acute (24 h) exposure induced DNA double strand break repair signaling by inducing Mre11 foci formation, ATM phosphorylation and phosphorylated ATM foci formation, Rad51 protein levels and Rad51 foci formation. However, longer exposures reduced the Rad51 response. These data indicate a major chemical carcinogen can simultaneously induce DNA double strand breaks and alter their repair and describe a new and important aspect of the carcinogenic mechanism for Cr(VI). PMID:25173789

DNA purification by triplex-affinity capture and affinity capture electrophoresis

DOEpatents

Cantor, C.R.; Ito, Takashi; Smith, C.L.

1996-01-09

The invention provides a method for purifying or isolating double stranded DNA intact using triple helix formation. The method includes the steps of complexing an oligonucleotide and double stranded DNA to generate a triple helix and immobilization of the triple helix on a solid phase by means of a molecular recognition system such as avidin/biotin. The purified DNA is then recovered intact by treating the solid phase with a reagent that breaks the bonds between the oligonucleotide and the intact double stranded DNA while not affecting the Watson-Crick base pairs of the double helix. The present invention also provides a method for purifying or isolating double stranded DNA intact by complexing the double stranded DNA with a specific binding partner and recovering the complex during electrophoresis by immobilizing it on a solid phase trap imbedded in an electrophoretic gel. 6 figs.

Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Stasiak, Andrzej

2016-09-01

Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

PubMed

Thomason, Lynn C; Costantino, Nina; Court, Donald L

2016-09-13

Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.

Morphology and genome organization of the virus PSV of the hyperthermophilic archaeal genera Pyrobaculum and Thermoproteus: a novel virus family, the Globuloviridae.

PubMed

Häring, Monika; Peng, Xu; Brügger, Kim; Rachel, Reinhard; Stetter, Karl O; Garrett, Roger A; Prangishvili, David

2004-06-01

A novel virus, termed Pyrobaculum spherical virus (PSV), is described that infects anaerobic hyperthermophilic archaea of the genera Pyrobaculum and Thermoproteus. Spherical enveloped virions, about 100 nm in diameter, contain a major multimeric 33-kDa protein and host-derived lipids. A viral envelope encases a superhelical nucleoprotein core containing linear double-stranded DNA. The PSV infection cycle does not cause lysis of host cells. The viral genome was sequenced and contains 28337 bp. The genome is unique for known archaeal viruses in that none of the genes, including that encoding the major structural protein, show any significant sequence matches to genes in public sequence databases. Exceptionally for an archaeal double-stranded DNA virus, almost all the recognizable genes are located on one DNA strand. The ends of the genome consist of 190-bp inverted repeats that contain multiple copies of short direct repeats. The two DNA strands are probably covalently linked at their termini. On the basis of the unusual morphological and genomic properties of this DNA virus, we propose to assign PSV to a new viral family, the Globuloviridae.

Adenovirus Core Protein VII Protects the Viral Genome from a DNA Damage Response at Early Times after Infection▿

PubMed Central

Karen, Kasey A.; Hearing, Patrick

2011-01-01

Adenovirus has a linear, double-stranded DNA genome that is perceived by the cellular Mre11-Rad50-Nbs1 (MRN) DNA repair complex as a double-strand break. If unabated, MRN elicits a double-strand break repair response that blocks viral DNA replication and ligates the viral genomes into concatemers. There are two sets of early viral proteins that inhibit the MRN complex. The E1B-55K/E4-ORF6 complex recruits an E3 ubiquitin ligase and targets MRN proteins for proteasome-dependent degradation. The E4-ORF3 protein inhibits MRN through sequestration. The mechanism that prevents MRN recognition of the viral genome prior to the expression of these early proteins was previously unknown. Here we show a temporal correlation between the loss of viral core protein VII from the adenovirus genome and a gain of checkpoint signaling due to the double-strand break repair response. While checkpoint signaling corresponds to the recognition of the viral genome, core protein VII binding to and checkpoint signaling at viral genomes are largely mutually exclusive. Transcription is known to release protein VII from the genome, and the inhibition of transcription shows a decrease in checkpoint signaling. Finally, we show that the nuclease activity of Mre11 is dispensable for the inhibition of viral DNA replication during a DNA damage response. These results support a model involving the protection of the incoming viral genome from checkpoint signaling by core protein VII and suggest that the induction of an MRN-dependent DNA damage response may inhibit adenovirus replication by physically masking the origins of DNA replication rather than altering their integrity. PMID:21345950

Construction of a Holliday Junction in Small Circular DNA Molecules for Stable Motifs and Two-Dimensional Lattices.

PubMed

Guo, Xin; Wang, Xue-Mei; Wei, Shuai; Xiao, Shou-Jun

2018-04-12

Design rules for DNA nanotechnology have been mostly learnt from using linear single-stranded (ss) DNA as the source material. For example, the core structure of a typical DAO (double crossover, antiparallel, odd half-turns) tile for assembling 2D lattices is constructed from only two linear ss-oligonucleotide scaffold strands, similar to two ropes making a square knot. Herein, a new type of coupled DAO (cDAO) tile and 2D lattices of small circular ss-oligonucleotides as scaffold strands and linear ss-oligonucleotides as staple strands are reported. A cDAO tile of cDAO-c64nt (c64nt: circular 64 nucleotides), shaped as a solid parallelogram, is constructed with a Holliday junction (HJ) at the center and two HJs at both poles of a c64nt; similarly, cDAO-c84nt, shaped as a crossed quadrilateral composed of two congruent triangles, is formed with a HJ at the center and four three-way junctions at the corners of a c84nt. Perfect 2D lattices were assembled from cDAO tiles: infinite nanostructures of nanoribbons, nanotubes, and nanorings, and finite nanostructures. The structural relationship between the visible lattices imaged by AFM and the corresponding invisible secondary and tertiary molecular structures of HJs, inclination angle of hydrogen bonds against the double-helix axis, and the chirality of the tile can be interpreted very well. This work could shed new light on DNA nanotechnology with unique circular tiles. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quantitative, non-invasive imaging of radiation-induced DNA double strand breaks in vivo

PubMed Central

Li, Wenrong; Li, Fang; Huang, Qian; Shen, Jingping; Wolf, Frank; He, Yujun; Liu, Xinjian; Hu, Y. Angela; Bedford, Joel. S.; Li, Chuan-Yuan

2011-01-01

DNA double strand breaks is a major form of DNA damage and a key mechanism through which radiotherapy and some chemotherapeutic agents kill cancer cells. Despite its importance, measuring DNA double strand breaks is still a tedious task that is normally carried out by gel electrophoresis or immunofluorescence staining. Here we report a novel approach to image and quantify DNA double strand breaks in live mammalian cells through bi-fragment luciferase reconstitution. N- and C- terminal fragments of firefly luciferase gene were fused with H2AX and MDC1 genes, respectively. Our strategy was based on the established fact that at the sites of DNA double strand breaks, H2AX protein is phosphoryated and physically associates with the MDC1 protein, thus bringing together N- and C- luciferase fragments and reconstituting luciferase activity. Our strategy allowed serial, non-invasive quantification of DNA double strand breaks in cells irradiated with x-rays and 56Fe ions. Furthermore, it allowed for the evaluation of DNA double strand breaks (DSBs) non-invasively in vivo in irradiated tumors over two weeks. Surprisingly, we detected a second wave of DSB induction in irradiated tumor cells days after radiation exposure in addition to the initial rapid induction of DSBs. We conclude that our new split-luciferase based method for imaging γ-H2AX-MDC1 interaction is a powerful new tool to study DNA double strand break repair kinetics in vivo with considerable advantage for experiments requiring observations over an extended period of time. PMID:21527553

Molecular Precision at Micrometer Length Scales: Hierarchical Assembly of DNA-Protein Nanostructures.

PubMed

Schiffels, Daniel; Szalai, Veronika A; Liddle, J Alexander

2017-07-25

Robust self-assembly across length scales is a ubiquitous feature of biological systems but remains challenging for synthetic structures. Taking a cue from biology-where disparate molecules work together to produce large, functional assemblies-we demonstrate how to engineer microscale structures with nanoscale features: Our self-assembly approach begins by using DNA polymerase to controllably create double-stranded DNA (dsDNA) sections on a single-stranded template. The single-stranded DNA (ssDNA) sections are then folded into a mechanically flexible skeleton by the origami method. This process simultaneously shapes the structure at the nanoscale and directs the large-scale geometry. The DNA skeleton guides the assembly of RecA protein filaments, which provides rigidity at the micrometer scale. We use our modular design strategy to assemble tetrahedral, rectangular, and linear shapes of defined dimensions. This method enables the robust construction of complex assemblies, greatly extending the range of DNA-based self-assembly methods.

Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing.

PubMed

Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L

2016-05-01

Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.

Induction of single- and double-strand breaks in plasmid DNA by monoenergetic alpha-particles with energies below the Bragg-maximum.

PubMed

Scholz, V; Weidner, J; Köhnlein, W; Frekers, D; Wörtche, H J

1997-01-01

The yield of single-strand breaks (ssb) and double-strand breaks (dsb) produced by alpha-particles at the end of their track in DNA-films was determined experimentally. Helium nuclei were accelerated to 600 keV in the 400 kV ion accelerator and scattered at a carbon target. The elastically scattered alpha-particles with energies of 344 keV and 485 keV were used to irradiate supercircular plasmid DNA in vacuo. For the dosimetry of the alpha-particles a surface barrier detector was used and the energy distribution of the alpha-particles determined. The energy loss of the particles in the DNA-layer was calculated. DNA samples were separated into the three conformational isomers using agarose gel electrophoresis. After fluorochromation the number of ssb and dsb per plasmid DNA molecule was established from the band intensities assuming the validity of Poisson statistics. Linear dose effect correlations were found for ssb and dsb per plasmid molecule. In the case of 344 keV-alpha-particles the yield of dsb was (8.6 +/- 0.9) x 10(-11) breaks/Gy x dalton. The ratio of ssb/dsb was 0.5 +/- 0.2. This is at least a factor of six larger than the ratio found in experiments with higher energy alpha-particles and from model calculations. Similar experiments with protons yielded a relative biological effectiveness (rbe) value of 2.8 for the induction of double-strand breaks by track end alpha-particles.

Double stranded nucleic acid biochips

DOEpatents

Chernov, Boris; Golova, Julia

2006-05-23

This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.

PubMed

Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V

2017-09-22

Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.

The Human L1 Element Causes DNA Double-Strand Breaks in Breast Cancer

DTIC Science & Technology

2006-08-01

cancer is complex. However, defects in DNA repair genes in the double-strand break repair pathway are cancer predisposing. My lab has characterized...a new potentially important source of double-strand breaks (DSBs) in human cells and are interested in characterizing which DNA repair genes act on...this particular source of DNA damage. Selfish DNA accounts for 45% of the human genome. We have recently demonstrated that one particular selfish

Can a double stranded DNA be unzipped by pulling a single strand?: phases of adsorbed DNA.

PubMed

Kapri, Rajeev

2009-04-14

We study the unzipping of a double stranded DNA (dsDNA) by applying an external force on a single strand while leaving the other strand free. We find that the dsDNA can be unzipped to two single strands if the external force exceeds a critical value. We obtain the phase diagram, which is found to be different from the phase diagram of unzipping by pulling both the strands in opposite directions. In the presence of an attractive surface near DNA, the phase diagram gets modified drastically and shows richer surprises including a critical end point and a triple point.

Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

1984-02-01

Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

DNA recombination-initiation plays a role in the extremely biased inheritance of yeast [rho-] mitochondrial DNA that contains the replication origin ori5.

PubMed

Ling, Feng; Hori, Akiko; Shibata, Takehiko

2007-02-01

Hypersuppressiveness, as observed in Saccharomyces cerevisiae, is an extremely biased inheritance of a small mitochondrial DNA (mtDNA) fragment that contains a replication origin (HS [rho(-)] mtDNA). Our previous studies showed that concatemers (linear head-to-tail multimers) are obligatory intermediates for mtDNA partitioning and are primarily formed by rolling-circle replication mediated by Mhr1, a protein required for homologous mtDNA recombination. In this study, we found that Mhr1 is required for the hypersuppressiveness of HS [ori5] [rho(-)] mtDNA harboring ori5, one of the replication origins of normal ([rho(+)]) mtDNA. In addition, we detected an Ntg1-stimulated double-strand break at the ori5 locus. Purified Ntg1, a base excision repair enzyme, introduced a double-stranded break by itself into HS [ori5] [rho(-)] mtDNA at ori5 isolated from yeast cells. Both hypersuppressiveness and concatemer formation of HS [ori5] [rho(-)] mtDNA are simultaneously suppressed by the ntg1 null mutation. These results support a model in which, like homologous recombination, rolling-circle HS [ori5] [rho(-)] mtDNA replication is initiated by double-stranded breakage in ori5, followed by Mhr1-mediated homologous pairing of the processed nascent DNA ends with circular mtDNA. The hypersuppressiveness of HS [ori5] [rho(-)] mtDNA depends on a replication advantage furnished by the higher density of ori5 sequences and on a segregation advantage furnished by the higher genome copy number on transmitted concatemers.

Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament

PubMed Central

Fornander, Louise H.; Renodon-Cornière, Axelle; Kuwabara, Naoyuki; Ito, Kentaro; Tsutsui, Yasuhiro; Shimizu, Toshiyuki; Iwasaki, Hiroshi; Nordén, Bengt; Takahashi, Masayuki

2014-01-01

The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction. PMID:24304898

Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament.

PubMed

Fornander, Louise H; Renodon-Cornière, Axelle; Kuwabara, Naoyuki; Ito, Kentaro; Tsutsui, Yasuhiro; Shimizu, Toshiyuki; Iwasaki, Hiroshi; Nordén, Bengt; Takahashi, Masayuki

2014-02-01

The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.

A simple method for the computation of first neighbour frequencies of DNAs from CD spectra

PubMed Central

Marck, Christian; Guschlbauer, Wilhelm

1978-01-01

A procedure for the computation of the first neighbour frequencies of DNA's is presented. This procedure is based on the first neighbour approximation of Gray and Tinoco. We show that the knowledge of all the ten elementary CD signals attached to the ten double stranded first neighbour configurations is not necessary. One can obtain the ten frequencies of an unknown DNA with the use of eight elementary CD signals corresponding to eight linearly independent polymer sequences. These signals can be extracted very simply from any eight or more CD spectra of double stranded DNA's of known frequencies. The ten frequencies of a DNA are obtained by least square fit of its CD spectrum with these elementary signals. One advantage of this procedure is that it does not necessitate linear programming, it can be used with CD data digitalized using a large number of wavelengths, thus permitting an accurate resolution of the CD spectra. Under favorable case, the ten frequencies of a DNA (not used as input data) can be determined with an average absolute error < 2%. We have also observed that certain satellite DNA's, those of Drosophila virilis and Callinectes sapidus have CD spectra compatible with those of DNA's of quasi random sequence; these satellite DNA's should adopt also the B-form in solution. PMID:673843

Flow cytomeric measurement of DNA and incorporated nucleoside analogs

DOEpatents

Dolbeare, Frank A.; Gray, Joe W.

1989-01-01

A method is provided for simultaneously measuring total cellular DNA and incorporated nucleoside analog. The method entails altering the cellular DNA of cells grown in the presence of a nucleoside analog so that single stranded and double stranded portions are present. Separate stains are used against the two portions. An immunochemical stain is used against the single stranded portion to provide a measure of incorporated nucleoside analog, and a double strand DNA-specific stain is used against the double stranded portion to simultaneously provide a measure of total cellular DNA. The method permits rapid flow cytometric analysis of cell populations, rapid identification of cycling and noncycling subpopulations, and determination of the efficacy of S phase cytotoxic anticancer agents.

Surface shapes and surrounding environment analysis of single- and double-stranded DNA-binding proteins in protein-DNA interface.

PubMed

Wang, Wei; Liu, Juan; Sun, Lin

2016-07-01

Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Quantitative analysis and prediction of G-quadruplex forming sequences in double-stranded DNA

PubMed Central

Kim, Minji; Kreig, Alex; Lee, Chun-Ying; Rube, H. Tomas; Calvert, Jacob; Song, Jun S.; Myong, Sua

2016-01-01

Abstract G-quadruplex (GQ) is a four-stranded DNA structure that can be formed in guanine-rich sequences. GQ structures have been proposed to regulate diverse biological processes including transcription, replication, translation and telomere maintenance. Recent studies have demonstrated the existence of GQ DNA in live mammalian cells and a significant number of potential GQ forming sequences in the human genome. We present a systematic and quantitative analysis of GQ folding propensity on a large set of 438 GQ forming sequences in double-stranded DNA by integrating fluorescence measurement, single-molecule imaging and computational modeling. We find that short minimum loop length and the thymine base are two main factors that lead to high GQ folding propensity. Linear and Gaussian process regression models further validate that the GQ folding potential can be predicted with high accuracy based on the loop length distribution and the nucleotide content of the loop sequences. Our study provides important new parameters that can inform the evaluation and classification of putative GQ sequences in the human genome. PMID:27095201

Detecting the Length of Double-stranded DNA with Solid State Nanopores

NASA Astrophysics Data System (ADS)

Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene

2003-03-01

We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).

Mechanism for circularization of linear DNAs: circular parvovirus MVM DNA is formed by a "noose" sliding in a "lasso"-like DNA structure.

PubMed

Bratosin, S; Laub, O; Tal, J; Aloni, Y

1979-09-01

During an electron-microscopic survey with the aim of identifying the parvovirus MVM transcription template, we observed previously unidentified structures of MVM DNA in lysates of virus-infected cells. These included double-stranded "lasso"-like structures and relaxed circles. Both structures were of unit length MVM DNA, indicating that they were not intermediates formed during replication; they each represented about 5% of the total nuclear MVM DNA. The proportion of these structures was unchanged after digestion with sodium dodecyl sulfate/Pronase and RNase and after mild denaturation treatment. Cleavage of the "lasso" structures with EcoRI restriction endonuclease indicated that the "noose" part of the "lasso" structure is located on the 5' side of the genomic single-stranded MVM DNA. A model is presented for the molecular nature of the circularization process of MVM DNA in which the "lasso" structures are identified as intermediates during circle formation. This model proposes a mechanism for circularization of linear DNAs.

Linear nicking endonuclease-mediated strand-displacement DNA amplification.

PubMed

Joneja, Aric; Huang, Xiaohua

2011-07-01

We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand-displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to 5000 nucleotides can be linearly amplified using a nicking endonuclease with 7-bp recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length is linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. Copyright © 2011 Elsevier Inc. All rights reserved.

Linear nicking endonuclease-mediated strand displacement DNA amplification

PubMed Central

Joneja, Aric; Huang, Xiaohua

2011-01-01

We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to five thousand nucleotides can be linearly amplified using a nicking endonuclease with seven base-pair recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length are linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. PMID:21342654

Quantitative Analysis of HIV-1 Preintegration Complexes

PubMed Central

Engelman, Alan; Oztop, Ilker; Vandegraaff, Nick; Raghavendra, Nidhanapati K.

2009-01-01

Retroviral replication proceeds through the formation of a provirus, an integrated DNA copy of the viral RNA genome. The linear cDNA product of reverse transcription is the integration substrate and two different integrase activities, 3′ processing and DNA strand transfer, are required for provirus formation. Integrase nicks the cDNA ends adjacent to phylogenetically-conserved CA dinucleotides during 3′ processing. After nuclear entry and locating a suitable chromatin acceptor site, integrase joins the recessed 3′-OHs to the 5′-phosphates of a double-stranded staggered cut in the DNA target. Integrase functions in the context of a large nucleoprotein complex, called the preintegration complex (PIC), and PICs are analyzed to determine levels of integrase 3′ processing and DNA strand transfer activities that occur during acute virus infection. Denatured cDNA end regions are monitored by indirect end-labeling to measure the extent of 3′ processing. Native PICs can efficiently integrate their viral cDNA into exogenously added target DNA in vitro, and Southern blotting or nested PCR assays are used to quantify the resultant DNA strand transfer activity. This study details HIV-1 infection, PIC extraction, partial purification, and quantitative analyses of integrase 3′ processing and DNA strand transfer activities. PMID:19233280

Cisplatin enhances the formation of DNA single- and double-strand breaks by hydrated electrons and hydroxyl radicals.

PubMed

Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J

2013-03-01

The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing radiation.

Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

PubMed Central

Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

2015-01-01

In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

RAP80, ubiquitin and SUMO in the DNA damage response.

PubMed

Lombardi, Patrick M; Matunis, Michael J; Wolberger, Cynthia

2017-08-01

A decade has passed since the first reported connection between RAP80 and BRCA1 in DNA double-strand break repair. Despite the initial identification of RAP80 as a factor localizing BRCA1 to DNA double-strand breaks and potentially promoting homologous recombination, there is increasing evidence that RAP80 instead suppresses homologous recombination to fine-tune the balance of competing DNA repair processes during the S/G 2 phase of the cell cycle. RAP80 opposes homologous recombination by inhibiting DNA end-resection and sequestering BRCA1 into the BRCA1-A complex. Ubiquitin and SUMO modifications of chromatin at DNA double-strand breaks recruit RAP80, which contains distinct sequence motifs that recognize ubiquitin and SUMO. Here, we review RAP80's role in repressing homologous recombination at DNA double-strand breaks and how this role is facilitated by its ability to bind ubiquitin and SUMO modifications.

Stabilization of nucleic acids by unusual polyamines produced by an extreme thermophile, Thermus thermophilus

PubMed Central

2005-01-01

Extreme thermophiles produce two types of unusual polyamine: long linear polyamines such as caldopentamine and caldohexamine, and branched polyamines such as quaternary ammonium compounds [e.g. tetrakis(3-aminopropyl)ammonium]. To clarify the physiological roles of long linear and branched polyamines in thermophiles, we synthesized them chemically and tested their effects on the stability of ds (double-stranded) and ss (single-stranded) DNAs and tRNA in response to thermal denaturation, as measured by differential scanning calorimetry. Linear polyamines stabilized dsDNA in proportion to the number of amino nitrogen atoms within their molecular structure. We used the empirical results to derive formulae that estimate the melting temperature of dsDNA in the presence of polyamines of a particular molecular composition. ssDNA and tRNA were stabilized more effectively by tetrakis(3-aminopropyl)ammonium than any of the other polyamines tested. We propose that long linear polyamines are effective to stabilize DNA, and tetrakis(3-aminopropyl)ammonium plays important roles in stabilizing RNAs in thermophile cells. PMID:15673283

[DNA structure from A to Z--biological implications of structural diversity of DNA].

PubMed

Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

2006-01-01

Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

DNA fragmentation by charged particle tracks.

PubMed

Stenerlow, B; Hoglund, E; Carlsson, J

2002-01-01

High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons (60Co) or 125 keV/micrometers nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome. c2002 COSPAR. Published by Elsevier Science Ltd. All rights reserved.

Evolution of double-stranded DNA viruses of eukaryotes: from bacteriophages to transposons to giant viruses

PubMed Central

Koonin, Eugene V; Krupovic, Mart; Yutin, Natalya

2015-01-01

Diverse eukaryotes including animals and protists are hosts to a broad variety of viruses with double-stranded (ds) DNA genomes, from the largest known viruses, such as pandoraviruses and mimiviruses, to tiny polyomaviruses. Recent comparative genomic analyses have revealed many evolutionary connections between dsDNA viruses of eukaryotes, bacteriophages, transposable elements, and linear DNA plasmids. These findings provide an evolutionary scenario that derives several major groups of eukaryotic dsDNA viruses, including the proposed order “Megavirales,” adenoviruses, and virophages from a group of large virus-like transposons known as Polintons (Mavericks). The Polintons have been recently shown to encode two capsid proteins, suggesting that these elements lead a dual lifestyle with both a transposon and a viral phase and should perhaps more appropriately be named polintoviruses. Here, we describe the recently identified evolutionary relationships between bacteriophages of the family Tectiviridae, polintoviruses, adenoviruses, virophages, large and giant DNA viruses of eukaryotes of the proposed order “Megavirales,” and linear mitochondrial and cytoplasmic plasmids. We outline an evolutionary scenario under which the polintoviruses were the first group of eukaryotic dsDNA viruses that evolved from bacteriophages and became the ancestors of most large DNA viruses of eukaryotes and a variety of other selfish elements. Distinct lines of origin are detectable only for herpesviruses (from a different bacteriophage root) and polyoma/papillomaviruses (from single-stranded DNA viruses and ultimately from plasmids). Phylogenomic analysis of giant viruses provides compelling evidence of their independent origins from smaller members of the putative order “Megavirales,” refuting the speculations on the evolution of these viruses from an extinct fourth domain of cellular life. PMID:25727355

The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

PubMed

Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

2014-05-28

The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

NASA Technical Reports Server (NTRS)

Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan

2002-01-01

Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

Ends-in Vs. Ends-Out Recombination in Yeast

PubMed Central

Hastings, P. J.; McGill, C.; Shafer, B.; Strathern, J. N.

1993-01-01

Integration of linearized plasmids into yeast chromosomes has been used as a model system for the study of recombination initiated by double-strand breaks. The linearized plasmid DNA recombines efficiently into sequences homologous to the ends of the DNA. This efficient recombination occurs both for the configuration in which the break is in a contiguous region of homology (herein called the ends-in configuration) and for ``omega'' insertions in which plasmid sequences interrupt a linear region of homology (herein called the ends-out configuration). The requirements for integration of these two configurations are expected to be different. We compared these two processes in a yeast strain containing an ends-in target and an ends-out target for the same cut plasmid. Recovery of ends-in events exceeds ends-out events by two- to threefold. Possible causes for the origin of this small bias are discussed. The lack of an extreme difference in frequency implies that cooperativity between the two ends does not contribute to the efficiency with which cut circular plasmids are integrated. This may also be true for the repair of chromosomal double-strand breaks. PMID:8307337

Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2004-06-01

The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

Do chromatin changes around a nascent double strand DNA break spread spherically into linearly non-adjacent chromatin?

PubMed

Savic, Velibor

2013-01-01

In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions.

Inactivation, DNA double strand break induction and their rejoining in bacterial cells irradiated with heavy ions

NASA Technical Reports Server (NTRS)

Schaefer, M.; Zimmermann, H.; Schmitz, C.

1994-01-01

Besides inactivation one of the major interests in our experiments is to study the primary damage in the DNA double strand breaks (DSB) after heavy ion irradiation. These damages lead not only to cell death but also under repair activities to mutations. In further experiments we have investigated the inactivation with two different strains of Deinococcus radiodurans (R1, Rec 30) and the induction of DSB as well as the rejoining of DSB in stationary cells of E. coli (strain B/r) irradiated with radiations of different quality. In the latter case irradiations were done so that the cell survival was roughly at the same level. We measured the DSB using the pulse field gelelectrophoresis which allows to separate between intact (circular) and damaged (linear) DNA. The irradiated cells were transferred to NB medium and incubated for different times to allow rejoining.

Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

PubMed

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

PubMed Central

Jette, Nicholas; Lees-Miller, Susan P.

2015-01-01

The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

Artificial and Solar UV Radiation Induces Strand Breaks and Cyclobutane Pyrimidine Dimers in Bacillus subtilis Spore DNA

PubMed Central

Slieman, Tony A.; Nicholson, Wayne L.

2000-01-01

The loss of stratospheric ozone and the accompanying increase in solar UV flux have led to concerns regarding decreases in global microbial productivity. Central to understanding this process is determining the types and amounts of DNA damage in microbes caused by solar UV irradiation. While UV irradiation of dormant Bacillus subtilis endospores results mainly in formation of the “spore photoproduct” 5-thyminyl-5,6-dihydrothymine, genetic evidence indicates that an additional DNA photoproduct(s) may be formed in spores exposed to solar UV-B and UV-A radiation (Y. Xue and W. L. Nicholson, Appl. Environ. Microbiol. 62:2221–2227, 1996). We examined the occurrence of double-strand breaks, single-strand breaks, cyclobutane pyrimidine dimers, and apurinic-apyrimidinic sites in spore DNA under several UV irradiation conditions by using enzymatic probes and neutral or alkaline agarose gel electrophoresis. DNA from spores irradiated with artificial 254-nm UV-C radiation accumulated single-strand breaks, double-strand breaks, and cyclobutane pyrimidine dimers, while DNA from spores exposed to artificial UV-B radiation (wavelengths, 290 to 310 nm) accumulated only cyclobutane pyrimidine dimers. DNA from spores exposed to full-spectrum sunlight (UV-B and UV-A radiation) accumulated single-strand breaks, double-strand breaks, and cyclobutane pyrimidine dimers, whereas DNA from spores exposed to sunlight from which the UV-B component had been removed with a filter (“UV-A sunlight”) accumulated only single-strand breaks and double-strand breaks. Apurinic-apyrimidinic sites were not detected in spore DNA under any of the irradiation conditions used. Our data indicate that there is a complex spectrum of UV photoproducts in DNA of bacterial spores exposed to solar UV irradiation in the environment. PMID:10618224

Broken replication forks trigger heritable DNA breaks in the terminus of a circular chromosome

PubMed Central

Possoz, Christophe; Durand, Adeline; Desfontaines, Jean-Michel; Barre, François-Xavier; Leach, David R. F.

2018-01-01

It was recently reported that the recBC mutants of Escherichia coli, deficient for DNA double-strand break (DSB) repair, have a decreased copy number of their terminus region. We previously showed that this deficit resulted from DNA loss after post-replicative breakage of one of the two sister-chromosome termini at cell division. A viable cell and a dead cell devoid of terminus region were thus produced and, intriguingly, the reaction was transmitted to the following generations. Using genome marker frequency profiling and observation by microscopy of specific DNA loci within the terminus, we reveal here the origin of this phenomenon. We observed that terminus DNA loss was reduced in a recA mutant by the double-strand DNA degradation activity of RecBCD. The terminus-less cell produced at the first cell division was less prone to divide than the one produced at the next generation. DNA loss was not heritable if the chromosome was linearized in the terminus and occurred at chromosome termini that were unable to segregate after replication. We propose that in a recB mutant replication fork breakage results in the persistence of a linear DNA tail attached to a circular chromosome. Segregation of the linear and circular parts of this “σ-replicating chromosome” causes terminus DNA breakage during cell division. One daughter cell inherits a truncated linear chromosome and is not viable. The other inherits a circular chromosome attached to a linear tail ending in the chromosome terminus. Replication extends this tail, while degradation of its extremity results in terminus DNA loss. Repeated generation and segregation of new σ-replicating chromosomes explains the heritability of post-replicative breakage. Our results allow us to determine that in E. coli at each generation, 18% of cells are subject to replication fork breakage at dispersed, potentially random, chromosomal locations. PMID:29522563

A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor

PubMed Central

Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

2015-01-01

A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis. PMID:26569239

A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

PubMed

Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

2015-11-09

A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*

PubMed Central

Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko

2011-01-01

RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474

DNA Double-strand Breaks Induced byFractionated Neutron Beam Irradiation for Boron Neutron Capture Therapy.

PubMed

Kinashi, Yuko; Yokomizo, Natsuya; Takahashi, Sentaro

2017-04-01

To use the 53BP1 foci assay to detect DNA double-strand breaks induced by fractionated neutron beam irradiation of normal cells. The Kyoto University Research Reactor heavy-water facility and gamma-ray irradiation system were used as experimental radiation sources. After fixation of Chinese Hamster Ovary cells with 3.6% formalin, immunofluorescence staining was performed. Number and size of foci were analyzed using ImageJ software. Fractionated neutron irradiation induced 25% fewer 53BP1 foci than single irradiation at the same dose. By contrast, gamma irradiation induced 30% fewer 53BP1 foci than single irradiation at the same dose. Fractionated neutron irradiation induced larger foci than gamma irradiation, raising the possibility that persistent unrepaired DNA damage was amplified due to the high linear energy transfer component in the neutron beam. Unrepaired cluster DNA damage was more prevalent after fractionated neutron irradiation than after gamma irradiation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Enzyme-free detection and quantification of double-stranded nucleic acids.

PubMed

Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Hänni, Catherine; Daniel, Isabelle

2012-08-01

We have developed a fully enzyme-free SERRS hybridization assay for specific detection of double-stranded DNA sequences. Although all DNA detection methods ranging from PCR to high-throughput sequencing rely on enzymes, this method is unique for being totally non-enzymatic. The efficiency of enzymatic processes is affected by alterations, modifications, and/or quality of DNA. For instance, a limitation of most DNA polymerases is their inability to process DNA damaged by blocking lesions. As a result, enzymatic amplification and sequencing of degraded DNA often fail. In this study we succeeded in detecting and quantifying, within a mixture, relative amounts of closely related double-stranded DNA sequences from Rupicapra rupicapra (chamois) and Capra hircus (goat). The non-enzymatic SERRS assay presented here is the corner stone of a promising approach to overcome the failure of DNA polymerase when DNA is too degraded or when the concentration of polymerase inhibitors is too high. It is the first time double-stranded DNA has been detected with a truly non-enzymatic SERRS-based method. This non-enzymatic, inexpensive, rapid assay is therefore a breakthrough in nucleic acid detection.

Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance

PubMed Central

Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

2014-01-01

Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. PMID:25389272

Exploiting Tumor-Activated Testes Proteins to Enhance Efficacy of First-Line Chemotherapeutics in NSCLC

DTIC Science & Technology

2015-10-01

TERMS Cancer Testis Antigen (CTA), Fanconia- Anemia (FA), DNA Damage, Genomic Instability, DNA Double Strand Break (DSB) 16. SECURITY CLASSIFICATION OF...Cancer Testis Antigen (CTA) o Fanconia- Anemia (FA) o DNA Damage o Genomic Instability o DNA Double Strand Break (DSB) 3. Accomplishments • What

[Investigation of RNA viral genome amplification by multiple displacement amplification technique].

PubMed

Pang, Zheng; Li, Jian-Dong; Li, Chuan; Liang, Mi-Fang; Li, De-Xin

2013-06-01

In order to facilitate the detection of newly emerging or rare viral infectious diseases, a negative-strand RNA virus-severe fever with thrombocytopenia syndrome bunyavirus, and a positive-strand RNA virus-dengue virus, were used to investigate RNA viral genome unspecific amplification by multiple displacement amplification technique from clinical samples. Series of 10-fold diluted purified viral RNA were utilized as analog samples with different pathogen loads, after a series of reactions were sequentially processed, single-strand cDNA, double-strand cDNA, double-strand cDNA treated with ligation without or with supplemental RNA were generated, then a Phi29 DNA polymerase depended isothermal amplification was employed, and finally the target gene copies were detected by real time PCR assays to evaluate the amplification efficiencies of various methods. The results showed that multiple displacement amplification effects of single-strand or double-strand cDNA templates were limited, while the fold increases of double-strand cDNA templates treated with ligation could be up to 6 X 10(3), even 2 X 10(5) when supplemental RNA existed, and better results were obtained when viral RNA loads were lower. A RNA viral genome amplification system using multiple displacement amplification technique was established in this study and effective amplification of RNA viral genome with low load was achieved, which could provide a tool to synthesize adequate viral genome for multiplex pathogens detection.

The occurrence of antibodies against single-stranded DNA in the sera of patients with acute and chronic leukaemia.

PubMed Central

Izui, S; Lambert, P H; Carpentier, N; Miescher, P A

1976-01-01

One hundred and seventy-five sera from thirty-three patients with acute myeloid leukaemia, forty-two patients with chronic myeloid leukaemia and twelve patients with acute lymphatic leukaemia were examined by a radioimmunological technique for the presence of antibodies against single-stranded and double-stranded DNA. The levels of single-stranded DNA binding activity was significantly higher in all three types of leukaemia compared to those of healthy controls. In contrast, none of these sera exhibited a positive reaction with double-stranded DNA. In some cases the level of serum anti-DNA antibodies increased after the decrease of the leucocyte count. The presence of anti-DNA antibodies in leukaemic patients may have some biological significance. PMID:780020

21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

Code of Federal Regulations, 2012 CFR

2012-04-01

... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

Code of Federal Regulations, 2014 CFR

2014-04-01

... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.

Code of Federal Regulations, 2013 CFR

2013-04-01

... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...

Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks

PubMed Central

Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael

2017-01-01

DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene’s first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks. PMID:28628606

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Modification and restriction of T-even bacteriophages. In vitro degradation of deoxyribonucleic acid containing 5-hydroxymethylctosine.

PubMed

Fleischman, R A; Cambell, J L; Richardson, C C

1976-03-25

Using the single-stranded circular DNA of bacteriophage fd as template, double-stranded circular DNA has been prepared in vitro with either 5-hydroxymethylcytosine ([hmdC]DNA) or cytosine ([dC]DNA) in the product strand. Extracts prepared from Escherichia coli cells restrictive to T-even phage containing nonglucosylated DNA degrade [hmdC]DNA to acid-soluble material in vitro, but do not degrade [dC]dna. In contrast, extracts prepared from E. coli K12 rglA- rglB-, a strain permissive to T-even phage containing nonglucosylated DNA, do not degrade [hmdC]DNA or [dC]DNA. In addition, glucosylation of the [hmdC]DNA renders it resistant to degradation by extracts from restrictive strains. The conversion of [hmdC]DNA to acid-soluble material in vitro consists of an HmCyt-specific endonucleolytic cleavage requiring the presence of the RglB gene product to form a linear molecule, followed by a non-HmCyt-specific hydrolysis of the linear DNA to acid-soluble fragments, catalyzed in part by exonuclease V. The RglB protein present in extracts of E. coli K12 rglA- rglB+ has been purified 200-fold by complementation with extracts from E. coli K12 rglA- rglB-. The purified RglB protein does not contain detectable HmCyt-specific endonuclease or exonuclease activity. In vitro endonucleolytic cleavage of [hmdC]DNA thus requires additional factors present in cell extracts.

Multiphoton near-infrared femtosecond laser pulse-induced DNA damage with and without the photosensitizer proflavine.

PubMed

Shafirovich, V; Dourandin, A; Luneva, N P; Singh, C; Kirigin, F; Geacintov, N E

1999-03-01

The excitation of pBr322 supercoiled plasmid DNA with intense near-IR 810 nm fs laser pulses by a simultaneous multiphoton absorption mechanism results in single-strand breaks after treatment of the irradiated samples with Micrococcus luteus UV endonuclease. This enzyme cleaves DNA strands at sites of cyclobutane dimers that are formed by the simultaneous absorption of three (or more) 810 nm IR photons (pulse width approximately 140 fs, 76 MHz pulse repetition, average power output focused through 10x microscope objective is approximately 1.2 MW/cm2). Direct single-strand breaks (without treatment with M. luteus) were not observed under these conditions. However, in the presence of 6 microM of the intercalator proflavine (PF), both direct single- and double-strand breaks are observed under conditions where substantial fractions of undamaged supercoiled DNA molecules are still present. The fraction of direct double-strand breaks is 30 +/- 5% of all measurable strand cleavage events, is independent of dosage (up to 6.4 GJ/cm2) and is proportional to In, where I is the average power/area of the 810 nm fs laser pulses, and n = 3 +/- 1. The nicking of two DNA strands in the immediate vicinity of the excited PF molecules gives rise to this double-strand cleavage. In contrast, excitation of the same samples under low-power, single-photon absorption conditions (approximately 400-500 nm) gives rise predominantly to single-strand breaks, but some double-strand breaks are observed at the higher dosages. Thus, single-photon excitation with 400-500 nm light and multiphoton activation of PF by near-IR fs laser pulses produces different distributions of single- and double-strand breaks. These results suggest that DNA strand cleavage originates from unrelaxed, higher excited states when PF is excited by simultaneous IR multiphoton absorption processes.

Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

PubMed

Mouw, M; Pintel, D J

1998-11-10

GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

The HTLV-1 Tax Oncoprotein Represses Ku80 Gene Expression

PubMed Central

Ducu, Razvan I.; Dayaram, Tajhal; Marriott, Susan J.

2011-01-01

The HTLV-I oncoprotein Tax interferes with DNA double strand break repair. Since non-homologous end joining (NHEJ) is a major pathway used to repair DNA double strand breaks we examined the effect of Tax on this pathway, with particular interest in the expression and function of Ku80, a critical component of the NHEJ pathway. Tax expression decreased Ku80 mRNA and protein levels, and repressed transcription from the Ku80 promoter. Conversely, Ku80 mRNA increased following siRNA knockdown of Tax in HTLV-I infected cells. Tax expression was associated with an elevated number of micronuclei and nucleoplasmic bridges, hallmarks of improper DNA double strand break repair. Our studies identified Tax as a transcriptional repressor of Ku80 that correlates with decreased DNA repair function. The reduction of Ku80 transcription by Tax may deplete the cell of an essential DNA break binding protein, resulting in reduced repair of DNA double strand breaks and accumulation genomic mutations. PMID:21571351

Repair of DNA Strand Breaks in a Minichromosome In Vivo: Kinetics, Modeling, and Effects of Inhibitors

PubMed Central

Kumala, Slawomir; Fujarewicz, Krzysztof; Jayaraju, Dheekollu; Rzeszowska-Wolny, Joanna; Hancock, Ronald

2013-01-01

To obtain an overall picture of the repair of DNA single and double strand breaks in a defined region of chromatin in vivo, we studied their repair in a ∼170 kb circular minichromosome whose length and topology are analogous to those of the closed loops in genomic chromatin. The rate of repair of single strand breaks in cells irradiated with γ photons was quantitated by determining the sensitivity of the minichromosome DNA to nuclease S1, and that of double strand breaks by assaying the reformation of supercoiled DNA using pulsed field electrophoresis. Reformation of supercoiled DNA, which requires that all single strand breaks have been repaired, was not slowed detectably by the inhibitors of poly(ADP-ribose) polymerase-1 NU1025 or 1,5-IQD. Repair of double strand breaks was slowed by 20–30% when homologous recombination was supressed by KU55933, caffeine, or siRNA-mediated depletion of Rad51 but was completely arrested by the inhibitors of nonhomologous end-joining wortmannin or NU7441, responses interpreted as reflecting competition between these repair pathways similar to that seen in genomic DNA. The reformation of supercoiled DNA was unaffected when topoisomerases I or II, whose participation in repair of strand breaks has been controversial, were inhibited by the catalytic inhibitors ICRF-193 or F11782. Modeling of the kinetics of repair provided rate constants and showed that repair of single strand breaks in minichromosome DNA proceeded independently of repair of double strand breaks. The simplicity of quantitating strand breaks in this minichromosome provides a usefull system for testing the efficiency of new inhibitors of their repair, and since the sequence and structural features of its DNA and its transcription pattern have been studied extensively it offers a good model for examining other aspects of DNA breakage and repair. PMID:23382828

Exploiting Tumor Activated Testes Proteins To Enhance Efficacy of First Line Chemotherapeutics in NSCLC

DTIC Science & Technology

2016-10-01

Antigen (CTA), Fanconia- Anemia (FA), DNA Damage, Genomic Instability, DNA Double Strand Break (DSB) 16. SECURITY CLASSIFICATION OF: 17. LIMITATION...Fanconia- Anemia (FA) o DNA Damage o Genomic Instability o DNA Double Strand Break (DSB) 3. Accomplishments • What were the major goals and objectives of

Activation of a yeast replication origin near a double-stranded DNA break.

PubMed

Raghuraman, M K; Brewer, B J; Fangman, W L

1994-03-01

Irradiation in the G1 phase of the cell cycle delays the onset of DNA synthesis and transiently inhibits the activation of replication origins in mammalian cells. It has been suggested that this inhibition is the result of the loss of torsional tension in the DNA after it has been damaged. Because irradiation causes DNA damage at an undefined number of nonspecific sites in the genome, it is not known how cells respond to limited DNA damage, and how replication origins in the immediate vicinity of a damage site would behave. Using the sequence-specific HO endonuclease, we have created a defined double-stranded DNA break in a centromeric plasmid in G1-arrested cells of the yeast Saccharomyces cerevisiae. We show that replication does initiate at the origin on the cut plasmid, and that the plasmid replicates early in the S phase after linearization in vivo. These observations suggest that relaxation of a supercoiled DNA domain in yeast need not inactivate replication origins within that domain. Furthermore, these observations rule out the possibility that the late replication context associated with chromosomal termini is a consequence of DNA ends.

Intracellular generation of single-strand template increases the knock-in efficiency by combining CRISPR/Cas9 with AAV.

PubMed

Xiao, Qing; Min, Taishan; Ma, Shuangping; Hu, Lingna; Chen, Hongyan; Lu, Daru

2018-04-18

Targeted integration of transgenes facilitates functional genomic research and holds prospect for gene therapy. The established microhomology-mediated end-joining (MMEJ)-based strategy leads to the precise gene knock-in with easily constructed donor, yet the limited efficiency remains to be further improved. Here, we show that single-strand DNA (ssDNA) donor contributes to efficient increase of knock-in efficiency and establishes a method to achieve the intracellular linearization of long ssDNA donor. We identified that the CRISPR/Cas9 system is responsible for breaking double-strand DNA (dsDNA) of palindromic structure in inverted terminal repeats (ITRs) region of recombinant adeno-associated virus (AAV), leading to the inhibition of viral second-strand DNA synthesis. Combing Cas9 plasmids targeting genome and ITR with AAV donor delivery, the precise knock-in of gene cassette was achieved, with 13-14% of the donor insertion events being mediated by MMEJ in HEK 293T cells. This study describes a novel method to integrate large single-strand transgene cassettes into the genomes, increasing knock-in efficiency by 13.6-19.5-fold relative to conventional AAV-mediated method. It also provides a comprehensive solution to the challenges of complicated production and difficult delivery with large exogenous fragments.

Nuclear ARP2/3 drives DNA break clustering for homology-directed repair.

PubMed

Schrank, Benjamin R; Aparicio, Tomas; Li, Yinyin; Chang, Wakam; Chait, Brian T; Gundersen, Gregg G; Gottesman, Max E; Gautier, Jean

2018-06-20

DNA double-strand breaks repaired by non-homologous end joining display limited DNA end-processing and chromosomal mobility. By contrast, double-strand breaks undergoing homology-directed repair exhibit extensive processing and enhanced motion. The molecular basis of this movement is unknown. Here, using Xenopus laevis cell-free extracts and mammalian cells, we establish that nuclear actin, WASP, and the actin-nucleating ARP2/3 complex are recruited to damaged chromatin undergoing homology-directed repair. We demonstrate that nuclear actin polymerization is required for the migration of a subset of double-strand breaks into discrete sub-nuclear clusters. Actin-driven movements specifically affect double-strand breaks repaired by homology-directed repair in G2 cell cycle phase; inhibition of actin nucleation impairs DNA end-processing and homology-directed repair. By contrast, ARP2/3 is not enriched at double-strand breaks repaired by non-homologous end joining and does not regulate non-homologous end joining. Our findings establish that nuclear actin-based mobility shapes chromatin organization by generating repair domains that are essential for homology-directed repair in eukaryotic cells.

Method for assaying clustered DNA damages

DOEpatents

Sutherland, Betsy M.

2004-09-07

Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

Design of a Sensitive and Selective Electrochemical Aptasensor for the Determination of the Complementary cDNA of miRNA-145 Based on the Intercalation and Electrochemical Reduction of Doxorubicin.

PubMed

Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

2017-11-01

The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.

Double-strand DNA-templated formation of copper nanoparticles as fluorescent probe for label-free aptamer sensor.

PubMed

Zhou, Zhixue; Du, Yan; Dong, Shaojun

2011-07-01

Double-strand DNA (dsDNA) can act as an efficient template for the formation of copper nanoparticles (Cu NPs) at low concentration of CuSO(4), and the formed Cu NPs have excellent fluorescence, whereas a single-strand DNA (ssDNA) template does not support Cu NPs' formation. This property of dsDNA-Cu NPs makes it suitable for DNA sensing. However, exploration of dsDNA-Cu NPs applied in biological analysis is still at an early stage. In this regard, we report herein for the first time a sensitive, cost-effective, and simple aptamer sensor (aptasensor) using dsDNA-Cu NPs as fluorescent probe. The design consists of a dsDNA with reporter DNA (here, aptamer) as template for the formation of Cu NPs, and the formed dsDNA-Cu NPs show high fluorescence. Using adenosine triphosphate (ATP) as a model analyte, the introduction of ATP triggers the structure switching of reporter DNA to form aptamer-ATP complex, causing the destruction of the double helix and thus no formation of the Cu NPs, resulting in low fluorescence. The preferable linear range (0.05-500 μM), sensitivity (LOD 28 nM), and simplicity for the detection of ATP indicate that dsDNA-Cu NPs may have great prospects in the field of biological analysis. We also use this novel fluorescent probe to determine ATP in 1% human serum and human adenocarcinoma HeLa cells. The dsDNA-Cu NPs probes provide recovery of 104-108% in 1% human serum and a prominent fluorescent signal is obtained in cellular ATP assay, revealing the practicality of using dsDNA-Cu NPs for the determination of ATP in real samples. Besides, this design is simply based on nucleic acid hybridization, so it can be generally applied to other aptamers for label-free detection of a broad range of analytes. Successful detection of cocaine with detection limit of 0.1 μM demonstrates its potential to be a general method.

3D-structured illumination microscopy reveals clustered DNA double-strand break formation in widespread γH2AX foci after high LET heavy-ion particle radiation.

PubMed

Hagiwara, Yoshihiko; Niimi, Atsuko; Isono, Mayu; Yamauchi, Motohiro; Yasuhara, Takaaki; Limsirichaikul, Siripan; Oike, Takahiro; Sato, Hiro; Held, Kathryn D; Nakano, Takashi; Shibata, Atsushi

2017-12-12

DNA double-strand breaks (DSBs) induced by ionising radiation are considered the major cause of genotoxic mutations and cell death. While DSBs are dispersed throughout chromatin after X-rays or γ-irradiation, multiple types of DNA damage including DSBs, single-strand breaks and base damage can be generated within 1-2 helical DNA turns, defined as a complex DNA lesion, after high Linear Energy Transfer (LET) particle irradiation. In addition to the formation of complex DNA lesions, recent evidence suggests that multiple DSBs can be closely generated along the tracks of high LET particle irradiation. Herein, by using three dimensional (3D)-structured illumination microscopy, we identified the formation of 3D widespread γH2AX foci after high LET carbon-ion irradiation. The large γH2AX foci in G 2 -phase cells encompassed multiple foci of replication protein A (RPA), a marker of DSBs undergoing resection during homologous recombination. Furthermore, we demonstrated by 3D analysis that the distance between two individual RPA foci within γH2AX foci was approximately 700 nm. Together, our findings suggest that high LET heavy-ion particles induce clustered DSB formation on a scale of approximately 1 μm 3 . These closely localised DSBs are considered to be a risk for the formation of chromosomal rearrangement after heavy-ion irradiation.

DNA gyrase with a single catalytic tyrosine can catalyze DNA supercoiling by a nicking-closing mechanism

PubMed Central

Gubaev, Airat; Weidlich, Daniela; Klostermeier, Dagmar

2016-01-01

The topological state of DNA is important for replication, recombination and transcription, and is regulated in vivo by DNA topoisomerases. Gyrase introduces negative supercoils into DNA at the expense of ATP hydrolysis. It is the accepted view that gyrase achieves supercoiling by a strand passage mechanism, in which double-stranded DNA is cleaved, and a second double-stranded segment is passed through the gap, converting a positive DNA node into a negative node. We show here that gyrase with only one catalytic tyrosine that cleaves a single strand of its DNA substrate can catalyze DNA supercoiling without strand passage. We propose an alternative mechanism for DNA supercoiling via nicking and closing of DNA that involves trapping, segregation and relaxation of two positive supercoils. In contrast to DNA supercoiling, ATP-dependent relaxation and decatenation of DNA by gyrase lacking the C-terminal domains require both tyrosines and strand passage. Our results point towards mechanistic plasticity of gyrase and might pave the way for finding novel and specific mechanism-based gyrase inhibitors. PMID:27557712

Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.

PubMed

Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng

2015-10-07

To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.

Model systems for single molecule polymer dynamics

PubMed Central

Latinwo, Folarin

2012-01-01

Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980

DNA damage induced by ascorbate in the presence of Cu2+.

PubMed

Kobayashi, S; Ueda, K; Morita, J; Sakai, H; Komano, T

1988-01-25

DNA damage induced by ascorbate in the presence of Cu2+ was investigated by use of bacteriophage phi X174 double-stranded supercoiled DNA and linear restriction fragments as substrates. Single-strand cleavage was induced when supercoiled DNA was incubated with 5 microM-10 mM ascorbate and 50 microM Cu2+ at 37 degrees C for 10 min. The induced DNA damage was analyzed by sequencing of fragments singly labeled at their 5'- or 3'-end. DNA was cleaved directly and almost uniformly at every nucleotide by ascorbate and Cu2+. Piperidine treatment after the reaction showed that ascorbate and Cu2+ induced another kind of DNA damage different from the direct cleavage. The damage proceeded to DNA cleavage by piperidine treatment and was sequence-specific rather than random. These results indicate that ascorbate induces two classes of DNA damage in the presence of Cu2+, one being direct strand cleavage, probably via damage to the DNA backbone, and the other being a base modification labile to alkali treatment. These two classes of DNA damage were inhibited by potassium iodide, catalase and metal chelaters, suggesting the involvement of radicals generated from ascorbate hydroperoxide.

Isolation and characterization of naturally occurring hairpin structures in single-stranded DNA of coliphage M13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Mitra, S.

With precise conditions of digestion with single-strand-specific nucleases, namely, endonuclease S1 of Aspergillus oryzae and exonuclease I of Escherichia coli, nuclease-resistant DNA cores can be obtained reproducibly from single-stranded M13 DNA. The DNA cores are composed almost exclusively of two sizes (60 and 44 nucleotides long). These have high (G + C)-contents relative to that of intact M13 DNA, and arise from restricted regions of the M13 genome. The resistance of these fragments to single-strand-specific nucleases and their nondenaturability strongly suggest the presence of double-stranded segments in these core pieces. That the core pieces are only partially double-stranded is shownmore » by their lack of complete base complementarity and their pattern of elution from hydroxyapatite.« less

Zinc Chromate Induces Chromosome Instability and DNA Double Strand Breaks in Human Lung Cells

PubMed Central

Xie, Hong; Holmes, Amie L.; Young, Jamie L.; Qin, Qin; Joyce, Kellie; Pelsue, Stephen C.; Peng, Cheng; Wise, Sandra S.; Jeevarajan, Antony S.; Wallace, William T.; Hammond, Dianne; Wise, John Pierce

2014-01-01

Hexavalent chromium Cr(VI) is a respiratory toxicant and carcinogen, with solubility playing an important role in its carcinogenic potential. Zinc chromate, a water insoluble or ‘particulate’ Cr(VI) compound, has been shown to be carcinogenic in epidemiology studies and to induce tumors in experimental animals, but its genotoxicity is poorly understood. Our study shows that zinc chromate induced concentration-dependent increases in cytotoxicity, chromosome damage and DNA double strand breaks in human lung cells. In response to zinc chromate-induced breaks, MRE11 expression was increased and ATM and ATR were phosphorylated, indicating that the DNA double strand break repair system was initiated in the cells. In addition, our data show that zinc chromate-induced double strand breaks were only observed in the G2/M phase population, with no significant amount of double strand breaks observed in G1 and S phase cells. These data will aid in understanding the mechanisms of zinc chromate toxicity and carcinogenesis. PMID:19027772

Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells.

PubMed

Holton, Nathaniel W; Andrews, Joel F; Gassman, Natalie R

2017-09-05

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular biology techniques have clarified structure, enzymatic functions, and kinetics of repair proteins, there is still a need to understand how repair is coordinated within the nucleus. Laser micro-irradiation offers a powerful tool for inducing DNA damage and monitoring the recruitment of repair proteins. Induction of DNA damage by laser micro-irradiation can occur with a range of wavelengths, and users can reliably induce single strand breaks, base lesions and double strand breaks with a range of doses. Here, laser micro-irradiation is used to examine repair of single and double strand breaks induced by two common confocal laser wavelengths, 355 nm and 405 nm. Further, proper characterization of the applied laser dose for inducing specific damage mixtures is described, so users can reproducibly perform laser micro-irradiation data acquisition and analysis.

Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

PubMed

Bandyopadhyay, D; Bhattacharyya, D

2006-10-15

It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

Do chromatin changes around a nascent double strand DNA break spread spherically into linearly non-adjacent chromatin?

PubMed Central

Savic, Velibor

2013-01-01

In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions. PMID:23882282

Fluorometric determination of nucleic acids based on the use of polydopamine nanotubes and target-induced strand displacement amplification.

PubMed

Ge, Jia; Bai, Dong-Mei; -Geng, Xin; Hu, Ya-Lei; Cai, Qi-Yong; Xing, Ke; Zhang, Lin; Li, Zhao-Hui

2018-01-10

The authors describe a fluorometric method for the quantitation of nucleic acids by combining (a) cycled strand displacement amplification, (b) the unique features of the DNA probe SYBR Green, and (c) polydopamine nanotubes. SYBR Green undergoes strong fluorescence enhancement upon intercalation into double-stranded DNA (dsDNA). The polydopamine nanotubes selectively adsorb single-stranded DNA (ssDNA) and molecular beacons. In the absence of target DNA, the molecular beacon, primer and SYBR Green are adsorbed on the surface of polydopamine nanotubes. This results in quenching of the fluorescence of SYBR Green, typically measured at excitation/emission wavelengths of 488/518 nm. Upon addition of analyte (target DNA) and polymerase, the stem of the molecular beacon is opened so that it can bind to the primer. This triggers target strand displacement polymerization, during which dsDNA is synthesized. The hybridized target is then displaced due to the strand displacement activity of the polymerase. The displaced target hybridizes with another molecular beacon. This triggers the next round of polymerization. Consequently, a large amount of dsDNA is formed which is detected by addition of SYBR Green. Thus, sensitive and selective fluorometric detection is realized. The fluorescent sensing strategy shows very good analytical performances towards DNA detection, such as a wide linear range from 0.05 to 25 nM with a low limit of detection of 20 pM. Graphical abstract Schematic of a fluorometric strategy for highly sensitive and selective determination of nucleic acids by combining strand displacement amplification and the unique features of SYBR Green I (SG) and polydopamine nanotubes.

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

ORF157 from the Archaeal Virus Acidianus Filamentous Virus 1 Defines a New Class of Nuclease▿

PubMed Central

Goulet, Adeline; Pina, Mery; Redder, Peter; Prangishvili, David; Vera, Laura; Lichière, Julie; Leulliot, Nicolas; van Tilbeurgh, Herman; Ortiz-Lombardia, Miguel; Campanacci, Valérie; Cambillau, Christian

2010-01-01

Acidianus filamentous virus 1 (AFV1) (Lipothrixviridae) is an enveloped filamentous virus that was characterized from a crenarchaeal host. It infects Acidianus species that thrive in the acidic hot springs (>85°C and pH <3) of Yellowstone National Park, WY. The AFV1 20.8-kb, linear, double-stranded DNA genome encodes 40 putative open reading frames whose sequences generally show little similarity to other genes in the sequence databases. Because three-dimensional structures are more conserved than sequences and hence are more effective at revealing function, we set out to determine protein structures from putative AFV1 open reading frames (ORF). The crystal structure of ORF157 reveals an α+β protein with a novel fold that remotely resembles the nucleotidyltransferase topology. In vitro, AFV1-157 displays a nuclease activity on linear double-stranded DNA. Alanine substitution mutations demonstrated that E86 is essential to catalysis. AFV1-157 represents a novel class of nuclease, but its exact role in vivo remains to be determined. PMID:20200253

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

Induction and repair of DNA double-strand breaks in hippocampal neurons of mice of different age after exposure to 60Co γ-rays in vivo and in vitro

NASA Astrophysics Data System (ADS)

Kozhina, R. A.; Chausov, V. N.; Kuzmina, E. A.; Boreyko, A. V.

2018-04-01

One of the central problems of modern radiobiology is the study of DNA damage induction and repair mechanisms in central nervous system cells, in particular, in hippocampal cells. The study of the regularities of molecular damage formation and repair in the hippocampus cells is of special interest, because these cells, unlike most cells of the central nervous system (CNS), keep proliferative activity, i.e. ability to neurogenesis. Age-related changes in hippocampus play an important role, which could lead to radiosensitivity changes in neurons to the ionizing radiation exposure. Regularities in DNA double-strand breaks (DSB) induction and repair in different aged mice hippocampal cells in vivo and in vitro under the action of γ-rays 60Co were studied with DNA comet-assay. The obtained dose dependences of DNA DSB induction are linear both in vivo and in vitro. It is established that in young animals' cells, the degree of DNA damage is higher than in older animals. It is shown that repair kinetics is basically different for exposure in vivo and in vitro.

Evaluation of the Comet Assay for Assessing the Dose-Response Relationship of DNA Damage Induced by Ionizing Radiation

PubMed Central

Wang, Yan; Xu, Chang; Du, Li Qing; Cao, Jia; Liu, Jian Xiang; Su, Xu; Zhao, Hui; Fan, Fei-Yue; Wang, Bing; Katsube, Takanori; Fan, Sai Jun; Liu, Qiang

2013-01-01

Dose- and time-response curves were combined to assess the potential of the comet assay in radiation biodosimetry. The neutral comet assay was used to detect DNA double-strand breaks in lymphocytes caused by γ-ray irradiation. A clear dose-response relationship with DNA double-strand breaks using the comet assay was found at different times after irradiation (p < 0.001). A time-response relationship was also found within 72 h after irradiation (p < 0.001). The curves for DNA double-strand breaks and DNA repair in vitro of human lymphocytes presented a nice model, and a smooth, three-dimensional plane model was obtained when the two curves were combined. PMID:24240807

Visualization of complex DNA double-strand breaks in a tumor treated with carbon ion radiotherapy

PubMed Central

Oike, Takahiro; Niimi, Atsuko; Okonogi, Noriyuki; Murata, Kazutoshi; Matsumura, Akihiko; Noda, Shin-Ei; Kobayashi, Daijiro; Iwanaga, Mototaro; Tsuchida, Keisuke; Kanai, Tatsuaki; Ohno, Tatsuya; Shibata, Atsushi; Nakano, Takashi

2016-01-01

Carbon ion radiotherapy shows great potential as a cure for X-ray-resistant tumors. Basic research suggests that the strong cell-killing effect induced by carbon ions is based on their ability to cause complex DNA double-strand breaks (DSBs). However, evidence supporting the formation of complex DSBs in actual patients is lacking. Here, we used advanced high-resolution microscopy with deconvolution to show that complex DSBs are formed in a human tumor clinically treated with carbon ion radiotherapy, but not in a tumor treated with X-ray radiotherapy. Furthermore, analysis using a physics model suggested that the complexity of radiotherapy-induced DSBs is related to linear energy transfer, which is much higher for carbon ion beams than for X-rays. Visualization of complex DSBs in clinical specimens will help us to understand the anti-tumor effects of carbon ion radiotherapy. PMID:26925533

Dissimilar Kinetic Behavior of Electrically Manipulated Single- and Double-Stranded DNA Tethered to a Gold Surface

PubMed Central

Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R.; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

2006-01-01

We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment. PMID:16473909

Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

PubMed

Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

2006-05-15

We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

Structure of an XPF endonuclease with and without DNA suggests a model for substrate recognition

PubMed Central

Newman, Matthew; Murray-Rust, Judith; Lally, John; Rudolf, Jana; Fadden, Andrew; Knowles, Philip P; White, Malcolm F; McDonald, Neil Q

2005-01-01

The XPF/Mus81 structure-specific endonucleases cleave double-stranded DNA (dsDNA) within asymmetric branched DNA substrates and play an essential role in nucleotide excision repair, recombination and genome integrity. We report the structure of an archaeal XPF homodimer alone and bound to dsDNA. Superposition of these structures reveals a large domain movement upon binding DNA, indicating how the (HhH)2 domain and the nuclease domain are coupled to allow the recognition of double-stranded/single-stranded DNA junctions. We identify two nonequivalent DNA-binding sites and propose a model in which XPF distorts the 3′ flap substrate in order to engage both binding sites and promote strand cleavage. The model rationalises published biochemical data and implies a novel role for the ERCC1 subunit of eukaryotic XPF complexes. PMID:15719018

Spectrum of complex DNA damages depends on the incident radiation

NASA Astrophysics Data System (ADS)

Hada, M.; Sutherland, B.

Ionizing radiation induces clustered DNA damages in DNA-two or more abasic sites oxidized bases and strand breaks on opposite DNA strands within a few helical turns Clustered damages are considered to be difficult to repair and therefore potentially lethal and mutagenic damages Although induction of single strand breaks and isolated lesions has been studied extensively little is known of factors affecting induction of clusters other than double strand breaks DSB The aim of the present study was to determine whether the type of incident radiation could affect yield or spectra of specific clusters Genomic T7 DNA a simple 40 kbp linear blunt-ended molecule was irradiated in non-scavenging buffer conditions with Fe 970 MeV n Ti 980 MeV n C 293 MeV n Si 586 MeV n ions or protons 1 GeV n at the NASA Space Radiation Laboratory or with 100 kVp X-rays Irradiated DNA was treated with homogeneous Fpg or Nfo proteins or without enzyme treatment for DSB quantitation then electrophoresed in neutral agarose gels DSB Fpg-OxyPurine clusters and Nfo-Abasic clusters were quantified by number average length analysis The results show that the yields of all these complex damages depend on the incident radiation Although LETs are similar protons induced twice as many DSBs than did X-rays Further the spectrum of damage also depends on the radiation The yield damage Mbp Gy of all damages decreased with increasing linear energy transfer LET of the radiation The relative frequencies of DSBs to Abasic- and OxyBase clusters were higher

A critical role for topoisomerase IIb and DNA double strand breaks in transcription

PubMed Central

Calderwood, Stuart K.

2016-01-01

ABSTRACT Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb. PMID:27100743

A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

PubMed

Calderwood, Stuart K

2016-05-26

Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.

Single-stranded DNA condensed with poly-L-lysine results in nanometric particles that are significantly smaller, more stable in physiological ionic strength fluids and afford higher efficiency of gene delivery than their double-stranded counterparts.

PubMed

Molas, M; Bartrons, R; Perales, J C

2002-08-15

Nonviral gene transfer vectors have been actively studied in the past years in order to obtain structural entities with minimum size and defined shape. The final size of a gene transfer vector, which is compacted into unimolecular complexes, is directly proportional to the mass of the nucleic acid to be compacted. Thus, the purpose of this study was to assess the possibility of producing ssDNA vectors and their biophysical and biological characterization. We have obtained ssDNA/poly-L-lysine complexes that are significantly smaller than their double-stranded counterparts. We have also identified a lesser aggregative behavior of compacted single-stranded vs. double-stranded DNA vectors in the presence of physiological NaCl concentrations. Expression of compacted ssDNA is observed in hepatoma cell lines. Moreover, we have successfully delivered galactosylated ssDNA complexes into cells that express the asialoglycoprotein receptor via receptor-mediated endocytosis. The reduced size and biophysical behavior of ssDNA vectors may provide an advantage for transfection of eukaryotic cells.

DNA Sequencing Using capillary Electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dr. Barry Karger

2011-05-09

The overall goal of this program was to develop capillary electrophoresis as the tool to be used to sequence for the first time the Human Genome. Our program was part of the Human Genome Project. In this work, we were highly successful and the replaceable polymer we developed, linear polyacrylamide, was used by the DOE sequencing lab in California to sequence a significant portion of the human genome using the MegaBase multiple capillary array electrophoresis instrument. In this final report, we summarize our efforts and success. We began our work by separating by capillary electrophoresis double strand oligonucleotides using cross-linkedmore » polyacrylamide gels in fused silica capillaries. This work showed the potential of the methodology. However, preparation of such cross-linked gel capillaries was difficult with poor reproducibility, and even more important, the columns were not very stable. We improved stability by using non-cross linked linear polyacrylamide. Here, the entangled linear chains could move when osmotic pressure (e.g. sample injection) was imposed on the polymer matrix. This relaxation of the polymer dissipated the stress in the column. Our next advance was to use significantly lower concentrations of the linear polyacrylamide that the polymer could be automatically blown out after each run and replaced with fresh linear polymer solution. In this way, a new column was available for each analytical run. Finally, while testing many linear polymers, we selected linear polyacrylamide as the best matrix as it was the most hydrophilic polymer available. Under our DOE program, we demonstrated initially the success of the linear polyacrylamide to separate double strand DNA. We note that the method is used even today to assay purity of double stranded DNA fragments. Our focus, of course, was on the separation of single stranded DNA for sequencing purposes. In one paper, we demonstrated the success of our approach in sequencing up to 500 bases. Other application papers of sequencing up to this level were also published in the mid 1990's. A major interest of the sequencing community has always been read length. The longer the sequence read per run the more efficient the process as well as the ability to read repeat sequences. We therefore devoted a great deal of time to studying the factors influencing read length in capillary electrophoresis, including polymer type and molecule weight, capillary column temperature, applied electric field, etc. In our initial optimization, we were able to demonstrate, for the first time, the sequencing of over 1000 bases with 90% accuracy. The run required 80 minutes for separation. Sequencing of 1000 bases per column was next demonstrated on a multiple capillary instrument. Our studies revealed that linear polyacrylamide produced the longest read lengths because the hydrophilic single strand DNA had minimal interaction with the very hydrophilic linear polyacrylamide. Any interaction of the DNA with the polymer would lead to broader peaks and lower read length. Another important parameter was the molecular weight of the linear chains. High molecular weight (> 1 MDA) was important to allow the long single strand DNA to reptate through the entangled polymer matrix. In an important paper, we showed an inverse emulsion method to prepare reproducibility linear polyacrylamide polymer with an average MWT of 9MDa. This approach was used in the polymer for sequencing the human genome. Another critical factor in the successful use of capillary electrophoresis for sequencing was the sample preparation method. In the Sanger sequencing reaction, high concentration of salts and dideoxynucleotide remained. Since the sample was introduced to the capillary column by electrokinetic injection, these salt ions would be favorably injected into the column over the sequencing fragments, thus reducing the signal for longer fragments and hence reading read length. In two papers, we examined the role of individual components from the sequencing reaction and then developed a protocol to reduce the deleterious salts. We demonstrated a robust method for achieving long read length DNA sequencing. Continuing our advances, we next demonstrated the achievement of over 1000 bases in less than one hour with a base calling accuracy of between 98 and 99%. In this work, we implemented energy transfer dyes which allowed for cleaner differentiation of the 4 dye labeled terminal nucleotides. In addition, we developed improved base calling software to help read sequencing when the separation was only minimal as occurs at long read lengths. Another critical parameter we studied was column temperature. We demonstrated that read lengths improved as the column temperature was increased from room temperature to 60 C or 70 C. The higher temperature relaxed the DNA chains under the influence of the high electric field.« less

Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

PubMed

Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

2013-05-07

We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

Binding of radiation-induced phenylalanine radicals to DNA: influence on the biological activity of the DNA and on its sensitivity to the induction of breaks by gamma rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanderschans, G.P.; Vanrijn, C.J.S.; Bleichrodt, J.F.

1975-11-01

When an aqueous solution of double-stranded deoxyribonucleic acid (DNA) of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma rays, radiation induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA most of the phenylalanine radicals bound are nonlethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. Theremore » are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules. (Author) (GRA)« less

3D-structured illumination microscopy reveals clustered DNA double-strand break formation in widespread γH2AX foci after high LET heavy-ion particle radiation

PubMed Central

Hagiwara, Yoshihiko; Niimi, Atsuko; Isono, Mayu; Yamauchi, Motohiro; Yasuhara, Takaaki; Limsirichaikul, Siripan; Oike, Takahiro; Sato, Hiro; Held, Kathryn D.; Nakano, Takashi; Shibata, Atsushi

2017-01-01

DNA double-strand breaks (DSBs) induced by ionising radiation are considered the major cause of genotoxic mutations and cell death. While DSBs are dispersed throughout chromatin after X-rays or γ-irradiation, multiple types of DNA damage including DSBs, single-strand breaks and base damage can be generated within 1–2 helical DNA turns, defined as a complex DNA lesion, after high Linear Energy Transfer (LET) particle irradiation. In addition to the formation of complex DNA lesions, recent evidence suggests that multiple DSBs can be closely generated along the tracks of high LET particle irradiation. Herein, by using three dimensional (3D)-structured illumination microscopy, we identified the formation of 3D widespread γH2AX foci after high LET carbon-ion irradiation. The large γH2AX foci in G2-phase cells encompassed multiple foci of replication protein A (RPA), a marker of DSBs undergoing resection during homologous recombination. Furthermore, we demonstrated by 3D analysis that the distance between two individual RPA foci within γH2AX foci was approximately 700 nm. Together, our findings suggest that high LET heavy-ion particles induce clustered DSB formation on a scale of approximately 1 μm3. These closely localised DSBs are considered to be a risk for the formation of chromosomal rearrangement after heavy-ion irradiation. PMID:29312614

ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.

PubMed

Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A

2017-10-05

Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).

Analysis of branched DNA replication and recombination intermediates from prokaryotic cells by two-dimensional (2D) native-native agarose gel electrophoresis.

PubMed

Robinson, Nicholas P

2013-01-01

Branched DNA molecules are generated by the essential processes of replication and recombination. Owing to their distinctive extended shapes, these intermediates migrate differently from linear double-stranded DNA under certain electrophoretic conditions. However, these branched species exist in the cell at much low abundance than the bulk linear DNA. Consequently, branched molecules cannot be visualized by conventional electrophoresis and ethidium bromide staining. Two-dimensional native-native agarose electrophoresis has therefore been developed as a method to facilitate the separation and visualization of branched replication and recombination intermediates. A wide variety of studies have employed this technique to examine branched molecules in eukaryotic, archaeal, and bacterial cells, providing valuable insights into how DNA is duplicated and repaired in all three domains of life.

Effects of Complementary DNA and Salt on the Thermoresponsiveness of Poly(N-isopropylacrylamide)-b-DNA.

PubMed

Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo

2016-02-02

The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.

Cigarette smoke-induced DNA damage and repair detected by the comet assay in HPV-transformed cervical cells.

PubMed

Moktar, Afsoon; Ravoori, Srivani; Vadhanam, Manicka V; Gairola, C Gary; Gupta, Ramesh C

2009-12-01

Human papillomavirus (HPV) is the causative factor in the development and progression of cervical cancers in >97% of the cases, although insufficient. Epidemiological studies suggest an elevated risk of cervical cancer for cigarette smokers; therefore, we examined cigarette smoke-induced DNA damage and repair in HPV16-transformed human ectocervical cells (ECT1/E6 E7). Cells were treated with cigarette smoke condensate (CSC) for 72 h to assess the formation of single- and double-strand DNA breaks, measured by alkaline and neutral single cell gel electrophoresis assays, respectively. The mean tail length of cells with single-strand breaks was increased by 1.8-, 2.7- and 3.7-fold (p<0.001) after treatment with 4, 8 and 12 microg/ml CSC, respectively. The tail length with double-strand breaks was also increased dose-dependently. These results were further supported by measurement of the mean tail moment: the increase in both single- and double-strand breaks were much more pronounced with increasing concentration of CSC, by up to 23.5-fold (p<0.0001 for both assays). To examine the DNA repair, cells were treated with CSC for 72 h, followed by CSC withdrawal and re-incubation of the cells with fresh medium for 24, 48, or 72 h. Both single- and double-strand DNA breaks were removed during the initial 24 h but no further removal of the damage was observed. Up to 80% of residual single- and double-strand DNA breaks (p<0.05) were found to persist at all CSC concentrations examined. Ellagic acid, a known antioxidant and free-radical scavenger, was found to significantly inhibit DNA breaks induced by CSC. Thus, free radicals may be a plausible source of CSC-induced DNA damage. These data show that CSC-mediated DNA strand breaks are highly persistent, and suggest that persistence of cigarette smoke-associated DNA damage in the presence of HPV infection may lead to increased mutations in cervical cells and ultimately higher cancer risk.

Highly sensitive surface plasmon resonance biosensor for the detection of HIV-related DNA based on dynamic and structural DNA nanodevices.

PubMed

Diao, Wei; Tang, Min; Ding, Shijia; Li, Xinmin; Cheng, Wenbin; Mo, Fei; Yan, Xiaoyu; Ma, Hongmin; Yan, Yurong

2018-02-15

Early detection, diagnosis and treatment of human immune deficiency virus (HIV) infection is the key to reduce acquired immunodeficiency syndrome (AIDS) mortality. In our research, an innovative surface plasmon resonance (SPR) biosensing strategy has been developed for highly sensitive detection of HIV-related DNA based on entropy-driven strand displacement reactions (ESDRs) and double-layer DNA tetrahedrons (DDTs). ESDRs as enzyme-free and label-free signal amplification circuit can be specifically triggered by target DNA, leading to the cyclic utilization of target DNA and the formation of plentiful double-stranded DNA (dsDNA) products. Subsequently, the dsDNA products bind to the immobilized hairpin capture probes and further combine with DDTs nanostructures. Due to the high efficiency of ESDRs and large molecular weight of DDTs, the SPR response signal was enhanced dramatically. The proposed SPR biosensor could detect target DNA sensitively and specifically in a linear range from 1pM to 150nM with a detection limit of 48fM. In addition, the whole detecting process can be accomplished in 60min with high accuracy and duplicability. In particular, the developed SPR biosensor was successfully used to analyze target DNA in complex biological sample, indicating that the developed strategy is promising for rapid and early clinical diagnosis of HIV infection. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

PubMed

Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun

2016-09-15

We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Moving beyond Watson-Crick models of coarse grained DNA dynamics.

PubMed

Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

2011-11-28

DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

Melting of DNA double strand after binding to geroprotective tetrapeptide.

PubMed

Khavinson, V Kh; Solovyov, A Yu; Shataeva, L K

2008-11-01

Experimental relationship between the hyperchromic effect of DNA [poly(dA-dT):poly(dA-dT)] interacting with Ala-Glu-Asp-Gly peptide is presented by a saturation isotherm. The free DNA double strand is melting (the strands separate) at 69.5 degrees C and at higher energy expenditures (enthalpy increase by 976.4 kJ/mol b.p.) in comparison with melting of the DNA-peptide complex (28 degrees C and 444.6 kJ/mol b.p.). The detected regularities of melting of duplex DNA and the thermodynamic parameters of this process indicate the natural mechanism of interaction between DNA and regulatory peptides underlying functioning of the living matter.

The occurrence of double strand DNA breaks is not the sole condition for meiotic crossing over in Drosophila melanogaster.

PubMed

Portin, P; Rantanen, M

2000-01-01

Analysis of the interchromosomal effects of In(2L + 2R)Cy, In(3L + 3R)LVM and their joint effect on the frequencies of single and double crossovers in the cv-v-f region of the X chromosome as well as interference showed that both inversions, occurring separately, increased the frequency of single as well as double crossovers and the coefficient of coincidence. However, when the inversions occurred together the frequencies of single crossovers no longer increased, but the frequency of double crossovers, as well as the coefficient of coincidence did increase. These results indicate firstly that the interchromosomal effects influence some precondition of exchange, but that this precondition is not an occurrence of double strand DNA breaks. Thus, the occurrence of double strand DNA breaks is not the sole condition for crossing over in Drosophila melanogaster.

Force-induced rupture of double-stranded DNA in the absence and presence of covalently bonded anti-tumor drugs: Insights from molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Upadhyaya, Anurag; Nath, Shesh; Kumar, Sanjay

2018-06-01

DNA intra-strand cross-link (ICL) agents are widely used in the treatment of cancer. ICLs are thought to form a link between the same strand (intra-strand) or complimentary strand (inter-strand) and thereby increase the stability of DNA, which forbids the processes like replication and transcription. As a result, cell death occurs. In this work, we have studied the enhanced stability of a double stranded DNA in the presence of ICLs and compared our findings with the results obtained in the absence of these links. Using atomistic simulations with explicit solvent, a force is applied along and perpendicular to the direction of the helix and we measured the rupture force and the unzipping force of DNA-ICL complexes. Our results show that the rupture and the unzipping forces increase significantly in the presence of these links. The ICLs bind to the minor groove of DNA, which enhance the DNA stabilisation. Such information may be used to design alternative drugs that can stall replication and transcription that are critical to a growing number of anticancer drug discovery efforts.

Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

1982-12-01

Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-daltonmore » DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.« less

Artificial plasmid labeled with 5-bromo-2'-deoxyuridine: a universal molecular system for strand break detection.

PubMed

Zylicz-Stachula, Agnieszka; Polska, Katarzyna; Skowron, Piotr; Rak, Janusz

2014-07-07

DNA strand breaks (SBs) are among the most cytotoxic forms of DNA damage, and their residual levels correlate directly with cell death. Hence, the type and amount of SBs is directly related to the efficacy of a given anticancer therapy. In this study, we describe a molecular tool that can differentiate between single (SSBs) and double (DSBs) strand breaks and also assess them quantitatively. Our method involves PCR amplification of a linear DNA fragment labeled with a sensitizing nucleotide, circularization of that fragment, and enzymatic introduction of supercoils to transform the circular relaxed form of the synthesized plasmid into a supercoiled one. After exposure of the molecule to a damaging factor, SSB and DSB levels can be easily assayed with gel electrophoresis. We applied this method to prepare an artificial plasmid labeled with 5-bromo-2'-deoxyuridine and to assay SBs photoinduced in the synthesized plasmid. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks

NASA Astrophysics Data System (ADS)

Singleton, Martin R.; Dillingham, Mark S.; Gaudier, Martin; Kowalczykowski, Stephen C.; Wigley, Dale B.

2004-11-01

RecBCD is a multi-functional enzyme complex that processes DNA ends resulting from a double-strand break. RecBCD is a bipolar helicase that splits the duplex into its component strands and digests them until encountering a recombinational hotspot (Chi site). The nuclease activity is then attenuated and RecBCD loads RecA onto the 3' tail of the DNA. Here we present the crystal structure of RecBCD bound to a DNA substrate. In this initiation complex, the DNA duplex has been split across the RecC subunit to create a fork with the separated strands each heading towards different helicase motor subunits. The strands pass along tunnels within the complex, both emerging adjacent to the nuclease domain of RecB. Passage of the 3' tail through one of these tunnels provides a mechanism for the recognition of a Chi sequence by RecC within the context of double-stranded DNA. Gating of this tunnel suggests how nuclease activity might be regulated.

Melatonin Protects Human Cells from Clustered DNA Damages, Killing and Acquisition of Soft Agar Growth Induced by X-rays or 970 MeV/n Fe ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das, B.; Sutherland, B.; Bennett, P. V.

We tested the ability of melatonin (N-acetyl-5 methoxytryptamine), a highly effective radical scavenger and human hormone, to protect DNA in solution and in human cells against induction of complex DNA clusters and biological damage induced by low or high linear energy transfer radiation (100 kVp X-rays, 970 MeV/nucleon Fe ions). Plasmid DNA in solution was treated with increasing concentrations of melatonin (0.0-3.5 mM) and were irradiated with X-rays. Human cells (28SC monocytes) were also irradiated with X-rays and Fe ions with and without 2 mM melatonin. Agarose plugs containing genomic DNA were subjected to Contour Clamped Homogeneous Electrophoretic Field (CHEF)more » followed by imaging and clustered DNA damages were measured by using Number Average length analysis. Transformation experiments on human primary fibroblast cells using soft agar colony assay were carried out which were irradiated with Fe ions with or without 2 mM melatonin. In plasmid DNA in solution, melatonin reduced the induction of single- and double-strand breaks. Pretreatment of human 28SC cells for 24 h before irradiation with 2 mM melatonin reduced the level of X-ray induced double-strand breaks by {approx}50%, of abasic clustered damages about 40%, and of Fe ion-induced double-strand breaks (41% reduction) and abasic clusters (34% reduction). It decreased transformation to soft agar growth of human primary cells by a factor of 10, but reduced killing by Fe ions only by 20-40%. Melatonin's effective reduction of radiation-induced critical DNA damages, cell killing, and striking decrease of transformation suggest that it is an excellent candidate as a countermeasure against radiation exposure, including radiation exposure to astronaut crews in space travel.« less

Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease*

PubMed Central

Rogacheva, Maria V.; Manhart, Carol M.; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric

2014-01-01

Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair. PMID:24403070

Mlh1-Mlh3, a meiotic crossover and DNA mismatch repair factor, is a Msh2-Msh3-stimulated endonuclease.

PubMed

Rogacheva, Maria V; Manhart, Carol M; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric

2014-02-28

Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair.

Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection

PubMed Central

Weyler, Linda; Engelbrecht, Mattias; Mata Forsberg, Manuel; Brehwens, Karl; Vare, Daniel; Vielfort, Katarina; Wojcik, Andrzej; Aro, Helena

2014-01-01

The host epithelium is both a barrier against, and the target for microbial infections. Maintaining regulated cell growth ensures an intact protective layer towards microbial-induced cellular damage. Neisseria gonorrhoeae infections disrupt host cell cycle regulation machinery and the infection causes DNA double strand breaks that delay progression through the G2/M phase. We show that intracellular gonococci upregulate and release restriction endonucleases that enter the nucleus and damage human chromosomal DNA. Bacterial lysates containing restriction endonucleases were able to fragment genomic DNA as detected by PFGE. Lysates were also microinjected into the cytoplasm of cells in interphase and after 20 h, DNA double strand breaks were identified by 53BP1 staining. In addition, by using live-cell microscopy and NHS-ester stained live gonococci we visualized the subcellular location of the bacteria upon mitosis. Infected cells show dysregulation of the spindle assembly checkpoint proteins MAD1 and MAD2, impaired and prolonged M-phase, nuclear swelling, micronuclei formation and chromosomal instability. These data highlight basic molecular functions of how gonococcal infections affect host cell cycle regulation, cause DNA double strand breaks and predispose cellular malignancies. PMID:25460012

Restriction endonucleases from invasive Neisseria gonorrhoeae cause double-strand breaks and distort mitosis in epithelial cells during infection.

PubMed

Weyler, Linda; Engelbrecht, Mattias; Mata Forsberg, Manuel; Brehwens, Karl; Vare, Daniel; Vielfort, Katarina; Wojcik, Andrzej; Aro, Helena

2014-01-01

The host epithelium is both a barrier against, and the target for microbial infections. Maintaining regulated cell growth ensures an intact protective layer towards microbial-induced cellular damage. Neisseria gonorrhoeae infections disrupt host cell cycle regulation machinery and the infection causes DNA double strand breaks that delay progression through the G2/M phase. We show that intracellular gonococci upregulate and release restriction endonucleases that enter the nucleus and damage human chromosomal DNA. Bacterial lysates containing restriction endonucleases were able to fragment genomic DNA as detected by PFGE. Lysates were also microinjected into the cytoplasm of cells in interphase and after 20 h, DNA double strand breaks were identified by 53BP1 staining. In addition, by using live-cell microscopy and NHS-ester stained live gonococci we visualized the subcellular location of the bacteria upon mitosis. Infected cells show dysregulation of the spindle assembly checkpoint proteins MAD1 and MAD2, impaired and prolonged M-phase, nuclear swelling, micronuclei formation and chromosomal instability. These data highlight basic molecular functions of how gonococcal infections affect host cell cycle regulation, cause DNA double strand breaks and predispose cellular malignancies.

Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

PubMed

Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

2016-04-11

In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reliable method for generating double-stranded DNA vectors containing site-specific base modifications.

PubMed

Brégeon, Damien; Doetsch, Paul W

2004-11-01

Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.

An alternative mechanism for radioprotection by dimethyl sulfoxide; possible facilitation of DNA double-strand break repair.

PubMed

Kashino, Genro; Liu, Yong; Suzuki, Minoru; Masunaga, Shin-ichiro; Kinashi, Yuko; Ono, Koji; Tano, Keizo; Watanabe, Masami

2010-01-01

The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, i.e., 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in CHO, but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action.

Linear, Single-Stranded Deoxyribonucleic Acid Isolated from Kilham Rat Virus

PubMed Central

Salzman, Lois Ann; White, Wesley L.; Kakefuda, Tsuyoshi

1971-01-01

Kilham rat virus (KRV) was grown in a rat nephroma cell line and was purified by two isopycnic centrifugations in cesium chloride. The virus contains single-stranded deoxyribonucleic acid (DNA) with a molecular weight of approximately 1.6 × 106. The DNA was extracted from the virion by both phenol extraction and by 2% sodium dodecyl sulfate at 50 C. KRV DNA, extracted by both procedures, was observed in an electron microscope by using a cytochrome c or diethylaminoethyldextran monolayer. The DNA was also exposed to exonuclease I, an enzyme which hydrolyzes specifically linear, single-stranded DNA. Hydrolysis of 70 to 80% of the DNA was observed. Both the enzymatic and the electron microscope studies support the conclusion that extracted KRV DNA is a single-stranded, linear molecule. The length of the DNA was measured in the electron microscope and determined to be 1.505 ± 0.206 μm. Images PMID:4327590

SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

PubMed Central

Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

1973-01-01

Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

Correlation between energy deposition and molecular damage from Auger electrons: A case study of ultra-low energy (5-18 eV) electron interactions with DNA.

PubMed

Rezaee, Mohammad; Hunting, Darel J; Sanche, Léon

2014-07-01

The present study introduces a new method to establish a direct correlation between biologically related physical parameters (i.e., stopping and damaging cross sections, respectively) for an Auger-electron emitting radionuclide decaying within a target molecule (e.g., DNA), so as to evaluate the efficacy of the radionuclide at the molecular level. These parameters can be applied to the dosimetry of Auger electrons and the quantification of their biological effects, which are the main criteria to assess the therapeutic efficacy of Auger-electron emitting radionuclides. Absorbed dose and stopping cross section for the Auger electrons of 5-18 eV emitted by(125)I within DNA were determined by developing a nanodosimetric model. The molecular damages induced by these Auger electrons were investigated by measuring damaging cross section, including that for the formation of DNA single- and double-strand breaks. Nanoscale films of pure plasmid DNA were prepared via the freeze-drying technique and subsequently irradiated with low-energy electrons at various fluences. The damaging cross sections were determined by employing a molecular survival model to the measured exposure-response curves for induction of DNA strand breaks. For a single decay of(125)I within DNA, the Auger electrons of 5-18 eV deposit the energies of 12.1 and 9.1 eV within a 4.2-nm(3) volume of a hydrated or dry DNA, which results in the absorbed doses of 270 and 210 kGy, respectively. DNA bases have a major contribution to the deposited energies. Ten-electronvolt and high linear energy transfer 100-eV electrons have a similar cross section for the formation of DNA double-strand break, while 100-eV electrons are twice as efficient as 10 eV in the induction of single-strand break. Ultra-low-energy electrons (<18 eV) substantially contribute to the absorbed dose and to the molecular damage from Auger-electron emitting radionuclides; hence, they should be considered in the dosimetry calculation of such radionuclides. Moreover, absorbed dose is not an appropriate physical parameter for nanodosimetry. Instead, stopping cross section, which describes the probability of energy deposition in a target molecule can be an appropriate nanodosimetric parameter. The stopping cross section is correlated with a damaging cross section (e.g., cross section for the double-strand break formation) to quantify the number of each specific lesion in a target molecule for each nuclear decay of a single Auger-electron emitting radionuclide.

Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

PubMed

Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

2015-03-31

Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

Time-lapse crystallography snapshots of a double-strand break repair polymerase in action.

PubMed

Jamsen, Joonas A; Beard, William A; Pedersen, Lars C; Shock, David D; Moon, Andrea F; Krahn, Juno M; Bebenek, Katarzyna; Kunkel, Thomas A; Wilson, Samuel H

2017-08-15

DNA polymerase (pol) μ is a DNA-dependent polymerase that incorporates nucleotides during gap-filling synthesis in the non-homologous end-joining pathway of double-strand break repair. Here we report time-lapse X-ray crystallography snapshots of catalytic events during gap-filling DNA synthesis by pol μ. Unique catalytic intermediates and active site conformational changes that underlie catalysis are uncovered, and a transient third (product) metal ion is observed in the product state. The product manganese coordinates phosphate oxygens of the inserted nucleotide and PP i . The product metal is not observed during DNA synthesis in the presence of magnesium. Kinetic analyses indicate that manganese increases the rate constant for deoxynucleoside 5'-triphosphate insertion compared to magnesium. The likely product stabilization role of the manganese product metal in pol μ is discussed. These observations provide insight on structural attributes of this X-family double-strand break repair polymerase that impact its biological function in genome maintenance.DNA polymerase (pol) μ functions in DNA double-strand break repair. Here the authors use time-lapse X-ray crystallography to capture the states of pol µ during the conversion from pre-catalytic to product complex and observe a third transiently bound metal ion in the product state.

Probe and method for DNA detection

DOEpatents

Yeh, Hsin-Chih; Werner, James Henry; Sharma, Jaswinder Kumar; Martinez, Jennifer Suzanne

2013-07-02

A hybridization probe containing two linear strands of DNA lights up upon hybridization to a target DNA using silver nanoclusters that have been templated onto one of the DNA strands. Hybridization induces proximity between the nanoclusters on one strand and an overhang on the other strand, which results in enhanced fluorescence emission from the nanoclusters.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

PubMed

Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

2017-03-01

Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

PubMed Central

Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

Dewar Lesion Formation in Single- and Double-Stranded DNA is Quenched by Neighboring Bases.

PubMed

Bucher, Dominik B; Pilles, Bert M; Carell, Thomas; Zinth, Wolfgang

2015-07-16

UV-induced Dewar lesion formation is investigated in single- and double-stranded oligonucleotides with ultrafast vibrational spectroscopy. The quantum yield for the conversion of the (6-4) lesion to the Dewar isomer in DNA strands is reduced by a factor of 4 in comparison to model dinucleotides. Time resolved spectroscopy reveals a fast process in the excited state with spectral characteristics of bases which are adjacent to the excited (6-4) lesion. These kinetic components have large amplitudes and indicate that an additional quenching channel acts in the stranded DNA systems and reduces the Dewar formation yield. Presumably relaxation evolves via a charge transfer to the neighboring guanine and the paired cytosine participates in a double-stranded oligomer. Changes in the decay of the relaxed excited electronic state of the (6-4) chromophore point to modifications in the excited state energy landscape which may lead to an additional reduction of the Dewar formation yield.

BLISS is a versatile and quantitative method for genome-wide profiling of DNA double-strand breaks.

PubMed

Yan, Winston X; Mirzazadeh, Reza; Garnerone, Silvano; Scott, David; Schneider, Martin W; Kallas, Tomasz; Custodio, Joaquin; Wernersson, Erik; Li, Yinqing; Gao, Linyi; Federova, Yana; Zetsche, Bernd; Zhang, Feng; Bienko, Magda; Crosetto, Nicola

2017-05-12

Precisely measuring the location and frequency of DNA double-strand breaks (DSBs) along the genome is instrumental to understanding genomic fragility, but current methods are limited in versatility, sensitivity or practicality. Here we present Breaks Labeling In Situ and Sequencing (BLISS), featuring the following: (1) direct labelling of DSBs in fixed cells or tissue sections on a solid surface; (2) low-input requirement by linear amplification of tagged DSBs by in vitro transcription; (3) quantification of DSBs through unique molecular identifiers; and (4) easy scalability and multiplexing. We apply BLISS to profile endogenous and exogenous DSBs in low-input samples of cancer cells, embryonic stem cells and liver tissue. We demonstrate the sensitivity of BLISS by assessing the genome-wide off-target activity of two CRISPR-associated RNA-guided endonucleases, Cas9 and Cpf1, observing that Cpf1 has higher specificity than Cas9. Our results establish BLISS as a versatile, sensitive and efficient method for genome-wide DSB mapping in many applications.

B-DNA Structure and Stability as Function of Nucleic Acid Composition: Dispersion-Corrected DFT Study of Dinucleoside Monophosphate Single and Double Strands

PubMed Central

Barone, Giampaolo; Fonseca Guerra, Célia; Bickelhaupt, F Matthias

2013-01-01

We have computationally investigated the structure and stability of all 16 combinations of two out of the four natural DNA bases A, T, G and C in a di-2′-deoxyribonucleoside-monophosphate model DNA strand as well as in 10 double-strand model complexes thereof, using dispersion-corrected density functional theory (DFT-D). Optimized geometries with B-DNA conformation were obtained through the inclusion of implicit water solvent and, in the DNA models, of sodium counterions, to neutralize the negative charge of the phosphate groups. The results obtained allowed us to compare the relative stability of isomeric single and double strands. Moreover, the energy of the Watson–Crick pairing of complementary single strands to form double-helical structures was calculated. The latter furnished the following increasing stability trend of the double-helix formation energy: d(TpA)2

C60 fullerene binding to DNA

NASA Astrophysics Data System (ADS)

Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

2014-09-01

Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

Histone H3 and the histone acetyltransferase Hat1p contribute to DNA double-strand break repair.

PubMed

Qin, Song; Parthun, Mark R

2002-12-01

The modification of newly synthesized histones H3 and H4 by type B histone acetyltransferases has been proposed to play a role in the process of chromatin assembly. The type B histone acetyltransferase Hat1p and specific lysine residues in the histone H3 NH(2)-terminal tail (primarily lysine 14) are redundantly required for telomeric silencing. As many gene products, including other factors involved in chromatin assembly, have been found to participate in both telomeric silencing and DNA damage repair, we tested whether mutations in HAT1 and the histone H3 tail were also sensitive to DNA-damaging agents. Indeed, mutations both in specific lysine residues in the histone H3 tail and in HAT1 resulted in sensitivity to methyl methanesulfonate. The DNA damage sensitivity of the histone H3 and HAT1 mutants was specific for DNA double-strand breaks, as these mutants were sensitive to the induction of an exogenous restriction endonuclease, EcoRI, but not to UV irradiation. While histone H3 mutations had minor effects on nonhomologous end joining, the primary defect in the histone H3 and HAT1 mutants was in the recombinational repair of DNA double-strand breaks. Epistasis analysis indicates that the histone H3 and HAT1 mutants may influence DNA double-strand break repair through Asf1p-dependent chromatin assembly.

Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

PubMed

Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

2015-11-25

DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

Single- and Double-Strand Breaks of Dry DNA Exposed to Protons at Bragg-Peak Energies.

PubMed

Souici, Mounir; Khalil, Talat T; Muller, Dominique; Raffy, Quentin; Barillon, Rémi; Belafrites, Abdelfettah; Champion, Christophe; Fromm, Michel

2017-01-26

Ultrathin layers (<20 nm) of pBR322 plasmid DNA were deposited onto 2.5 μm thick polyester films and exposed to proton Bragg-peak energies (90-3000 keV) at various fluences. A quantitative analysis of radio-induced DNA damage is reported here in terms of single- and double-strand breaks (SSB and DSB, respectively). The corresponding yields as well as G-values and the cross sections exhibit fairly good agreement with the rare available data, stemming from close experimental conditions, namely, based on α particle irradiation. SSB/DSB rates appear to be linear when plotted against linear energy transfer (LET) in the whole energy range studied. All the data present a maximum in the 150-200 keV energy range; as for LET, it peaks at 90 keV. We also show that fragmentation starts to be significant for proton fluences greater than 1 × 10 11 cm -2 at the Bragg-peak energies. Finally, we determine the average proton track radial extension, r max , corresponding to an occupation probability of 100% DSB in the Bragg-peak region. The r max values determined are in excellent agreement with the radial extensions of proton tracks determined by simulation approaches in water. When plotted as a function of LET, both SSB and DSB cross sections bend back at high LETs.

Human cytomegalovirus inhibits a DNA damage response by mislocalizing checkpoint proteins

NASA Astrophysics Data System (ADS)

Gaspar, Miguel; Shenk, Thomas

2006-02-01

The DNA damage checkpoint pathway responds to DNA damage and induces a cell cycle arrest to allow time for DNA repair. Several viruses are known to activate or modulate this cellular response. Here we show that the ataxia-telangiectasia mutated checkpoint pathway, which responds to double-strand breaks in DNA, is activated in response to human cytomegalovirus DNA replication. However, this activation does not propagate through the pathway; it is blocked at the level of the effector kinase, checkpoint kinase 2 (Chk2). Late after infection, several checkpoint proteins, including ataxia-telangiectasia mutated and Chk2, are mislocalized to a cytoplasmic virus assembly zone, where they are colocalized with virion structural proteins. This colocalization was confirmed by immunoprecipitation of virion proteins with an antibody that recognizes Chk2. Virus replication was resistant to ionizing radiation, which causes double-strand breaks in DNA. We propose that human CMV DNA replication activates the checkpoint response to DNA double-strand breaks, and the virus responds by altering the localization of checkpoint proteins to the cytoplasm and thereby inhibiting the signaling pathway. ionizing radiation | ataxia-telangiectasia mutated pathway

Deinococcus radiodurans RecA nucleoprotein filaments characterized at the single-molecule level with optical tweezers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pobegalov, Georgii, E-mail: george.pobegalov@nanobio.spbstu.ru; Cherevatenko, Galina; Alekseev, Aleksandr

2015-10-23

Deinococcus radiodurans can survive extreme doses of ionizing radiation due to the very efficient DNA repair mechanisms that are able to cope even with hundreds of double-strand breaks. RecA, the critical protein of homologous recombination in bacteria, is one of the key components of the DNA-repair system. Repair of double-strand breaks requires RecA binding to DNA and assembly of the RecA nucleoprotein helical filaments. The Escherichia coli RecA protein (EcRecA) and its interactions with DNA have been extensively studied using various approaches including single-molecule techniques, while the D. radiodurans RecA (DrRecA) remains much less characterized. However, DrRecA shows some remarkable differencesmore » from E. coli homolog. Here we combine microfluidics and single-molecule DNA manipulation with optical tweezers to follow the binding of DrRecA to long double-stranded DNA molecules and probe the mechanical properties of DrRecA nucleoprotein filaments at physiological pH. Our data provide a direct comparison of DrRecA and EcRecA binding to double-stranded DNA under identical conditions. We report a significantly faster filaments assembly as well as lower values of persistence length and contour length for DrRecA nucleoprotein filaments compared to EcRecA. Our results support the existing model of DrRecA forming more frequent and less continuous filaments relative to those of EcRecA. - Highlights: • We investigate Deinococcus radiodurans RecA interactions with long double-stranded DNA at the single-molecule level. • At physiological pH D. radiodurans RecA forms nucleoprotein filaments significantly faster relative to Escherichia coli RecA. • D. radiodurans RecA-dsDNA nucleoprotein filaments are more flexible and slightly shorter compared to those of E. coli RecA.« less

Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

PubMed Central

Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

2005-01-01

Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

Mechanisms for RNA capture by ssDNA viruses: grand theft RNA.

PubMed

Stedman, Kenneth

2013-06-01

Viruses contain three common types of packaged genomes; double-stranded DNA (dsDNA), RNA (mostly single and occasionally double stranded) and single-stranded DNA (ssDNA). There are relatively straightforward explanations for the prevalence of viruses with dsDNA and RNA genomes, but the evolutionary basis for the apparent success of ssDNA viruses is less clear. The recent discovery of four ssDNA virus genomes that appear to have been formed by recombination between co-infecting RNA and ssDNA viruses, together with the high mutation rate of ssDNA viruses provide possible explanations. RNA-DNA recombination allows ssDNA viruses to access much broader sequence space than through nucleotide substitution and DNA-DNA recombination alone. Multiple non-exclusive mechanisms, all due to the unique replication of ssDNA viruses, are proposed for this unusual RNA capture. RNA capture provides an explanation for the evolutionary success of the ssDNA viruses and may help elucidate the mystery of integrated RNA viruses in viral and cellular DNA genomes.

Dna2 initiates resection at clean DNA double-strand breaks

PubMed Central

Paudyal, Sharad C.; Li, Shan; Yan, Hong; Hunter, Tony

2017-01-01

Abstract Nucleolytic resection of DNA double-strand breaks (DSBs) is essential for both checkpoint activation and homology-mediated repair; however, the precise mechanism of resection, especially the initiation step, remains incompletely understood. Resection of blocked ends with protein or chemical adducts is believed to be initiated by the MRN complex in conjunction with CtIP through internal cleavage of the 5′ strand DNA. However, it is not clear whether resection of clean DSBs with free ends is also initiated by the same mechanism. Using the Xenopus nuclear extract system, here we show that the Dna2 nuclease directly initiates the resection of clean DSBs by cleaving the 5′ strand DNA ∼10–20 nucleotides away from the ends. In the absence of Dna2, MRN together with CtIP mediate an alternative resection initiation pathway where the nuclease activity of MRN apparently directly cleaves the 5′ strand DNA at more distal sites. MRN also facilitates resection initiation by promoting the recruitment of Dna2 and CtIP to the DNA substrate. The ssDNA-binding protein RPA promotes both Dna2- and CtIP–MRN-dependent resection initiation, but a RPA mutant can distinguish between these pathways. Our results strongly suggest that resection of blocked and clean DSBs is initiated via distinct mechanisms. PMID:28981724

Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

PubMed Central

Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

2015-01-01

Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

PubMed

De Bruin, Lennart; Maddocks, John H

2018-06-14

The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

Detection of DNA double-strand breaks and chromosome translocations using ligation-mediated PCR and inverse PCR.

PubMed

Villalobos, Michael J; Betti, Christopher J; Vaughan, Andrew T M

2006-01-01

Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks introduced into any identifiable genomic location.

DNA Repair by DNA: The UV1C DNAzyme Catalyzes Photoreactivation of Cyclobutane Thymine Dimers in DNA More Effectively than Their de Novo Formation.

PubMed

Barlev, Adam; Sekhon, Gurpreet S; Bennet, Andrew J; Sen, Dipankar

2016-11-01

UV1C, a 42-nt DNA oligonucleotide, is a deoxyribozyme (DNAzyme) that optimally uses 305 nm wavelength light to catalyze photoreactivation of a cyclobutane thymine dimer placed within a gapped, unnatural DNA substrate, TDP. Herein we show that UV1C is also capable of photoreactivating thymine dimers within an authentic single-stranded DNA substrate, LDP. This bona fide UV1C substrate enables, for the first time, investigation of whether UV1C catalyzes only photoreactivation or also the de novo formation of thymine dimers. Single-turnover experiments carried out with LDP and UV1C, relative to control experiments with LDP alone in single-stranded and double-stranded contexts, show that while UV1C does modestly promote thymine dimer formation, its major activity is indeed photoreactivation. Distinct photostationary states are reached for LDP in its three contexts: as a single strand, as a constituent of a double-helix, and as a 1:1 complex with UV1C. The above results on the cofactor-independent photoreactivation capabilities of a catalytic DNA reinforce a series of recent, unexpected reports that purely nucleotide-based photoreactivation is also operational within conventional double-helical DNA.

A novel nonenzymatic cascade amplification for ultrasensitive photoelectrochemical DNA sensing based on target driven to initiate cyclic assembly of hairpins.

PubMed

Wen, Guangming; Dong, Wenxia; Liu, Bin; Li, Zhongping; Fan, Lifang

2018-05-29

A novel cascade photoelectrochemical (PEC) signal amplification biosensing tactics was developed for DNA detection based on a target-driven DNA association to induce cyclic hairpin assembly. In the circulatory system there are two ssDNA (A and B) and two hairpins (C and D). The hybridization of these ssDNA led to the formation of an A-target-B structure. The close proximity of their toehold and branch-migration regions was able to induce the cyclic hairpin assembly. Afterwards, the assembly result further causes the separation of a double-stranded probe DNA (Q:F) to switch the PEC signal via toehold-mediated strand replacement. As such, the signal stranded DNA-CdS QDs (F) as the signal tag was released in the presence of the target DNA. The signal DNA-CdS QDs was then coated to F-doped tin oxide (FTO) electrode leading to the "signal-on" PEC signal. The designed biosensing strategy showed a low detection limit of 21.3 pM for target DNA and a broad linear range from 50 pM to 100 nM. This signal amplification PEC sensing method exhibited a potential application to detect protein molecules, RNA or metal ions via changing the sequence of A and B recognition. Copyright © 2018 Elsevier B.V. All rights reserved.

A non-canonical DNA structure enables homologous recombination in various genetic systems.

PubMed

Masuda, Tokiha; Ito, Yutaka; Terada, Tohru; Shibata, Takehiko; Mikawa, Tsutomu

2009-10-30

Homologous recombination, which is critical to genetic diversity, depends on homologous pairing (HP). HP is the switch from parental to recombinant base pairs, which requires expansion of inter-base pair spaces. This expansion unavoidably causes untwisting of the parental double-stranded DNA. RecA/Rad51-catalyzed ATP-dependent HP is extensively stimulated in vitro by negative supercoils, which compensates for untwisting. However, in vivo, double-stranded DNA is relaxed by bound proteins and thus is an unfavorable substrate for RecA/Rad51. In contrast, Mhr1, an ATP-independent HP protein required for yeast mitochondrial homologous recombination, catalyzes HP without the net untwisting of double-stranded DNA. Therefore, we questioned whether Mhr1 uses a novel strategy to promote HP. Here, we found that, like RecA, Mhr1 induced the extension of bound single-stranded DNA. In addition, this structure was induced by all evolutionarily and structurally distinct HP proteins so far tested, including bacterial RecO, viral RecT, and human Rad51. Thus, HP includes the common non-canonical DNA structure and uses a common core mechanism, independent of the species of HP proteins. We discuss the significance of multiple types of HP proteins.

Trifluorothymidine exhibits potent antitumor activity via the induction of DNA double-strand breaks.

PubMed

Suzuki, Norihiko; Nakagawa, Fumio; Nukatsuka, Mamoru; Fukushima, Masakazu

2011-05-01

TAS-102 is an oral anticancer drug composed of trifluorothymidine (TFT) and TPI (an inhibitor of thymidine phosphorylase that strongly inhibits the biodegradation of TFT). Similar to 5-fluorouracil (5FU) and 5-fluoro-2'-deoxyuridine (FdUrd), TFT also inhibits thymidylate synthase (TS), a rate-limiting enzyme of DNA biosynthesis, and is incorporated into DNA. TFT exhibits an anticancer effect on colorectal cancer cells that have acquired 5FU and/or FdUrd resistance as a result of the overexpression of TS. Therefore, we examined the mode of action of TFT-induced DNA damage after its incorporation into DNA. When HeLa cells were treated with TFT, the number of ring-open aldehyde forms at apurinic/apyrimidinic sites increased in a dose-dependent manner, although we previously reported that no detectable excisions of TFT paired to adenine were observed using uracil DNA glycosylases, thymine DNA glycosylase or methyl-CpG binding domain 4 and HeLa whole cell extracts. To investigate the functional mechanism of TFT-induced DNA damage, we measured the phosphorylation of ATR, ATM, BRCA2, chk1 and chk2 in nuclear extracts of HeLa cells after 0, 24, 48 or 72 h of exposure to an IC(50) concentration of TFT, FdUrd or 5FU using Western blot analysis or an enzyme-linked immunosorbent assay (ELISA). Unlike FdUrd and 5FU, TFT resulted in an earlier phosphorylation of ATR and chk1 proteins after only 24 h of exposure, while phosphorylated ATM, BRCA2 and chk2 proteins were detected after more than 48 h of exposure to TFT. These results suggest that TFT causes single-strand breaks followed by double-strand breaks in the DNA of TFT-treated cells. TFT (as TAS-102) showed a more potent antitumor activity than oral 5FU on CO-3 colon cancer xenografts in mice, and such antitumor potency was supported by the increased number of double-strand breaks occurring after single-strand breaks in the DNA of the TFT-treated tumors. These results suggest that TFT causes single-strand breaks after its incorporation into DNA followed by double-strand breaks, resulting in DNA damage. This effect of TFT on DNA may explain its potent anticancer activity in cancer therapy.

Trifluorothymidine exhibits potent antitumor activity via the induction of DNA double-strand breaks

PubMed Central

SUZUKI, NORIHIKO; NAKAGAWA, FUMIO; NUKATSUKA, MAMORU; FUKUSHIMA, MASAKAZU

2011-01-01

TAS-102 is an oral anticancer drug composed of trifluorothymidine (TFT) and TPI (an inhibitor of thymidine phosphorylase that strongly inhibits the biodegradation of TFT). Similar to 5-fluorouracil (5FU) and 5-fluoro-2′-deoxyuridine (FdUrd), TFT also inhibits thymidylate synthase (TS), a rate-limiting enzyme of DNA biosynthesis, and is incorporated into DNA. TFT exhibits an anticancer effect on colorectal cancer cells that have acquired 5FU and/or FdUrd resistance as a result of the overexpression of TS. Therefore, we examined the mode of action of TFT-induced DNA damage after its incorporation into DNA. When HeLa cells were treated with TFT, the number of ring-open aldehyde forms at apurinic/apyrimidinic sites increased in a dose-dependent manner, although we previously reported that no detectable excisions of TFT paired to adenine were observed using uracil DNA glycosylases, thymine DNA glycosylase or methyl-CpG binding domain 4 and HeLa whole cell extracts. To investigate the functional mechanism of TFT-induced DNA damage, we measured the phosphorylation of ATR, ATM, BRCA2, chk1 and chk2 in nuclear extracts of HeLa cells after 0, 24, 48 or 72 h of exposure to an IC50 concentration of TFT, FdUrd or 5FU using Western blot analysis or an enzyme-linked immunosorbent assay (ELISA). Unlike FdUrd and 5FU, TFT resulted in an earlier phosphorylation of ATR and chk1 proteins after only 24 h of exposure, while phosphorylated ATM, BRCA2 and chk2 proteins were detected after more than 48 h of exposure to TFT. These results suggest that TFT causes single-strand breaks followed by double-strand breaks in the DNA of TFT-treated cells. TFT (as TAS-102) showed a more potent antitumor activity than oral 5FU on CO-3 colon cancer xenografts in mice, and such antitumor potency was supported by the increased number of double-strand breaks occurring after single-strand breaks in the DNA of the TFT-treated tumors. These results suggest that TFT causes single-strand breaks after its incorporation into DNA followed by double-strand breaks, resulting in DNA damage. This effect of TFT on DNA may explain its potent anticancer activity in cancer therapy. PMID:22977515

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

DOE PAGES

Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

2015-06-02

Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sobottka, Marcelo, E-mail: sobottka@mtm.ufsc.br; Hart, Andrew G., E-mail: ahart@dim.uchile.cl

Highlights: {yields} We propose a simple stochastic model to construct primitive DNA sequences. {yields} The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. {yields} The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. {yields} We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. {yields} We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that themore » frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.« less

Trehalose facilitates DNA melting: a single-molecule optical tweezers study.

PubMed

Bezrukavnikov, Sergey; Mashaghi, Alireza; van Wijk, Roeland J; Gu, Chan; Yang, Li Jiang; Gao, Yi Qin; Tans, Sander J

2014-10-07

Using optical tweezers, here we show that the overstretching transition force of double-stranded DNA (dsDNA) is lowered significantly by the addition of the disaccharide trehalose as well as certain polyol osmolytes. This effect is found to depend linearly on the logarithm of the trehalose concentration. We propose an entropic driving mechanism for the experimentally observed destabilization of dsDNA that is rooted in the higher affinity of the DNA bases for trehalose than for water, which promotes base exposure and DNA melting. Molecular dynamics simulation reveals the direct interaction of trehalose with nucleobases. Experiments with other osmolytes confirm that the extent of dsDNA destabilization is governed by the ratio between polar and apolar fractions of an osmolyte.

[Lethal effect after transmutation of 33P incorporated into bacteriophage S 13 and mechanisms of DNA double helix rupture].

PubMed

Apelgot, S

1980-04-01

The experiments show the lethal effect of the beta decay of 33P incorporated in DNA of bacteriophage S 13. The lethal efficiency is high, 0.72 at 0 degrees C and 0.55 at--197 degrees C. The presence of a radical scavenger like AET has no influence. It was found previously that for such phages with single-stranded DNA, the lethal efficiency of 32P decay is unity, and that the lethal event is a DNA single-strand break, owing to the high energy of the nucleogenic 32S atom. As the recoil energy of the 33S atom is too low to account for such a break, it is suggested that the reorganization of the phosphate molecule into sulphate is able to bring about a DNA single-strand break with an efficiency as high as 0.7, at 0 degrees C. A model for the DNA double-strand-break produced by a transmutation processes is suggested.

DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay

PubMed Central

Park, Sojin; Choi, Seoyun; Ahn, Byungchan

2016-01-01

DNA damage responses are important for the maintenance of genome stability and the survival of organisms. Such responses are activated in the presence of DNA damage and lead to cell cycle arrest, apoptosis, and DNA repair. In Caenorhabditis elegans, double-strand breaks induced by DNA damaging agents have been detected indirectly by antibodies against DSB recognizing proteins. In this study we used a comet assay to detect DNA strand breaks and to measure the elimination of DNA strand breaks in mitotic germline nuclei of C. elegans. We found that C. elegans brc-1 mutants were more sensitive to ionizing radiation and camptothecin than the N2 wild-type strain and repaired DNA strand breaks less efficiently than N2. This study is the first demonstration of direct measurement of DNA strand breaks in mitotic germline nuclei of C. elegans. This newly developed assay can be applied to detect DNA strand breaks in different C. elegans mutants that are sensitive to DNA damaging agents. PMID:26903030

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

PubMed Central

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

2017-01-01

Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

PubMed

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

SAMHD1 Sheds Moonlight on DNA Double-Strand Break Repair.

PubMed

Cabello-Lobato, Maria Jose; Wang, Siyue; Schmidt, Christine Katrin

2017-12-01

SAMHD1 (sterile α motif and histidine (H) aspartate (D) domain-containing protein 1) is known for its antiviral activity of hydrolysing deoxynucleotides required for virus replication. Daddacha et al. identify a hydrolase-independent, moonlighting function of SAMHD1 that facilitates homologous recombination of DNA double-strand breaks (DSBs) by promoting recruitment of C-terminal binding protein interacting protein (CTIP), a DNA-end resection factor, to damaged DNA. These findings could benefit anticancer treatment. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Evidence for a Single-Stranded Adenovirus-Associated Virus Genome: Isolation and Separation of Complementary Single Strands

PubMed Central

Berns, K. I.; Rose, J. A.

1970-01-01

Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749

High sensitive and direct fluorescence detection of single viral DNA sequences by integration of double strand probes onto microgels particles.

PubMed

Aliberti, A; Cusano, A M; Battista, E; Causa, F; Netti, P A

2016-02-21

A novel class of probes for fluorescence detection was developed and combined to microgel particles for a high sensitive fluorescence detection of nucleic acids. A double strand probe with an optimized fluorescent-quencher couple was designed for the detection of different lengths of nucleic acids (39 nt and 100 nt). Such probe proved efficient in target detection in different contests and specific even in presence of serum proteins. The conjugation of double strand probes onto polymeric microgels allows for a sensitive detection of DNA sequences from HIV, HCV and SARS corona viruses with a LOD of 1.4 fM, 3.7 fM and 1.4 fM, respectively, and with a dynamic range of 10(-9)-10(-15) M. Such combination enhances the sensitivity of the detection of almost five orders of magnitude when compared to the only probe. The proposed platform based on the integration of innovative double strand probe into microgels particles represents an attractive alternative to conventional sensitive DNA detection technologies that rely on amplifications methods.

DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

PubMed

Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

2015-10-29

Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poeschla, Eric, E-mail: poeschla.eric@mayo.edu

Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins,more » and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import.« less

Determination and analysis of site-specific 125I decay-induced DNA double-strand break end-group structures.

PubMed

Datta, Kamal; Weinfeld, Michael; Neumann, Ronald D; Winters, Thomas A

2007-02-01

End groups contribute to the structural complexity of radiation-induced DNA double-strand breaks (DSBs). As such, end-group structures may affect a cell's ability to repair DSBs. The 3'-end groups of strand breaks caused by gamma radiation, or oxidative processes, under oxygenated aqueous conditions have been shown to be distributed primarily between 3'-phosphoglycolate and 3'-phosphate, with 5'-phosphate ends in both cases. In this study, end groups of the high-LET-like DSBs caused by 125I decay were investigated. Site-specific DNA double-strand breaks were produced in plasmid pTC27 in the presence or absence of 2 M DMSO by 125I-labeled triplex-forming oligonucleotide targeting. End-group structure was assessed enzymatically as a function of the DSB end to serve as a substrate for ligation and various forms of end labeling. Using this approach, we have demonstrated 3'-hydroxyl (3'-OH) and 3'-phosphate (3'-P) end groups and 5'-ends (> or = 42%) terminated by phosphate. A 32P postlabeling assay failed to detect 3'-phosphoglycolate in a restriction fragment terminated by the 125I-induced DNA double-strand break, and this is likely due to restricted oxygen diffusion during irradiation as a frozen aqueous solution. Even so, end-group structure and relative distribution varied as a function of the free radical scavenging capacity of the irradiation buffer.

Why double-stranded RNA resists condensation

PubMed Central

Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.

2014-01-01

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663

Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

PubMed Central

Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

2013-01-01

Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

Complete Genome Sequence of EtG, the First Phage Sequenced from Erwinia tracheiphila.

PubMed

Andrade-Domínguez, Andrés; Kolter, Roberto; Shapiro, Lori R

2018-02-22

Erwinia tracheiphila is the causal agent of bacterial wilt of cucurbits. Here, we report the genome sequence of the temperate phage EtG, which was isolated from an E. tracheiphila -infected cucumber plant. Phage EtG has a linear 30,413-bp double-stranded DNA genome with cohesive ends and 45 predicted open reading frames. Copyright © 2018 Andrade-Domínguez et al.

Winding single-molecule double-stranded DNA on a nanometer-sized reel

PubMed Central

You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

2012-01-01

A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

PubMed Central

2015-01-01

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

Yeast Pif1 accelerates annealing of complementary DNA strands.

PubMed

Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

2014-12-09

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

The Human DNA glycosylases NEIL1 and NEIL3 Excise Psoralen-Induced DNA-DNA Cross-Links in a Four-Stranded DNA Structure.

PubMed

Martin, Peter R; Couvé, Sophie; Zutterling, Caroline; Albelazi, Mustafa S; Groisman, Regina; Matkarimov, Bakhyt T; Parsons, Jason L; Elder, Rhoderick H; Saparbaev, Murat K

2017-12-12

Interstrand cross-links (ICLs) are highly cytotoxic DNA lesions that block DNA replication and transcription by preventing strand separation. Previously, we demonstrated that the bacterial and human DNA glycosylases Nei and NEIL1 excise unhooked psoralen-derived ICLs in three-stranded DNA via hydrolysis of the glycosidic bond between the crosslinked base and deoxyribose sugar. Furthermore, NEIL3 from Xenopus laevis has been shown to cleave psoralen- and abasic site-induced ICLs in Xenopus egg extracts. Here we report that human NEIL3 cleaves psoralen-induced DNA-DNA cross-links in three-stranded and four-stranded DNA substrates to generate unhooked DNA fragments containing either an abasic site or a psoralen-thymine monoadduct. Furthermore, while Nei and NEIL1 also cleave a psoralen-induced four-stranded DNA substrate to generate two unhooked DNA duplexes with a nick, NEIL3 targets both DNA strands in the ICL without generating single-strand breaks. The DNA substrate specificities of these Nei-like enzymes imply the occurrence of long uninterrupted three- and four-stranded crosslinked DNA-DNA structures that may originate in vivo from DNA replication fork bypass of an ICL. In conclusion, the Nei-like DNA glycosylases unhook psoralen-derived ICLs in various DNA structures via a genuine repair mechanism in which complex DNA lesions can be removed without generation of highly toxic double-strand breaks.

Flexible DNA Path in the MCM Double Hexamer Loaded on DNA.

PubMed

Hizume, Kohji; Kominami, Hiroaki; Kobayashi, Kei; Yamada, Hirofumi; Araki, Hiroyuki

2017-05-16

The formation of the pre-replicative complex (pre-RC) during the G1 phase, which is also called the licensing of DNA replication, is the initial and essential step of faithful DNA replication during the subsequent S phase. It is widely accepted that in the pre-RC, double-stranded DNA passes through the holes of two ring-shaped minichromosome maintenance (MCM) 2-7 hexamers; however, the spatial organization of the DNA and proteins involved in pre-RC formation is unclear. Here we reconstituted the pre-RC from purified DNA and proteins and visualized the complex using atomic force microscopy (AFM). AFM revealed that the MCM double hexamers formed elliptical particles on DNA. Analysis of the angle of binding of DNA to the MCM double hexamer suggests that the DNA does not completely pass through both holes of the MCM hexamers, possibly because the DNA exited from the gap between Mcm2 and Mcm5. A DNA loop fastened by the MCM double hexamer was detected in pre-RC samples reconstituted from purified proteins as well as those purified from yeast cells, suggesting a higher-order architecture of the loaded MCM hexamers and DNA strands.

Push back to respond better: regulatory inhibition of the DNA double-strand break response.

PubMed

Panier, Stephanie; Durocher, Daniel

2013-10-01

Single DNA lesions such as DNA double-strand breaks (DSBs) can cause cell death or trigger genome rearrangements that have oncogenic potential, and so the pathways that mend and signal DNA damage must be highly sensitive but, at the same time, selective and reversible. When initiated, boundaries must be set to restrict the DSB response to the site of the lesion. The integration of positive and, crucially, negative control points involving post-translational modifications such as phosphorylation, ubiquitylation and acetylation is key for building fast, effective responses to DNA damage and for mitigating the impact of DNA lesions on genome integrity.

Genetic recombination induced by DNA double-strand break in bacteriophage T4: nature of the left/right bias.

PubMed

Shcherbakov, Victor P; Shcherbakova, Tamara; Plugina, Lidiya; Sizova, Svetlana; Kudryashova, Elena; Granovsky, Igor

2008-06-01

The experimental system combining double-strand breaks (DSBs), produced site-specifically by SegC endonuclease, with the famous advantages of the bacteriophage T4 rII mutant recombination analysis was used here to elucidate the origin of the recombination bias on two sides of the DSB, especially pronounced in gene 39 (topoisomerase II) and gene 59 (41-helicase loader) mutants. Three sources were found to contribute to the bias: (1) the SegC endonuclease may remain bound to the end of the broken DNA and thus protect it from exonuclease degradation; (2) in heteroduplex heterozygotes (HHs), arising as the recombinant products in the left-hand crosses, the transcribed strands are of rII mutant phenotype, so they, in contrast to the right-hand HHs, do not produce plaques on the lawn of the lambda-lysogenic host; and (3) the intrinsic polarity of T4 chromosome, reflected in transcription, may be a cause for discrimination of promoter-proximal and promoter-distal DNA sequences. It is shown that the apparent recombination bias does not imply one-sidedness of the DSB repair but just reflects a different depth of the end processing. It is inferred that the cause, underlying the "intrinsic" bias, might be interference between strand exchange and transcription. Topoisomerase and helicase functions are necessary to turn the process in favor of strand exchange. The idea is substantiated that the double-stranded to single-stranded DNA transition edge (not ss-DNA tip) serves as an actual recombinogenic element.

Characterizing DNA Repair Processes at Transient and Long-lasting Double-strand DNA Breaks by Immunofluorescence Microscopy.

PubMed

Murthy, Vaibhav; Dacus, Dalton; Gamez, Monica; Hu, Changkun; Wendel, Sebastian O; Snow, Jazmine; Kahn, Andrew; Walterhouse, Stephen H; Wallace, Nicholas A

2018-06-08

The repair of double-stranded breaks (DSBs) in DNA is a highly coordinated process, necessitating the formation and resolution of multi-protein repair complexes. This process is regulated by a myriad of proteins that promote the association and disassociation of proteins to these lesions. Thanks in large part to the ability to perform functional screens of a vast library of proteins, there is a greater appreciation of the genes necessary for the double-strand DNA break repair. Often knockout or chemical inhibitor screens identify proteins involved in repair processes by using increased toxicity as a marker for a protein that is required for DSB repair. Although useful for identifying novel cellular proteins involved in maintaining genome fidelity, functional analysis requires the determination of whether the protein of interest promotes localization, formation, or resolution of repair complexes. The accumulation of repair proteins can be readily detected as distinct nuclear foci by immunofluorescence microscopy. Thus, association and disassociation of these proteins at sites of DNA damage can be accessed by observing these nuclear foci at representative intervals after the induction of double-strand DNA breaks. This approach can also identify mis-localized repair factor proteins, if repair defects do not simultaneously occur with incomplete delays in repair. In this scenario, long-lasting double-strand DNA breaks can be engineered by expressing a rare cutting endonuclease (e.g., I-SceI) in cells where the recognition site for the said enzyme has been integrated into the cellular genome. The resulting lesion is particularly hard to resolve as faithful repair will reintroduce the enzyme's recognition site, prompting another round of cleavage. As a result, differences in the kinetics of repair are eliminated. If repair complexes are not formed, localization has been impeded. This protocol describes the methodology necessary to identify changes in repair kinetics as well as repair protein localization.

Spatial distribution and yield of DNA double-strand breaks induced by 3-7 MeV helium ions in human fibroblasts

NASA Technical Reports Server (NTRS)

Rydberg, Bjorn; Heilbronn, Lawrence; Holley, William R.; Lobrich, Markus; Zeitlin, Cary; Chatterjee, Aloke; Cooper, Priscilla K.

2002-01-01

Accelerated helium ions with mean energies at the target location of 3-7 MeV were used to simulate alpha-particle radiation from radon daughters. The experimental setup and calibration procedure allowed determination of the helium-ion energy distribution and dose in the nuclei of irradiated cells. Using this system, the induction of DNA double-strand breaks and their spatial distributions along DNA were studied in irradiated human fibroblasts. It was found that the apparent number of double-strand breaks as measured by a standard pulsed-field gel assay (FAR assay) decreased with increasing LET in the range 67-120 keV/microm (corresponding to the energy of 7-3 MeV). On the other hand, the generation of small and intermediate-size DNA fragments (0.1-100 kbp) increased with LET, indicating an increased intratrack long-range clustering of breaks. The fragment size distribution was measured in several size classes down to the smallest class of 0.1-2 kbp. When the clustering was taken into account, the actual number of DNA double-strand breaks (separated by at least 0.1 kbp) could be calculated and was found to be in the range 0.010-0.012 breaks/Mbp Gy(-1). This is two- to threefold higher than the apparent yield obtained by the FAR assay. The measured yield of double-strand breaks as a function of LET is compared with theoretical Monte Carlo calculations that simulate the track structure of energy depositions from helium ions as they interact with the 30-nm chromatin fiber. When the calculation is performed to include fragments larger than 0.1 kbp (to correspond to the experimental measurements), there is good agreement between experiment and theory.

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Correlation between energy deposition and molecular damage from Auger electrons: A case study of ultra-low energy (5–18 eV) electron interactions with DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rezaee, Mohammad, E-mail: Mohammad.Rezaee@USherbrooke.ca; Hunting, Darel J.; Sanche, Léon

2014-07-15

Purpose: The present study introduces a new method to establish a direct correlation between biologically related physical parameters (i.e., stopping and damaging cross sections, respectively) for an Auger-electron emitting radionuclide decaying within a target molecule (e.g., DNA), so as to evaluate the efficacy of the radionuclide at the molecular level. These parameters can be applied to the dosimetry of Auger electrons and the quantification of their biological effects, which are the main criteria to assess the therapeutic efficacy of Auger-electron emitting radionuclides. Methods: Absorbed dose and stopping cross section for the Auger electrons of 5–18 eV emitted by{sup 125}I withinmore » DNA were determined by developing a nanodosimetric model. The molecular damages induced by these Auger electrons were investigated by measuring damaging cross section, including that for the formation of DNA single- and double-strand breaks. Nanoscale films of pure plasmid DNA were prepared via the freeze-drying technique and subsequently irradiated with low-energy electrons at various fluences. The damaging cross sections were determined by employing a molecular survival model to the measured exposure–response curves for induction of DNA strand breaks. Results: For a single decay of{sup 125}I within DNA, the Auger electrons of 5–18 eV deposit the energies of 12.1 and 9.1 eV within a 4.2-nm{sup 3} volume of a hydrated or dry DNA, which results in the absorbed doses of 270 and 210 kGy, respectively. DNA bases have a major contribution to the deposited energies. Ten-electronvolt and high linear energy transfer 100-eV electrons have a similar cross section for the formation of DNA double-strand break, while 100-eV electrons are twice as efficient as 10 eV in the induction of single-strand break. Conclusions: Ultra-low-energy electrons (<18 eV) substantially contribute to the absorbed dose and to the molecular damage from Auger-electron emitting radionuclides; hence, they should be considered in the dosimetry calculation of such radionuclides. Moreover, absorbed dose is not an appropriate physical parameter for nanodosimetry. Instead, stopping cross section, which describes the probability of energy deposition in a target molecule can be an appropriate nanodosimetric parameter. The stopping cross section is correlated with a damaging cross section (e.g., cross section for the double-strand break formation) to quantify the number of each specific lesion in a target molecule for each nuclear decay of a single Auger-electron emitting radionuclide.« less

Correlation between energy deposition and molecular damage from Auger electrons: A case study of ultra-low energy (5–18 eV) electron interactions with DNA

PubMed Central

Rezaee, Mohammad; Hunting, Darel J.; Sanche, Léon

2015-01-01

Purpose The present study introduces a new method to establish a direct correlation between biologically related physical parameters (i.e., stopping and damaging cross sections, respectively) for an Auger-electron emitting radionuclide decaying within a target molecule (e.g., DNA), so as to evaluate the efficacy of the radionuclide at the molecular level. These parameters can be applied to the dosimetry of Auger electrons and the quantification of their biological effects, which are the main criteria to assess the therapeutic efficacy of Auger-electron emitting radionuclides. Methods Absorbed dose and stopping cross section for the Auger electrons of 5–18 eV emitted by 125I within DNA were determined by developing a nanodosimetric model. The molecular damages induced by these Auger electrons were investigated by measuring damaging cross section, including that for the formation of DNA single- and double-strand breaks. Nanoscale films of pure plasmid DNA were prepared via the freeze-drying technique and subsequently irradiated with low-energy electrons at various fluences. The damaging cross sections were determined by employing a molecular survival model to the measured exposure–response curves for induction of DNA strand breaks. Results For a single decay of 125I within DNA, the Auger electrons of 5–18 eV deposit the energies of 12.1 and 9.1 eV within a 4.2-nm3 volume of a hydrated or dry DNA, which results in the absorbed doses of 270 and 210 kGy, respectively. DNA bases have a major contribution to the deposited energies. Ten-electronvolt and high linear energy transfer 100-eV electrons have a similar cross section for the formation of DNA double-strand break, while 100-eV electrons are twice as efficient as 10 eV in the induction of single-strand break. Conclusions Ultra-low-energy electrons (<18 eV) substantially contribute to the absorbed dose and to the molecular damage from Auger-electron emitting radionuclides; hence, they should be considered in the dosimetry calculation of such radionuclides. Moreover, absorbed dose is not an appropriate physical parameter for nanodosimetry. Instead, stopping cross section, which describes the probability of energy deposition in a target molecule can be an appropriate nanodosimetric parameter. The stopping cross section is correlated with a damaging cross section (e.g., cross section for the double-strand break formation) to quantify the number of each specific lesion in a target molecule for each nuclear decay of a single Auger-electron emitting radionuclide. PMID:24989405

Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

PubMed

Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

2018-01-01

DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

Polintons: a hotbed of eukaryotic virus, transposon and plasmid evolution

PubMed Central

Krupovic, Mart; Koonin, Eugene V.

2018-01-01

Polintons (also known as Mavericks) are large DNA transposons that are widespread in the genomes of eukaryotes. We have recently shown that Polintons encode virus capsid proteins, which suggests that these transposons might form virions, at least under some conditions. In this Opinion article, we delineate the evolutionary relationships among bacterial tectiviruses, Polintons, adenoviruses, virophages, large and giant DNA viruses of eukaryotes of the proposed order ‘Megavirales’, and linear mitochondrial and cytoplasmic plasmids. We hypothesize that Polintons were the first group of eukaryotic double-stranded DNA viruses to evolve from bacteriophages and that they gave rise to most large DNA viruses of eukaryotes and various other selfish genetic elements. PMID:25534808

Mechanism for accurate, protein-assisted DNA annealing by Deinococcus radiodurans DdrB

PubMed Central

Sugiman-Marangos, Seiji N.; Weiss, Yoni M.; Junop, Murray S.

2016-01-01

Accurate pairing of DNA strands is essential for repair of DNA double-strand breaks (DSBs). How cells achieve accurate annealing when large regions of single-strand DNA are unpaired has remained unclear despite many efforts focused on understanding proteins, which mediate this process. Here we report the crystal structure of a single-strand annealing protein [DdrB (DNA damage response B)] in complex with a partially annealed DNA intermediate to 2.2 Å. This structure and supporting biochemical data reveal a mechanism for accurate annealing involving DdrB-mediated proofreading of strand complementarity. DdrB promotes high-fidelity annealing by constraining specific bases from unauthorized association and only releases annealed duplex when bound strands are fully complementary. To our knowledge, this mechanism provides the first understanding for how cells achieve accurate, protein-assisted strand annealing under biological conditions that would otherwise favor misannealing. PMID:27044084

New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong

Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less

Theory of high-force DNA stretching and overstretching.

PubMed

Storm, C; Nelson, P C

2003-05-01

Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not satisfactorily describe recent high-force stretching data. We instead propose a model (the discrete persistent chain) that borrows features from both the FJC and the wormlike chain, and show that it resembles the data more closely. We find that most of the high-force behavior previously attributed to stretch elasticity is really a feature of the corrected entropic elasticity; the true stretch compliance of single-stranded DNA is several times smaller than that found by previous authors. Next we elaborate our model to allow coexistence of two conformational states of DNA, each with its own stretch and bend elastic constants. Our model is computationally simple and gives an excellent fit through the entire overstretching transition of nicked, double-stranded DNA. The fit gives the first value for the bend stiffness of the overstretched state. In particular, we find the effective bend stiffness for DNA in this state to be about 12 nm k(B)T, a value quite different from either the B-form or single-stranded DNA.

Combined quantum-mechanics/molecular-mechanics dynamics simulation of A-DNA double strands irradiated by ultra-low-energy carbon ions

NASA Astrophysics Data System (ADS)

Ngaojampa, C.; Nimmanpipug, P.; Yu, L. D.; Anuntalabhochai, S.; Lee, V. S.

2011-02-01

In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.

Gel electrophoresis of linear and star-branched DNA

NASA Astrophysics Data System (ADS)

Lau, Henry W.; Archer, Lynden A.

2011-12-01

The electrophoretic mobility of double-stranded DNA in polyacrylamide gel is investigated using an activated hopping model for the transport of a charged object within a heterogeneous medium. The model is premised upon a representation of the DNA path through the gel matrix as a series of traps with alternating large and small cross sections. Calculations of the trap dimensions from gel data show that the path imposes varying degrees of confinement upon migrating analytes, which retard their forward motion in a size-dependent manner. An expression derived for DNA mobility is shown to provide accurate predictions for the dynamics of linear DNA (67-622 bp) in gels of multiple concentrations. For star-branched DNA, the incorporation within the model of a length scale previously proposed to account for analyte architecture [Yuan , Anal. Chem.ANCHAM0003-270010.1021/ac060414w 78, 6179 (2006)] leads to mobility predictions that compare well with experimental results for a wide range of DNA shapes and molecular weights.

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.

PubMed

Nowarski, Roni; Kotler, Moshe

2013-06-15

High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. ©2013 AACR.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zahn, Karl E.; Averill, April M.; Aller, Pierre

DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less

DNA Damage by Ionizing Radiation: Tandem Double Lesions by Charged Particles

NASA Technical Reports Server (NTRS)

Huo, Winifred M.; Chaban, Galina M.; Wang, Dunyou; Dateo, Christopher E.

2005-01-01

Oxidative damages by ionizing radiation are the source of radiation-induced carcinogenesis, damage to the central nervous system, lowering of the immune response, as well as other radiation-induced damages to human health. Monte Carlo track simulations and kinetic modeling of radiation damages to the DNA employ available molecular and cellular data to simulate the biological effect of high and low LET radiation io the DNA. While the simulations predict single and double strand breaks and base damages, so far all complex lesions are the result of stochastic coincidence from independent processes. Tandem double lesions have not yet been taken into account. Unlike the standard double lesions that are produced by two separate attacks by charged particles or radicals, tandem double lesions are produced by one single attack. The standard double lesions dominate at the high dosage regime. On the other hand, tandem double lesions do not depend on stochastic coincidences and become important at the low dosage regime of particular interest to NASA. Tandem double lesions by hydroxyl radical attack of guanine in isolated DNA have been reported at a dosage of radiation as low as 10 Gy. The formation of two tandem base lesions was found to be linear with the applied doses, a characteristic of tandem lesions. However, tandem double lesions from attack by a charged particle have not been reported.

When Maxwellian demon meets action at a distance. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Rybenkov, Valentin V.

2016-09-01

The ability of living systems to defy thermodynamics without explicitly violating it is a continued source of inspiration to many biophysicists. The story of type-2 DNA topoisomerases is a beautiful example from that book. DNA topoisomerases catalyze a concerted DNA cleavage-religation reaction, which is interjected by a strand passage event. This sequence of events results in a seemingly unhindered transfer of one piece of DNA through another upon their random collision. An obvious consequence of such transfer is a change in the topological state of the colliding DNAs; hence the name of the enzymes, topoisomerases. There are several classes of topoisomerases, which differ in how they capture the cleaved and transported DNA segments (which are often referred to as the gate and transfer segments; or the G- and T-segments, to be short). Type-2 topoisomerases have two cleavage-religation centers. They open a gate in double stranded DNA and transfer another piece of double stranded DNA through it [1]. And in doing so, they manage to collect information about the rest of the DNA and perform strand passage in a directional manner so as to take the molecule away from the thermodynamic equilibrium [2].

CgII cleaves DNA using a mechanism distinct from other ATP-dependent restriction endonucleases

PubMed Central

Toliusis, Paulius; Silanskas, Arunas; Szczelkun, Mark D.

2017-01-01

Abstract The restriction endonuclease CglI from Corynebacterium glutamicum recognizes an asymmetric 5′-GCCGC-3′ site and cleaves the DNA 7 and 6/7 nucleotides downstream on the top and bottom DNA strands, respectively, in an NTP-hydrolysis dependent reaction. CglI is composed of two different proteins: an endonuclease (R.CglI) and a DEAD-family helicase-like ATPase (H.CglI). These subunits form a heterotetrameric complex with R2H2 stoichiometry. However, the R2H2·CglI complex has only one nuclease active site sufficient to cut one DNA strand suggesting that two complexes are required to introduce a double strand break. Here, we report studies to evaluate the DNA cleavage mechanism of CglI. Using one- and two-site circular DNA substrates we show that CglI does not require two sites on the same DNA for optimal catalytic activity. However, one-site linear DNA is a poor substrate, supporting a mechanism where CglI complexes must communicate along the one-dimensional DNA contour before cleavage is activated. Based on experimental data, we propose that adenosine triphosphate (ATP) hydrolysis by CglI produces translocation on DNA preferentially in a downstream direction from the target, although upstream translocation is also possible. Our results are consistent with a mechanism of CglI action that is distinct from that of other ATP-dependent restriction-modification enzymes. PMID:28854738

3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

NASA Astrophysics Data System (ADS)

Konforti, Boyana B.; Davis, Ronald W.

1987-02-01

The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

Armored DNA in recombinant Baculoviruses as controls in molecular genetic assays.

PubMed

Freystetter, Andrea; Paar, Christian; Stekel, Herbert; Berg, Jörg

2017-10-01

The widespread use of molecular PCR-based assays in analytical and clinical laboratories brings about the need for test-specific, stable, and reliable external controls (EC) as well as standards and internal amplification controls (IC), in order to arrive at consistent test results. In addition, there is also a growing need to produce and provide stable, well-characterized molecular controls for quality assurance programs. In this study, we describe a novel approach to generate armored double-stranded DNA controls, which are encapsulated in baculovirus (BV) particles of the species Autographa californica multiple nucleopolyhedrovirus. We used the well-known BacPAK™ Baculovirus Expression System (Takara-Clontech), removed the polyhedrin promoter used for protein expression, and generated recombinant BV-armored DNAs. The obtained BV-armored DNAs were readily extracted by standard clinical DNA extraction methods, showed favorable linearity and performance in our clinical PCR assays, were resistant to DNase I digestion, and exhibited marked stability in human plasma and serum. BV-armored DNA ought to be used as ECs, quantification standards, and ICs in molecular assays, with the latter application allowing for the entire monitoring of clinical molecular assays for sample adequacy. BV-armored DNA may also be used to produce double-stranded DNA reference materials for, e.g., quality assurance programs. The ease to produce BV-armored DNA should make this approach feasible for a broad spectrum of molecular applications. Finally, as BV-armored DNAs are non-infectious to mammals, they may be even more conveniently shipped than clinical specimen.

Scanning fluorescence correlation spectroscopy techniques to quantify the kinetics of DNA double strand break repair proteins after γ-irradiation and bleomycin treatment

PubMed Central

Abdisalaam, Salim; Davis, Anthony J.; Chen, David J.; Alexandrakis, George

2014-01-01

A common feature of DNA repair proteins is their mobilization in response to DNA damage. The ability to visualizing and quantifying the kinetics of proteins localizing/dissociating from DNA double strand breaks (DSBs) via immunofluorescence or live cell fluorescence microscopy have been powerful tools in allowing insight into the DNA damage response, but these tools have some limitations. For example, a number of well-established DSB repair factors, in particular those required for non-homologous end joining (NHEJ), do not form discrete foci in response to DSBs induced by ionizing radiation (IR) or radiomimetic drugs, including bleomycin, in living cells. In this report, we show that time-dependent kinetics of the NHEJ factors Ku80 and DNA-dependent protein kinase catalytic subunits (DNA–PKcs) in response to IR and bleomycin can be quantified by Number and Brightness analysis and Raster-scan Image Correlation Spectroscopy. Fluorescent-tagged Ku80 and DNA–PKcs quickly mobilized in response to IR and bleomycin treatments consistent with prior reports using laser-generated DSBs. The response was linearly dependent on IR dose, and blocking NHEJ enhanced immobilization of both Ku80 and DNA–PKcs after DNA damage. These findings support the idea of using Number and Brightness and Raster-scan Image Correlation Spectroscopy as methods to monitor kinetics of DSB repair proteins in living cells under conditions mimicking radiation and chemotherapy treatments. PMID:24137007

Spatially sculpted laser scissors for study of DNA damage and repair

NASA Astrophysics Data System (ADS)

Stephens, Jared; Mohanty, Samarendra K.; Genc, Suzanne; Kong, Xiangduo; Yokomori, Kyoko; Berns, Michael W.

2009-09-01

We present a simple and efficient method for controlled linear induction of DNA damage in live cells. By passing a pulsed laser beam through a cylindrical lens prior to expansion, an elongated elliptical beam profile is created with the ability to expose controlled linear patterns while keeping the beam and the sample stationary. The length and orientation of the beam at the sample plane were reliably controlled by an adjustable aperture and rotation of the cylindrical lens, respectively. Localized immunostaining by the DNA double strand break (DSB) markers phosphorylated H2AX (γH2AX) and Nbs1 in the nuclei of HeLa cells exposed to the ``line scissors'' was shown via confocal imaging. The line scissors method proved more efficient than the scanning mirror and scanning stage methods at induction of DNA DSB damage with the added benefit of having a greater potential for high throughput applications.

Monte Carlo simulation of ionizing radiation induced DNA strand breaks utilizing coarse grained high-order chromatin structures.

PubMed

Liang, Ying; Yang, Gen; Liu, Feng; Wang, Yugang

2016-01-07

Ionizing radiation threatens genome integrity by causing DNA damage. Monte Carlo simulation of the interaction of a radiation track structure with DNA provides a powerful tool for investigating the mechanisms of the biological effects. However, the more or less oversimplification of the indirect effect and the inadequate consideration of high-order chromatin structures in current models usually results in discrepancies between simulations and experiments, which undermine the predictive role of the models. Here we present a biophysical model taking into consideration factors that influence indirect effect to simulate radiation-induced DNA strand breaks in eukaryotic cells with high-order chromatin structures. The calculated yields of single-strand breaks and double-strand breaks (DSBs) for photons are in good agreement with the experimental measurements. The calculated yields of DSB for protons and α particles are consistent with simulations by the PARTRAC code, whereas an overestimation is seen compared with the experimental results. The simulated fragment size distributions for (60)Co γ irradiation and α particle irradiation are compared with the measurements accordingly. The excellent agreement with (60)Co irradiation validates our model in simulating photon irradiation. The general agreement found in α particle irradiation encourages model applicability in the high linear energy transfer range. Moreover, we demonstrate the importance of chromatin high-order structures in shaping the spectrum of initial damage.

Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

PubMed

Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

2013-01-01

We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

DNA strand-exchange patterns associated with double-strand break-induced and spontaneous mitotic crossovers in Saccharomyces cerevisiae

PubMed Central

2018-01-01

Mitotic recombination can result in loss of heterozygosity and chromosomal rearrangements that shape genome structure and initiate human disease. Engineered double-strand breaks (DSBs) are a potent initiator of recombination, but whether spontaneous events initiate with the breakage of one or both DNA strands remains unclear. In the current study, a crossover (CO)-specific assay was used to compare heteroduplex DNA (hetDNA) profiles, which reflect strand exchange intermediates, associated with DSB-induced versus spontaneous events in yeast. Most DSB-induced CO products had the two-sided hetDNA predicted by the canonical DSB repair model, with a switch in hetDNA position from one product to the other at the position of the break. Approximately 40% of COs, however, had hetDNA on only one side of the initiating break. This anomaly can be explained by a modified model in which there is frequent processing of an early invasion (D-loop) intermediate prior to extension of the invading end. Finally, hetDNA tracts exhibited complexities consistent with frequent expansion of the DSB into a gap, migration of strand-exchange junctions, and template switching during gap-filling reactions. hetDNA patterns in spontaneous COs isolated in either a wild-type background or in a background with elevated levels of reactive oxygen species (tsa1Δ mutant) were similar to those associated with the DSB-induced events, suggesting that DSBs are the major instigator of spontaneous mitotic recombination in yeast. PMID:29579095

Trapping and breaking of in vivo nicked DNA during pulsed-field gel electrophoresis

PubMed Central

Khan, Sharik R.; Kuzminov, Andrei

2013-01-01

Pulsed field gel electrophoresis (PFGE) offers a high-resolution approach to quantify chromosomal fragmentation in bacteria, measured as percent of chromosomal DNA entering the gel. The degree of separation in PFG depends upon the size of DNA, as well as various conditions of electrophoresis, such as electric field strength (FS), time of electrophoresis, switch time and buffer composition. Here we describe a new parameter, the structural integrity of the sample DNA itself, that influences its migration through PFGs. We show that sub-chromosomal fragments containing both spontaneous and DNA damage-induced nicks are prone to breakage during PFGE. Such breakage at single strand interruptions results in artefactual decrease in molecular weight of linear DNA making accurate determination of the number of double strand breaks difficult. While breakage of nicked sub-chromosomal fragments is FS-independent, some high molecular weight sub-chromosomal fragments are also trapped within wells under the standard PFGE conditions. This trapping can be minimized by lowering the field strength and increasing the time of electrophoresis. We discuss how breakage of nicked DNA may be mechanistically linked to trapping. Our results suggest how to optimize conditions for PFGE when quantifying chromosomal fragmentation induced by DNA damage. PMID:23770235

Joining of correct and incorrect DNA ends at double-strand breaks produced by high-linear energy transfer radiation in human fibroblasts

NASA Technical Reports Server (NTRS)

Lobrich, M.; Cooper, P. K.; Rydberg, B.; Chatterjee, A. (Principal Investigator)

1998-01-01

DNA double-strand breaks (DSBs) were measured within a 3.2-Mbp NotI fragment on chromosome 21 of cells of a normal human fibroblast cell line. Correct rejoining of DSBs was followed by measuring reconstitution of the original-size NotI fragment, and this was compared to total rejoining as measured by a conventional pulsed-field gel electrophoresis technique (FAR assay). After 80 Gy of particle irradiations with LETs in the range of 7-150 keV/microm, it was found that the repair kinetics was generally slower after irradiation with high-LET particles compared to X irradiation and that a larger proportion of the breaks remained unrepaired after 24 h. On the other hand, the misrejoining frequency as measured by the difference between correct and total rejoining after 24 h did not change with LET, but was approximately the same for all radiations at this dose, equal to 25-30% of the initial breaks. This result is discussed in relation to formation of chromosomal aberrations, deletion mutations and other biological end points.

Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

PubMed

Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

2009-09-01

Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

Repair and recombination of X-irradiated plasmids in Xenopus laevis oocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sweigert, S.E.; Carroll, D.

1990-11-01

Plasmid DNA substrates were X-irradiated and injected into the nuclei of Xenopus laevis oocytes. After incubation for 20 h, DNA was recovered from the oocytes and analyzed simultaneously for repair and for intermolecular homologous recombination by electrophoresis and bacterial transformation. Oocyte-mediated repair of DNA strand breaks was observed with both methods. Using a repair-deficient mutant Escherichia coli strain and its repair-proficient parent as hosts for the transformation assay, we also demonstrated that oocytes repaired oxidative-type DNA base damage induced by X-rays. X-irradiation of a circular DNA stimulated its potential to recombine with a homologous linear partner. Recombination products were detectedmore » directly by Southern blot hybridization and as bacterial transformant clones expressing two antibiotic resistance markers originally carried separately on the two substrates. The increase in recombination was dependent on X-ray dose. There is some suggestion that lesions other than double-strand breaks contribute to the stimulation of oocyte-mediated homologous recombination. In summary, oocytes have considerable capacity to repair X-ray-induced damage, and some X-ray lesions stimulate homologous recombination in these cells.« less

Human DNA polymerase θ grasps the primer terminus to mediate DNA repair

DOE PAGES

Zahn, Karl E.; Averill, April M.; Aller, Pierre; ...

2015-03-16

DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less

Synthetic transcripts of double-stranded Birnavirus genome are infectious.

PubMed Central

Mundt, E; Vakharia, V N

1996-01-01

We have developed a system for generation of infectious bursal disease virus (IBDV), a segmented double-stranded RNA virus of the Birnaviridae family, with the use of synthetic transcripts derived from cloned cDNA. Independent full-length cDNA clones were constructed that contained the entire coding and noncoding regions of RNA segments A and B of two distinguishable IBDV strains of serotype I. Segment A encodes all of the structural (VP2, VP4, and VP3) and nonstructural (VP5) proteins, whereas segment B encodes the RNA-dependent RNA polymerase (VP1). Synthetic RNAs of both segments were produced by in vitro transcription of linearized plasmids with T7 RNA polymerase. Transfection of Vero cells with combined plus-sense transcripts of both segments generated infectious virus as early as 36 hr after transfection. The infectivity and specificity of the recovered chimeric virus was ascertained by the appearance of cytopathic effect in chicken embryo cells, by immunofluorescence staining of infected Vero cells with rabbit anti-IBDV serum, and by nucleotide sequence analysis of the recovered virus, respectively. In addition, transfectant viruses containing genetically tagged sequences in either segment A or segment B of IBDV were generated to confirm the feasibility of this system. The development of a reverse genetics system for double-stranded RNA viruses will greatly facilitate studies of the regulation of viral gene expression, pathogenesis, and design of a new generation of live vaccines. Images Fig. 2 Fig. 3 Fig. 4 PMID:8855321

A Role for Single-Stranded Exonucleases in the Use of DNA as a Nutrient▿

PubMed Central

Palchevskiy, Vyacheslav; Finkel, Steven E.

2009-01-01

Nutritional competence is the ability of bacterial cells to utilize exogenous double-stranded DNA molecules as a nutrient source. We previously identified several genes in Escherichia coli that are important for this process and proposed a model, based on models of natural competence and transformation in bacteria, where it is assumed that single-stranded DNA (ssDNA) is degraded following entry into the cytoplasm. Since E. coli has several exonucleases, we determined whether they play a role in the long-term survival and the catabolism of DNA as a nutrient. We show here that mutants lacking either ExoI, ExoVII, ExoX, or RecJ are viable during all phases of the bacterial life cycle yet cannot compete with wild-type cells during long-term stationary-phase incubation. We also show that nuclease mutants, alone or in combination, are defective in DNA catabolism, with the exception of the ExoX− single mutant. The ExoX− mutant consumes double-stranded DNA better than wild-type cells, possibly implying the presence of two pathways in E. coli for the processing of ssDNA as it enters the cytoplasm. PMID:19329645

Sequence-Specific DNA Photosplitting of Crosslinked DNAs Containing the 3-Cyanovinylcarbazole Nucleoside by Using DNA Strand Displacement.

PubMed

Nakamura, Shigetaka; Kawabata, Hayato; Fujimoto, Kenzo

2016-08-17

An oligodeoxynucleotide (ODN) containing the ultrafast reversible 3-cyanovinylcarbazole ((CNV) K) photo-crosslinker was photo-crosslinked to a complementary strand upon exposure to 366 nm irradiation and photosplit by use of 312 nm irradiation. In this paper we report that the photoreaction of (CNV) K on irradiation at 366 nm involves a photostationary state and that its reaction can be controlled by temperature. Guided by this new insight, we proposed and have now demonstrated previously unknown photosplitting of (CNV) K aided by DNA strand displacement as an alternative to heating. The photo-crosslinked double-stranded DNA (dsDNA) underwent >80 % photosplitting aided by DNA strand displacement on irradiation at 366 nm without heating. In this photosplitting based on DNA strand displacement, the relative thermal stability of the invader strand with respect to the template strands plays an important role, and an invader strand/template strand system that is more stable than the passenger strand/template strand system induces photosplitting without heating. This new strand-displacement-aided photosplitting occurred in a sequence-specific manner through irradiation at 366 nm in the presence of an invader strand. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

WE-E-BRE-03: Biological Validation of a Novel High-Throughput Irradiator for Predictive Radiation Sensitivity Bioassays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowler, TL; Martin, JA; Shepard, AJ

2014-06-15

Purpose: The large dose-response variation in both tumor and normal cells between individual patients has led to the recent implementation of predictive bioassays of patient-specific radiation sensitivity in order to personalize radiation therapy. This exciting new clinical paradigm has led us to develop a novel high-throughput, variable dose-rate irradiator to accompany these efforts. Here we present the biological validation of this irradiator through the use of human cells as a relative dosimeter assessed by two metrics, DNA double-strand break repair pathway modulation and intercellular reactive oxygen species production. Methods: Immortalized human tonsilar epithelial cells were cultured in 96-well micro titermore » plates and irradiated in groups of eight wells to absorbed doses of 0, 0.5, 1, 2, 4, and 8 Gy. High-throughput immunofluorescent microscopy was used to detect γH2AX, a DNA double-strand break repair mechanism recruiter. The same analysis was performed with the cells stained with CM-H2DCFDA that produces a fluorescent adduct when exposed to reactive oxygen species during the irradiation cycle. Results: Irradiations of the immortalized human tonsilar epithelial cells at absorbed doses of 0, 0.5, 1, 2, 4, and 8 Gy produced excellent linearity in γH2AX and CM-H2DCFDA with R2 values of 0.9939 and 0.9595 respectively. Single cell gel electrophoresis experimentation for the detection of physical DNA double-strand breaks in ongoing. Conclusions: This work indicates significant potential for our high-throughput variable dose rate irradiator for patient-specific predictive radiation sensitivity bioassays. This irradiator provides a powerful tool by increasing the efficiency and number of assay techniques available to help personalize radiation therapy.« less

Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

PubMed Central

Phan, Anh Tuân; Mergny, Jean-Louis

2002-01-01

Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

Purification and general properties of the DNA-binding protein (P16) from rat liver mitochondria.

PubMed

Pavco, P A; Van Tuyle, G C

1985-01-01

The mitochondrial DNA-binding protein P16 was isolated from rat liver mitochondrial lysates by affinity chromatography on single strand DNA agarose and separated from DNA in the preparation by alkaline CsCl isopycnic gradients. The top fraction of the gradients contained a single polypeptide species (Mr approximately equal to 15,200) based upon SDS PAGE. Digestion of single strand DNA-bound P16 with proteinase K produced a protease-insensitive, DNA-binding fragment (Mr approximately equal to 6,000) that has been purified by essentially the same procedures used for intact P16. The partial amino acid compositions for P16 and the DNA-binding fragment were obtained by conventional methods. Analysis of subcellular fractions revealed that nearly all of the cellular P16 was located in the mitochondria and that only trace amounts of protein of comparable electrophoretic mobility could be isolated from the nuclear or cytoplasmic fractions. The labeling of P16 with [35S]methionine in primary rat hepatocyte cultures was inhibited by more than 90% by the cytoplasmic translation inhibitor cycloheximide, but unaffected by the mitochondrial-specific agent chloramphenicol. These results indicate that P16 is synthesized on cytoplasmic ribosomes and imported into the mitochondria. The addition of purified P16 to deproteinized mitochondrial DNA resulted in the complete protection of the labeled nascent strands of displacement loops against branch migrational loss during cleavage of parental DNA with SstI, thus providing strong evidence that P16 is the single entity required for this in vitro function. Incubation of P16 with single strand phi X174 DNA, double strand (RF) phi X174 DNA, or Escherichia coli ribosomal RNA and subsequent analysis of the nucleic acid species for bound protein indicated a strong preference of P16 for single strand DNA and no detectable affinity for RNA or double strand DNA. Examination of P16-single strand phi X174 DNA complexes by direct electron microscopy revealed thickened, irregular fibers characteristic of protein-associated single strand DNA.

Low level phosphorylation of histone H2AX on serine 139 (γH2AX) is not associated with DNA double-strand breaks.

PubMed

Rybak, Paulina; Hoang, Agnieszka; Bujnowicz, Lukasz; Bernas, Tytus; Berniak, Krzysztof; Zarębski, Mirosław; Darzynkiewicz, Zbigniew; Dobrucki, Jerzy

2016-08-02

Phosphorylation of histone H2AX on serine 139 (γH2AX) is an early step in cellular response to a DNA double-strand break (DSB). γH2AX foci are generally regarded as markers of DSBs. A growing body of evidence demonstrates, however, that while induction of DSBs always brings about phosphorylation of histone H2AX, the reverse is not true - the presence of γH2AX foci should not be considered an unequivocal marker of DNA double-strand breaks. We studied DNA damage induced in A549 human lung adenocarcinoma cells by topoisomerase type I and II inhibitors (0.2 μM camptothecin, 10 μM etoposide or 0.2 μM mitoxantrone for 1 h), and using 3D high resolution quantitative confocal microscopy, assessed the number, size and the integrated intensity of immunofluorescence signals of individual γH2AX foci induced by these drugs. Also, investigated was spatial association between γH2AX foci and foci of 53BP1, the protein involved in DSB repair, both in relation to DNA replication sites (factories) as revealed by labeling nascent DNA with EdU. Extensive 3D and correlation data analysis demonstrated that γH2AX foci exhibit a wide range of sizes and levels of H2AX phosphorylation, and correlate differently with 53BP1 and DNA replication. This is the first report showing lack of a link between low level phosphorylation γH2AX sites and double-strand DNA breaks in cells exposed to topoisomerase I or II inhibitors. The data are discussed in terms of mechanisms that may be involved in formation of γH2AX sites of different sizes and intensities.

Alphavirus-based DNA vaccine breaks immunological tolerance by activating innate antiviral pathways

PubMed Central

Leitner, Wolfgang W.; Hwang, Leroy N.; Deveer, Michael J.; Zhou, Aimin; Silverman, Robert H.; Williams, Bryan R.G.; Dubensky, Thomas W.; Ying, Han; Restifo, Nicholas P.

2006-01-01

Cancer vaccines targeting ‘self’ antigens that are expressed at consistently high levels by tumor cells are potentially useful in immunotherapy, but immunological tolerance may block their function. Here, we describe a novel, naked DNA vaccine encoding an alphavirus replicon (self-replicating mRNA) and the self/tumor antigen tyrosinase-related protein-1. Unlike conventional DNA vaccines, this vaccine can break tolerance and provide immunity to melanoma. The vaccine mediates production of double-stranded RNA, as evidenced by the autophosphorylation of protein kinase R. Double-stranded RNA is critical to vaccine function because both the immunogenicity and the anti-tumor activity of the vaccine are blocked in mice deficient for the RNase L enzyme, a key component of the 2′,5′-linked oligoadenylate synthetase antiviral pathway involved in double-stranded RNA recognition. This study shows for the first time that alphaviral replicon-encoding DNA vaccines activate innate immune pathways known to drive antiviral immune responses, and points the way to strategies for improving the efficacy of immunization with naked DNA. PMID:12496961

Formation of Clustered DNA Damage after High-LET Irradiation: A Review

NASA Technical Reports Server (NTRS)

Hada, Megumi; Georgakilas, Alexandros G.

2008-01-01

Radiation can cause as well as cure cancer. The risk of developing radiation-induced cancer has traditionally been estimated from cancer incidence among survivors of the atomic bombs in Hiroshima and Nagasaki. These data provide the best estimate of human cancer risk over the dose range for low linear energy transfer (LET) radiations, such as X- or gamma-rays. The situation of estimating the real biological effects becomes even more difficult in the case of high LET particles encountered in space or as the result of domestic exposure to particles from radon gas emitters or other radioactive emitters like uranium-238. Complex DNA damage, i.e., the signature of high-LET radiations comprises by closely spaced DNA lesions forming a cluster of DNA damage. The two basic groups of complex DNA damage are double strand breaks (DSBs) and non-DSB oxidative clustered DNA lesions (OCDL). Theoretical analysis and experimental evidence suggest there is increased complexity and severity of complex DNA damage with increasing LET (linear energy transfer) and a high mutagenic or carcinogenic potential. Data available on the formation of clustered DNA damage (DSBs and OCDL) by high-LET radiations are often controversial suggesting a variable response to dose and type of radiation. The chemical nature and cellular repair mechanisms of complex DNA damage have been much less characterized than those of isolated DNA lesions like an oxidized base or a single strand break especially in the case of high-LET radiation. This review will focus on the induction of clustered DNA damage by high-LET radiations presenting the earlier and recent relative data.

Why soft UV-A damages DNA: An optical micromanipulation study

NASA Astrophysics Data System (ADS)

Rapp, A.; Greulich, K. O.

2013-09-01

Optical micromanipulation studies have solved a puzzle on DNA damage and repair. Such knowledge is crucial for understanding cancer and ageing. So far it was not understood, why the soft UV component of sunlight, UV-A, causes the dangerous DNA double strand breaks. The energy of UV-A photons is below 4 eV per photon, too low to directly cleave the corresponding chemical bonds in DNA. This is occasionally used to claim that artificial sunbeds, which mainly use UV-A, would not impose a risk on health. UV-A is only sufficient for induction of single strand breaks. The essential new observation is that, when on the opposite strand there is another single strand break at a distance of up to 20 base pairs. These two breaks will be converted into a break of the whole double strand with all its known consequences for cancer and ageing. However, in natural sun the effect is counteracted. Simultaneous red light illumination reduces UV induced DNA damages to 1/3. Since sunlight has a red component, skin tanning with natural sun is not as risky as might appear at a first glance.

Chromatin Collapse during Caspase-dependent Apoptotic Cell Death Requires DNA Fragmentation Factor, 40-kDa Subunit-/Caspase-activated Deoxyribonuclease-mediated 3′-OH Single-strand DNA Breaks*

PubMed Central

Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Sánchez-Osuna, María; Casanelles, Elisenda; García-Belinchón, Mercè; Comella, Joan X.; Yuste, Victor J.

2013-01-01

Apoptotic nuclear morphology and oligonucleosomal double-strand DNA fragments (also known as DNA ladder) are considered the hallmarks of apoptotic cell death. From a classic point of view, these two processes occur concomitantly. Once activated, DNA fragmentation factor, 40-kDa subunit (DFF40)/caspase-activated DNase (CAD) endonuclease hydrolyzes the DNA into oligonucleosomal-size pieces, facilitating the chromatin package. However, the dogma that the apoptotic nuclear morphology depends on DNA fragmentation has been questioned. Here, we use different cellular models, including MEF CAD−/− cells, to unravel the mechanism by which DFF40/CAD influences chromatin condensation and nuclear collapse during apoptosis. Upon apoptotic insult, SK-N-AS cells display caspase-dependent apoptotic nuclear alterations in the absence of internucleosomal DNA degradation. The overexpression of a wild-type form of DFF40/CAD endonuclease, but not of different catalytic-null mutants, restores the cellular ability to degrade the chromatin into oligonucleosomal-length fragments. We show that apoptotic nuclear collapse requires a 3′-OH endonucleolytic activity even though the internucleosomal DNA degradation is impaired. Moreover, alkaline unwinding electrophoresis and In Situ End-Labeling (ISEL)/In Situ Nick Translation (ISNT) assays reveal that the apoptotic DNA damage observed in the DNA ladder-deficient SK-N-AS cells is characterized by the presence of single-strand nicks/breaks. Apoptotic single-strand breaks can be impaired by DFF40/CAD knockdown, abrogating nuclear collapse and disassembly. In conclusion, the highest order of chromatin compaction observed in the later steps of caspase-dependent apoptosis relies on DFF40/CAD-mediated DNA damage by generating 3′-OH ends in single-strand rather than double-strand DNA nicks/breaks. PMID:23430749

Heat exposure enhances radiosensitivity by depressing DNA-PK kinase activity during double strand break repair.

PubMed

Ihara, Makoto; Takeshita, Satoshi; Okaichi, Kumio; Okumura, Yutaka; Ohnishi, Takeo

2014-03-01

From the role of double strand DNA dependent protein kinase (DNA-PKcs) activity of non-homologous end joining (NHEJ) repair for DNA double strand breaks (DSBs), we aim to define possible associations between thermo-sensitisation and the enzyme activities in X-ray irradiated cells. DNA-PKcs deficient mouse, Chinese hamster and human cultured cells were compared to the parental wild-type cells. The radiosensitivities, the number of DSBs and DNA-PKcs activities after heat-treatment were measured. Both DNA-PKcs deficient cells and the wild-type cells showed increased radiosensitivities after heat-treatment. The wild-type cells have two repair processes; fast repair and slow repair. In contrast, DNA-PKcs deficient cells have only the slow repair process. The fast repair component apparently disappeared by heat-treatment in the wild-type cells. In both cell types, additional heat exposure enhanced radiosensitivities. Although DNA-PKcs activity was depressed by heat, the inactivated DNA-PKcs activity recovered during an incubation at 37 °C. DSB repair efficiency was dependent on the reactivation of DNA-PKcs activity. It was suggested that NHEJ is the major process used to repair X-ray-induced DSBs and utilises DNA-PKcs activity, but homologous recombination repair provides additional secondary levels of DSB repair. The thermo-sensitisation in X-ray-irradiated cells depends on the inhibition of NHEJ repair through the depression of DNA-PKcs activities.

Rapid and simple method for purification of nucleic acids.

PubMed

Boom, R; Sol, C J; Salimans, M M; Jansen, C L; Wertheim-van Dillen, P M; van der Noordaa, J

1990-03-01

We have developed a simple, rapid, and reliable protocol for the small-scale purification of DNA and RNA from, e.g., human serum and urine. The method is based on the lysing and nuclease-inactivating properties of the chaotropic agent guanidinium thiocyanate together with the nucleic acid-binding properties of silica particles or diatoms in the presence of this agent. By using size-fractionated silica particles, nucleic acids (covalently closed circular, relaxed circular, and linear double-stranded DNA; single-stranded DNA; and rRNA) could be purified from 12 different specimens in less than 1 h and were recovered in the initial reaction vessel. Purified DNA (although significantly sheared) was a good substrate for restriction endonucleases and DNA ligase and was recovered with high yields (usually over 50%) from the picogram to the microgram level. Copurified rRNA was recovered almost undegraded. Substituting size-fractionated silica particles for diatoms (the fossilized cell walls of unicellular algae) allowed for the purification of microgram amounts of genomic DNA, plasmid DNA, and rRNA from cell-rich sources, as exemplified for pathogenic gram-negative bacteria. In this paper, we show representative experiments illustrating some characteristics of the procedure which may have wide application in clinical microbiology.

Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

PubMed

Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

2017-03-17

Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Preparation of Double-Stranded (Replicative Form) Bacteriophage M13 DNA.

PubMed

Green, Michael R; Sambrook, Joseph

2017-11-01

The double-stranded, closed-circular, replicative form (RF) of M13 DNA is present in high copy numbers in infected cells, and its physical characteristics are essentially identical to those of closed-circular plasmid DNAs. Any of the methods commonly used to purify plasmid DNA can therefore be used to isolate M13 RF DNA. This protocol describes the isolation of M13 RF DNA by alkaline lysis from small volumes (1-2 mL) of infected bacterial cultures. The yield of DNA (1-4 mg, depending on the size of the M13 clone) is more than enough for most purposes in molecular cloning. However, should more DNA be needed, the procedure can easily be scaled up. © 2017 Cold Spring Harbor Laboratory Press.

Adaptation of the neutral bacterial comet assay to assess antimicrobial-mediated DNA double-strand breaks in Escherichia coli

PubMed Central

SOLANKY, DIPESH; HAYDEL, SHELLEY E.

2012-01-01

This study aimed to determine the mechanism of action of a natural antibacterial clay mineral mixture, designated CB, by investigating the induction of DNA double-strand breaks (DSBs) in Escherichia coli. To quantify DNA damage upon exposure to soluble antimicrobial compounds, we modified a bacterial neutral comet assay, which primarily associates the general length of an electrophoresed chromosome, or comet, with the degree of DSB-associated DNA damage. To appropriately account for antimicrobial-mediated strand fragmentation, suitable control reactions consisting of exposures to water, ethanol, kanamycin, and bleomycin were developed and optimized for the assay. Bacterial exposure to the CB clay resulted in significantly longer comet lengths, compared to water and kanamycin exposures, suggesting that the induction of DNA DSBs contributes to the killing activity of this antibacterial clay mineral mixture. The comet assay protocol described herein provides a general technique for evaluating soluble antimicrobial-derived DNA damage and for comparing DNA fragmentation between experimental and control assays. PMID:22940101

Loss of NEIL3 DNA glycosylase markedly increases replication associated double strand breaks and enhances sensitivity to ATR inhibitor in glioblastoma cells

PubMed Central

Klattenhoff, Alex W.; Thakur, Megha; Chu, Christopher S.; Ray, Debolina; Habib, Samy L.; Kidane, Dawit

2017-01-01

DNA endonuclease eight-like glycosylase 3 (NEIL3) is one of the DNA glycosylases that removes oxidized DNA base lesions from single-stranded DNA (ssDNA) and non-B DNA structures. Approximately seven percent of human tumors have an altered NEIL3 gene. However, the role of NEIL3 in replication-associated repair and its impact on modulating treatment response is not known. Here, we report that NEIL3 is localized at the DNA double-strand break (DSB) sites during oxidative DNA damage and replication stress. Loss of NEIL3 significantly increased spontaneous replication-associated DSBs and recruitment of replication protein A (RPA). In contrast, we observed a marked decrease in Rad51 on nascent DNA strands at the replication fork, suggesting that HR-dependent repair is compromised in NEIL3-deficient cells. Interestingly, NEIL3-deficient cells were sensitive to ataxia–telangiectasia and Rad3 related protein (ATR) inhibitor alone or in combination with PARP1 inhibitor. This study elucidates the mechanism by which NEIL3 is critical to overcome oxidative and replication-associated genotoxic stress. Our findings may have important clinical implications to utilize ATR and PARP1 inhibitors to enhance cytotoxicity in tumors that carry altered levels of NEIL3. PMID:29348879

Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

PubMed

Paul, Philip; Apgar, Josh

2005-04-01

Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

Streptavidin-coated magnetic beads for DNA strand separation implicate a multitude of problems during cell-SELEX.

PubMed

Paul, Angela; Avci-Adali, Meltem; Ziemer, Gerhard; Wendel, Hans P

2009-09-01

Using whole living cells as a target for SELEX (systematic evolution of ligands by exponential enrichment) experiments represents a promising method to generate cell receptor-specific aptamers. These aptamers have a huge potential in diagnostics, therapeutics, imaging, regenerative medicine, and target validation. During the SELEX for selecting DNA aptamers, one important step is the separation of 2 DNA strands to yield one of the 2 strands as single-stranded DNA aptamer. This is being done routinely by biotin labeling of the complementary DNA strand to the desired aptamer and then separating the DNA strand by using streptavidin-coated magnetic beads. After immobilization of the double-stranded DNA on these magnetic beads and alkaline denaturation, the non-biotinylated strand is being eluted and the biotinylated strand is retarded. Using Western blot analysis, we demonstrated the detachment of covalent-bonded streptavidin from the bead surface after alkaline treatment. The eluates were also contaminated with undesired biotinylated strands. Furthermore, a streptavidin-induced aggregation of target cells was demonstrated by flow cytometry and microscopic methods. Cell-specific enrichment of aptamers was not possible due to clustering and patching effects triggered by streptavidin. Therefore, the use of streptavidin-coated magnetic beads for DNA strand separation should be examined thoroughly, especially for cell-SELEX applications.

Yeast exonuclease 5 is essential for mitochondrial genome maintenance.

PubMed

Burgers, Peter M; Stith, Carrie M; Yoder, Bonita L; Sparks, Justin L

2010-03-01

Yeast exonuclease 5 is encoded by the YBR163w (DEM1) gene, and this gene has been renamed EXO5. It is distantly related to the Escherichia coli RecB exonuclease class. Exo5 is localized to the mitochondria, and EXO5 deletions or nuclease-defective EXO5 mutants invariably yield petites, amplifying either the ori3 or ori5 region of the mitochondrial genome. These petites remain unstable and undergo continuous rearrangement. The mitochondrial phenotype of exo5Delta strains suggests an essential role for the enzyme in DNA replication and recombination. No nuclear phenotype associated with EXO5 deletions has been detected. Exo5 is a monomeric 5' exonuclease that releases dinucleotides as products. It is specific for single-stranded DNA and does not hydrolyze RNA. However, Exo5 has the capacity to slide across 5' double-stranded DNA or 5' RNA sequences and resumes cutting two nucleotides downstream of the double-stranded-to-single-stranded junction or RNA-to-DNA junction, respectively.

Modulation of the Pyrococcus abyssi NucS Endonuclease Activity by Replication Clamp at Functional and Structural Levels*

PubMed Central

Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P.; Khun, Joelle; Vos, Marten H.; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

2012-01-01

Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5′ and 3′ flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction. PMID:22431731

Modulation of the Pyrococcus abyssi NucS endonuclease activity by replication clamp at functional and structural levels.

PubMed

Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P; Khun, Joelle; Vos, Marten H; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

2012-05-04

Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5' and 3' flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction.

Simulation of the Formation of DNA Double Strand Breaks and Chromosome Aberrations in Irradiated Cells

NASA Technical Reports Server (NTRS)

Plante, Ianik; Ponomarev, Artem L.; Wu, Honglu; Blattnig, Steve; George, Kerry

2014-01-01

The formation of DNA double-strand breaks (DSBs) and chromosome aberrations is an important consequence of ionizing radiation. To simulate DNA double-strand breaks and the formation of chromosome aberrations, we have recently merged the codes RITRACKS (Relativistic Ion Tracks) and NASARTI (NASA Radiation Track Image). The program RITRACKS is a stochastic code developed to simulate detailed event-by-event radiation track structure: [1] This code is used to calculate the dose in voxels of 20 nm, in a volume containing simulated chromosomes, [2] The number of tracks in the volume is calculated for each simulation by sampling a Poisson distribution, with the distribution parameter obtained from the irradiation dose, ion type and energy. The program NASARTI generates the chromosomes present in a cell nucleus by random walks of 20 nm, corresponding to the size of the dose voxels, [3] The generated chromosomes are located within domains which may intertwine, and [4] Each segment of the random walks corresponds to approx. 2,000 DNA base pairs. NASARTI uses pre-calculated dose at each voxel to calculate the probability of DNA damage at each random walk segment. Using the location of double-strand breaks, possible rejoining between damaged segments is evaluated. This yields various types of chromosomes aberrations, including deletions, inversions, exchanges, etc. By performing the calculations using various types of radiations, it will be possible to obtain relative biological effectiveness (RBE) values for several types of chromosome aberrations.

Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

PubMed Central

Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

2011-01-01

Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

Caulobacter crescentus Cell Cycle-Regulated DNA Methyltransferase Uses a Novel Mechanism for Substrate Recognition.

PubMed

Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O

2017-08-01

Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.

Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

DOEpatents

Gray, Joe W.; Pinkel, Daniel

1991-01-01

A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

Sulfolobus chromatin proteins modulate strand displacement by DNA polymerase B1

PubMed Central

Sun, Fei; Huang, Li

2013-01-01

Strand displacement by a DNA polymerase serves a key role in Okazaki fragment maturation, which involves displacement of the RNA primer of the preexisting Okazaki fragment into a flap structure, and subsequent flap removal and fragment ligation. We investigated the role of Sulfolobus chromatin proteins Sso7d and Cren7 in strand displacement by DNA polymerase B1 (PolB1) from the hyperthermophilic archaeon Sulfolobus solfataricus. PolB1 showed a robust strand displacement activity and was capable of synthesizing thousands of nucleotides on a DNA-primed 72-nt single-stranded circular DNA template. This activity was inhibited by both Sso7d and Cren7, which limited the flap length to 3–4 nt at saturating concentrations. However, neither protein inhibited RNA displacement on an RNA-primed single-stranded DNA minicircle by PolB1. Strand displacement remained sensitive to modulation by the chromatin proteins when PolB1 was in association with proliferating cell nuclear antigen. Inhibition of DNA instead of RNA strand displacement by the chromatin proteins is consistent with the finding that double-stranded DNA was more efficiently bound and stabilized than an RNA:DNA duplex by these proteins. Our results suggest that Sulfolobus chromatin proteins modulate strand displacement by PolB1, permitting efficient removal of the RNA primer while inhibiting excessive displacement of the newly synthesized DNA strand during Okazaki fragment maturation. PMID:23821667

Histone Variant Regulates DNA Repair via Chromatin Condensation | Center for Cancer Research

Cancer.gov

Activating the appropriate DNA repair pathway is essential for maintaining the stability of the genome after a break in both strands of DNA. How a pathway is selected, however, is not well understood. Since these double strand breaks (DSBs) occur while DNA is packaged as chromatin, changes in its organization are necessary for repair to take place. Numerous alterations have

A novel quantitative electrochemical method to monitor DNA double-strand breaks caused by a DNA cleavage agent at a DNA sensor.

PubMed

Banasiak, Anna; Cassidy, John; Colleran, John

2018-06-01

To date, DNA cleavage, caused by cleavage agents, has been monitored mainly by gel and capillary electrophoresis. However, these techniques are time-consuming, non-quantitative and require gel stains. In this work, a novel, simple and, importantly, a quantitative method for monitoring the DNA nuclease activity of potential anti-cancer drugs, at a DNA electrochemical sensor, is presented. The DNA sensors were prepared using thiol-modified oligonucleotides that self-assembled to create a DNA monolayer at gold electrode surfaces. The quantification of DNA double-strand breaks is based on calculating the DNA surface coverage, before and after exposure to a DNA cleavage agent. The nuclease properties of a model DNA cleavage agent, copper bis-phenanthroline ([Cu II (phen) 2 ] 2+ ), that can cleave DNA in a Fenton-type reaction, were quantified electrochemically. The DNA surface coverage decreased on average by 21% after subjecting the DNA sensor to a nuclease assay containing [Cu II (phen) 2 ] 2+ , a reductant and an oxidant. This percentage indicates that 6 base pairs were cleaved in the nuclease assay from the immobilised 30 base pair strands. The DNA cleavage can be also induced electrochemically in the absence of a chemical reductant. [Cu II (phen) 2 ] 2+ intercalates between DNA base pairs and, on application of a suitable potential, can be reduced to [Cu I (phen) 2 ] + , with dissolved oxygen acting as the required oxidant. This reduction process is facilitated through DNA strands via long-range electron transfer, resulting in DNA cleavage of 23%. The control measurements for both chemically and electrochemically induced cleavage revealed that DNA strand breaks did not occur under experimental conditions in the absence of [Cu II (phen) 2 ] 2+ . Copyright © 2018 Elsevier B.V. All rights reserved.

Nucleosomes suppress the formation of double-strand DNA breaks during attempted base excision repair of clustered oxidative damages.

PubMed

Cannan, Wendy J; Tsang, Betty P; Wallace, Susan S; Pederson, David S

2014-07-18

Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Nucleosomes Suppress the Formation of Double-strand DNA Breaks during Attempted Base Excision Repair of Clustered Oxidative Damages*

PubMed Central

Cannan, Wendy J.; Tsang, Betty P.; Wallace, Susan S.; Pederson, David S.

2014-01-01

Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. PMID:24891506

DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Xu; Ptasinska, Sylwia; Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556

2013-06-10

The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

NASA Astrophysics Data System (ADS)

Han, Xu; Klas, Matej; Liu, Yueying; Sharon Stack, M.; Ptasinska, Sylwia

2013-06-01

The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

PubMed

Kurian, P; Dunston, G; Lindesay, J

2016-02-21

Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism. Copyright © 2015 Elsevier Ltd. All rights reserved.

Defective double-strand DNA break repair and chromosomal translocations by MYC overexpression.

PubMed

Karlsson, Asa; Deb-Basu, Debabrita; Cherry, Athena; Turner, Stephanie; Ford, James; Felsher, Dean W

2003-08-19

DNA repair mechanisms are essential for the maintenance of genomic integrity. Disruption of gene products responsible for DNA repair can result in chromosomal damage. Improperly repaired chromosomal damage can result in the loss of chromosomes or the generation of chromosomal deletions or translocations, which can lead to tumorigenesis. The MYC protooncogene is a transcription factor whose overexpression is frequently associated with human neoplasia. MYC has not been previously implicated in a role in DNA repair. Here we report that the overexpression of MYC disrupts the repair of double-strand DNA breaks, resulting in a several-magnitude increase in chromosomal breaks and translocations. We found that MYC inhibited the repair of gamma irradiation DNA breaks in normal human cells and blocked the repair of a single double-strand break engineered to occur in an immortal cell line. By spectral karyotypic analysis, we found that MYC even within one cell division cycle resulted in a several-magnitude increase in the frequency of chromosomal breaks and translocations in normal human cells. Hence, MYC overexpression may be a previously undescribed example of a dominant mutator that may fuel tumorigenesis by inducing chromosomal damage.

Detection of DNA double-strand breaks and chromosome translocations using ligation-mediated PCR and inverse PCR.

PubMed

Singh, Sheetal; Shih, Shyh-Jen; Vaughan, Andrew T M

2014-01-01

Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter- and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks and rearrangements introduced into any identifiable genomic location. We have also applied parallel sequencing for the high-throughput analysis of inverse PCR products to facilitate the unbiased recording of all rearrangements located at a specific genomic location.

How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases

PubMed Central

Kurian, P.; Dunston, G.; Lindesay, J.

2015-01-01

Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme’s displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations—a possible signature of quantum entanglement—may be explained by such a mechanism. PMID:26682627

Trio of Tryptophans Aid in Camptothecin Therapy | Center for Cancer Research

Cancer.gov

On occasion, a normally desirable feature becomes not so desirable, making it necessary to find ways to work around it. The double helical nature of DNA helps it attain a compact, supercoiled state, which is essential for lengthy strands of DNA to reside in the nucleus as part of the chromosomes. During DNA replication and gene transcription, however, cellular machinery needs to access individual DNA strands; thus, the supercoiled, knotted state becomes undesirable. Just as a tangled telephone cord has to be manipulated, the DNA strands must be separated, unwound, and eventually joined together again.

Repair of clustered DNA damage caused by high LET radiation in human fibroblasts

NASA Technical Reports Server (NTRS)

Rydberg, B.; Lobrich, M.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

1998-01-01

It has recently been demonstrated experimentally that DNA damage induced by high LET radiation in mammalian cells is non-randomly distributed along the DNA molecule in the form of clusters of various sizes. The sizes of such clusters range from a few base-pairs to at least 200 kilobase-pairs. The high biological efficiency of high LET radiation for induction of relevant biological endpoints is probably a consequence of this clustering, although the exact mechanisms by which the clustering affects the biological outcome is not known. We discuss here results for induction and repair of base damage, single-strand breaks and double-strand breaks for low and high LET radiations. These results are discussed in the context of clustering. Of particular interest is to determine how clustering at different scales affects overall rejoining and fidelity of rejoining of DNA double-strand breaks. However, existing methods for measuring repair of DNA strand breaks are unable to resolve breaks that are close together in a cluster. This causes problems in interpretation of current results from high LET radiation and will require new methods to be developed.

DNA - peptide polyelectrolyte complexes: Phase control by hybridization

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

Characterization of Bleomycin-Mediated Cleavage of a Hairpin DNA Library

PubMed Central

Segerman, Zachary J.; Roy, Basab; Hecht, Sidney M.

2013-01-01

A study of BLM A5 was conducted using a previously isolated library of hairpin DNAs found to bind strongly to metal free BLM. The ability of Fe(II)•BLM to effect cleavage on both the 3' and 5'-arms of the hairpin DNAs was characterized. The strongly bound DNAs were found to be efficient substrates for Fe•BLM A5-mediated hairpin DNA cleavage. Surprisingly, the most prevalent site of BLM-mediated cleavage was found to be the 5′-AT-3′ dinucleotide sequence. This dinucleotide sequence, and other sequences generally not cleaved well by BLM when examined using arbitrarily chosen DNA substrates, were apparent when examining the library of ten hairpin DNAs. In total, 132 sites of DNA cleavage were produced by exposure of the hairpin DNA library to Fe•BLM A5. The existence of multiple sites of cleavage on both the 3′- and 5′-arms of the hairpin DNAs suggested that some of these might be double-strand cleavage events. Accordingly, an assay was developed with which to test the propensity of the hairpin DNAs to undergo double-strand DNA damage. One hairpin DNA was characterized using this method, and gave results consistent with earlier reports of double-strand DNA cleavage, but with a sequence selectivity different from those reported previously. PMID:23834496

Mouse but not human embryonic stem cells are deficient in rejoining of ionizing radiation-induced DNA double-strand breaks.

PubMed

Bañuelos, C A; Banáth, J P; MacPhail, S H; Zhao, J; Eaves, C A; O'Connor, M D; Lansdorp, P M; Olive, P L

2008-09-01

Mouse embryonic stem (mES) cells will give rise to all of the cells of the adult mouse, but they failed to rejoin half of the DNA double-strand breaks (dsb) produced by high doses of ionizing radiation. A deficiency in DNA-PK(cs) appears to be responsible since mES cells expressed <10% of the level of mouse embryo fibroblasts (MEFs) although Ku70/80 protein levels were higher than MEFs. However, the low level of DNA-PK(cs) found in wild-type cells appeared sufficient to allow rejoining of dsb after doses <20Gy even in G1 phase cells. Inhibition of DNA-PK(cs) with wortmannin and NU7026 still sensitized mES cells to radiation confirming the importance of the residual DNA-PK(cs) at low doses. In contrast to wild-type cells, mES cells lacking H2AX, a histone protein involved in the DNA damage response, were radiosensitive but they rejoined double-strand breaks more rapidly. Consistent with more rapid dsb rejoining, H2AX(-/-) mES cells also expressed 6 times more DNA-PK(cs) than wild-type mES cells. Similar results were obtained for ATM(-/-) mES cells. Differentiation of mES cells led to an increase in DNA-PK(cs), an increase in dsb rejoining rate, and a decrease in Ku70/80. Unlike mouse ES, human ES cells were proficient in rejoining of dsb and expressed high levels of DNA-PK(cs). These results confirm the importance of homologous recombination in the accurate repair of double-strand breaks in mES cells, they help explain the chromosome abnormalities associated with deficiencies in H2AX and ATM, and they add to the growing list of differences in the way rodent and human cells deal with DNA damage.

Investigations of nanoscale variations in spin and charge transport in manganites and organic semiconductors using spin polarized scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Hughes, Cameron Richard

Analysis of DNA structure and behavior, up to and including full sequencing of a genome's bases, and of biological processes such as replication, transcription and translation, is essential for an understanding of genetic variation, heritable diseases and the effects of environmental factors. Recently, single-molecule techniques have been developed to study DNA properties in unprecedented detail. For a number of these techniques, controlled adsorption of linearly stretched DNA molecules on surfaces is necessary. In experiments where hybridization of adsorbed molecules to labeled probes is used to determine DNA structure, single-stranded DNA is needed. Conventionally, for long DNA's (up to Mbp), double-stranded DNA is deposited on a surface and denatured in-situ. While successful, this method has several disadvantages. This thesis reports efforts to directly adsorb long single-stranded DNA's out of solution as an alternative strategy. It consists of three parts: (1) Establishment of a simple method using Acridine Orange (AO) staining dye to determine whether DNA's are ss or ds on the surface. The method allows for the assessment of the degree of renaturation during deposition. Incubation of surface-adsorbed DNA in solutions of AO dye in the concentration range of 10--15uM were found to be effective for discriminating between ss DNA and ds DNA based on differences in the fluorescence emission spectra. (2) Deposition of ss DNA produced by heat denaturation on polymer-coated surfaces. Lambda DNA (48502bp) was adsorbed by drop evaporation or dipping/extraction of surface out of a buffered solution. The efficiency of deposition was optimized with respect to DNA concentration, buffer type and pH. (3) Separation of complementary single strands of Lambda, mono-cut digest and HindIII digest by gel electrophoresis. Using agarose gels in concentrations ranging from 0.4% to 1.4% (weight/volume), electric fields in the range 1--4V/cm in 1x Tris-Acetate-EDTA (TAE) buffer, good strand separation could be obtained. Both DC and pulsed electric fields were used and compared. Following separation, sense and anti-sense strands of lambda DNA were extracted from gels and deposited separately onto surfaces, and length distributions of the isolated molecules were measured by fluorescence microscopy.

Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.

PubMed

Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter

2018-04-01

Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.

Cryo-EM structure of Mcm2-7 double hexamer on DNA suggests a lagging-strand DNA extrusion model.

PubMed

Noguchi, Yasunori; Yuan, Zuanning; Bai, Lin; Schneider, Sarah; Zhao, Gongpu; Stillman, Bruce; Speck, Christian; Li, Huilin

2017-11-07

During replication initiation, the core component of the helicase-the Mcm2-7 hexamer-is loaded on origin DNA as a double hexamer (DH). The two ring-shaped hexamers are staggered, leading to a kinked axial channel. How the origin DNA interacts with the axial channel is not understood, but the interaction could provide key insights into Mcm2-7 function and regulation. Here, we report the cryo-EM structure of the Mcm2-7 DH on dsDNA and show that the DNA is zigzagged inside the central channel. Several of the Mcm subunit DNA-binding loops, such as the oligosaccharide-oligonucleotide loops, helix 2 insertion loops, and presensor 1 (PS1) loops, are well defined, and many of them interact extensively with the DNA. The PS1 loops of Mcm 3, 4, 6, and 7, but not 2 and 5, engage the lagging strand with an approximate step size of one base per subunit. Staggered coupling of the two opposing hexamers positions the DNA right in front of the two Mcm2-Mcm5 gates, with each strand being pressed against one gate. The architecture suggests that lagging-strand extrusion initiates in the middle of the DH that is composed of the zinc finger domains of both hexamers. To convert the Mcm2-7 DH structure into the Mcm2-7 hexamer structure found in the active helicase, the N-tier ring of the Mcm2-7 hexamer in the DH-dsDNA needs to tilt and shift laterally. We suggest that these N-tier ring movements cause the DNA strand separation and lagging-strand extrusion. Copyright © 2017 the Author(s). Published by PNAS.

Dynamic Conformations of Nucleosome Arrays in Solution from Small-Angle X-ray Scattering

NASA Astrophysics Data System (ADS)

Howell, Steven C.

Chromatin conformation and dynamics remains unsolved despite the critical role of the chromatin in fundamental genetic functions such as transcription, replication, and repair. At the molecular level, chromatin can be viewed as a linear array of nucleosomes, each consisting of 147 base pairs (bp) of double-stranded DNA (dsDNA) wrapped around a protein core and connected by 10 to 90 bp of linker dsDNA. Using small-angle X-ray scattering (SAXS), we investigated how the conformations of model nucleosome arrays in solution are modulated by ionic condition as well as the effect of linker histone proteins. To facilitate ensemble modeling of these SAXS measurements, we developed a simulation method that treats coarse-grained DNA as a Markov chain, then explores possible DNA conformations using Metropolis Monte Carlo (MC) sampling. This algorithm extends the functionality of SASSIE, a program used to model intrinsically disordered biological molecules, adding to the previous methods for simulating protein, carbohydrates, and single-stranded DNA. Our SAXS measurements of various nucleosome arrays together with the MC generated models provide valuable solution structure information identifying specific differences from the structure of crystallized arrays.

Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.

PubMed

Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi

2016-03-24

For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comet Assay in Cancer Chemoprevention.

PubMed

Santoro, Raffaela; Ferraiuolo, Maria; Morgano, Gian Paolo; Muti, Paola; Strano, Sabrina

2016-01-01

The comet assay can be useful in monitoring DNA damage in single cells caused by exposure to genotoxic agents, such as those causing air, water, and soil pollution (e.g., pesticides, dioxins, electromagnetic fields) and chemo- and radiotherapy in cancer patients, or in the assessment of genoprotective effects of chemopreventive molecules. Therefore, it has particular importance in the fields of pharmacology and toxicology, and in both environmental and human biomonitoring. It allows the detection of single strand breaks as well as double-strand breaks and can be used in both normal and cancer cells. Here we describe the alkali method for comet assay, which allows to detect both single- and double-strand DNA breaks.

Biochemical studies of the Saccharomyces cerevisiae Mph1 helicase on junction-containing DNA structures

PubMed Central

Kang, Young-Hoon; Munashingha, Palinda Ruvan; Lee, Chul-Hwan; Nguyen, Tuan Anh; Seo, Yeon-Soo

2012-01-01

Saccharomyces cerevisiae Mph1 is a 3–5′ DNA helicase, required for the maintenance of genome integrity. In order to understand the ATPase/helicase role of Mph1 in genome stability, we characterized its helicase activity with a variety of DNA substrates, focusing on its action on junction structures containing three or four DNA strands. Consistent with its 3′ to 5′ directionality, Mph1 displaced 3′-flap substrates in double-fixed or equilibrating flap substrates. Surprisingly, Mph1 displaced the 5′-flap strand more efficiently than the 3′ flap strand from double-flap substrates, which is not expected for a 3–5′ DNA helicase. For this to occur, Mph1 required a threshold size (>5 nt) of 5′ single-stranded DNA flap. Based on the unique substrate requirements of Mph1 defined in this study, we propose that the helicase/ATPase activity of Mph1 play roles in converting multiple-stranded DNA structures into structures cleavable by processing enzymes such as Fen1. We also found that the helicase activity of Mph1 was used to cause structural alterations required for restoration of replication forks stalled due to damaged template. The helicase properties of Mph1 reported here could explain how it resolves D-loop structure, and are in keeping with a model proposed for the error-free damage avoidance pathway. PMID:22090425

Monitoring Recombination During Meiosis in Budding Yeast.

PubMed

Owens, Shannon; Tang, Shangming; Hunter, Neil

2018-01-01

Homologous recombination is fundamental to sexual reproduction, facilitating accurate segregation of homologous chromosomes at the first division of meiosis, and creating novel allele combinations that fuel evolution. Following initiation of meiotic recombination by programmed DNA double-strand breaks (DSBs), homologous pairing and DNA strand exchange form joint molecule (JM) intermediates that are ultimately resolved into crossover and noncrossover repair products. Physical monitoring of the DNA steps of meiotic recombination in Saccharomyces cerevisiae (budding yeast) cultures undergoing synchronous meiosis has provided seminal insights into the molecular basis of meiotic recombination and affords a powerful tool for dissecting the molecular roles of recombination factors. This chapter describes a suit of electrophoretic and Southern hybridization techniques used to detect and quantify the DNA intermediates of meiotic recombination at recombination hotspots in budding yeast. DSBs and recombination products (crossovers and noncrossovers) are resolved using one-dimensional electrophoresis and distinguished by restriction site polymorphisms between the parental chromosomes. Psoralen cross-linking is used to stabilize branched JMs, which are resolved from linear species by native/native two-dimensional electrophoresis. Native/denaturing two-dimensional electrophoresis is employed to determine the component DNA strands of JMs and to measure the processing of DSBs. These techniques are generally applicable to any locus where the frequency of recombination is high enough to detect intermediates by Southern hybridization. © 2018 Elsevier Inc. All rights reserved.

Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

NASA Astrophysics Data System (ADS)

Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C.

2003-01-01

Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L III shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l -1) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gottlieb, J.; Muzyczka, N.

1988-06-01

When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

Creating complex molecular topologies by configuring DNA four-way junctions

NASA Astrophysics Data System (ADS)

Liu, Di; Chen, Gang; Akhter, Usman; Cronin, Timothy M.; Weizmann, Yossi

2016-10-01

The realization of complex topologies at the molecular level represents a grand challenge in chemistry. This necessitates the manipulation of molecular interactions with high precision. Here we show that single-stranded DNA (ssDNA) knots and links can be created by utilizing the inherent topological properties that pertain to the DNA four-way junction, at which the two helical strands form a node and can be configured conveniently and connected for complex topological construction. Using this strategy, we produced series of ssDNA topoisomers with the same sequences. By finely designing the curvature and torsion, double-stranded DNA knots were accessed by hybridizing and ligating the complementary strands with the knotted ssDNA templates. Furthermore, we demonstrate the use of a constructed ssDNA knot both to probe the topological conversion catalysed by DNA topoisomerase and to study the DNA replication under topological constraint.

Global analysis of double-strand break processing reveals in vivo properties of the helicase-nuclease complex AddAB

PubMed Central

Badrinarayanan, Anjana; Cisse, Ibrahim I.

2017-01-01

In bacteria, double-strand break (DSB) repair via homologous recombination is thought to be initiated through the bi-directional degradation and resection of DNA ends by a helicase-nuclease complex such as AddAB. The activity of AddAB has been well-studied in vitro, with translocation speeds between 400–2000 bp/s on linear DNA suggesting that a large section of DNA around a break site is processed for repair. However, the translocation rate and activity of AddAB in vivo is not known, and how AddAB is regulated to prevent excessive DNA degradation around a break site is unclear. To examine the functions and mechanistic regulation of AddAB inside bacterial cells, we developed a next-generation sequencing-based approach to assay DNA processing after a site-specific DSB was introduced on the chromosome of Caulobacter crescentus. Using this assay we determined the in vivo rates of DSB processing by AddAB and found that putative chi sites attenuate processing in a RecA-dependent manner. This RecA-mediated regulation of AddAB prevents the excessive loss of DNA around a break site, limiting the effects of DSB processing on transcription. In sum, our results, taken together with prior studies, support a mechanism for regulating AddAB that couples two key events of DSB repair–the attenuation of DNA-end processing and the initiation of homology search by RecA–thereby helping to ensure that genomic integrity is maintained during DSB repair. PMID:28489851

Variations in the Processing of DNA Double-Strand Breaks Along 60-MeV Therapeutic Proton Beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chaudhary, Pankaj; Marshall, Thomas I.; Currell, Frederick J.

Purpose: To investigate the variations in induction and repair of DNA damage along the proton path, after a previous report on the increasing biological effectiveness along clinically modulated 60-MeV proton beams. Methods and Materials: Human skin fibroblast (AG01522) cells were irradiated along a monoenergetic and a modulated spread-out Bragg peak (SOBP) proton beam used for treating ocular melanoma at the Douglas Cyclotron, Clatterbridge Centre for Oncology, Wirral, Liverpool, United Kingdom. The DNA damage response was studied using the 53BP1 foci formation assay. The linear energy transfer (LET) dependence was studied by irradiating the cells at depths corresponding to entrance, proximal, middle, andmore » distal positions of SOBP and the entrance and peak position for the pristine beam. Results: A significant amount of persistent foci was observed at the distal end of the SOBP, suggesting complex residual DNA double-strand break damage induction corresponding to the highest LET values achievable by modulated proton beams. Unlike the directly irradiated, medium-sharing bystander cells did not show any significant increase in residual foci. Conclusions: The DNA damage response along the proton beam path was similar to the response of X rays, confirming the low-LET quality of the proton exposure. However, at the distal end of SOBP our data indicate an increased complexity of DNA lesions and slower repair kinetics. A lack of significant induction of 53BP1 foci in the bystander cells suggests a minor role of cell signaling for DNA damage under these conditions.« less

Size fractionation of double-stranded DNA by precipitation with polyethylene glycol

PubMed Central

Lis, John T.; Schleif, Robert

1975-01-01

We show that DNA molecules of differing molecular mass are separable by selective precipitation with polyethylene glycol (PEG†). Higher molecular mass DNA precipitates at lower PEG concentrations than lower molecular mass DNA. Double-stranded DNA can be fractionated at least in the range of 3 × 107 to 1 × 105 daltons. The effects of PEG concentration, sodium chloride concentration, DNA concentration, pH, divalent ions, precipitation time, and centrifugal force have been determined. These studies show PEG precipitation offers a size fractionation method for DNA which is convenient, of high capacity, and applicable over a wide range of conditions. However, resolution is not high and separation of two species approaches 100% only if they differ in molecular mass by at least a factor of two. Images PMID:236548

Influence of extended incubation time on Human sperm chromatin condensation, sperm DNA strand breaks and their effect on fertilisation rate.

PubMed

Ahmed, I; Abdelateef, S; Laqqan, M; Amor, H; Abdel-Lah, M A; Hammadeh, M E

2018-02-14

The purpose of this study was to determine influence of extended incubation time on sperm chromatin condensation and DNA strand breaks and their effect on fertilisation rate. Forty couples undergoing ICSI therapy were included. Semen was prepared by PureSperm gradient centrifugation and divided into two parts. The first part (G1) was used immediately for ICSI, whereas the second part (G2) was kept in the incubator at 37°C, 5% and 90% Humidity for 5 hr, and thereafter, the capacitated spermatozoa were used for ICSI. The TUNEL test and chromomycin CMA3 were used to evaluate the DNA strand breaks and chromatin condensation respectively. The percentage of condensed chromatin was 73.92 ± 12.70 in the group 1 and 81.13 ± 10.31% in group 2 (p = .001). However, the double-strand breaks were 11.15 ± 8.67% in G.1 and 16.30 ± 11.12% in G.2. (p = .001). Fertilisation rate in the (Group 1) was 62.45% and 69.17% in (Group 2). There was a positive correlation between condensed chromatin and fertilisation rate (r = 0.846, p = .001) and a negative correlation with DNA double-strand breaks (r = -0.802; p = .001). In conclusion, the prolonged sperm incubation (5 hr) leads to a higher chromatin condensation and to a significantly increased number of DNA strands double breaks with no influence on fertilisation rates. © 2018 Blackwell Verlag GmbH.

Effects of heavy ions on inactivation and DNA double strand breaks in Deinococcus radiodurans R1.

PubMed

Zimmermann, H; Schafer, M; Schmitz, C; Bucker, H

1994-10-01

Inactivation and double strand break (dsb) induction after heavy ion irradiation were studied in stationary phase cells of the highly radiation resistant bacterium Deinococcus radiodurans R1. There is evidence that the radiation sensitivity of this bacterium is nearly independent on energy in the range of up to 15 MeV/u for lighter ions (Ar). The responses to dsb induction for charged particles show direct relationship between increasing radiation dose and residual intact DNA.

Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

DOEpatents

Gray, J.W.; Pinkel, D.

1991-07-02

A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

Crystal structure of an Okazaki fragment at 2-A resolution

NASA Technical Reports Server (NTRS)

Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

1992-01-01

In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

Heavy ion-induced DNA double-strand breaks in yeast.

PubMed

Kiefer, Jürgen; Egenolf, Ralf; Ikpeme, Samuel

2002-02-01

Induction of DSBs in the diploid yeast, Saccharomyces cerevisiae, was measured by pulsed-field gel electrophoresis (PFGE) after the cells had been exposed on membrane filters to a variety of energetic heavy ions with values of linear energy transfer (LET) ranging from about 2 to 11,500 keV/microm, (241)Am alpha particles, and 80 keV X rays. After irradiation, the cells were lysed, and the chromosomes were separated by PFGE. The gels were stained with ethidium bromide, placed on a UV transilluminator, and analyzed using a computer-coupled camera. The fluorescence intensities of the larger bands were found to decrease exponentially with dose or particle fluence. The slope of this line corresponds to the cross section for at least one double-strand break (DSB), but closely spaced multiple breaks cannot be discriminated. Based on the known size of the native DNA molecules, breakage cross sections per base pair were calculated. They increased with LET until they reached a transient plateau value of about 6 x 10(-7) microm(2) at about 300-2000 keV/microm; they then rose for the higher LETs, probably reflecting the influence of delta electrons. The relative biological effectiveness for DNA breakage displays a maximum of about 2.5 around 100-200 keV/microm and falls below unity for LET values above 10(3) keV/microm. For these yeast cells, comparison of the derived breakage cross sections with the corresponding cross section for inactivation derived from the terminal slope of the survival curves shows a strong linear relationship between these cross sections, extending over several orders of magnitude.

E1B and E4 oncoproteins of adenovirus antagonize the effect of apoptosis inducing factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turner, Roberta L.; Wilkinson, John C., E-mail: john.wilkinson@ndsu.edu; Ornelles, David A., E-mail: ornelles@wakehealth.edu

2014-05-15

Adenovirus inundates the productively infected cell with linear, double-stranded DNA and an abundance of single-stranded DNA. The cellular response to this stimulus is antagonized by the adenoviral E1B and E4 early genes. A mutant group C adenovirus that fails to express the E1B-55K and E4ORF3 genes is unable to suppress the DNA-damage response. Cells infected with this double-mutant virus display significant morphological heterogeneity at late times of infection and frequently contain fragmented nuclei. Nuclear fragmentation was due to the translocation of apoptosis inducing factor (AIF) from the mitochondria into the nucleus. The release of AIF was dependent on active poly(ADP-ribose)more » polymerase-1 (PARP-1), which appeared to be activated by viral DNA replication. Nuclear fragmentation did not occur in AIF-deficient cells or in cells treated with a PARP-1 inhibitor. The E1B-55K or E4ORF3 proteins independently prevented nuclear fragmentation subsequent to PARP-1 activation, possibly by altering the intracellular distribution of PAR-modified proteins. - Highlights: • E1B-55K or E4orf3 prevents nuclear fragmentation. • Nuclear fragmentation requires AIF and PARP-1 activity. • Adenovirus DNA replication activates PARP-1. • E1B-55K or E4orf3 proteins alter the distribution of PAR.« less

Biological Nanomotors with a Revolution, Linear, or Rotation Motion Mechanism

PubMed Central

Noji, Hiroyuki; Yengo, Christopher M.; Zhao, Zhengyi; Grainge, Ian

2016-01-01

SUMMARY The ubiquitous biological nanomotors were classified into two categories in the past: linear and rotation motors. In 2013, a third type of biomotor, revolution without rotation (http://rnanano.osu.edu/movie.html), was discovered and found to be widespread among bacteria, eukaryotic viruses, and double-stranded DNA (dsDNA) bacteriophages. This review focuses on recent findings about various aspects of motors, including chirality, stoichiometry, channel size, entropy, conformational change, and energy usage rate, in a variety of well-studied motors, including FoF1 ATPase, helicases, viral dsDNA-packaging motors, bacterial chromosome translocases, myosin, kinesin, and dynein. In particular, dsDNA translocases are used to illustrate how these features relate to the motion mechanism and how nature elegantly evolved a revolution mechanism to avoid coiling and tangling during lengthy dsDNA genome transportation in cell division. Motor chirality and channel size are two factors that distinguish rotation motors from revolution motors. Rotation motors use right-handed channels to drive the right-handed dsDNA, similar to the way a nut drives the bolt with threads in same orientation; revolution motors use left-handed motor channels to revolve the right-handed dsDNA. Rotation motors use small channels (<2 nm in diameter) for the close contact of the channel wall with single-stranded DNA (ssDNA) or the 2-nm dsDNA bolt; revolution motors use larger channels (>3 nm) with room for the bolt to revolve. Binding and hydrolysis of ATP are linked to different conformational entropy changes in the motor that lead to altered affinity for the substrate and allow work to be done, for example, helicase unwinding of DNA or translocase directional movement of DNA. PMID:26819321

Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.

PubMed

Ricchetti, M; Fairhead, C; Dujon, B

1999-11-04

The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process.

Construction of three-dimensional DNA hydrogels from linear building blocks.

PubMed

Nöll, Tanja; Schönherr, Holger; Wesner, Daniel; Schopferer, Michael; Paululat, Thomas; Nöll, Gilbert

2014-08-04

A three-dimensional DNA hydrogel was generated by self-assembly of short linear double-stranded DNA (dsDNA) building blocks equipped with sticky ends. The resulting DNA hydrogel is thermoresponsive and the length of the supramolecular dsDNA structures varies with temperature. The average diffusion coefficients of the supramolecular dsDNA structures formed by self-assembly were determined by diffusion-ordered NMR spectroscopy (DOSY NMR) for temperatures higher than 60 °C. Temperature-dependent rheological measurements revealed a gel point of 42±1 °C. Below this temperature, the resulting material behaved as a true gel of high viscosity with values for the storage modulus G' being significantly larger than that for the loss modulus G''. Frequency-dependent rheological measurements at 20 °C revealed a mesh size (ξ) of 15 nm. AFM analysis of the diluted hydrogel in the dry state showed densely packed structures of entangled chains, which are also expected to contain multiple interlocked rings and catenanes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA damage induced by the direct effect of radiation

NASA Astrophysics Data System (ADS)

Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.

2008-10-01

We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

The Apis mellifera Filamentous Virus Genome

PubMed Central

Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D.; de Miranda, Joachim R.; Neumann, Peter

2015-01-01

A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family. PMID:26184284

The Apis mellifera Filamentous Virus Genome.

PubMed

Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D; de Miranda, Joachim R; Neumann, Peter

2015-07-09

A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family.

Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.; Maye, M; Zhang, Y

We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.

Comparison of direct DNA strand breaks induced by low energy electrons with different inelastic cross sections

NASA Astrophysics Data System (ADS)

Li, Jun-Li; Li, Chun-Yan; Qiu, Rui; Yan, Cong-Chong; Xie, Wen-Zhang; Zeng, Zhi; Tung, Chuan-Jong

2013-09-01

In order to study the influence of inelastic cross sections on the simulation of direct DNA strand breaks induced by low energy electrons, six different sets of inelastic cross section data were calculated and loaded into the Geant4-DNA code to calculate the DNA strand break yields under the same conditions. The six sets of the inelastic cross sections were calculated by applying the dielectric function method of Emfietzoglou's optical-data treatments, with two different optical datasets and three different dispersion models, using the same Born corrections. Results show that the inelastic cross sections have a notable influence on the direct DNA strand break yields. The yields simulated with the inelastic cross sections based on Hayashi's optical data are greater than those based on Heller's optical data. The discrepancies are about 30-45% for the single strand break yields and 45-80% for the double strand break yields. Among the yields simulated with cross sections of the three different dispersion models, generally the greatest are those of the extended-Drude dispersion model, the second are those of the extended-oscillator-Drude dispersion model, and the last are those of the Ashley's δ-oscillator dispersion model. For the single strand break yields, the differences between the first two are very little and the differences between the last two are about 6-57%. For the double strand break yields, the biggest difference between the first two can be about 90% and the differences between the last two are about 17-70%.

Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

PubMed Central

Muchová, Veronika; Amiard, Simon; Mozgová, Iva; Dvořáčková, Martina; Gallego, Maria E; White, Charles; Fajkus, Jiří

2015-01-01

Arabidopsis thaliana mutants in FAS1 and FAS2 subunits of chromatin assembly factor 1 (CAF1) show progressive loss of 45S rDNA copies and telomeres. We hypothesized that homology-dependent DNA damage repair (HDR) may contribute to the loss of these repeats in fas mutants. To test this, we generated double mutants by crossing fas mutants with knock-out mutants in RAD51B, one of the Rad51 paralogs of A. thaliana. Our results show that the absence of RAD51B decreases the rate of rDNA loss, confirming the implication of RAD51B-dependent recombination in rDNA loss in the CAF1 mutants. Interestingly, this effect is not observed for telomeric repeat loss, which thus differs from that acting in rDNA loss. Involvement of DNA damage repair in rDNA dynamics in fas mutants is further supported by accumulation of double-stranded breaks (measured as γ-H2AX foci) in 45S rDNA. Occurrence of the foci is not specific for S-phase, and is ATM-independent. While the foci in fas mutants occur both in the transcribed (intranucleolar) and non-transcribed (nucleoplasmic) fraction of rDNA, double fas rad51b mutants show a specific increase in the number of the intranucleolar foci. These results suggest that the repair of double-stranded breaks present in the transcribed rDNA region is RAD51B dependent and that this contributes to rDNA repeat loss in fas mutants, presumably via the single-stranded annealing recombination pathway. Our results also highlight the importance of proper chromatin assembly in the maintenance of genome stability. PMID:25359579

Double-Stranded RNA Is Detected by Immunofluorescence Analysis in RNA and DNA Virus Infections, Including Those by Negative-Stranded RNA Viruses.

PubMed

Son, Kyung-No; Liang, Zhiguo; Lipton, Howard L

2015-09-01

Early biochemical studies of viral replication suggested that most viruses produce double-stranded RNA (dsRNA), which is essential for the induction of the host immune response. However, it was reported in 2006 that dsRNA could be detected by immunofluorescence antibody staining in double-stranded DNA and positive-strand RNA virus infections but not in negative-strand RNA virus infections. Other reports in the literature seemed to support these observations. This suggested that negative-strand RNA viruses produce little, if any, dsRNA or that more efficient viral countermeasures to mask dsRNA are mounted. Because of our interest in the use of dsRNA antibodies for virus discovery, particularly in pathological specimens, we wanted to determine how universal immunostaining for dsRNA might be in animal virus infections. We have detected the in situ formation of dsRNA in cells infected with vesicular stomatitis virus, measles virus, influenza A virus, and Nyamanini virus, which represent viruses from different negative-strand RNA virus families. dsRNA was also detected in cells infected with lymphocytic choriomeningitis virus, an ambisense RNA virus, and minute virus of mice (MVM), a single-stranded DNA (ssDNA) parvovirus, but not hepatitis B virus. Although dsRNA staining was primarily observed in the cytoplasm, it was also seen in the nucleus of cells infected with influenza A virus, Nyamanini virus, and MVM. Thus, it is likely that most animal virus infections produce dsRNA species that can be detected by immunofluorescence staining. The apoptosis induced in several uninfected cell lines failed to upregulate dsRNA formation. An effective antiviral host immune response depends on recognition of viral invasion and an intact innate immune system as a first line of defense. Double-stranded RNA (dsRNA) is a viral product essential for the induction of innate immunity, leading to the production of type I interferons (IFNs) and the activation of hundreds of IFN-stimulated genes. The present study demonstrates that infections, including those by ssDNA viruses and positive- and negative-strand RNA viruses, produce dsRNAs detectable by standard immunofluorescence staining. While dsRNA staining was primarily observed in the cytoplasm, nuclear staining was also present in some RNA and DNA virus infections. The nucleus is unlikely to have pathogen-associated molecular pattern (PAMP) receptors for dsRNA because of the presence of host dsRNA molecules. Thus, it is likely that most animal virus infections produce dsRNA species detectable by immunofluorescence staining, which may prove useful in viral discovery as well. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Evaluation of aluminum phthalocyanine chloride and DNA interactions for the design of an advanced drug delivery system in photodynamic therapy.

PubMed

Jayme, Cristiano Ceron; Calori, Italo Rodrigo; Cunha, Elise Marques Freire; Tedesco, Antonio Claudio

2018-08-05

The aim of this study was to evaluate the interaction of aluminum phthalocyanine chloride (AlClPc) with double-stranded DNA. Absorption and fluorescence spectra, resonance light scattering, and circular dichroism were evaluated in water and water/ethanol mixtures with different concentrations of DNA or AlClPc. AlClPc showed a high ability to bind to DNA in both water and 4/6 water/ethanol mixture (v/v), with a majority of monomeric and aggregated initial forms of AlClPc, respectively. In this interaction, AlClPc bound preferentially to the grooves of DNA. The monomeric/aggregate state of AlClPc in DNA was dependent on the AlClPc/DNA ratio. At low concentrations of AlClPc, the interaction of AlClPc with few DNA sites caused a curvature in the DNA structure that provided a favorable environment for the intercalation of AlClPc aggregates. Increase in AlClPc concentration induced interactions with a high number of binding sites on DNA, which prevented bending and therefore aggregation of AlClPc molecules throughout the double-stranded DNA. These results are relevant to the understanding of the behavior and interaction of AlClPc with double-stranded DNA in the design of novel drug delivery systems for clinical application in photodynamic therapy as a new approach to treat skin or oral cancer, scars, or wound healing. Copyright © 2018 Elsevier B.V. All rights reserved.

Analysis of DNA Double-Strand Breaks and Cytotoxicity after 7 Tesla Magnetic Resonance Imaging of Isolated Human Lymphocytes

PubMed Central

Guttek, Karina; Hartig, Roland; Godenschweger, Frank; Roggenbuck, Dirk; Ricke, Jens; Reinhold, Dirk; Speck, Oliver

2015-01-01

The global use of magnetic resonance imaging (MRI) is constantly growing and the field strengths increasing. Yet, only little data about harmful biological effects caused by MRI exposure are available and published research analyzing the impact of MRI on DNA integrity reported controversial results. This in vitro study aimed to investigate the genotoxic and cytotoxic potential of 7 T ultra-high-field MRI on isolated human peripheral blood mononuclear cells. Hence, unstimulated mononuclear blood cells were exposed to 7 T static magnetic field alone or in combination with maximum permissible imaging gradients and radiofrequency pulses as well as to ionizing radiation during computed tomography and γ-ray exposure. DNA double-strand breaks were quantified by flow cytometry and automated microscopy analysis of immunofluorescence stained γH2AX. Cytotoxicity was studied by CellTiter-Blue viability assay and [3H]-thymidine proliferation assay. Exposure of unstimulated mononuclear blood cells to 7 T static magnetic field alone or combined with varying gradient magnetic fields and pulsed radiofrequency fields did not induce DNA double-strand breaks, whereas irradiation with X- and γ-rays led to a dose-dependent induction of γH2AX foci. The viability assay revealed a time- and dose-dependent decrease in metabolic activity only among samples exposed to γ-radiation. Further, there was no evidence for altered proliferation response after cells were exposed to 7 T MRI or low doses of ionizing radiation (≤ 0.2 Gy). These findings confirm the acceptance of MRI as a safe non-invasive diagnostic imaging tool, but whether MRI can induce other types of DNA lesions or DNA double-strand breaks during altered conditions still needs to be investigated. PMID:26176601

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

NASA Astrophysics Data System (ADS)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

PubMed

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

Design and Characterization of DNA Strand-Displacement Circuits in Serum-Supplemented Cell Medium.

PubMed

Fern, Joshua; Schulman, Rebecca

2017-09-15

The functional stability and lifetimes of synthetic molecular circuits in biological environments are important for long-term, stable sensors or controllers of cell or tissue behavior. DNA-based molecular circuits, in particular DNA strand-displacement circuits, provide simple and effective biocompatible control mechanisms and sensors, but are vulnerable to digestion by nucleases present in living tissues and serum-supplemented cell culture. The stability of double-stranded and single-stranded DNA circuit components in serum-supplemented cell medium and the corresponding effect of nuclease-mediated degradation on circuit performance were characterized to determine the major routes of degradation and DNA strand-displacement circuit failure. Simple circuit design choices, such as the use of 5' toeholds within the DNA complexes used as reactants in the strand-displacement reactions and the termination of single-stranded components with DNA hairpin domains at the 3' termini, significantly increase the functional lifetime of the circuit components in the presence of nucleases. Simulations of multireaction circuits, guided by the experimentally measured operation of single-reaction circuits, enable predictive realization of multilayer and competitive-reaction circuit behavior. Together, these results provide a basic route to increased DNA circuit stability in cell culture environments.

Design and Characterization of DNA Strand-Displacement Circuits in Serum-Supplemented Cell Medium

DOE PAGES

Fern, Joshua; Schulman, Rebecca

2017-05-30

The functional stability and lifetimes of synthetic molecular circuits in biological environments are important for long-term, stable sensors or controllers of cell or tissue behavior. DNA-based molecular circuits, particularly DNA strand-displacement circuits, provide simple and effective biocompatible control mechanisms and sensors, but are vulnerable to digestion by nucleases present in living tissues and serum-supplemented cell culture. The stability of double-stranded and single-stranded DNA circuit components in serum-supplemented cell medium and the corresponding effect of nuclease-mediated degradation on circuit performance were characterized to determine the major routes of degradation and DNA strand-displacement circuit failure. Simple circuit design choices, such as themore » use of 5' toeholds within the DNA complexes used as reactants in the strand-displacement reactions and the termination of single-stranded components with DNA hairpin domains at the 3' termini, significantly increase the functional lifetime of the circuit components in the presence of nucleases. Furthermore, simulations of multireaction circuits, guided by the experimentally measured operation of single-reaction circuits, enable predictive realization of multilayer and competitive-reaction circuit behavior. Altogether, these results provide a basic route to increased DNA circuit stability in cell culture environments.« less

Design and Characterization of DNA Strand-Displacement Circuits in Serum-Supplemented Cell Medium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fern, Joshua; Schulman, Rebecca

The functional stability and lifetimes of synthetic molecular circuits in biological environments are important for long-term, stable sensors or controllers of cell or tissue behavior. DNA-based molecular circuits, particularly DNA strand-displacement circuits, provide simple and effective biocompatible control mechanisms and sensors, but are vulnerable to digestion by nucleases present in living tissues and serum-supplemented cell culture. The stability of double-stranded and single-stranded DNA circuit components in serum-supplemented cell medium and the corresponding effect of nuclease-mediated degradation on circuit performance were characterized to determine the major routes of degradation and DNA strand-displacement circuit failure. Simple circuit design choices, such as themore » use of 5' toeholds within the DNA complexes used as reactants in the strand-displacement reactions and the termination of single-stranded components with DNA hairpin domains at the 3' termini, significantly increase the functional lifetime of the circuit components in the presence of nucleases. Furthermore, simulations of multireaction circuits, guided by the experimentally measured operation of single-reaction circuits, enable predictive realization of multilayer and competitive-reaction circuit behavior. Altogether, these results provide a basic route to increased DNA circuit stability in cell culture environments.« less

Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.

There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less

Spacer length controlled lamello-columnar to oblique-columnar mesophase transition in liquid crystalline DNA - discotic cationic lipid complexes

NASA Astrophysics Data System (ADS)

Zhu, Lei; Cui, Li; Miao, Jianjun

2006-03-01

A series of asymmetric triphenylene imidazolium salts with different spacer lengths (C5, C8, and C11) were synthesized and their ionic complexes with double-strand DNA were prepared in aqueous solution. The molecular composition of the complexes was determined by FTIR analysis. The liquid crystalline morphology was characterized by polarized light microscopy, X-ray diffraction (XRD), and transmission electron microscope. 2D XRD results indicated an oblique columnar phase for the complex with a short spacer length of C5, while lamello-columnar phases for those with longer spacer lengths (C8 and C11). Thin film circular dichroism results showed the disappearing of any helical conformation in the DNA in all the complexes. Instead, the complexation between single-strand RNA and discotic cationic lipids did not show columnar morphology; therefore, the columnar liquid crystalline morphology in the DNA-discotic cationic lipid complexes was attributed to the DNA double-strand chain rigidity.

Energy required to pinch a DNA plectoneme

NASA Astrophysics Data System (ADS)

Barde, Céline; Destainville, Nicolas; Manghi, Manoel

2018-03-01

DNA supercoiling plays an important role from a biological point of view. One of its consequences at the supramolecular level is the formation of DNA superhelices named plectonemes. Normally separated by a distance on the order of 10 nm, the two opposite double strands of a DNA plectoneme must be brought closer if a protein or protein complex implicated in genetic regulation is to be bound simultaneously to both strands, as if the plectoneme was locally pinched. We propose an analytic calculation of the energetic barrier, of elastic nature, required to bring closer the two loci situated on the opposed double strands. We examine how this energy barrier scales with the DNA supercoiling. For physically relevant values of elastic parameters and of supercoiling density, we show that the energy barrier is in the kBT range under physiological conditions, thus demonstrating that the limiting step to loci encounter is more likely the preceding plectoneme slithering bringing the two loci side by side.

Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA

DOE PAGES

Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.; ...

2017-10-27

There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less

Growing Bacteriophage M13 in Liquid Culture.

PubMed

Green, Michael R; Sambrook, Joseph

2017-11-01

Stocks of bacteriophage M13 are usually grown in liquid culture. The infected bacteria do not lyse but, instead, grow at a slower than normal rate to form a dilute suspension. The inoculum of bacteriophage is almost always a freshly picked plaque or a suspension of bacteriophage particles obtained from a single plaque, as described here. Infected cells contain up to 200 copies of double-stranded, replicative-form DNA and extrude several hundred bacteriophage particles per generation. Thus, a 1-mL culture of infected cells can produce enough double-stranded viral DNA (1-2 mg) for restriction mapping and recovery of cloned DNA inserts and sufficient single-stranded DNA (∼5-10 mg) for site-directed mutagenesis, DNA sequencing, or synthesis of radiolabeled probes. The titer of bacteriophages in the supernatant from infected cells is so high (∼10 12 pfu/mL) that a small aliquot serves as a permanent stock of the starting plaque. © 2017 Cold Spring Harbor Laboratory Press.

Mammalian DNA enriched for replication origins is enriched for snap-back sequences.

PubMed

Zannis-Hadjopoulos, M; Kaufmann, G; Martin, R G

1984-11-15

Using the instability of replication loops as a method for the isolation of double-stranded nascent DNA, extruded DNA enriched for replication origins was obtained and denatured. Snap-back DNA, single-stranded DNA with inverted repeats (palindromic sequences), reassociates rapidly into stem-loop structures with zero-order kinetics when conditions are changed from denaturing to renaturing, and can be assayed by chromatography on hydroxyapatite. Origin-enriched nascent DNA strands from mouse, rat and monkey cells growing either synchronously or asynchronously were purified and assayed for the presence of snap-back sequences. The results show that origin-enriched DNA is also enriched for snap-back sequences, implying that some origins for mammalian DNA replication contain or lie near palindromic sequences.

RecA: Regulation and Mechanism of a Molecular Search Engine.

PubMed

Bell, Jason C; Kowalczykowski, Stephen C

2016-06-01

Homologous recombination maintains genomic integrity by repairing broken chromosomes. The broken chromosome is partially resected to produce single-stranded DNA (ssDNA) that is used to search for homologous double-stranded DNA (dsDNA). This homology driven 'search and rescue' is catalyzed by a class of DNA strand exchange proteins that are defined in relation to Escherichia coli RecA, which forms a filament on ssDNA. Here, we review the regulation of RecA filament assembly and the mechanism by which RecA quickly and efficiently searches for and identifies a unique homologous sequence among a vast excess of heterologous DNA. Given that RecA is the prototypic DNA strand exchange protein, its behavior affords insight into the actions of eukaryotic RAD51 orthologs and their regulators, BRCA2 and other tumor suppressors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integration supports the double-stranded break repair model for T-DNA integration.

PubMed

Hu, Yufei; Chen, Zhiyu; Zhuang, Chuxiong; Huang, Jilei

2017-06-01

Transferred DNA (T-DNA) from Agrobacterium tumefaciens can be integrated into the plant genome. The double-stranded break repair (DSBR) pathway is a major model for T-DNA integration. From this model, we expect that two ends of a T-DNA molecule would invade into a single DNA double-stranded break (DSB) or independent DSBs in the plant genome. We call the later phenomenon a heterogeneous T-DNA integration, which has never been observed. In this work, we demonstrated it in an Arabidopsis T-DNA insertion mutant seb19. To resolve the chromosomal structural changes caused by T-DNA integration at both the nucleotide and chromosome levels, we performed inverse PCR, genome resequencing, fluorescence in situ hybridization and linkage analysis. We found, in seb19, a single T-DNA connected two different chromosomal loci and caused complex chromosomal rearrangements. The specific break-junction pattern in seb19 is consistent with the result of heterogeneous T-DNA integration but not of recombination between two T-DNA insertions. We demonstrated that, in seb19, heterogeneous T-DNA integration evoked a cascade of incorrect repair of seven DSBs on chromosomes 4 and 5, and then produced translocation, inversion, duplication and deletion. Heterogeneous T-DNA integration supports the DSBR model and suggests that two ends of a T-DNA molecule could be integrated into the plant genome independently. Our results also show a new origin of chromosomal abnormalities. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Wing 1 of protein HOP2 is as important as helix 3 in DNA binding by MD simulation.

PubMed

Moktan, Hem; Zhou, Donghua H

2018-05-01

The repair of programmed DNA double-strand breaks through recombination is required for proper association and disjunction of the meiotic homologous chromosomes. Meiosis-specific protein HOP2 plays essential roles in recombination by promoting recombinase activities. The N-terminal domain of HOP2 interacts with DNA through helix 3 (H3) and wing 1 (W1). Mutations in wing 1 (Y65A/K67A/Q68A) slightly weakened the binding but mutations in helices 2 and 3 (Q30A/K44A/K49A) nearly abolished the binding. To better understand such differential effects at atomic level, molecular dynamics simulations were employed. Despite losing some hydrogen bonds, the W1-mutant DNA complex was rescued by stronger hydrophobic interactions. For the wild type and W1-mutant, the protein was found to slide along the DNA grooves as the DNA rolls along its double-helix axis. This motion could be functionally important to facilitate the precise positioning of the single-stranded DNA with the homologous double-stranded DNA. The sliding motion was reduced in the W1-mutant. The H-mutant nearly lost all intermolecular interactions. Moreover, an additional mutation in wing 1 (Y65A/K67A/Q68A/K69A) also caused complete complex dissociation. Therefore, both wing 1 and helix 3 make important contribution to the DNA binding, which could be important to the strand invasion function of HOP2 homodimer and HOP2-MND1 heterodimer. Similar to cocking a medieval crossbow with the archer's foot placed in the stirrup, wing 1 may push the minor groove to cause distortion while helix 3 grabs the major groove.

Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease.

PubMed

Liu, Yibin; Song, Chen; Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Makrigiorgos, G Mike

2017-04-07

Aberrant methylation changes, often present in a minor allelic fraction in clinical samples such as plasma-circulating DNA (cfDNA), are potentially powerful prognostic and predictive biomarkers in human disease including cancer. We report on a novel, highly-multiplexed approach to facilitate analysis of clinically useful methylation changes in minor DNA populations. Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) employs a double-strand-specific DNA nuclease (DSN) to remove excess DNA with normal methylation patterns. The technique utilizes oligonucleotide-probes that direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets, and leaving methylated targets intact; and vice versa. Subsequent amplification of the targeted regions results in enrichment of the targeted methylated or unmethylated minority-epigenetic-alleles. We validate MS-NaME by demonstrating enrichment of RARb2, ATM, MGMT and GSTP1 promoters in multiplexed MS-NaME reactions (177-plex) using dilutions of methylated/unmethylated DNA and in DNA from clinical lung cancer samples and matched normal tissue. MS-NaME is a highly scalable single-step approach performed at the genomic DNA level in solution that combines with most downstream detection technologies including Sanger sequencing, methylation-sensitive-high-resolution melting (MS-HRM) and methylation-specific-Taqman-based-digital-PCR (digital Methylight) to boost detection of low-level aberrant methylation-changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mammalian DNA single-strand break repair: an X-ra(y)ted affair.

PubMed

Caldecott, K W

2001-05-01

The genetic stability of living cells is continuously threatened by the presence of endogenous reactive oxygen species and other genotoxic molecules. Of particular threat are the thousands of DNA single-strand breaks that arise in each cell, each day, both directly from disintegration of damaged sugars and indirectly from the excision repair of damaged bases. If un-repaired, single-strand breaks can be converted into double-strand breaks during DNA replication, potentially resulting in chromosomal rearrangement and genetic deletion. Consequently, cells have adopted multiple pathways to ensure the rapid and efficient removal of single-strand breaks. A general feature of these pathways appears to be the extensive employment of protein-protein interactions to stimulate both the individual component steps and the overall repair reaction. Our current understanding of DNA single-strand break repair is discussed, and testable models for the architectural coordination of this important process are presented. Copyright 2001 John Wiley & Sons, Inc.

Nonenzymatic Role for WRN in Preserving Nascent DNA Strands after Replication Stress

DOE PAGES

Su, Fengtao; Mukherjee, Shibani; Yang, Yanyong; ...

2014-11-20

WRN, the protein defective in Werner syndrome (WS), is a multifunctional nuclease involved in DNA damage repair, replication, and genome stability maintenance. It was assumed that the nuclease activities of WRN were critical for these functions. Here, we report a nonenzymatic role for WRN in preserving nascent DNA strands following replication stress. We found that lack of WRN led to shortening of nascent DNA strands after replication stress. Furthermore, we discovered that the exonuclease activity of MRE11 was responsible for the shortening of newly replicated DNA in the absence of WRN. Mechanistically, the N-terminal FHA domain of NBS1 recruits WRNmore » to replication-associated DNA double-stranded breaks to stabilize Rad51 and to limit the nuclease activity of its C-terminal binding partner MRE11. Thus, this previously unrecognized nonenzymatic function of WRN in the stabilization of nascent DNA strands sheds light on the molecular reason for the origin of genome instability in WS individuals.« less

Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

NASA Astrophysics Data System (ADS)

Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping

2010-12-01

Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

PubMed

Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

2017-02-20

The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

Binding mode and thermodynamic studies on the interaction of the anticancer drug dacarbazine and dacarbazine-Cu(II) complex with single and double stranded DNA.

PubMed

Temerk, Yassien; Ibrahim, Hossieny

2014-07-01

The binding mode and thermodynamic characteristics of the anticancer drug dacarbazine (Dac) with double and single stranded DNA were investigated in the absence and presence of Cu(II) using cyclic voltammetry, square wave voltammetry and fluorescence spectroscopy. The interaction of Dac and Dac-Cu(II) complex with dsDNA indicated their intercalation into the base stacking domain of dsDNA double helix and the strength of interaction is independent on the ionic strength. The interaction of Dac with dsDNA in the presence of Cu(II) leads to a much stronger intercalation. The interaction mode of Dac molecules with ssDNA is electrostatic attraction via negative phosphate on the exterior of the ssDNA with Dac. The binding constants, stoichiometric coefficients and thermodynamic parameters of Dac and Dac-Cu(II) complex with dsDNA and ssDNA were evaluated. Comparison of the mode interaction of Dac with dsDNA and ssDNA was discussed. The decrease of peak current of Dac was proportional to DNA concentration, which was applied for determination of dsDNA and ssDNA concentration. Copyright © 2014 Elsevier B.V. All rights reserved.

Aptamer sensor for cocaine using minor groove binder based energy transfer.

PubMed

Zhou, Jinwen; Ellis, Amanda V; Kobus, Hilton; Voelcker, Nicolas H

2012-03-16

We report on an optical aptamer sensor for cocaine detection. The cocaine sensitive fluorescein isothiocyanate (FITC)-labeled aptamer underwent a conformational change from a partial single-stranded DNA with a short hairpin to a double-stranded T-junction in the presence of the target. The DNA minor groove binder Hoechst 33342 selectively bound to the double-stranded T-junction, bringing the dye within the Förster radius of FITC, and therefore initiating minor groove binder based energy transfer (MBET), and reporting on the presence of cocaine. The sensor showed a detection limit of 0.2 μM. The sensor was also implemented on a carboxy-functionalized polydimethylsiloxane (PDMS) surface by covalently immobilizing DNA aptamers. The ability of surface-bound cocaine detection is crucial for the development of microfluidic sensors. Copyright © 2012 Elsevier B.V. All rights reserved.

Irradiation of DNA loaded with platinum containing molecules by fast atomic ions C(6+) and Fe(26+).

PubMed

Usami, N; Kobayashi, K; Furusawa, Y; Frohlich, H; Lacombe, S; Sech, C Le

2007-09-01

In order to study the role of the Linear Energy Transfer (LET) of fast atomic ions in platinum-DNA complexes inducing breaks, DNA Plasmids were irradiated by C(6+) and Fe(26+) ions. DNA Plasmids (pBR322) loaded with different amounts of platinum contained in a terpyridine-platinum molecule (PtTC) were irradiated by C(6+) ions and Fe(26+) ions. The LET values ranged between 13.4 keV/microm and 550 keV/microm. In some experiments, dimethyl sulfoxide (DMSO) was added. In all experiments, a significant increase in DNA strand breaks was observed when platinum was present. The yield of breaks induced per Gray decreased when the LET increased. The yield of single and double strand breaks per plasmid per track increased with the LET, indicating that the number of DNA breaks per Gray was related to the number of tracks through the medium. These findings show that more DNA breaks are induced by atomic ions when platinum is present. This effect increases for low LET heavy atoms. As DSB induction may induce cell death, these results could open new perspectives with the association of hadrontherapy and chemotherapy. Thus the therapeutic index might be improved by loading the tumour with platinum salts.

Visualization of complex DNA damage along accelerated ions tracks

NASA Astrophysics Data System (ADS)

Kulikova, Elena; Boreyko, Alla; Bulanova, Tatiana; Ježková, Lucie; Zadneprianetc, Mariia; Smirnova, Elena

2018-04-01

The most deleterious DNA lesions induced by ionizing radiation are clustered DNA double-strand breaks (DSB). Clustered or complex DNA damage is a combination of a few simple lesions (single-strand breaks, base damage etc.) within one or two DNA helix turns. It is known that yield of complex DNA lesions increases with increasing linear energy transfer (LET) of radiation. For investigation of the induction and repair of complex DNA lesions, human fibroblasts were irradiated with high-LET 15N ions (LET = 183.3 keV/μm, E = 13MeV/n) and low-LET 60Co γ-rays (LET ≈ 0.3 keV/μm) radiation. DNA DSBs (γH2AX and 53BP1) and base damage (OGG1) markers were visualized by immunofluorecence staining and high-resolution microscopy. The obtained results showed slower repair kinetics of induced DSBs in cells irradiated with accelerated ions compared to 60Co γ-rays, indicating induction of more complex DNA damage. Confirming previous assumptions, detailed 3D analysis of γH2AX/53BP1 foci in 15N ions tracks revealed more complicated structure of the foci in contrast to γ-rays. It was shown that proteins 53BP1 and OGG1 involved in repair of DNA DSBs and modified bases, respectively, were colocalized in tracks of 15N ions and thus represented clustered DNA DSBs.

Dielectric dispersion for short double-strand DNA.

PubMed

Omori, Shinji; Katsumoto, Yoichi; Yasuda, Akio; Asami, Koji

2006-05-01

A complex dielectric constant for double-strand DNA molecules with a length of not greater than 120 base pairs in an aqueous solution containing 30 mM NaCl was systematically measured as a function of chain length in such a way that experimental uncertainties associated with the molecular-weight distribution of specimens were virtually excluded. In contrast to the past experimental and theoretical studies for much longer DNA molecules, both the molar specific dielectric increment and the relaxation time are proportional to the chain length. These scaling rules cannot be accounted for by any theory so far proposed that gives analytical expressions for those two quantities in the long-chain limit.

The role of the non-homologous end-joining pathway in lymphocyte development.

PubMed

Rooney, Sean; Chaudhuri, Jayanta; Alt, Frederick W

2004-08-01

One of the most toxic insults a cell can incur is a disruption of its linear DNA in the form of a double-strand break (DSB). Left unrepaired, or repaired improperly, these lesions can result in cell death or neoplastic transformation. Despite these dangers, lymphoid cells purposely introduce DSBs into their genome to maximize the diversity and effector functions of their antigen receptor genes. While the generation of breaks requires distinct lymphoid-specific factors, their resolution requires various ubiquitously expressed DNA-repair proteins, known collectively as the non-homologous end-joining pathway. In this review, we discuss the factors that constitute this pathway as well as the evidence of their involvement in two lymphoid-specific DNA recombination events.

Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Tae Hoon; Chennakrishnaiah, Shilpa; Audemard, Eric

2014-08-22

Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellularmore » vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells.« less

Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

PubMed

Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

2008-07-02

Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

Quantifying clustered DNA damage induction and repair by gel electrophoresis, electronic imaging and number average length analysis

NASA Technical Reports Server (NTRS)

Sutherland, Betsy M.; Georgakilas, Alexandros G.; Bennett, Paula V.; Laval, Jacques; Sutherland, John C.; Gewirtz, A. M. (Principal Investigator)

2003-01-01

Assessing DNA damage induction, repair and consequences of such damages requires measurement of specific DNA lesions by methods that are independent of biological responses to such lesions. Lesions affecting one DNA strand (altered bases, abasic sites, single strand breaks (SSB)) as well as damages affecting both strands (clustered damages, double strand breaks) can be quantified by direct measurement of DNA using gel electrophoresis, gel imaging and number average length analysis. Damage frequencies as low as a few sites per gigabase pair (10(9)bp) can be quantified by this approach in about 50ng of non-radioactive DNA, and single molecule methods may allow such measurements in DNA from single cells. This review presents the theoretical basis, biochemical requirements and practical aspects of this approach, and shows examples of their applications in identification and quantitation of complex clustered damages.

Role of Escherichia coli dnaG function in coliphage M13 DNA synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta, S.; Mitra, S.

Examination of the role of Escherichia coli dnaG function in different stages of M13 phage DNA synthesis by ultracentrifugal analysis of intracellular phage DNA in a thermosensitive dnaG mutant shows that: (a) the formation of parental double-strand replicative-form DNA (rfDNA) from the infecting virus is independent of dnaG function; (b) the synthesis of progeny rfDNA requires dnaG product; (c) after a pool of rfDNA is made up, dnaG function is not required for the progeny single-strand DNA (ssDNA) synthesis. The ssDNAs produced under nonpermissive condition are mostly circular and biologically functional.

Scalable and Versatile Genome Editing Using Linear DNAs with Microhomology to Cas9 Sites in Caenorhabditis elegans

PubMed Central

Paix, Alexandre; Wang, Yuemeng; Smith, Harold E.; Lee, Chih-Yung S.; Calidas, Deepika; Lu, Tu; Smith, Jarrett; Schmidt, Helen; Krause, Michael W.; Seydoux, Geraldine

2014-01-01

Homology-directed repair (HDR) of double-strand DNA breaks is a promising method for genome editing, but is thought to be less efficient than error-prone nonhomologous end joining in most cell types. We have investigated HDR of double-strand breaks induced by CRISPR-associated protein 9 (Cas9) in Caenorhabditis elegans. We find that HDR is very robust in the C. elegans germline. Linear repair templates with short (∼30–60 bases) homology arms support the integration of base and gene-sized edits with high efficiency, bypassing the need for selection. Based on these findings, we developed a systematic method to mutate, tag, or delete any gene in the C. elegans genome without the use of co-integrated markers or long homology arms. We generated 23 unique edits at 11 genes, including premature stops, whole-gene deletions, and protein fusions to antigenic peptides and GFP. Whole-genome sequencing of five edited strains revealed the presence of passenger variants, but no mutations at predicted off-target sites. The method is scalable for multi-gene editing projects and could be applied to other animals with an accessible germline. PMID:25249454

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

PubMed

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Direct Comparison of Amino Acid and Salt Interactions with Double-Stranded and Single-Stranded DNA from Explicit-Solvent Molecular Dynamics Simulations.

PubMed

Andrews, Casey T; Campbell, Brady A; Elcock, Adrian H

2017-04-11

Given the ubiquitous nature of protein-DNA interactions, it is important to understand the interaction thermodynamics of individual amino acid side chains for DNA. One way to assess these preferences is to perform molecular dynamics (MD) simulations. Here we report MD simulations of 20 amino acid side chain analogs interacting simultaneously with both a 70-base-pair double-stranded DNA and with a 70-nucleotide single-stranded DNA. The relative preferences of the amino acid side chains for dsDNA and ssDNA match well with values deduced from crystallographic analyses of protein-DNA complexes. The estimated apparent free energies of interaction for ssDNA, on the other hand, correlate well with previous simulation values reported for interactions with isolated nucleobases, and with experimental values reported for interactions with guanosine. Comparisons of the interactions with dsDNA and ssDNA indicate that, with the exception of the positively charged side chains, all types of amino acid side chain interact more favorably with ssDNA, with intercalation of aromatic and aliphatic side chains being especially notable. Analysis of the data on a base-by-base basis indicates that positively charged side chains, as well as sodium ions, preferentially bind to cytosine in ssDNA, and that negatively charged side chains, and chloride ions, preferentially bind to guanine in ssDNA. These latter observations provide a novel explanation for the lower salt dependence of DNA duplex stability in GC-rich sequences relative to AT-rich sequences.

An Enzyme-Catalyzed Multistep DNA Refolding Mechanism in Hairpin Telomere Formation

PubMed Central

Shi, Ke; Huang, Wai Mun; Aihara, Hideki

2013-01-01

Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting–rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions. PMID:23382649

Minimalist Approach to Complexity: Templating the Assembly of DNA Tile Structures with Sequentially Grown Input Strands.

PubMed

Lau, Kai Lin; Sleiman, Hanadi F

2016-07-26

Given its highly predictable self-assembly properties, DNA has proven to be an excellent template toward the design of functional materials. Prominent examples include the remarkable complexity provided by DNA origami and single-stranded tile (SST) assemblies, which require hundreds of unique component strands. However, in many cases, the majority of the DNA assembly is purely structural, and only a small "working area" needs to be aperiodic. On the other hand, extended lattices formed by DNA tile motifs require only a few strands; but they suffer from lack of size control and limited periodic patterning. To overcome these limitations, we adopt a templation strategy, where an input strand of DNA dictates the size and patterning of resultant DNA tile structures. To prepare these templating input strands, a sequential growth technique developed in our lab is used, whereby extended DNA strands of defined sequence and length may be generated simply by controlling their order of addition. With these, we demonstrate the periodic patterning of size-controlled double-crossover (DX) and triple-crossover (TX) tile structures, as well as intentionally designed aperiodicity of a DX tile structure. As such, we are able to prepare size-controlled DNA structures featuring aperiodicity only where necessary with exceptional economy and efficiency.

Phosphorylation of Exo1 modulates homologous recombination repair of DNA double-strand breaks

PubMed Central

Bolderson, Emma; Tomimatsu, Nozomi; Richard, Derek J.; Boucher, Didier; Kumar, Rakesh; Pandita, Tej K.; Burma, Sandeep; Khanna, Kum Kum

2010-01-01

DNA double-strand break (DSB) repair via the homologous recombination pathway is a multi-stage process, which results in repair of the DSB without loss of genetic information or fidelity. One essential step in this process is the generation of extended single-stranded DNA (ssDNA) regions at the break site. This ssDNA serves to induce cell cycle checkpoints and is required for Rad51 mediated strand invasion of the sister chromatid. Here, we show that human Exonuclease 1 (Exo1) is required for the normal repair of DSBs by HR. Cells depleted of Exo1 show chromosomal instability and hypersensitivity to ionising radiation (IR) exposure. We find that Exo1 accumulates rapidly at DSBs and is required for the recruitment of RPA and Rad51 to sites of DSBs, suggesting a role for Exo1 in ssDNA generation. Interestingly, the phosphorylation of Exo1 by ATM appears to regulate the activity of Exo1 following resection, allowing optimal Rad51 loading and the completion of HR repair. These data establish a role for Exo1 in resection of DSBs in human cells, highlighting the critical requirement of Exo1 for DSB repair via HR and thus the maintenance of genomic stability. PMID:20019063

Recombinational Repair of DNA Damage in Escherichia coli and Bacteriophage λ

PubMed Central

Kuzminov, Andrei

1999-01-01

Although homologous recombination and DNA repair phenomena in bacteria were initially extensively studied without regard to any relationship between the two, it is now appreciated that DNA repair and homologous recombination are related through DNA replication. In Escherichia coli, two-strand DNA damage, generated mostly during replication on a template DNA containing one-strand damage, is repaired by recombination with a homologous intact duplex, usually the sister chromosome. The two major types of two-strand DNA lesions are channeled into two distinct pathways of recombinational repair: daughter-strand gaps are closed by the RecF pathway, while disintegrated replication forks are reestablished by the RecBCD pathway. The phage λ recombination system is simpler in that its major reaction is to link two double-stranded DNA ends by using overlapping homologous sequences. The remarkable progress in understanding the mechanisms of recombinational repair in E. coli over the last decade is due to the in vitro characterization of the activities of individual recombination proteins. Putting our knowledge about recombinational repair in the broader context of DNA replication will guide future experimentation. PMID:10585965

Two conformational states in D-shaped DNA: Effects of local denaturation

NASA Astrophysics Data System (ADS)

Lee, O.-Chul; Kim, Cheolhee; Kim, Jae-Yeol; Lee, Nam Ki; Sung, Wokyung

2016-06-01

The bending of double-stranded(ds) DNA on the nano-meter scale plays a key role in many cellular processes such as nucleosome packing, transcription-control, and viral-genome packing. In our recent study, a nanometer-sized dsDNA bent into a D shape was formed by hybridizing a circular single-stranded(ss) DNA and a complementary linear ssDNA. Our fluorescence resonance energy transfer (FRET) measurement of D-DNA revealed two types of conformational states: a less-bent state and a kinked state, which can transform into each other. To understand the origin of the two deformed states of D-DNA, here we study the presence of open base-pairs in the ds portion by using the breathing-DNA model to simulate the system. We provide strong evidence that the two states are due to the emergence of local denaturation, i.e., a bubble in the middle and two forks at ends of the dsDNA portion. We also study the system analytically and find that the free-energy landscape is bistable with two minima representative of the two states. The kink and fork sizes estimated by the analytical calculation are also in excellent agreement with the results of the simulation. Thus, this combined experimental-simulation-analytical study corroborates that highly bent D-DNA reduces bending stress via local denaturation.

Excess single-stranded DNA inhibits meiotic double-strand break repair.

PubMed

Johnson, Rebecca; Borde, Valérie; Neale, Matthew J; Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S H

2007-11-01

During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins.

Excess Single-Stranded DNA Inhibits Meiotic Double-Strand Break Repair

PubMed Central

Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S. H

2007-01-01

During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1.We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Δ cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Δ cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins. PMID:18081428

A paper-based device for double-stranded DNA detection with Zif268

NASA Astrophysics Data System (ADS)

Zhang, Daohong

2017-05-01

Here, a small analytical device was fabricated on both nitrocellulose membrane and filter paper, for the detection of biotinylated double-stranded DNA (dsDNA) from 1 nM. Zif268 was utilized for capturing the target DNA, which was a zinc finger protein that recognized only a dsDNA with specific sequence. Therefore, this detection platform could be utilized for PCR result detection, with the well-designed primers (interpolate both biotin and Zif268 binding sequence). The result of the assay could be recorded by a camera-phone, and analyzed with software. The whole assay finished within 1 hour. Due to the easy fabrication, operation and disposal of this device, this method can be employed in point-of-care detection or on-site monitoring.

A novel method to produce armored double-stranded DNA by encapsulation of MS2 viral capsids.

PubMed

Zhang, Lei; Sun, Yu; Chang, Le; Jia, Tingting; Wang, Guojing; Zhang, Rui; Zhang, Kuo; Li, Jinming

2015-09-01

With the rapid development of molecular diagnostic techniques, there is a growing need for quality controls and standards with favorable properties to monitor the entire detection process. In this study, we describe a novel method to produce armored hepatitis B virus (HBV) and human papillomavirus (HPV) DNA for use in nucleic acid tests, which was confirmed to be stable, homogeneous, noninfectious, nuclease resistant, and safe for shipping. We demonstrated that MS2 bacteriophage could successfully package double-stranded DNA of 1.3-, 3-, 3.5-, and 6.5-kb length into viral capsids with high reassembly efficiency. This is the first application of RNA bacteriophage MS2 as a platform to encapsulate double-stranded DNA, forming virus-like particles (VLPs) which were indistinguishable from native MS2 capsids in size and morphology. Moreover, by analyzing the interaction mechanism of pac site and the MS2 coat protein (CP), we found that in addition to the recognized initiation signal TR-RNA, TR-DNA can also trigger spontaneous reassembly of CP dimers, providing a more convenient and feasible method of assembly. In conclusion, this straightforward and reliable manufacturing approach makes armored DNA an ideal control and standard for use in clinical laboratory tests and diagnostics, possessing prospects for broad application, especially providing a new platform for the production of quality controls for DNA viruses.

Rolling-circle amplification under topological constraints

PubMed Central

Kuhn, Heiko; Demidov, Vadim V.; Frank-Kamenetskii, Maxim D.

2002-01-01

We have performed rolling-circle amplification (RCA) reactions on three DNA templates that differ distinctly in their topology: an unlinked DNA circle, a linked DNA circle within a pseudorotaxane-type structure and a linked DNA circle within a catenane. In the linked templates, the single-stranded circle (dubbed earring probe) is threaded, with the aid of two peptide nucleic acid openers, between the two strands of double-stranded DNA (dsDNA). We have found that the RCA efficiency of amplification was essentially unaffected when the linked templates were employed. By showing that the DNA catenane remains intact after RCA reactions, we prove that certain DNA polymerases can carry out the replicative synthesis under topological constraints allowing detection of several hundred copies of a dsDNA marker without DNA denaturation. Our finding may have practical implications in the area of DNA diagnostics. PMID:11788721

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Transient kinetics measured with force steps discriminate between double-stranded DNA elongation and melting and define the reaction energetics

PubMed Central

Bongini, Lorenzo; Melli, Luca; Lombardi, Vincenzo; Bianco, Pasquale

2014-01-01

Under a tension of ∼65 pN, double-stranded DNA undergoes an overstretching transition from its basic (B-form) conformation to a 1.7 times longer conformation whose nature is only recently starting to be understood. Here we provide a structural and thermodynamic characterization of the transition by recording the length transient following force steps imposed on the λ-phage DNA with different melting degrees and temperatures (10–25°C). The shortening transient following a 20–35 pN force drop from the overstretching force shows a sequence of fast shortenings of double-stranded extended (S-form) segments and pauses owing to reannealing of melted segments. The lengthening transients following a 2–35 pN stretch to the overstretching force show the kinetics of a two-state reaction and indicate that the whole 70% extension is a B-S transition that precedes and is independent of melting. The temperature dependence of the lengthening transient shows that the entropic contribution to the B-S transition is one-third of the entropy change of thermal melting, reinforcing the evidence for a double-stranded S-form that maintains a significant fraction of the interstrand bonds. The cooperativity of the unitary elongation (22 bp) is independent of temperature, suggesting that structural factors, such as the nucleic acid sequence, control the transition. PMID:24353317

Complete and Incomplete Hepatitis B Virus Particles: Formation, Function, and Application.

PubMed

Hu, Jianming; Liu, Kuancheng

2017-03-21

Hepatitis B virus (HBV) is a para-retrovirus or retroid virus that contains a double-stranded DNA genome and replicates this DNA via reverse transcription of a RNA pregenome. Viral reverse transcription takes place within a capsid upon packaging of the RNA and the viral reverse transcriptase. A major characteristic of HBV replication is the selection of capsids containing the double-stranded DNA, but not those containing the RNA or the single-stranded DNA replication intermediate, for envelopment during virion secretion. The complete HBV virion particles thus contain an outer envelope, studded with viral envelope proteins, that encloses the capsid, which, in turn, encapsidates the double-stranded DNA genome. Furthermore, HBV morphogenesis is characterized by the release of subviral particles that are several orders of magnitude more abundant than the complete virions. One class of subviral particles are the classical surface antigen particles (Australian antigen) that contain only the viral envelope proteins, whereas the more recently discovered genome-free (empty) virions contain both the envelope and capsid but no genome. In addition, recent evidence suggests that low levels of RNA-containing particles may be released, after all. We will summarize what is currently known about how the complete and incomplete HBV particles are assembled. We will discuss briefly the functions of the subviral particles, which remain largely unknown. Finally, we will explore the utility of the subviral particles, particularly, the potential of empty virions and putative RNA virions as diagnostic markers and the potential of empty virons as a vaccine candidate.

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

PubMed

Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

2018-01-23

Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

PubMed Central

Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

2006-01-01

Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

Poly(ADP-ribose) polymerases covalently modify strand break termini in DNA fragments in vitro

PubMed Central

Talhaoui, Ibtissam; Lebedeva, Natalia A.; Zarkovic, Gabriella; Saint-Pierre, Christine; Kutuzov, Mikhail M.; Sukhanova, Maria V.; Matkarimov, Bakhyt T.; Gasparutto, Didier; Saparbaev, Murat K.; Lavrik, Olga I.; Ishchenko, Alexander A.

2016-01-01

Poly(ADP-ribose) polymerases (PARPs/ARTDs) use nicotinamide adenine dinucleotide (NAD+) to catalyse the synthesis of a long branched poly(ADP-ribose) polymer (PAR) attached to the acceptor amino acid residues of nuclear proteins. PARPs act on single- and double-stranded DNA breaks by recruiting DNA repair factors. Here, in in vitro biochemical experiments, we found that the mammalian PARP1 and PARP2 proteins can directly ADP-ribosylate the termini of DNA oligonucleotides. PARP1 preferentially catalysed covalent attachment of ADP-ribose units to the ends of recessed DNA duplexes containing 3′-cordycepin, 5′- and 3′-phosphate and also to 5′-phosphate of a single-stranded oligonucleotide. PARP2 preferentially ADP-ribosylated the nicked/gapped DNA duplexes containing 5′-phosphate at the double-stranded termini. PAR glycohydrolase (PARG) restored native DNA structure by hydrolysing PAR-DNA adducts generated by PARP1 and PARP2. Biochemical and mass spectrometry analyses of the adducts suggested that PARPs utilise DNA termini as an alternative to 2′-hydroxyl of ADP-ribose and protein acceptor residues to catalyse PAR chain initiation either via the 2′,1″-O-glycosidic ribose-ribose bond or via phosphodiester bond formation between C1′ of ADP-ribose and the phosphate of a terminal deoxyribonucleotide. This new type of post-replicative modification of DNA provides novel insights into the molecular mechanisms underlying biological phenomena of ADP-ribosylation mediated by PARPs. PMID:27471034

Assessment of DNA double-strand breaks induced by intravascular iodinated contrast media following in vitro irradiation and in vivo, during paediatric cardiac catheterization.

PubMed

Gould, Richard; McFadden, Sonyia L; Horn, Simon; Prise, Kevin M; Doyle, Philip; Hughes, Ciara M

2016-01-01

Paediatric cardiac catheterizations may result in the administration of substantial amounts of iodinated contrast media and ionizing radiation. The aim of this work was to investigate the effect of iodinated contrast media in combination with in vitro and in vivo X-ray radiation on lymphocyte DNA. Six concentrations of iodine (15, 17.5, 30, 35, 45, and 52.5 mg of iodine per mL blood) represented volumes of iodinated contrast media used in the clinical setting. Blood obtained from healthy volunteers was mixed with iodinated contrast media and exposed to radiation doses commonly used in paediatric cardiac catheterizations (0 mGy, 70 mGy, 140 mGy, 250 mGy and 450 mGy). Control samples contained no iodine. For in vivo experimentation, pre and post blood samples were collected from children undergoing cardiac catheterization, receiving iodine concentrations of up to 51 mg of iodine per mL blood and radiation doses of up to 400 mGy. Fluorescence microscopy was performed to assess γH2AX-foci induction, which corresponded to the number of DNA double-strand breaks. The presence of iodine in vitro resulted in significant increases of DNA double-strand breaks beyond that induced by radiation for ≥ 17.5 mg/mL iodine to blood. The in vivo effects of contrast media on children undergoing cardiac catheterization resulted in a 19% increase in DNA double-strand breaks in children receiving an average concentration of 19 mg/mL iodine to blood. A larger investigation is required to provide further information of the potential benefit of lowering the amount of iodinated contrast media received during X-ray radiation investigations. Copyright © 2015 John Wiley & Sons, Ltd.

Influence of different iodinated contrast media on the induction of DNA double-strand breaks after in vitro X-ray irradiation.

PubMed

Deinzer, Christoph K W; Danova, Daniela; Kleb, Beate; Klose, Klaus J; Heverhagen, Johannes T

2014-01-01

The objective of this work was to examine differences in DNA double-strand break induction in peripheral blood lymphocytes after in vitro X-ray irradiation between iodinated contrast agents. Four different iodinated X-ray contrast agents--three of them with two different iodine concentrations--and mannitol (negative control; concentration of 150 mg mannitol per ml blood) were pipetted into blood samples so that there was a concentration of 0, 7.5 or 15 mg of iodine per ml blood in the samples. Negative controls without contrast medium (0 mg of iodine per ml blood) were also processed for every irradiation dose. The tubes were exposed to 0, 20 or 500 mGy in vitro X-ray irradiation. After that, the lymphocytes were separated by using density-gradient centrifugation. Fluorescence microscopy was applied to determine the average number of γH2AX-foci per lymphocyte in the presence or absence of different contrast media or mannitol. Differences in the number of γH2AX-foci were statistically analysed by one-way ANOVA and post-hoc Tukey's honestly significant difference test. Iodinated contrast agents led to a statistically significant increase in DNA double-strand breaks after in vitro irradiation. This effect increased statistically significant with rising radiation dose and appeared independent of the contrast agent used (iopromid, iodixanol, iomeprol, iopamidol). A statistically significant difference in DNA damage between the different tested contrast agents was not found. Therefore, the increase in DNA double-strand breaks depends solely on the amount of iodine applied. For evaluation of clinical consequences, our findings could be tested in further animal studies. Copyright © 2014 John Wiley & Sons, Ltd.

Mechanisms of radiation-induced gene responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woloschak, G.E.; Paunesku, T.

1996-10-01

In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

Detection of damage on single- or double-stranded DNA in a population exposed to arsenic in drinking water.

PubMed

Jiménez-Villarreal, J; Rivas-Armendariz, D I; Pineda-Belmontes, C P; Betancourt-Martínez, N D; Macías-Corral, M A; Guerra-Alanis, A J; Niño-Castañeda, M S; Morán-Martínez, J

2017-05-18

Different studies have suggested an association between arsenic (As) exposure and damage to single-stranded DNA by reactive oxygen species derived from the biotransformation of arsenic. The single strand damages are converted to double strand damage upon interaction with ultraviolet radiation. Analysis of genomic integrity is important for assessing the genotoxicity caused by environmental pollutants. In this study, we compared the concentration of As in drinking water, nutritional status, lifestyle variables, and the level of genotoxicity in an exposed population and a control group. Arsenic content of water was determined using a portable Arsenator ® kit. DNA fragmentation was determined using the two-tailed comet assay. Our results show that the exposed population had low nutritional consumption compared to the control group (P < 0.05). Furthermore, the water consumed by the exposed group had As concentration of 14.3 ± 8.4 mg/L, whereas the As level in the water consumed by the control group was 7.7 ± 3.5 mg/L. Analysis shows that the frequency of double strand break (DSB) fragmentation was higher in the population exposed to higher levels of As compared to that of the control group. These results suggest a possible association between the concentration of As in drinking water and lifestyle variables, with increasing fragmentation of DSBs in the exposed population.

DNA Hairpins Containing the Cytidine Analog Pyrrolo-dC: Structural, Thermodynamic, and Spectroscopic Studies

PubMed Central

Zhang, Xu; Wadkins, Randy M.

2009-01-01

Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D. PMID:19254547

DNA hairpins containing the cytidine analog pyrrolo-dC: structural, thermodynamic, and spectroscopic studies.

PubMed

Zhang, Xu; Wadkins, Randy M

2009-03-04

Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D.

Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.

PubMed

Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J

2016-03-04

Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange*

PubMed Central

Borgogno, María V.; Monti, Mariela R.; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E.; Pezza, Roberto J.

2016-01-01

Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3′ end of the initiating DNA strand have a small effect, whereas most mismatches near the 5′ end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. PMID:26709229

Origins and evolution of viruses of eukaryotes: The ultimate modularity

PubMed Central

Koonin, Eugene V.; Dolja, Valerian V.; Krupovic, Mart

2018-01-01

Viruses and other selfish genetic elements are dominant entities in the biosphere, with respect to both physical abundance and genetic diversity. Various selfish elements parasitize on all cellular life forms. The relative abundances of different classes of viruses are dramatically different between prokaryotes and eukaryotes. In prokaryotes, the great majority of viruses possess double-stranded (ds) DNA genomes, with a substantial minority of single-stranded (ss) DNA viruses and only limited presence of RNA viruses. In contrast, in eukaryotes, RNA viruses account for the majority of the virome diversity although ssDNA and dsDNA viruses are common as well. Phylogenomic analysis yields tangible clues for the origins of major classes of eukaryotic viruses and in particular their likely roots in prokaryotes. Specifically, the ancestral genome of positive-strand RNA viruses of eukaryotes might have been assembled de novo from genes derived from prokaryotic retroelements and bacteria although a primordial origin of this class of viruses cannot be ruled out. Different groups of double-stranded RNA viruses derive either from dsRNA bacteriophages or from positive-strand RNA viruses. The eukaryotic ssDNA viruses apparently evolved via a fusion of genes from prokaryotic rolling circle-replicating plasmids and positive-strand RNA viruses. Different families of eukaryotic dsDNA viruses appear to have originated from specific groups of bacteriophages on at least two independent occasions. Polintons, the largest known eukaryotic transposons, predicted to also form virus particles, most likely, were the evolutionary intermediates between bacterial tectiviruses and several groups of eukaryotic dsDNA viruses including the proposed order “Megavirales” that unites diverse families of large and giant viruses. Strikingly, evolution of all classes of eukaryotic viruses appears to have involved fusion between structural and replicative gene modules derived from different sources along with additional acquisitions of diverse genes. PMID:25771806

The N-terminus of RPA large subunit and its spatial position are important for the 5'->3' resection of DNA double-strand breaks.

PubMed

Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

2015-10-15

The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5' strand to generate 3' ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5'->3' directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3'->5' helicase activity and DNA2's 5'->3' ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The N-terminus of RPA large subunit and its spatial position are important for the 5′->3′ resection of DNA double-strand breaks

PubMed Central

Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

2015-01-01

The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5′ strand to generate 3′ ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5′->3′ directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3′->5′ helicase activity and DNA2's 5′->3′ ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. PMID:26227969

The rate of X-ray-induced DNA double-strand break repair in the embryonic mouse brain is unaffected by exposure to 50 Hz magnetic fields.

PubMed

Woodbine, Lisa; Haines, Jackie; Coster, Margaret; Barazzuol, Lara; Ainsbury, Elizabeth; Sienkiewicz, Zenon; Jeggo, Penny

2015-06-01

Following in utero exposure to low dose radiation (10-200 mGy), we recently observed a linear induction of DNA double-strand breaks (DSB) and activation of apoptosis in the embryonic neuronal stem/progenitor cell compartment. No significant induction of DSB or apoptosis was observed following exposure to magnetic fields (MF). In the present study, we exploited this in vivo system to examine whether exposure to MF before and after exposure to 100 mGy X-rays impacts upon DSB repair rates. 53BP1 foci were quantified following combined exposure to radiation and MF in the embryonic neuronal stem/progenitor cell compartment. Embryos were exposed in utero to 50 Hz MF at 300 μT for 3 h before and up to 9 h after exposure to 100 mGy X-rays. Controls included embryos exposed to MF or X-rays alone plus sham exposures. Exposure to MF before and after 100 mGy X-rays did not impact upon the rate of DSB repair in the embryonic neuronal stem cell compartment compared to repair rates following radiation exposure alone. We conclude that in this sensitive system MF do not exert any significant level of DNA damage and do not impede the repair of X-ray induced damage.

Evaluation of the effect of non-B DNA structures on plasmid integrity via accelerated stability studies.

PubMed

Ribeiro, S C; Monteiro, G A; Prazeres, D M F

2009-04-01

Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.

Studies on the formation and stability of triplex DNA using fluorescence correlation spectroscopy.

PubMed

Hu, Hongyan; Huang, Xiangyi; Ren, Jicun

2016-05-01

Triplex DNA has become one of the most useful recognition motifs in the design of new molecular biology tools, therapeutic agents and sophisticated DNA-based nanomaterials because of its direct recognition of natural double-stranded DNA. In this paper, we developed a sensitive and microscale method to study the formation and stability characterization of triplex DNA using fluorescence correlation spectroscopy (FCS). The principle of this method is mainly based on the excellent capacity of FCS for sensitively distinguishing between free single-strand DNA (ssDNA) fluorescent probes and fluorescent probe-double-strand DNA (dsDNA) hybridized complexes. First, we systematically investigated the experimental conditions of triplex DNA formation. Then, we evaluated the equilibrium association constants (K(a)) under different ssDNA probe lengths, composition and pH. Finally, we used FCS to measure the hybridization fraction of a 20-mer perfectly matched ssDNA probe and three single-base mismatched ssDNA probes with 146-mer dsDNA. Our data illustrated that FCS is a useful tool for the direct determination of the thermodynamic parameters of triplex DNA formation and discrimination of a single-base mismatch of triplex DNA without denaturation. Compared with current methods, our method is characterized by high sensitivity, good universality and small sample and reagent requirements. More importantly, our method has the potential to become a platform for triplex DNA research in vitro. Copyright © 2015 John Wiley & Sons, Ltd.

A novel electrochemical biosensor based on dynamic polymerase-extending hybridization for E. coli O157:H7 DNA detection.

PubMed

Wang, Lijiang; Liu, Qingjun; Hu, Zhaoying; Zhang, Yuanfan; Wu, Chunsheng; Yang, Mo; Wang, Ping

2009-05-15

A novel biosensor based on single-stranded DNA (ssDNA) probe functionalized aluminum anodized oxide (AAO) nanopore membranes was demonstrated for Escherichia coli O157:H7 DNA detection. An original and dynamic polymerase-extending (PE) DNA hybridization procedure is proposed, where hybridization happens in the existence of Taq DNA polymerase and dNTPs under controlled reaction temperature. The probe strand would be extended as long as the target DNA strand, then the capability to block the ionic flow in the pores has been prominently enhanced by the double strand complex. We have investigated the variation of ionic conductivity during the fabrication of the film and the hybridization using cyclic voltammetry and impedance spectroscopy. The present approach provides low detection limit for DNA (a few hundreds of pmol), rapid label-free and easy-to-use bacteria detection, which holds the potential for future use in various ss-DNA analyses by integrated into a self-contained biochip.

Characterization of the interplay between DNA repair and CRISPR/Cas9-induced DNA lesions at an endogenous locus

PubMed Central

Bothmer, Anne; Phadke, Tanushree; Barrera, Luis A.; Margulies, Carrie M; Lee, Christina S.; Buquicchio, Frank; Moss, Sean; Abdulkerim, Hayat S.; Selleck, William; Jayaram, Hariharan; Myer, Vic E.; Cotta-Ramusino, Cecilia

2017-01-01

The CRISPR–Cas9 system provides a versatile toolkit for genome engineering that can introduce various DNA lesions at specific genomic locations. However, a better understanding of the nature of these lesions and the repair pathways engaged is critical to realizing the full potential of this technology. Here we characterize the different lesions arising from each Cas9 variant and the resulting repair pathway engagement. We demonstrate that the presence and polarity of the overhang structure is a critical determinant of double-strand break repair pathway choice. Similarly, single nicks deriving from different Cas9 variants differentially activate repair: D10A but not N863A-induced nicks are repaired by homologous recombination. Finally, we demonstrate that homologous recombination is required for repairing lesions using double-stranded, but not single-stranded DNA as a template. This detailed characterization of repair pathway choice in response to CRISPR–Cas9 enables a more deterministic approach for designing research and therapeutic genome engineering strategies. PMID:28067217

MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Obeidat, M; Cline, K; Stathakis, S

Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed smallmore » volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)« less

A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

PubMed

Liu, Ziping; Su, Xingguang

2017-01-15

In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

Repair of DNA double-strand breaks and cell killing by charged particles

NASA Astrophysics Data System (ADS)

Eguchi-Kasai, K.; Murakami, M.; Itsukaichi, H.; Fukutsu, K.; Yatagai, F.; Kanai, T.; Ohara, H.; Sato, K.

It has been suggested that it is not simple double-strand breaks (dsb) but the non-reparable breaks which correlate well with the high biological effectiveness of high LET radiations for cell killing. We have compared the effects of charged particles on cell death in 3 pairs of cell lines which are normal or defective in the repair of DNA dsbs. For the cell lines SL3-147, M10, and SX10 which are deficient in DNA dsb repair, RBE values were close to unity for cell killing induced by charged particles with linear energy transfer (LET) up to 200 keV/mum and were even smaller than unity for the LET region greater than 300 keV/mum. The inactivation cross section (ICS) increased with LET for all 3 pairs. The ICS of dsb repair deficient mutants was always larger than that of their parents for all the LET ranges, but with increasing LET the difference in ICS between the mutant and its parent became smaller. Since a small difference in ICS remained at LET of about 300 keV/mum, dsb repair may still take place at this high LET, even if its role is apparently small. These results suggest that the DNA repair system does not play a major role in protection against the attack of high LET radiations and that a main cause of cell death is non-reparable dsb which are produced at a higher yield compared with low LET radiations. No correlation was observed between DNA content or nuclear area and ICS.

Transcription and DNA Damage: Holding Hands or Crossing Swords?

PubMed

D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio

2017-10-27

Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Kinetic and thermodynamic hysteresis imposed by intercalation of proflavine in ferrocene-modified double-stranded DNA.

PubMed

Gebala, Magdalena; La Mantia, Fabio; Schuhmann, Wolfgang

2013-07-22

Surface-confined immobilized redox species often do not show the expected zero peak separation in slow-scan cyclic voltammograms. This phenomenon is frequently associated to experimental drawbacks and hence neglected. However, a nonzero peak separation, which is common to many electrochemical systems with high structural flexibility, can be rationally assigned to a thermodynamic hysteresis. To study this phenomenon, a surface-confined redox species was used. Specifically, a DNA strand which is tagged with ferrocene (Fc) moieties at its 5' end and its complementary capture probe is thiolated at the 3' end was self-assembled in a monolayer at a Au electrode with the Fc moieties being located at the bottom plane of the double-stranded DNA (dsDNA). The DNA-bound Fc undergoes rapid electron transfer with the electrode surface as evaluated by fast scan cyclic voltammetry. The electron transfer is sensitive to the ion transport along the DNA strands, a phenomenon which is modulated upon specific intercalation of proflavine into surface-bound dsDNA. The electron transfer rate of the Fc(0/+) redox process is influenced by the cationic permselectivity of the DNA monolayer. In addition to the kinetic hindrance, a thermodynamic effect correlated with changes in the activity coefficients of the Fc(0/+) moieties near the gold-dsDNA interface is observed and discussed as source of the observed hysteresis causing the non-zero peak separation in the voltammograms. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Label-Free Nanopore Biosensor for Rapid and Highly Sensitive Cocaine Detection in Complex Biological Fluids.

PubMed

Rauf, Sana; Zhang, Ling; Ali, Asghar; Liu, Yang; Li, Jinghong

2017-02-24

Detection of very low amounts of illicit drugs such as cocaine in clinical fluids like serum continues to be important for many areas in the fight against drug trafficking. Herein, we constructed a label-free nanopore biosensor for rapid and highly sensitive detection of cocaine in human serum and saliva samples based on target-induced strand release strategy. In this bioassay, an aptamer for cocaine was prehybridized with a short complementary DNA. Owing to cocaine specific binding with aptamer, the short DNA strand was displaced from aptamer and translocation of this output DNA through α-hemolysin nanopore generated distinct spike-like current blockages. When plotted in double-logarithmic scale, a linear relationship between target cocaine concentration and output DNA event frequency was obtained in a wide concentration range from 50 nM to 100 μM of cocaine, with the limit of detection down to 50 nM. In addition, this aptamer-based sensor method was successfully applied for cocaine detection in complex biological fluids like human saliva and serum samples with great selectivity. Simple preparation, low cost, rapid, label-free, and real sample detection are the motivating factors for practical application of the proposed biosensor.

Channel Size Conversion of Phi29 DNA-Packaging Nanomotor for Discrimination of Single- and Double-Stranded Nucleic Acids

PubMed Central

Geng, Jia; Wang, Shaoying; Fang, Huaming; Guo, Peixuan

2013-01-01

Nanopores have been utilized to detect the conformation and dynamics of polymers, including DNA and RNA. Biological pores are extremely reproducible at the atomic level with uniform channel sizes. The channel of the bacterial virus phi29 DNA packaging motor is a natural conduit for the transportation of double-stranded DNA (dsDNA), and has the largest diameter among the well-studied biological channels. The larger channel facilitates translocation of dsDNA, and offers more space for further channel modification and conjugation. Interestingly, the relatively large wild type channel, which translocates dsDNA, cannot detect single-stranded nucleic acids (ssDNA or ssRNA) under the current experimental conditions. Herein, we reengineered this motor channel by removing the internal loop segment of the channel. The modification resulted in two classes of channels. One class was the same size as the wild type channel, while the other class had a cross-sectional area about 60% of the wild type. This smaller channel was able to detect the real-time translocation of single stranded nucleic acids at single-molecule level. While the wild type connector exhibited a one-way traffic property with respect to dsDNA translocation, the loop deleted connector was able to translocate ssDNA and ssRNA with equal competencies from both termini. This finding of size alterations in reengineered motor channels expands the potential application of the phi29 DNA packaging motor in nanomedicine, nanobiotechnology, and high-throughput single pore DNA sequencing. PMID:23488809

hMSH5 Facilitates the Repair of Camptothecin-induced Double-strand Breaks through an Interaction with FANCJ*

PubMed Central

Xu, Yang; Wu, Xiling; Her, Chengtao

2015-01-01

Replication stress from stalled or collapsed replication forks is a major challenge to genomic integrity. The anticancer agent camptothecin (CPT) is a DNA topoisomerase I inhibitor that causes fork collapse and double-strand breaks amid DNA replication. Here we report that hMSH5 promotes cell survival in response to CPT-induced DNA damage. Cells deficient in hMSH5 show elevated CPT-induced γ-H2AX and RPA2 foci with concomitant reduction of Rad51 foci, indicative of impaired homologous recombination. In addition, CPT-treated hMSH5-deficient cells exhibit aberrant activation of Chk1 and Chk2 kinases and therefore abnormal cell cycle progression. Furthermore, the hMSH5-FANCJ chromatin recruitment underlies the effects of hMSH5 on homologous recombination and Chk1 activation. Intriguingly, FANCJ depletion desensitizes hMSH5-deficient cells to CPT-elicited cell killing. Collectively, our data point to the existence of a functional interplay between hMSH5 and FANCJ in double-strand break repair induced by replication stress. PMID:26055704

The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation

PubMed Central

Long, Quanxin; Yan, Ran; Hu, Jieli; Cai, Dawei; Kim, Elena S.; Zhang, Hu; Liu, Yuanjie

2017-01-01

Hepadnavirus covalently closed circular (ccc) DNA is the bona fide viral transcription template, which plays a pivotal role in viral infection and persistence. Upon infection, the non-replicative cccDNA is converted from the incoming and de novo synthesized viral genomic relaxed circular (rc) DNA, presumably through employment of the host cell’s DNA repair mechanisms in the nucleus. The conversion of rcDNA into cccDNA requires preparation of the extremities at the nick/gap regions of rcDNA for strand ligation. After screening 107 cellular DNA repair genes, we herein report that the cellular DNA ligase (LIG) 1 and 3 play a critical role in cccDNA formation. Ligase inhibitors or functional knock down/out of LIG1/3 significantly reduced cccDNA production in an in vitro cccDNA formation assay, and in cccDNA-producing cells without direct effect on viral core DNA replication. In addition, transcomplementation of LIG1/3 in the corresponding knock-out or knock-down cells was able to restore cccDNA formation. Furthermore, LIG4, a component in non-homologous end joining DNA repair apparatus, was found to be responsible for cccDNA formation from the viral double stranded linear (dsl) DNA, but not rcDNA. In conclusion, we demonstrate that hepadnaviruses utilize the whole spectrum of host DNA ligases for cccDNA formation, which sheds light on a coherent molecular pathway of cccDNA biosynthesis, as well as the development of novel antiviral strategies for treatment of hepatitis B. PMID:29287110

Transformation of Saccharomyces cerevisiae with UV-irradiated single-stranded plasmid.

PubMed

Zgaga, Z

1991-08-01

UV-irradiated single-stranded replicative plasmids were used to transform different yeast strains. The low doses of UV used in this study (10-75 J/m2) caused a significant decrease in the transforming efficiency of plasmid DNA in the Rad+ strain, while they had no effect on transformation with double-stranded plasmids of comparable size. Neither the rev3 mutation, nor the rad18 or rad52 mutations influenced the efficiency of transformation with irradiated single-stranded plasmid. However, it was found to be decreased in the double rev3 rad52 mutant. Extracellular irradiation of plasmid that contains both URA3 and LEU2 genes (psLU) gave rise to up to 5% Leu- transformants among selected Ura+ ones in the repair-proficient strain. Induction of Leu- transformants was dose-dependent and only partially depressed in the rev3 mutant. These results suggest that both mutagenic and recombinational repair processes operate on UV-damaged single-stranded DNA in yeast.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Developmentally programmed DNA deletion in Tetrahymena thermophila by a transposition-like reaction pathway.

PubMed Central

Saveliev, S V; Cox, M M

1996-01-01

We provide a molecular description of key intermediates in the deletion of two internal eliminated sequences (IES elements), the M and R regions, during macronuclear development in Tetrahymena thermophila. Using a variety of PCR-based methods in vivo, double-strand breaks are detected that are generated by hydrolytic cleavage and correspond closely to the observed chromosomal junctions left behind in the macronuclei. The breaks exhibit a temporal and structural relationship to the deletion reaction that provides strong evidence that they are intermediates in the deletion pathway. Breaks in the individual strands are staggered by 4 bp, producing a four nucleotide 5' extension. Evidence is presented that breaks do not occur simultaneously at both ends. The results are most consistent with a deletion mechanism featuring initiation by double-strand cleavage at one end of the deleted element, followed by transesterification to generate the macronuclear junction on one DNA strand. An adenosine residue is found at all the nucleophilic 3' ends used in the postulated transesterification step. Evidence for the transesterification step is provided by detection of a 3' hydroxyl that would be liberated by such a step at a deletion boundary where no other DNA strand ends are detected. Images PMID:8654384

Genetics Home Reference: Warsaw breakage syndrome

MedlinePlus

... helicase. Helicases are enzymes that attach (bind) to DNA and temporarily unwind the two spiral strands (double helix) of the DNA molecule. This unwinding is necessary for copying ( replicating ) ...

Lack of spontaneous and radiation-induced chromosome breakage at interstitial telomeric sites in murine scid cells.

PubMed

Wong, H-P; Mozdarani, H; Finnegan, C; McIlrath, J; Bryant, P E; Slijepcevic, P

2004-01-01

Interstitial telomeric sites (ITSs) in chromosomes from DNA repair-proficient mammalian cells are sensitive to both spontaneous and radiation-induced chromosome breakage. Exact mechanisms of this chromosome breakage sensitivity are not known. To investigate factors that predispose ITSs to chromosome breakage we used murine scid cells. These cells lack functional DNA-PKcs, an enzyme involved in the repair of DNA double-strand breaks. Interestingly, our results revealed lack of both spontaneous and radiation-induced chromosome breakage at ITSs found in scid chromosomes. Therefore, it is possible that increased sensitivity of ITSs to chromosome breakage is associated with the functional DNA double-strand break repair machinery. To investigate if this is the case we used scid cells in which DNA-PKcs deficiency was corrected. Our results revealed complete disappearance of ITSs in scid cells with functional DNA-PKcs, presumably through chromosome breakage at ITSs, but their unchanged frequency in positive and negative control cells. Therefore, our results indicate that the functional DNA double-strand break machinery is required for elevated sensitivity of ITSs to chromosome breakage. Interestingly, we observed significant differences in mitotic chromosome condensation between scid cells and their counterparts with restored DNA-PKcs activity suggesting that lack of functional DNA-PKcs may cause a defect in chromatin organization. Increased condensation of mitotic chromosomes in the scid background was also confirmed in vivo. Therefore, our results indicate a previously unanticipated role of DNA-PKcs in chromatin organisation, which could contribute to the lack of ITS sensitivity to chromosome breakage in murine scid cells. Copyright 2003 S. Karger AG, Basel

Why double-stranded RNA resists condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.

2014-09-15

The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less

Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

PubMed

Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

2017-12-15

Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

Modular assembly of chimeric phi29 packaging RNAs that support DNA packaging.

PubMed

Fang, Yun; Shu, Dan; Xiao, Feng; Guo, Peixuan; Qin, Peter Z

2008-08-08

The bacteriophage phi29 DNA packaging motor is a protein/RNA complex that can produce strong force to condense the linear-double-stranded DNA genome into a pre-formed protein capsid. The RNA component, called the packaging RNA (pRNA), utilizes magnesium-dependent inter-molecular base-pairing interactions to form ring-shaped complexes. The pRNA is a class of non-coding RNA, interacting with phi29 motor proteins to enable DNA packaging. Here, we report a two-piece chimeric pRNA construct that is fully competent in interacting with partner pRNA to form ring-shaped complexes, in packaging DNA via the motor, and in assembling infectious phi29 virions in vitro. This is the first example of a fully functional pRNA assembled using two non-covalently interacting fragments. The results support the notion of modular pRNA architecture in the phi29 packaging motor.

Modular assembly of chimeric phi29 packaging RNAs that support DNA packaging

PubMed Central

Fang, Yun; Shu, Dan; Xiao, Feng; Guo, Peixuan; Qin, Peter Z.

2008-01-01

The bacteriophage phi29 DNA packaging motor is a protein/RNA complex that can produce strong force to condense the linear-double stranded DNA genome into a pre-formed protein capsid. The RNA component, called the packaging RNA (pRNA), utilizes magnesium-dependent intermolecular base-pairing interactions to form ring-shaped complexes. The pRNA is a class of non-coding RNA, interacting with phi29 motor proteins to enable DNA packaging. Here, we report a 2-piece chimeric pRNA construct that is fully competent in interacting with partner pRNA to form ring-shaped complexes, in packaging DNA via the motor, and in assembling infectious phi29 virions in vitro. This is the first example of a fully functional pRNA assembled using two non-covalently interacting fragments. The results support the notion of modular pRNA architecture in the phi29 packaging motor. PMID:18514064

A homogeneous nucleic acid hybridization assay based on strand displacement.

PubMed Central

Vary, C P

1987-01-01

A homogeneous nucleic acid hybridization assay which is conducted in solution and requires no separation steps is described. The assay is based on the concept of strand displacement. In the strand displacement assay, an RNA "signal strand" is hybridized within a larger DNA strand termed the "probe strand", which is, in turn, complementary to the target nucleic acid of interest. Hybridization of the target nucleic acid with the probe strand ultimately results in displacement of the RNA signal strand. Strand displacement, therefore, causes conversion of the RNA from double to single-stranded form. The single-strand specificity of polynucleotide phosphorylase (EC 2.7.7.8) allows discrimination between double-helical and single-stranded forms of the RNA signal strand. As displacement proceeds, free RNA signal strands are preferentially phosphorolyzed to component nucleoside diphosphates, including adenosine diphosphate. The latter nucleotide is converted to ATP by pyruvate kinase(EC 2.7.1.40). Luciferase catalyzed bioluminescence is employed to measure the ATP generated as a result of strand displacement. Images PMID:3309890

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Cell birth, cell death, cell diversity and DNA breaks: how do they all fit together?

NASA Technical Reports Server (NTRS)

Gilmore, E. C.; Nowakowski, R. S.; Caviness, V. S. Jr; Herrup, K.

2000-01-01

Substantial death of migrating and differentiating neurons occurs within the developing CNS of mice that are deficient in genes required for repair of double-stranded DNA breaks. These findings suggest that large-scale, yet previously unrecognized, double-stranded DNA breaks occur normally in early postmitotic and differentiating neurons. Moreover, they imply that cell death occurs if the breaks are not repaired. The cause and natural function of such breaks remains a mystery; however, their occurrence has significant implications. They might be detected by histological methods that are sensitive to DNA fragmentation and mistakenly interpreted to indicate cell death when no relationship exists. In a broader context, there is now renewed speculation that DNA recombination might be occurring during neuronal development, similar to DNA recombination in developing lymphocytes. If this is true, the target gene(s) of recombination and their significance remain to be determined.

The unusual and dynamic character of PX-DNA

DOE PAGES

Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...

2015-07-15

PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

PubMed

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Single-strand DNA binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs

PubMed Central

Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.

2015-01-01

Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350

A tool for rapid screening of direct DNA agents using reaction rates and relative interaction potency: towards screening environmental contaminants for hazard.

PubMed

Gavina, Jennilee M A; Rubab, Mamoona; Zhang, Huijuan; Zhu, Jiping; Nong, Andy; Feng, Yong-Lai

2011-11-01

DNA damage represents a potential biomarker for determining the exposure risk to chemicals and may provide early warning data for identifying chemical hazards to human health. Here, we have demonstrated a simple chromatography-based method that can be used to rapidly screen for the presence of chemical hazards as well as to determine parameters relevant to hazard assessment. In this proof-of-principle study, a simple in vitro system was used to determine the interaction of pollutants and probable carcinogens, phenyl glycidyl ether (PGE), tetrachlorohydroquinone (Cl(4)HQ), methylmethane sulfonate (MMS), styrene-7,8-oxide (SO), and benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), a metabolite of benzo[a]pyrene (B[a]P), with single- and double-stranded DNA probes. Differences in potency and reaction kinetics were studied for chemical and DNA type. A relative interaction potency equivalency (PEQ) of a chemical was determined by ratio of interaction potency of a chemical to BPDE as the reference chemical in the reaction with single- and double-stranded oligodeoxynucleotides. PEQs were found to be BPDE > PGE > SO > MMS > Cl(4)HQ for single-stranded oligodeoxynucleotides while they were found to be BPDE > PGE > Cl(4)HQ > MMS > SO for double-stranded oligodeoxynucleotides. Kinetics evaluation revealed that BPDE reacted with both DNA probes at a significantly faster rate, as compared to the remaining test chemicals. Equilibrium was reached within an hour for BPDE, but required a minimum of 48 h for the remaining chemicals. First-order rate constants were (1.61 ± 0.2) × 10(-3) s(-1) and (3.18 ± 0.4) × 10(-4) s(-1) for reaction of BPDE with double- and single-stranded DNA, respectively. The remaining chemicals possessed rate constants from 2 to 13 × 10(-6) s(-1) with a relative kinetic order for reaction with DNA of BPDE ≫ MMS > SO > PGE > Cl(4)HQ for ds-DNA and BPDE ≫ SO ≈ Cl(4)HQ ≈ MMS > PGE for ss-DNA. We further found that the reaction potency, defined by dose-response between chemical pollutants and DNA, depends on the form of DNA present for reaction. Noteworthy, we found that relative PEQ did not follow the same kinetic trends. However, our preliminary findings suggest that reaction kinetics, in combination with relative interaction potency, may be a significant parameter that can be used to evaluate the hazard level of environmental pollutants.

ATRX Loss Promotes Tumor Growth and Impairs Non-Homologous End Joining DNA Repair in Glioma

PubMed Central

Koschmann, Carl; Calinescu, Anda-Alexandra; Nunez, Felipe J.; Mackay, Alan; Fazal-Salom, Janet; Thomas, Daniel; Mendez, Flor; Kamran, Neha; Dzaman, Marta; Mulpuri, Lakshman; Krasinkiewicz, Johnathon; Doherty, Robert; Lemons, Rosemary; Brosnan-Cashman, Jackie A.; Li, Youping; Roh, Soyeon; Zhao, Lili; Appelman, Henry; Ferguson, David; Gorbunova, Vera; Meeker, Alan; Jones, Chris; Lowenstein, Pedro R.; Castro, Maria G.

2017-01-01

Recent work in human glioblastoma (GBM) has documented recurrent mutations in the histone chaperone protein ATRX. We developed an animal model of ATRX-deficient GBM and show that loss of ATRX reduces median survival and increases genetic instability. Further, analysis of genome-wide data for human gliomas showed that ATRX mutation is associated with increased mutation rate at the single nucleotide variant (SNV) level. In mouse tumors, ATRX deficiency impairs non-homologous end joining (NHEJ) and increases sensitivity to DNA-damaging agents that induce double-stranded DNA breaks. We propose that ATRX loss results in a genetically unstable tumor, which is more aggressive when left untreated, but is more responsive to double-stranded DNA-damaging agents, resulting in improved overall survival. PMID:26936505

Ionizing radiation, ion transports, and radioresistance of cancer cells

PubMed Central

Huber, Stephan M.; Butz, Lena; Stegen, Benjamin; Klumpp, Dominik; Braun, Norbert; Ruth, Peter; Eckert, Franziska

2013-01-01

The standard treatment of many tumor entities comprises fractionated radiation therapy which applies ionizing radiation to the tumor-bearing target volume. Ionizing radiation causes double-strand breaks in the DNA backbone that result in cell death if the number of DNA double-strand breaks exceeds the DNA repair capacity of the tumor cell. Ionizing radiation reportedly does not only act on the DNA in the nucleus but also on the plasma membrane. In particular, ionizing radiation-induced modifications of ion channels and transporters have been reported. Importantly, these altered transports seem to contribute to the survival of the irradiated tumor cells. The present review article summarizes our current knowledge on the underlying mechanisms and introduces strategies to radiosensitize tumor cells by targeting plasma membrane ion transports. PMID:23966948

Molecular Genetic Characterization of Mutagenesis Using a Highly Sensitive Single-Stranded DNA Reporter System in Budding Yeast.

PubMed

Chan, Kin

2018-01-01

Mutations are permanent alterations to the coding content of DNA. They are starting material for the Darwinian evolution of species by natural selection, which has yielded an amazing diversity of life on Earth. Mutations can also be the fundamental basis of serious human maladies, most notably cancers. In this chapter, I describe a highly sensitive reporter system for the molecular genetic analysis of mutagenesis, featuring controlled generation of long stretches of single-stranded DNA in budding yeast cells. This system is ~100- to ~1000-fold more susceptible to mutation than conventional double-stranded DNA reporters, and is well suited for generating large mutational datasets to investigate the properties of mutagens.

RPA coordinates DNA end resection and prevents formation of DNA hairpins.

PubMed

Chen, Huan; Lisby, Michael; Symington, Lorraine S

2013-05-23

Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

PubMed Central

Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

1998-01-01

Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

If the cap fits, wear it: an overview of telomeric structures over evolution.

PubMed

Fulcher, Nick; Derboven, Elisa; Valuchova, Sona; Riha, Karel

2014-03-01

Genome organization into linear chromosomes likely represents an important evolutionary innovation that has permitted the development of the sexual life cycle; this process has consequently advanced nuclear expansion and increased complexity of eukaryotic genomes. Chromosome linearity, however, poses a major challenge to the internal cellular machinery. The need to efficiently recognize and repair DNA double-strand breaks that occur as a consequence of DNA damage presents a constant threat to native chromosome ends known as telomeres. In this review, we present a comparative survey of various solutions to the end protection problem, maintaining an emphasis on DNA structure. This begins with telomeric structures derived from a subset of prokaryotes, mitochondria, and viruses, and will progress into the typical telomere structure exhibited by higher organisms containing TTAGG-like tandem sequences. We next examine non-canonical telomeres from Drosophila melanogaster, which comprise arrays of retrotransposons. Finally, we discuss telomeric structures in evolution and possible switches between canonical and non-canonical solutions to chromosome end protection.

Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

PubMed Central

Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

2015-01-01

Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

Investigating actinomycin D binding to G-quadruplex, i-motif and double-stranded DNA in 27-nt segment of c-MYC gene promoter.

PubMed

Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood

2016-01-01

c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif. Copyright © 2015 Elsevier B.V. All rights reserved.

Finding of widespread viral and bacterial revolution dsDNA translocation motors distinct from rotation motors by channel chirality and size

PubMed Central

2014-01-01

Background Double-stranded DNA translocation is ubiquitous in living systems. Cell mitosis, bacterial binary fission, DNA replication or repair, homologous recombination, Holliday junction resolution, viral genome packaging and cell entry all involve biomotor-driven dsDNA translocation. Previously, biomotors have been primarily classified into linear and rotational motors. We recently discovered a third class of dsDNA translocation motors in Phi29 utilizing revolution mechanism without rotation. Analogically, the Earth rotates around its own axis every 24 hours, but revolves around the Sun every 365 days. Results Single-channel DNA translocation conductance assay combined with structure inspections of motor channels on bacteriophages P22, SPP1, HK97, T7, T4, Phi29, and other dsDNA translocation motors such as bacterial FtsK and eukaryotic mimiviruses or vaccinia viruses showed that revolution motor is widespread. The force generation mechanism for revolution motors is elucidated. Revolution motors can be differentiated from rotation motors by their channel size and chirality. Crystal structure inspection revealed that revolution motors commonly exhibit channel diameters larger than 3 nm, while rotation motors that rotate around one of the two separated DNA strands feature a diameter smaller than 2 nm. Phi29 revolution motor translocated double- and tetra-stranded DNA that occupied 32% and 64% of the narrowest channel cross-section, respectively, evidencing that revolution motors exhibit channel diameters significantly wider than the dsDNA. Left-handed oriented channels found in revolution motors drive the right-handed dsDNA via anti-chiral interaction, while right-handed channels observed in rotation motors drive the right-handed dsDNA via parallel threads. Tethering both the motor and the dsDNA distal-end of the revolution motor does not block DNA packaging, indicating that no rotation is required for motors of dsDNA phages, while a small-angle left-handed twist of dsDNA that is aligned with the channel could occur due to the conformational change of the phage motor channels from a left-handed configuration for DNA entry to a right-handed configuration for DNA ejection for host cell infection. Conclusions The revolution motor is widespread among biological systems, and can be distinguished from rotation motors by channel size and chirality. The revolution mechanism renders dsDNA void of coiling and torque during translocation of the lengthy helical chromosome, thus resulting in more efficient motor energy conversion. PMID:24940480

Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

PubMed

Giehr, Pascal; Walter, Jörn

2018-01-01

The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

Investigating Deinococcus radiodurans RecA protein filament formation on dsDNA by a real-time single-molecule approach

PubMed Central

Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen

2011-01-01

With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996

Alkaline Comet Assay for Assessing DNA Damage in Individual Cells.

PubMed

Pu, Xinzhu; Wang, Zemin; Klaunig, James E

2015-08-06

Single-cell gel electrophoresis, commonly called a comet assay, is a simple and sensitive method for assessing DNA damage at the single-cell level. It is an important technique in genetic toxicological studies. The comet assay performed under alkaline conditions (pH >13) is considered the optimal version for identifying agents with genotoxic activity. The alkaline comet assay is capable of detecting DNA double-strand breaks, single-strand breaks, alkali-labile sites, DNA-DNA/DNA-protein cross-linking, and incomplete excision repair sites. The inclusion of digestion of lesion-specific DNA repair enzymes in the procedure allows the detection of various DNA base alterations, such as oxidative base damage. This unit describes alkaline comet assay procedures for assessing DNA strand breaks and oxidative base alterations. These methods can be applied in a variety of cells from in vitro and in vivo experiments, as well as human studies. Copyright © 2015 John Wiley & Sons, Inc.

Virus Assembly and Maturation

NASA Astrophysics Data System (ADS)

Johnson, John E.

2004-03-01

We use two techniques to look at three-dimensional virus structure: electron cryomicroscopy (cryoEM) and X-ray crystallography. Figure 1 is a gallery of virus particles whose structures Timothy Baker, one of my former colleagues at Purdue University, used cryoEM to determine. It illustrates the variety of sizes of icosahedral virus particles. The largest virus particle on this slide is the Herpes simplex virus, around 1200Å in diameter; the smallest we examined was around 250Å in diameter. Viruses bear their genomic information either as positive-sense DNA and RNA, double-strand DNA, double-strand RNA, or negative-strand RNA. Viruses utilize the various structure and function "tactics" seen throughout cell biology to replicate at high levels. Many of the biological principles that we consider general were in fact discovered in the context of viruses ...

Creating Directed Double-strand Breaks with the Ref Protein: A Novel Rec A-Dependent Nuclease from Bacteriophage P1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gruenig, Marielle C.; Lu, Duo; Won, Sang Joon

2012-03-16

The bacteriophage P1-encoded Ref protein enhances RecA-dependent recombination in vivo by an unknown mechanism. We demonstrate that Ref is a new type of enzyme; that is, a RecA-dependent nuclease. Ref binds to ss- and dsDNA but does not cleave any DNA substrate until RecA protein and ATP are added to form RecA nucleoprotein filaments. Ref cleaves only where RecA protein is bound. RecA functions as a co-nuclease in the Ref/RecA system. Ref nuclease activity can be limited to the targeted strands of short RecA-containing D-loops. The result is a uniquely programmable endonuclease activity, producing targeted double-strand breaks at any chosenmore » DNA sequence in an oligonucleotide-directed fashion. We present evidence indicating that cleavage occurs in the RecA filament groove. The structure of the Ref protein has been determined to 1.4 {angstrom} resolution. The core structure, consisting of residues 77-186, consists of a central 2-stranded {beta}-hairpin that is sandwiched between several {alpha}-helical and extended loop elements. The N-terminal 76 amino acid residues are disordered; this flexible region is required for optimal activity. The overall structure of Ref, including several putative active site histidine residues, defines a new subclass of HNH-family nucleases. We propose that enhancement of recombination by Ref reflects the introduction of directed, recombinogenic double-strand breaks.« less

The energetic basis of the DNA double helix: a combined microcalorimetric approach

PubMed Central

Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.

2015-01-01

Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541

An insertion approach electrochemical aptasensor for mucin 1 detection based on exonuclease-assisted target recycling.

PubMed

Wen, Wei; Hu, Rong; Bao, Ting; Zhang, Xiuhua; Wang, Shengfu

2015-09-15

In this work, a sensitive exonuclease-assisted amplification electrochemical aptasensor through insertion approach was developed for the detection of mucin 1 (MUC 1). In order to construct the aptasensor, 6-Mercapto-1-hexanol (MCH) was used to block partial sites of gold electrode (GE), followed by thiolated capture probe self-assembled on GE. Methylene blue (MB) labeled aptamer hybridized with capture probe at both ends to form double-strand DNA. For the MB labeled termini was close to GE, the electrochemical response was remarkable. The presence of MUC 1 caused the dissociation of the double-strand DNA owing to the specific recognition of aptamer to MUC 1. Then exonuclease I (Exo I) selectively digested the aptamer which bound with MUC 1, the released MUC 1 participated new binding with the rest aptamer. Insertion approach improved the reproducibility and Exo I-catalyzed target recycling improved the sensitivity of the aptasensor significantly. Under optimal experimental conditions, the proposed aptasensor had a good linear correlation ranged from 10 pM to 1 μM with a detection limit of 4 pM (Signal to Noise ratio, S/N=3). The strategy had great potential for the simple and sensitive detection of other cancer markers. Copyright © 2015 Elsevier B.V. All rights reserved.

Biochemical evidence for Ku-independent backup pathways of NHEJ.

PubMed

Wang, Huichen; Perrault, Ange Ronel; Takeda, Yoshihiko; Qin, Wei; Wang, Hongyan; Iliakis, George

2003-09-15

Cells of higher eukaryotes process within minutes double strand breaks (DSBs) in their genome using a non-homologous end joining (NHEJ) apparatus that engages DNA-PKcs, Ku, DNA ligase IV, XRCC4 and other as of yet unidentified factors. Although chemical inhibition, or mutation, in any of these factors delays processing, cells ultimately remove the majority of DNA DSBs using an alternative pathway operating with an order of magnitude slower kinetics. This alternative pathway is active in mutants deficient in genes of the RAD52 epistasis group and frequently joins incorrect ends. We proposed, therefore, that it reflects an alternative form of NHEJ that operates as a backup (B-NHEJ) to the DNA-PK-dependent (D-NHEJ) pathway, rather than homology directed repair of DSBs. The present study investigates the role of Ku in the coordination of these pathways using as a model end joining of restriction endonuclease linearized plasmid DNA in whole cell extracts. Efficient, error-free, end joining observed in such in vitro reactions is strongly inhibited by anti-Ku antibodies. The inhibition requires DNA-PKcs, despite the fact that Ku efficiently binds DNA ends in the presence of antibodies, or in the absence of DNA-PKcs. Strong inhibition of DNA end joining is also mediated by wortmannin, an inhibitor of DNA-PKcs, in the presence but not in the absence of Ku, and this inhibition can be rescued by pre-incubating the reaction with double stranded oligonucleotides. The results are compatible with a role of Ku in directing end joining to a DNA-PK dependent pathway, mediated by efficient end binding and productive interactions with DNA-PKcs. On the other hand, efficient end joining is observed in extracts of cells lacking DNA-PKcs, as well as in Ku-depleted extracts in line with the operation of alternative pathways. Extracts depleted of Ku and DNA-PKcs rejoin blunt ends, as well as homologous ends with 3' or 5' protruding single strands with similar efficiency, but addition of Ku suppresses joining of blunt ends and homologous ends with 3' overhangs. We propose that the affinity of Ku for DNA ends, particularly when cooperating with DNA-PKcs, suppresses B-NHEJ by quickly and efficiently binding DNA ends and directing them to D-NHEJ for rapid joining. A chromatin-based model of DNA DSB rejoining accommodating biochemical and genetic results is presented and deviations between in vitro and in vivo results discussed.

Biochemical evidence for Ku-independent backup pathways of NHEJ

PubMed Central

Wang, Huichen; Perrault, Ange Ronel; Takeda, Yoshihiko; Qin, Wei; Wang, Hongyan; Iliakis, George

2003-01-01

Cells of higher eukaryotes process within minutes double strand breaks (DSBs) in their genome using a non-homologous end joining (NHEJ) apparatus that engages DNA-PKcs, Ku, DNA ligase IV, XRCC4 and other as of yet unidentified factors. Although chemical inhibition, or mutation, in any of these factors delays processing, cells ultimately remove the majority of DNA DSBs using an alternative pathway operating with an order of magnitude slower kinetics. This alternative pathway is active in mutants deficient in genes of the RAD52 epistasis group and frequently joins incorrect ends. We proposed, therefore, that it reflects an alternative form of NHEJ that operates as a backup (B-NHEJ) to the DNA-PK-dependent (D-NHEJ) pathway, rather than homology directed repair of DSBs. The present study investigates the role of Ku in the coordination of these pathways using as a model end joining of restriction endonuclease linearized plasmid DNA in whole cell extracts. Efficient, error-free, end joining observed in such in vitro reactions is strongly inhibited by anti-Ku antibodies. The inhibition requires DNA-PKcs, despite the fact that Ku efficiently binds DNA ends in the presence of antibodies, or in the absence of DNA-PKcs. Strong inhibition of DNA end joining is also mediated by wortmannin, an inhibitor of DNA-PKcs, in the presence but not in the absence of Ku, and this inhibition can be rescued by pre-incubating the reaction with double stranded oligonucleotides. The results are compatible with a role of Ku in directing end joining to a DNA-PK dependent pathway, mediated by efficient end binding and productive interactions with DNA-PKcs. On the other hand, efficient end joining is observed in extracts of cells lacking DNA-PKcs, as well as in Ku-depleted extracts in line with the operation of alternative pathways. Extracts depleted of Ku and DNA-PKcs rejoin blunt ends, as well as homologous ends with 3′ or 5′ protruding single strands with similar efficiency, but addition of Ku suppresses joining of blunt ends and homologous ends with 3′ overhangs. We propose that the affinity of Ku for DNA ends, particularly when cooperating with DNA-PKcs, suppresses B-NHEJ by quickly and efficiently binding DNA ends and directing them to D-NHEJ for rapid joining. A chromatin-based model of DNA DSB rejoining accommodating biochemical and genetic results is presented and deviations between in vitro and in vivo results discussed. PMID:12954774

XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair.

PubMed

Craxton, A; Somers, J; Munnur, D; Jukes-Jones, R; Cain, K; Malewicz, M

2015-06-01

Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protein associated with DNA-PKcs-c9orf142. Computer-based modelling of c9orf142 predicted a structure very similar to XRCC4, hence we have named c9orf142-XLS (XRCC4-like small protein). Depletion of c9orf142/XLS in cells impaired DSB repair consistent with a defect in NHEJ. Furthermore, c9orf142/XLS interacted with other core NHEJ factors. These results demonstrate the existence of a new component of the NHEJ DNA repair pathway in mammalian cells.

Mechanisms of DNA Packaging by Large Double-Stranded DNA Viruses

PubMed Central

Rao, Venigalla B.; Feiss, Michael

2016-01-01

Translocation of viral double-stranded DNA (dsDNA) into the icosahedral prohead shell is catalyzed by TerL, a motor protein that has ATPase, endonuclease, and translocase activities. TerL, following endonucleolytic cleavage of immature viral DNA concatemer recognized by TerS, assembles into a pentameric ring motor on the prohead’s portal vertex and uses ATP hydrolysis energy for DNA translocation. TerL’s N-terminal ATPase is connected by a hinge to the C-terminal endonuclease. Inchworm models propose that modest domain motions accompanying ATP hydrolysis are amplified, through changes in electrostatic interactions, into larger movements of the C-terminal domain bound to DNA. In phage φ29, four of the five TerL subunits sequentially hydrolyze ATP, each powering translocation of 2.5 bp. After one viral genome is encapsidated, the internal pressure signals termination of packaging and ejection of the motor. Current focus is on the structures of packaging complexes and the dynamics of TerL during DNA packaging, endonuclease regulation, and motor mechanics. PMID:26958920

Double-stranded DNA organization in bacteriophage heads: an alternative toroid-based model.

PubMed Central

Hud, N V

1995-01-01

Studies of the organization of double-stranded DNA within bacteriophage heads during the past four decades have produced a wealth of data. However, despite the presentation of numerous models, the true organization of DNA within phage heads remains unresolved. The observations of toroidal DNA structures in electron micrographs of phage lysates have long been cited as support for the organization of DNA in a spool-like fashion. This particular model, like all other models, has not been found to be consistent will all available data. Recently we proposed that DNA within toroidal condensates produced in vitro is organized in a manner significantly different from that suggested by the spool model. This new toroid model has allowed the development of an alternative model for DNA organization within bacteriophage heads that is consistent with a wide range of biophysical data. Here we propose that bacteriophage DNA is packaged in a toroid that is folded into a highly compact structure. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 PMID:8534805

Photosensitization by iodinated DNA minor groove binding ligands: Evaluation of DNA double-strand break induction and repair.

PubMed

Briggs, Benjamin; Ververis, Katherine; Rodd, Annabelle L; Foong, Laura J L; Silva, Fernando M Da; Karagiannis, Tom C

2011-05-03

Iodinated DNA minor groove binding bibenzimidazoles represent a unique class of UVA photosensitizer and their extreme photopotency has been previously characterized. Earlier studies have included a comparison of three isomers, referred to as ortho-, meta- and para-iodoHoechst, which differ only in the location of the iodine substituent in the phenyl ring of the bibenzimidazole. DNA breakage and clonogenic survival studies in human erythroleukemic K562 cells have highlighted the higher photo-efficiency of the ortho-isomer (subsequently designated UV(A)Sens) compared to the meta- and para-isomers. In this study, the aim was to compare the induction and repair of DNA double-strand breaks induced by the three isomers in K562 cells. Further, we examined the effects of the prototypical broad-spectrum histone deacetylase inhibitor, Trichostatin A, on ortho-iodoHoechst/UVA-induced double-strand breaks in K562 cells. Using γH2AX as a molecular marker of the DNA lesions, our findings indicate a disparity in the induction and particularly, in the repair kinetics of double-strand breaks for the three isomers. The accumulation of γH2AX foci induced by the meta- and para-isomers returned to background levels within 24 and 48 h, respectively; the number of γH2AX foci induced by ortho-iodoHoechst remained elevated even after incubation for 96 h post-irradiation. These findings provide further evidence that the extreme photopotency of ortho-iodoHoechst is due to not only to the high quantum yield of dehalogenation, but also to the severity of the DNA lesions which are not readily repaired. Finally, our findings which indicate that Trichostatin A has a remarkable potentiating effect on ortho-iodoHoechst/UVA-induced DNA lesions are encouraging, particularly in the context of cutaneous T-cell lymphoma, for which a histone deacetylase inhibitor is already approved for therapy. This finding prompts further evaluation of the potential of combination therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

Genes and Junk in Plant Mitochondria—Repair Mechanisms and Selection

PubMed Central

Christensen, Alan C.

2014-01-01

Plant mitochondrial genomes have very low mutation rates. In contrast, they also rearrange and expand frequently. This is easily understood if DNA repair in genes is accomplished by accurate mechanisms, whereas less accurate mechanisms including nonhomologous end joining or break-induced replication are used in nongenes. An important question is how different mechanisms of repair predominate in coding and noncoding DNA, although one possible mechanism is transcription-coupled repair (TCR). This work tests the predictions of TCR and finds no support for it. Examination of the mutation spectra and rates in genes and junk reveals what DNA repair mechanisms are available to plant mitochondria, and what selective forces act on the repair products. A model is proposed that mismatches and other DNA damages are repaired by converting them into double-strand breaks (DSBs). These can then be repaired by any of the DSB repair mechanisms, both accurate and inaccurate. Natural selection will eliminate coding regions repaired by inaccurate mechanisms, accounting for the low mutation rates in genes, whereas mutations, rearrangements, and expansions generated by inaccurate repair in noncoding regions will persist. Support for this model includes the structure of the mitochondrial mutS homolog in plants, which is fused to a double-strand endonuclease. The model proposes that plant mitochondria do not distinguish a damaged or mismatched DNA strand from the undamaged strand, they simply cut both strands and perform homology-based DSB repair. This plant-specific strategy for protecting future generations from mitochondrial DNA damage has the side effect of genome expansions and rearrangements. PMID:24904012

Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

PubMed

Cheng, Xin; Ivessa, Andreas S

2012-10-01

Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

Bioelectrochemical sensing of promethazine with bamboo-type multiwalled carbon nanotubes dispersed in calf-thymus double stranded DNA.

PubMed

Primo, Emiliano N; Oviedo, M Belén; Sánchez, Cristián G; Rubianes, María D; Rivas, Gustavo A

2014-10-01

We report the quantification of promethazine (PMZ) using glassy carbon electrodes (GCE) modified with bamboo-like multi-walled carbon nanotubes (bCNT) dispersed in double stranded calf-thymus DNA (dsDNA) (GCE/bCNT-dsDNA). Cyclic voltammetry measurements demonstrated that PMZ presents a thin film-confined redox behavior at GCE/bCNT-dsDNA, opposite to the irreversibly-adsorbed behavior obtained at GCE modified with bCNT dispersed in ethanol (GCE/bCNT). Differential pulse voltammetry-adsorptive stripping with medium exchange experiments performed with GCE/bCNT-dsDNA and GCE modified with bCNTs dispersed in single-stranded calf-thymus DNA (ssDNA) confirmed that the interaction between PMZ and bCNT-dsDNA is mainly hydrophobic. These differences are due to the intercalation of PMZ within the dsDNA that supports the bCNTs, as evidenced from the bathochromic displacement of UV-Vis absorption spectra of PMZ and quantum dynamics calculations at DFTB level. The efficient accumulation of PMZ at GCE/bCNT-dsDNA made possible its sensitive quantification at nanomolar levels (sensitivity: (3.50±0.05)×10(8) μA·cm(-2)·M(-1) and detection limit: 23 nM). The biosensor was successfully used for the determination of PMZ in a pharmaceutical product with excellent correlation. Copyright © 2014 Elsevier B.V. All rights reserved.

Protein dynamics of human RPA and RAD51 on ssDNA during assembly and disassembly of the RAD51 filament

PubMed Central

Ma, Chu Jian; Gibb, Bryan; Kwon, YoungHo; Sung, Patrick; Greene, Eric C.

2017-01-01

Homologous recombination (HR) is a crucial pathway for double-stranded DNA break (DSB) repair. During the early stages of HR, the newly generated DSB ends are processed to yield long single-stranded DNA (ssDNA) overhangs, which are quickly bound by replication protein A (RPA). RPA is then replaced by the DNA recombinase Rad51, which forms extended helical filaments on the ssDNA. The resulting nucleoprotein filament, known as the presynaptic complex, is responsible for pairing the ssDNA with homologous double-stranded DNA (dsDNA), which serves as the template to guide DSB repair. Here, we use single-molecule imaging to visualize the interplay between human RPA (hRPA) and human RAD51 during presynaptic complex assembly and disassembly. We demonstrate that ssDNA-bound hRPA can undergo facilitated exchange, enabling hRPA to undergo rapid exchange between free and ssDNA-bound states only when free hRPA is present in solution. Our results also indicate that the presence of free hRPA inhibits RAD51 filament nucleation, but has a lesser impact upon filament elongation. This finding suggests that hRPA exerts important regulatory influence over RAD51 and may in turn affect the properties of the assembled RAD51 filament. These experiments provide an important basis for further investigations into the regulation of human presynaptic complex assembly. PMID:27903895

Site- and strand-specific nicking of DNA by fusion proteins derived from MutH and I-SceI or TALE repeats.

PubMed

Gabsalilow, Lilia; Schierling, Benno; Friedhoff, Peter; Pingoud, Alfred; Wende, Wolfgang

2013-04-01

Targeted genome engineering requires nucleases that introduce a highly specific double-strand break in the genome that is either processed by homology-directed repair in the presence of a homologous repair template or by non-homologous end-joining (NHEJ) that usually results in insertions or deletions. The error-prone NHEJ can be efficiently suppressed by 'nickases' that produce a single-strand break rather than a double-strand break. Highly specific nickases have been produced by engineering of homing endonucleases and more recently by modifying zinc finger nucleases (ZFNs) composed of a zinc finger array and the catalytic domain of the restriction endonuclease FokI. These ZF-nickases work as heterodimers in which one subunit has a catalytically inactive FokI domain. We present two different approaches to engineer highly specific nickases; both rely on the sequence-specific nicking activity of the DNA mismatch repair endonuclease MutH which we fused to a DNA-binding module, either a catalytically inactive variant of the homing endonuclease I-SceI or the DNA-binding domain of the TALE protein AvrBs4. The fusion proteins nick strand specifically a bipartite recognition sequence consisting of the MutH and the I-SceI or TALE recognition sequences, respectively, with a more than 1000-fold preference over a stand-alone MutH site. TALE-MutH is a programmable nickase.

Ataxia telangiectasia mutated (ATM) interacts with p400 ATPase for an efficient DNA damage response.

PubMed

Smith, Rebecca J; Savoian, Matthew S; Weber, Lauren E; Park, Jeong Hyeon

2016-11-04

Ataxia telangiectasia mutated (ATM) and TRRAP proteins belong to the phosphatidylinositol 3-kinase-related kinase family and are involved in DNA damage repair and chromatin remodeling. ATM is a checkpoint kinase that is recruited to sites of DNA double-strand breaks where it phosphorylates a diverse range of proteins that are part of the chromatin and DNA repair machinery. As an integral subunit of the TRRAP-TIP60 complexes, p400 ATPase is a chromatin remodeler that is also targeted to DNA double-strand break sites. While it is understood that DNA binding transcriptional activators recruit p400 ATPase into a regulatory region of the promoter, how p400 recognises and moves to DNA double-strand break sites is far less clear. Here we investigate a possibility whether ATM serves as a shuttle to deliver p400 to break sites. Our data indicate that p400 co-immunoprecipitates with ATM independently of DNA damage state and that the N-terminal domain of p400 is vital for this interaction. Heterologous expression studies using Sf9 cells revealed that the ATM-p400 complex can be reconstituted without other mammalian bridging proteins. Overexpression of ATM-interacting p400 regions in U2OS cells induced dominant negative effects including the inhibition of both DNA damage repair and cell proliferation. Consistent with the dominant negative effect, the stable expression of an N-terminal p400 fragment showed a decrease in the association of p400 with ATM, but did not alter the association of p400 with TRRAP. Taken together, our findings suggest that a protein-protein interaction between ATM and p400 ATPase occurs independently of DNA damage and contributes to efficient DNA damage response and repair.

Sequence selective capture, release and analysis of DNA using a magnetic microbead-assisted toehold-mediated DNA strand displacement reaction.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Linacre, Adrian; Ellis, Amanda V

2014-07-21

This paper reports on the modification of magnetic beads with oligonucleotide capture probes with a specially designed pendant toehold (overhang) aimed specifically to capture double-stranded PCR products. After capture, the PCR products were selectively released from the magnetic beads by means of a toehold-mediated strand displacement reaction using short artificial oligonucleotide triggers and analysed using capillary electrophoresis. The approach was successfully shown on two genes widely used in human DNA genotyping, namely human c-fms (macrophage colony-stimulating factor) proto-oncogene for the CSF-1 receptor (CSF1PO) and amelogenin.

Development of novel decoy oligonucleotides: advantages of circular dumb-bell decoy.

PubMed

Tomita, Naruya; Tomita, Tetsuya; Yuyama, Kazuhiko; Tougan, Takahiro; Tajima, Tsuyoshi; Ogihara, Toshio; Morishita, Ryuichi

2003-04-01

The inhibition of specific transcription regulatory proteins is a novel approach to regulate gene expression. The transcriptional activities of DNA binding proteins can be inhibited by the use of double-stranded oligonucleotides (ODNs) that compete for binding to their specific target sequences in promoters and enhancers. Transfection of this cis-element double-stranded ODN, referred to as decoy ODN, has been reported to be a powerful tool that provides a new class of anti-gene strategies to gene therapy and permits examination of specific gene regulation. We have demonstrated the usefulness of this decoy ODN strategy in animal models of restenosis, myocardial infarction, glomerulonephritis and rheumatoid arthritis. However, one of the major limitations of decoy ODN technology is the rapid degradation of phosphodiester ODNs by intracellular nucleases. To date, several different types of double-stranded decoy ODNs have been developed to overcome this issue. Circular dumb-bell (CD) double-stranded decoy ODNs that were developed to resolve this issue have attracted a high level of interest. In this review, the applications of decoy ODN strategy and the advantages of modified CD double-stranded decoy ODNs will be discussed.

Electron transfer of plurimodified DNA SAMs.

PubMed

Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

2007-07-17

An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

Synthesis of mouse centromere-targeted polyamides and physico-chemical studies of their interaction with the target double-stranded DNA.

PubMed

Nozeret, Karine; Bonan, Marc; Yarmoluk, Serguiy M; Novopashina, Darya S; Boutorine, Alexandre S

2015-09-01

Synthetic minor groove-binding pyrrole-imidazole polyamides labeled by fluorophores are promising candidates for fluorescence imaging of double-stranded DNA in isolated chromosomes or fixed and living cells. We synthesized nine hairpin and two head-to-head tandem polyamides targeting repeated sequences from mouse major satellites. Their interaction with synthetic target dsDNA has been studied by physico-chemical methods in vitro before and after coupling to various fluorophores. Great variability in affinities and fluorescence properties reveals a conclusion that these properties do not only rely on recognition rules, but also on other known and unknown structural factors. Individual testing of each probe is needed before cellular applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gene interactions in the DNA damage-response pathway identified by genome-wide RNA-interference analysis of synthetic lethality

PubMed Central

van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel

2004-01-01

Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288

Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

NASA Astrophysics Data System (ADS)

Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

2003-11-01

Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

Characterization of the interaction of yeast enolase with polynucleotides.

PubMed

al-Giery, A G; Brewer, J M

1992-09-23

Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.

Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism.

PubMed

Awate, Sanket; Brosh, Robert M

2017-06-08

Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.

Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism

PubMed Central

Awate, Sanket; Brosh, Robert M.

2017-01-01

Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies. PMID:28594346

TDP2 suppresses chromosomal translocations induced by DNA topoisomerase II during gene transcription.

PubMed

Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W

2017-08-10

DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.

RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.

PubMed

Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing

2017-01-27

DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

Enzyme-adenylate structure of a bacterial ATP-dependent DNA ligase with a minimized DNA-binding surface.

PubMed

Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder

2014-11-01

DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.

Protocol for the use of a rapid real-time PCR method for the detection of HIV-1 proviral DNA using double-stranded primer.

PubMed

Pau, Chou-Pong; Wells, Susan K; Granade, Timothy C

2012-01-01

This chapter describes a real-time PCR method for the detection of HIV-1 proviral DNA in whole blood samples using a novel double-stranded primer system. The assay utilizes a simple commercially available DNA extraction method and a rapid and easy-to-perform real-time PCR protocol to consistently detect a minimum of four copies of HIV-1 group M proviral DNA in as little as 90 min after sample (whole blood) collection. Co-amplification of the human RNase P gene serves as an internal control to monitor the efficiency of both the DNA extraction and amplification. Once the assay is validated properly, it may be suitable as an alternative confirmation test for HIV-1 infections in a variety of HIV testing venues including the mother-to-child transmission testing sites, clinics, and diagnostic testing centers.

APOBEC3 Cytidine Deaminases in Double-Strand DNA Break Repair and Cancer Promotion

PubMed Central

Nowarski, Roni; Kotler, Moshe

2013-01-01

High frequency of cytidine to thymidine conversions were identified in the genome of several types of cancer cells. In breast cancer cells these mutations are clustered in long DNA regions associated with ssDNA, double-strand DNA breaks (DSBs) and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs and clustered mutations. PMID:23598277

8-Methoxypsoralen photoinduced plasmid-chromosome recombination in Saccharomyces cerevisiae using a centromeric vector.

PubMed Central

Meira, L B; Henriques, J A; Magaña-Schwencke, N

1995-01-01

The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218

Magnetic-field-induced DNA strand breaks in brain cells of the rat.

PubMed Central

Lai, Henry; Singh, Narendra P

2004-01-01

In previous research, we found that rats acutely (2 hr) exposed to a 60-Hz sinusoidal magnetic field at intensities of 0.1-0.5 millitesla (mT) showed increases in DNA single- and double-strand breaks in their brain cells. Further research showed that these effects could be blocked by pretreating the rats with the free radical scavengers melatonin and N-tert-butyl-alpha-phenylnitrone, suggesting the involvement of free radicals. In the present study, effects of magnetic field exposure on brain cell DNA in the rat were further investigated. Exposure to a 60-Hz magnetic field at 0.01 mT for 24 hr caused a significant increase in DNA single- and double-strand breaks. Prolonging the exposure to 48 hr caused a larger increase. This indicates that the effect is cumulative. In addition, treatment with Trolox (a vitamin E analog) or 7-nitroindazole (a nitric oxide synthase inhibitor) blocked magnetic-field-induced DNA strand breaks. These data further support a role of free radicals on the effects of magnetic fields. Treatment with the iron chelator deferiprone also blocked the effects of magnetic fields on brain cell DNA, suggesting the involvement of iron. Acute magnetic field exposure increased apoptosis and necrosis of brain cells in the rat. We hypothesize that exposure to a 60-Hz magnetic field initiates an iron-mediated process (e.g., the Fenton reaction) that increases free radical formation in brain cells, leading to DNA strand breaks and cell death. This hypothesis could have an important implication for the possible health effects associated with exposure to extremely low-frequency magnetic fields in the public and occupational environments. PMID:15121512

DNA double strand break induction in yeast.

PubMed

Kiefer, J; Egenolf, R; Ikpeme, S E

2002-01-01

The induction of DNA double strand breaks (DSBs) by accelerated heavy ions was systematically measured in diploid yeast cells. Particles were provided by the accelerators at GSI, Darmstadt, and HMI, Berlin. DNA was separated using pulsed field gel electrophoresis and the intensity of the largest bands used to determine the loss of molecular weight. Since the DNA content of each chromosome is exactly known absolute values for DSB induction can be measured without calibration procedures. Ions used range from protons to uranium with LET values between 2 and about 15,000 keV.micron-1. Induction cross sections increase in the lower LET region approaching a plateau around 200 keV.micron-1. With higher LET values the dependence can no longer be described by a common curve with each ion showing a specific behaviour. With very heavy particles the influence of the penumbra becomes obvious: cross sections decrease with LET because of the reduced penumbra extensions. Classical target theory would predict cross sections to follow a simple saturation function which is not substantiated by the data. Track structure analysis as introduced by Butts and Katz in 1967 is also not able to predict the experimental results. A semi-empirical fit indicates a linear-quadratic dependence of induction cross sections on LET up to about 1000 keV.micron-1. RBE for DSB induction rises above unity reaching a maximum of about 2.5 around 200 keV.micron-1. This is different from many experiments in mammalian cells and is presumably due to differences in chromatin structure since yeast cells seem to lack a functional III histone.

Transposition of an intron in yeast mitochondria requires a protein encoded by that intron.

PubMed

Macreadie, I G; Scott, R M; Zinn, A R; Butow, R A

1985-06-01

The optional 1143 bp intron in the yeast mitochondrial 21S rRNA gene (omega +) is nearly quantitatively inserted in genetic crosses into 21S rRNA alleles that lack it (omega -). The intron contains an open reading frame that can encode a protein of 235 amino acids, but no function has been ascribed to this sequence. We previously found an in vivo double-strand break in omega - DNA at or close to the intron insertion site only in zygotes of omega + X omega - crosses that appears with the same kinetics as intron insertion. We now show that mutations in the intron open reading frame that would alter the translation product simultaneously inhibit nonreciprocal omega recombination and the in vivo double-strand break in omega - DNA. These results provide evidence that the open reading frame encodes a protein required for intron transposition and support the role of the double-strand break in the process.

The CAF-1 and Hir Histone Chaperones Associate with Sites of Meiotic Double-Strand Breaks in Budding Yeast

PubMed Central

Brachet, Elsa; Béneut, Claire; Serrentino, Maria-Elisabetta; Borde, Valérie

2015-01-01

In the meiotic prophase, programmed DNA double-strand breaks (DSB) are introduced along chromosomes to promote homolog pairing and recombination. Although meiotic DSBs usually occur in nucleosome-depleted, accessible regions of chromatin, their repair by homologous recombination takes place in a nucleosomal environment. Nucleosomes may represent an obstacle for the recombination machinery and their timely eviction and reincorporation into chromatin may influence the outcome of recombination, for instance by stabilizing recombination intermediates. Here we show in budding yeast that nucleosomes flanking a meiotic DSB are transiently lost during recombination, and that specific histone H3 chaperones, CAF-1 and Hir, are mobilized at meiotic DSBs. However, the absence of these chaperones has no effect on meiotic recombination, suggesting that timely histone reincorporation following their eviction has no influence on the recombination outcome, or that redundant pathways are activated. This study is the first example of the involvement of histone H3 chaperones at naturally occurring, developmentally programmed DNA double-strand breaks. PMID:25938567

Evaluation of the efficacy of radiation-modifying compounds using γH2AX as a molecular marker of DNA double-strand breaks.

PubMed

Mah, Li-Jeen; Orlowski, Christian; Ververis, Katherine; Vasireddy, Raja S; El-Osta, Assam; Karagiannis, Tom C

2011-01-25

Radiation therapy is a widely used therapeutic approach for cancer. To improve the efficacy of radiotherapy there is an intense interest in combining this modality with two broad classes of compounds, radiosensitizers and radioprotectors. These either enhance tumour-killing efficacy or mitigate damage to surrounding non-malignant tissue, respectively. Radiation exposure often results in the formation of DNA double-strand breaks, which are marked by the induction of H2AX phosphorylation to generate γH2AX. In addition to its essential role in DDR signalling and coordination of double-strand break repair, the ability to visualize and quantitate γH2AX foci using immunofluorescence microscopy techniques enables it to be exploited as an indicator of therapeutic efficacy in a range of cell types and tissues. This review will explore the emerging applicability of γH2AX as a marker for monitoring the effectiveness of radiation-modifying compounds.

Evaluation of the efficacy of radiation-modifying compounds using γH2AX as a molecular marker of DNA double-strand breaks

PubMed Central

2011-01-01

Radiation therapy is a widely used therapeutic approach for cancer. To improve the efficacy of radiotherapy there is an intense interest in combining this modality with two broad classes of compounds, radiosensitizers and radioprotectors. These either enhance tumour-killing efficacy or mitigate damage to surrounding non-malignant tissue, respectively. Radiation exposure often results in the formation of DNA double-strand breaks, which are marked by the induction of H2AX phosphorylation to generate γH2AX. In addition to its essential role in DDR signalling and coordination of double-strand break repair, the ability to visualize and quantitate γH2AX foci using immunofluorescence microscopy techniques enables it to be exploited as an indicator of therapeutic efficacy in a range of cell types and tissues. This review will explore the emerging applicability of γH2AX as a marker for monitoring the effectiveness of radiation-modifying compounds. PMID:21261999

Neoplastic cell transformation by high-LET radiation - Molecular mechanisms

NASA Technical Reports Server (NTRS)

Yang, Tracy Chui-Hsu; Craise, Laurie M.; Tobias, Cornelius A.; Mei, Man-Tong

1989-01-01

Quantitative data were collected on dose-response curves of cultured mouse-embryo cells (C3H10T1/2) irradiated with heavy ions of various charges and energies. Results suggests that two breaks formed on DNA within 80 A may cause cell transformation and that two DNA breaks formed within 20 A may be lethal. From results of experiments with restriction enzymes which produce DNA damages at specific sites, it was found that DNA double strand breaks are important primary lesions for radiogenic cell transformation and that blunt-ended double-strand breaks can form lethal as well as transformational damages due to misrepair or incomplete repair in the cell. The RBE-LET relationship for high-LET radiation is similar to that for HGPRT locus mutation, chromosomal deletion, and cell transformation, indicating that common lesions may be involved in these radiation effects.

Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

PubMed

Fernández-Sierra, Mónica; Quiñones, Edwin

2015-03-15

Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

Strand displacement synthesis by yeast DNA polymerase ε

PubMed Central

Ganai, Rais A.; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik

2016-01-01

DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3′–5′ exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo. We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3′–5′ exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5′ end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. PMID:27325747

Left-handed Z-DNA: structure and function

NASA Technical Reports Server (NTRS)

Herbert, A.; Rich, A.

1999-01-01

Z-DNA is a high energy conformer of B-DNA that forms in vivo during transcription as a result of torsional strain generated by a moving polymerase. An understanding of the biological role of Z-DNA has advanced with the discovery that the RNA editing enzyme double-stranded RNA adenosine deaminase type I (ADAR1) has motifs specific for the Z-DNA conformation. Editing by ADAR1 requires a double-stranded RNA substrate. In the cases known, the substrate is formed by folding an intron back onto the exon that is targeted for modification. The use of introns to direct processing of exons requires that editing occurs before splicing. Recognition of Z-DNA by ADAR1 may allow editing of nascent transcripts to be initiated immediately after transcription, ensuring that editing and splicing are performed in the correct sequence. Structural characterization of the Z-DNA binding domain indicates that it belongs to the winged helix-turn-helix class of proteins and is similar to the globular domain of histone-H5.

XPD-dependent activation of apoptosis in response to triplex-induced DNA damage

PubMed Central

Kaushik Tiwari, Meetu; Rogers, Faye A.

2013-01-01

DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. Using triplex-forming oligonucleotides to synthetically create altered helical distortions, we have determined that pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Here, we show that triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of γH2AX foci. XPD was subsequently recruited to the triplex-induced double strand breaks and co-localized with γH2AX at the damage site. Furthermore, phosphorylation of H2AX tyrosine 142 was found to stimulate the signaling pathway of XPD-dependent apoptosis. We suggest that this mechanism may play an active role in minimizing genomic instability induced by naturally occurring noncanonical structures, perhaps protecting against cancer initiation. PMID:23913414

Nucleotide excision repair-dependent DNA double-strand break formation and ATM signaling activation in mammalian quiescent cells.

PubMed

Wakasugi, Mitsuo; Sasaki, Takuma; Matsumoto, Megumi; Nagaoka, Miyuki; Inoue, Keiko; Inobe, Manabu; Horibata, Katsuyoshi; Tanaka, Kiyoji; Matsunaga, Tsukasa

2014-10-10

Histone H2A variant H2AX is phosphorylated at Ser(139) in response to DNA double-strand break (DSB) and single-stranded DNA (ssDNA) formation. UV light dominantly induces pyrimidine photodimers, which are removed from the mammalian genome by nucleotide excision repair (NER). We previously reported that in quiescent G0 phase cells, UV induces ATR-mediated H2AX phosphorylation plausibly caused by persistent ssDNA gap intermediates during NER. In this study, we have found that DSB is also generated following UV irradiation in an NER-dependent manner and contributes to an earlier fraction of UV-induced H2AX phosphorylation. The NER-dependent DSB formation activates ATM kinase and triggers the accumulation of its downstream factors, MRE11, NBS1, and MDC1, at UV-damaged sites. Importantly, ATM-deficient cells exhibited enhanced UV sensitivity under quiescent conditions compared with asynchronously growing conditions. Finally, we show that the NER-dependent H2AX phosphorylation is also observed in murine peripheral T lymphocytes, typical nonproliferating quiescent cells in vivo. These results suggest that in vivo quiescent cells may suffer from NER-mediated secondary DNA damage including ssDNA and DSB. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Selections From the AIDSinfo Glossary | NIH MedlinePlus the Magazine

MedlinePlus

... is responsible for most HIV infections throughout the world, whereas HIV-2 is found primarily in West Africa. Retrovirus A type of virus that stores its genetic information in a single-stranded RNA molecule, and constructs a double-stranded DNA version ...

An amplified graphene oxide-based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling for bioassays.

PubMed

Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai

2013-04-15

An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.

Effect of DNA type on response of DNA biosensor for carcinogens

NASA Astrophysics Data System (ADS)

Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

2013-11-01

Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

PubMed

Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

2016-08-02

Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

DNA origami compliant nanostructures with tunable mechanical properties.

PubMed

Zhou, Lifeng; Marras, Alexander E; Su, Hai-Jun; Castro, Carlos E

2014-01-28

DNA origami enables fabrication of precise nanostructures by programming the self-assembly of DNA. While this approach has been used to make a variety of complex 2D and 3D objects, the mechanical functionality of these structures is limited due to their rigid nature. We explore the fabrication of deformable, or compliant, objects to establish a framework for mechanically functional nanostructures. This compliant design approach is used in macroscopic engineering to make devices including sensors, actuators, and robots. We build compliant nanostructures by utilizing the entropic elasticity of single-stranded DNA (ssDNA) to locally bend bundles of double-stranded DNA into bent geometries whose curvature and mechanical properties can be tuned by controlling the length of ssDNA strands. We demonstrate an ability to achieve a wide range of geometries by adjusting a few strands in the nanostructure design. We further developed a mechanical model to predict both geometry and mechanical properties of our compliant nanostructures that agrees well with experiments. Our results provide a basis for the design of mechanically functional DNA origami devices and materials.

Switching bonds in a DNA gel: an all-DNA vitrimer.

PubMed

Romano, Flavio; Sciortino, Francesco

2015-02-20

We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.

Characterization of Two Virulent Phages of Lactobacillus plantarum

PubMed Central

Briggiler Marcó, Mariángeles; Garneau, Josiane E.; Tremblay, Denise; Quiberoni, Andrea

2012-01-01

We characterized two Lactobacillus plantarum virulent siphophages, ATCC 8014-B1 (B1) and ATCC 8014-B2 (B2), previously isolated from corn silage and anaerobic sewage sludge, respectively. Phage B2 infected two of the eight L. plantarum strains tested, while phage B1 infected three. Phage adsorption was highly variable depending on the strain used. Phage defense systems were found in at least two L. plantarum strains, LMG9211 and WCSF1. The linear double-stranded DNA genome of the pac-type phage B1 had 38,002 bp, a G+C content of 47.6%, and 60 open reading frames (ORFs). Surprisingly, the phage B1 genome has 97% identity with that of Pediococcus damnosus phage clP1 and 77% identity with that of L. plantarum phage JL-1; these phages were isolated from sewage and cucumber fermentation, respectively. The double-stranded DNA (dsDNA) genome of the cos-type phage B2 had 80,618 bp, a G+C content of 36.9%, and 127 ORFs with similarities to those of Bacillus and Lactobacillus strains as well as phages. Some phage B2 genes were similar to ORFs from L. plantarum phage LP65 of the Myoviridae family. Additionally, 6 tRNAs were found in the phage B2 genome. Protein analysis revealed 13 (phage B1) and 9 (phage B2) structural proteins. To our knowledge, this is the first report describing such high identity between phage genomes infecting different genera of lactic acid bacteria. PMID:23042172

Entropy in DNA Double-Strand Break, Detection and Signaling

NASA Astrophysics Data System (ADS)

Zhang, Yang; Schindler, Christina; Heermann, Dieter

2014-03-01

In biology, the term entropy is often understood as a measure of disorder - a restrictive interpretation that can even be misleading. Recently it has become clearer and clearer that entropy, contrary to conventional wisdom, can help to order and guide biological processes in living cells. DNA double-strand breaks (DSBs) are among the most dangerous lesions and efficient damage detection and repair is essential for organism viability. However, what remains unknown is the precise mechanism of targeting the site of damage within billions of intact nucleotides and a crowded nuclear environment, a process which is often referred to as recruitment or signaling. Here we show that the change in entropy associated with inflicting a DSB facilitates the recruitment of damage sensor proteins. By means of computational modeling we found that higher mobility and local chromatin structure accelerate protein association at DSB ends. We compared the effect of different chromatin architectures on protein dynamics and concentrations in the vicinity of DSBs, and related these results to experiments on repair in heterochromatin. Our results demonstrate how entropy contributes to a more efficient damage detection. We identify entropy as the physical basis for DNA double-strand break signaling.

Small Rad51 and Dmc1 Complexes Often Co-occupy Both Ends of a Meiotic DNA Double Strand Break

PubMed Central

Brown, M. Scott; Grubb, Jennifer; Zhang, Annie; Rust, Michael J.; Bishop, Douglas K.

2015-01-01

The Eukaryotic RecA-like proteins Rad51 and Dmc1 cooperate during meiosis to promote recombination between homologous chromosomes by repairing programmed DNA double strand breaks (DSBs). Previous studies showed that Rad51 and Dmc1 form partially overlapping co-foci. Here we show these Rad51-Dmc1 co-foci are often arranged in pairs separated by distances of up to 400 nm. Paired co-foci remain prevalent when DSBs are dramatically reduced or when strand exchange or synapsis is blocked. Super-resolution dSTORM microscopy reveals that individual foci observed by conventional light microscopy are often composed of two or more substructures. The data support a model in which the two tracts of ssDNA formed by a single DSB separate from one another by distances of up to 400 nm, with both tracts often bound by one or more short (about 100 nt) Rad51 filaments and also by one or more short Dmc1 filaments. PMID:26719980

UVA-induced DNA double-strand breaks result from the repair of clustered oxidative DNA damages

PubMed Central

Greinert, R.; Volkmer, B.; Henning, S.; Breitbart, E. W.; Greulich, K. O.; Cardoso, M. C.; Rapp, Alexander

2012-01-01

UVA (320–400 nm) represents the main spectral component of solar UV radiation, induces pre-mutagenic DNA lesions and is classified as Class I carcinogen. Recently, discussion arose whether UVA induces DNA double-strand breaks (dsbs). Only few reports link the induction of dsbs to UVA exposure and the underlying mechanisms are poorly understood. Using the Comet-assay and γH2AX as markers for dsb formation, we demonstrate the dose-dependent dsb induction by UVA in G1-synchronized human keratinocytes (HaCaT) and primary human skin fibroblasts. The number of γH2AX foci increases when a UVA dose is applied in fractions (split dose), with a 2-h recovery period between fractions. The presence of the anti-oxidant Naringin reduces dsb formation significantly. Using an FPG-modified Comet-assay as well as warm and cold repair incubation, we show that dsbs arise partially during repair of bi-stranded, oxidative, clustered DNA lesions. We also demonstrate that on stretched chromatin fibres, 8-oxo-G and abasic sites occur in clusters. This suggests a replication-independent formation of UVA-induced dsbs through clustered single-strand breaks via locally generated reactive oxygen species. Since UVA is the main component of solar UV exposure and is used for artificial UV exposure, our results shine new light on the aetiology of skin cancer. PMID:22941639

Chromosomal Integrity after UV Irradiation Requires FANCD2-Mediated Repair of Double Strand Breaks

PubMed Central

Federico, María Belén; Vallerga, María Belén; Radl, Analía; Paviolo, Natalia Soledad; Bocco, José Luis; Di Giorgio, Marina; Soria, Gastón; Gottifredi, Vanesa

2016-01-01

Fanconi Anemia (FA) is a rare autosomal recessive disorder characterized by hypersensitivity to inter-strand crosslinks (ICLs). FANCD2, a central factor of the FA pathway, is essential for the repair of double strand breaks (DSBs) generated during fork collapse at ICLs. While lesions different from ICLs can also trigger fork collapse, the contribution of FANCD2 to the resolution of replication-coupled DSBs generated independently from ICLs is unknown. Intriguingly, FANCD2 is readily activated after UV irradiation, a DNA-damaging agent that generates predominantly intra-strand crosslinks but not ICLs. Hence, UV irradiation is an ideal tool to explore the contribution of FANCD2 to the DNA damage response triggered by DNA lesions other than ICL repair. Here we show that, in contrast to ICL-causing agents, UV radiation compromises cell survival independently from FANCD2. In agreement, FANCD2 depletion does not increase the amount of DSBs generated during the replication of UV-damaged DNA and is dispensable for UV-induced checkpoint activation. Remarkably however, FANCD2 protects UV-dependent, replication-coupled DSBs from aberrant processing by non-homologous end joining, preventing the accumulation of micronuclei and chromatid aberrations including non-homologous chromatid exchanges. Hence, while dispensable for cell survival, FANCD2 selectively safeguards chromosomal stability after UV-triggered replication stress. PMID:26765540

Chromosomal Integrity after UV Irradiation Requires FANCD2-Mediated Repair of Double Strand Breaks.

PubMed

Federico, María Belén; Vallerga, María Belén; Radl, Analía; Paviolo, Natalia Soledad; Bocco, José Luis; Di Giorgio, Marina; Soria, Gastón; Gottifredi, Vanesa

2016-01-01

Fanconi Anemia (FA) is a rare autosomal recessive disorder characterized by hypersensitivity to inter-strand crosslinks (ICLs). FANCD2, a central factor of the FA pathway, is essential for the repair of double strand breaks (DSBs) generated during fork collapse at ICLs. While lesions different from ICLs can also trigger fork collapse, the contribution of FANCD2 to the resolution of replication-coupled DSBs generated independently from ICLs is unknown. Intriguingly, FANCD2 is readily activated after UV irradiation, a DNA-damaging agent that generates predominantly intra-strand crosslinks but not ICLs. Hence, UV irradiation is an ideal tool to explore the contribution of FANCD2 to the DNA damage response triggered by DNA lesions other than ICL repair. Here we show that, in contrast to ICL-causing agents, UV radiation compromises cell survival independently from FANCD2. In agreement, FANCD2 depletion does not increase the amount of DSBs generated during the replication of UV-damaged DNA and is dispensable for UV-induced checkpoint activation. Remarkably however, FANCD2 protects UV-dependent, replication-coupled DSBs from aberrant processing by non-homologous end joining, preventing the accumulation of micronuclei and chromatid aberrations including non-homologous chromatid exchanges. Hence, while dispensable for cell survival, FANCD2 selectively safeguards chromosomal stability after UV-triggered replication stress.

Efficiencies of induction of DNA double strand breaks in solution by photoabsorption at phosphorus and platinum.

PubMed

Maeda, Munetoshi; Kobayashi, Katsumi; Hieda, Kotaro

2004-01-01

This paper aims at determining and comparing the cross sections and quantum yields for DNA strand break induction by the Auger effect at the K-shell of phosphorus and at the LIII-shell of platinum. Using synchrotron radiation, free and Pt-bound pBR322 plasmid DNA were irradiated in solution with monochromatic X-rays, the energies of which were 2.153 and 2.147 keV, corresponding to "on" and "below" the phosphorus K-shell photoabsorption, and 11.566 and 11.542 keV for "above" and "below" the L(III)-shell photoabsorption of platinum, respectively. To suppress indirect effects by hydroxyl radicals, DMSO (1M) was used as a scavenger. The inner-shell photoabsorption of phosphorus and of platinum significantly increased the induction of DNA double strand breaks (DSB), whereas it had little effect on single strand break (SSB) induction. The quantum yields for the induction of DSB were calculated to be 0.017 and 1.13, in the case of phosphorus and platinum, respectively. CONCLSIONS: The value of the quantum yield for the DSB induction of platinum was about 66-fold larger than that for the phosphorus. These results clearly demonstrate that the quantum yield of DSB depends upon the magnitude of the Auger cascade.

Alterations in ATR in nasal NK/T-cell lymphoma and chronic active Epstein-Barr virus infection.

PubMed

Liu, Angen; Takakuwa, Tetsuya; Luo, Wen-Juan; Fujita, Shigeki; Aozasa, Katsuyuki

2006-07-01

Nasal natural killer (NK)/T-cell lymphoma (NKTCL) and chronic active Epstein-Barr virus infection (CAEBV) are relatively frequent, especially in Asia, and are poor in prognosis. Both diseases are proliferative diseases of NK/T cells that show highly complicated karyotypes, suggesting the involvement of chromosomal instability. ATR is an important gene for DNA damage response and chromosomal stability. To evaluate the role of ATR gene alterations in the pathogenesis of NKTCL and CAEBV, the whole coding region of the ATR gene was examined in cell lines derived from NKTCL and CAEBV, as well as tumor samples from patients. ATR alterations were detected in two of eight NKTCL and in one of three CAEBV lines. Most aberrant transcripts observed were deletions resulting from aberrant splicing. ATR alterations were also detected in four of 10 NKTCL clinical samples. Both NKTCL and CAEBV cell lines with ATR alterations showed a delay or abrogation in repair of ionizing radiation-induced DNA double-strand breaks and ultraviolet-induced DNA single-strand breaks, and both exhibited a defect in p53 accumulation. These findings show that alterations in the ATR gene result in an abnormal response to DNA double-strand break and single-strand break repair, suggesting a role for ATR gene alterations in NKTCL lymphomagenesis.

Characterization of the human SNM1A and SNM1B/Apollo DNA repair exonucleases.

PubMed

Sengerová, Blanka; Allerston, Charles K; Abu, Mika; Lee, Sook Y; Hartley, Janet; Kiakos, Konstantinos; Schofield, Christopher J; Hartley, John A; Gileadi, Opher; McHugh, Peter J

2012-07-27

Human SNM1A and SNM1B/Apollo have both been implicated in the repair of DNA interstrand cross-links (ICLs) by cellular studies, and SNM1B is also required for telomere protection. Here, we describe studies on the biochemical characterization of the SNM1A and SNM1B proteins. The results reveal some fundamental differences in the mechanisms of the two proteins. Both SNM1A and SNM1B digest double-stranded and single-stranded DNA with a 5'-to-3' directionality in a reaction that is stimulated by divalent cations, and both nucleases are inhibited by the zinc chelator o-phenanthroline. We find that SNM1A has greater affinity for single-stranded DNA over double-stranded DNA that is not observed with SNM1B. Although both proteins demonstrate a low level of processivity on low molecular weight DNA oligonucleotide substrates, when presented with high molecular weight DNA, SNM1A alone is rendered much more active, being capable of digesting kilobase-long stretches of DNA. Both proteins can digest past ICLs induced by the non-distorting minor groove cross-linking agent SJG-136, albeit with SNM1A showing a greater capacity to achieve this. This is consistent with the proposal that SNM1A and SNM1B might exhibit some redundancy in ICL repair. Together, our work establishes differences in the substrate selectivities of SNM1A and SNM1B that are likely to be relevant to their in vivo roles and which might be exploited in the development of selective inhibitors.

Characterization of biochemical properties of Bacillus subtilis RecQ helicase.

PubMed

Qin, Wei; Liu, Na-Nv; Wang, Lijun; Zhou, Min; Ren, Hua; Bugnard, Elisabeth; Liu, Jie-Lin; Zhang, Lin-Hu; Vendôme, Jeremie; Hu, Jin-Shan; Xi, Xu Guang

2014-12-01

RecQ family helicases function as safeguards of the genome. Unlike Escherichia coli, the Gram-positive Bacillus subtilis bacterium possesses two RecQ-like homologues, RecQ[Bs] and RecS, which are required for the repair of DNA double-strand breaks. RecQ[Bs] also binds to the forked DNA to ensure a smooth progression of the cell cycle. Here we present the first biochemical analysis of recombinant RecQ[Bs]. RecQ[Bs] binds weakly to single-stranded DNA (ssDNA) and blunt-ended double-stranded DNA (dsDNA) but strongly to forked dsDNA. The protein exhibits a DNA-stimulated ATPase activity and ATP- and Mg(2+)-dependent DNA helicase activity with a 3' → 5' polarity. Molecular modeling shows that RecQ[Bs] shares high sequence and structure similarity with E. coli RecQ. Surprisingly, RecQ[Bs] resembles the truncated Saccharomyces cerevisiae Sgs1 and human RecQ helicases more than RecQ[Ec] with regard to its enzymatic activities. Specifically, RecQ[Bs] unwinds forked dsDNA and DNA duplexes with a 3'-overhang but is inactive on blunt-ended dsDNA and 5'-overhung duplexes. Interestingly, RecQ[Bs] unwinds blunt-ended DNA with structural features, including nicks, gaps, 5'-flaps, Kappa joints, synthetic replication forks, and Holliday junctions. We discuss these findings in the context of RecQ[Bs]'s possible functions in preserving genomic stability. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination.

PubMed

Surtees, Jennifer A; Alani, Eric

2006-07-14

Genetic studies in Saccharomyces cerevisiae predict that the mismatch repair (MMR) factor MSH2-MSH3 binds and stabilizes branched recombination intermediates that form during single strand annealing and gene conversion. To test this model, we constructed a series of DNA substrates that are predicted to form during these recombination events. We show in an electrophoretic mobility shift assay that S. cerevisiae MSH2-MSH3 specifically binds branched DNA substrates containing 3' single-stranded DNA and that ATP stimulates its release from these substrates. Chemical footprinting analyses indicate that MSH2-MSH3 specifically binds at the double-strand/single-strand junction of branched substrates, alters its conformation and opens up the junction. Therefore, MSH2-MSH3 binding to its substrates creates a unique nucleoprotein structure that may signal downstream steps in repair that include interactions with MMR and nucleotide excision repair factors.

Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

ERIC Educational Resources Information Center

Ito, Takashi

2008-01-01

This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

Recombineering: A Homologous Recombination-Based Method of Genetic Engineering

PubMed Central

Sharan, Shyam K.; Thomason, Lynn C.; Kuznetsov, Sergey G.; Court, Donald L.

2009-01-01

Recombineering is an efficient method of in vivo genetic engineering applicable to chromosomal as well as episomal replicons in E. coli. This method circumvents the need for most standard in vitro cloning techniques. Recombineering allows construction of DNA molecules with precise junctions without constraints being imposed by restriction enzyme site location. Bacteriophage homologous recombination proteins catalyze these recombineering reactions using double- and single-strand linear DNA substrates, so-called targeting constructs, introduced by electroporation. Gene knockouts, deletions and point mutations are readily made, gene tags can be inserted, and regions of bacterial artificial chromosomes (BACs) or the E. coli genome can be subcloned by gene retrieval using recombineering. Most of these constructs can be made within about a week's time. PMID:19180090

Effect of halogenated pyrimidines on readiosensitivity of E.coli.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaplan, H S; Smith, K C; Tomlin, P A

1962-01-01

The incorporation of halogcnated thymine and thymidine analogs into E.coli DNA during log-phase growth, though relatively nontoxic per se, was associated with a significant increase in sensitivity of the bacterial cells to x and uv irradiation. Although incorporation was linear with time from 2 to 10 hours of incubation, significant radiosensitization was not observed untiI 4 hours (l7% replacement of thymine by 5-bromouracil) and was maximal at the end of log-phase growth (40 to 50% replacement), despite a further increment of incorporation during stationary phase, Labeling of only one strand of the DNA double helix was sufficient to confer atmore » least half-maximal radiosensitization. The implications of the data for clinical radiotherapy are discussed.« less

Properties of internalization factors contributing to the uptake of extracellular DNA into tumor-initiating stem cells of mouse Krebs-2 cell line.

PubMed

Dolgova, Evgeniya V; Potter, Ekaterina A; Proskurina, Anastasiya S; Minkevich, Alexandra M; Chernych, Elena R; Ostanin, Alexandr A; Efremov, Yaroslav R; Bayborodin, Sergey I; Nikolin, Valeriy P; Popova, Nelly A; Kolchanov, Nikolay A; Bogachev, Sergey S

2016-05-25

Previously, we demonstrated that poorly differentiated cells of various origins, including tumor-initiating stem cells present in the ascites form of mouse cancer cell line Krebs-2, are capable of naturally internalizing both linear double-stranded DNA and circular plasmid DNA. The method of co-incubating Krebs-2 cells with extracellular plasmid DNA (pUC19) or TAMRA-5'-dUTP-labeled polymerase chain reaction (PCR) product was used. It was found that internalized plasmid DNA isolated from Krebs-2 can be transformed into competent Escherichia coli cells. Thus, the internalization processes taking place in the Krebs-2 cell subpopulation have been analyzed and compared, as assayed by E. coli colony formation assay (plasmid DNA) and cytofluorescence (TAMRA-DNA). We showed that extracellular DNA both in the form of plasmid DNA and a PCR product is internalized by the same subpopulation of Krebs-2 cells. We found that the saturation threshold for Krebs-2 ascites cells is 0.5 μg DNA/10(6) cells. Supercoiled plasmid DNA, human high-molecular weight DNA, and 500 bp PCR fragments are internalized into the Krebs-2 tumor-initiating stem cells via distinct, non-competing internalization pathways. Under our experimental conditions, each cell may harbor 340-2600 copies of intact plasmid material, or up to 3.097 ± 0.044×10(6) plasmid copies (intact or not), as detected by quantitative PCR. The internalization dynamics of extracellular DNA, copy number of the plasmids taken up by the cells, and competition between different types of double-stranded DNA upon internalization into tumor-initiating stem cells of mouse ascites Krebs-2 have been comprehensively analyzed. Investigation of the extracellular DNA internalization into tumor-initiating stem cells is an important part of understanding their properties and possible destruction mechanisms. For example, a TAMRA-labeled DNA probe may serve as an instrument to develop a target for the therapy of cancer, aiming at elimination of tumor stem cells, as well as developing a straightforward test system for the quantification of poorly differentiated cells, including tumor-initiating stem cells, in the bulk tumor sample (biopsy or surgery specimen).

TH-CD-201-11: Optimizing the Response and Cost of a DNA Double-Strand Break Dosimeter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Obeidat, M; Cline, K; Stathakis, S

Purpose: A DNA double-strand break (DSB) dosimeter was developed to measure the biological effect of radiation. The goal here is to refine the fabrication method of this dosimeter to reproducibly create a low coefficient of variation (CoV) and reduce the cost for the dosimeter. Methods: Our dosimeter consists of 4 kilo-base pair DNA strands (labeled on one end with biotin and on the other with fluorescein) attached to streptavidin magnetic beads. The final step of the DNA dosimeter fabrication is to suspend these attached beads in phosphate-buffered saline (PBS). The amount of PBS used to suspend the attached beads andmore » the relative volume of the DNA strands to the beads both affect the CoV and dosimeter cost. We diluted the beads attached with DNA in different volumes of PBS (100, 200, and 400 µL) to create different concentrations of the DNA dosimeter. Then we irradiated these dosimeters (50 µL samples) in a water-equivalent plastic phantom at 25 and 50 Gy (three samples per dose) and calculated the CoV for each dosimeter concentration. Also, we used different masses of DNA strands (1, 2, 8, 16, 24, and 32 µg) to attach to the same volume of magnetic beads (100 µL) to explore how this affects the cost of the dosimeter. Results: The lowest CoV was produced for the highest concentration of dosimeter (100 µL of PBS), which created CoV of 2.0 and 1.0% for 25 and 50 Gy, respectively. We found that the lowest production cost for the dosimeter occurs by attaching 16 µg of DNA strands with 100 µL of beads. Conclusion: : We optimized the fabrication of the DNA dosimeter to produce low CoV and cost, but we still need to explore ways to further improve the dosimeter for use at lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)« less

Mouse embryonic stem cells, but not somatic cells, predominantly use homologous recombination to repair double-strand DNA breaks.

PubMed

Tichy, Elisia D; Pillai, Resmi; Deng, Li; Liang, Li; Tischfield, Jay; Schwemberger, Sandy J; Babcock, George F; Stambrook, Peter J

2010-11-01

Embryonic stem (ES) cells give rise to all cell types of an organism. Since mutations at this embryonic stage would affect all cells and be detrimental to the overall health of an organism, robust mechanisms must exist to ensure that genomic integrity is maintained. To test this proposition, we compared the capacity of murine ES cells to repair DNA double-strand breaks with that of differentiated cells. Of the 2 major pathways that repair double-strand breaks, error-prone nonhomologous end joining (NHEJ) predominated in mouse embryonic fibroblasts, whereas the high fidelity homologous recombinational repair (HRR) predominated in ES cells. Microhomology-mediated end joining, an emerging repair pathway, persisted at low levels in all cell types examined. The levels of proteins involved in HRR and microhomology-mediated end joining were highly elevated in ES cells compared with mouse embryonic fibroblasts, whereas those for NHEJ were quite variable, with DNA Ligase IV expression low in ES cells. The half-life of DNA Ligase IV protein was also low in ES cells. Attempts to increase the abundance of DNA Ligase IV protein by overexpression or inhibition of its degradation, and thereby elevate NHEJ in ES cells, were unsuccessful. When ES cells were induced to differentiate, however, the level of DNA Ligase IV protein increased, as did the capacity to repair by NHEJ. The data suggest that preferential use of HRR rather than NHEJ may lend ES cells an additional layer of genomic protection and that the limited levels of DNA Ligase IV may account for the low level of NHEJ activity.

Quencher-free fluorescence strategy for detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification.

PubMed

Liu, Haisheng; Ma, Changbei; Zhou, Meijuan; Chen, Hanchun; He, Hailun; Wang, Kemin

2016-11-01

This work demonstrates a novel method for DNA methyltransferase (MTase) activity detection with a quencher-free molecular beacon (MB) probe based on exonuclease (Exo) III-assisted signal amplification. In the presence of Dam MTase and DpnI endonuclease, the elaborately designed hairpin substrate (MB1) was cleaved into two parts (part A and part B). Exo III can then digest part A and release a single-stranded target of the 2-aminopurine-labeled MB (MB2). Subsequently, the MB2 can hybridize with its target to form a double-stranded structure with a protruding 3'-terminus and then trigger the digestion of MB2 by Exo III. During the digestion of MB2, the 2-aminopurine is separated from the DNA strands and released free in solution, inducing an increase of the fluorescent signal. Owing to the presence of a recessed 3'-terminus in the formed double-stranded DNA, Exo III-assisted recyclable cleavage of MB2 was achieved. Therefore, an amplified fluorescence signal was observed. Under the optimized conditions, Dam MTase can be detected in the range of 0.2-40 units/mL with a limit of detection of 0.2 units/mL and good selectivity. Furthermore, the present assay can be used for screening potential DNA MTase inhibitors. Graphical Abstract A quencher-free fluorescence assay for sensitive detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification is reported.

Perspectives on the combination of radiotherapy and targeted therapy with DNA repair inhibitors in the treatment of pancreatic cancer

PubMed Central

Yang, Shih-Hung; Kuo, Ting-Chun; Wu, Hsu; Guo, Jhe-Cyuan; Hsu, Chiun; Hsu, Chih-Hung; Tien, Yu-Wen; Yeh, Kun-Huei; Cheng, Ann-Lii; Kuo, Sung-Hsin

2016-01-01

Pancreatic cancer is highly lethal. Current research that combines radiation with targeted therapy may dramatically improve prognosis. Cancerous cells are characterized by unstable genomes and activation of DNA repair pathways, which are indicated by increased phosphorylation of numerous factors, including H2AX, ATM, ATR, Chk1, Chk2, DNA-PKcs, Rad51, and Ku70/Ku80 heterodimers. Radiotherapy causes DNA damage. Cancer cells can be made more sensitive to the effects of radiation (radiosensitization) through inhibition of DNA repair pathways. The synergistic effects, of two or more combined non-lethal treatments, led to co-administration of chemotherapy and radiosensitization in BRCA-defective cells and patients, with promising results. ATM/Chk2 and ATR/Chk1 pathways are principal regulators of cell cycle arrest, following DNA double-strand or single-strand breaks. DNA double-stranded breaks activate DNA-dependent protein kinase, catalytic subunit (DNA-PKcs). It forms a holoenzyme with Ku70/Ku80 heterodimers, called DNA-PK, which catalyzes the joining of nonhomologous ends. This is the primary repair pathway utilized in human cells after exposure to ionizing radiation. Radiosensitization, induced by inhibitors of ATM, ATR, Chk1, Chk2, Wee1, PP2A, or DNA-PK, has been demonstrated in preclinical pancreatic cancer studies. Clinical trials are underway. Development of agents that inhibit DNA repair pathways to be clinically used in combination with radiotherapy is warranted for the treatment of pancreatic cancer. PMID:27621574

Nontoxic concentration of DNA-PK inhibitor NU7441 radio-sensitizes lung tumor cells with little effect on double strand break repair.

PubMed

Sunada, Shigeaki; Kanai, Hideki; Lee, Younghyun; Yasuda, Takeshi; Hirakawa, Hirokazu; Liu, Cuihua; Fujimori, Akira; Uesaka, Mitsuru; Okayasu, Ryuichi

2016-09-01

High-linear energy transfer (LET) heavy ions have been increasingly employed as a useful alternative to conventional photon radiotherapy. As recent studies suggested that high LET radiation mainly affects the nonhomologous end-joining (NHEJ) pathway of DNA double strand break (DSB) repair, we further investigated this concept by evaluating the combined effect of an NHEJ inhibitor (NU7441) at a non-toxic concentration and carbon ions. NU7441-treated non-small cell lung cancer (NSCLC) A549 and H1299 cells were irradiated with X-rays and carbon ions (290 MeV/n, 50 keV/μm). Cell survival was measured by clonogenic assay. DNA DSB repair, cell cycle distribution, DNA fragmentation and cellular senescence induction were studied using a flow cytometer. Senescence-associated protein p21 was detected by western blotting. In the present study, 0.3 μM of NU7441, nontoxic to both normal and tumor cells, caused a significant radio-sensitization in tumor cells exposed to X-rays and carbon ions. This concentration did not seem to cause inhibition of DNA DSB repair but induced a significant G2/M arrest, which was particularly emphasized in p53-null H1299 cells treated with NU7441 and carbon ions. In addition, the combined treatment induced more DNA fragmentation and a higher degree of senescence in H1299 cells than in A549 cells, indicating that DNA-PK inhibitor contributes to various modes of cell death in a p53-dependent manner. In summary, NSCLC cells irradiated with carbon ions were radio-sensitized by a low concentration of DNA-PK inhibitor NU7441 through a strong G2/M cell cycle arrest. Our findings may contribute to further effective radiotherapy using heavy ions. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

PubMed

Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

2010-08-01

We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, J; Park, S; Jeong, J

Purpose: In particle therapy and radiobiology, the investigation of mechanisms leading to the death of target cancer cells induced by ionising radiation is an active field of research. Recently, several studies based on Monte Carlo simulation codes have been initiated in order to simulate physical interactions of ionising particles at cellular scale and in DNA. Geant4-DNA is the one of them; it is an extension of the general purpose Geant4 Monte Carlo simulation toolkit for the simulation of physical interactions at sub-micrometre scale. In this study, we present Geant4-DNA Monte Carlo simulations for the prediction of DNA strand breakage usingmore » a geometrical modelling of DNA structure. Methods: For the simulation of DNA strand breakage, we developed a specific DNA geometrical structure. This structure consists of DNA components, such as the deoxynucleotide pairs, the DNA double helix, the nucleosomes and the chromatin fibre. Each component is made of water because the cross sections models currently available in Geant4-DNA for protons apply to liquid water only. Also, at the macroscopic-scale, protons were generated with various energies available for proton therapy at the National Cancer Center, obtained using validated proton beam simulations developed in previous studies. These multi-scale simulations were combined for the validation of Geant4-DNA in radiobiology. Results: In the double helix structure, the deposited energy in a strand allowed to determine direct DNA damage from physical interaction. In other words, the amount of dose and frequency of damage in microscopic geometries was related to direct radiobiological effect. Conclusion: In this report, we calculated the frequency of DNA strand breakage using Geant4- DNA physics processes for liquid water. This study is now on-going in order to develop geometries which use realistic DNA material, instead of liquid water. This will be tested as soon as cross sections for DNA material become available in Geant4-DNA.« less

Modeling DNA bubble formation at the atomic scale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beleva, V; Rasmussen, K. O.; Garcia, A. E.

We describe the fluctuations of double stranded DNA molecules using a minimalist Go model over a wide range of temperatures. Minimalist models allow us to describe, at the atomic level, the opening and formation of bubbles in DNA double helices. This model includes all the geometrical constraints in helix melting imposed by the 3D structure of the molecule. The DNA forms melted bubbles within double helices. These bubbles form and break as a function of time. The equilibrium average number of broken base pairs shows a sharp change as a function of T. We observe a temperature profile of sequencemore » dependent bubble formation similar to those measured by Zeng et al. Long nuclei acid molecules melt partially through the formations of bubbles. It is known that CG rich sequences melt at higher temperatures than AT rich sequences. The melting temperature, however, is not solely determined by the CG content, but by the sequence through base stacking and solvent interactions. Recently, models that incorporate the sequence and nonlinear dynamics of DNA double strands have shown that DNA exhibits a very rich dynamics. Recent extensions of the Bishop-Peyrard model show that fluctuations in the DNA structure lead to opening in localized regions, and that these regions in the DNA are associated with transcription initiation sites. 1D and 2D models of DNA may contain enough information about stacking and base pairing interactions, but lack the coupling between twisting, bending and base pair opening imposed by the double helical structure of DNA that all atom models easily describe. However, the complexity of the energy function used in all atom simulations (including solvent, ions, etc) does not allow for the description of DNA folding/unfolding events that occur in the microsecond time scale.« less

Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, S.S.

1987-01-01

In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

Annealing of Complementary DNA Sequences During Double-Strand Break Repair in Drosophila Is Mediated by the Ortholog of SMARCAL1.

PubMed

Holsclaw, Julie Korda; Sekelsky, Jeff

2017-05-01

DNA double-strand breaks (DSBs) pose a serious threat to genomic integrity. If unrepaired, they can lead to chromosome fragmentation and cell death. If repaired incorrectly, they can cause mutations and chromosome rearrangements. DSBs are repaired using end-joining or homology-directed repair strategies, with the predominant form of homology-directed repair being synthesis-dependent strand annealing (SDSA). SDSA is the first defense against genomic rearrangements and information loss during DSB repair, making it a vital component of cell health and an attractive target for chemotherapeutic development. SDSA has also been proposed to be the primary mechanism for integration of large insertions during genome editing with CRISPR/Cas9. Despite the central role for SDSA in genome stability, little is known about the defining step: annealing. We hypothesized that annealing during SDSA is performed by the annealing helicase SMARCAL1, which can anneal RPA-coated single DNA strands during replication-associated DNA damage repair. We used unique genetic tools in Drosophila melanogaster to test whether the fly ortholog of SMARCAL1, Marcal1, mediates annealing during SDSA. Repair that requires annealing is significantly reduced in Marcal1 null mutants in both synthesis-dependent and synthesis-independent (single-strand annealing) assays. Elimination of the ATP-binding activity of Marcal1 also reduced annealing-dependent repair, suggesting that the annealing activity requires translocation along DNA. Unlike the null mutant, however, the ATP-binding defect mutant showed reduced end joining, shedding light on the interaction between SDSA and end-joining pathways. Copyright © 2017 by the Genetics Society of America.

Recombination-dependent mtDNA partitioning: in vivo role of Mhr1p to promote pairing of homologous DNA.

PubMed

Ling, Feng; Shibata, Takehiko

2002-09-02

Yeast mhr1-1 was isolated as a defective mutation in mitochondrial DNA (mtDNA) recombination. About half of mhr1-1 cells lose mtDNA during growth at a higher temperature. Here, we show that mhr1-1 exhibits a defect in the partitioning of nascent mtDNA into buds and is a base-substitution mutation in MHR1 encoding a mitochondrial matrix protein. We found that the Mhr1 protein (Mhr1p) has activity to pair single-stranded DNA and homologous double-stranded DNA to form heteroduplex joints in vitro, and that mhr1-1 causes the loss of this activity, indicating its role in homologous mtDNA recombination. While the majority of the mtDNA in the mother cells consists of head-to-tail concatemers, more than half of the mtDNA in the buds exists as genome-sized monomers. The mhr1-1 deltacce1 double mutant cells do not maintain any mtDNA, indicating the strict dependence of mtDNA maintenance on recombination functions. These results suggest a mechanism for mtDNA inheritance similar to that operating in the replication and packaging of phage DNA.

Plasma induced DNA damage: Comparison with the effects of ionizing radiation

NASA Astrophysics Data System (ADS)

Lazović, S.; Maletić, D.; Leskovac, A.; Filipović, J.; Puač, N.; Malović, G.; Joksić, G.; Petrović, Z. Lj.

2014-09-01

We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.