DOE Office of Scientific and Technical Information (OSTI.GOV)
Onda, M.; Kudo, S.; Fukuda, M.
Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less
Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin
2015-04-01
This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.
Guimond, A; Moss, T
1999-02-01
We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.
NASA Astrophysics Data System (ADS)
Gong, Qianhong; Yu, Wengong; Dai, Jixun; Liu, Hongquan; Xu, Rifu; Guan, Huashi; Pan, Kehou
2007-01-01
Endogenous tubulin promoter has been widely used for expressing foreign genes in green algae, but the efficiency and feasibility of endogenous tubulin promoter in the economically important Porphyra yezoensis (Rhodophyta) are unknown. In this study, the flanking sequences of beta-tubulin gene from P. yezoensis were amplified and two transient expression vectors were constructed to determine their transcription promoting feasibility for foreign gene gusA. The testing vector pATubGUS was constructed by inserting 5'-and 3'-flanking regions ( Tub5' and Tub3') up-and down-stream of β-glucuronidase (GUS) gene ( gusA), respectively, into pA, a derivative of pCAT®3-enhancer vector. The control construct, pAGUSTub3, contains only gusA and Tub3'. These constructs were electroporated into P. yezoensis protoplasts and the GUS activities were quantitatively analyzed by spectrometry. The results demonstrated that gusA gene was efficiently expressed in P. yezoensis protoplasts under the regulation of 5'-flanking sequence of the beta-tubulin gene. More interestingly, the pATubGUS produced stronger GUS activity in P. yezoensis protoplasts when compared to the result from pBI221, in which the gusA gene was directed by a constitutive CaMV 35S promoter. The data suggest that the integration of P. yezoensis protoplast and its endogenous beta-tubulin flanking sequences is a potential novel system for foreign gene expression.
Kato, Karin; Matsumura, Yasufumi; Yamamoto, Masaki; Nagao, Miki; Takakura, Shunji; Ichiyama, Satoshi
2017-07-01
In this study, we analyzed the molecular epidemiology of extended-spectrum β-lactamase (ESBL)-producing Proteus mirabilis isolates collected from the central region of Japan. Between 2005 and 2012, 820 clinical P. mirabilis isolates were obtained from ten acute care hospitals in Japan. We characterized ESBL confirmatory test-positive isolates by sequencing the ESBL genes and their flanking regions, detecting plasmid replicons, and performing pulsed-field gel electrophoresis (PFGE). Ninety-six isolates (12%) were positive according to the ESBL confirmatory test; all these isolates possessed bla CTX-M-2 with the same flanking structure of upstream ΔISEcp1 and a downstream region identical to downstream bla KLUA-1 . IncT was the prevalent, and only, replicon found in 63 isolates. PFGE analysis detected eight clusters with more than one isolate, among which three included 56 isolates and six included isolates from multiple hospitals. CTX-M-2-producing P. mirabilis with an identical genetic structure flanking bla CTX-M-2 is dominant in this Japanese region, and there is evidence for the clonal spread of isolates.
Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar
2006-12-01
An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.
The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.
Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R
1982-01-01
The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791
Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J
2014-04-01
The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase
Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins
2008-01-01
Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404
Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.
Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins
2008-04-28
In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.
Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays
Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel
2006-01-01
Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921
Chaperones in Polyglutamine Aggregation: Beyond the Q-Stretch
Kuiper, E. F. E.; de Mattos, Eduardo P.; Jardim, Laura B.; Kampinga, Harm H.; Bergink, Steven
2017-01-01
Expanded polyglutamine (polyQ) stretches in at least nine unrelated proteins lead to inherited neuronal dysfunction and degeneration. The expansion size in all diseases correlates with age at onset (AO) of disease and with polyQ protein aggregation, indicating that the expanded polyQ stretch is the main driving force for the disease onset. Interestingly, there is marked interpatient variability in expansion thresholds for a given disease. Between different polyQ diseases the repeat length vs. AO also indicates the existence of modulatory effects on aggregation of the upstream and downstream amino acid sequences flanking the Q expansion. This can be either due to intrinsic modulation of aggregation by the flanking regions, or due to differential interaction with other proteins, such as the components of the cellular protein quality control network. Indeed, several lines of evidence suggest that molecular chaperones have impact on the handling of different polyQ proteins. Here, we review factors differentially influencing polyQ aggregation: the Q-stretch itself, modulatory flanking sequences, interaction partners, cleavage of polyQ-containing proteins, and post-translational modifications, with a special focus on the role of molecular chaperones. By discussing typical examples of how these factors influence aggregation, we provide more insight on the variability of AO between different diseases as well as within the same polyQ disorder, on the molecular level. PMID:28386214
van Hoek, Angela H A M; Mayrhofer, Sigrid; Domig, Konrad J; Flórez, Ana B; Ammor, Mohammed S; Mayo, Baltasar; Aarts, Henk J M
2008-01-01
For the first time, mosaic tetracycline resistance genes were identified in Lactobacillus johnsonii and in Bifidobacterium thermophilum strains. The L. johnsonii strain investigated contains a complex hybrid gene, tet(O/W/32/O/W/O), whereas the five bifidobacterial strains possess two different mosaic tet genes: i.e., tet(W/32/O) and tet(O/W). As reported by others, the crossover points of the mosaic tet gene segments were found at similar positions within the genes, suggesting a hot spot for recombination. Analysis of the sequences flanking these genes revealed that the upstream part corresponds to the 5' end of the mosaic open reading frame. In contrast, the downstream region was shown to be more variable. Surprisingly, in one of the B. thermophilum strains a third tet determinant was identified, coding for the efflux pump Tet(L).
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.
A chromosome inversion near the KIT gene and the Tobiano spotting pattern in horses.
Brooks, S A; Lear, T L; Adelson, D L; Bailey, E
2007-01-01
Tobiano is a white spotting pattern in horses caused by a dominant gene, Tobiano(TO). Here, we report TO associated with a large paracentric chromosome inversion on horse chromosome 3. DNA sequences flanking the inversion were identified and a PCR test was developed to detect the inversion. The inversion was only found in horses with the tobiano pattern, including horses with diverse genetic backgrounds, which indicated a common genetic origin thousands of years ago. The inversion does not interrupt any annotated genes, but begins approximately 100 kb downstream of the KIT gene. This inversion may disrupt regulatory sequences for the KIT gene and cause the white spotting pattern. Copyright (c) 2008 S. Karger AG, Basel.
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.
Eriani, G; Dirheimer, G; Gangloff, J
1989-01-01
The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891
Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
Structure and genomic organization of the human B1 receptor gene for kinins (BDKRB1).
Bachvarov, D R; Hess, J F; Menke, J G; Larrivée, J F; Marceau, F
1996-05-01
Two subtypes of mammalian bradykinin receptors, B1 and B2 (BDKRB1 and BDKRB2), have been defined based on their pharmacological properties. The B1 type kinin receptors have weak affinity for intact BK or Lys-BK but strong affinity for kinin metabolites without the C-terminal arginine (e.g., des-Arg9-BK and Lys-des-Arg9-BK, also called des-Arg10-kallidin), which are generated by kininase I. The B1 receptor expression is up-regulated following tissue injury and inflammation (hyperemia, exudation, hyperalgesia, etc.). In the present study, we have cloned and sequenced the gene encoding human B1 receptor from a human genomic library. The human B1 receptor gene contains three exons separated by two introns. The first and the second exon are noncoding, while the coding region and the 3'-flanking region are located entirely on the third exon. The exon-intron arrangement of the human B1 receptor gene shows significant similarity with the genes encoding the B2 receptor subtype in human, mouse, and rat. Sequence analysis of the 5'-flanking region revealed the presence of a consensus TATA box and of numerous candidate transcription factor binding sequences. Primer extension experiments have shown the existence of multiple transcription initiation sites situated downstream and upstream from the consensus TATA box. Genomic Southern blot analysis indicated that the human B1 receptor is encoded by a single-copy gene.
Activity Enhancement of G-Quadruplex/Hemin DNAzyme by Flanking d(CCC).
Chang, Tianjun; Gong, Hongmei; Ding, Pi; Liu, Xiangjun; Li, Weiguo; Bing, Tao; Cao, Zehui; Shangguan, Dihua
2016-03-14
G-quadruplex (G4)/hemin DNAzymes have been extensively applied in bioanalysis and molecular devices. However, their catalytic activity is still much lower than that of proteinous enzymes. The G4/hemin DNAzyme activity is correlated with the G4 conformations and the solution conditions. However, little is known about the effect of the flanking sequences on the activity, though they are important parts of G4s. Here, we report sequences containing d(CCC), flanked on both ends of the G4-core sequences remarkably enhance their DNAzyme activity. By using circular dichroism and UV-visible spectroscopy, the d(CCC) flanking sequences were demonstrated to improve the hemin binding affinity to G4s instead of increasing the parallel G4 formation, which might explain the enhanced DNAzyme activity. Meanwhile, the increased hemin binding ability promoted the degradation of hemin within the DNAzyme by H2O2. Furthermore, the DNAzyme with d(CCC) flanking sequences showed strong tolerance to pH value changes, which makes it more suitable for applications requiring wide pH conditions. The results highlight the influence of the flanking sequences on the DNAzyme activity and provide insightful information for the design of highly active DNAzymes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gurvich, Olga L.; Näsvall, S. Joakim; Baranov, Pavel V.; Björk, Glenn R.; Atkins, John F.
2011-01-01
The bacterial pheL gene encodes the leader peptide for the phenylalanine biosynthetic operon. Translation of pheL mRNA controls transcription attenuation and, consequently, expression of the downstream pheA gene. Fifty-three unique pheL genes have been identified in sequenced genomes of the gamma subdivision. There are two groups of pheL genes, both of which are short and contain a run(s) of phenylalanine codons at an internal position. One group is somewhat diverse and features different termination and 5′-flanking codons. The other group, mostly restricted to Enterobacteria and including Escherichia coli pheL, has a conserved nucleotide sequence that ends with UUC_CCC_UGA. When these three codons in E. coli pheL mRNA are in the ribosomal E-, P- and A-sites, there is an unusually high level, 15%, of +1 ribosomal frameshifting due to features of the nascent peptide sequence that include the penultimate phenylalanine. This level increases to 60% with a natural, heterologous, nascent peptide stimulator. Nevertheless, studies with different tRNAPro mutants in Salmonella enterica suggest that frameshifting at the end of pheL does not influence expression of the downstream pheA. This finding of incidental, rather than utilized, frameshifting is cautionary for other studies of programmed frameshifting. PMID:21177642
İnce, İkbal Agah; Pijlman, Gorben P; Vlak, Just M; van Oers, Monique M
2017-11-01
Previously, we observed that the transcripts of Invertebrate iridescent virus 6 (IIV6) are not polyadenylated, in line with the absence of canonical poly(A) motifs (AATAAA) downstream of the open reading frames (ORFs) in the genome. Here, we determined the 3' ends of the transcripts of fifty-four IIV6 virion protein genes in infected Drosophila Schneider 2 (S2) cells. By using ligation-based amplification of cDNA ends (LACE) it was shown that the IIV6 mRNAs often ended with a CAUUA motif. In silico analysis showed that the 3'-untranslated regions of IIV6 genes have the ability to form hairpin structures (22-56 nt in length) and that for about half of all IIV6 genes these 3' sequences contained complementary TAATG and CATTA motifs. We also show that a hairpin in the 3' flanking region with conserved sequence motifs is a conserved feature in invertebrate-infecting iridoviruses (genus Iridovirus and Chloriridovirus). Copyright © 2017 Elsevier Inc. All rights reserved.
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
j5 DNA assembly design automation.
Hillson, Nathan J
2014-01-01
Modern standardized methodologies, described in detail in the previous chapters of this book, have enabled the software-automated design of optimized DNA construction protocols. This chapter describes how to design (combinatorial) scar-less DNA assembly protocols using the web-based software j5. j5 assists biomedical and biotechnological researchers construct DNA by automating the design of optimized protocols for flanking homology sequence as well as type IIS endonuclease-mediated DNA assembly methodologies. Unlike any other software tool available today, j5 designs scar-less combinatorial DNA assembly protocols, performs a cost-benefit analysis to identify which portions of an assembly process would be less expensive to outsource to a DNA synthesis service provider, and designs hierarchical DNA assembly strategies to mitigate anticipated poor assembly junction sequence performance. Software integrated with j5 add significant value to the j5 design process through graphical user-interface enhancement and downstream liquid-handling robotic laboratory automation.
Lenzmeier, B A; Giebler, H A; Nyborg, J K
1998-02-01
Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.
Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I
2004-03-01
We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.
Length and sequence dependence in the association of Huntingtin protein with lipid membranes
NASA Astrophysics Data System (ADS)
Jawahery, Sudi; Nagarajan, Anu; Matysiak, Silvina
2013-03-01
There is a fundamental gap in our understanding of how aggregates of mutant Huntingtin protein (htt) with overextended polyglutamine (polyQ) sequences gain the toxic properties that cause Huntington's disease (HD). Experimental studies have shown that the most important step associated with toxicity is the binding of mutant htt aggregates to lipid membranes. Studies have also shown that flanking amino acid sequences around the polyQ sequence directly affect interactions with the lipid bilayer, and that polyQ sequences of greater than 35 glutamine repeats in htt are a characteristic of HD. The key steps that determine how flanking sequences and polyQ length affect the structure of lipid bilayers remain unknown. In this study, we use atomistic molecular dynamics simulations to study the interactions between lipid membranes of varying compositions and polyQ peptides of varying lengths and flanking sequences. We find that overextended polyQ interactions do cause deformation in model membranes, and that the flanking sequences do play a role in intensifying this deformation by altering the shape of the affected regions.
Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.
Cox, J M; Sloan, L S; Schepartz, A
1995-12-01
HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.
Brander, Christian; Yang, Otto O.; Jones, Norman G.; Lee, Yun; Goulder, Philip; Johnson, R. Paul; Trocha, Alicja; Colbert, David; Hay, Christine; Buchbinder, Susan; Bergmann, Cornelia C.; Zweerink, Hans J.; Wolinsky, Steven; Blattner, William A.; Kalams, Spyros A.; Walker, Bruce D.
1999-01-01
Immune escape from cytotoxic T-lymphocyte (CTL) responses has been shown to occur not only by changes within the targeted epitope but also by changes in the flanking sequences which interfere with the processing of the immunogenic peptide. However, the frequency of such an escape mechanism has not been determined. To investigate whether naturally occurring variations in the flanking sequences of an immunodominant human immunodeficiency virus type 1 (HIV-1) Gag CTL epitope prevent antigen processing, cells infected with HIV-1 or vaccinia virus constructs encoding different patient-derived Gag sequences were tested for recognition by HLA-A*0201-restricted, p17-specific CTL. We found that the immunodominant p17 epitope (SL9) and its variants were efficiently processed from minigene expressing vectors and from six HIV-1 Gag variants expressed by recombinant vaccinia virus constructs. Furthermore, SL9-specific CTL clones derived from multiple donors efficiently inhibited virus replication when added to HLA-A*0201-bearing cells infected with primary or laboratory-adapted strains of virus, despite the variability in the SL9 flanking sequences. These data suggest that escape from this immunodominant CTL response is not frequently accomplished by changes in the epitope flanking sequences. PMID:10559335
Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon
2013-01-01
Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044
Wong, S W; Schaffer, P A
1991-05-01
Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.
Freitas, F Zanolli; Bertolini, M C
2004-12-01
Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.
Cas9 specifies functional viral targets during CRISPR-Cas adaptation.
Heler, Robert; Samai, Poulami; Modell, Joshua W; Weiner, Catherine; Goldberg, Gregory W; Bikard, David; Marraffini, Luciano A
2015-03-12
Clustered regularly interspaced short palindromic repeat (CRISPR) loci and their associated (Cas) proteins provide adaptive immunity against viral infection in prokaryotes. Upon infection, short phage sequences known as spacers integrate between CRISPR repeats and are transcribed into small RNA molecules that guide the Cas9 nuclease to the viral targets (protospacers). Streptococcus pyogenes Cas9 cleavage of the viral genome requires the presence of a 5'-NGG-3' protospacer adjacent motif (PAM) sequence immediately downstream of the viral target. It is not known whether and how viral sequences flanked by the correct PAM are chosen as new spacers. Here we show that Cas9 selects functional spacers by recognizing their PAM during spacer acquisition. The replacement of cas9 with alleles that lack the PAM recognition motif or recognize an NGGNG PAM eliminated or changed PAM specificity during spacer acquisition, respectively. Cas9 associates with other proteins of the acquisition machinery (Cas1, Cas2 and Csn2), presumably to provide PAM-specificity to this process. These results establish a new function for Cas9 in the genesis of prokaryotic immunological memory.
Molecular analysis of the glucocerebrosidase gene locus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Winfield, S.L.; Martin, B.M.; Fandino, A.
1994-09-01
Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less
Finnigan, Gregory C; Thorner, Jeremy
2016-07-07
Genome editing exploiting CRISPR/Cas9 has been adopted widely in academia and in the biotechnology industry to manipulate DNA sequences in diverse organisms. Molecular engineering of Cas9 itself and its guide RNA, and the strategies for using them, have increased efficiency, optimized specificity, reduced inappropriate off-target effects, and introduced modifications for performing other functions (transcriptional regulation, high-resolution imaging, protein recruitment, and high-throughput screening). Moreover, Cas9 has the ability to multiplex, i.e., to act at different genomic targets within the same nucleus. Currently, however, introducing concurrent changes at multiple loci involves: (i) identification of appropriate genomic sites, especially the availability of suitable PAM sequences; (ii) the design, construction, and expression of multiple sgRNA directed against those sites; (iii) potential difficulties in altering essential genes; and (iv) lingering concerns about "off-target" effects. We have devised a new approach that circumvents these drawbacks, as we demonstrate here using the yeast Saccharomyces cerevisiae First, any gene(s) of interest are flanked upstream and downstream with a single unique target sequence that does not normally exist in the genome. Thereafter, expression of one sgRNA and cotransformation with appropriate PCR fragments permits concomitant Cas9-mediated alteration of multiple genes (both essential and nonessential). The system we developed also allows for maintenance of the integrated, inducible Cas9-expression cassette or its simultaneous scarless excision. Our scheme-dubbed mCAL for " M: ultiplexing of C: as9 at A: rtificial L: oci"-can be applied to any organism in which the CRISPR/Cas9 methodology is currently being utilized. In principle, it can be applied to install synthetic sequences into the genome, to generate genomic libraries, and to program strains or cell lines so that they can be conveniently (and repeatedly) manipulated at multiple loci with extremely high efficiency. Copyright © 2016 Finnigan and Thorner.
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
The G-Box Transcriptional Regulatory Code in Arabidopsis1[OPEN
Shepherd, Samuel J.K.; Brestovitsky, Anna; Dickinson, Patrick; Biswas, Surojit
2017-01-01
Plants have significantly more transcription factor (TF) families than animals and fungi, and plant TF families tend to contain more genes; these expansions are linked to adaptation to environmental stressors. Many TF family members bind to similar or identical sequence motifs, such as G-boxes (CACGTG), so it is difficult to predict regulatory relationships. We determined that the flanking sequences near G-boxes help determine in vitro specificity but that this is insufficient to predict the transcription pattern of genes near G-boxes. Therefore, we constructed a gene regulatory network that identifies the set of bZIPs and bHLHs that are most predictive of the expression of genes downstream of perfect G-boxes. This network accurately predicts transcriptional patterns and reconstructs known regulatory subnetworks. Finally, we present Ara-BOX-cis (araboxcis.org), a Web site that provides interactive visualizations of the G-box regulatory network, a useful resource for generating predictions for gene regulatory relations. PMID:28864470
Neuhaus, H; Link, G
1987-01-01
The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.
Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L
2000-03-01
Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.
Zhang, Lihua; Chen, Xianzhong; Chen, Zhen; Wang, Zezheng; Jiang, Shan; Li, Li; Pötter, Markus; Shen, Wei; Fan, You
2016-11-01
The diploid yeast Candida tropicalis, which can utilize n-alkane as a carbon and energy source, is an attractive strain for both physiological studies and practical applications. However, it presents some characteristics, such as rare codon usage, difficulty in sequential gene disruption, and inefficiency in foreign gene expression, that hamper strain improvement through genetic engineering. In this work, we present a simple and effective method for sequential gene disruption in C. tropicalis based on the use of an auxotrophic mutant host defective in orotidine monophosphate decarboxylase (URA3). The disruption cassette, which consists of a functional yeast URA3 gene flanked by a 0.3 kb gene disruption auxiliary sequence (gda) direct repeat derived from downstream or upstream of the URA3 gene and of homologous arms of the target gene, was constructed and introduced into the yeast genome by integrative transformation. Stable integrants were isolated by selection for Ura + and identified by PCR and sequencing. The important feature of this construct, which makes it very attractive, is that recombination between the flanking direct gda repeats occurs at a high frequency (10 -8 ) during mitosis. After excision of the URA3 marker, only one copy of the gda sequence remains at the recombinant locus. Thus, the resulting ura3 strain can be used again to disrupt a second allelic gene in a similar manner. In addition to this effective sequential gene disruption method, a codon-optimized green fluorescent protein-encoding gene (GFP) was functionally expressed in C. tropicalis. Thus, we propose a simple and reliable method to improve C. tropicalis by genetic manipulation.
Carlson, M; Celenza, J L; Eng, F J
1985-01-01
The SUC gene family of Saccharomyces contains six structural genes for invertase (SUC1 through SUC5 and SUC7) which are located on different chromosomes. Most yeast strains do not carry all six SUC genes and instead carry natural negative (suc0) alleles at some or all SUC loci. We determined the physical structures of SUC and suc0 loci. Except for SUC2, which is an unusual member of the family, all of the SUC genes are located very close to telomeres and are flanked by homologous sequences. On the centromere-proximal side of the gene, the conserved region contains X sequences, which are sequences found adjacent to telomeres (C. S. M. Chan and B.-K. Tye, Cell 33:563-573, 1983). On the other side of the gene, the homology includes about 4 kilobases of flanking sequence and then extends into a Y' element, which is an element often found distal to the X sequence at telomeres (Chan and Tye, Cell 33:563-573, 1983). Thus, these SUC genes and flanking sequences are embedded in telomere-adjacent sequences. Chromosomes carrying suc0 alleles (except suc20) lack SUC structural genes and portions of the conserved flanking sequences. The results indicate that the dispersal of SUC genes to different chromosomes occurred by rearrangements of chromosome telomeres. Images PMID:3018485
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.
Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G
1993-01-01
The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231
Analysis of the aac(3)-VIa gene encoding a novel 3-N-acetyltransferase.
Rather, P N; Mann, P A; Mierzwa, R; Hare, R S; Miller, G H; Shaw, K J
1993-01-01
Biochemical analysis (G. A. Papanicolaou, R. S. Hare, R. Mierzwa, and G. H. Miller, abstr. 152, Program Abstr. 29th Intersci. Conf. Antimicrob. Agents Chemother., 1989) demonstrated the presence of a novel 3-N-acetyltransferase in Enterobacter cloacae 88020217. This organism was resistant to gentamicin, and the MIC of 2'-N-ethylnetilmicin for it was fourfold lower than that of 6'-N-ethylnetilmicin, a resistance pattern which suggested 2'-acetylating activity. However, high-pressure liquid chromatography analysis demonstrated that the enzyme acetylated sisomicin in the 3 position. We have cloned the structural gene for this enzyme from a large (> 70-kb) conjugative plasmid present in E. cloacae. Subcloning experiments have localized the aac(3)-VIa gene to a 2.1-kb Sau3A fragment. The deduced AAC(3)-VIa protein showed 48% amino acid identity to the AAC(3)-IIa protein and 39% identity to the AAC(3)-VII protein. Examination of the 5'-flanking sequences demonstrated that the aac(3)-VIa gene was located 167 bp downstream of the aadA1 gene and was present in an integron. In addition, the aac(3)-VIa gene is also downstream of a 59-base element often seen in an integron environment. Primer extension analysis has identified a promoter for the aac(3)-VIa gene downstream of both the aadA1 gene and a 59-base element. Images PMID:8257126
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke
1997-05-01
Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less
Yeh, Lung-Kun; Liu, Chia-Yang; Kao, Winston W.-Y.; Huang, Chang-Jen; Hu, Fung-Rong; Chien, Chung-Liang; Wang, I-Jong
2010-01-01
The lumican gene (lum), which encodes one of the major keratan sulfate proteoglycans (KSPGs) in the vertebrate cornea and sclera, has been linked to axial myopia in humans. In this study, we chose zebrafish (Danio rerio) as an animal model to elucidate the role of lumican in the development of axial myopia. The zebrafish lumican gene (zlum) spans ∼4.6 kb of the zebrafish genome. Like human (hLUM) and mouse (mlum), zlum consists of three exons, two introns, and a TATA box-less promoter at the 5′-flanking region of the transcription initiation site. Sequence analysis of the cDNA predicts that zLum encodes 344 amino acids. zLum shares 51% amino acid sequence identity with human lumican. Similar to hLUM and mlum, zlum mRNA is expressed in the eye and many other tissues, such as brain, muscle, and liver as well. Transgenic zebrafish harboring an enhanced GFP reporter gene construct downstream of a 1.7-kb zlum 5′-flanking region displayed enhanced GFP expression in the cornea and sclera, as well as throughout the body. Down-regulation of zlum expression by antisense zlum morpholinos manifested ocular enlargement resembling axial myopia due to disruption of the collagen fibril arrangement in the sclera and resulted in scleral thinning. Administration of muscarinic receptor antagonists, e.g. atropine and pirenzepine, effectively subdued the ocular enlargement caused by morpholinos in in vivo zebrafish larvae assays. The observation suggests that zebrafish can be used as an in vivo model for screening compounds in treating myopia. PMID:20551313
Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.
Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E
2015-09-01
The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa
2018-01-01
Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225
Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice.
Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun
2015-12-11
As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice.
Müller, P
2004-04-01
The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T
1992-03-24
P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.
5. An environmental view, looking due east from the roadbed ...
5. An environmental view, looking due east from the roadbed of the bridge. The downstream bed of Sugar Creek is prominent, flanked by pasture and woodlands - Vigo County Bridge No. 139, Spanning Sugar Creek at Seventy-fourth Place, Terre Haute, Vigo County, IN
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-03-12
ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-01-01
ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.
1994-12-31
Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less
Four RNA families with functional transient structures
Zhu, Jing Yun A; Meyer, Irmtraud M
2015-01-01
Protein-coding and non-coding RNA transcripts perform a wide variety of cellular functions in diverse organisms. Several of their functional roles are expressed and modulated via RNA structure. A given transcript, however, can have more than a single functional RNA structure throughout its life, a fact which has been previously overlooked. Transient RNA structures, for example, are only present during specific time intervals and cellular conditions. We here introduce four RNA families with transient RNA structures that play distinct and diverse functional roles. Moreover, we show that these transient RNA structures are structurally well-defined and evolutionarily conserved. Since Rfam annotates one structure for each family, there is either no annotation for these transient structures or no such family. Thus, our alignments either significantly update and extend the existing Rfam families or introduce a new RNA family to Rfam. For each of the four RNA families, we compile a multiple-sequence alignment based on experimentally verified transient and dominant (dominant in terms of either the thermodynamic stability and/or attention received so far) RNA secondary structures using a combination of automated search via covariance model and manual curation. The first alignment is the Trp operon leader which regulates the operon transcription in response to tryptophan abundance through alternative structures. The second alignment is the HDV ribozyme which we extend to the 5′ flanking sequence. This flanking sequence is involved in the regulation of the transcript's self-cleavage activity. The third alignment is the 5′ UTR of the maturation protein from Levivirus which contains a transient structure that temporarily postpones the formation of the final inhibitory structure to allow translation of maturation protein. The fourth and last alignment is the SAM riboswitch which regulates the downstream gene expression by assuming alternative structures upon binding of SAM. All transient and dominant structures are mapped to our new alignments introduced here. PMID:25751035
Four RNA families with functional transient structures.
Zhu, Jing Yun A; Meyer, Irmtraud M
2015-01-01
Protein-coding and non-coding RNA transcripts perform a wide variety of cellular functions in diverse organisms. Several of their functional roles are expressed and modulated via RNA structure. A given transcript, however, can have more than a single functional RNA structure throughout its life, a fact which has been previously overlooked. Transient RNA structures, for example, are only present during specific time intervals and cellular conditions. We here introduce four RNA families with transient RNA structures that play distinct and diverse functional roles. Moreover, we show that these transient RNA structures are structurally well-defined and evolutionarily conserved. Since Rfam annotates one structure for each family, there is either no annotation for these transient structures or no such family. Thus, our alignments either significantly update and extend the existing Rfam families or introduce a new RNA family to Rfam. For each of the four RNA families, we compile a multiple-sequence alignment based on experimentally verified transient and dominant (dominant in terms of either the thermodynamic stability and/or attention received so far) RNA secondary structures using a combination of automated search via covariance model and manual curation. The first alignment is the Trp operon leader which regulates the operon transcription in response to tryptophan abundance through alternative structures. The second alignment is the HDV ribozyme which we extend to the 5' flanking sequence. This flanking sequence is involved in the regulation of the transcript's self-cleavage activity. The third alignment is the 5' UTR of the maturation protein from Levivirus which contains a transient structure that temporarily postpones the formation of the final inhibitory structure to allow translation of maturation protein. The fourth and last alignment is the SAM riboswitch which regulates the downstream gene expression by assuming alternative structures upon binding of SAM. All transient and dominant structures are mapped to our new alignments introduced here.
Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing
2009-11-25
Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.
Amplification and chromosomal dispersion of human endogenous retroviral sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Steele, P.E.; Martin, M.A.; Rabson, A.B.
1986-09-01
Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification andmore » dispersion events may be linked.« less
Villate, Olatz; Ibarluzea, Nekane; Fraile-Bethencourt, Eugenia; Valenzuela, Alberto; Velasco, Eladio A; Grozeva, Detelina; Raymond, F L; Botella, María P; Tejada, María-Isabel
2018-01-01
Mutations in CHD7 have been shown to be a major cause of CHARGE syndrome, which presents many symptoms and features common to other syndromes making its diagnosis difficult. Next generation sequencing (NGS) of a panel of intellectual disability related genes was performed in an adult patient without molecular diagnosis. A splice donor variant in CHD7 (c.5665 + 1G > T) was identified. To study its potential pathogenicity, exons and flanking intronic sequences were amplified from patient DNA and cloned into the pSAD ® splicing vector. HeLa cells were transfected with this construct and a wild-type minigene and functional analysis were performed. The construct with the c.5665 + 1G > T variant produced an aberrant transcript with an insert of 63 nucleotides of intron 28 creating a premature termination codon (TAG) 25 nucleotides downstream. This would lead to the insertion of 8 new amino acids and therefore a truncated 1896 amino acid protein. As a result of this, the patient was diagnosed with CHARGE syndrome. Functional analyses underline their usefulness for studying the pathogenicity of variants found by NGS and therefore its application to accurately diagnose patients.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.
Tyson, Jess; Armour, John A L
2012-12-11
Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N
2003-09-01
Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.
Dean, C; Jones, J; Favreau, M; Dunsmuir, P; Bedbrook, J
1988-01-01
The petunia rbcS gene SSU301 was introduced into tobacco using Agrobacterium tumefaciens-mediated transformation. The time at which rbcS expression was maximal after transfer of the tobacco plants to the greenhouse was determined. The expression level of the SSU301 gene varied up to 9 fold between individual tobacco plants which had been standardized physiologically as much as possible. The presence of adjacent pUC plasmid sequences did not affect the expression of the SSU301 gene. In an attempt to reduce the between-transformant variability in expression, the SSU301 gene was introduced into tobacco surrounded by 10kb of 5' and 13 kb of 3' DNA sequences which normally flank SSU301 in petunia. The longer flanking regions did not reduce the between-transformant variability of SSU301 gene expression. Images PMID:3174450
Method to amplify variable sequences without imposing primer sequences
Bradbury, Andrew M.; Zeytun, Ahmet
2006-11-14
The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.
An integrated SNP mining and utilization (ISMU) pipeline for next generation sequencing data.
Azam, Sarwar; Rathore, Abhishek; Shah, Trushar M; Telluri, Mohan; Amindala, BhanuPrakash; Ruperao, Pradeep; Katta, Mohan A V S K; Varshney, Rajeev K
2014-01-01
Open source single nucleotide polymorphism (SNP) discovery pipelines for next generation sequencing data commonly requires working knowledge of command line interface, massive computational resources and expertise which is a daunting task for biologists. Further, the SNP information generated may not be readily used for downstream processes such as genotyping. Hence, a comprehensive pipeline has been developed by integrating several open source next generation sequencing (NGS) tools along with a graphical user interface called Integrated SNP Mining and Utilization (ISMU) for SNP discovery and their utilization by developing genotyping assays. The pipeline features functionalities such as pre-processing of raw data, integration of open source alignment tools (Bowtie2, BWA, Maq, NovoAlign and SOAP2), SNP prediction (SAMtools/SOAPsnp/CNS2snp and CbCC) methods and interfaces for developing genotyping assays. The pipeline outputs a list of high quality SNPs between all pairwise combinations of genotypes analyzed, in addition to the reference genome/sequence. Visualization tools (Tablet and Flapjack) integrated into the pipeline enable inspection of the alignment and errors, if any. The pipeline also provides a confidence score or polymorphism information content value with flanking sequences for identified SNPs in standard format required for developing marker genotyping (KASP and Golden Gate) assays. The pipeline enables users to process a range of NGS datasets such as whole genome re-sequencing, restriction site associated DNA sequencing and transcriptome sequencing data at a fast speed. The pipeline is very useful for plant genetics and breeding community with no computational expertise in order to discover SNPs and utilize in genomics, genetics and breeding studies. The pipeline has been parallelized to process huge datasets of next generation sequencing. It has been developed in Java language and is available at http://hpc.icrisat.cgiar.org/ISMU as a standalone free software.
Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin
Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.
2015-01-01
Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lane, H.R.; Frye, M.W.; Couples, G.D.
1992-01-01
Biothems are regional wedge- or lens-shaped bodies of strata that are bounded shelfward or cratonward by paleontologically recognizable unconformities; generally thicken on marine shelves, where they are typically conformable with underlying and overlying biothems; are commonly thinner or represent starved sequences further basinward; and in their most basinward extent, are either bounded by biostratigraphically recognizable unconformities or are conformable with underlying and overlying biothems. As recognized to date, biothems have a logical distribution of faunal and floral components, as well as facies groupings that represent internally consistent and logical sequences of depositional environments. A west-to-east transect within the North Americanmore » Mississippian System which extends from the Basin and Range Province, across the Transcontinental Arch (TA), into the Anadarko Basin, was constructed to demonstrate the regional distribution and tectono-stratigraphic significance of biothems relative to the axis of the TA. The relationships portrayed on the transect, tied to an understanding of North American Mississippian paleogeography, imply that biothems deposited during relative highstand events on one flank of the TA are time-equivalent to biothems deposited during relative lowstand events on the opposite flank of the TA. This distribution is interpreted to have been controlled by intraplate tectonic events that formed piano key basins along the flanks of the TA. The spatial patterns of these basins are not consistent with published models of basin evolution. A further conclusion is that the lack of coincident, transgressive or regressive Mississippian biothems on either flank of the TA suggests that it is inadvisable to impose the Mississippi Valley-derived eustasy curve on western flank depositional sequences.« less
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions
Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun
2017-01-01
Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093
On the Magnetospheric Heating Problem
NASA Astrophysics Data System (ADS)
Nykyri, K.; Moore, T.; Dimmock, A. P.; Ma, X.; Johnson, J.; Delamere, P. A.
2016-12-01
In the Earth's magnetosphere the specific entropy, increases by approximately two orders of magnitude when transitioning from the magnetosheath into the magnetosphere. However, the origin of this non-adiabatic heating is not well understood. In addition, there exists a dawn-dusk temperature asymmetry in the flanks of the plasma sheet - the cold component ions are hotter by 30-40% at the dawnside plasma sheet compared to the duskside plasma sheet. Our recent statistical study of magnetosheath temperatures using 7 years of THEMIS data indicates that ion magnetosheath temperatures downstream of quasi-parallel (dawn-flank for the Parker-Spiral IMF) bow shock are only 15 percent higher than downstream of the quasi-perpendicular shock. This magnetosheath temperature asymmetry is therefore inadequate to cause the observed level of the plasma sheet temperature asymmetry. In this presentation we address the origin of non-adiabatic heating from the magnetosheath into the plasma sheet by utilizing small Cluster spacecraft separations, 9 years of statistical THEMIS data as well as Hall-MHD and hybrid simulations. We present evidence of a new physical mechanism capable of cross-scale energy transport at the flank magnetopause with strong contributions to the non-adiabatic heating observed between the magnetosheath and plasma sheet. This same heating mechanism may occur and drive asymmetries also in the magnetospheres of gas giants: Jupiter and Saturn, as well as play role elsewhere in the universe where significant flow shears are present such as in the solar corona, and other astrophysical and laboratory plasmas.
Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T
1997-02-07
An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR
2012-01-01
Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example. PMID:23231411
Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang
2014-01-01
Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449
Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang
2014-01-01
Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.
Gene Deletion in Barley Mediated by LTR-retrotransposon BARE
Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao
2017-01-01
A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053
Wang, Y J; Liu, T; Hou, J M; Zuo, Y H
2013-09-01
In this report, 156 hygromycin-resistant mutants were generated via restriction enzyme-mediated insertional (REMI) mutagenesis. All mutants were subjected to a bioassay on detached leaves. Five mutants (T4, T39, T71, T91, and T135) showed reduced symptom development, whereas one mutant (T120) did not exhibit any symptoms on the leaves compared with the wild type. The pathogenicity of these mutants was further assayed through the spray inoculation of whole seedlings. The results demonstrated that the pathogenicity of the T4, T39, T71, T91, and T135 mutants was reduced, whereas the T120 mutant lost its pathogenicity. Southern blot analysis revealed that the plasmids were inserted at different sites in the genome with different copy numbers. Flanking sequences approximately 550, 860, and 150 bp were obtained from T7, T91, and T120, respectively through plasmids rescue. Sequence analysis of the flanking sequences from T7 and T91 showed no homology to any known sequences in GenBank. The flanking sequence from the T120 mutant was highly homologous to MAPKK kinases, which regulates sexual/asexual development, melanization, pathogenicity from Cochliobolus heterostrophus. These results indicate that REMI and plasmids rescue have great potential for finding pathogenicity genes.
Xiong, Jie; Gao, Shan; Dui, Wen; Yang, Wentao; Chen, Xiao; Taverna, Sean D; Pearlman, Ronald E; Ashlock, Wendy; Miao, Wei; Liu, Yifan
2016-12-01
The ciliate protozoan Tetrahymena thermophila contains two types of structurally and functionally differentiated nuclei: the transcriptionally active somatic macronucleus (MAC) and the transcriptionally silent germ-line micronucleus (MIC). Here, we demonstrate that MAC features well-positioned nucleosomes downstream of transcription start sites and flanking splice sites. Transcription-associated trans-determinants promote nucleosome positioning in MAC. By contrast, nucleosomes in MIC are dramatically delocalized. Nucleosome occupancy in MAC and MIC are nonetheless highly correlated with each other, as well as with in vitro reconstitution and predictions based upon DNA sequence features, revealing unexpectedly strong contributions from cis-determinants. In particular, well-positioned nucleosomes are often matched with GC content oscillations. As many nucleosomes are coordinately accommodated by both cis- and trans-determinants, we propose that their distribution is shaped by the impact of these nucleosomes on the mutational and transcriptional landscape, and driven by evolutionary selection. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U
2000-01-01
Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.
Nowacka-Woszuk, Joanna; Switonski, Marek
2009-01-01
The sex determination process is under the control of several genes of which two (SRY and SOX9), encoding transcription factors, play a crucial role. It is well-known that mutations at these genes may cause the development of an intersexual phenotype. The aim of this study was to conduct a comparative analysis of the coding sequence and 5'-flanking regions of both genes in four species of the family Canidae (the dog, red fox, arctic fox and Chinese raccoon dog). Similarity of the coding sequence of the SOX9 gene among the studied species was higher (99.7-99.9%) than in the case of the SRY gene (96.7-97.3%). Only single nucleotide changes were found in the compared coding sequences, whereas in the 5'-flanking region of both genes nucleotide substitutions, as well as insertions and deletions were observed. None of the changes detected in the 5'-flanking region occurred within the potential consensus sequences for transcription factors. No polymorphism was found for either of these genes in any of the analyzed species.
Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A
2002-01-01
κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628
Human renin 5'-flanking DNA to nucleotide-2750.
Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J
1995-01-01
Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.
Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism
USDA-ARS?s Scientific Manuscript database
Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...
Thieme, Frank; Marillonnet, Sylvestre
2014-01-01
Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.
Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida
2010-11-01
The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.
Polymorphism of BMP4 gene in Indian goat breeds differing in prolificacy.
Sharma, Rekha; Ahlawat, Sonika; Maitra, A; Roy, Manoranjan; Mandakmale, S; Tantia, M S
2013-12-10
Bone morphogenetic proteins (BMPs) are members of the TGF-β (transforming growth factor-beta) superfamily, of which BMP4 is the most important due to its crucial role in follicular growth and differentiation, cumulus expansion and ovulation. Reproduction is a crucial trait in goat breeding and based on the important role of BMP4 gene in reproduction it was considered as a possible candidate gene for the prolificacy of goats. The objective of the present study was to detect polymorphism in intronic, exonic and 3' un-translated regions of BMP4 gene in Indian goats. Nine different goat breeds (Barbari, Beetal, Black Bengal, Malabari, Jakhrana (Twinning>40%), Osmanabadi, Sangamneri (Twinning 20-30%), Sirohi and Ganjam (Twinning<10%)) differing in prolificacy and geographic distribution were employed for polymorphism scanning. Cattle sequence (AC_000167.1) was used to design primers for the amplification of a targeted region followed by direct DNA sequencing to identify the genetic variations. Single nucleotide polymorphisms (SNPs) were not detected in exon 3, the intronic region and the 3' flanking region. A SNP (G1534A) was identified in exon 2. It was a non-synonymous mutation resulting in an arginine to lysine change in a corresponding protein sequence. G to A transition at the 1534 locus revealed two genotypes GG and GA in the nine investigated goat breeds. The GG genotype was predominant with a genotype frequency of 0.98. The GA genotype was present in the Black Bengal as well as Jakhrana breed with a genotype frequency of 0.02. A microsatellite was identified in the 3' flanking region, only 20 nucleotides downstream from the termination site of the coding region, as a short sequence with more than nineteen continuous and repeated CA dinucleotides. Since the gene is highly evolutionarily conserved, identification of a non-synonymous SNP (G1534A) in the coding region gains further importance. To our knowledge, this is the first report of a mutation in the coding region of the caprine BMP4 gene. But whether the reproduction trait of goat is associated with the BMP4 polymorphism, needs to be further defined by association studies in more populations so as to delineate an effect on it. © 2013 Elsevier B.V. All rights reserved.
Characterization of genetic sequence variation of 58 STR loci in four major population groups.
Novroski, Nicole M M; King, Jonathan L; Churchill, Jennifer D; Seah, Lay Hong; Budowle, Bruce
2016-11-01
Massively parallel sequencing (MPS) can identify sequence variation within short tandem repeat (STR) alleles as well as their nominal allele lengths that traditionally have been obtained by capillary electrophoresis. Using the MiSeq FGx Forensic Genomics System (Illumina), STRait Razor, and in-house excel workbooks, genetic variation was characterized within STR repeat and flanking regions of 27 autosomal, 7 X-chromosome and 24 Y-chromosome STR markers in 777 unrelated individuals from four population groups. Seven hundred and forty six autosomal, 227 X-chromosome, and 324 Y-chromosome STR alleles were identified by sequence compared with 357 autosomal, 107 X-chromosome, and 189 Y-chromosome STR alleles that were identified by length. Within the observed sequence variation, 227 autosomal, 156 X-chromosome, and 112 Y-chromosome novel alleles were identified and described. One hundred and seventy six autosomal, 123 X-chromosome, and 93 Y-chromosome sequence variants resided within STR repeat regions, and 86 autosomal, 39 X-chromosome, and 20 Y-chromosome variants were located in STR flanking regions. Three markers, D18S51, DXS10135, and DYS385a-b had 1, 4, and 1 alleles, respectively, which contained both a novel repeat region variant and a flanking sequence variant in the same nucleotide sequence. There were 50 markers that demonstrated a relative increase in diversity with the variant sequence alleles compared with those of traditional nominal length alleles. These population data illustrate the genetic variation that exists in the commonly used STR markers in the selected population samples and provide allele frequencies for statistical calculations related to STR profiling with MPS data. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Kardinal, C; Selmayr, M; Mocikat, R
1996-01-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041
Kardinal, C; Selmayr, M; Mocikat, R
1996-11-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.
Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.
1990-01-01
Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)
An Integrated SNP Mining and Utilization (ISMU) Pipeline for Next Generation Sequencing Data
Azam, Sarwar; Rathore, Abhishek; Shah, Trushar M.; Telluri, Mohan; Amindala, BhanuPrakash; Ruperao, Pradeep; Katta, Mohan A. V. S. K.; Varshney, Rajeev K.
2014-01-01
Open source single nucleotide polymorphism (SNP) discovery pipelines for next generation sequencing data commonly requires working knowledge of command line interface, massive computational resources and expertise which is a daunting task for biologists. Further, the SNP information generated may not be readily used for downstream processes such as genotyping. Hence, a comprehensive pipeline has been developed by integrating several open source next generation sequencing (NGS) tools along with a graphical user interface called Integrated SNP Mining and Utilization (ISMU) for SNP discovery and their utilization by developing genotyping assays. The pipeline features functionalities such as pre-processing of raw data, integration of open source alignment tools (Bowtie2, BWA, Maq, NovoAlign and SOAP2), SNP prediction (SAMtools/SOAPsnp/CNS2snp and CbCC) methods and interfaces for developing genotyping assays. The pipeline outputs a list of high quality SNPs between all pairwise combinations of genotypes analyzed, in addition to the reference genome/sequence. Visualization tools (Tablet and Flapjack) integrated into the pipeline enable inspection of the alignment and errors, if any. The pipeline also provides a confidence score or polymorphism information content value with flanking sequences for identified SNPs in standard format required for developing marker genotyping (KASP and Golden Gate) assays. The pipeline enables users to process a range of NGS datasets such as whole genome re-sequencing, restriction site associated DNA sequencing and transcriptome sequencing data at a fast speed. The pipeline is very useful for plant genetics and breeding community with no computational expertise in order to discover SNPs and utilize in genomics, genetics and breeding studies. The pipeline has been parallelized to process huge datasets of next generation sequencing. It has been developed in Java language and is available at http://hpc.icrisat.cgiar.org/ISMU as a standalone free software. PMID:25003610
Sadofsky, M; Connelly, S; Manley, J L; Alwine, J C
1985-01-01
Our previous studies of the 3'-end processing of simian virus 40 late mRNAs indicated the existence of an essential element (or elements) downstream of the AAUAAA signal. We report here the use of transient expression analysis to study a functional element which we located within the sequence AGGUUUUUU, beginning 59 nucleotides downstream of the recognized signal AAUAAA. Deletion of this element resulted in (i) at least a 75% drop in 3'-end processing at the normal site and (ii) appearance of readthrough transcripts with alternate 3' ends. Some flexibility in the downstream position of this element relative to the AAUAAA was noted by deletion analysis. Using computer sequence comparison, we located homologous regions within downstream sequences of other genes, suggesting a generalized sequence element. In addition, specific complementarity is noted between the downstream element and U4 RNA. The possibility that this complementarity could participate in 3'-end site selection is discussed. Images PMID:3016512
Small Deletion Variants Have Stable Breakpoints Commonly Associated with Alu Elements
Coin, Lachlan J. M.; Steinfeld, Israel; Yakhini, Zohar; Sladek, Rob; Froguel, Philippe; Blakemore, Alexandra I. F.
2008-01-01
Copy number variants (CNVs) contribute significantly to human genomic variation, with over 5000 loci reported, covering more than 18% of the euchromatic human genome. Little is known, however, about the origin and stability of variants of different size and complexity. We investigated the breakpoints of 20 small, common deletions, representing a subset of those originally identified by array CGH, using Agilent microarrays, in 50 healthy French Caucasian subjects. By sequencing PCR products amplified using primers designed to span the deleted regions, we determined the exact size and genomic position of the deletions in all affected samples. For each deletion studied, all individuals carrying the deletion share identical upstream and downstream breakpoints at the sequence level, suggesting that the deletion event occurred just once and later became common in the population. This is supported by linkage disequilibrium (LD) analysis, which has revealed that most of the deletions studied are in moderate to strong LD with surrounding SNPs, and have conserved long-range haplotypes. Analysis of the sequences flanking the deletion breakpoints revealed an enrichment of microhomology at the breakpoint junctions. More significantly, we found an enrichment of Alu repeat elements, the overwhelming majority of which intersected deletion breakpoints at their poly-A tails. We found no enrichment of LINE elements or segmental duplications, in contrast to other reports. Sequence analysis revealed enrichment of a conserved motif in the sequences surrounding the deletion breakpoints, although whether this motif has any mechanistic role in the formation of some deletions has yet to be determined. Considered together with existing information on more complex inherited variant regions, and reports of de novo variants associated with autism, these data support the presence of different subgroups of CNV in the genome which may have originated through different mechanisms. PMID:18769679
Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta
2000-01-01
Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136
Fritsch, Leonie; Fischer, Rainer; Wambach, Christoph; Dudek, Max; Schillberg, Stefan; Schröper, Florian
2015-08-01
Simple and reliable, high-throughput techniques to detect the zygosity of transgenic events in plants are valuable for biotechnology and plant breeding companies seeking robust genotyping data for the assessment of new lines and the monitoring of breeding programs. We show that next-generation sequencing (NGS) applied to short PCR products spanning the transgene integration site provides accurate zygosity data that are more robust and reliable than those generated by PCR-based methods. The NGS reads covered the 5' border of the transgenic events (incorporating part of the transgene and the flanking genomic DNA), or the genomic sequences flanking the unfilled transgene integration site at the wild-type locus. We compared the NGS method to competitive real-time PCR with transgene-specific and wild-type-specific primer/probe pairs, one pair matching the 5' genomic flanking sequence and 5' part of the transgene and the other matching the unfilled transgene integration site. Although both NGS and real-time PCR provided useful zygosity data, the NGS technique was favorable because it needed fewer optimization steps. It also provided statistically more-reliable evidence for the presence of each allele because each product was often covered by more than 100 reads. The NGS method is also more suitable for the genotyping of large panels of plants because up to 80 million reads can be produced in one sequencing run. Our novel method is therefore ideal for the rapid and accurate genotyping of large numbers of samples.
The role of heterologous chloroplast sequence elements in transgene integration and expression.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-04-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.
Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry
2010-01-01
Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...
2016-03-09
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less
FARME DB: a functional antibiotic resistance element database
Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.
2017-01-01
Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567
Transcriptional insulation of the human keratin 18 gene in transgenic mice.
Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G
1993-01-01
Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and brain suggests that the property of transcriptional insulation of the K18 gene may be conferred by the distal flanking sequences of the K18 gene and, additionally, may function for other genes. Images PMID:7681143
USDA-ARS?s Scientific Manuscript database
Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Zhang, Fan; Zhang, Bing; Xiang, Hua; Hu, Songnian
2009-11-01
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widespread system that provides acquired resistance against phages in bacteria and archaea. Here we aim to genome-widely analyze the CRISPR in extreme halophilic archaea, of which the whole genome sequences are available at present time. We used bioinformatics methods including alignment, conservation analysis, GC content and RNA structure prediction to analyze the CRISPR structures of 7 haloarchaeal genomes. We identified the CRISPR structures in 5 halophilic archaea and revealed a conserved palindromic motif in the flanking regions of these CRISPR structures. In addition, we found that the repeat sequences of large CRISPR structures in halophilic archaea were greatly conserved, and two types of predicted RNA secondary structures derived from the repeat sequences were likely determined by the fourth base of the repeat sequence. Our results support the proposal that the leader sequence may function as recognition site by having palindromic structures in flanking regions, and the stem-loop secondary structure formed by repeat sequences may function in mediating the interaction between foreign genetic elements and CAS-encoded proteins.
Gould, Virginia C; Okazaki, Aki; Howe, Robin A; Avison, Matthew B
2004-08-01
To determine the level of variation in the smeDEF efflux pump and smeT transcriptional regulator genes among three defined 16S rRNA sequence subgroups of clinical Stenotrophomonas maltophilia isolates. smeDEF sequencing used a PCR genome walking approach. Determination of the sequence surrounding smeDEF used a flanking primer PCR method and specific primers anchored in smeD or smeF together with random primers. smeDEF is chromosomal and located in the same position in the chromosome in all three subgroups of isolates. Flanking smeD is a gene, smeT, encoding a putative transcriptional repressor for smeDEF. Variation at these loci among the isolates is considerably lower (up to 10%) than at intrinsic beta-lactamase loci (up to 30%) in the same isolates, implying greater functional constraint. The smeD-smeT intergenic region contains a highly conserved section, which maps with previously predicted promoter/operator regions, and a hypervariable untranslated region, which can be used to subgroup clinical isolates. These data provide further evidence that it is possible to group clinical isolates of the inherently variable species, S. maltophilia, based on genotypic properties. Isolate D457, in which most work concerning smeDEF expression has been performed, does not fall into S. maltophilia subgroup A, which is the most typical.
Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage
Black, Paul J.; Miller, Adam S.; Hayes, Jeffrey J.
2016-01-01
Purpose As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. Materials and methods To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. Results We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines, and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. Conclusions These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation. PMID:27349757
Feng, X; Happ, G M
1996-11-14
The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.
Kida, Yuichiro; Morimoto, Fumiko; Sakaguchi, Masao
2007-01-01
During protein integration into the endoplasmic reticulum, the N-terminal domain preceding the type I signal-anchor sequence is translocated through a translocon. By fusing a streptavidin-binding peptide tag to the N terminus, we created integration intermediates of multispanning membrane proteins. In a cell-free system, N-terminal domain (N-domain) translocation was arrested by streptavidin and resumed by biotin. Even when N-domain translocation was arrested, the second hydrophobic segment mediated translocation of the downstream hydrophilic segment. In one of the defined intermediates, two hydrophilic segments and two hydrophobic segments formed a transmembrane disposition in a productive state. Both of the translocating hydrophilic segments were crosslinked with a translocon subunit, Sec61α. We conclude that two translocating hydrophilic segment in a single membrane protein can span the membrane during multispanning topogenesis flanking the translocon. Furthermore, even after six successive hydrophobic segments entered the translocon, N-domain translocation could be induced to restart from an arrested state. These observations indicate the remarkably flexible nature of the translocon. PMID:18166653
Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao
2015-10-02
We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.
Evidence for the Concerted Evolution between Short Linear Protein Motifs and Their Flanking Regions
Chica, Claudia; Diella, Francesca; Gibson, Toby J.
2009-01-01
Background Linear motifs are short modules of protein sequences that play a crucial role in mediating and regulating many protein–protein interactions. The function of linear motifs strongly depends on the context, e.g. functional instances mainly occur inside flexible regions that are accessible for interaction. Sometimes linear motifs appear as isolated islands of conservation in multiple sequence alignments. However, they also occur in larger blocks of sequence conservation, suggesting an active role for the neighbouring amino acids. Results The evolution of regions flanking 116 functional linear motif instances was studied. The conservation of the amino acid sequence and order/disorder tendency of those regions was related to presence/absence of the instance. For the majority of the analysed instances, the pairs of sequences conserving the linear motif were also observed to maintain a similar local structural tendency and/or to have higher local sequence conservation when compared to pairs of sequences where one is missing the linear motif. Furthermore, those instances have a higher chance to co–evolve with the neighbouring residues in comparison to the distant ones. Those findings are supported by examples where the regulation of the linear motif–mediated interaction has been shown to depend on the modifications (e.g. phosphorylation) at neighbouring positions or is thought to benefit from the binding versatility of disordered regions. Conclusion The results suggest that flanking regions are relevant for linear motif–mediated interactions, both at the structural and sequence level. More interestingly, they indicate that the prediction of linear motif instances can be enriched with contextual information by performing a sequence analysis similar to the one presented here. This can facilitate the understanding of the role of these predicted instances in determining the protein function inside the broader context of the cellular network where they arise. PMID:19584925
Hussing, C; Bytyci, R; Huber, C; Morling, N; Børsting, C
2018-05-24
Some STR loci have internal sequence variations, which are not revealed by the standard STR typing methods used in forensic genetics (PCR and fragment length analysis by capillary electrophoresis (CE)). Typing of STRs with next-generation sequencing (NGS) uncovers the sequence variation in the repeat region and in the flanking regions. In this study, 363 Danish individuals were typed for 56 STRs (26 autosomal STRs, 24 Y-STRs, and 6 X-STRs) using the ForenSeq™ DNA Signature Prep Kit to establish a Danish STR sequence database. Increased allelic diversity was observed in 34 STRs by the PCR-NGS assay. The largest increases were found in DYS389II and D12S391, where the numbers of sequenced alleles were around four times larger than the numbers of alleles determined by repeat length alone. Thirteen SNPs and one InDel were identified in the flanking regions of 12 STRs. Furthermore, 36 single positions and five longer stretches in the STR flanking regions were found to have dubious genotyping quality. The combined match probability of the 26 autosomal STRs was 10,000 times larger using the PCR-NGS assay than by using PCR-CE. The typical paternity indices for trios and duos were 500 and 100 times larger, respectively, than those obtained with PCR-CE. The assay also amplified 94 SNPs selected for human identification. Eleven of these loci were not in Hardy-Weinberg equilibrium in the Danish population, most likely because the minimum threshold for allele calling (30 reads) in the ForenSeq™ Universal Analysis Software was too low and frequent allele dropouts were not detected.
Redkiewicz, Patrycja; Stachyra, Anna; Sawicka, Róz∙a; Bocian, Katarzyna; Góra-Sochacka, Anna; Kosson, Piotr; Sirko, Agnieszka
2017-01-01
Influenza is one of the most important illnesses in the modern world, causing great public health losses each year due to the lack of medication and broadly protective, long-lasting vaccines. The development of highly immunogenic and safe vaccines is currently one of the major problems encountered in efficient influenza prevention. DNA vaccines represent a novel and powerful alternative to the conventional vaccine approaches. To improve the efficacy of the DNA vaccine against influenza H5N1, we inserted three repeated kappa B (κB) motifs, separated by a 5-bp nucleotide spacer, upstream of the cytomegalovirus promoter and downstream of the SV40 late polyadenylation signal. The κB motif is a specific DNA element (10pb-long) recognized by one of the most important transcription factors NFκB. NFκB is present in almost all animal cell types and upon cell stimulation under a variety of pathogenic conditions. NFκB is released from IκB and translocates to the nucleus and binds to κB sites, thereby leading to enhanced transcription and expression of downstream genes. We tested the variants of DNA vaccine with κB sites flanking the antigen expression cassette and without such sites in two animal models: chickens (broilers and layers) and mice (BALB/c). In chickens, the variant with κB sites stimulated stronger humoral response against the target antigen. In mice, the differences in humoral response were less apparent. Instead, it was possible to spot several gene expression differences in the spleens isolated from mice immunized with both variants. The results of our study indicate that modification of the sequence outside of the sequence encoding the antigen might enhance the immune response to the target but understanding the mechanisms responsible for this process requires further analysis. PMID:28883819
Güler-Gane, Gülin; Kidd, Sara; Sridharan, Sudharsan; Vaughan, Tristan J; Wilkinson, Trevor C I; Tigue, Natalie J
2016-01-01
The expression and subsequent purification of mammalian recombinant proteins is of critical importance to many areas of biological science. To maintain the appropriate tertiary structure and post-translational modifications of such proteins, transient mammalian expression systems are often adopted. The successful utilisation of these systems is, however, not always forthcoming and some recombinant proteins prove refractory to expression in mammalian hosts. In this study we focussed on the role of different N-terminal signal peptides and residues immediately downstream, in influencing the level of secreted recombinant protein obtained from suspension HEK293 cells. Using secreted alkaline phosphatase (SEAP) as a model protein, we identified that the +1/+2 downstream residues flanking a heterologous signal peptide significantly affect secreted levels. By incorporating these findings we conducted a comparison of different signal peptide sequences and identified the most productive as secrecon, a computationally-designed sequence. Importantly, in the context of the secrecon signal peptide and SEAP, we also demonstrated a clear preference for specific amino acid residues at the +1 position (e.g. alanine), and a detrimental effect of others (cysteine, proline, tyrosine and glutamine). When proteins that naturally contain these "undesirable" residues at the +1 position were expressed with their native signal peptide, the heterologous secrecon signal peptide, or secrecon with an additional alanine at the +1 or +1 and +2 position, the level of expression differed significantly and in an unpredictable manner. For each protein, however, at least one of the panel of signal peptide/adjacent amino acid combinations enabled successful recombinant expression. In this study, we highlight the important interplay between a signal peptide and its adjacent amino acids in enabling protein expression, and we describe a strategy that could enable recombinant proteins that have so far proved refractory to expression in HEK293 cells, to be produced in sufficient quantities to answer important biological questions.
Tarazona-Santos, Eduardo; Fabbri, Cristina; Yeager, Meredith; Magalhaes, Wagner C; Burdett, Laurie; Crenshaw, Andrew; Pettener, Davide; Chanock, Stephen J
2010-03-23
Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs). Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13) is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American), all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp), while the C-terminal region downstream of intron 6 ( approximately 2600 bp) harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1) episodes of natural selection (likely a selective sweep) predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2) the target of natural selection may not be in the SLC2A4 coding sequence. We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.
Chowdari, K V; Northup, A; Pless, L; Wood, J; Joo, Y H; Mirnics, K; Lewis, D A; Levitt, P R; Bacanu, S-A; Nimgaonkar, V L
2007-04-01
Many candidate gene association studies have evaluated incomplete, unrepresentative sets of single nucleotide polymorphisms (SNPs), producing non-significant results that are difficult to interpret. Using a rapid, efficient strategy designed to investigate all common SNPs, we tested associations between schizophrenia and two positional candidate genes: ACSL6 (Acyl-Coenzyme A synthetase long-chain family member 6) and SIRT5 (silent mating type information regulation 2 homologue 5). We initially evaluated the utility of DNA sequencing traces to estimate SNP allele frequencies in pooled DNA samples. The mean variances for the DNA sequencing estimates were acceptable and were comparable to other published methods (mean variance: 0.0008, range 0-0.0119). Using pooled DNA samples from cases with schizophrenia/schizoaffective disorder (Diagnostic and Statistical Manual of Mental Disorders edition IV criteria) and controls (n=200, each group), we next sequenced all exons, introns and flanking upstream/downstream sequences for ACSL6 and SIRT5. Among 69 identified SNPs, case-control allele frequency comparisons revealed nine suggestive associations (P<0.2). Each of these SNPs was next genotyped in the individual samples composing the pools. A suggestive association with rs 11743803 at ACSL6 remained (allele-wise P=0.02), with diminished evidence in an extended sample (448 cases, 554 controls, P=0.062). In conclusion, we propose a multi-stage method for comprehensive, rapid, efficient and economical genetic association analysis that enables simultaneous SNP detection and allele frequency estimation in large samples. This strategy may be particularly useful for research groups lacking access to high throughput genotyping facilities. Our analyses did not yield convincing evidence for associations of schizophrenia with ACSL6 or SIRT5.
Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel
2008-10-01
Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.
Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D
2014-01-01
The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.
CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.
Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine
2007-07-01
Clustered regularly interspaced short palindromic repeats (CRISPRs) constitute a particular family of tandem repeats found in a wide range of prokaryotic genomes (half of eubacteria and almost all archaea). They consist of a succession of highly conserved regions (DR) varying in size from 23 to 47 bp, separated by similarly sized unique sequences (spacer) of usually viral origin. A CRISPR cluster is flanked on one side by an AT-rich sequence called the leader and assumed to be a transcriptional promoter. Recent studies suggest that this structure represents a putative RNA-interference-based immune system. Here we describe CRISPRFinder, a web service offering tools to (i) detect CRISPRs including the shortest ones (one or two motifs); (ii) define DRs and extract spacers; (iii) get the flanking sequences to determine the leader; (iv) blast spacers against Genbank database and (v) check if the DR is found elsewhere in prokaryotic sequenced genomes. CRISPRFinder is freely accessible at http://crispr.u-psud.fr/Server/CRISPRfinder.php.
Molin, William T; Wright, Alice A; Lawton-Rauh, Amy; Saski, Christopher A
2017-01-17
The expanding number and global distributions of herbicide resistant weedy species threaten food, fuel, fiber and bioproduct sustainability and agroecosystem longevity. Amongst the most competitive weeds, Amaranthus palmeri S. Wats has rapidly evolved resistance to glyphosate primarily through massive amplification and insertion of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene across the genome. Increased EPSPS gene copy numbers results in higher titers of the EPSPS enzyme, the target of glyphosate, and confers resistance to glyphosate treatment. To understand the genomic unit and mechanism of EPSPS gene copy number proliferation, we developed and used a bacterial artificial chromosome (BAC) library from a highly resistant biotype to sequence the local genomic landscape flanking the EPSPS gene. By sequencing overlapping BACs, a 297 kb sequence was generated, hereafter referred to as the "EPSPS cassette." This region included several putative genes, dense clusters of tandem and inverted repeats, putative helitron and autonomous replication sequences, and regulatory elements. Whole genome shotgun sequencing (WGS) of two biotypes exhibiting high and no resistance to glyphosate was performed to compare genomic representation across the EPSPS cassette. Mapping of sequences for both biotypes to the reference EPSPS cassette revealed significant differences in upstream and downstream sequences relative to EPSPS with regard to both repetitive units and coding content between these biotypes. The differences in sequence may have resulted from a compounded-building mechanism such as repetitive transpositional events. The association of putative helitron sequences with the cassette suggests a possible amplification and distribution mechanism. Flow cytometry revealed that the EPSPS cassette added measurable genomic content. The adoption of glyphosate resistant cropping systems in major crops such as corn, soybean, cotton and canola coupled with excessive use of glyphosate herbicide has led to evolved glyphosate resistance in several important weeds. In Amaranthus palmeri, the amplification of the EPSPS cassette, characterized by a complex array of repetitive elements and putative helitron sequences, suggests an adaptive structural genomic mechanism that drives amplification and distribution around the genome. The added genomic content not found in glyphosate sensitive plants may be driving evolution through genome expansion.
Precursor slope distress leading up to the 2010 Mount Meager landslide, British Columbia
NASA Astrophysics Data System (ADS)
Roberti, Gioachino; Ward, Brent; van Wyk de Vries, Benjamin; Friele, Pierre; Clague, John; Perotti, Luigi; Giardino, Marco
2017-04-01
Volcanoes are highly prone to landslides, in part due to erosion of the flanks by glaciers and streams. Mount Meager (British Columbia, Canada) is a glacier-clad volcano that is one of the most landslide-prone areas in Canada, due in part to glacial erosion. In 2010, the south flank of the volcano failed catastrophically, generating one of the largest (˜50 x 106 m 3) landslides in Canadian history. We document the evolution of the edifice up to the time of this failure using an archive of historic aerial photographs spanning the period from 1948 to 2006. Oblique digital photos taken after the landslide yielded information on the geology and internal structure of the volcano. All photos were processed with Structure from Motion (SfM) photogrammetry. We used the SfM products to produce pre-and post-failure geomorphic maps that document glacier and edifice changes. The maps show that a glacier below the 2010 landslide source area re-advanced in the 1980s, then rapidly retreated up to the present. Our photographic reconstruction documents 60 years of progressive development of tension cracks, bulging, and precursor failures (1998, 2009) at the toe of the 2010 failure zone. The final 2010 collapse was conditioned by glacial debuttressing and triggered by hot summer weather accompanied by ice and snow melt. Meltwater increased porewater pressures in fragmented and fractured material at the base of the 2010 failure zone, causing it to mobilize, which in turn triggered several secondary failures controlled by lithology and faults. The landslide retrogressed from the base of the slope to near the peak of Mount Meager and involved basement rock and the overlying volcanic sequence. Elsewhere on the flanks of Mount Meager, large fractures have developed in recently deglaciated areas, conditioning these slopes for collapse and debris avalanches. Potential failures in these areas have larger volumes than the 2010 landslide. Atmospheric warming over the next several decades will cause further loss of snow and glacier ice, and induce additional slope instability. Satellite- and ground-based monitoring of these slopes might provide advanced warning of future landslides and could be used to reduce risk in regions downstream of the volcano.
Characterization of (CA)n microsatellite repeats from large-insert clones.
Litt, M; Browne, D
2001-05-01
The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.
NASA Astrophysics Data System (ADS)
Nyssen, Jan; Frankl, Amaury; Pontzeele, Jolien; De Visscher, Maarten; Billi, Paolo
2013-04-01
With the recovery of the European beaver (Castor fiber) and their capacity to engineer fluvial landscapes, questions arise as to how they influence river discharge and sediment transport. The Chevral river (Ardennes, Belgium) contains two beaver dam sequences which appeared in 2004 and count now about 30 dams. Flow discharges and sediment fluxes were measured at the in- and outflow of each dam sequence. Volumes of sediment deposited behind the dams were measured. Between 2004 and 2011, peak flows were topped off, and the magnitude of extreme events decreased. 1710 m³ of sediment were deposited behind the beaver dams, with an average sediment thickness of 25 cm. The thickness of the sediment layer is related to the area of the beaver ponds. Along the stream, beaver pond sediment thickness displayed a sinusoidal deposition pattern, in which ponds with thick sediment layers were preceded by a series of ponds with thinner sediment layers. A downstream textural coarsening in the dam sequences was also observed, probably due to dam failures subsequent to surges. Differences in sediment flux between the in- and outflow at the beaver pond sequence were related to the river hydrograph, with deposition taking place during the rising limbs and slight erosion during the falling limbs. The seven-year-old sequences have filtered 190 tons of sediment out of the Chevral river, which is of the same order of magnitude as the 374 tons measured in pond deposits, with the difference between the values corresponding to beaver excavations (60 tons), inflow from small tributaries, and runoff from the valley flanks. Hydrogeomorphic effects of C. fiber and C. canadensis activity are similar in magnitude. The detailed analysis of changes to hydrology in beaver pond sequences confirms the potential of beavers to contribute to river and wetland restoration and catchment management.
Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B
1994-01-01
The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Chery, Joyce G; Sass, Chodon; Specht, Chelsea D
2017-09-01
We developed a bioinformatic pipeline that leverages a publicly available genome and published transcriptomes to design primers in conserved coding sequences flanking targeted introns of single-copy nuclear loci. Paullinieae (Sapindaceae) is used to demonstrate the pipeline. Transcriptome reads phylogenetically closer to the lineage of interest are aligned to the closest genome. Single-nucleotide polymorphisms are called, generating a "pseudoreference" closer to the lineage of interest. Several filters are applied to meet the criteria of single-copy nuclear loci with introns of a desired size. Primers are designed in conserved coding sequences flanking introns. Using this pipeline, we developed nine single-copy nuclear intron markers for Paullinieae. This pipeline is highly flexible and can be used for any group with available genomic and transcriptomic resources. This pipeline led to the development of nine variable markers for phylogenetic study without generating sequence data de novo.
Cole, Shelley A; Voruganti, V Saroja; Cai, Guowen; Haack, Karin; Kent, Jack W; Blangero, John; Comuzzie, Anthony G; McPherson, John D; Gibbs, Richard A
2010-01-01
Background: Melanocortin-4-receptor (MC4R) haploinsufficiency is the most common form of monogenic obesity; however, the frequency of MC4R variants and their functional effects in general populations remain uncertain. Objective: The aim was to identify and characterize the effects of MC4R variants in Hispanic children. Design: MC4R was resequenced in 376 parents, and the identified single nucleotide polymorphisms (SNPs) were genotyped in 613 parents and 1016 children from the Viva la Familia cohort. Measured genotype analysis (MGA) tested associations between SNPs and phenotypes. Bayesian quantitative trait nucleotide (BQTN) analysis was used to infer the most likely functional polymorphisms influencing obesity-related traits. Results: Seven rare SNPs in coding and 18 SNPs in flanking regions of MC4R were identified. MGA showed suggestive associations between MC4R variants and body size, adiposity, glucose, insulin, leptin, ghrelin, energy expenditure, physical activity, and food intake. BQTN analysis identified SNP 1704 in a predicted micro-RNA target sequence in the downstream flanking region of MC4R as a strong, probable functional variant influencing total, sedentary, and moderate activities with posterior probabilities of 1.0. SNP 2132 was identified as a variant with a high probability (1.0) of exerting a functional effect on total energy expenditure and sleeping metabolic rate. SNP rs34114122 was selected as having likely functional effects on the appetite hormone ghrelin, with a posterior probability of 0.81. Conclusion: This comprehensive investigation provides strong evidence that MC4R genetic variants are likely to play a functional role in the regulation of weight, not only through energy intake but through energy expenditure. PMID:19889825
Yin, Yajuan; Cao, Guangli; Xue, Renyu; Gong, Chengliang
2014-10-01
The Streptomyces bacteriophage, φC31, uses a site-specific integrase enzyme to perform efficient recombination. The recombination system uses specific sequences to integrate exogenous DNA from the phage into a host. The sequences are known as the attP site in the phage and the attB site in the host. The system can be used as a genetic manipulation tool. In this study it has been applied to the transformation of cultured BmN cells and the construction of transgenic Bombyx mori individuals. A plasmid, pSK-attB/Pie1-EGFP/Zeo-PASV40, containing a cassette designed to express a egfp-zeocin fusion gene, was co-transfected into cultured BmN cells with a helper plasmid, pSK-Pie1/NLS-Int/NSL. Expression of the egfp-zeocin fusion gene was driven by an ie-1 promoter, downstream of a φC31 attB site. The helper plasmid encoded the φC31 integrase enzyme, which was flanked by two nuclear localization signals. Expression of the egfp-zeocin fusion gene could be observed in transformed cells. The two plasmids were also transferred into silkworm eggs to obtain transgenic silkworms. Successful integration of the fusion gene was indicated by the detection of green fluorescence, which was emitted by the silkworms. Nucleotide sequence analysis demonstrated that the attB site had been cut, to allow recombination between the attB and endogenous pseudo attP sites in the cultured silkworm cells and silkworm individuals.
Williams, Kevin R; Doak, Thomas G; Herrick, Glenn
2002-01-01
Background Ciliates employ massive chromatid breakage and de novo telomere formation during generation of the somatic macronucleus. Positions flanking the 81-MAC locus are reproducibly cut. But those flanking the Common Region are proposed to often escape cutting, generating three nested macronuclear chromosomes, two retaining "arms" still appended to the Common Region. Arm-distal positions must differ (in cis) from the Common Region flanks. Results The Common-Region-flanking positions also differ from the arm-distal positions in that they are "multi-TAS" regions: anchored PCR shows heterogeneous patterns of telomere addition sites, but arm-distal sites do not. The multi-TAS patterns are reproducible, but are sensitive to the sequence of the allele being processed. Thus, random degradation following chromatid cutting does not create this heterogeneity; these telomere addition sites also must be dictated by cis-acting sequences. Conclusions Most ciliates show such micro-heterogeneity in the precise positions of telomere addition sites. Telomerase is believed to be tightly associated with, and act in concert with, the chromatid-cutting nuclease: heterogeneity must be the result of intervening erosion activity. Our "weak-sites" hypothesis explains the correlation between alternative chromatid cutting at the Common Region boundaries and their multi-TAS character: when the chromatid-breakage machine encounters either a weak binding site or a weak cut site at these regions, then telomerase dissociates prematurely, leaving the new end subject to erosion by an exonuclease, which pauses at cis-acting sequences; telomerase eventually heals these resected termini. Finally, we observe TAS positioning influenced by trans-allelic interactions, reminiscent of transvection. PMID:12199911
Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun
2016-11-01
As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Knox, P.R.
1989-09-01
Donkey Creek and Coyote Creek fields contain combined reserves of approximately 35 million bbl of oil and are within a trend of fields on the eastern flank of the Powder River basin that totals over 100 million bbl of reserves. The principal producing formation is the Lower Cretaceous Fall River Sandstone. A study of 45 cores and 248 logs from the three pools in the Donkey Creek and Coyote fields has shown that the Fall River is composed of three progradational deltaic units deposited during a period of rising relative sea level. These are locally eroded and are filled bymore » a fluvial point-bar complex deposited following a lowering of relative sea level. Four important depositional facies have been recognized: the delta-front and distributary-channel sandstone of the highstand deltaic sequence and the point-bar sandstone and channel-abandonment of the lowstand fluvial sequence. Stratigraphic traps in Coyote Creek and south Donkey Creek pools are the result of permeable (250 md) point-bar sandstone (250 bbl oil/day ip) bounded updip by impermeable (0.1 md) channel abandonment mudstone. Most of the oil in the central Donkey Creek pool is produced from permeable (76 md) distributary-channel sandstone (150 bbl oil/day ip), which is restricted to the western flank of a structural nose. Lesser production, on the crest and upper western flank of the structure, is obtained from the less permeable (2.8 md) delta-front sandstone (50 bbl oil/day ip). Production is possibly limited to the crest and western flank by hydrodynamic processes.« less
Fukami, Maki; Naiki, Yasuhiro; Muroya, Koji; Hamajima, Takashi; Soneda, Shun; Horikawa, Reiko; Jinno, Tomoko; Katsumi, Momori; Nakamura, Akie; Asakura, Yumi; Adachi, Masanori; Ogata, Tsutomu; Kanzaki, Susumu
2015-09-01
Pseudoautosomal region 1 (PAR1) contains SHOX, in addition to seven highly conserved non-coding DNA elements (CNEs) with cis-regulatory activity. Microdeletions involving SHOX exons 1-6a and/or the CNEs result in idiopathic short stature (ISS) and Leri-Weill dyschondrosteosis (LWD). Here, we report six rare copy-number variations (CNVs) in PAR1 identified through copy-number analyzes of 245 ISS/LWD patients and 15 unaffected individuals. The six CNVs consisted of three microduplications encompassing SHOX and some of the CNEs, two microduplications in the SHOX 3'-region affecting one or four of the downstream CNEs, and a microdeletion involving SHOX exon 6b and its neighboring CNE. The amplified DNA fragments of two SHOX-containing duplications were detected at chromosomal regions adjacent to the original positions. The breakpoints of a SHOX-containing duplication resided within Alu repeats. A microduplication encompassing four downstream CNEs was identified in an unaffected father-daughter pair, whereas the other five CNVs were detected in ISS patients. These results suggest that microduplications involving SHOX cause ISS by disrupting the cis-regulatory machinery of this gene and that at least some of microduplications in PAR1 arise from Alu-mediated non-allelic homologous recombination. The pathogenicity of other rare PAR1-linked CNVs, such as CNE-containing microduplications and exon 6b-flanking microdeletions, merits further investigation.
Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M
1984-01-01
Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178
Structural evolution of Arsia Mons, Pavonis Mons, and Ascreus Mons Tharsis region of Mars
NASA Technical Reports Server (NTRS)
Crumpler, L. S.; Aubele, J. C.
1978-01-01
Analysis of Viking Orbiter data suggests that Arsia Mons, Pavonis Mons, and Ascreus Mons, three large shield volcanoes of the Tharsis volcanoes of Mars, have had similar evolutionary trends. Arsia Mons appears to have developed in the following sequence: (1) construction of a main shield volcano, (2) outbreak of parasitic eruption centers on the northeast and southwest flanks, (3) volcano-tectonic subsidence of the summit and formation of concentric fractures and grabens, possibly by evacuation of an underlying magma chamber during eruption of copious lavas from parasitic eruption centers on the northeast and southwest flanks, and (4) continued volcanism along a fissure or rift bisecting the main shield, resulting in flooding of the floor of the volcano-tectonic depression and inundation of the northeast and southwest flanks by voluminous lavas locally forming parasitic shields. In terms of this sequence Pavonis Mons has developed to stage (3) and Ascreus Mons has evolved to stage (2). This interpretation is supported by crater frequency-diameter distributions in the 0.1- to 3.0-km diameter range.
PH dependent adhesive peptides
Tomich, John; Iwamoto, Takeo; Shen, Xinchun; Sun, Xiuzhi Susan
2010-06-29
A novel peptide adhesive motif is described that requires no receptor or cross-links to achieve maximal adhesive strength. Several peptides with different degrees of adhesive strength have been designed and synthesized using solid phase chemistries. All peptides contain a common hydrophobic core sequence flanked by positively or negatively charged amino acids sequences.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fracasso, M.A.
The Travis Peak Formation (Lower Cretaceous) in the eastern East Texas basin represents a sand-rich, fluvial-deltaic depositional system. This lobate, high-constructive deltaic system prograded radially to the southeast from an Upshur County locus. Regional studies of the Travis Peak established a threefold internal stratigraphic framework: a middle sand-rich fluvial and delta-plain sequence is gradationally overlain and underlain by a marine-influenced delta-fringe zone with a higher mud content. The entire Travis Peak succession thins over the Bethany dome on the western flank of the Sabine uplift. However, the delta-fringe sequences are relatively thicker over the structure because of a disproportionately greatermore » thinning of the middle sandy fluvial-deltaic sequence. Lesser sand deposition over the Bethany dome reflects an active structural control over facies distribution. Gas production in the Bethany field and surrounding area is concentrated in thin zones (5-15 ft) of the upper delta-fringe sequence. This distribution probably reflects the increased abundance of mudstone beds in the upper delta-fringe interval, which may have served as source rocks or barriers to upward gas migration, or as both. The predominant trapping mechanism in this region is stratigraphic sand pinch-out in a structurally updip direction on the flanks of major structures. Studies of core and closely spaced electric logs west of the Bethany dome help define the depositional systems in the upper delta-fringe producing interval. This sequence comprises a complex mosaic of continental and marine facies, and exhibits an overall upward trend of increasing marine influence that spans a gradual transition into transgressive carbonates of the Sligo Formation.« less
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori
2007-01-01
Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.
Innate Immune Complexity in the Purple Sea Urchin: Diversity of the Sp185/333 System
Smith, L. Courtney
2012-01-01
The California purple sea urchin, Strongylocentrotus purpuratus, is a long-lived echinoderm with a complex and sophisticated innate immune system. There are several large gene families that function in immunity in this species including the Sp185/333 gene family that has ∼50 (±10) members. The family shows intriguing sequence diversity and encodes a broad array of diverse yet similar proteins. The genes have two exons of which the second encodes the mature protein and has repeats and blocks of sequence called elements. Mosaics of element patterns plus single nucleotide polymorphisms-based variants of the elements result in significant sequence diversity among the genes yet maintains similar structure among the members of the family. Sequence of a bacterial artificial chromosome insert shows a cluster of six, tightly linked Sp185/333 genes that are flanked by GA microsatellites. The sequences between the GA microsatellites in which the Sp185/333 genes and flanking regions are located, are much more similar to each other than are the sequences outside the microsatellites suggesting processes such as gene conversion, recombination, or duplication. However, close linkage does not correspond with greater sequence similarity compared to randomly cloned and sequenced genes that are unlikely to be linked. There are three segmental duplications that are bounded by GAT microsatellites and include three almost identical genes plus flanking regions. RNA editing is detectible throughout the mRNAs based on comparisons to the genes, which, in combination with putative post-translational modifications to the proteins, results in broad arrays of Sp185/333 proteins that differ among individuals. The mature proteins have an N-terminal glycine-rich region, a central RGD motif, and a C-terminal histidine-rich region. The Sp185/333 proteins are localized to the cell surface and are found within vesicles in subsets of polygonal and small phagocytes. The coelomocyte proteome shows full-length and truncated proteins, including some with missense sequence. Current results suggest that both native Sp185/333 proteins and a recombinant protein bind bacteria and are likely important in sea urchin innate immunity. PMID:22566951
DNA Barcode Sequence Identification Incorporating Taxonomic Hierarchy and within Taxon Variability
Little, Damon P.
2011-01-01
For DNA barcoding to succeed as a scientific endeavor an accurate and expeditious query sequence identification method is needed. Although a global multiple–sequence alignment can be generated for some barcoding markers (e.g. COI, rbcL), not all barcoding markers are as structurally conserved (e.g. matK). Thus, algorithms that depend on global multiple–sequence alignments are not universally applicable. Some sequence identification methods that use local pairwise alignments (e.g. BLAST) are unable to accurately differentiate between highly similar sequences and are not designed to cope with hierarchic phylogenetic relationships or within taxon variability. Here, I present a novel alignment–free sequence identification algorithm–BRONX–that accounts for observed within taxon variability and hierarchic relationships among taxa. BRONX identifies short variable segments and corresponding invariant flanking regions in reference sequences. These flanking regions are used to score variable regions in the query sequence without the production of a global multiple–sequence alignment. By incorporating observed within taxon variability into the scoring procedure, misidentifications arising from shared alleles/haplotypes are minimized. An explicit treatment of more inclusive terminals allows for separate identifications to be made for each taxonomic level and/or for user–defined terminals. BRONX performs better than all other methods when there is imperfect overlap between query and reference sequences (e.g. mini–barcode queries against a full–length barcode database). BRONX consistently produced better identifications at the genus–level for all query types. PMID:21857897
Van Kreijl, C F; Bos, J L
1977-01-01
The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740
Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses
Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa
2018-01-01
Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196
USDA-ARS?s Scientific Manuscript database
Several studies had reported homologous recombination between porcine circovirus type 2 (PCV2)-group 1 (Gp1) and -group 2 (Gp2) viruses. Interestingly, the recombination events described thus far mapped either within the Rep gene sequences or the sequences flanking the Rep gene region. Previously, ...
USDA-ARS?s Scientific Manuscript database
Previous research identified that the 5S ribosomal (rrn) gene and associated flanking sequences that are closely linked to the dkgB gene of Salmonella enterica were highly variable between serotypes, but not between subpopulations within the same serotype (PMID: 17005008). The degree of variability ...
USDA-ARS?s Scientific Manuscript database
BACKGROUND: The dkgB-linked ribosomal region of Salmonella enterica flanking a 5S gene shows genetic heterogeneity that distinguishes closely related serovars such as Enteritidis, Dublin, Gallinarum and Pullorum (Morales et al, 2006). We wanted to know how sequence-based ISR compared to the traditio...
Lu, Hong; Patil, Prabhu; Van Sluys, Marie-Anne; White, Frank F; Ryan, Robert P; Dow, J Maxwell; Rabinowicz, Pablo; Salzberg, Steven L; Leach, Jan E; Sonti, Ramesh; Brendel, Volker; Bogdanove, Adam J
2008-01-01
Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown. To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors) cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage. Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small number of genes or in non-coding sequences, and/or differences outside the clusters, potentially among regulatory targets or secretory substrates.
Sorenson, Laurie; Santini, Francesco
2013-01-01
Ray-finned fishes constitute the dominant radiation of vertebrates with over 32,000 species. Although molecular phylogenetics has begun to disentangle major evolutionary relationships within this vast section of the Tree of Life, there is no widely available approach for efficiently collecting phylogenomic data within fishes, leaving much of the enormous potential of massively parallel sequencing technologies for resolving major radiations in ray-finned fishes unrealized. Here, we provide a genomic perspective on longstanding questions regarding the diversification of major groups of ray-finned fishes through targeted enrichment of ultraconserved nuclear DNA elements (UCEs) and their flanking sequence. Our workflow efficiently and economically generates data sets that are orders of magnitude larger than those produced by traditional approaches and is well-suited to working with museum specimens. Analysis of the UCE data set recovers a well-supported phylogeny at both shallow and deep time-scales that supports a monophyletic relationship between Amia and Lepisosteus (Holostei) and reveals elopomorphs and then osteoglossomorphs to be the earliest diverging teleost lineages. Our approach additionally reveals that sequence capture of UCE regions and their flanking sequence offers enormous potential for resolving phylogenetic relationships within ray-finned fishes. PMID:23824177
NASA Technical Reports Server (NTRS)
Breault, D. T.; Lichtler, A. C.; Rowe, D. W.
1997-01-01
Collagen reporter gene constructs have be used to identify cell-specific sequences needed for transcriptional activation. The elements required for endogenous levels of COL1A1 expression, however, have not been elucidated. The human COL1A1 minigene is expressed at high levels and likely harbors sequence elements required for endogenous levels of activity. Using stably transfected osteoblastic Py1a cells, we studied a series of constructs (pOBColCAT) designed to characterize further the elements required for high level of expression. pOBColCAT, which contains the COL1A1 first intron, was expressed at 50-100-fold higher levels than ColCAT 3.6, which lacks the first intron. This difference is best explained by improved mRNA processing rather than a transcriptional effect. Furthermore, variation in activity observed with the intron deletion constructs is best explained by altered mRNA splicing. Two major regions of the human COL1A1 minigene, the 3'-flanking sequences and the minigene body, were introduced into pOBColCAT to assess both transcriptional enhancing activity and the effect on mRNA stability. Analysis of the minigene body, which includes the first five exons and introns fused with the terminal six introns and exons, revealed an orientation-independent 5-fold increase in CAT activity. In contrast the 3'-flanking sequences gave rise to a modest 61% increase in CAT activity. Neither region increased the mRNA half-life of the parent construct, suggesting that CAT-specific mRNA instability elements may serve as dominant negative regulators of stability. This study suggests that other sites within the body of the COL1A1 minigene are important for high expression, e.g. during periods of rapid extracellular matrix production.
Huszar, Tunde I; Jobling, Mark A; Wetton, Jon H
2018-04-12
Short tandem repeats on the male-specific region of the Y chromosome (Y-STRs) are permanently linked as haplotypes, and therefore Y-STR sequence diversity can be considered within the robust framework of a phylogeny of haplogroups defined by single nucleotide polymorphisms (SNPs). Here we use massively parallel sequencing (MPS) to analyse the 23 Y-STRs in Promega's prototype PowerSeq™ Auto/Mito/Y System kit (containing the markers of the PowerPlex® Y23 [PPY23] System) in a set of 100 diverse Y chromosomes whose phylogenetic relationships are known from previous megabase-scale resequencing. Including allele duplications and alleles resulting from likely somatic mutation, we characterised 2311 alleles, demonstrating 99.83% concordance with capillary electrophoresis (CE) data on the same sample set. The set contains 267 distinct sequence-based alleles (an increase of 58% compared to the 169 detectable by CE), including 60 novel Y-STR variants phased with their flanking sequences which have not been reported previously to our knowledge. Variation includes 46 distinct alleles containing non-reference variants of SNPs/indels in both repeat and flanking regions, and 145 distinct alleles containing repeat pattern variants (RPV). For DYS385a,b, DYS481 and DYS390 we observed repeat count variation in short flanking segments previously considered invariable, and suggest new MPS-based structural designations based on these. We considered the observed variation in the context of the Y phylogeny: several specific haplogroup associations were observed for SNPs and indels, reflecting the low mutation rates of such variant types; however, RPVs showed less phylogenetic coherence and more recurrence, reflecting their relatively high mutation rates. In conclusion, our study reveals considerable additional diversity at the Y-STRs of the PPY23 set via MPS analysis, demonstrates high concordance with CE data, facilitates nomenclature standardisation, and places Y-STR sequence variants in their phylogenetic context. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Wang, Lin; Liu, Simin; Niu, Tianhua; Xu, Xin
2005-03-18
Single nucleotide polymorphisms (SNPs) provide an important tool in pinpointing susceptibility genes for complex diseases and in unveiling human molecular evolution. Selection and retrieval of an optimal SNP set from publicly available databases have emerged as the foremost bottlenecks in designing large-scale linkage disequilibrium studies, particularly in case-control settings. We describe the architectural structure and implementations of a novel software program, SNPHunter, which allows for both ad hoc-mode and batch-mode SNP search, automatic SNP filtering, and retrieval of SNP data, including physical position, function class, flanking sequences at user-defined lengths, and heterozygosity from NCBI dbSNP. The SNP data extracted from dbSNP via SNPHunter can be exported and saved in plain text format for further down-stream analyses. As an illustration, we applied SNPHunter for selecting SNPs for 10 major candidate genes for type 2 diabetes, including CAPN10, FABP4, IL6, NOS3, PPARG, TNF, UCP2, CRP, ESR1, and AR. SNPHunter constitutes an efficient and user-friendly tool for SNP screening, selection, and acquisition. The executable and user's manual are available at http://www.hsph.harvard.edu/ppg/software.htm
Chromosomal arrangement of leghemoglobin genes in soybean.
Lee, J S; Brown, G G; Verma, D P
1983-01-01
A cluster of four different leghemoglobin (Lb) genes was isolated from AluI-HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases (kb) of contiguous DNA. These four genes, including a pseudogene, are present in the same orientation and are arranged in the order: 5'-Lba-Lbc1-Lb psi-Lbc3-3'. The intergenic regions average 2.5 kb. In addition to this main Lb locus, there are other Lb genes which do not appear to be contiguous to this locus. A sequence probably common to the 3' region of Lb loci was found flanking the Lbc3 gene. The 3' flanking region of the main Lb locus also contains a sequence that appears to be expressed more abundantly in root tissue. Another sequence which is primarily expressed in root and leaf is found 5' to two Lb loci. Overall, the main leghemoglobin locus is similar in structure to the mammalian globin gene loci. Images PMID:6310504
Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M; Kashi, Yechezkel
2004-04-01
Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria.
Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M.; Kashi, Yechezkel
2004-01-01
Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria. PMID:15066845
Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén
2012-05-01
To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.
Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.
The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
Ryner, L C; Takagaki, Y; Manley, J L
1989-01-01
To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang
2012-01-01
The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa, Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa.
Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang
2012-01-01
The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa,Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa. PMID:23240028
Plasma waves downstream of weak collisionless shocks
NASA Technical Reports Server (NTRS)
Coroniti, F. V.; Greenstadt, E. W.; Moses, S. L.; Smith, E. J.; Tsurutani, B. T.
1993-01-01
In September 1983 the International Sun Earth Explorer 3 (ISEE 3) International Cometary Explorer (ICE) spacecraft made a long traversal of the distant dawnside flank region of the Earth's magnetosphere and had many encounters with the low Mach number bow shock. These weak shocks excite plasma wave electric field turbulence with amplitudes comparable to those detected in the much stronger bow shock near the nose region. Downstream of quasi-perpendicular (quasi-parallel) shocks, the E field spectra exhibit a strong peak (plateau) at midfrequencies (1 - 3 kHz); the plateau shape is produced by a low-frequency (100 - 300 Hz) emission which is more intense behind downstream of two quasi-perpendicular shocks show that the low frequency signals are polarized parallel to the magnetic field, whereas the midfrequency emissions are unpolarized or only weakly polarized. A new high frequency (10 - 30 kHz) emission which is above the maximum Doppler shift exhibit a distinct peak at high frequencies; this peak is often blurred by the large amplitude fluctuations of the midfrequency waves. The high-frequency component is strongly polarized along the magnetic field and varies independently of the lower-frequency waves.
Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L
1980-01-01
The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547
Flank vents and graben as indicators of Late Amazonian volcanotectonic activity on Olympus Mons
NASA Astrophysics Data System (ADS)
Peters, S. I.; Christensen, P. R.
2017-03-01
Previous studies have focused on large-scale features on Olympus Mons, such as its flank terraces, the summit caldera complex, and the basal escarpment and aureole deposits. Here we identify and characterize previously unrecognized and unmapped small scale features to help further understand the volcanotectonic evolution of this enormous volcano. Using Context Camera, High Resolution Imaging Science Experiment, Thermal Emission Imaging System, High Resolution Stereo Camera Digital Terrain Model, and Mars Orbiter Laser Altimeter data, we identified and characterized the morphology and distribution of 60 flank vents and 84 grabens on Olympus Mons. We find that effusive eruptions have dominated volcanic activity on Olympus Mons in the Late Amazonian. Explosive eruptions were rare, implying volatile-poor magmas and/or a lack of magma-water interactions during the Late Amazonian. The distribution of flank vents suggests dike propagation of hundreds of kilometers and shallow magma storage. Small grabens, not previously observed in lower-resolution data, occur primarily on the lower flanks of Olympus Mons and indicate late-stage extensional tectonism. Based on superposition relationships, we have concluded two stages of development for Olympus Mons during the Late Amazonian: (1) primarily effusive resurfacing and formation of flank vents followed by (2) waning effusive volcanism and graben formation and/or reactivation. This developmental sequence resembles that proposed for Ascraeus Mons and other large Martian shields, suggesting a similar geologic evolution for these volcanoes.
NASA Astrophysics Data System (ADS)
McPhei, J.
1987-07-01
Late Carboniferous continental conglomerates interbedded with silicic ignimbrite sheets outcrop along more than 400 km of the western margin of the southern portion of the New England Orogen. Farther east, the coeval sedimentary facies are volcanogenic shallow marine and turbidite deposits. The volcanic source terrain, no longer exposed, was located to the west of the existing conglomerate-ignimbrite sequences and was underlain by continental crust which is, in part, represented by the northern Lachlan Fold Belt. The regional Late Carboniferous palaeogeography was similar to that of the present-day western continental margin of South America. The geology of the oceanward-flank of the Andean arc in northern Chile and a section of the Late Carboniferous continental sequence near Currabubula are comparable in detail. The Andean stratovolcanoes and ignimbrite centres thus provide the means of reconstruction of the Late Carboniferous volcanic source terrain. The geological record of both of these continental margin volcanic arcs, preserved in deposits of the arc flanks, is shaped by volcanism, especially the eruption of voluminous ignimbrites, and by uplift, deformation and glaciation centered on the arc. For the arc sections considered, diversity in the flank sequences arises because these controls vary in importance spatially and during the life of the arc (20-30 Ma). For the entire Andean arc, arc-parallel variations in the sites of active volcanism and its character appear to be related to differences in the continental crust thickness and the circumstances of subduction of oceanic crust, particularly the dip of the Benioff Zone. By analogy, variation in the age, duration and style of volcanic activity along the late Palaeozoic magmatic arc of the western New England Orogen perhaps reflects the former existence of significant differences in crust thickness and in the angle of subduction.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Increased complexity of circRNA expression during species evolution.
Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li
2017-08-03
Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.
A pause site for RNA polymerase II is associated with termination of transcription.
Enriquez-Harris, P; Levitt, N; Briggs, D; Proudfoot, N J
1991-01-01
Termination of transcription by RNA polymerase II has been postulated to involve a pausing process. We have identified such a pause signal, 350 bp into the 3' flanking region of the human alpha 2 globin gene at a position where termination is thought to occur. We show that this pause signal enhances the utilization of an upstream poly(A) site which is otherwise out-competed by a stronger downstream poly(A) site. We also demonstrate that the pause site rescues a poly(A) site that is inactive due to its location within an intron. Using nuclear run-on analysis we show that elongating RNA polymerase II molecules accumulate over this pause signal. Furthermore we show that when the pause site is positioned immediately downstream of a strong poly(A) signal, significant levels of transcription termination take place. Images PMID:2050120
cis-Acting elements important for retroviral RNA packaging specificity.
Beasley, Benjamin E; Hu, Wei-Shau
2002-05-01
Spleen necrosis virus (SNV) proteins can package RNA from distantly related murine leukemia virus (MLV), whereas MLV proteins cannot package SNV RNA efficiently. We used this nonreciprocal recognition to investigate regions of packaging signals that influence viral RNA encapsidation specificity. Although the MLV and SNV packaging signals (Psi and E, respectively) do not contain significant sequence homology, they both contain a pair of hairpins. This hairpin pair was previously proposed to be the core element in MLV Psi. In the present study, MLV-based vectors were generated to contain chimeric SNV/MLV packaging signals in which the hairpins were replaced with the heterologous counterpart. The interactions between these chimeras and MLV or SNV proteins were examined by virus replication and RNA analyses. SNV proteins recognized all of the chimeras, indicating that these chimeras were functional. We found that replacing the hairpin pair did not drastically alter the ability of MLV proteins to package these chimeras. These results indicate that, despite the important role of the hairpin pair in RNA packaging, it is not the major motif responsible for the ability of MLV proteins to discriminate between the MLV and SNV packaging signals. To determine the role of sequences flanking the hairpins in RNA packaging specificity, vectors with swapped flanking regions were generated and evaluated. SNV proteins packaged all of these chimeras efficiently. In contrast, MLV proteins strongly favored chimeras with the MLV 5'-flanking regions. These data indicated that MLV Gag recognizes multiple elements in the viral packaging signal, including the hairpin structure and flanking regions.
Mataseje, L F; Boyd, D A; Lefebvre, B; Bryce, E; Embree, J; Gravel, D; Katz, K; Kibsey, P; Kuhn, M; Langley, J; Mitchell, R; Roscoe, D; Simor, A; Taylor, G; Thomas, E; Turgeon, N; Mulvey, M R
2014-03-01
Emergence of plasmids harbouring bla(NDM-1) is a major public health concern due to their association with multidrug resistance and their potential mobility. PCR was used to detect bla(NDM-1) from clinical isolates of Providencia rettgeri (PR) and Klebsiella pneumoniae (KP). Antimicrobial susceptibilities were determined using Vitek 2. The complete DNA sequence of two bla(NDM-1) plasmids (pPrY2001 and pKp11-42) was obtained using a 454-Genome Sequencer FLX. Contig assembly and gap closures were confirmed by PCR-based sequencing. Comparative analysis was done using BLASTn and BLASTp algorithms. Both clinical isolates were resistant to all β-lactams, carbapenems, aminoglycosides, ciprofloxacin and trimethoprim/sulfamethoxazole, and susceptible to tigecycline. Plasmid pPrY2001 (113 295 bp) was isolated from PR. It did not show significant homology to any known plasmid backbone and contained a truncated repA and novel repB. Two bla(NDM-1)-harbouring plasmids from Acinetobacter lwoffii (JQ001791 and JQ060896) shared 100% similarity to a 15 kb region that contained bla(NDM-1). pPrY2001 also contained a type II toxin/antitoxin system. pKp11-42 (146 695 bp) was isolated from KP. It contained multiple repA genes. The plasmid backbone had the highest homology to the IncFIIk plasmid type (51% coverage, 100% nucleotide identity). The bla(NDM-1) region was unique in that it was flanked upstream by IS3000 and downstream by a novel transposon designated Tn6229. pKp11-42 also contained a number of mutagenesis and plasmid stability proteins. pPrY2001 differed from all known plasmids due to its novel backbone and repB. pKp11-42 was similar to IncFIIk plasmids and contained a number of genes that aid in plasmid persistence.
Geologic Mapping Investigations of Alba Mons, Mars
NASA Astrophysics Data System (ADS)
Crown, D. A.; Berman, D. C.; Scheidt, S. P.; Hauber, E.
2018-06-01
Geologic mapping of the summit region and western flank of Alba Mons at 1:1M-scale is revealing sequences of volcanic, tectonic, impact, and degradation processes that have formed and modified the northernmost of the Tharsis volcanoes.
Polycythemia in transgenic mice expressing the human erythropoietin gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.
1989-04-01
Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5{prime} flanking sequence and 0.7 kilobase of 3{prime} flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver,more » adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels.« less
Hearn, Arron; York, Ian A.; Bishop, Courtney; Rock, Kenneth L.
2010-01-01
Many MHC class I binding peptides are generated as N-extended precursors during protein degradation by the proteasome. These peptides can be subsequently trimmed by aminopeptidases in the cytosol and/or the ER to produce mature epitope. However, the contribution and specificity of each of these subcellular compartments in removing N-terminal amino acids for antigen presentation is not well defined. Here we investigate this issue for antigenic precursors that are expressed in the cytosol. By systematically varying the N-terminal flanking sequences of peptides we show that the amino acids upstream of an epitope precursor are a major determinant of the amount of antigen presentation. In many cases MHC class I binding peptides are produced through sequential trimming in both the cytosol and ER. Trimming of flanking residues in the cytosol contributes most to sequences that are poorly trimmed in the ER. Since N-terminal trimming has different specificity in the cytosol and ER, the cleavage of peptides in both of these compartments serves to broaden the repertoire of sequences that are presented. PMID:20351195
Cunha, Mariana Sequetin; Esposito, Danillo Lucas Alves; Rocco, Iray Maria; Maeda, Adriana Yurika; Vasami, Fernanda Gisele Silva; Nogueira, Juliana Silva; de Souza, Renato Pereira; Suzuki, Akemi; Addas-Carvalho, Marcelo; Barjas-Castro, Maria de Lourdes; Resende, Mariângela Ribeiro; Stucchi, Raquel Silveira Bello; Boin, Ilka de Fátima Santana Ferreira; Katz, Gizelda; Angerami, Rodrigo Nogueira
2016-01-01
We report here the genome sequence of Zika virus, strain ZikaSPH2015, containing all structural and nonstructural proteins flanked by the 5′ and 3′ untranslated region. It was isolated in São Paulo state, Brazil, in 2015, from a patient who received a blood transfusion from an asymptomatic donor at the time of donation. PMID:26941134
Janecek, S.
1996-01-01
The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins. PMID:8762144
Janecek, S
1996-06-01
The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins.
Flanking signal and mature peptide residues influence signal peptide cleavage
Choo, Khar Heng; Ranganathan, Shoba
2008-01-01
Background Signal peptides (SPs) mediate the targeting of secretory precursor proteins to the correct subcellular compartments in prokaryotes and eukaryotes. Identifying these transient peptides is crucial to the medical, food and beverage and biotechnology industries yet our understanding of these peptides remains limited. This paper examines the most common type of signal peptides cleavable by the endoprotease signal peptidase I (SPase I), and the residues flanking the cleavage sites of three groups of signal peptide sequences, namely (i) eukaryotes (Euk) (ii) Gram-positive (Gram+) bacteria, and (iii) Gram-negative (Gram-) bacteria. Results In this study, 2352 secretory peptide sequences from a variety of organisms with amino-terminal SPs are extracted from the manually curated SPdb database for analysis based on physicochemical properties such as pI, aliphatic index, GRAVY score, hydrophobicity, net charge and position-specific residue preferences. Our findings show that the three groups share several similarities in general, but they display distinctive features upon examination in terms of their amino acid compositions and frequencies, and various physico-chemical properties. Thus, analysis or prediction of their sequences should be separated and treated as distinct groups. Conclusion We conclude that the peptide segment recognized by SPase I extends to the start of the mature protein to a limited extent, upon our survey of the amino acid residues surrounding the cleavage processing site. These flanking residues possibly influence the cleavage processing and contribute to non-canonical cleavage sites. Our findings are applicable in defining more accurate prediction tools for recognition and identification of cleavage site of SPs. PMID:19091014
Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan
2009-02-01
The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nagao, Yoshiro; Sly, W.S.; Batanian, J.R.
1995-08-10
Carbonic anhydrase V (CA V) is expressed in mitochondrial matrix in liver and several other tissues. It is of interest for its putative roles in providing bicarbonate to carbamoyl phosphate synthetase for ureagenesis and to pyruvate carboxylase for gluconeogenesis and its possible importance in explaining certain inherited metabolic disorders with hyperammonemia and hypoglycemia. Following the recent characterization of the cDNA for human CA V, we report the isolation of the human gene from two {lambda} genomic libraries and its characterization. The CA V gene (CA5) is approximately 50 kb long and contains 7 exons and 6 introns. The exon-intron boundariesmore » are found in positions identical to those determined for the previously described CA II, CA III, and CA VII genes. Like the CA VII gene, CA5 does not contain typical TATA and CAAT promoter elements in the 5{prime} flanking region but does contain a TTTAA sequence 147 nucleotides upstream of the initiation codon. CA5 also contains a 12-bp GT-rich segment beginning 13 bp downstream of the polyadenylation signal in the 3{prime} untranslated region of exon 7. FISH analysis allowed CA5 to be assigned to chromosome 16q24.3. An unprocessed pseudogene containing sequence homologous to exons 3-7 and introns 3-6 was also isolated and was assigned by FISH analysis to chromosome 16p11.2-p12. 22 refs., 4 figs., 1 tab.« less
Man, Michal; Epel, Bernard L
2004-06-01
A replicon based on Tobacco mosaic virus that was engineered to express the open reading frame (ORF) of the green fluorescent protein (GFP) gene in place of the native coat protein (CP) gene from a minimal CP subgenomic (sg) RNA promoter was found to accumulate very low levels of GFP. Regulatory regions within the CP ORF were identified that, when presented as untranslated regions flanking the GFP ORF, enhanced or inhibited sg transcription and GFP expression. Full GFP expression from the CP sgRNA promoter required more than the first 20 nt of the CP ORF but not beyond the first 56 nt. Further analysis indicated the presence of an enhancer element between nt +25 and +55 with respect to the CP translation start site. The inclusion of this enhancer sequence upstream of the GFP ORF led to elevated sg transcription and to a 50-fold increase in GFP accumulation in comparison with a minimal CP promoter in which the entire CP ORF was displaced by the GFP ORF. Inclusion of the 3'-terminal 22 nt had a minor positive effect on GFP accumulation, but the addition of extended untranslated sequences from the 3' terminus of the CP ORF downstream of the GFP ORF was basically found to inhibit sg transcription. Secondary structure analysis programs predicted the CP sgRNA promoter to reside within two stable stem-loop structures, which are followed by an enhancer region.
Tai, Phillip W L; Wu, Hai; van Wijnen, André J; Stein, Gary S; Stein, Janet L; Lian, Jane B
2017-01-01
The ability to discover regulatory sequences that control bone-related genes during development has been greatly improved by massively parallel sequencing methodologies. To expand our understanding of cis-regulatory regions critical to the control of gene expression during osteoblastogenesis, we probed the presence of open chromatin states across the osteoblast genome using global DNase hypersensitivity (DHS) mapping. Our profiling of MC3T3 mouse pre-osteoblasts during differentiation has identified more than 224,000 unique DHS sites. Approximately 65% of these sites are dynamic during temporal stages of osteoblastogenesis, and a majority of them are located within non-promoter (intergenic and intronic) regions. Nearly half of all DHS sites (both constitutive and dynamic) overlap binding events of the bone-essential RUNX2 and/or the chromatin-related CTCF transcription factors. This finding reinforces the role of these regulatory proteins as essential components of the bone gene regulome. We observe a reduction in chromatin accessibility throughout the genome between pre-osteoblast and early osteoblasts. Our analysis also defined a class of differentially expressed genes that harbor DHS peaks centered within 1 kb downstream of transcriptional end sites (TES). These DHSs at the 3'-flanks of genes exhibit dynamic changes during differentiation that may impact regulation of the osteoblast genome. Taken together, the distribution of DHS regions within non-promoter locations harboring osteoblast and chromatin related transcription factor binding motifs, reflect novel cis-regulatory requirements to support temporal gene expression in differentiating osteoblasts.
Evaluation of the arrestin gene in patients with retinitis pigmentosa or an allied disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeStefano, D.J.; Berson, E.L.; Dryja, T.P.
1994-09-01
Arrestin, also called 48K protein or S-antigen, plays a role in deactivating rhodopsin, the photosensitive, seven-helix, G-protein receptor found in rod photoreceptors. In Drosophila, null mutations in arrestin genes cause a light-dependent photoreceptor degeneration. It is possible that a comparable photoreceptor degeneration in humans is caused by defects in the rod arrestin gene. In order to evaluate this possibility, we are characterizing the human arrestin locus on chromosome 2q. We screened a genomic library (5 million plaques) using an arrestin cDNA clone. Sixty-eight hybridizing clones were identified; portions of 7 clones were sequenced to determine the intron sequence flanking themore » exons. We are using SSCP analysis and direct genomic sequencing to screen the entire coding region, splice donor and acceptor sites, and the promoter region of the arrestin gene in 188 patients with autosomal dominant and 104 patients with autosomal recessive retinitis pigmentosa. We have already obtained flanking intron sequences necessary for SSCP analysis for 13 of 16 exons. So far, we have identified 4 silent base changes at codons 67 (TGC-to-TGT), 107 (CTG-to-CTC), 163 (GCC-to-GCT), and 288 (CTG-to-TGT), all with allele frequencies at 1% or less. Several other variant bands detected by SSCP analysis are currently being sequenced.« less
Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.
Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A
2018-05-01
Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.
Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon
2013-01-01
The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860
“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta
Hansen, Geneviève; Chilton, Mary-Dell
1996-01-01
We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167
Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R
2005-09-01
We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.
Characterization of circulating transfer RNA-derived RNA fragments in cattle
Casas, Eduardo; Cai, Guohong; Neill, John D.
2015-01-01
The objective was to characterize naturally occurring circulating transfer RNA-derived RNA fragments (tRFs) in cattle1. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences aligned to transfer RNA (tRNA) genes or their flanking sequences were characterized. Sequences aligned to the beginning of 5′ end of the mature tRNA were classified as tRF5; those aligned to the 3′ end of mature tRNA were classified as tRF3; and those aligned to the beginning of the 3′ end flanking sequences were classified as tRF1. There were 3,190,962 sequences that mapped to transfer RNA and small non-coding RNAs in the bovine genome. Of these, 2,323,520 were identified as tRF5s, 562 were tRF3s, and 81 were tRF1s. There were 866,799 sequences identified as other small non-coding RNAs (microRNA, rRNA, snoRNA, etc.) and were excluded from the study. The tRF5s ranged from 28 to 40 nucleotides; and 98.7% ranged from 30 to 34 nucleotides in length. The tRFs with the greatest number of sequences were derived from tRNA of histidine, glutamic acid, lysine, glycine, and valine. There was no association between number of codons for each amino acid and number of tRFs in the samples. The reason for tRF5s being the most abundant can only be explained if these sequences are associated with function within the animal. PMID:26379699
Cunha, Mariana Sequetin; Esposito, Danillo Lucas Alves; Rocco, Iray Maria; Maeda, Adriana Yurika; Vasami, Fernanda Gisele Silva; Nogueira, Juliana Silva; de Souza, Renato Pereira; Suzuki, Akemi; Addas-Carvalho, Marcelo; Barjas-Castro, Maria de Lourdes; Resende, Mariângela Ribeiro; Stucchi, Raquel Silveira Bello; Boin, Ilka de Fátima Santana Ferreira; Katz, Gizelda; Angerami, Rodrigo Nogueira; da Fonseca, Benedito Antonio Lopes
2016-03-03
We report here the genome sequence of Zika virus, strain ZikaSPH2015, containing all structural and nonstructural proteins flanked by the 5' and 3' untranslated region. It was isolated in São Paulo state, Brazil, in 2015, from a patient who received a blood transfusion from an asymptomatic donor at the time of donation. Copyright © 2016 Cunha et al.
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
Agouti sequence polymorphisms in coyotes, wolves and dogs suggest hybridization.
Schmutz, Sheila M; Berryere, Thomas G; Barta, Jodi L; Reddick, Kimberley D; Schmutz, Josef K
2007-01-01
Domestic dogs have been shown to have multiple alleles of the Agouti Signal Peptide (ASIP) in exon 4 and we wished to determine the level of polymorphism in the common wild canids of Canada, wolves and coyotes, in comparison. All Canadian coyotes and most wolves have banded hairs. The ASIP coding sequence of the wolf did not vary from the domestic dog but one variant was detected in exon 4 of coyotes that did not alter the arginine at this position. Two other differences were found in the sequence flanking exon 4 of coyotes compared with the 45 dogs and 1 wolf. The coyotes also demonstrated a relatively common polymorphism in the 3' UTR sequence that could be used for population studies. One of the ASIP alleles (R96C) in domestic dogs causes a solid black coat color in homozygotes. Although some wolves are melanistic, this phenotype does not appear to be caused by this same mutation. However, one wolf, potentially a dog-wolf hybrid or descendant thereof, was heterozygous for this allele. Likewise 2 coyotes, potentially dog-coyote or wolf-coyote hybrid descendants, were heterozygous for the several polymorphisms in and flanking exon 4. We could conclude that these were coyote-dog hybrids because both were heterozygous for 2 mutations causing fawn coat color in dogs.
The Specificity of Trimming of MHC Class I-Presented Peptides in the Endoplasmic Reticulum1
Hearn, Arron; York, Ian A.; Rock, Kenneth L.
2010-01-01
Aminopeptidases in the endoplasmic reticulum (ER) can cleave antigenic peptides and in so doing either create or destroy MHC class I-presented epitopes. However the specificity of this trimming process overall and of the major ER aminopeptidase ERAP1 in particular is not well understood. This issue is important because peptide trimming influences the magnitude and specificity of CD8 T cell responses. By systematically varying the N-terminal flanking sequences of peptides in a cell free biochemical system and in intact cells, we elucidated the specificity of ERAP1 and of ER trimming overall. ERAP1 can cleave after many amino acids on the N-terminus of epitope precursors but does so at markedly different rates. The specificity seen with purified ERAP1 is similar to that observed for trimming and presentation of epitopes in the ER of intact cells. We define N-terminal sequences that are favorable or unfavorable for antigen presentation in ways that are independent from the epitopes core sequence. When databases of known presented peptides were analyzed, the residues that were preferred for the trimming of model peptide precursors were found to be overrepresented in N-terminal flanking sequences of epitopes generally. These data define key determinants in the specificity of antigen processing. PMID:19828632
bpRNA: large-scale automated annotation and analysis of RNA secondary structure.
Danaee, Padideh; Rouches, Mason; Wiley, Michelle; Deng, Dezhong; Huang, Liang; Hendrix, David
2018-05-09
While RNA secondary structure prediction from sequence data has made remarkable progress, there is a need for improved strategies for annotating the features of RNA secondary structures. Here, we present bpRNA, a novel annotation tool capable of parsing RNA structures, including complex pseudoknot-containing RNAs, to yield an objective, precise, compact, unambiguous, easily-interpretable description of all loops, stems, and pseudoknots, along with the positions, sequence, and flanking base pairs of each such structural feature. We also introduce several new informative representations of RNA structure types to improve structure visualization and interpretation. We have further used bpRNA to generate a web-accessible meta-database, 'bpRNA-1m', of over 100 000 single-molecule, known secondary structures; this is both more fully and accurately annotated and over 20-times larger than existing databases. We use a subset of the database with highly similar (≥90% identical) sequences filtered out to report on statistical trends in sequence, flanking base pairs, and length. Both the bpRNA method and the bpRNA-1m database will be valuable resources both for specific analysis of individual RNA molecules and large-scale analyses such as are useful for updating RNA energy parameters for computational thermodynamic predictions, improving machine learning models for structure prediction, and for benchmarking structure-prediction algorithms.
Bhatia, S; Singh Negi, M; Lakshmikumaran, M
1996-11-01
EcoRI restriction of the B. nigra rDNA recombinants, isolated from a lambda genomic library, showed that the 3.9-kb fragment corresponded to the Intergenic Spacer (IGS), which was sequenced and found to be 3,928 bp in size. Sequence and dot-matrix analyses showed that the organization of the B. nigra rDNA IGS was typical of most rDNA spacers, consisting of a central repetitive region and flanking unique sequences on either side. The repetitive region was composed of two repeat families-RF 'A' and RF 'B.' The B. nigra RF 'A' consisted of a tandem array of three full-length copies of a 106-bp sequence element. RF 'B' was composed of 66 tandemly repeated elements. Each 'B' element was only 21-bp in size and this is the smallest repeat unit identified in plant rDNA to date. The putative transcription initiation site (TIS) was identified as nucleotide position 3,110. Based on the sequence analysis it was suggested that the present organization of the repeat families was generated by successive cycles of deletions and amplifications and was being maintained by homogenization processes such as gene conversion and crossing-over.A detailed comparison of the rDNA IGS sequences of the three diploid Brassica species-namely, B. nigra, B. campestris, and B. oleracea-was carried out. First, comparisons revealed that B. campestris and B. oleracea were close to each other as the repeat families in both showed high sequence homology between each other. Second, the repeat elements in both the species were organized in an interspersed manner. Third, a 52-bp sequence, present just downstream of the repeats in B. campestris, was found to be identical to the B. oleracea repeats, thereby suggesting a common progenitor. On the other hand, in B. nigra no interspersion pattern of organization of repeats was observed. Further, the B. nigra RF 'A' was identified as distinct from the repeat families of B. campestris and B. oleracea. Based on this analysis, it was suggested that during speciation B. campestris and B. oleracea evolved in one lineage whereas B. nigra diverged into a separate lineage. The comparative analysis of the IGS helped in identifying not only conserved ancestral sequence motifs of possible functional significance such as promoters and enhancers, but also sequences which showed variation between the three diploid species and were therefore identified as species-specific sequences.
Arsenic loads in Spearfish Creek, western South Dakota, water years 1989-91
Driscoll, Daniel G.; Hayes, Timothy S.
1995-01-01
Numerous small tributaries on the eastern flank of Spearfish Creek originate within a mineralized area with a long history of gold-mining activity. Some streams draining this area are known to have elevated concentrations of arsenic. One such tributary is Annie Creek, where arsenic concentrations regularly approach the Maximum Contaminant Level of 50 mg/L (micrograms per liter) established by the U.S. Environmental Protection Agency. A site on Annie Creek was proposed for inclusion on the National Priorities List by the Environmental Protection Agency in 1991. This report presents information about arsenic loads and concentrations in Spearfish Creek and its tributaries, including Annie Creek. Stream types were classified according to geologic characteris- tics and in-stream arsenic concentrations. The first type includes streams that lack significant arsenic sources and have low in-stream arsenic concentra- tions. The second type has abundant arsenic sources and high in-stream concentrations. The third type has abundant arsenic sources but only moderate in-stream concentrations. The fourth type is a mixture of the first three types. Annual loads of dissolved arsenic were calculated for two reaches of Spearfish Creek to quantify arsenic loads at selected gaging stations during water years 1989-91. Mass-balance calculations also were performed to estimate arsenic concentrations for ungaged inflows to Spearfish Creek. The drainage area of the upstream reach includes significant mineralized areas, whereas the drainage area of the downstream reach generally is without known arsenic sources. The average load of dissolved arsenic transported from the upstream reach of Spearfish Creek, which is representative of a type 4 stream, was 158 kilograms per year, calculated for station 06430900, Spearfish Creek above Spearfish. Gaged headwater tributaries draining unmineralized areas (type 1) contributed only 16 percent of the arsenic load in 63 percent of the discharge. Annie Creek (type 2), which has the highest measured arsenic concentra- tions in the Spearfish Creek drainage, contributed about 15 percent of the arsenic load in about 2 percent of the discharge of the upstream reach. Squaw Creek, which drains another mineralized area, but has only moderate in-stream concentrations (type 3), contributed 4 percent of the arsenic load in 5 percent of the discharge. Ungaged inflows to the reach contributed the remaining 65 percent of the arsenic load in 30 percent of the discharge. The calculated loads from ungaged inflows include all arsenic contributed by surface- and ground-water sources, as well as any additions of arsenic from dissolution of arsenic-bearing solid phases, or from desorption of arsenic from solid surfaces, within the streambed of the upstream reach. Mass-balance calculations indicate that dissolved arsenic concentrations of the ungaged inflows in the upstream reach averaged about 9 mg/L. In-stream arsenic concentrations of ungaged inflows from the unmineralized western flank of Spearfish Creek probably are generally low (type 1). Thus, in-stream arsenic concentrations for ungaged inflows draining the mineralized eastern flank of Spearfish probably average almost twice that level, or about 18 mg/L. Some ungaged, eastern-flank inflows probably are derived from type 3 drainages, with only moderate arsenic concentrations. If so, other ungaged, eastern-flank inflows could have in-stream arsenic concentrations similar to those of Annie Creek. No significant arsenic sources were apparent in the downstream reach of Spearfish Creek. Over the course of the downstream reach, arsenic concentrations decreased somewhat, probably resulting from dilution, as well as from possible chemical adsorption to sediment surfaces or arsenic-phase precipitation. A decrease in arsenic loads resulted from various diversions from the creek and from the potential chemical removal processes. Because of a large margin of error associated with calculation o
Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit
2016-05-01
Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.
Mavromatis, Konstantinos; Land, Miriam L; Brettin, Thomas S; Quest, Daniel J; Copeland, Alex; Clum, Alicia; Goodwin, Lynne; Woyke, Tanja; Lapidus, Alla; Klenk, Hans Peter; Cottingham, Robert W; Kyrpides, Nikos C
2012-01-01
The emergence of next generation sequencing (NGS) has provided the means for rapid and high throughput sequencing and data generation at low cost, while concomitantly creating a new set of challenges. The number of available assembled microbial genomes continues to grow rapidly and their quality reflects the quality of the sequencing technology used, but also of the analysis software employed for assembly and annotation. In this work, we have explored the quality of the microbial draft genomes across various sequencing technologies. We have compared the draft and finished assemblies of 133 microbial genomes sequenced at the Department of Energy-Joint Genome Institute and finished at the Los Alamos National Laboratory using a variety of combinations of sequencing technologies, reflecting the transition of the institute from Sanger-based sequencing platforms to NGS platforms. The quality of the public assemblies and of the associated gene annotations was evaluated using various metrics. Results obtained with the different sequencing technologies, as well as their effects on downstream processes, were analyzed. Our results demonstrate that the Illumina HiSeq 2000 sequencing system, the primary sequencing technology currently used for de novo genome sequencing and assembly at JGI, has various advantages in terms of total sequence throughput and cost, but it also introduces challenges for the downstream analyses. In all cases assembly results although on average are of high quality, need to be viewed critically and consider sources of errors in them prior to analysis. These data follow the evolution of microbial sequencing and downstream processing at the JGI from draft genome sequences with large gaps corresponding to missing genes of significant biological role to assemblies with multiple small gaps (Illumina) and finally to assemblies that generate almost complete genomes (Illumina+PacBio).
Itzhaki, H; Maxson, J M; Woodson, W R
1994-09-13
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.
The volcanotectonic structures of Ascraeus Mons
NASA Astrophysics Data System (ADS)
Byrne, Paul; van Wyk de Vries, Benjamin; Murray, John; Troll, Valentin
2010-05-01
Ascraeus Mons is the tallest of three large volcanoes situated to the NE of the Tharsis Rise and aligned parallel to a NE-SW regional structural trend. With a vertical relief of 14.9 km and an E-W diameter of 400 km, the main shield has a convex-upward morphology and a summit plateau, whilst significantly younger lava rift aprons issue from expansive embayments on its lower flanks onto the surrounding plains. The volcano hosts several types of well-preserved surface structures, and so has served as a basis for understanding Martian volcano geodynamics. Previous studies have not incorporated the full set of structures on Ascraeus Mons, however, and have been limited by photogeological data of lower resolution than that available today. We have used a GIS of MOLA, HRSC, and CTX data to map the spatial and temporal distributions of the most pronounced structures on Ascraeus Mons — its summit calderas, flank terraces, arcuate graben, and pit craters — to develop as comprehensive an evolutionary sequence for this volcano as possible. We summarise our mapping results here. · The 55-km wide caldera complex consists of at least three NE-SW-aligned depressions, with a possible fourth caldera on the periphery. Depths range from 818 m for the shallowest caldera to 3,110 m for the deepest. Whilst most lavas on the volcano are summit-derived, even the latest flows are cut by post-caldera formation subsidence and fracturing. · Flank terraces, topographically subtle outward-verging, convex-upward structures, encircle Ascraeus Mons in an imbricate, fish-scale pattern. 142 terraces in total extend from immediately below the summit to the basal plains, but do not occur on the rift aprons. The mean circumferential length for terraces is 31.9 km, though terraces over 60 km long lie on the NW and SE flanks. · Arcuate graben crosscut the NW flanks and surrounding plains, and extend for ca. 90° concentric to the volcano. These structures vary in width from 400 m to 1,200 m, and are between 10 and 100 m deep. They are shallower and more laterally continuous than the pit troughs observed elsewhere on the flanks (described below), although pits do occur nearby, and in places are laterally contiguous with graben. · Pit craters are circular or ovoid rimless depressions, between 190 and 3,000 m in diameter and several 100s m deep, that are superposed upon the latest lavas on the volcano. Rows of pits form crater chains, whilst chains can merge to form troughs. We mapped 4,166 pits across the volcano, trending circumferential near the summit to radial low on the NE and SW flanks; here, chains and troughs coalesce to form the embayments. Caldera formation is likely the result of evacuation of an underlying magma chamber. Recent work indicates that flank terraces are compressive structures, formed by upper flank shortening of a volcano as it flexes the supporting lithosphere; flexure could also account for the arcuate graben concentric to the shield. In contrast, pit craters are probably extensional structures, formed by collapse into subsurface voids. A developmental sequence for Ascraeus Mons, therefore, needs to account for the disparate formation mechanisms proposed for these spatially coincident structures. Incorporating our findings with earlier studies of this volcano, we conclude that Ascraeus has experienced a history of rapid shield building, coeval with magma chamber evacuation, which initiated sustained lithospheric flexure and led to the formation of flank terraces and concentric graben. Main shield construction was followed by a period of repose before rift apron volcanism initiated on the lower flanks along the NE-SW regional lineament. Ultimately, the dominant tectonic regime upon the volcano's flanks changed from compressional to extensional, resulting in the development of pit craters. This model may help establish a framework for understanding the volcanotectonic histories of large shields across Mars.
Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou
2018-04-01
While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.
Maia, A L; Berry, M J; Sabbag, R; Harney, J W; Larsen, P R
1995-08-01
The type 1 deiodinase (D1) provides the major portion of the circulating T3 in vertebrates. In C3H and certain other inbred mice, liver and kidney D1 activity is 5- to 10-fold lower than in the common phenotype, C57. The lower D1 levels are paralleled by a decreased normal-sized dio1 mRNA and hyperthyroxinemia. Low activity cosegregates with a restriction fragment length variant (RFLV) in both inbred and recombinant strains, indicating it is due to differences in the dio1 gene. The exonic structure and the deduced amino acid sequences are identical for both strains and highly homologous to that of the rat. The RFLV is due to an approximately 150-base pair expansion of repetitive sequences in the second intron of the C3H gene, but this segment does not differentially affect the transient expression of a human GH gene. The promoter and 5'-flanking regions of the C3H and C57 dio1 genes are very similar and are GC rich without TATA or CCAAT boxes. However, functional assays of 1.5-kilobase 5'-flanking dio1-CAT constructs showed 2- to 3-fold higher activity of the C57-CAT constructs. Deletion mutants showed that sequences between -705 and -162 were the cause of this. In this region, the only major difference between the two genes is a 21-base pair insert containing five CTG repeats in the C3H promoter. This difference also cosegregates with low D1 activity and the intron RFLV in four other mouse strains. The correlation of the CTG repeat insert with both in vitro and in vivo expression and the absence of other significant sequence differences in the 5'-flanking region argue that this is the major explanation for the impaired expression of the dio1 gene and the resulting hyperthyroxinemia of the C3H mouse.
Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A
2016-01-01
The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.
Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J
2000-11-01
Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
Dias, Miguel de Sousa; Hernan, Imma; Pascual, Beatriz; Borràs, Emma; Mañé, Begoña; Gamundi, Maria José
2013-01-01
Purpose To devise an effective method for detecting mutations in 12 genes (CA4, CRX, IMPDH1, NR2E3, RP9, PRPF3, PRPF8, PRPF31, PRPH2, RHO, RP1, and TOPORS) commonly associated with autosomal dominant retinitis pigmentosa (adRP) that account for more than 95% of known mutations. Methods We used long-range PCR (LR-PCR) amplification and next-generation sequencing (NGS) performed in a GS Junior 454 benchtop sequencing platform. Twenty LR-PCR fragments, between 3,000 and 10,000 bp, containing all coding exons and flanking regions of the 12 genes, were obtained from DNA samples of patients with adRP. Sequencing libraries were prepared with an enzymatic (Fragmentase technology) method. Results Complete coverage of the coding and flanking sequences of the 12 genes assayed was obtained with NGS, with an average sequence depth of 380× (ranging from 128× to 1,077×). Five previous known mutations in the adRP genes were detected with a sequence variation percentage between 35% and 65%. We also performed a parallel sequence analysis of four samples, three of them new patients with index adRP, in which two novel mutations were detected in RHO (p.Asn73del) and PRPF31 (p.Ile109del). Conclusions The results demonstrate that genomic LR-PCR amplification together with NGS is an effective method for analyzing individual patient samples for mutations in a monogenic heterogeneous disease such as adRP. This approach proved effective for the parallel analysis of adRP and has been introduced as routine. Additionally, this approach could be extended to other heterogeneous genetic diseases. PMID:23559859
Fleckenstein, E C; Dirks, W G; Drexler, H G
2000-02-01
The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.
Chen, Zhuo; Xu, Shixia; Zhou, Kaiya; Yang, Guang
2011-10-27
A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future.
Burke, Kathleen A; Kauffman, Karlina J; Umbaugh, C Samuel; Frey, Shelli L; Legleiter, Justin
2013-05-24
Huntington disease (HD) is caused by an expanded polyglutamine (poly(Q)) repeat near the N terminus of the huntingtin (htt) protein. Expanded poly(Q) facilitates formation of htt aggregates, eventually leading to deposition of cytoplasmic and intranuclear inclusion bodies containing htt. Flanking sequences directly adjacent to the poly(Q) domain, such as the first 17 amino acids on the N terminus (Nt17) and the polyproline (poly(P)) domain on the C-terminal side of the poly(Q) domain, heavily influence aggregation. Additionally, htt interacts with a variety of membraneous structures within the cell, and Nt17 is implicated in lipid binding. To investigate the interaction between htt exon1 and lipid membranes, a combination of in situ atomic force microscopy, Langmuir trough techniques, and vesicle permeability assays were used to directly monitor the interaction of a variety of synthetic poly(Q) peptides with different combinations of flanking sequences (KK-Q35-KK, KK-Q35-P10-KK, Nt17-Q35-KK, and Nt17-Q35-P10-KK) on model membranes and surfaces. Each peptide aggregated on mica, predominately forming extended, fibrillar aggregates. In contrast, poly(Q) peptides that lacked the Nt17 domain did not appreciably aggregate on or insert into lipid membranes. Nt17 facilitated the interaction of peptides with lipid surfaces, whereas the poly(P) region enhanced this interaction. The aggregation of Nt17-Q35-P10-KK on the lipid bilayer closely resembled that of a htt exon1 construct containing 35 repeat glutamines. Collectively, this data suggests that the Nt17 domain plays a critical role in htt binding and aggregation on lipid membranes, and this lipid/htt interaction can be further modulated by the presence of the poly(P) domain.
Relevance of sodium/glucose cotransporter-1 (SGLT1) to diabetes mellitus and obesity in dogs.
Batchelor, D J; German, A J; Shirazi-Beechey, S P
2013-04-01
Glucose transport across the enterocyte brush border membrane by sodium/glucose cotransporter-1 (SGLT1, coded by Slc5a1) is the rate-limiting step for intestinal glucose transport. The relevance of SGLT1 expression in predisposition to diabetes mellitus and to obesity was investigated in dogs. Cultured Caco-2/TC7 cells were shown to express SGLT1 in vitro. A 2-kbp fragment of the Slc5a1 5' flanking region was cloned from canine genomic DNA, ligated into reporter gene plasmids, and shown to drive reporter gene expression in these cells above control (P < 0.001). To determine the effect of the 3 known SNPs in this region on promoter function, new promoter/reporter constructs (all permutations of these 3 SNPs) were created by site-directed mutagenesis. No significant differences in promoter function were seen, suggesting that these SNPs do not have a significant effect on the constitutive transcription of SGLT1 mRNA in dogs. A search for novel SNPs in this region in dogs was made in 2 breeds predisposed to diabetes mellitus (Samoyed and cairn terrier), 2 breeds that rarely develop diabetes (boxer and German shepherd), and 2 breeds predisposed to obesity (Labrador retriever and cocker spaniel). The Slc5a1 5' flanking region was amplified from 10 healthy individuals of each of these breeds by high-fidelity PCR with the use of breed-labeled primers and sequenced by pyrosequencing. The sequence of the Slc5a1 5' flanking region in all individuals of all breeds tested was identical. On this evidence, variations in Slc5a1 promoter sequence between dogs do not influence the pathogenesis of diabetes mellitus or obesity in these breeds. Copyright © 2013 Elsevier Inc. All rights reserved.
2011-01-01
Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future. PMID:22029548
A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle
NASA Astrophysics Data System (ADS)
Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo
2003-04-01
From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.
Allnutt, T R; Roper, K; Henry, C
2008-01-23
A genetic marker system based on the S1 Short Interspersed Elements (SINEs) in the important commercial crop, oilseed rape ( Brassica napus L.) has been developed. SINEs provided a successful multilocus, dominant marker system that was capable of clearly delineating winter- and spring-type crop varieties. Sixteen of 20 varieties tested showed unique profiles from the 17 polymorphic SINE markers generated. The 3' or 5' flank region of nine SINE markers were cloned, and DNA was sequenced. In addition, one putative pre-transposition SINE allele was cloned and sequenced. Two SINE flanking sequences were used to design real-time PCR assays. These quantitative SINE assays were applied to study the genetic structure of eight fields of oilseed rape crops. Studied fields were more genetically diverse than expected for the chosen loci (mean H T = 0.23). The spatial distribution of SINE marker frequencies was highly structured in some fields, suggesting locations of volunteer impurities within the crop. In one case, the assay identified a mislabeling of the crop variety. SINE markers were a useful tool for crop genetics, phylogenetics, variety identification, and purity analysis. The use and further application of quantitative, real-time PCR markers are discussed.
Shao, Chengchen; Zhang, Yaqi; Zhou, Yueqin; Zhu, Wei; Xu, Hongmei; Liu, Zhiping; Tang, Qiqun; Shen, Yiwen; Xie, Jianhui
2015-01-01
Aim To systemically select and evaluate short tandem repeats (STRs) on the chromosome 14 and obtain new STR loci as expanded genotyping markers for forensic application. Methods STRs on the chromosome 14 were filtered from Tandem Repeats Database and further selected based on their positions on the chromosome, repeat patterns of the core sequences, sequence homology of the flanking regions, and suitability of flanking regions in primer design. The STR locus with the highest heterozygosity and polymorphism information content (PIC) was selected for further analysis of genetic polymorphism, forensic parameters, and the core sequence. Results Among 26 STR loci selected as candidates, D14S739 had the highest heterozygosity (0.8691) and PIC (0.8432), and showed no deviation from the Hardy-Weinberg equilibrium. 14 alleles were observed, ranging in size from 21 to 34 tetranucleotide units in the core region of (GATA)9-18 (GACA)7-12 GACG (GACA)2 GATA. Paternity testing showed no mutations. Conclusion D14S739 is a highly informative STR locus and could be a suitable genetic marker for forensic applications in the Han Chinese population. PMID:26526885
2012-01-01
Background The mycobacteriophage large serine recombinase Bxb1 catalyzes site-specific recombination between its corresponding attP and attB recognition sites. Previously, we and others have shown that Bxb1 has catalytic activity in various eukaryotic species including Nicotiana tabacum, Schizosaccharomyces pombe, insects and mammalian cells. Results In this work, the Bxb1 recombinase gene was transformed and constitutively expressed in Arabidopsis thaliana plants harboring a chromosomally integrated attP and attB-flanked target sequence. The Bxb1 recombinase successfully excised the target sequence in a conservative manner and the resulting recombination event was heritably transmitted to subsequent generations in the absence of the recombinase transgene. In addition, we also show that Bxb1 recombinase expressing plants can be manually crossed with att-flanked target transgenic plants to generate excised progeny. Conclusion The Bxb1 large serine recombinase performs site-specific recombination in Arabidopsis thaliana germinal tissue, producing stable lines free of unwanted DNA. The precise site-specific deletion produced by Bxb1 in planta demonstrates that this enzyme can be a useful tool for the genetic engineering of plants without selectable marker transgenes or other undesirable exogenous sequences. PMID:22436504
NASA Astrophysics Data System (ADS)
Szymanski, E.; Stockli, D.; Johnson, P.; Kattan, F. H.; Al Shamari, A.
2006-12-01
Numerous models exploring the rupturing modes and mechanisms of continental lithosphere are based on geological evidence from the Red Sea/Gulf of Suez rift system. Individually, the Red Sea basin is the prototype for many models of orthogonal continental rifting. Despite being a classic example of continental extension, many temporal and spatial strain distribution aspects, as well as the dynamic evolution of the rift architecture of the Red Sea, remain poorly constrained. Critical data come mostly from the Gulf of Suez and the Egyptian and Yemeni margins of the Red Sea; the rift flanks in Sudan and Saudi Arabia have remained largely unstudied, leaving a large information gap along the central portions of the rift system. Improving continental lithosphere rupture models requires an absolute understanding of the timing and magnitude of strain partitioning along the full rift flank. This study focuses on the development of extensional structures, syn- extensional sedimentary deposits, and rift-related Tertiary basaltic volcanism along the central flank of the rift system in Saudi Arabia. Geo- and thermochronometric techniques are used to elucidate the evolution of inboard and outboard strain markers manifested by structurally-controlled extensional basins that parallel the trend of the main Red Sea rift. Constraints on the dynamics of rift flank deformation are achieved through the collection of thermochronometric transects that traverse both the entire Arabian shield and individual normal faults that bound inland basins. Preliminary results show inland basins as asymmetric half-grabens filled by tilted Cenozoic sedimentary strata and separated by exhumed basement fault blocks. The most prominent extensional basin is the NW-trending Hamd-Jizil basin, located north of Madinah, measuring ~200 km along strike and up to 20 km in width. The Hamd-Jizil basin is structurally characterized by two half-grabens exposing a series of syn-rift siliciclastic sedimentary sections below Tertiary basalts. In certain areas, thick basalt sequences provide basin infill and appear faulted by a younger series of normal faults. Work continues on the production of further geo- and thermochronologic data for the Tertiary basalt sequences as well as the entire rift flank region.
Chandran, Anil Kumar Nalini; Lee, Gang-Seob; Yoo, Yo-Han; Yoon, Ung-Han; Ahn, Byung-Ohg; Yun, Doh-Won; Kim, Jin-Hyun; Choi, Hong-Kyu; An, GynHeung; Kim, Tae-Ho; Jung, Ki-Hong
2016-12-01
Rice is one of the most important food crops for humans. To improve the agronomical traits of rice, the functions of more than 1,000 rice genes have been recently characterized and summarized. The completed, map-based sequence of the rice genome has significantly accelerated the functional characterization of rice genes, but progress remains limited in assigning functions to all predicted non-transposable element (non-TE) genes, estimated to number 37,000-41,000. The International Rice Functional Genomics Consortium (IRFGC) has generated a huge number of gene-indexed mutants by using mutagens such as T-DNA, Tos17 and Ds/dSpm. These mutants have been identified by 246,566 flanking sequence tags (FSTs) and cover 65 % (25,275 of 38,869) of the non-TE genes in rice, while the mutation ratio of TE genes is 25.7 %. In addition, almost 80 % of highly expressed non-TE genes have insertion mutations, indicating that highly expressed genes in rice chromosomes are more likely to have mutations by mutagens such as T-DNA, Ds, dSpm and Tos17. The functions of around 2.5 % of rice genes have been characterized, and studies have mainly focused on transcriptional and post-transcriptional regulation. Slow progress in characterizing the function of rice genes is mainly due to a lack of clues to guide functional studies or functional redundancy. These limitations can be partially solved by a well-categorized functional classification of FST genes. To create this classification, we used the diverse overviews installed in the MapMan toolkit. Gene Ontology (GO) assignment to FST genes supplemented the limitation of MapMan overviews. The functions of 863 of 1,022 known genes can be evaluated by current FST lines, indicating that FST genes are useful resources for functional genomic studies. We assigned 16,169 out of 29,624 FST genes to 34 MapMan classes, including major three categories such as DNA, RNA and protein. To demonstrate the MapMan application on FST genes, transcriptome analysis was done from a rice mutant of 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) gene with FST. Mapping of 756 down-regulated genes in dxr mutants and their annotation in terms of various MapMan overviews revealed candidate genes downstream of DXR-mediating light signaling pathway in diverse functional classes such as the methyl-D-erythritol 4-phosphatepathway (MEP) pathway overview, photosynthesis, secondary metabolism and regulatory overview. This report provides a useful guide for systematic phenomics and further applications to enhance the key agronomic traits of rice.
Magnetic field studies of the solar wind interaction with venus from the galileo flyby.
Kivelson, M G; Kennel, C F; McPherron, R L; Russell, C T; Southwood, D J; Walker, R J; Hammond, C M; Khurana, K K; Strangeway, R J; Coleman, P J
1991-09-27
During the 10 February 1990 flyby of Venus, the Galileo spacecraft skimmed the downstream flank of the planetary bow shock. This provided an opportunity to examine both the global and the local structure of the shock in an interval during which conditions in the solar wind plasma were quite steady. The data show that the cross section of the shock in planes transverse to the flow is smaller in directions aligned with the projection of the interplanetary magnetic field than in directions not so aligned. Ultralow-frequency waves were present in the unshocked solar wind, and their amplitude peaked when the spacecraft was downstream of the foreshock. At large distances down the tail, the Mach number of the flow normal to the shock is low, thus providing the opportunity to study repeated crossings of the collisionless shock in an interesting parameter regime. Some of the shock crossings reveal structure that comes close to the theoretically predicted form of intermediate shocks, whose existence in collisionless plasmas has not been confirmed.
A tag-based approach for high-throughput analysis of CCWGG methylation.
Denisova, Oksana V; Chernov, Andrei V; Koledachkina, Tatyana Y; Matvienko, Nicholas I
2007-10-15
Non-CpG methylation occurring in the context of CNG sequences is found in plants at a large number of genomic loci. However, there is still little information available about non-CpG methylation in mammals. Efficient methods that would allow detection of scarcely localized methylated sites in small quantities of DNA are required to elucidate the biological role of non-CpG methylation in both plants and animals. In this study, we tested a new whole genome approach to identify sites of CCWGG methylation (W is A or T), a particular case of CNG methylation, in genomic DNA. This technique is based on digestion of DNAs with methylation-sensitive restriction endonucleases EcoRII-C and AjnI. Short DNAs flanking methylated CCWGG sites (tags) are selectively purified and assembled in tandem arrays of up to nine tags. This allows high-throughput sequencing of tags, identification of flanking regions, and their exact positions in the genome. In this study, we tested specificity and efficiency of the approach.
Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei
2015-01-01
LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444
Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M
2015-07-01
The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boccaccio, C.; Deshatrette, J.; Meunier-Rotival, M.
1994-05-01
The genomic fragment carrying the human activator of liver function, previously described as an episome capable of inducing differentiation upon transfection into a dedifferentiated rat hepatoma cell line, was mapped on human chromosome 12q24.2-12q24.3. This chromosomal location was indistinguishable by in situ hybridization from that of the gene coding for the hepatic transcription factor HNF1. The sequence of the integrated form of the episome as well as its flanking sequences show that it is rich in retroposons. It contains a human ribosomal protein L21 processed pseudogene, one truncated L1Hs sequence, and 10 Alu repeats, which belong to different subfamilies.
Vakili, Hana; Jin, Yan; Menticoglou, Savas; Cattini, Peter A
2013-08-02
Human chorionic somatomammotropin (CS) and placental growth hormone variant (GH-V) act as metabolic adaptors in response to maternal insulin resistance, which occurs in "normal" pregnancy. Maternal obesity can exacerbate this "resistance," suggesting that CS, GH-V, or transcription factors that regulate their production might be targets. The human CS genes, hCS-A and hCS-B, flank the GH-V gene. A significant decrease in pre-term placental CS/GH-V RNA levels was observed in transgenic mice containing the CS/GH-V genes in a model of high fat diet (HFD)-induced maternal obesity. Similarly, a decrease in CS/GH-V RNA levels was detected in term placentas from obese (body mass index (BMI) ≥ 35 kg/m(2)) versus lean (BMI 20-25 kg/m(2)) women. A specific decrease in transcription factor CCAAT-enhancer-binding protein β (C/EBPβ) RNA levels was also seen with obesity; C/EBPβ is required for mouse placenta development and is expressed, like CS and GH-V, in syncytiotrophoblasts. Binding of C/EBPβ to the CS gene downstream enhancer regions, which by virtue of their position distally flank the GH-V gene, was reduced in placenta chromatin from mice on a HFD and in obese women; a corresponding decrease in RNA polymerase II associated with CS/GH-V promoters was also observed. Detection of decreased endogenous CS/GH-V RNA levels in human placental tumor cells treated with C/EBPβ siRNA is consistent with a direct effect. These data provide evidence for CS/GH-V dysregulation in acute HFD-induced obesity in mouse pregnancy and chronic obesity in human pregnancy and implicate C/EBPβ, a factor associated with CS regulation and placental development.
Watanabe, Yoshiyuki; Yamamoto, Hiroyuki; Oikawa, Ritsuko; Toyota, Minoru; Yamamoto, Masakazu; Kokudo, Norihiro; Tanaka, Shinji; Arii, Shigeki; Yotsuyanagi, Hiroshi; Koike, Kazuhiko; Itoh, Fumio
2015-01-01
Integration of DNA viruses into the human genome plays an important role in various types of tumors, including hepatitis B virus (HBV)–related hepatocellular carcinoma. However, the molecular details and clinical impact of HBV integration on either human or HBV epigenomes are unknown. Here, we show that methylation of the integrated HBV DNA is related to the methylation status of the flanking human genome. We developed a next-generation sequencing-based method for structural methylation analysis of integrated viral genomes (denoted G-NaVI). This method is a novel approach that enables enrichment of viral fragments for sequencing using unique baits based on the sequence of the HBV genome. We detected integrated HBV sequences in the genome of the PLC/PRF/5 cell line and found variable levels of methylation within the integrated HBV genomes. Allele-specific methylation analysis revealed that the HBV genome often became significantly methylated when integrated into highly methylated host sites. After integration into unmethylated human genome regions such as promoters, however, the HBV DNA remains unmethylated and may eventually play an important role in tumorigenesis. The observed dynamic changes in DNA methylation of the host and viral genomes may functionally affect the biological behavior of HBV. These findings may impact public health given that millions of people worldwide are carriers of HBV. We also believe our assay will be a powerful tool to increase our understanding of the various types of DNA virus-associated tumorigenesis. PMID:25653310
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA
Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.
1995-01-01
The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581
Relative ages of lava flows at Alba Patera, Mars
NASA Technical Reports Server (NTRS)
Schneeberger, Dale M.; Pieri, David C.
1987-01-01
Many large lava flows on the flanks of Alba Patera are astonishing in their volume and length. As a suite, these flows suggest tremendously voluminous and sustained eruptions, and provide dimensional boundary conditions typically a factor of 100 larger than terrestrial flows. One of the most striking features associated with Alba Patera is the large, radially oriented lava flows that exhibit a variety of flow morphologies. These include sheet flows, tube fed and tube channel flows, and undifferentiated flows. Three groups of flows were studied; flows on the northwest flank, southeast flank, and the intracaldera region. The lava flows discussed probably were erupted as a group during the same major volcanic episode as suggested by the data presented. Absolute ages are poorly constrained for both the individual flows and shield, due in part to disagreement as to which absolute age curve is representative for Mars. A relative age sequence is implied but lacks precision due to the closeness of the size frequency curves.
Cyclic flank-vent and central-vent eruption patterns
NASA Astrophysics Data System (ADS)
Takada, Akira
Many basaltic and andesitic polygenetic volcanoes have cyclic eruptive activity that alternates between a phase dominated by flank eruptions and a phase dominated by eruptions from a central vent. This paper proposes the use of time-series diagrams of eruption sites on each polygenetic volcano and intrusion distances of dikes to evaluate volcano growth, to qualitatively reconstruct the stress history within the volcano, and to predict the next eruption site. In these diagrams the position of an eruption site is represented by the distance from the center of the volcano and the clockwise azimuth from north. Time-series diagrams of Mauna Loa, Kilauea, Kliuchevskoi, Etna, Sakurajima, Fuji, Izu-Oshima, and Hekla volcanoes indicate that fissure eruption sites of these volcanoes migrated toward the center of the volcano linearly, radially, or spirally with damped oscillation, occasionally forming a hierarchy in convergence-related features. At Krafla, terminations of dikes also migrated toward the center of the volcano with time. Eruption sites of Piton de la Fournaise did not converge but oscillated around the center. After the convergence of eruption sites with time, the central eruption phase is started. The intrusion sequence of dikes is modeled, applying crack interaction theory. Variation in convergence patterns is governed by the regional stress and the magma supply. Under the condition that a balance between regional extension and magma supply is maintained, the central vent convergence time during the flank eruption phase is 1-10 years, whereas the flank vent recurrence time during the central eruption phase is greater than 100 years owing to an inferred decrease in magma supply. Under the condition that magma supply prevails over regional extension, the central vent convergence time increases, whereas the flank vent recurrence time decreases owing to inferred stress relaxation. Earthquakes of M>=6 near a volcano during the flank eruption phase extend the central vent convergence time. Earthquakes during the central eruption phase promote recurrence of flank eruptions. Asymmetric distribution of eruption sites around the flanks of a volcano can be caused by local stress sources such as an adjacent volcano.
Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24
Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan
2005-01-01
The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557
Upadhyay, Sanjay K
2014-05-01
To determine the bioactive conformation required to bind with receptor aIIbb3, the peptide sequence RIPRGDMP from Kistrin was inserted into CDR 1 loop region of REI protein, resulting in REI-RGD34. The activity of REI-RGD34 was observed to increase at higher temperature towards the receptor aIIbb3. It could be justified in either way: the modified complex forces the restricted peptide to adapt bioactive conformation or it unfolds the peptide in a way that opens its binding surface with high affinity for receptor. Here, we model the conformational preference of RGD sequence in RIPRGDMP at 25 and 42 °C using multiple MD simulations. Further, we model the peptide sequence RGD, PRGD and PRGDMP from kistrin to observe the effect of flanking residues on conformational sampling of RGD. The presence of flanking residues around RGD peptide greatly influenced the conformational sampling. A transition from bend to turn conformation was observed for RGD sequence at 42 °C. The turn conformation shows pharmacophoric parameters required to recognize the receptor aIIbb3. Thus, the temperaturedependent activity of RIPRGDMP when inserted into the loop region of REI can be explained by the presence of the turn conformation. This study will help in designing potential antagonist for the receptor aIIbb3.
The Malarial Host-Targeting Signal Is Conserved in the Irish Potato Famine Pathogen
Liolios, Konstantinos; Win, Joe; Kanneganti, Thirumala-Devi; Young, Carolyn; Kamoun, Sophien; Haldar, Kasturi
2006-01-01
Animal and plant eukaryotic pathogens, such as the human malaria parasite Plasmodium falciparum and the potato late blight agent Phytophthora infestans, are widely divergent eukaryotic microbes. Yet they both produce secretory virulence and pathogenic proteins that alter host cell functions. In P. falciparum, export of parasite proteins to the host erythrocyte is mediated by leader sequences shown to contain a host-targeting (HT) motif centered on an RxLx (E, D, or Q) core: this motif appears to signify a major pathogenic export pathway with hundreds of putative effectors. Here we show that a secretory protein of P. infestans, which is perceived by plant disease resistance proteins and induces hypersensitive plant cell death, contains a leader sequence that is equivalent to the Plasmodium HT-leader in its ability to export fusion of green fluorescent protein (GFP) from the P. falciparum parasite to the host erythrocyte. This export is dependent on an RxLR sequence conserved in P. infestans leaders, as well as in leaders of all ten secretory oomycete proteins shown to function inside plant cells. The RxLR motif is also detected in hundreds of secretory proteins of P. infestans, Phytophthora sojae, and Phytophthora ramorum and has high value in predicting host-targeted leaders. A consensus motif further reveals E/D residues enriched within ~25 amino acids downstream of the RxLR, which are also needed for export. Together the data suggest that in these plant pathogenic oomycetes, a consensus HT motif may reside in an extended sequence of ~25–30 amino acids, rather than in a short linear sequence. Evidence is presented that although the consensus is much shorter in P. falciparum, information sufficient for vacuolar export is contained in a region of ~30 amino acids, which includes sequences flanking the HT core. Finally, positional conservation between Phytophthora RxLR and P. falciparum RxLx (E, D, Q) is consistent with the idea that the context of their presentation is constrained. These studies provide the first evidence to our knowledge that eukaryotic microbes share equivalent pathogenic HT signals and thus conserved mechanisms to access host cells across plant and animal kingdoms that may present unique targets for prophylaxis across divergent pathogens. PMID:16733545
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S
1996-03-01
In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.
Scar-less multi-part DNA assembly design automation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hillson, Nathan J.
The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less
Molecular epidemiology of infectious laryngotracheitis: a review
USDA-ARS?s Scientific Manuscript database
Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...
PRIMARY STRUCTURE OF THE P450 LANOSTEROL DEMETHYLASE GENE FROM SACCHAROMYCES CEREVISIAE
We have sequenced the structural gene and flanking regions for lanosterol 14 alpha-demethylase (14DM) from Saccharomyces cerevisiae. An open reading frame of 530 codons encodes a 60.7-kDa protein. When this gene is disrupted by integrative transformation, the resulting strain req...
Tissue-specific expression of human CD4 in transgenic mice.
Gillespie, F P; Doros, L; Vitale, J; Blackwell, C; Gosselin, J; Snyder, B W; Wadsworth, S C
1993-01-01
The gene for the human CD4 glycoprotein, which serves as the receptor for human immunodeficiency virus type 1, along with approximately 23 kb of sequence upstream of the translational start site, was cloned. The ability of 5' flanking sequences to direct tissue-specific expression was tested in cell culture and in transgenic mice. A 5' flanking region of 6 kb was able to direct transcription of the CD4 gene in NIH 3T3 cells but did not result in detectable expression in the murine T-cell line EL4 or in four lines of transgenic mice. A larger 5' flanking region of approximately 23 kb directed high-level CD4 transcription in the murine T-cell line EL4 and in three independent lines of transgenic mice. Human CD4 expression in all tissues analyzed was tightly correlated with murine CD4 expression; the highest levels of human CD4 RNA expression were found in the thymus and spleen, with relatively low levels detected in other tissues. Expression of human CD4 protein in peripheral blood mononuclear cells was examined by flow cytometry in these transgenic animals and found to be restricted to the murine CD4+ subset of lymphocytes. Human CD4 protein, detected with an anti-human CD4 monoclonal antibody, was present on the surface of 45 to 50% of the peripheral blood mononuclear cells from all transgenic lines. Images PMID:8474453
Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong
2008-12-31
CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.
Rosa, Rafael Diego; Stoco, Patricia Hermes; Barracco, Margherita Anna
2008-11-01
Anti-lipopolysaccharide factors (ALFs) are antimicrobial peptides found in limulids and crustaceans that have a potent and broad range of antimicrobial activity. We report here the identification and molecular characterisation of new sequences encoding for ALFs in the haemocytes of the freshwater prawn Macrobrachium olfersi and also in two Brazilian penaeid species, Farfantepenaeus paulensis and Litopenaeus schmitti. All obtained sequences encoded for highly cationic peptides containing two conserved cysteine residues flanking a putative LPS-binding domain. They exhibited a significant amino acid similarity with crustacean and limulid ALF sequences, especially with those of penaeid shrimps. This is the first identification of ALF in a freshwater prawn.
Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo.
Gandhi, Shashank; Piacentino, Michael L; Vieceli, Felipe M; Bronner, Marianne E
2017-12-01
The advent of CRISPR/Cas9 has made genome editing possible in virtually any organism, including those not previously amenable to genetic manipulations. Here, we present an optimization of CRISPR/Cas9 for application to early avian embryos with improved efficiency via a three-fold strategy. First, we employed Cas9 protein flanked with two nuclear localization signal sequences for improved nuclear localization. Second, we used a modified guide RNA (gRNA) scaffold that obviates premature termination of transcription and unstable Cas9-gRNA interactions. Third, we used a chick-specific U6 promoter that yields 4-fold higher gRNA expression than the previously utilized human U6. For rapid screening of gRNAs for in vivo applications, we also generated a chicken fibroblast cell line that constitutively expresses Cas9. As proof of principle, we performed electroporation-based loss-of-function studies in the early chick embryo to knock out Pax7 and Sox10, key transcription factors with known functions in neural crest development. The results show that CRISPR/Cas9-mediated deletion causes loss of their respective proteins and transcripts, as well as predicted downstream targets. Taken together, the results reveal the utility of this optimized CRISPR/Cas9 method for targeted gene knockout in chicken embryos in a manner that is reproducible, robust and specific. Copyright © 2017 Elsevier Inc. All rights reserved.
Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J
1997-04-01
The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.
Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.
Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S
2015-12-01
Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.
Akt3 is a privileged first responder in isozyme-specific electrophile response.
Long, Marcus J C; Parvez, Saba; Zhao, Yi; Surya, Sanjna L; Wang, Yiran; Zhang, Sheng; Aye, Yimon
2017-03-01
Isozyme-specific post-translational regulation fine tunes signaling events. However, redundancy in sequence or activity renders links between isozyme-specific modifications and downstream functions uncertain. Methods to study this phenomenon are underdeveloped. Here we use a redox-targeting screen to reveal that Akt3 is a first-responding isozyme sensing native electrophilic lipids. Electrophile modification of Akt3 modulated downstream pathway responses in cells and Danio rerio (zebrafish) and markedly differed from Akt2-specific oxidative regulation. Digest MS sequencing identified Akt3 C119 as the privileged cysteine that senses 4-hydroxynonenal. A C119S Akt3 mutant was hypomorphic for all downstream phenotypes shown by wild-type Akt3. This study documents isozyme-specific and chemical redox signal-personalized physiological responses.
TARGET researchers sequenced the tyrosine kinome and downstream signaling genes in 45 high-risk pediatric ALL cases with activated kinase signaling, including Ph-like ALL, to establish the incidence of tyrosine kinase mutations in this cohort. The study confirmed previously identified somatic mutations in JAK and FLT3, but did not find novel alterations in any additional tyrosine kinases or downstream genes. The mechanism of kinase signaling activation in this high-risk subgroup of pediatric ALL remains largely unknown.
A Benchmark Study on Error Assessment and Quality Control of CCS Reads Derived from the PacBio RS
Jiao, Xiaoli; Zheng, Xin; Ma, Liang; Kutty, Geetha; Gogineni, Emile; Sun, Qiang; Sherman, Brad T.; Hu, Xiaojun; Jones, Kristine; Raley, Castle; Tran, Bao; Munroe, David J.; Stephens, Robert; Liang, Dun; Imamichi, Tomozumi; Kovacs, Joseph A.; Lempicki, Richard A.; Huang, Da Wei
2013-01-01
PacBio RS, a newly emerging third-generation DNA sequencing platform, is based on a real-time, single-molecule, nano-nitch sequencing technology that can generate very long reads (up to 20-kb) in contrast to the shorter reads produced by the first and second generation sequencing technologies. As a new platform, it is important to assess the sequencing error rate, as well as the quality control (QC) parameters associated with the PacBio sequence data. In this study, a mixture of 10 prior known, closely related DNA amplicons were sequenced using the PacBio RS sequencing platform. After aligning Circular Consensus Sequence (CCS) reads derived from the above sequencing experiment to the known reference sequences, we found that the median error rate was 2.5% without read QC, and improved to 1.3% with an SVM based multi-parameter QC method. In addition, a De Novo assembly was used as a downstream application to evaluate the effects of different QC approaches. This benchmark study indicates that even though CCS reads are post error-corrected it is still necessary to perform appropriate QC on CCS reads in order to produce successful downstream bioinformatics analytical results. PMID:24179701
A Benchmark Study on Error Assessment and Quality Control of CCS Reads Derived from the PacBio RS.
Jiao, Xiaoli; Zheng, Xin; Ma, Liang; Kutty, Geetha; Gogineni, Emile; Sun, Qiang; Sherman, Brad T; Hu, Xiaojun; Jones, Kristine; Raley, Castle; Tran, Bao; Munroe, David J; Stephens, Robert; Liang, Dun; Imamichi, Tomozumi; Kovacs, Joseph A; Lempicki, Richard A; Huang, Da Wei
2013-07-31
PacBio RS, a newly emerging third-generation DNA sequencing platform, is based on a real-time, single-molecule, nano-nitch sequencing technology that can generate very long reads (up to 20-kb) in contrast to the shorter reads produced by the first and second generation sequencing technologies. As a new platform, it is important to assess the sequencing error rate, as well as the quality control (QC) parameters associated with the PacBio sequence data. In this study, a mixture of 10 prior known, closely related DNA amplicons were sequenced using the PacBio RS sequencing platform. After aligning Circular Consensus Sequence (CCS) reads derived from the above sequencing experiment to the known reference sequences, we found that the median error rate was 2.5% without read QC, and improved to 1.3% with an SVM based multi-parameter QC method. In addition, a De Novo assembly was used as a downstream application to evaluate the effects of different QC approaches. This benchmark study indicates that even though CCS reads are post error-corrected it is still necessary to perform appropriate QC on CCS reads in order to produce successful downstream bioinformatics analytical results.
Molecular characterization of the complete genome of falconid herpesvirus strain S-18
USDA-ARS?s Scientific Manuscript database
Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...
USDA-ARS?s Scientific Manuscript database
Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5' and 3' flanking regions of IRS2 (approx. 14.5 kb), were bidirectionally sequenced for single nucleotide...
USDA-ARS?s Scientific Manuscript database
The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1alpha subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated...
Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.
Ponce, M R; Quesada, V; Micol, J L
1998-05-01
An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.
E74-like factor 2 regulates valosin-containing protein expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Binglin; Tomita, Yasuhiko; Qiu, Ying
2007-05-11
Enhanced expression of valosin-containing protein (VCP) correlates with invasion and metastasis of cancers. To clarify the transcription mechanism of VCP, human and mouse genomic sequence was compared, revealing a 260 bp DNA sequence in the 5'-flanking region of VCP gene to be highly conserved between the two, in which binding motif of E74-like factor 2/new Ets-related factor (ELF2/NERF) was identified. Chromatin immunoprecipitation assay showed binding of ELF2/NERF to the 5'-flanking region of VCP gene. Knock-down of ELF2/NERF by siRNA decreased expression level of VCP. Viability of cells under tumor necrosis factor-alpha treatment significantly reduced in ELF2/NERF-knock-down breast cancer cell line.more » Immunohistochemical analysis on clinical breast cancer specimens showed a correlation of nuclear ELF2/NERF expression with VCP expression and proliferative activity of cells shown by Ki-67 immunohistochemistry. These findings indicate that ELF2/NERF promotes VCP transcription and that ELF2/NERF-VCP pathway might be important for cell survival and proliferation under cytokine stress.« less
Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin
2015-10-01
Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.
Nikaido, Masato; Matsuno, Fumio; Hamilton, Healy; Brownell, Robert L.; Cao, Ying; Ding, Wang; Zuoyan, Zhu; Shedlock, Andrew M.; Fordyce, R. Ewan; Hasegawa, Masami; Okada, Norihiro
2001-01-01
SINE (short interspersed element) insertion analysis elucidates contentious aspects in the phylogeny of toothed whales and dolphins (Odontoceti), especially river dolphins. Here, we characterize 25 informative SINEs inserted into unique genomic loci during evolution of odontocetes to construct a cladogram, and determine a total of 2.8 kb per taxon of the flanking sequences of these SINE loci to estimate divergence times among lineages. We demonstrate that: (i) Odontocetes are monophyletic; (ii) Ganges River dolphins, beaked whales, and ocean dolphins diverged (in this order) after sperm whales; (iii) three other river dolphin taxa, namely the Amazon, La Plata, and Yangtze river dolphins, form a monophyletic group with Yangtze River dolphins being the most basal; and (iv) the rapid radiation of extant cetacean lineages occurred some 28–33 million years B.P., in strong accord with the fossil record. The combination of SINE and flanking sequence analysis suggests a topology and set of divergence times for odontocete relationships, offering alternative explanations for several long-standing problems in cetacean evolution. PMID:11416211
Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine
2007-01-01
Background In Archeae and Bacteria, the repeated elements called CRISPRs for "clustered regularly interspaced short palindromic repeats" are believed to participate in the defence against viruses. Short sequences called spacers are stored in-between repeated elements. In the current model, motifs comprising spacers and repeats may target an invading DNA and lead to its degradation through a proposed mechanism similar to RNA interference. Analysis of intra-species polymorphism shows that new motifs (one spacer and one repeated element) are added in a polarised fashion. Although their principal characteristics have been described, a lot remains to be discovered on the way CRISPRs are created and evolve. As new genome sequences become available it appears necessary to develop automated scanning tools to make available CRISPRs related information and to facilitate additional investigations. Description We have produced a program, CRISPRFinder, which identifies CRISPRs and extracts the repeated and unique sequences. Using this software, a database is constructed which is automatically updated monthly from newly released genome sequences. Additional tools were created to allow the alignment of flanking sequences in search for similarities between different loci and to build dictionaries of unique sequences. To date, almost six hundred CRISPRs have been identified in 475 published genomes. Two Archeae out of thirty-seven and about half of Bacteria do not possess a CRISPR. Fine analysis of repeated sequences strongly supports the current view that new motifs are added at one end of the CRISPR adjacent to the putative promoter. Conclusion It is hoped that availability of a public database, regularly updated and which can be queried on the web will help in further dissecting and understanding CRISPR structure and flanking sequences evolution. Subsequent analyses of the intra-species CRISPR polymorphism will be facilitated by CRISPRFinder and the dictionary creator. CRISPRdb is accessible at PMID:17521438
Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U
1984-01-01
A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198
Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R
2005-08-01
Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.
Pesicek, Jeremy; Thurber, Clifford H.; DeShon, Heather R.; Prejean, Stephanie G.; Zhang, Haijiang
2008-01-01
Waveform cross-correlation with bispectrum verification is combined with double-difference tomography to increase the precision of earthquake locations and constrain regional 3D P-wave velocity heterogeneity at Great Sitkin volcano, Alaska. From 1999 through 2005, the Alaska Volcano Observatory (AVO) recorded ∼1700 earthquakes in the vicinity of Great Sitkin, including two ML 4.3 earthquakes that are among the largest events in the AVO catalog. The majority of earthquakes occurred during 2002 and formed two temporally and spatially separate event sequences. The first sequence began on 17 March 2002 and was centered ∼20 km west of the volcano. The second sequence occurred on the southeast flank of Great Sitkin and began 28 May 2002. It was preceded by two episodes of volcanic tremor. Earthquake relocations of this activity on the southeast flank define a vertical planar feature oriented radially from the summit and in the direction of the assumed regional maximum compressive stress due to convergence along the Alaska subduction zone. This swarm may have been caused or accompanied by the emplacement of a dike. Relocations of the mainshock–aftershock sequence occurring west of Great Sitkin are consistent with rupture on a strike-slip fault. Tomographic images support the presence of a vertically dipping fault striking parallel to the direction of convergence in this region. The remaining catalog hypocenters relocate along discrete features beneath the volcano summit; here, low P-wave velocities possibly indicate the presence of magma beneath the volcano.
Nakamura, Masayuki; Kuwahara, Hideto; Onoyama, Keisuke; Iwai, Hisashi
2012-08-01
Agrobacterium tumefaciens-mediated transformation (AtMT) has become a common technique for DNA transformation of yeast and filamentous fungi. In this study, we first established a protocol of AtMT for the phytopathogenic fungus Colletotrichum sansevieriae. Binary T-DNA vector containing the hygromycin B phosphotransferase gene controlled by the Aspergillus nidulans gpdA promoter and the trpC terminator was constructed with pCAMBIA0380 and used with three different strains LBA4404, GV3101, and GV2260 of A. tumefaciens. Transformants were most effectively obtained when GV2260 and C. sansevieriae Sa-1-2 were co-cultivated; there were about 320 transformants per 10(6) spores. When 1,048 transformants were inoculated on Sansevieria trifasciata, three transformants were found to have completely lost their pathogenicity and two transformants displayed reduced pathogenicity. All of the five transformants had a single copy of T-DNA in their genomes. The three pathogenicity-deficient transformants were subjected to thermal asymmetric interlaced polymerase chain reaction and the reaction allowed us to amplify the sequences flanking the left and/or right borders. The flanking sequences of the two transformants, M154 and M875, showed no homology to any sequences in databases, but the sequences of M678 contained motifs of alpha-1,3-glucan synthase, suggesting that the gene might contribute to the pathogenicity of C. sansevieriae. This study describes a useful method for investigating pathogenicity genes in C. sansevieriae.
Reish, Orit; Huber, Céline; Altarescu, Gheona; Chapman-Shimshoni, Daphne; Levy-Lahad, Ephrat; Renbaum, Paul; Mashevich, Maya; Munnich, Arnold; Cormier-Daire, Valérie
2010-09-01
Mutations or deletions in the SHOX gene cause Leri-Weill dyschondrosteosis (LWD) and Langer mesomelic dysplasia (LMD) when present in heterozygous or homozygous form, respectively. A new class of enhancer deletions was identified 30-250 kb downstream of SHOX. We identified a female patient with marked short stature, mosaic for monosomy X in 31% of her lymphocytes, and findings consistent with LWD. Additional molecular studies demonstrated segregation of 17 polymorphic markers flanking and including the SHOX locus, spanning 328 kb of pseudoautosomal region 1 (PAR1) region. A deletion up to 10 kb residing 197 kb downstream of SHOX gene was detected, which was germinally transmitted from her clinically unaffected father. This was associated with post-zygotic mosaic loss of the normal maternal X-chromosome, evidenced by fluorescent fragment analysis. Since most patients with LMD with deletions downstream of SHOX gene also have SHOX mutations in trans, it may suggest these deletions are associated with a milder phenotype. Further studies are required to elucidate the role of the former region in disease etiology. Mutations should be sought in clinically non-affected family members because of the variable expressivity in hemizygous carriers, and cytogenetic evaluation should be considered to detect possible X-chromosome rearrangements underlying the haploinsufficiency for the PAR1 when deletion is detected by molecular analysis. Similarly, when LWD and marked short stature occur in a patient with mosaic Turner syndrome, the possibility of mutations in SHOX and the downstream of SHOX gene should be considered. Copyright 2010 Wiley-Liss, Inc.
Coexistence of Two blaNDM-5 Genes on an IncF Plasmid as Revealed by Nanopore Sequencing.
Feng, Yu; Liu, Lu; McNally, Alan; Zong, Zhiyong
2018-05-01
In a carbapenem-resistant Escherichia coli clinical isolate of sequence type 167, two copies of bla NDM-5 were found on a 144,225-bp IncF self-transmissible plasmid of the F36:A4:B - type. Both bla NDM-5 genes were located in 11,065-bp regions flanked by two copies of IS 26 The two regions were identical in sequence but were present at different locations on the plasmid, suggesting a duplication of the same region. This study highlights the complex genetic contexts of bla NDM-5 . Copyright © 2018 American Society for Microbiology.
Isolation and characterization of major histocompatibility complex class II B genes in cranes.
Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi
2015-11-01
In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution.
Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.
Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette
2002-01-01
Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.
Molecular basis of length polymorphism in the human zeta-globin gene complex.
Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J
1983-01-01
The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667
Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao
2011-12-28
For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.
Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.
Hirsh, J; Morgan, B A; Scholnick, S B
1986-01-01
We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170
AmpliVar: mutation detection in high-throughput sequence from amplicon-based libraries.
Hsu, Arthur L; Kondrashova, Olga; Lunke, Sebastian; Love, Clare J; Meldrum, Cliff; Marquis-Nicholson, Renate; Corboy, Greg; Pham, Kym; Wakefield, Matthew; Waring, Paul M; Taylor, Graham R
2015-04-01
Conventional means of identifying variants in high-throughput sequencing align each read against a reference sequence, and then call variants at each position. Here, we demonstrate an orthogonal means of identifying sequence variation by grouping the reads as amplicons prior to any alignment. We used AmpliVar to make key-value hashes of sequence reads and group reads as individual amplicons using a table of flanking sequences. Low-abundance reads were removed according to a selectable threshold, and reads above this threshold were aligned as groups, rather than as individual reads, permitting the use of sensitive alignment tools. We show that this approach is more sensitive, more specific, and more computationally efficient than comparable methods for the analysis of amplicon-based high-throughput sequencing data. The method can be extended to enable alignment-free confirmation of variants seen in hybridization capture target-enrichment data. © 2015 WILEY PERIODICALS, INC.
Beck, Heather J.; Fleming, Ian M. C.
2016-01-01
Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758
Functional Architecture of T7 RNA Polymerase Transcription Complexes
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2007-01-01
Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086
Chi, Po-Shen; Wong, Hin-Chung
2017-10-16
Vibrio parahaemolyticus is a halophilic foodborne pathogenic bacterium that causes gastroenteritis; it has become an issue of global concern since the emergence and spread of pandemic O3:K6 strains. This study evaluated the role of Vibrio pathogenicity island (VPaI)-associated fragments in the genetic variation and grouping of this pathogen. Distribution of some VPaI fragments and flanking fragments (VPaI-1, VPaI-4, VPaI-5, VPaI-6 and VPaI-7) was determined in a total of 53 V. parahaemolyticus isolates from environmental and clinical sources in Taiwan, and supported by the sequences of seven fragments of VPaI-4 and its flanking fragment VP2145. As determined from the distribution of these VPaI-associated fragments, the clinical pandemic isolates were closely related in a single cluster; the clinical nonpandemic isolates were grouped into several clusters, while the environmental isolates were comparatively highly diversified. The profiles of virulence-associated genes of environmental pathogenic isolates varied, and were closer to those of clinical nonpandemic isolates than those of pandemic isolates. Isolates with atypical profiles of the VPaI-associated fragments and virulence-associated genes were identified. Sequences of VP2145 exhibited a close phylogenetic relationship among these local isolates, which were distinct from most V. parahaemolyticus strains from other geographic regions. This investigation demonstrated the application of VPaI-associated fragments in studying the genetic variation and clustering of V. parahaemolyticus isolates from different sources. Copyright © 2017. Published by Elsevier B.V.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Dhanda, Sandeep Kumar; Grifoni, Alba; Pham, John; Vaughan, Kerrie; Sidney, John; Peters, Bjoern; Sette, Alessandro
2018-01-01
Unwanted immune responses against protein therapeutics can reduce efficacy or lead to adverse reactions. T-cell responses are key in the development of such responses, and are directed against immunodominant regions within the protein sequence, often associated with binding to several allelic variants of HLA class II molecules (promiscuous binders). Herein, we report a novel computational strategy to predict 'de-immunized' peptides, based on previous studies of erythropoietin protein immunogenicity. This algorithm (or method) first predicts promiscuous binding regions within the target protein sequence and then identifies residue substitutions predicted to reduce HLA binding. Further, this method anticipates the effect of any given substitution on flanking peptides, thereby circumventing the creation of nascent HLA-binding regions. As a proof-of-principle, the algorithm was applied to Vatreptacog α, an engineered Factor VII molecule associated with unintended immunogenicity. The algorithm correctly predicted the two immunogenic peptides containing the engineered residues. As a further validation, we selected and evaluated the immunogenicity of seven substitutions predicted to simultaneously reduce HLA binding for both peptides, five control substitutions with no predicted reduction in HLA-binding capacity, and additional flanking region controls. In vitro immunogenicity was detected in 21·4% of the cultures of peptides predicted to have reduced HLA binding and 11·4% of the flanking regions, compared with 46% for the cultures of the peptides predicted to be immunogenic. This method has been implemented as an interactive application, freely available online at http://tools.iedb.org/deimmunization/. © 2017 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fracasso, M.A.; Dutton, S.P.; Finley, R.J.
The Travis Peak formation (lower Cretaceous) in the eastern East Texas basin is a fluvio-deltaic depositional system divided into large-scale facies packages: a middle sandstone-rich fluvial and delta-plain sequence that is gradationally overlain and underlain by a marine-influenced delta-fringe zone with a higher mudstone content. Domes and structural terraces on the west flank of the Sabine Uplift influenced deposition of Travis Peak sediments, and most Travis Peak gas production in this area is from thin sandstones (<25 ft(<7.6 m) thick) in the upper delta-fringe facies. The trapping mechanism is stratigraphic pinch-out of sandstones or porosity zones within sandstone, or both,more » on the flanks of structures. Detailed mapping of producing sandstone sequences in the uppermost upper delta-fringe on the western flank of the Bethany structure has delineated fluvial channelways, distributary or tidal channels, and barrier of distributary-mouth bars. Most Travis Peak gas production in the Bethany West area is from the bases of channel sandstones in a marine-influenced facies belt. Travis Peak sandstones in the eastern East Texas basin have undergone a complex series of diagenetic modifications. Precipitation of authigenic quartz, ankerite, dolomite, illite, and chlorite and the introduction of reservoir bitumen were the most important causes of occlusion of primary porosity and reduction of permeability. Permeability decreases with depth in the Travis Peak, which suggests that the diagenetic processes that caused extensive cementation and resultant low permeability throughout most of the formation operated less completely on sediments deposited near the top of the succession.« less
NASA Astrophysics Data System (ADS)
Rud'ko, S. V.; Petrov, P. Yu.; Kuznetsov, A. B.; Shatsillo, A. V.; Petrov, O. L.
2017-12-01
New data were obtained on δ13Ccarb and δ18O variations in the sequence of deposits of the Dal'nyaya Taiga series at the western and eastern flanks of the Ura anticline. The summary δ13C curve was plotted in view of the correlation of sequence-stratigraphic data of the basin analysis. A series of positive anomalies was found within the succession. Alternatives for global chemostratigraphic correlation of the Dal'nyaya Taiga series of the Ura uplift were considered.
Compositional correlations in the chicken genome.
Musto, H; Romero, H; Zavala, A; Bernardi, G
1999-09-01
This paper analyses the compositional correlations that hold in the chicken genome. Significant linear correlations were found among the regions studied-coding sequences (and their first, second, and third codon positions), flanking regions (5' and 3'), and introns-as is the case in the human genome. We found that these compositional correlations are not limited to global GC levels but even extend to individual bases. Furthermore, an analysis of 1037 coding sequences has confirmed a correlation among GC(3), GC(2), and GC(1). The implications of these results are discussed.
John F. Walker; Orson K. Miller; Jonathan L. Horton
2005-01-01
Diversity of ectotrophic mycobionts on outplanted seedlings of two oak species (Quercus rubra and Quercus prinus) was estimated at two sites in mature mixed forests in the southern Appalachian Mountains by sequencing nuclear 5.8S rRNA genes and the flanking internal transcribed spacer regions I and II (ITS). The...
Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research
Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in
PRIMARY STRUCTURE OF THE CYTOCHROME P450 LANOSTEROL 14A-DEMETHYLASE GENE FROM CANDIDA TROPICALIS
We report the nucleotide sequence of the gene and flanking DNA for the cytochrome P450 lanosterol 14 alpha-demethylase (14DM) from the yeast Candida tropicalis ATCC750. An open reading frame (ORF) of 528 codons encoding a 60.9-kD protein is identified. This ORF includes a charact...
Spliced RNA of woodchuck hepatitis virus.
Ogston, C W; Razman, D G
1992-07-01
Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.
Orthologs in Arabidopsis thaliana of the Hsp70 interacting protein Hip
Webb, Mary Alice; Cavaletto, John M.; Klanrit, Preekamol; Thompson, Gary A.
2001-01-01
The Hsp70-interacting protein Hip binds to the adenosine triphosphatase domain of Hsp70, stabilizing it in the adenosine 5′-diphosphate–ligated conformation and promoting binding of target polypeptides. In mammalian cells, Hip is a component of the cytoplasmic chaperone heterocomplex that regulates signal transduction via interaction with hormone receptors and protein kinases. Analysis of the complete genome sequence of the model flowering plant Arabidopsis thaliana revealed 2 genes encoding Hip orthologs. The deduced sequence of AtHip-1 consists of 441 amino acid residues and is 42% identical to human Hip. AtHip-1 contains the same functional domains characterized in mammalian Hip, including an N-terminal dimerization domain, an acidic domain, 3 tetratricopeptide repeats flanked by a highly charged region, a series of degenerate GGMP repeats, and a C-terminal region similar to the Sti1/Hop/p60 protein. The deduced amino acid sequence of AtHip-2 consists of 380 amino acid residues. AtHip-2 consists of a truncated Hip-like domain that is 46% identical to human Hip, followed by a C-terminal domain related to thioredoxin. AtHip-2 is 63% identical to another Hip-thioredoxin protein recently identified in Vitis labrusca (grape). The truncated Hip domain in AtHip-2 includes the amino terminus, the acidic domain, and tetratricopeptide repeats with flanking charged region. Analyses of expressed sequence tag databases indicate that both AtHip-1 and AtHip-2 are expressed in A thaliana and that orthologs of Hip are also expressed widely in other plants. The similarity between AtHip-1 and its mammalian orthologs is consistent with a similar role in plant cells. The sequence of AtHip-2 suggests the possibility of additional unique chaperone functions. PMID:11599566
Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine
2014-12-12
Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.
Breakpoint structure of the Anopheles gambiae 2Rb chromosomal inversion.
Lobo, Neil F; Sangaré, Djibril M; Regier, Allison A; Reidenbach, Kyanne R; Bretz, David A; Sharakhova, Maria V; Emrich, Scott J; Traore, Sekou F; Costantini, Carlo; Besansky, Nora J; Collins, Frank H
2010-10-25
Alternative arrangements of chromosome 2 inversions in Anopheles gambiae are important sources of population structure, and are associated with adaptation to environmental heterogeneity. The forces responsible for their origin and maintenance are incompletely understood. Molecular characterization of inversion breakpoints provides insight into how they arose, and provides the basis for development of molecular karyotyping methods useful in future studies. Sequence comparison of regions near the cytological breakpoints of 2Rb allowed the molecular delineation of breakpoint boundaries. Comparisons were made between the standard 2R+b arrangement in the An. gambiae PEST reference genome and the inverted 2Rb arrangements in the An. gambiae M and S genome assemblies. Sequence differences between alternative 2Rb arrangements were exploited in the design of a PCR diagnostic assay, which was evaluated against the known chromosomal banding pattern of laboratory colonies and field-collected samples from Mali and Cameroon. The breakpoints of the 7.55 Mb 2Rb inversion are flanked by extensive runs of the same short (72 bp) tandemly organized sequence, which was likely responsible for chromosomal breakage and rearrangement. Application of the molecular diagnostic assay suggested that 2Rb has a single common origin in An. gambiae and its sibling species, Anopheles arabiensis, and also that the standard arrangement (2R+b) may have arisen twice through breakpoint reuse. The molecular diagnostic was reliable when applied to laboratory colonies, but its accuracy was lower in natural populations. The complex repetitive sequence flanking the 2Rb breakpoint region may be prone to structural and sequence-level instability. The 2Rb molecular diagnostic has immediate application in studies based on laboratory colonies, but its usefulness in natural populations awaits development of complementary molecular tools.
Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio
2017-03-01
Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.
Sorting Out the Ocean Crust Deep Biosphere with Single Cell Omics Approaches
NASA Astrophysics Data System (ADS)
Orcutt, B.; D'Angelo, T.; Goordial, J.; Jones, R. M.; Carr, S. A.
2017-12-01
Although oceanic crust comprises a large habitat for subsurface life, the structure, function, and dynamics of microbial communities living on rocks in the subsurface are poorly understood. Single cell level approaches can overcome limitations of low biomass in subsurface systems. Coupled with incubation experiments with amino acid orthologs, single cell level sorting can reveal high resolution information about identity, functional potential, and growth. Leveraging collaboration with the Single Cell Genomics Center and the Facility for Aquatic Cytometry at Bigelow Laboratory, we present recent results from single cell level sorting and -omics sequencing from several crustal environments, including the Atlantis Massif and the Juan de Fuca Ridge flank. We will also highlight new experiments conducted with samples recovered from the flank of the Mid-Atlantic Ridge.
Insertion and deletion mutagenesis of the human cytomegalovirus genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spaete, R.R.; Mocarski, E.S.
1987-10-01
Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less
SSR allelic variation in almond (Prunus dulcis Mill.).
Xie, Hua; Sui, Yi; Chang, Feng-Qi; Xu, Yong; Ma, Rong-Cai
2006-01-01
Sixteen SSR markers including eight EST-SSR and eight genomic SSRs were used for genetic diversity analysis of 23 Chinese and 15 international almond cultivars. EST- and genomic SSR markers previously reported in species of Prunus, mainly peach, proved to be useful for almond genetic analysis. DNA sequences of 117 alleles of six of the 16 SSR loci were analysed to reveal sequence variation among the 38 almond accessions. For the four SSR loci with AG/CT repeats, no insertions or deletions were observed in the flanking regions of the 98 alleles sequenced. Allelic size variation of these loci resulted exclusively from differences in the structures of repeat motifs, which involved interruptions or occurrences of new motif repeats in addition to varying number of AG/CT repeats. Some alleles had a high number of uninterrupted repeat motifs, indicating that SSR mutational patterns differ among alleles at a given SSR locus within the almond species. Allelic homoplasy was observed in the SSR loci because of base substitutions, interruptions or compound repeat motifs. Substitutions in the repeat regions were found at two SSR loci, suggesting that point mutations operate on SSRs and hinder the further SSR expansion by introducing repeat interruptions to stabilize SSR loci. Furthermore, it was shown that some potential point mutations in the flanking regions are linked with new SSR repeat motif variation in almond and peach.
Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert
2009-07-01
Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.
Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.
Abrão, M G; Leite, M V; Carvalho, L R; Billerbeck, A E C; Nishi, M Y; Barbosa, A S; Martin, R M; Arnhold, I J P; Mendonca, B B
2006-09-01
PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. Pituitary function and imaging assessment and molecular analysis of PROP1. Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G
1995-01-01
The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.
Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul
2012-11-20
Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies.
Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, L.A.
1994-05-06
We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.
Zhang, Tiejun; Yu, Long-Xi; Zheng, Ping; Li, Yajun; Rivera, Martha; Main, Dorrie; Greene, Stephanie L
2015-01-01
Drought resistance is an important breeding target for enhancing alfalfa productivity in arid and semi-arid regions. Identification of genes involved in drought tolerance will facilitate breeding for improving drought resistance and water use efficiency in alfalfa. Our objective was to use a diversity panel of alfalfa accessions comprised of 198 cultivars and landraces to identify genes involved in drought tolerance. The panel was selected from the USDA-ARS National Plant Germplasm System alfalfa collection and genotyped using genotyping by sequencing. A greenhouse procedure was used for phenotyping two important traits associated with drought tolerance: drought resistance index (DRI) and relative leaf water content (RWC). Marker-trait association identified nineteen and fifteen loci associated with DRI and RWC, respectively. Alignments of target sequences flanking to the resistance loci against the reference genome of M. truncatula revealed multiple chromosomal locations. Markers associated with DRI are located on all chromosomes while markers associated with RWC are located on chromosomes 1, 2, 3, 4, 5, 6 and 7. Co-localizations of significant markers between DRI and RWC were found on chromosomes 3, 5 and 7. Most loci associated with DRI in this work overlap with the reported QTLs associated with biomass under drought in alfalfa. Additional significant markers were targeted to several contigs with unknown chromosomal locations. BLAST search using their flanking sequences revealed homology to several annotated genes with functions in stress tolerance. With further validation, these markers may be used for marker-assisted breeding new alfalfa varieties with drought resistance and enhanced water use efficiency.
Namouchi, Amine; Mardassi, Helmi
2006-11-01
Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.
Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V
2003-12-01
This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.
NASA Astrophysics Data System (ADS)
Beyeler, J. D.; Montgomery, D.; Kennard, P. M.
2016-12-01
Downwasting of all glaciers on the flanks of Mount Rainier, WA, in recent decades has debuttressed Little Ice Age glaciogenic sediments driving proglacial responses to regionally warming climate. Rivers draining the deglaciating edifice are responding to paraglacial sedimentation processes through transient storage of retreat-liberated sediments in aggrading (e.g., >5m) fluvial networks with widening channel corridors (i.e., 50-150%) post-LIA (ca., 1880-1910 locally). We hypothesize that the downstream transmission of proglacial fluxes (i.e., sediment and water) through deglaciating alpine terrain is a two-step geomorphic process. The ice-proximal portion of the proglacial system is dominated by the delivery of high sediment-to-water ratio flows (i.e., hyperconcentrated and debris slurries) and sediment retention by in-channel accumulation (e.g., confined debris fans within channel margins of valley segments) exacerbated by recruitment and accumulation of large wood (e.g., late seral stage conifers), whereas ice-distal fluvial reworking of transient sediment accumulations generates downstream aggradation. Historical Carbon River observations show restricted ice-proximal proglacial aggradation until a mainstem avulsion in 2009 initiated incision into sediment accumulations formed in recent decades, which is translating into aggradation farther down the network. Surficial morphology mapped with GPS, exposed subsurface sedimentology, and preliminary dating of buried trees suggest a transitional geomorphic process zone has persisted along the proglacial Carbon River through recent centuries and prior to the ultimate LIA glaciation. Structure-from-motion DEM differencing through the 2016 water year shows discrete zones of proglacial evolution through channel-spanning bed aggradation forced by interactions between large wood and sediment-rich flows that transition to fluvial process dominance as sediment is transported downstream. Long-term DEM differencing suggests these are persistent geomorphic processes as rivers respond to alpine deglaciation. This process-based study implies downstream river flooding in deglaciating alpine terrain globally is driven by glaciogenic sediment release and downstream channel aggradation irrespective of changes in discharge.
Mothes, Patricia A; Vallance, James W.
2015-01-01
Lahars are volcanic debris flows that are dubbed primary when triggered by eruptive activity or secondary when triggered by other factors such as heavy rainfall after eruptive activity has waned. Variation in time and space of the proportion of sediment to water within a lahar dictates lahar flow phase and the resultant sedimentary character of deposits. Characteristics of source material and of debris eroded and incorporated during flow downstream may strongly affect the grain-size composition of flowing lahars and their deposits. Lahars borne on the flanks of two steep-sided stratocones in Ecuador exemplify two important lahar types. Glacier-clad Cotopaxi volcano has been a producer of primary lahars that flow great distances downstream. Such primary lahars include those of both clast-rich and matrix-rich composition—some of which have flowed as far as 325 km to the Pacific Ocean. Cotopaxi's last important eruption in 1877 generated formidable syneruptive lahars comparable in size to those that buried Armero, Colombia, following the 1985 eruption of Nevado del Ruiz volcano. In contrast, ash-producing eruptive activity during the past 15 years at Tungurahua volcano has generated a continual supply of fresh volcaniclastic debris that is regularly remobilized by precipitation. Between 2000 and 2011, 886 rain-generated lahars were registered at Tungurahua. These two volcanoes pose dramatically different hazards to nearby populations. At Tungurahua, the frequency and small sizes of lahars have resulted in effective mitigation measures. At Cotopaxi 137 years have passed since the last important lahar-producing eruption, and there is now a high-risk situation for more than 100,000 people living in downstream valleys.
Simultaneous Differentiation and Typing of Entamoeba histolytica and Entamoeba dispar
Zaki, Mehreen; Meelu, Parool; Sun, Wei; Clark, C. Graham
2002-01-01
Sequences corresponding to some of the polymorphic loci previously reported from Entamoeba histolytica have been detected in Entamoeba dispar. Comparison of nucleotide sequences of two loci between E. dispar strain SAW760 and E. histolytica strain HM-1:IMSS revealed significant differences in both repeat and flanking regions. The tandem repeat units varied not only in sequence but also in number and arrangement between the two species at both the loci. Using the sequences obtained, primer pairs aimed at amplifying species-specific products were designed and tested on a variety of E. histolytica and E. dispar samples. Amplification results were in complete agreement with the original species classification in all cases, and the PCR products displayed discernible size and pattern variations among the isolates. PMID:11923344
Composition and Structure of Mauna Loa's Submarine West Flank, Hawaii
NASA Astrophysics Data System (ADS)
Borchers, D.; Morgan, J. K.; Clague, D. A.; Moore, G. F.
2003-12-01
James Moore's pioneering work on submarine landslides in the Hawaiian Islands contributed significantly to early models for the structure and evolution of Mauna Loa's submarine western flank. The west flank experienced catastrophic failure in the past, generating massive blocks and debris fields offshore. Moore recognized that the midslope bench near the base of the submarine flank must have postdated the debris avalanche, but little data existed to determine if it formed in response to further landsliding or to deeper volcanic processes. As the processes that shaped Mauna Loa are thought to be analogous to those currently active at Kilauea, an improved understanding of Mauna Loa's history can provide valuable insight into the future of the younger Hawaiian volcanoes. Several recent marine surveys in the area, including submersible surveys conducted by MBARI and JAMSTEC, and a multi-channel seismic (MCS) survey carried out by the University of Hawaii, provide important new data about the composition and structure of Mauna Loa's submarine west flank. We carried out detailed geochemical, petrographic and structural analyses of rock samples and dive videos collected from the exposed northern wall of the midslope bench, documenting a repeated sequences of volcaniclastic sandstones and breccias. This stratigraphy contrasts with the predominantly subaerially erupted basalts composing the upper flank. Several thick ponded flows or sill-like diabase units are also interspersed in the section. The volcaniclastic units are highly cemented, and many contain hydrothermal alteration products, including chlorite, zeolites, and actinolite. The most altered rocks occur near the base of the bench and the degree of alteration decreases upward in the section. Samples collected from the outer scarp of the bench show evidence for intense shearing and cataclasis at all scales. The new MCS line crosses Mauna Loa's southern submarine flank and central bench. More than 500 m of finely layered slope strata overlie the upper flank to the south, and are truncated above the Ka Lae avalanche scar. The central bench to the north, sampled by the MBARI dives, shows only thin sediment cover above a poorly reflective interior. Strong deep reflections in both locations begin to resolve the underlying oceanic crust, as well as probable fault planes that may be responsible for flank deformation in this area. The abundance of volcaniclastic rocks with Mauna Loa affinities within the bench supports the idea that giant landslides from Mauna Loa were the source of much of the offshore debris. The stratal repetition, deformation fabrics, and cementation of the volcaniclastics also suggest that the rocks composing the bench were once deeply buried and have been subsequently exhumed by thrusting, most likely driven by deep volcanic spreading.
Parson, Walther; Ballard, David; Budowle, Bruce; Butler, John M; Gettings, Katherine B; Gill, Peter; Gusmão, Leonor; Hares, Douglas R; Irwin, Jodi A; King, Jonathan L; Knijff, Peter de; Morling, Niels; Prinz, Mechthild; Schneider, Peter M; Neste, Christophe Van; Willuweit, Sascha; Phillips, Christopher
2016-05-01
The DNA Commission of the International Society for Forensic Genetics (ISFG) is reviewing factors that need to be considered ahead of the adoption by the forensic community of short tandem repeat (STR) genotyping by massively parallel sequencing (MPS) technologies. MPS produces sequence data that provide a precise description of the repeat allele structure of a STR marker and variants that may reside in the flanking areas of the repeat region. When a STR contains a complex arrangement of repeat motifs, the level of genetic polymorphism revealed by the sequence data can increase substantially. As repeat structures can be complex and include substitutions, insertions, deletions, variable tandem repeat arrangements of multiple nucleotide motifs, and flanking region SNPs, established capillary electrophoresis (CE) allele descriptions must be supplemented by a new system of STR allele nomenclature, which retains backward compatibility with the CE data that currently populate national DNA databases and that will continue to be produced for the coming years. Thus, there is a pressing need to produce a standardized framework for describing complex sequences that enable comparison with currently used repeat allele nomenclature derived from conventional CE systems. It is important to discern three levels of information in hierarchical order (i) the sequence, (ii) the alignment, and (iii) the nomenclature of STR sequence data. We propose a sequence (text) string format the minimal requirement of data storage that laboratories should follow when adopting MPS of STRs. We further discuss the variant annotation and sequence comparison framework necessary to maintain compatibility among established and future data. This system must be easy to use and interpret by the DNA specialist, based on a universally accessible genome assembly, and in place before the uptake of MPS by the general forensic community starts to generate sequence data on a large scale. While the established nomenclature for CE-based STR analysis will remain unchanged in the future, the nomenclature of sequence-based STR genotypes will need to follow updated rules and be generated by expert systems that translate MPS sequences to match CE conventions in order to guarantee compatibility between the different generations of STR data. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Biogeochemical and Microbial Survey of Gravity Cores from the Guaymas Basin and Sonora Margin
NASA Astrophysics Data System (ADS)
Buckley, A.; Mckay, L. J.; Chanton, J.; Hensen, C.; Turner, T.; Aiello, I. W.; Ravelo, A. C.; Mortera, C.; Teske, A.
2015-12-01
During the cruise "Guaymas14" with RV El Puma (Oct. 14-25, 2014), 15 sediment cores were obtained from the Guaymas Basin Ridge flanks and the Sonora Margin, to contrast the shallow subsurface sediments of the seafloor set at this spreading center and its adjacent continental margin. Here we present biogeochemical profiles of porewater dissolved gases and stable ions, along with high-throughout 16S rRNA gene sequencing of selected samples. Cores from the NW and SE ends of the Guaymas Basin ridge flanks were not sulfidic, and showed neither sulfate depletion nor methane accumulation. In contrast, samples of compression-impacted Sonora Margin on the NE edge of Guaymas Basin and from the upper Sonora Margin beneath the oxygen minimum zone showed an abundance of sulfide, DIC with sulfate depletion, and accumulation of biogenic methane (δ13C-CH4 ca. -85 to -88 ‰) at supersaturated concentrations below sulfate-replete sediment. Samples from an attenuated off-axis seep site on the NW flank of Guaymas Basin differed from both Sonora Margin and Guaymas Basin. The off-axis seep sediments contained 1 to 1.5 mM methane, with distinct δ13C -isotopic content (δ13C-CH4 near -60 ‰); intermediate to the biogenic methane of the Sonora Margin and the hydrothermally produced methane at Guaymas Basin. Unaltered sulfate and low sulfide concentrations indicate insufficiently reduced conditions, suggesting the methane was not produced in situ. Porewater DIC concentrations in the old seep site and the control site were similar to each other (3-5 mM), and lower than in the Sonora Margin sites (ca. 20-40 mM), indicating low bioremineralization in the old seep site and control sediments. Diverse seafloor habitats are expected to result in distinct microbiota that range from strictly anaerobic seep specialists and methane-cycling archaea in the Sonora Margin to diversified heterotrophic communities in the off-axis ridge flank sediments of Guaymas Basin; high-throughput sequencing should also address potential hydrothermal microbial signature in the attenuated off-axis seep site.
Ngezahayo, Frédéric; Xu, Chunming; Wang, Hongyan; Jiang, Lily; Pang, Jinsong; Liu, Bao
2009-01-01
Background mPing is an endogenous MITE in the rice genome, which is quiescent under normal conditions but can be induced towards mobilization under various stresses. The cellular mechanism responsible for modulating the activity of mPing remains unknown. Cytosine methylation is a major epigenetic modification in most eukaryotes, and the primary function of which is to serve as a genome defense system including taming activity of transposable elements (TEs). Given that tissue-culture is capable of inducing both methylation alteration and mPing transposition in certain rice genotypes, it provides a tractable system to investigate the possible relationship between the two phenomena. Results mPing transposition and cytosine methylation alteration were measured in callus and regenerated plants in three rice (ssp. indica) genotypes, V14, V27 and R09. All three genotypes showed transposition of mPing, though at various frequencies. Cytosine methylation alteration occurred both at the mPing-flanks and at random loci sampled globally in callus and regenerated plants of all three genotypes. However, a sharp difference in the changing patterns was noted between the mPing-flanks and random genomic loci, with a particular type of methylation modification, i.e., CNG hypermethylation, occurred predominantly at the mPing-flanks. Pearson's test on pairwise correlations indicated that mPing activity is positively correlated with specific patterns of methylation alteration at random genomic loci, while the element's immobility is positively correlated with methylation levels of the mPing's 5'-flanks. Bisulfite sequencing of two mPing-containing loci showed that whereas for the immobile locus loss of CG methylation in the 5'-flank was accompanied by an increase in CHG methylation, together with an overall increase in methylation of all three types (CG, CHG and CHH) in the mPing-body region, for the active locus erasure of CG methylation in the 5'-flank was not followed by such a change. Conclusion Our results documented that tissue culture-induced mPing activity in rice ssp. indica is correlated with alteration in cytosine methylation patterns at both random genomic loci and the elements' flanks, while the stability of mPing positively correlates with enhanced methylation levels of both the flanks and probably the elements per se. Thus, our results implicate a possible role of cytosine methylation in maintaining mPing stability under normal conditions, and in releasing the element's activity as a consequence of epigenetic perturbation in a locus-specific manner under certain stress conditions. PMID:19604382
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Xun; Guanga, Gerald P; Wan, Cheng
2012-11-13
MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less
USDA-ARS?s Scientific Manuscript database
The highly effective Hessian fly-resistance gene, H33, was introgressed from durum wheat into common wheat and genetically mapped to chromosome 3AS, in previous research. However, H33 located to a region that is well-known to be devoid of molecular markers, with the closest flanking simple sequence ...
USDA-ARS?s Scientific Manuscript database
Transposable elements (TEs) are mobile DNA regions that alter host genome structure and gene expression. A novel 588 bp non-autonomous high copy number TE in the Ostrinia nubilalis genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A+T content (62.3%),...
USDA-ARS?s Scientific Manuscript database
Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...
Shima, Hirohito; Tanaka, Toshiaki; Kamimaki, Tsutomu; Dateki, Sumito; Muroya, Koji; Horikawa, Reiko; Kanno, Junko; Adachi, Masanori; Naiki, Yasuhiro; Tanaka, Hiroyuki; Mabe, Hiroyo; Yagasaki, Hideaki; Kure, Shigeo; Matsubara, Yoichi; Tajima, Toshihiro; Kashimada, Kenichi; Ishii, Tomohiro; Asakura, Yumi; Fujiwara, Ikuma; Soneda, Shun; Nagasaki, Keisuke; Hamajima, Takashi; Kanzaki, Susumu; Jinno, Tomoko; Ogata, Tsutomu; Fukami, Maki
2016-07-01
The etiology of idiopathic short stature (ISS) and Leri-Weill dyschondrosteosis (LWD) in European patients is known to include SHOX mutations and copy-number variations (CNVs) involving SHOX and/or the highly evolutionarily conserved non-coding DNA elements (CNEs) flanking the gene. However, the frequency and types of SHOX abnormalities in non-European patients and the clinical importance of mutations in the CNEs remains to be clarified. Here, we performed systematic molecular analyses of SHOX for 328 Japanese patients with ISS or LWD. SHOX abnormalities accounted for 3.8% of ISS and 50% of LWD cases. CNVs around SHOX were identified in 16 cases, although the ~47 kb deletion frequently reported in European patients was absent in our cases. Probably damaging mutations and benign/silent substitutions were detected in four cases, respectively. Although CNE-linked substitutions were detected in 15 cases, most of them affected poorly conserved nucleotides and were shared by unaffected individuals. These results suggest that the frequency and mutation spectrum of SHOX abnormalities are comparable between Asian and European patients, with the exception of a European-specific downstream deletion. Furthermore, this study highlights the clinical importance and genetic heterogeneity of the SHOX-flanking CNVs, and indicates a limited clinical significance of point mutations in the CNEs.
Wang, Li Kai; Zhu, Hui; Shuman, Stewart
2009-03-27
NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria, where they are essential for growth and present attractive targets for antimicrobial drug discovery. LigA has a distinctive modular structure in which a nucleotidyltransferase catalytic domain is flanked by an upstream NMN-binding module and by downstream OB-fold, zinc finger, helix-hairpin-helix, and BRCT domains. Here we conducted a structure-function analysis of the nucleotidyltransferase domain of Escherichia coli LigA, guided by the crystal structure of the LigA-DNA-adenylate intermediate. We tested the effects of 29 alanine and conservative mutations at 15 amino acids on ligase activity in vitro and in vivo. We thereby identified essential functional groups that coordinate the reactive phosphates (Arg(136)), contact the AMP adenine (Lys(290)), engage the phosphodiester backbone flanking the nick (Arg(218), Arg(308), Arg(97) plus Arg(101)), or stabilize the active domain fold (Arg(171)). Finer analysis of the mutational effects revealed step-specific functions for Arg(136), which is essential for the reaction of LigA with NAD(+) to form the covalent ligase-AMP intermediate (step 1) and for the transfer of AMP to the nick 5'-PO(4) to form the DNA-adenylate intermediate (step 2) but is dispensable for phosphodiester formation at a preadenylylated nick (step 3).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schmidhauser, C. Bissell, M.J.; Myers, C.A.; Casperson, G.F.
1990-12-01
Milk protein regulation involves synergistic action of lactogenic hormones and extracellular matrix (ECM). It is well established that substratum has a dramatic effect on morphology and function of mammary cells. The molecular mechanisms that regulate the ECM- and hormone-dependent gene expression, however, have not been resolved. To address this question, a subpopulation (designated CID 9) of the mouse mammary epithelial cell strain COMMA-2D has been developed in which more than 35% of the cells express {beta}-casein, form alveoli-like structures when plated onto a reconstituted basement membrane, and secrete {beta}-casein undirectionally into a lumen. These cells were stably transfected with amore » series of chloramphenicol acetyltransferase (CAT) fusion genes to study transcriptional regulation of the bovine {beta}-casein gene. The expression of CAT in these lines demonstrated a striking matrix and hormone dependency. This regulation occurered primarily at the transcriptional level and was dependent on the length of the 5{prime} flanking region of the {beta}-casein promotor. Both matrix and hormonal control of transcription occurred within at least the first 1790 base pairs upstream and/or 42 base pairs downstream of the transcriptional initiation site. The ECM effect was independent of glucocorticoid stimulation. However, prolactin was essential and hydrocortisone further increased CAT expression. Endogenous {beta}-casein expression in these lines was similar to that of the parent CID 9 cells. Our data indicate the existence of matrix-dependent elements that regulate transcription.« less
Synthetic Promoters Functional in Francisella novicida and Escherichia coli
McWhinnie, Ralph L.
2014-01-01
In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126
Leonard, D A; Rajaram, N; Kerppola, T K
1997-05-13
Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.
Regulation of gene expression mediating indeterminate muscle growth in teleosts.
Ahammad, A K Shakur; Asaduzzaman, Md; Asakawa, Shuichi; Watabe, Shugo; Kinoshita, Shigeharu
2015-08-01
Teleosts are unique among vertebrates due to their indeterminate muscle growth, i.e., continued production of neonatal muscle fibers until death. However, the molecular mechanism(s) underlying this property is unknown. Here, we focused on the torafugu (Takifugu rubripes) myosin heavy chain gene, MYHM2528-1, which is specifically expressed in neonatal muscle fibers produced by indeterminate muscle growth. We examined the flanking region of MYHM2528-1 through an in vivo reporter assay using zebrafish (Danio rerio) and identified a 2100 bp 5'-flanking sequence that contained sufficient promoter activity to allow specific gene expression. The effects of enhanced promoter activity were observed at the outer region of the fast muscle and the dorsal edge of slow muscle in zebrafish larvae. At the juvenile stage, the promoter was specifically activated in small diameter muscle fibers scattered throughout fast muscle and in slow muscle near the septum separating slow and fast muscles. This spatio-temporal promoter activity overlapped with known myogenic zones involved in teleost indeterminate muscle growth. A deletion mutant analysis revealed that the -2100 to -600 bp 5'flanking sequence of MYHM2528-1 is essential for promoter activity. This region contains putative binding sites for several representative myogenesis-related transcription factors and nuclear factor of activated T-cell (NFAT), a transcription activator involved in regeneration of mammalian adult skeletal muscle. A significant reduction in the promoter activity of the MYHM2528-1 deletion constructs was observed in accordance with a reduction in the number of these binding sites, suggesting the involvement of specific transcription factors in indeterminate muscle growth. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.
2009-01-01
Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269
Pooling across cells to normalize single-cell RNA sequencing data with many zero counts.
Lun, Aaron T L; Bach, Karsten; Marioni, John C
2016-04-27
Normalization of single-cell RNA sequencing data is necessary to eliminate cell-specific biases prior to downstream analyses. However, this is not straightforward for noisy single-cell data where many counts are zero. We present a novel approach where expression values are summed across pools of cells, and the summed values are used for normalization. Pool-based size factors are then deconvolved to yield cell-based factors. Our deconvolution approach outperforms existing methods for accurate normalization of cell-specific biases in simulated data. Similar behavior is observed in real data, where deconvolution improves the relevance of results of downstream analyses.
Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli.
Iguchi, Atsushi; Shirai, Hiroki; Seto, Kazuko; Ooka, Tadasuke; Ogura, Yoshitoshi; Hayashi, Tetsuya; Osawa, Kayo; Osawa, Ro
2011-01-01
Most Escherichia coli O157-serogroup strains are classified as enterohemorrhagic E. coli (EHEC), which is known as an important food-borne pathogen for humans. They usually produce Shiga toxin (Stx) 1 and/or Stx2, and express H7-flagella antigen (or nonmotile). However, O157 strains that do not produce Stxs and express H antigens different from H7 are sometimes isolated from clinical and other sources. Multilocus sequence analysis revealed that these 21 O157:non-H7 strains tested in this study belong to multiple evolutionary lineages different from that of EHEC O157:H7 strains, suggesting a wide distribution of the gene set encoding the O157-antigen biosynthesis in multiple lineages. To gain insight into the gene organization and the sequence similarity of the O157-antigen biosynthesis gene clusters, we conducted genomic comparisons of the chromosomal regions (about 59 kb in each strain) covering the O-antigen gene cluster and its flanking regions between six O157:H7/non-H7 strains. Gene organization of the O157-antigen gene cluster was identical among O157:H7/non-H7 strains, but was divided into two distinct types at the nucleotide sequence level. Interestingly, distribution of the two types did not clearly follow the evolutionary lineages of the strains, suggesting that horizontal gene transfer of both types of O157-antigen gene clusters has occurred independently among E. coli strains. Additionally, detailed sequence comparison revealed that some positions of the repetitive extragenic palindromic (REP) sequences in the regions flanking the O-antigen gene clusters were coincident with possible recombination points. From these results, we conclude that the horizontal transfer of the O157-antigen gene clusters induced the emergence of multiple O157 lineages within E. coli and speculate that REP sequences may involve one of the driving forces for exchange and evolution of O-antigen loci.
Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.
2011-01-01
We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875
Molecular design of sequence specific DNA alkylating agents.
Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi
2009-01-01
Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.
Transposition-mediated DNA re-replication in maize
Zhang, Jianbo; Zuo, Tao; Wang, Dafang; Peterson, Thomas
2014-01-01
Every DNA segment in a eukaryotic genome normally replicates once and only once per cell cycle to maintain genome stability. We show here that this restriction can be bypassed through alternative transposition, a transposition reaction that utilizes the termini of two separate, nearby transposable elements (TEs). Our results suggest that alternative transposition during S phase can induce re-replication of the TEs and their flanking sequences. The DNA re-replication can spontaneously abort to generate double-strand breaks, which can be repaired to generate Composite Insertions composed of transposon termini flanking segmental duplications of various lengths. These results show how alternative transposition coupled with DNA replication and repair can significantly alter genome structure and may have contributed to rapid genome evolution in maize and possibly other eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.03724.001 PMID:25406063
Treetrimmer: a method for phylogenetic dataset size reduction.
Maruyama, Shinichiro; Eveleigh, Robert J M; Archibald, John M
2013-04-12
With rapid advances in genome sequencing and bioinformatics, it is now possible to generate phylogenetic trees containing thousands of operational taxonomic units (OTUs) from a wide range of organisms. However, use of rigorous tree-building methods on such large datasets is prohibitive and manual 'pruning' of sequence alignments is time consuming and raises concerns over reproducibility. There is a need for bioinformatic tools with which to objectively carry out such pruning procedures. Here we present 'TreeTrimmer', a bioinformatics procedure that removes unnecessary redundancy in large phylogenetic datasets, alleviating the size effect on more rigorous downstream analyses. The method identifies and removes user-defined 'redundant' sequences, e.g., orthologous sequences from closely related organisms and 'recently' evolved lineage-specific paralogs. Representative OTUs are retained for more rigorous re-analysis. TreeTrimmer reduces the OTU density of phylogenetic trees without sacrificing taxonomic diversity while retaining the original tree topology, thereby speeding up downstream computer-intensive analyses, e.g., Bayesian and maximum likelihood tree reconstructions, in a reproducible fashion.
Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H
2006-11-21
Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.
Sun, Xiaoyong; Wang, Lin; Ding, Jiechao; Wang, Yanru; Wang, Jiansheng; Zhang, Xiaoyang; Che, Yulei; Liu, Ziwei; Zhang, Xinran; Ye, Jiazhen; Wang, Jie; Sablok, Gaurav; Deng, Zhiping; Zhao, Hongwei
2016-10-01
A new regulatory class of small endogenous RNAs called circular RNAs (circRNAs) has been described as miRNA sponges in animals. Using 16 Arabidopsis thaliana RNA-Seq data sets, we identified 803 circRNAs in RNase R-/non-RNase R-treated samples. The results revealed the following features: Canonical and noncanonical splicing can generate circRNAs; chloroplasts are a hotspot for circRNA generation; furthermore, limited complementary sequences exist not only in introns, but also in the sequences flanking splice sites. The latter finding suggests that multiple combinations between complementary sequences may facilitate the formation of the circular structure. Our results contribute to a better understanding of this novel class of plant circRNAs. © 2016 Federation of European Biochemical Societies.
Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur
2012-01-01
Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607
Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.
Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R
2017-11-01
DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.
Yun, Tao; Zhang, Dabing; Ma, Xuejun; Cao, Zhenzhen; Chen, Liu; Ni, Zheng; Ye, Weicheng; Yu, Bin; Hua, Jionggang; Zhang, Yan; Zhang, Cun
2012-03-01
Duck tembusu virus (DTMUV) is an emerging agent that causes a severe disease in ducks. We report herein the first complete genome sequences of duck tembusu virus strains YY5, ZJ-407, and GH-2, isolated from Shaoxing ducks, breeder ducks, and geese, respectively, in China. The genomes of YY5, ZJ-407, and GH-2 are all 10,990 nucleotides (nt) in length and encode a putative polyprotein of 3,426 amino acids. It is flanked by a 5' and a 3' noncoding region (NCR) of 94 and 618 nt, respectively. Knowledge of the whole sequence of DTMUV will be useful for further studies of the mechanisms of virus replication and pathogenesis.
Analysis of Morphogenic Effect of hDAB2IP on Prostate Cancer and its Disease Correlation
2007-02-01
variety of or- gans and cell lines. By determining the promoter sequence from the 5’- flanking region of the mDab2ip gene in mouse prosta - tic epithelial...patient with de novo acute myeloid leukemia. Genes Chromo- somes Cancer 39, 324 –334. WANG, Z., TSENG, C.P., PONG, R.C., CHEN, H., MCCONNELL, J.D
Vian, A; Carrascosa, A V; García, J L; Cortés, E
1998-06-01
The nucleotide sequence of both the bgaA gene, coding for a thermostable beta-galactosidase of Thermus sp. strain T2, and its flanking regions was determined. The deduced amino acid sequence of the enzyme predicts a polypeptide of 645 amino acids (Mr, 73,595). Comparative analysis of the open reading frames located in the flanking regions of the bgaA gene revealed that they might encode proteins involved in the transport and hydrolysis of sugars. The observed homology between the deduced amino acid sequences of BgaA and the beta-galactosidase of Bacillus stearothermophilus allows us to classify the new enzyme within family 42 of glycosyl hydrolases. BgaA was overexpressed in its active form in Escherichia coli, but more interestingly, an active chimeric beta-galactosidase was constructed by fusing the BgaA protein to the choline-binding domain of the major pneumococcal autolysin. This chimera illustrates a novel approach for producing an active and thermostable hybrid enzyme that can be purified in a single step by affinity chromatography on DEAE-cellulose, retaining the catalytic properties of the native enzyme. The chimeric enzyme showed a specific activity of 191,000 U/mg at 70 degrees C and a Km value of 1.6 mM with o-nitrophenyl-beta-D-galactopyranoside as a substrate, and it retained 50% of its initial activity after 1 h of incubation at 70 degrees C.
Nguyen, Tuan; Ruan, Zheng; Oruganty, Krishnadev; Kannan, Natarajan
2015-01-01
Mitogen activated protein kinases (MAPKs) form a closely related family of kinases that control critical pathways associated with cell growth and survival. Although MAPKs have been extensively characterized at the biochemical, cellular, and structural level, an integrated evolutionary understanding of how MAPKs differ from other closely related protein kinases is currently lacking. Here, we perform statistical sequence comparisons of MAPKs and related protein kinases to identify sequence and structural features associated with MAPK functional divergence. We show, for the first time, that virtually all MAPK-distinguishing sequence features, including an unappreciated short insert segment in the β4-β5 loop, physically couple distal functional sites in the kinase domain to the D-domain peptide docking groove via the C-terminal flanking tail (C-tail). The coupling mediated by MAPK-specific residues confers an allosteric regulatory mechanism unique to MAPKs. In particular, the regulatory αC-helix conformation is controlled by a MAPK-conserved salt bridge interaction between an arginine in the αC-helix and an acidic residue in the C-tail. The salt-bridge interaction is modulated in unique ways in individual sub-families to achieve regulatory specificity. Our study is consistent with a model in which the C-tail co-evolved with the D-domain docking site to allosterically control MAPK activity. Our study provides testable mechanistic hypotheses for biochemical characterization of MAPK-conserved residues and new avenues for the design of allosteric MAPK inhibitors. PMID:25799139
CRISPR-based screening of genomic island excision events in bacteria.
Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe
2015-06-30
Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.
Kass, David H; Janoušek, Václav; Wang, Liuyang; Tucker, Priscilla K
2014-06-01
Reproductive barriers exist between the house mouse subspecies, Mus musculus musculus and M. m. domesticus, members of the Mus musculus species complex, primarily as a result of hybrid male infertility, and a hybrid zone exists where their ranges intersect in Europe. Using single nucleotide polymorphisms (SNPs) diagnostic for the two taxa, the extent of introgression across the genome was previously compared in these hybrid populations. Sixty-nine of 1316 autosomal SNPs exhibited reduced introgression in two hybrid zone transects suggesting maladaptive interactions among certain loci. One of these markers is within a region on chromosome 11 that, in other studies, has been associated with hybrid male sterility of these subspecies. We assessed sequence variation in a 20 Mb region on chromosome 11 flanking this marker, and observed its inclusion within a roughly 150 kb stretch of DNA showing elevated sequence differentiation between the two subspecies. Four genes are associated with this genomic subregion, with two entirely encompassed. One of the two genes, the uncharacterized 1700093K21Rik gene, displays distinguishing features consistent with a potential role in reproductive isolation between these subspecies. Along with its expression specifically within spermatogenic cells, we present various sequence analyses that demonstrate a high rate of molecular evolution of this gene, as well as identify a subspecies amino acid variant resulting in a structural difference. Taken together, the data suggest a role for this gene in reproductive isolation.
NASA Astrophysics Data System (ADS)
Acharyya, S. K.
2015-07-01
This study provides an insight into the lithotectonic evolution of the N-S trending Indo-Burma Range (IBR), constituting the southern flank of the Himalayan syntaxis. Paleogene flyschoid sediments (Disang-Barail) that represent a shallow marine to deltaic environment mainly comprise the west-central sector of IBR, possibly resting upon a continental base. On the east, these sequences are tectonically flanked by the Eocene olistostromal facies of the Disang, which developed through accretion of trench sediments during the subduction. The shelf and trench facies sequences of the Disang underwent overthrusting from the east, giving rise to two ophiolite suites ( Naga Hills Lower Ophiolite ( NHLO) and Victoria Hills Upper Ophiolite ( VHUO), but with different accretion history. The ophiolite and ophiolite cover rock package were subsequently overthrusted by the Proterozoic metamorphic sequence, originated from the Burmese continent. The NHLO suite of Late Jurassic to Early Eocene age is unconformably overlain by mid-Eocene shallow marine ophiolite-derived clastics. On the south, the VHUO of Mesozoic age is structurally underlain by continental metamorphic rocks. The entire package in Victoria Hills is unconformably overlain by shallow marine Late Albian sediments. Both the ophiolite suites and the sandwiched continental metamorphic rocks are thrust westward over the Paleogene shelf sediments. These dismembered ophiolites and continental metamorphic rocks suggest thin-skinned tectonic detachment processes in IBR, as reflected from the presence of klippe of continental metamorphic rocks over the NHLO and the flyschoid Disang floor sediments and half windows exposing the Disang beneath the NHLO.
Archaebacterial rhodopsin sequences: Implications for evolution
NASA Technical Reports Server (NTRS)
Lanyi, J. K.
1991-01-01
It was proposed over 10 years ago that the archaebacteria represent a separate kingdom which diverged very early from the eubacteria and eukaryotes. It follows that investigations of archaebacterial characteristics might reveal features of early evolution. So far, two genes, one for bacteriorhodopsin and another for halorhodopsin, both from Halobacterium halobium, have been sequenced. We cloned and sequenced the gene coding for the polypeptide of another one of these rhodopsins, a halorhodopsin in Natronobacterium pharaonis. Peptide sequencing of cyanogen bromide fragments, and immuno-reactions of the protein and synthetic peptides derived from the C-terminal gene sequence, confirmed that the open reading frame was the structural gene for the pharaonis halorhodopsin polypeptide. The flanking DNA sequences of this gene, as well as those of other bacterial rhodopsins, were compared to previously proposed archaebacterial consensus sequences. In pairwise comparisons of the open reading frame with DNA sequences for bacterio-opsin and halo-opsin from Halobacterium halobium, silent divergences were calculated. These indicate very considerable evolutionary distance between each pair of genes, even in the dame organism. In spite of this, three protein sequences show extensive similarities, indicating strong selective pressures.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Recognition and dynamics of syntectonic sediment routing systems, southern Pyrenees
NASA Astrophysics Data System (ADS)
Allen, P. A.; Duller, R.; Fordyce, S.; Smithells, R.; Springett, J.; Whitchurch, A.; Whittaker, A.; Carter, A.; Fedele, J.-J.
2009-04-01
The erosional, transportational and depositional aspects of the biogeochemical cycles involving particulate sediment and solutes are integrated in sediment routing systems. The component parts of these tectonic-geomorphic systems communicate with each other, especially in response to changes in external forcing mechanisms such as tectonic perturbations and climate change; that is, sediment routing systems are characterized by important teleconnections. We are only just beginning to understand how these teleconnections work, and what it means for the spatial and temporal scales of system behaviour. One strategy for investigating the dynamics of sediment routing systems is to link information on the denudation of upstream source regions with downstream patterns of deposition. This is most likely to be fruitful where upstream catchments are tectonically active. Sediment is released into basins whose long-term subsidence is also controlled by tectonic activity. The spatial distribution of subsidence and the magnitude of the sediment discharge from the catchment are critical factors in the dispersal of sediment of different grain size and composition away from a mountain front. We investigate the coarse clastic sediment routing systems of mid-late Eocene age (40-34 Ma) that were deposited in basins located at the boundary of the Axial Zone and the thrust belt of the South-Central Unit on the southern flank of the Pyrenees, Spain. Most of the fan deposits of interest are found in the Pobla Basin, situated north of Tremp, which benefits from outstanding exposure conditions and rigorous previous work on biostratigraphy, magnetostratigraphy and sedimentology (Mellere 1993; Beamud et al. 2003). Distinct fan depositional systems can be identified and mapped on the basis of their sediment composition, detrital thermochronology, facies and architectures, which can be related to correspondingly distinct catchment properties (size, location, exhumational history, lithologies). Downstream fining of clasts of variable composition in streamflood fanglomerates is interpreted in terms of abrasion, which is minor, and selective deposition, which dominates. The observed downstream trends in different fan systems are used as a test for the selective deposition model of Fedele & Paola (2007). Beamud, E., Garcés, M., Cabrera, L., Munoz, J.A. & Almar, Y., 2003, A new middle to late Eocene continental chronostratigraphy from NE Spain. Earth & Planetary Science Letters, 216, 501-514. Fedele, J.J., & Paola, C., 2007, Similarity solutions for fluvial sediment fining by selective deposition. Journal Geophysical Research-Earth Surface, 112, F02038, doi:10.1029/2005JF000409. Mellere, D., 1993, Thurst-generated, back-fill stacking of alluvial fan sequences, south-central Pyrenees, Spain (la Pobla de Segur Conglomerates). Special Publication International Association Sedimentologists, 20, 259-276.
Rank-order-selective neurons form a temporal basis set for the generation of motor sequences.
Salinas, Emilio
2009-04-08
Many behaviors are composed of a series of elementary motor actions that must occur in a specific order, but the neuronal mechanisms by which such motor sequences are generated are poorly understood. In particular, if a sequence consists of a few motor actions, a primate can learn to replicate it from memory after practicing it for just a few trials. How do the motor and premotor areas of the brain assemble motor sequences so fast? The network model presented here reveals part of the solution to this problem. The model is based on experiments showing that, during the performance of motor sequences, some cortical neurons are always activated at specific times, regardless of which motor action is being executed. In the model, a population of such rank-order-selective (ROS) cells drives a layer of downstream motor neurons so that these generate specific movements at different times in different sequences. A key ingredient of the model is that the amplitude of the ROS responses must be modulated by sequence identity. Because of this modulation, which is consistent with experimental reports, the network is able not only to produce multiple sequences accurately but also to learn a new sequence with minimal changes in connectivity. The ROS neurons modulated by sequence identity thus serve as a basis set for constructing arbitrary sequences of motor responses downstream. The underlying mechanism is analogous to the mechanism described in parietal areas for generating coordinate transformations in the spatial domain.
RANK-ORDER-SELECTIVE NEURONS FORM A TEMPORAL BASIS SET FOR THE GENERATION OF MOTOR SEQUENCES
Salinas, Emilio
2009-01-01
Many behaviors are composed of a series of elementary motor actions that must occur in a specific order, but the neuronal mechanisms by which such motor sequences are generated are poorly understood. In particular, if a sequence consists of a few motor actions, a primate can learn to replicate it from memory after practicing it for just a few trials. How do the motor and premotor areas of the brain assemble motor sequences so fast? The network model presented here reveals part of the solution to this problem. The model is based on experiments showing that, during the performance of motor sequences, some cortical neurons are always activated at specific times, regardless of which motor action is being executed. In the model, a population of such rank-order-selective (ROS) cells drives a layer of downstream motor neurons so that these generate specific movements at different times in different sequences. A key ingredient of the model is that the amplitude of the ROS responses must be modulated by sequence identity. Because of this modulation, which is consistent with experimental reports, the network is able not only to produce multiple sequences accurately but also to learn a new sequence with minimal changes in connectivity. The ROS neurons modulated by sequence identity thus serve as a basis set for constructing arbitrary sequences of motor responses downstream. The underlying mechanism is analogous to the mechanism described in parietal areas for generating coordinate transformations in the spatial domain. PMID:19357265
hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0
Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej
2015-01-01
Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581
Volff, J N; Körting, C; Altschmied, J; Duschl, J; Sweeney, K; Wichert, K; Froschauer, A; Schartl, M
2001-02-01
Jule is the second complete long-terminal-repeat (LTR) Ty3/Gypsy retrotransposon identified to date in vertebrates. Jule, first isolated from the poeciliid fish Xiphophorus maculatus, is 4.8 kb in length, is flanked by two 202-bp LTRs, and encodes Gag (structural core protein) and Pol (protease, reverse transcriptase, RNase H, and integrase, in that order) but no envelope. There are three to four copies of Jule per haploid genome in X. maculatus. Two of them are located in a subtelomeric region of the sex chromosomes, where they are associated with the Xmrk receptor tyrosine kinase genes, of which oncogenic versions are responsible for the formation of hereditary melanoma in Xiphophorus. One almost intact copy of Jule was found in the first intron of the X-chromosomal allele of the Xmrk proto-oncogene, and a second, more corrupted copy is present only 56 nt downstream of the polyadenylation signal of the Xmrk oncogene. Jule-related elements were detected by Southern blot hybridization with less than 10 copies per haploid genome in numerous other poeciliids, as well as in more divergent fishes, including the medakafish Oryzias latipes and the tilapia Oreochromis niloticus. Database searches also identified Jule-related sequences in the zebrafish Danio rerio and in both genome project pufferfishes, Fugu rubripes and Tetraodon nigroviridis. Phylogenetic analysis revealed that Jule is the first member of the Mag family of Ty3/Gypsy retrotransposons described to date in vertebrates. This family includes the silkworm Mag and sea urchin SURL retrotransposons, as well as sequences from the nematode Caenorhabditis elegans. Additional related elements were identified in the genomes of the malaria mosquito Anopheles gambiae and the nematode Ascaris lumbricoides. Phylogeny of Mag-related elements suggested that the Mag family of retrotransposons is polyphyletic and is constituted of several ancient lineages that diverged before their host genomes more than 600 MYA.
A Role for the GCC-Box in Jasmonate-Mediated Activation of the PDF1.2 Gene of Arabidopsis1
Brown, Rebecca L.; Kazan, Kemal; McGrath, Ken C.; Maclean, Don J.; Manners, John M.
2003-01-01
The PDF1.2 gene of Arabidopsis encoding a plant defensin is commonly used as a marker for characterization of the jasmonate-dependent defense responses. Here, using PDF1.2 promoter-deletion lines linked to the β-glucoronidase-reporter gene, we examined putative promoter elements associated with jasmonate-responsive expression of this gene. Using stably transformed plants, we first characterized the extended promoter region that positively regulates basal expression from the PDF1.2 promoter. Second, using promoter deletion constructs including one from which the GCC-box region was deleted, we observed a substantially lower response to jasmonate than lines carrying this motif. In addition, point mutations introduced into the core GCC-box sequence substantially reduced jasmonate responsiveness, whereas addition of a 20-nucleotide-long promoter element carrying the core GCC-box and flanking nucleotides provided jasmonate responsiveness to a 35S minimal promoter. Taken together, these results indicated that the GCC-box plays a key role in conferring jasmonate responsiveness to the PDF1.2 promoter. However, deletion or specific mutations introduced into the core GCC-box did not completely abolish the jasmonate responsiveness of the promoter, suggesting that the other promoter elements lying downstream from the GCC-box region may also contribute to jasmonate responsiveness. In other experiments, we identified a jasmonate- and pathogen-responsive ethylene response factor transcription factor, AtERF2, which when overexpressed in transgenic Arabidopsis plants activated transcription from the PDF1.2, Thi2.1, and PR4 (basic chitinase) genes, all of which contain a GCC-box sequence in their promoters. Our results suggest that in addition to their roles in regulating ethylene-mediated gene expression, ethylene response factors also appear to play important roles in regulating jasmonate-responsive gene expression, possibly via interaction with the GCC-box. PMID:12805630
Sidhu, M S; Heir, E; Sørum, H; Holck, A
2001-01-01
Little is known about the occurrence of antimicrobial resistance determinants in staphylococci isolated from food and food processing industries. Quaternary ammonium compound (QAC)-resistant coagulase-negative staphylococci (CNS) isolated from food and food-processing industries were investigated for the presence of genetic determinants (qacA/B and qacC/smr) encoding resistance to the QAC benzalkonium chloride (BC), several antibiotic resistance genes, and staphylococcal insertion sequences IS257 and IS256. Six qacA/B-harboring strains were resistant to penicillin and hybridized to a blaZ probe. The qacA/B and blaZ probes hybridized to plasmids of similar size in three isolates. Molecular and genetic characterization of the 23-kb plasmid (pST6) of Staphylococcus epidermidis St.6 revealed the presence of qacB adjacent to an incomplete beta-lactamase transposon Tn552 encoding the gene cluster blaZ, blaR, and blaI. Sequence analysis of flanking regions and the intergenic region between blaZ and qacB revealed the presence of IS257 downstream of blaZ as well as sin and binR between blaZ and qacB. In the three other BC and penicillin-resistant strains, the qacA/B and blaZ genes were located on separate plasmids. A qacC harboring S. epidermidis strain (St.17) also hybridized to tetK (tetracycline resistance) and ermB (erythromycin resistance) genes. The individual genes were located on separate plasmids, suggesting no linkage between QAC and antibiotic resistance determinants. Plasmid-free Staphylococcus aureus RN4220 allowed uptake of the pST6 plasmid DNA, indicating that the resistance genes could potentially be transferred to pathogens under selective stress. In conclusion, presence of both resistance determinants could lead to co-selection during antimicrobial therapy or disinfection in hospitals or in food industries.
Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z
1994-01-01
The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.
Tectonic controls on rift basin morphology: Evolution of the northern Malawi (Nyasa) rift
NASA Technical Reports Server (NTRS)
Ebinger, C. J.; Deino, A. L.; Tesha, A. L.; Becker, T.; Ring, U.
1993-01-01
Radiometric (K-Ar and Ar-40/Ar-39) age determinations of volcanic and volcaniclastic rocks, combined with structural, gravity, and seismic reflection data, are used to constrain the age of sedimentary strata contained within the seismically and volcanically active northern Malawi (Nyasa) rift and to characterize changes in basin and flank morphologies with time. Faulting and volcanism within the Tukuyu-Karonga basin began at approximately 8.6 Ma, when sediments were deposited in abroad, initially asymmetric lake basin bounded on its northeastern side by a border fault system with minor topographic relief. Extensions, primarily by a slip along the border fault, and subsequent regional isostatic compensation led to the development of a 5-km-deep basin bounded by broad uplifted flanks. Along the low-relief basin margin opposite border fault, younger stratigraphic sequences commonly onlap older wedge-shaped sequences, although their internal geometry is often progradational. Intrabasinal faulting, flankuplift, and basaltic and felsic volcanism from centers at the northern end of the basin became more important at about 2.5 Ma when cross-rift transfer faults developed to link the Tukuyu-Karonga basin to the Rukwa basin. Local uplift and volcanic construction at the northern end of the basin led to a southeastward shift in the basin's depocenter. Sequence boundaries are commonly erosional along this low-relief (hanging wall) margin and conformable in the deep lake basin. The geometry of stratigraphic sequences and the distribution of the erosion indicate that horizontal and vertical crustal movements both across and along the length of the rift basin led to changes in levels of the lake, irrespective of paleoclimatic fluctuations.
Huang, Jinqiang; Li, Yongjuan; Shao, Changwei; Wang, Na; Chen, Songlin
2017-06-20
The nanos gene encodes an RNA-binding zinc finger protein, which is required in the development and maintenance of germ cells. However, there is very limited information about nanos in flatfish, which impedes its application in fish breeding. In this study, we report the molecular cloning, characterization and functional analysis of the 3'-untranslated region of the nanos gene (Csnanos) from half-smooth tongue sole (Cynoglossus semilaevis), which is an economically important flatfish in China. The 1233-bp cDNA sequence, 1709-bp genomic sequence and flanking sequences (2.8-kb 5'- and 1.6-kb 3'-flanking regions) of Csnanos were cloned and characterized. Sequence analysis revealed that CsNanos shares low homology with Nanos in other species, but the zinc finger domain of CsNanos is highly similar. Phylogenetic analysis indicated that CsNanos belongs to the Nanos2 subfamily. Csnanos expression was widely detected in various tissues, but the expression level was higher in testis and ovary. During early development and sex differentiation, Csnanos expression exhibited a clear sexually dimorphic pattern, suggesting its different roles in the migration and differentiation of primordial germ cells (PGCs). Higher expression levels of Csnanos mRNA in normal females and males than in neomales indicated that the nanos gene may play key roles in maintaining the differentiation of gonad. Moreover, medaka PGCs were successfully labeled by the microinjection of synthesized mRNA consisting of green fluorescence protein and the 3'-untranslated region of Csnanos. These findings provide new insights into nanos gene expression and function, and lay the foundation for further study of PGC development and applications in tongue sole breeding. Copyright © 2017 Elsevier B.V. All rights reserved.
Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael
2017-02-01
We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.
Sharma, Ronesh; Bayarjargal, Maitsetseg; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok
2018-01-21
Intrinsically Disordered Proteins (IDPs) lack stable tertiary structure and they actively participate in performing various biological functions. These IDPs expose short binding regions called Molecular Recognition Features (MoRFs) that permit interaction with structured protein regions. Upon interaction they undergo a disorder-to-order transition as a result of which their functionality arises. Predicting these MoRFs in disordered protein sequences is a challenging task. In this study, we present MoRFpred-plus, an improved predictor over our previous proposed predictor to identify MoRFs in disordered protein sequences. Two separate independent propensity scores are computed via incorporating physicochemical properties and HMM profiles, these scores are combined to predict final MoRF propensity score for a given residue. The first score reflects the characteristics of a query residue to be part of MoRF region based on the composition and similarity of assumed MoRF and flank regions. The second score reflects the characteristics of a query residue to be part of MoRF region based on the properties of flanks associated around the given residue in the query protein sequence. The propensity scores are processed and common averaging is applied to generate the final prediction score of MoRFpred-plus. Performance of the proposed predictor is compared with available MoRF predictors, MoRFchibi, MoRFpred, and ANCHOR. Using previously collected training and test sets used to evaluate the mentioned predictors, the proposed predictor outperforms these predictors and generates lower false positive rate. In addition, MoRFpred-plus is a downloadable predictor, which makes it useful as it can be used as input to other computational tools. https://github.com/roneshsharma/MoRFpred-plus/wiki/MoRFpred-plus:-Download. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji
1999-01-01
Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208
Ma, Junying; Zeng, Zhenling; Chen, Zhangliu; Xu, Xiaogang; Wang, Xiaoying; Deng, Yuting; Lü, Dianhong; Huang, Liangzong; Zhang, Yunyuan; Liu, Jianhua; Wang, Minggui
2009-02-01
Three kinds of plasmid-mediated quinolone resistance (PMQR) determinants have been discovered and have been shown to be widely distributed among clinical isolates: qnr genes, aac(6')-Ib-cr, and qepA. Few data on the prevalence of these determinants in strains from animals are available. The presence of PMQR genes in isolates from animals was determined by PCR amplification and DNA sequencing. The production of extended-spectrum beta-lactamases (ESBLs) and AmpC beta-lactamases in the strains was detected, and their genotypes were determined. The genetic environment of PMQR determinants in selected plasmids was analyzed. All samples of ceftiofur-resistant (MICs > or = 8 microg/ml) isolates of the family Enterobacteriaceae were selected from 36 companion animals and 65 food-producing animals in Guangdong Province, China, between November 2003 and April 2007, including 89 Escherichia coli isolates, 9 Klebsiella pneumoniae isolates, and isolates of three other genera. A total of 68.3% (69/101) of the isolates produced ESBLs and/or AmpC beta-lactamases, mainly those of the CTX-M and CMY types. Of the 101 strains, PMQR determinants were present in 35 (34.7%) isolates, with qnr, aac(6')-Ib-cr, and qepA detected alone or in combination in 8 (7.9%), 19 (18.8%), and 16 (15.8%) strains, respectively. The qnr genes detected included one qnrB4 gene, four qnrB6 genes, and three qnrS1 genes. Five strains were positive for both aac(6')-Ib-cr and qepA, while one strain was positive for qnrS1, aac(6')-Ib-cr, and qepA. qnrB6 was flanked by two copies of ISCR1 with an intervening dfr gene downstream and sul1 and qacEDelta1 genes upstream. In another plasmid, aac(6')-Ib-cr followed intI1 and arr-3 was downstream. PMQR determinants are highly prevalent in ceftiofur-resistant Enterobacteriaceae strains isolated from animals in China. This is the first report of the occurrence of PMQR determinants among isolates from companion animals.
Danilowicz, Claudia; Hermans, Laura; Coljee, Vincent; Prévost, Chantal
2017-01-01
Abstract During DNA recombination and repair, RecA family proteins must promote rapid joining of homologous DNA. Repeated sequences with >100 base pair lengths occupy more than 1% of bacterial genomes; however, commitment to strand exchange was believed to occur after testing ∼20–30 bp. If that were true, pairings between different copies of long repeated sequences would usually become irreversible. Our experiments reveal that in the presence of ATP hydrolysis even 75 bp sequence-matched strand exchange products remain quite reversible. Experiments also indicate that when ATP hydrolysis is present, flanking heterologous dsDNA regions increase the reversibility of sequence matched strand exchange products with lengths up to ∼75 bp. Results of molecular dynamics simulations provide insight into how ATP hydrolysis destabilizes strand exchange products. These results inspired a model that shows how pairings between long repeated sequences could be efficiently rejected even though most homologous pairings form irreversible products. PMID:28854739
Vandenbol, M; Jauniaux, J C; Grenson, M
1989-11-15
The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.
Jiang, Zhou; Li, Ping; Jiang, Dawei; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Wang, Yanxin
2016-01-01
Arsenic biogeochemistry has been studied extensively in acid sulfate-chloride hot springs, but not in acid sulfate hot springs with low chloride. In this study, Zhenzhuquan in Tengchong geothermal area, a representative acid sulfate hot spring with low chloride, was chosen to study arsenic geochemistry and microbial community structure using Illumina MiSeq sequencing. Over 0.3 million 16S rRNA sequence reads were obtained from 6-paired parallel water and sediment samples along its outflow channel. Arsenic oxidation occurred in the Zhenxhuquan pool, with distinctly high ratios of arsenate to total dissolved arsenic (0.73-0.86). Coupled with iron and sulfur oxidation along the outflow channel, arsenic accumulated in downstream sediments with concentrations up to 16.44 g/kg and appeared to significantly constrain their microbial community diversity. These oxidations might be correlated with the appearance of some putative functional microbial populations, such as Aquificae and Pseudomonas (arsenic oxidation), Sulfolobus (sulfur and iron oxidation), Metallosphaera and Acidicaldus (iron oxidation). Temperature, total organic carbon and dissolved oxygen significantly shaped the microbial community structure of upstream and downstream samples. In the upstream outflow channel region, most microbial populations were microaerophilic/anaerobic thermophiles and hyperthermophiles, such as Sulfolobus, Nocardia, Fervidicoccus, Delftia, and Ralstonia. In the downstream region, aerobic heterotrophic mesophiles and thermophiles were identified, including Ktedonobacteria, Acidicaldus, Chthonomonas and Sphingobacteria. A total of 72.41-95.91% unassigned-genus sequences were derived from the downstream high arsenic sediments 16S rRNA clone libraries. This study could enable us to achieve an integrated understanding on arsenic biogeochemistry in acid hot springs.
Venieraki, Anastasia; Dimou, Maria; Vezyri, Eleni; Vamvakas, Alexandros; Katinaki, Pagona-Artemis; Chatzipavlidis, Iordanis; Tampakaki, Anastasia; Katinakis, Panagiotis
2014-01-01
The presence of nitrogen fixers within the genus Pseudomonas has been established and so far most isolated strains are phylogenetically affiliated to Pseudomonas stutzeri. A gene ortholog neighborhood analysis of the nitrogen fixation island (NFI) in four diazotrophic P. stutzeri strains and Pseudomonas azotifigens revealed that all are flanked by genes coding for cobalamin synthase (cobS) and glutathione peroxidise (gshP). The putative NFIs lack all the features characterizing a mobilizable genomic island. Nevertheless, bioinformatic analysis P. stutzeri DSM 4166 NFI demonstrated the presence of short inverted and/or direct repeats within both flanking regions. The other P. stutzeri strains carry only one set of repeats. The genetic diversity of eleven diazotrophic Pseudomonas isolates was also investigated. Multilocus sequence typing grouped nine isolates along with P. stutzeri and two isolates are grouped in a separate clade. A Rep-PCR fingerprinting analysis grouped the eleven isolates into four distinct genotypes. We also provided evidence that the putative NFI in our diazotrophic Pseudomonas isolates is flanked by cobS and gshP genes. Furthermore, we demonstrated that the putative NFI of Pseudomonas sp. Gr65 is flanked by inverted repeats identical to those found in P. stutzeri DSM 4166 and while the other P. stutzeri isolates harbor the repeats located in the intergenic region between cobS and glutaredoxin genes as in the case of P. stutzeri A1501. Taken together these data suggest that all putative NFIs of diazotrophic Pseudomonas isolates are anchored in an intergenic region between cobS and gshP genes and their flanking regions are designated by distinct repeats patterns. Moreover, the presence of almost identical NFIs in diazotrophic Pseudomonas strains isolated from distal geographical locations around the world suggested that this horizontal gene transfer event may have taken place early in the evolution. PMID:25251496
Venieraki, Anastasia; Dimou, Maria; Vezyri, Eleni; Vamvakas, Alexandros; Katinaki, Pagona-Artemis; Chatzipavlidis, Iordanis; Tampakaki, Anastasia; Katinakis, Panagiotis
2014-01-01
The presence of nitrogen fixers within the genus Pseudomonas has been established and so far most isolated strains are phylogenetically affiliated to Pseudomonas stutzeri. A gene ortholog neighborhood analysis of the nitrogen fixation island (NFI) in four diazotrophic P. stutzeri strains and Pseudomonas azotifigens revealed that all are flanked by genes coding for cobalamin synthase (cobS) and glutathione peroxidise (gshP). The putative NFIs lack all the features characterizing a mobilizable genomic island. Nevertheless, bioinformatic analysis P. stutzeri DSM 4166 NFI demonstrated the presence of short inverted and/or direct repeats within both flanking regions. The other P. stutzeri strains carry only one set of repeats. The genetic diversity of eleven diazotrophic Pseudomonas isolates was also investigated. Multilocus sequence typing grouped nine isolates along with P. stutzeri and two isolates are grouped in a separate clade. A Rep-PCR fingerprinting analysis grouped the eleven isolates into four distinct genotypes. We also provided evidence that the putative NFI in our diazotrophic Pseudomonas isolates is flanked by cobS and gshP genes. Furthermore, we demonstrated that the putative NFI of Pseudomonas sp. Gr65 is flanked by inverted repeats identical to those found in P. stutzeri DSM 4166 and while the other P. stutzeri isolates harbor the repeats located in the intergenic region between cobS and glutaredoxin genes as in the case of P. stutzeri A1501. Taken together these data suggest that all putative NFIs of diazotrophic Pseudomonas isolates are anchored in an intergenic region between cobS and gshP genes and their flanking regions are designated by distinct repeats patterns. Moreover, the presence of almost identical NFIs in diazotrophic Pseudomonas strains isolated from distal geographical locations around the world suggested that this horizontal gene transfer event may have taken place early in the evolution.
Ba Abdullah, Mohammed M; Palermo, Richard D; Palser, Anne L; Grayson, Nicholas E; Kellam, Paul; Correia, Samantha; Szymula, Agnieszka; White, Robert E
2017-12-01
Epstein-Barr virus (EBV) is a ubiquitous pathogen of humans that can cause several types of lymphoma and carcinoma. Like other herpesviruses, EBV has diversified through both coevolution with its host and genetic exchange between virus strains. Sequence analysis of the EBV genome is unusually challenging because of the large number and lengths of repeat regions within the virus. Here we describe the sequence assembly and analysis of the large internal repeat 1 of EBV (IR1; also known as the BamW repeats) for more than 70 strains. The diversity of the latency protein EBV nuclear antigen leader protein (EBNA-LP) resides predominantly within the exons downstream of IR1. The integrity of the putative BWRF1 open reading frame (ORF) is retained in over 80% of strains, and deletions truncating IR1 always spare BWRF1. Conserved regions include the IR1 latency promoter (Wp) and one zone upstream of and two within BWRF1. IR1 is heterogeneous in 70% of strains, and this heterogeneity arises from sequence exchange between strains as well as from spontaneous mutation, with interstrain recombination being more common in tumor-derived viruses. This genetic exchange often incorporates regions of <1 kb, and allelic gene conversion changes the frequency of small regions within the repeat but not close to the flanks. These observations suggest that IR1-and, by extension, EBV-diversifies through both recombination and breakpoint repair, while concerted evolution of IR1 is driven by gene conversion of small regions. Finally, the prototype EBV strain B95-8 contains four nonconsensus variants within a single IR1 repeat unit, including a stop codon in the EBNA-LP gene. Repairing IR1 improves EBNA-LP levels and the quality of transformation by the B95-8 bacterial artificial chromosome (BAC). IMPORTANCE Epstein-Barr virus (EBV) infects the majority of the world population but causes illness in only a small minority of people. Nevertheless, over 1% of cancers worldwide are attributable to EBV. Recent sequencing projects investigating virus diversity to see if different strains have different disease impacts have excluded regions of repeating sequence, as they are more technically challenging. Here we analyze the sequence of the largest repeat in EBV (IR1). We first characterized the variations in protein sequences encoded across IR1. In studying variations within the repeat of each strain, we identified a mutation in the main laboratory strain of EBV that impairs virus function, and we suggest that tumor-associated viruses may be more likely to contain DNA mixed from two strains. The patterns of this mixing suggest that sequences can spread between strains (and also within the repeat) by copying sequence from another strain (or repeat unit) to repair DNA damage. Copyright © 2017 Ba abdullah et al.
Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito
2002-01-01
Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471
Shin, Jeong Hong; Jung, Soobin; Ramakrishna, Suresh; Kim, Hyongbum Henry; Lee, Junwon
2018-07-07
Genome editing technology using programmable nucleases has rapidly evolved in recent years. The primary mechanism to achieve precise integration of a transgene is mainly based on homology-directed repair (HDR). However, an HDR-based genome-editing approach is less efficient than non-homologous end-joining (NHEJ). Recently, a microhomology-mediated end-joining (MMEJ)-based transgene integration approach was developed, showing feasibility both in vitro and in vivo. We expanded this method to achieve targeted sequence substitution (TSS) of mutated sequences with normal sequences using double-guide RNAs (gRNAs), and a donor template flanking the microhomologies and target sequence of the gRNAs in vitro and in vivo. Our method could realize more efficient sequence substitution than the HDR-based method in vitro using a reporter cell line, and led to the survival of a hereditary tyrosinemia mouse model in vivo. The proposed MMEJ-based TSS approach could provide a novel therapeutic strategy, in addition to HDR, to achieve gene correction from a mutated sequence to a normal sequence. Copyright © 2018 Elsevier Inc. All rights reserved.
Circular RNA biogenesis can proceed through an exon-containing lariat precursor.
Barrett, Steven P; Wang, Peter L; Salzman, Julia
2015-06-09
Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical 'backsplicing' event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in Schizosaccharomyces pombe is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure.
Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.
2002-01-01
The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576
Chronology of volcanism and rift basin propagation - Rungwe volcanic province, East Africa
NASA Technical Reports Server (NTRS)
Ebinger, C. J.; Deino, A. L.; Drake, R. E.; Tesha, A. L.
1989-01-01
The spatial and temporal development of along-axis segmentation in youthful continental rifts was investigated using the results of field, remote sensing, and K-Ar geochronology studies conducted in four (Rukwa, Songwe, Usangu, and Karonga) rift basins within the Rungwe volcanic province in East Africa. Results indicated that the Rukwa and Karonga border fault segments formed between 7.25 and 5 m.y. ago, the Usangu border fault segment developed between 3 and 2 m.y. ago, and subsidence along the Songwe border fault segment had occurred by 0.5 Ma. It is shown that individual basins developed diachronously, each following a similar sequence: (1) initial border fault development; (2) asymmetric basin subsidence/flank uplift and the development of monoclines opposite the border faults; and (3) continued subsidence and tilting along intrabasinal faults with flexural upwarping of the rift flanks, enhancing basinal asymmetries.
Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa
2012-01-01
Background Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies. PMID:23167289
Impact of electrode sequence on electrochemical removal of trichloroethylene from aqueous solution
Rajic, Ljiljana; Fallahpour, Noushin; Alshawabkeh, Akram N.
2015-01-01
The electrode sequence in a mixed flow-through electrochemical cell is evaluated to improve the hydrodechlorination (HDC) of trichloroethylene (TCE) in aqueous solutions. In a mixed (undivided) electrochemical cell, oxygen generated at the anode competes with the transformation of target contaminants at the cathode. In this study, we evaluate the effect of placing the anode downstream from the cathode and using multiple electrodes to promote TCE reduction. Experiments with a cathode followed by an anode (C→A) and an anode followed by a cathode (A→C) were conducted using mixed metal oxide (MMO) and iron as electrode materials. The TCE removal rates when the anode is placed downstream of the cathode (C→A) were 54% by MMO→MMO, 64% by MMO→Fe and 87% by Fe→MMO sequence. Removal rates when the anode is placed upstream of the cathode (A→C) were 38% by MMO→MMO, 58% by Fe→MMO and 69% by MMO→Fe sequence. Placing the anode downstream of the cathode positively improves (by 26%) the degradation of aqueous TCE in a mixed flow-through cell as it minimizes the influence of oxygen generated at the MMO anode on TCE reduction at the cathode. Furthermore, placing the MMO anode downstream of the cathode neutralizes pH and redox potential of the treated solution. Higher flow velocity under the C→A setup increases TCE mass flux reduction rate. Using multiple cathodes and an iron foam cathode up stream of the anode increase the removal rate by 1.6 and 2.4 times, respectively. More than 99% of TCE was removed in the presence of Pd catalyst on carbon and as an iron foam coating. Enhanced reaction rates found in this study imply that a mixed flow-through electrochemical cell with multiple cathodes up stream of an anode is an effective method to promote the reduction of TCE in groundwater. PMID:25931774
Characterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.
Zhang, Wenbo; Lin, Xiaofei; Peddigari, Suresh; Takechi, Katsuaki; Takano, Hiroyoshi; Takio, Susumu
2007-02-01
Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3' and 5' RACE suggested that PySN1 was expressed as a chimera transcript with flanking SINE-unrelated sequences and possessed the poly-A tail at the same position near the 3' end of PySN1.
spa typing for epidemiological surveillance of Staphylococcus aureus.
Hallin, Marie; Friedrich, Alexander W; Struelens, Marc J
2009-01-01
The spa typing method is based on sequencing of the polymorphic X region of the protein A gene (spa), present in all strains of Staphylococcus aureus. The X region is constituted of a variable number of 24-bp repeats flanked by well-conserved regions. This single-locus sequence-based typing method combines a number of technical advantages, such as rapidity, reproducibility, and portability. Moreover, due to its repeat structure, the spa locus simultaneously indexes micro- and macrovariations, enabling the use of spa typing in both local and global epidemiological studies. These studies are facilitated by the establishment of standardized spa type nomenclature and Internet shared databases.
Processing of Archaebacterial Intron-Containing tRNA Gene Transcripts.
1987-07-31
1{ 1. Project Goals: A. To determine the mechanism of tRNA intron processing in the halophilic archaebacteria. B. Characterize and compare the...enzyme(s) responsible for the removal of 5’-flanking sequences from halophilic and sulfur-dependent tRNA gene transcripts. C. Examine the structure and...distribution of tRNA introns in the halophilic archaebacteria. 2. Accomplishments: A. Intron processing mechanism We have succeeded in our primary
Simplex and duplex event-specific analytical methods for functional biotech maize.
Lee, Seong-Hun; Kim, Su-Jeong; Yi, Bu-Young
2009-08-26
Analytical methods are very important in the control of genetically modified organism (GMO) labeling systems or living modified organism (LMO) management for biotech crops. Event-specific primers and probes were developed for qualitative and quantitative analysis for biotech maize event 3272 and LY 038 on the basis of the 3' flanking regions, respectively. The qualitative primers confirmed the specificity by a single PCR product and sensitivity to 0.05% as a limit of detection (LOD). Simplex and duplex quantitative methods were also developed using TaqMan real-time PCR. One synthetic plasmid was constructed from two taxon-specific DNA sequences of maize and two event-specific 3' flanking DNA sequences of event 3272 and LY 038 as reference molecules. In-house validation of the quantitative methods was performed using six levels of mixing samples, from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-30%. Limits of quantitation (LOQs) of the quantitative methods were all 0.1% for simplex real-time PCRs of event 3272 and LY 038 and 0.5% for duplex real-time PCR of LY 038. This study reports that event-specific analytical methods were applicable for qualitative and quantitative analysis for biotech maize event 3272 and LY 038.
Wang, Meng; Rada, Cristina; Neuberger, Michael S
2010-01-18
High-affinity antibodies are generated by somatic hypermutation with nucleotide substitutions introduced into the IgV in a semirandom fashion, but with intrinsic mutational hotspots strategically located to optimize antibody affinity maturation. The process is dependent on activation-induced deaminase (AID), an enzyme that can deaminate deoxycytidine in DNA in vitro, where its activity is sensitive to the identity of the 5'-flanking nucleotide. As a critical test of whether such DNA deamination activity underpins antibody diversification and to gain insight into the extent to which the antibody mutation spectrum is dependent on the intrinsic substrate specificity of AID, we investigated whether it is possible to change the IgV mutation spectrum by altering AID's active site such that it prefers a pyrimidine (rather than a purine) flanking the targeted deoxycytidine. Consistent with the DNA deamination mechanism, B cells expressing the modified AID proteins yield altered IgV mutation spectra (exhibiting a purine-->pyrimidine shift in flanking nucleotide preference) and altered hotspots. However, AID-catalyzed deamination of IgV targets in vitro does not yield the same degree of hotspot dominance to that observed in vivo, indicating the importance of features beyond AID's active site and DNA local sequence environment in determining in vivo hotspot dominance.
Kim, S-J; Young, L J; Gonen, D; Veenstra-VanderWeele, J; Courchesne, R; Courchesne, E; Lord, C; Leventhal, B L; Cook, E H; Insel, T R
2002-01-01
Impairment in social reciprocity is a central component of autism. In preclinical studies, arginine vasopressin (AVP) has been shown to increase a range of social behaviors, including affiliation and attachment, via the V(1a) receptor (AVPR1A) in the brain. Both the behavioral effects of AVP and the neural distribution of the V1a receptor vary greatly across mammalian species. This difference in regional receptor expression as well as differences in social behavior may result from a highly variable repetitive sequence in the 5' flanking region of the V1a gene (AVPR1A). Given this comparative evidence for a role in inter-species variation in social behavior, we explored whether within our own species, variation in the human AVPR1A may contribute to individual variations in social behavior, with autism representing an extreme form of social impairment. We genotyped two microsatellite polymorphisms from the 5' flanking region of AVPR1A for 115 autism trios and found nominally significant transmission disequilibrium between autism and one of the microsatellite markers by Multiallelic Transmission/Disequilibrium test (MTDT) that was not significant after Bonferroni correction. We also screened approximately 2 kb of the 5' flanking region and the coding region and identified 10 single nucleotide polymorphisms.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
Alignment methods: strategies, challenges, benchmarking, and comparative overview.
Löytynoja, Ari
2012-01-01
Comparative evolutionary analyses of molecular sequences are solely based on the identities and differences detected between homologous characters. Errors in this homology statement, that is errors in the alignment of the sequences, are likely to lead to errors in the downstream analyses. Sequence alignment and phylogenetic inference are tightly connected and many popular alignment programs use the phylogeny to divide the alignment problem into smaller tasks. They then neglect the phylogenetic tree, however, and produce alignments that are not evolutionarily meaningful. The use of phylogeny-aware methods reduces the error but the resulting alignments, with evolutionarily correct representation of homology, can challenge the existing practices and methods for viewing and visualising the sequences. The inter-dependency of alignment and phylogeny can be resolved by joint estimation of the two; methods based on statistical models allow for inferring the alignment parameters from the data and correctly take into account the uncertainty of the solution but remain computationally challenging. Widely used alignment methods are based on heuristic algorithms and unlikely to find globally optimal solutions. The whole concept of one correct alignment for the sequences is questionable, however, as there typically exist vast numbers of alternative, roughly equally good alignments that should also be considered. This uncertainty is hidden by many popular alignment programs and is rarely correctly taken into account in the downstream analyses. The quest for finding and improving the alignment solution is complicated by the lack of suitable measures of alignment goodness. The difficulty of comparing alternative solutions also affects benchmarks of alignment methods and the results strongly depend on the measure used. As the effects of alignment error cannot be predicted, comparing the alignments' performance in downstream analyses is recommended.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doug Blankenship
Archive of ArcGIS data from the West Flank FORGE site located in Coso, California. Archive contains the following eight shapefiles: Polygon of the 3D geologic model (WestFlank3DGeologicModelExtent) Polylines of the traces 3D modeled faults (WestFlank3DModeledFaultTraces) Polylines of the fault traces from Duffield and Bacon, 1980 (WestFlankFaultsfromDuffieldandBacon) Polygon of the West Flank FORGE site (WestFlankFORGEsite) Polylines of the traces of the geologic cross-sections (cross-sections in a separate archive in the GDR) (WestFlankGeologicCrossSections) Polylines of the traces of the seismic reflection profiles through and adjacent to the West Flank site (seismic reflection profiles in a separate archive in the GDR) (WestFlankSiesmicReflectionProfiles) Pointsmore » of the well collars in and around the West Flank site (WestFlankWellCollars) Polylines of the surface expression of the West Flank well paths (WestFlankWellPaths)« less
User Guidelines for the Brassica Database: BRAD.
Wang, Xiaobo; Cheng, Feng; Wang, Xiaowu
2016-01-01
The genome sequence of Brassica rapa was first released in 2011. Since then, further Brassica genomes have been sequenced or are undergoing sequencing. It is therefore necessary to develop tools that help users to mine information from genomic data efficiently. This will greatly aid scientific exploration and breeding application, especially for those with low levels of bioinformatic training. Therefore, the Brassica database (BRAD) was built to collect, integrate, illustrate, and visualize Brassica genomic datasets. BRAD provides useful searching and data mining tools, and facilitates the search of gene annotation datasets, syntenic or non-syntenic orthologs, and flanking regions of functional genomic elements. It also includes genome-analysis tools such as BLAST and GBrowse. One of the important aims of BRAD is to build a bridge between Brassica crop genomes with the genome of the model species Arabidopsis thaliana, thus transferring the bulk of A. thaliana gene study information for use with newly sequenced Brassica crops.
Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN
Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger
2016-01-01
Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831
Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster
Harden, N.; Ashburner, M.
1990-01-01
FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013
Identification and characterization of circular RNAs in zebrafish.
Shen, Yudong; Guo, Xianwu; Wang, Weimin
2017-01-01
Circular RNA (circRNA), a class of RNAs with circular structure, has received little attention until recently, when some new features and functions were discovered. In the present study, we sequenced circRNAs in zebrafish (Danio rerio) and identified 3868 circRNAs using three algorithms (find_circ, CIRI, segemehl). The analysis of microRNA target sites on circRNAs shows that some circRNAs may function as miRNA sponges. Furthermore, we identified the existence of reverse complementary sequences in the flanking regions of only 25 (2.64%) exonic circRNAs, indicating that the mechanism of zebrafish exonic circRNA biogenesis might be different from that in mammals. Moreover, 1122 (29%) zebrafish circRNA sequences showed homology with human, mouse and coelacanth circRNAs. © 2016 Federation of European Biochemical Societies.
[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].
Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen
2018-02-10
OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.
Parsons, Michael T.; Whiley, Phillip J.; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A.; Marquart, Louise; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D.; Spurdle, Amanda B.
2014-01-01
Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. PMID:24302565
Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8
DOE Office of Scientific and Technical Information (OSTI.GOV)
Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong
2010-02-19
Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less
Leblanc, B; Read, C; Moss, T
1993-02-01
The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.
2015-08-01
Sequence tags were mapped on the human reference genome using the Novoalign software. Only those tags... the linear islands to create a novel junctional sequence that does not exist in the genome . Thus the PE- sequence of a fragment that breaks at or...identified in cancer cell lines. (b) Median percent GC content of microDNAs and the genomic sequences up- or downstream of the source loci are
Novel Immune Modulating Cellular Vaccine for Prostate Cancer
2014-10-01
restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal
FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes
Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena
2017-01-01
Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678
DOE Office of Scientific and Technical Information (OSTI.GOV)
Funkenstein, B.; Leary, S.L.; Stein, J.C.
1988-03-01
The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of themore » Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.« less
Akpinar, Bala Ani; Biyiklioglu, Sezgi; Alptekin, Burcu; Havránková, Miroslava; Vrána, Jan; Doležel, Jaroslav; Distelfeld, Assaf; Hernandez, Pilar; Budak, Hikmet
2018-05-04
Wild emmer wheat (Triticum turgidum ssp. dicoccoides) is the progenitor of wheat. We performed chromosome-based survey sequencing of the 14 chromosomes, examining repetitive sequences, protein-coding genes, miRNA/target pairs and tRNA genes, as well as syntenic relationships with related grasses. We found considerable differences in the content and distribution of repetitive sequences between the A and B subgenomes. The gene contents of individual chromosomes varied widely, not necessarily correlating with chromosome size. We catalogued candidate agronomically important loci, along with new alleles and flanking sequences that can be used to design exome sequencing. Syntenic relationships and virtual gene orders revealed several small-scale evolutionary rearrangements, in addition to providing evidence for the 4AL-5AL-7BS translocation in wild emmer wheat. Chromosome-based sequence assemblies contained five novel miRNA families, among 59 families putatively encoded in the entire genome which provide insight into the domestication of wheat and an overview of the genome content and organization. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Structural features of the rice chromosome 4 centromere.
Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin
2004-01-01
A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.
Nanopore sequencing technology: a new route for the fast detection of unauthorized GMO.
Fraiture, Marie-Alice; Saltykova, Assia; Hoffman, Stefan; Winand, Raf; Deforce, Dieter; Vanneste, Kevin; De Keersmaecker, Sigrid C J; Roosens, Nancy H C
2018-05-21
In order to strengthen the current genetically modified organism (GMO) detection system for unauthorized GMO, we have recently developed a new workflow based on DNA walking to amplify unknown sequences surrounding a known DNA region. This DNA walking is performed on transgenic elements, commonly found in GMO, that were earlier detected by real-time PCR (qPCR) screening. Previously, we have demonstrated the ability of this approach to detect unauthorized GMO via the identification of unique transgene flanking regions and the unnatural associations of elements from the transgenic cassette. In the present study, we investigate the feasibility to integrate the described workflow with the MinION Next-Generation-Sequencing (NGS). The MinION sequencing platform can provide long read-lengths and deal with heterogenic DNA libraries, allowing for rapid and efficient delivery of sequences of interest. In addition, the ability of this NGS platform to characterize unauthorized and unknown GMO without any a priori knowledge has been assessed.
Ventura, Marco; Canchaya, Carlos; Meylan, Valèrie; Klaenhammer, Todd R.; Zink, Ralf
2003-01-01
We analyzed the tuf gene, encoding elongation factor Tu, from 33 strains representing 17 Lactobacillus species and 8 Bifidobacterium species. The tuf sequences were aligned and used to infer phylogenesis among species of lactobacilli and bifidobacteria. We demonstrated that the synonymous substitution affecting this gene renders elongation factor Tu a reliable molecular clock for investigating evolutionary distances of lactobacilli and bifidobacteria. In fact, the phylogeny generated by these tuf sequences is consistent with that derived from 16S rRNA analysis. The investigation of a multiple alignment of tuf sequences revealed regions conserved among strains belonging to the same species but distinct from those of other species. PCR primers complementary to these regions allowed species-specific identification of closely related species, such as Lactobacillus casei group members. These tuf gene-based assays developed in this study provide an alternative to present methods for the identification for lactic acid bacterial species. Since a variable number of tuf genes have been described for bacteria, the presence of multiple genes was examined. Southern analysis revealed one tuf gene in the genomes of lactobacilli and bifidobacteria, but the tuf gene was arranged differently in the genomes of these two taxa. Our results revealed that the tuf gene in bifidobacteria is flanked by the same gene constellation as the str operon, as originally reported for Escherichia coli. In contrast, bioinformatic and transcriptional analyses of the DNA region flanking the tuf gene in four Lactobacillus species indicated the same four-gene unit and suggested a novel tuf operon specific for the genus Lactobacillus. PMID:14602655
Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain
2014-01-01
Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herzog, R.; Lutz, S.; Blin, N.
1991-02-05
Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less
Song, Jiangning; Wang, Minglei; Burrage, Kevin
2006-07-21
High-quality data about protein structures and their gene sequences are essential to the understanding of the relationship between protein folding and protein coding sequences. Firstly we constructed the EcoPDB database, which is a high-quality database of Escherichia coli genes and their corresponding PDB structures. Based on EcoPDB, we presented a novel approach based on information theory to investigate the correlation between cysteine synonymous codon usages and local amino acids flanking cysteines, the correlation between cysteine synonymous codon usages and synonymous codon usages of local amino acids flanking cysteines, as well as the correlation between cysteine synonymous codon usages and the disulfide bonding states of cysteines in the E. coli genome. The results indicate that the nearest neighboring residues and their synonymous codons of the C-terminus have the greatest influence on the usages of the synonymous codons of cysteines and the usage of the synonymous codons has a specific correlation with the disulfide bond formation of cysteines in proteins. The correlations may result from the regulation mechanism of protein structures at gene sequence level and reflect the biological function restriction that cysteines pair to form disulfide bonds. The results may also be helpful in identifying residues that are important for synonymous codon selection of cysteines to introduce disulfide bridges in protein engineering and molecular biology. The approach presented in this paper can also be utilized as a complementary computational method and be applicable to analyse the synonymous codon usages in other model organisms.
A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract
Yang, Juhua; Zhu, Yihua; Gu, Feng; He, Xiang; Cao, Zongfu; Li, Xuexi; Tong, Yi
2008-01-01
Purpose To identify the molecular defect underlying an autosomal dominant congenital nuclear cataract in a Chinese family. Methods Twenty-two members of a three-generation pedigree were recruited, clinical examinations were performed, and genomic DNA was extracted from peripheral blood leukocytes. All members were genotyped with polymorphic microsatellite markers adjacent to each of the known cataract-related genes. Linkage analysis was performed after genotyping. Candidate genes were screened for mutation using direct sequencing. Individuals were screened for presence of a mutation by restriction fragment length polymorphism (RFLP) analysis. Results Linkage analysis identified a maximum LOD score of 3.31 (recombination fraction [θ]=0.0) with marker D22S1167 on chromosome 22, which flanks the β-crystallin gene cluster (CRYBB3, CRYBB2, CRYBB1, and CRYBA4). Sequencing the coding regions and the flanking intronic sequences of these four candidate genes identified a novel, heterozygous C→T transition in exon 6 of CRYBB1 in the affected individuals of the family. This single nucleotide change introduced a novel BfaI site and was predicted to result in a nonsense mutation at codon 223 that changed a phylogenetically conserved amino acid to a stop codon (p.Q223X). RFLP analysis confirmed that this mutation co-segregated with the disease phenotype in all available family members and was not found in 100 normal unrelated individuals from the same ethnic background. Conclusions This study has identified a novel nonsense mutation in CRYBB1 (p.Q223X) associated with autosomal dominant congenital nuclear cataract. PMID:18432316
Splicing of designer exons informs a biophysical model for exon definition
Arias, Mauricio A.; Chasin, Lawrence A.
2015-01-01
Pre-mRNA molecules in humans contain mostly short internal exons flanked by longer introns. To explain the removal of such introns, exon recognition instead of intron recognition has been proposed. We studied this exon definition using designer exons (DEs) made up of three prototype modules of our own design: an exonic splicing enhancer (ESE), an exonic splicing silencer (ESS), and a Reference Sequence (R) predicted to be neither. Each DE was examined as the central exon in a three-exon minigene. DEs made of R modules showed a sharp size dependence, with exons shorter than 14 nt and longer than 174 nt splicing poorly. Changing the strengths of the splice sites improved longer exon splicing but worsened shorter exon splicing, effectively displacing the curve to the right. For the ESE we found, unexpectedly, that its enhancement efficiency was independent of its position within the exon. For the ESS we found a step-wise positional increase in its effects; it was most effective at the 3′ end of the exon. To apply these results quantitatively, we developed a biophysical model for exon definition of internal exons undergoing cotranscriptional splicing. This model features commitment to inclusion before the downstream exon is synthesized and competition between skipping and inclusion fates afterward. Collision of both exon ends to form an exon definition complex was incorporated to account for the effect of size; ESE/ESS effects were modeled on the basis of stabilization/destabilization. This model accurately predicted the outcome of independent experiments on more complex DEs that combined ESEs and ESSs. PMID:25492963
Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon
2013-06-01
Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.
Jiang, Zhou; Li, Ping; Jiang, Dawei; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Wang, Yanxin
2016-01-01
Arsenic biogeochemistry has been studied extensively in acid sulfate-chloride hot springs, but not in acid sulfate hot springs with low chloride. In this study, Zhenzhuquan in Tengchong geothermal area, a representative acid sulfate hot spring with low chloride, was chosen to study arsenic geochemistry and microbial community structure using Illumina MiSeq sequencing. Over 0.3 million 16S rRNA sequence reads were obtained from 6-paired parallel water and sediment samples along its outflow channel. Arsenic oxidation occurred in the Zhenxhuquan pool, with distinctly high ratios of arsenate to total dissolved arsenic (0.73–0.86). Coupled with iron and sulfur oxidation along the outflow channel, arsenic accumulated in downstream sediments with concentrations up to 16.44 g/kg and appeared to significantly constrain their microbial community diversity. These oxidations might be correlated with the appearance of some putative functional microbial populations, such as Aquificae and Pseudomonas (arsenic oxidation), Sulfolobus (sulfur and iron oxidation), Metallosphaera and Acidicaldus (iron oxidation). Temperature, total organic carbon and dissolved oxygen significantly shaped the microbial community structure of upstream and downstream samples. In the upstream outflow channel region, most microbial populations were microaerophilic/anaerobic thermophiles and hyperthermophiles, such as Sulfolobus, Nocardia, Fervidicoccus, Delftia, and Ralstonia. In the downstream region, aerobic heterotrophic mesophiles and thermophiles were identified, including Ktedonobacteria, Acidicaldus, Chthonomonas and Sphingobacteria. A total of 72.41–95.91% unassigned-genus sequences were derived from the downstream high arsenic sediments 16S rRNA clone libraries. This study could enable us to achieve an integrated understanding on arsenic biogeochemistry in acid hot springs. PMID:26761709
Preliminary volcano-hazard assessment for Mount Spurr Volcano, Alaska
Waythomas, Christopher F.; Nye, Christopher J.
2001-01-01
Mount Spurr volcano is an ice- and snow-covered stratovolcano complex located in the north-central Cook Inlet region about 100 kilometers west of Anchorage, Alaska. Mount Spurr volcano consists of a breached stratovolcano, a lava dome at the summit of Mount Spurr, and Crater Peak vent, a small stratocone on the south flank of Mount Spurr volcano. Historical eruptions of Crater Peak occurred in 1953 and 1992. These eruptions were relatively small but explosive, and they dispersed volcanic ash over areas of interior, south-central, and southeastern Alaska. Individual ash clouds produced by the 1992 eruption drifted east, north, and south. Within a few days of the eruption, the south-moving ash cloud was detected over the North Atlantic. Pyroclastic flows that descended the south flank of Crater Peak during both historical eruptions initiated volcanic-debris flows or lahars that formed temporary debris dams across the Chakachatna River, the principal drainage south of Crater Peak. Prehistoric eruptions of Crater Peak and Mount Spurr generated clouds of volcanic ash, pyroclastic flows, and lahars that extended to the volcano flanks and beyond. A flank collapse on the southeast side of Mount Spurr generated a large debris avalanche that flowed about 20 kilometers beyond the volcano into the Chakachatna River valley. The debris-avalanche deposit probably formed a large, temporary debris dam across the Chakachatna River. The distribution and thickness of volcanic-ash deposits from Mount Spurr volcano in the Cook Inlet region indicate that volcanic-ash clouds from most prehistoric eruptions were as voluminous as those produced by the 1953 and 1992 eruptions. Clouds of volcanic ash emitted from the active vent, Crater Peak, would be a major hazard to all aircraft using Ted Stevens Anchorage International Airport and other local airports and, depending on wind direction, could drift a considerable distance beyond the volcano. Ash fall from future eruptions could disrupt many types of economic and social activities, including oil and gas operations and shipping activities in the Cook Inlet area. Eruptions of Crater Peak could involve significant amounts of ice and snow that would lead to the formation of large lahars, formation of volcanic debris dams, and downstream flooding. The greatest hazards in order of importance are described below and shown on plate 1.
Singh, Swati; Gupta, Sanchita; Mani, Ashutosh; Chaturvedi, Anoop
2012-01-01
Humulus lupulus is commonly known as hops, a member of the family moraceae. Currently many projects are underway leading to the accumulation of voluminous genomic and expressed sequence tag sequences in public databases. The genetically characterized domains in these databases are limited due to non-availability of reliable molecular markers. The large data of EST sequences are available in hops. The simple sequence repeat markers extracted from EST data are used as molecular markers for genetic characterization, in the present study. 25,495 EST sequences were examined and assembled to get full-length sequences. Maximum frequency distribution was shown by mononucleotide SSR motifs i.e. 60.44% in contig and 62.16% in singleton where as minimum frequency are observed for hexanucleotide SSR in contig (0.09%) and pentanucleotide SSR in singletons (0.12%). Maximum trinucleotide motifs code for Glutamic acid (GAA) while AT/TA were the most frequent repeat of dinucleotide SSRs. Flanking primer pairs were designed in-silico for the SSR containing sequences. Functional categorization of SSRs containing sequences was done through gene ontology terms like biological process, cellular component and molecular function. PMID:22368382
Error and Error Mitigation in Low-Coverage Genome Assemblies
Hubisz, Melissa J.; Lin, Michael F.; Kellis, Manolis; Siepel, Adam
2011-01-01
The recent release of twenty-two new genome sequences has dramatically increased the data available for mammalian comparative genomics, but twenty of these new sequences are currently limited to ∼2× coverage. Here we examine the extent of sequencing error in these 2× assemblies, and its potential impact in downstream analyses. By comparing 2× assemblies with high-quality sequences from the ENCODE regions, we estimate the rate of sequencing error to be 1–4 errors per kilobase. While this error rate is fairly modest, sequencing error can still have surprising effects. For example, an apparent lineage-specific insertion in a coding region is more likely to reflect sequencing error than a true biological event, and the length distribution of coding indels is strongly distorted by error. We find that most errors are contributed by a small fraction of bases with low quality scores, in particular, by the ends of reads in regions of single-read coverage in the assembly. We explore several approaches for automatic sequencing error mitigation (SEM), making use of the localized nature of sequencing error, the fact that it is well predicted by quality scores, and information about errors that comes from comparisons across species. Our automatic methods for error mitigation cannot replace the need for additional sequencing, but they do allow substantial fractions of errors to be masked or eliminated at the cost of modest amounts of over-correction, and they can reduce the impact of error in downstream phylogenomic analyses. Our error-mitigated alignments are available for download. PMID:21340033
Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server
Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J
2006-01-01
Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563
Bidard, J N; de Nadai, F; Rovere, C; Moinier, D; Laur, J; Martinez, J; Cuber, J C; Kitabgi, P
1993-01-01
Neurotensin (NT) and neuromedin N (NN) are two related biologically active peptides that are encoded in the same precursor molecule. In the rat, the precursor consists of a 169-residue polypeptide starting with an N-terminal signal peptide and containing in its C-terminal region one copy each of NT and NN. NN precedes NT and is separated from it by a Lys-Arg sequence. Two other Lys-Arg sequences flank the N-terminus of NN and the C-terminus of NT. A fourth Lys-Arg sequence occurs near the middle of the precursor and is followed by an NN-like sequence. Finally, an Arg-Arg pair is present within the NT moiety. The four Lys-Arg doublets represent putative processing sites in the precursor molecule. The present study was designed to investigate the post-translational processing of the NT/NN precursor in the rat medullary thyroid carcinoma (rMTC) 6-23 cell line, which synthesizes large amounts of NT upon dexamethasone treatment. Five region-specific antisera recognizing the free N- or C-termini of sequences adjacent to the basic doublets were produced, characterized and used for immunoblotting and radioimmunoassay studies in combination with gel filtration, reverse-phase h.p.l.c. and trypsin digestion of rMTC 6-23 cell extracts. Because two of the antigenic sequences, i.e. NN and the NN-like sequence, start with a lysine residue that is essential for recognition by their respective antisera, a micromethod by which trypsin specifically cleaves at arginine residues was developed. The results show that dexamethasone-treated rMTC 6-23 cells produced comparable amounts of NT, NN and a peptide corresponding to a large N-terminal precursor fragment lacking the NN and NT moieties. This large fragment was purified. N-Terminal sequencing revealed that it started at residue Ser23 of the prepro-NT/NN sequence, and thus established the Cys22-Ser23 bond as the cleavage site of the signal peptide. Two other large N-terminal fragments bearing respectively the NN and NT sequences at their C-termini were present in lower amounts. The NN-like sequence was internal to all the large fragments. There was no evidence for the presence of peptides with the NN-like sequence at their N-termini. This shows that, in rMTC 6-23 cells, the precursor is readily processed at the three Lys-Arg doublets that flank and separate the NT and NN sequences. In contrast, the Lys-Arg doublet that precedes the NN-like sequence is not processed in this system.(ABSTRACT TRUNCATED AT 400 WORDS) Images Figure 3 PMID:8471039
Scott, K.M.; Vallance, J.W.; Kerle, N.; Macias, J.L.; Strauch, W.; Devoli, G.
2005-01-01
A catastrophic lahar began on 30 October 1998, as hurricane precipitation triggered a small flank collapse of Casita volcano, a complex and probably dormant stratovolcano. The initial rockslide-debris avalanche evolved on the flank to yield a watery debris flood with a sediment concentration less than 60 per cent by volume at the base of the volcano. Within 2-5 km, however, the watery flow entrained (bulked) enough sediment to transform entirely to a debris flow. The debris flow, 6 km downstream and 1??2 km wide and 3 to 6 m deep, killed 2500 people, nearly the entire populations of the communities of El Porvenir and Rolando Rodriguez. These 'new towns' were developed in a prehistoric lahar pathway: at least three flows of similar size since 8330 14C years BP are documented by stratigraphy in the same 30-degree sector. Travel time between perception of the flow and destruction of the towns was only 2??5-3??0 minutes. The evolution of the flow wave occurred with hydraulic continuity and without pause or any extraordinary addition of water. The precipitation trigger of the Casita lahar emphasizes the nee d, in volcano hazard assessments, for including the potential for non-eruption-related collapse lahars with the more predictable potential of their syneruption analogues. The flow behaviour emphasizes that volcano collapses can yield not only volcanic debris avalanches with restricted runouts, but also mobile lahars that enlarge by bulking as they flow. Volumes and hence inundation areas of collapse-runout lahars can increase greatly beyond their sources: the volume of the Casita lahar bulked to at least 2??6 times the contributing volume of the flank collapse and 4??2 times that of the debris flood. At least 78 per cent of the debris flow matrix (sediment < -1??0??; 2 mm) was entrained during flow. Copyright c 2004 John Wiley & Sons, Ltd.
Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research
Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in the architecture of eukaryotic genomes and are the evolutionary origin of retroviruses, including human immunodeficiency virus (HIV).
Supply-Limited Bedforms in a Gravel-Sand Transition
NASA Astrophysics Data System (ADS)
Venditti, J. G.; Nittrouer, J. A.; Humphries, R. P.; Allison, M. A.
2009-12-01
Rivers often exhibit an abrupt transition from gravel to sand-bedded conditions as river channel slopes decrease. A distinct suite of bedforms has been observed through these reaches where sand supply to the bed is limited. The suite of bedforms includes a sequence of sand ribbons, barchans, and channel spanning dunes as sediment supply increases in the downstream direction. While these bedforms have been extensively documented in laboratory channels, there are relatively few observations of this sequence of supply-limited bedforms from large natural channels. Here we examine the sequence through the gravel-sand transition of the Fraser River in Southwestern British Columbia. We mapped the bed using multi-beam swath-bathymetry (Reson 8101 Seabat) at high flow (~9,000 m3s-1) immediately following a high peak flow of 11,800 m3s-1 in June 2007 The bed material grades from >70% gravel to entirely sand through the reach. The bedforms follow the expected sequence where sand ribbons and barchanoid forms cover the bed where it is primarily gravel. Channel spanning dunes form as the sand bed coverage increases. Bedform dimensions (height and length) increase moving downstream as the sand moving on the bed increases. Supply-unlimited bedforms typically scale with the flow depth where the height is 1/5 the flow depth. The bedforms developed over the gravel are undersized by this criterion. Downstream, where the bed is dominantly sand, bedforms do scale with flow depth. These data highlight the dominant role sediment supply can play in bedform morphology and scaling, confirming patterns observed in laboratory data.
Geomorphic Response to Significant Sediment Loading Along Tahoma Creek on Mount Rainier, WA
NASA Astrophysics Data System (ADS)
Anderson, S.; Kennard, P.; Pitlick, J.
2012-12-01
Increased sediment loading in streams draining the flanks of Mt. Rainier has caused significant damage to National Park Service infrastructure and has prompted concern in downstream communities. The processes driving sedimentation and the controls on downstream response are explored in the 37 km2 Tahoma Creek basin, using repeat LiDAR surveys supplemented with additional topographic datasets. DEM differencing between 2003 and 2008 LiDAR datasets shows that over 2.2 million cubic meters of material was evacuated from the upper reaches of the basin, predominately in the form of debris flows. These debris flows were sourced in recently exposed lateral moraines, bulking through the broad collapse of unstable hillslopes. 40% of this material was deposited in the historic debris fan 4-6 km downstream of the terminus, while 55% completely exited the system at the downstream point of the surveys. Distinct zones of aggradation and incision of up to one meter are present along the lower channel and appear to be controlled by valley constrictions and inflections. However, the lower channel has shown remarkable long-term stability in the face of significant sediment loads. Alder ages suggest fluvial high stands in the late 70's and early 90's, immediately following periods of significant debris flow activity, yet the river quickly returned to pre-disturbance elevations. On longer time scales, the presence of old-growth forest on adjacent floodplain/terrace surfaces indicates broad stability on both vertical and horizontal planes. More than a passive indicator, these forested surfaces play a significant role in maintaining channel stability through increased overbank roughness and the formation of bank-armoring log jams. Sediment transport mechanics along this lower reach are explored using the TomSED sediment transport model, driven by data from an extensive sediment sampling and stream gaging effort. In its current state, the model is able to replicate the stability of the channel but significantly under predicts total loads when compared to the LiDAR differencing.
NASA Astrophysics Data System (ADS)
Brand, Brittany D.; Bendaña, Sylvana; Self, Stephen; Pollock, Nicholas
2016-07-01
Our ability to interpret the deposits of pyroclastic density currents (PDCs) is critical for understanding the transport and depositional processes that control PDC dynamics. This paper focuses on the influence of slope on flow dynamics and criticality as recorded in PDC deposits from the 18 May 1980 eruption of Mt. St. Helens (USA). PDC deposits are found along the steep flanks (10°-30°) and across the pumice plain ( 5°) up to 8 km north of the volcano. Granulometry, componentry and descriptions of depositional characteristics (e.g., bedform morphology) are recorded with distance from source. The pumice plain deposits are primarily thick (3-12 m), massive and poorly-sorted, and represent deposition from a series of concentrated PDCs. By contrast, the steep flank deposits are stratified to cross-stratified, suggesting deposition from PDCs where turbulence strongly influenced transport and depositional processes. We propose that acceleration of the concentrated PDCs along the steep flanks resulted in thinning of the concentrated, basal region of the current(s). Enhanced entrainment of ambient air, and autofluidization from upward fluxes of air from substrate interstices and plunging breakers across rugged, irregular topography further inflated the currents to the point that the overriding turbulent region strongly influenced transport and depositional mechanisms. Acceleration in combination with partial confinement in slot canyons and high surface roughness would also increase basal shear stress, further promoting shear and traction transport in the basal region of the current. Conditions along the steep flank resulted in supercritical flow, as recorded by regressive bedforms, which gradually transitioned to subcritical flow downstream as the concentrated basal region thickness increased as a function of decreasing slope and flow energy. We also find that (1) PDCs were erosive into the underlying granular substrate along high slopes (> 25°) where currents were partially confined in steep slot canyons, suggesting that basal shear stress is an important control on erosive capacity, and (2) bedform amplitude, wavelength and the presence of regressive bedforms increase with increasing slope and proximity to source along the steep flank, suggesting a link between bedform morphology, flow velocity, and flow criticality. While our results indicate that slope and irregular topography strongly influence PDC dynamics, criticality and erosive capacity, the influence of these conditions on ultimate flow runout distance is unclear. The work here also highlights the issue that relationships between the controls on bedform size and morphology in density stratified flows remain poorly constrained, limiting our ability to extract important information about the currents that produced them. These final two points warrant further exploration through the combination of field, experimental and numerical approaches.
Serova, Irina A; Dvoryanchikov, Gennady A; Andreeva, Ludmila E; Burkov, Ivan A; Dias, Luciene P B; Battulin, Nariman R; Smirnov, Alexander V; Serov, Oleg L
2012-06-01
A new expression vector containing the 1,944 bp 5'-flanking regulatory region together with exon 1 and intron 1 of the goat alpha-S1-casein gene (CSN1S1), the full-sized human granulocyte colony-stimulating factor gene (hGCSF) and the 3'-flanking sequence of the bovine CSN1S1, was created. The vector DNA was used for generation of four mouse transgenic lines. The transgene was integrated into chromosomes 8 and 12 of two founders as 2 and 5 copies, respectively. Tissue-specific secretion of hG-CSF into the milk of transgenic mice was in the range of 19-40 μg/ml. RT-PCR analysis of various tissues of the transgenic mice demonstrated that expression of hGCSF was detected in only the mammary gland in the progeny of all founders. Moreover, cells were shown to be positive for hG-CSF by immunofluorescent analysis in the mammary glands but not in any other tissues. There were no signs of mosaic expression in the mammary gland. Trace amounts of hG-CSF were detected in the serum of females of two transgenic lines during lactation only. However, no transgenic mice showed any changes in hematopoiesis based on the number of granulocytes in blood. Immunoblotting of hG-CSF in the milk of transgenic mice revealed two forms, presumably the glycosylated and non-glycosylated forms. The hematopoietic activity of hG-CSF in the milk of transgenic females is comparable to that of recombinant G-CSF. In general, the data obtained in this study show that the new expression vector is able to provide correct tissue-specific expression of hG-CSF with high biological activity in transgenic mice.
Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra
2013-01-01
Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this promoter could grant wide applicability in plant biotechnology.
Khoroshko, Varvara A.; Levitsky, Viktor G.; Zykova, Tatyana Yu.; Antonenko, Oksana V.; Belyaeva, Elena S.; Zhimulev, Igor F.
2016-01-01
Late-replicating domains (intercalary heterochromatin) in the Drosophila genome display a number of features suggesting their organization is quite unique. Typically, they are quite large and encompass clusters of functionally unrelated tissue-specific genes. They correspond to the topologically associating domains and conserved microsynteny blocks. Our study aims at exploring further details of molecular organization of intercalary heterochromatin and has uncovered surprising heterogeneity of chromatin composition in these regions. Using the 4HMM model developed in our group earlier, intercalary heterochromatin regions were found to host chromatin fragments with a particular epigenetic profile. Aquamarine chromatin fragments (spanning 0.67% of late-replicating regions) are characterized as a class of sequences that appear heterogeneous in terms of their decompactization. These fragments are enriched with enhancer sequences and binding sites for insulator proteins. They likely mark the chromatin state that is related to the binding of cis-regulatory proteins. Malachite chromatin fragments (11% of late-replicating regions) appear to function as universal transitional regions between two contrasting chromatin states. Namely, they invariably delimit intercalary heterochromatin regions from the adjacent active chromatin of interbands. Malachite fragments also flank aquamarine fragments embedded in the repressed chromatin of late-replicating regions. Significant enrichment of insulator proteins CP190, SU(HW), and MOD2.2 was observed in malachite chromatin. Neither aquamarine nor malachite chromatin types appear to correlate with the positions of highly conserved non-coding elements (HCNE) that are typically replete in intercalary heterochromatin. Malachite chromatin found on the flanks of intercalary heterochromatin regions tends to replicate earlier than the malachite chromatin embedded in intercalary heterochromatin. In other words, there exists a gradient of replication progressing from the flanks of intercalary heterochromatin regions center-wise. The peculiar organization and features of replication in large late-replicating regions are discussed as possible factors shaping the evolutionary stability of intercalary heterochromatin. PMID:27300486
Excess single-stranded DNA inhibits meiotic double-strand break repair.
Johnson, Rebecca; Borde, Valérie; Neale, Matthew J; Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S H
2007-11-01
During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins.
Excess Single-Stranded DNA Inhibits Meiotic Double-Strand Break Repair
Bishop-Bailey, Anna; North, Matthew; Harris, Sheila; Nicolas, Alain; Goldman, Alastair S. H
2007-01-01
During meiosis, self-inflicted DNA double-strand breaks (DSBs) are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1.We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE), in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Δ cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA) in dmc1Δ cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects of overabundant repair proteins. PMID:18081428
Arkas: Rapid reproducible RNAseq analysis
Colombo, Anthony R.; J. Triche Jr, Timothy; Ramsingh, Giridharan
2017-01-01
The recently introduced Kallisto pseudoaligner has radically simplified the quantification of transcripts in RNA-sequencing experiments. We offer cloud-scale RNAseq pipelines Arkas-Quantification, and Arkas-Analysis available within Illumina’s BaseSpace cloud application platform which expedites Kallisto preparatory routines, reliably calculates differential expression, and performs gene-set enrichment of REACTOME pathways . Due to inherit inefficiencies of scale, Illumina's BaseSpace computing platform offers a massively parallel distributive environment improving data management services and data importing. Arkas-Quantification deploys Kallisto for parallel cloud computations and is conveniently integrated downstream from the BaseSpace Sequence Read Archive (SRA) import/conversion application titled SRA Import. Arkas-Analysis annotates the Kallisto results by extracting structured information directly from source FASTA files with per-contig metadata, calculates the differential expression and gene-set enrichment analysis on both coding genes and transcripts. The Arkas cloud pipeline supports ENSEMBL transcriptomes and can be used downstream from the SRA Import facilitating raw sequencing importing, SRA FASTQ conversion, RNA quantification and analysis steps. PMID:28868134
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.
Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R
2003-02-01
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.
Detection of Plasmodium sp. in capybara.
dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin
2009-07-07
In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".
Bolzán, Alejandro D
2017-07-01
By definition, telomeric sequences are located at the very ends or terminal regions of chromosomes. However, several vertebrate species show blocks of (TTAGGG)n repeats present in non-terminal regions of chromosomes, the so-called interstitial telomeric sequences (ITSs), interstitial telomeric repeats or interstitial telomeric bands, which include those intrachromosomal telomeric-like repeats located near (pericentromeric ITSs) or within the centromere (centromeric ITSs) and those telomeric repeats located between the centromere and the telomere (i.e., truly interstitial telomeric sequences) of eukaryotic chromosomes. According with their sequence organization, localization and flanking sequences, ITSs can be classified into four types: 1) short ITSs, 2) subtelomeric ITSs, 3) fusion ITSs, and 4) heterochromatic ITSs. The first three types have been described mainly in the human genome, whereas heterochromatic ITSs have been found in several vertebrate species but not in humans. Several lines of evidence suggest that ITSs play a significant role in genome instability and evolution. This review aims to summarize our current knowledge about the origin, function, instability and evolution of these telomeric-like repeats in vertebrate chromosomes. Copyright © 2017 Elsevier B.V. All rights reserved.
Subbiah, Madhuri; Xiao, Sa; Collins, Peter L.; Samal, Siba K
2009-01-01
The complete RNA genome sequence of avian paramyxovirus (APMV) serotype 2, strain Yucaipa isolated from chicken has been determined. With genome size of 14,904 nucleotides (nt), strain Yucaipa is consistent with the “rule of six” and is the smallest virus reported to date among the members of subfamily Paramyxovirinae. The genome contains six non-overlapping genes in the order 3′-N-P/V-M-F-HN-L-5′. The genes are flanked on either side by highly-conserved transcription start and stop signals and have intergenic sequences varying in length from 3 to 23 nt. The genome contains a 55 nt leader sequence at 3′ end and a 154 nt trailer sequence at 5′ end. Alignment and phylogenetic analysis of the predicted amino acid sequences of strain Yucaipa proteins with the cognate proteins of viruses of all of the five genera of family Paramyxoviridae showed that APMV-2 strain Yucaipa is more closely related to APMV-6 than APMV-1. PMID:18603323
Cis-acting elements in the promoter region of the human aldolase C gene.
Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F
1993-08-16
We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
Toyoda, N; Kleinhaus, N; Larsen, P R
1996-06-01
We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.
Arrieta-Aguirre, Inés; Menéndez-Manjón, Pilar; Cuétara, María Soledad; Fernández de Larrinoa, Iñigo; García-Ruiz, Juan Carlos; Moragues, María Dolores
2018-02-01
Saprochaete capitata , formerly known as Geotrichum capitatum , is an emerging fungal pathogen with low susceptibility to echinocandins. Here, we report the nucleotide sequence of the S. capitata hot spot 1 region of the FKS gene ( FKS HS1), which codifies for the catalytic subunit of β-1,3-d-glucan synthase, the target of echinocandins. For that purpose, we first designed degenerated oligonucleotide primers derived from conserved flanking regions of the FKS1 HS1 segment of 12 different fungal species. Interestingly, analysis of the translated FKS HS1 sequences of 12 isolates of S. capitata revealed that all of them exhibited the same F-to-L substitution in a position that is highly related to reduced echinocandin susceptibility. Copyright © 2018 American Society for Microbiology.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first experimental evidence of a pseudogene with stronger promoter activity than its parental gene. © 2013.
ReQON: a Bioconductor package for recalibrating quality scores from next-generation sequencing data
2012-01-01
Background Next-generation sequencing technologies have become important tools for genome-wide studies. However, the quality scores that are assigned to each base have been shown to be inaccurate. If the quality scores are used in downstream analyses, these inaccuracies can have a significant impact on the results. Results Here we present ReQON, a tool that recalibrates the base quality scores from an input BAM file of aligned sequencing data using logistic regression. ReQON also generates diagnostic plots showing the effectiveness of the recalibration. We show that ReQON produces quality scores that are both more accurate, in the sense that they more closely correspond to the probability of a sequencing error, and do a better job of discriminating between sequencing errors and non-errors than the original quality scores. We also compare ReQON to other available recalibration tools and show that ReQON is less biased and performs favorably in terms of quality score accuracy. Conclusion ReQON is an open source software package, written in R and available through Bioconductor, for recalibrating base quality scores for next-generation sequencing data. ReQON produces a new BAM file with more accurate quality scores, which can improve the results of downstream analysis, and produces several diagnostic plots showing the effectiveness of the recalibration. PMID:22946927
Zhao, A; Guo, A; Liu, Z; Pape, L
1997-01-01
The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
The importance of the specific Z-DNA structure and polyamines in carcinogenesis: fact or fiction.
Juranic, Z; Kidric, M; Tomin, R; Juranić, I; Spuzić, I; Petrović, J
1991-08-01
In this work some aspects of carcinogenesis are given. The importance of the emergence of Z or H DNA structure in the gene, or in the flanking gene sequences for the gene deletion and unusual gene recombination, is discussed. Some considerations on the role of selective pressure (of polyamines, of Mg2+, of the various levels of topoisomerase II, and of ATP) in the process of oncogene amplification, are given too.
Breinholt, Jesse W; Earl, Chandra; Lemmon, Alan R; Lemmon, Emily Moriarty; Xiao, Lei; Kawahara, Akito Y
2018-01-01
The advent of next-generation sequencing technology has allowed for thecollection of large portions of the genome for phylogenetic analysis. Hybrid enrichment and transcriptomics are two techniques that leverage next-generation sequencing and have shown much promise. However, methods for processing hybrid enrichment data are still limited. We developed a pipeline for anchored hybrid enrichment (AHE) read assembly, orthology determination, contamination screening, and data processing for sequences flanking the target "probe" region. We apply this approach to study the phylogeny of butterflies and moths (Lepidoptera), a megadiverse group of more than 157,000 described species with poorly understood deep-level phylogenetic relationships. We introduce a new, 855 locus AHE kit for Lepidoptera phylogenetics and compare resulting trees to those from transcriptomes. The enrichment kit was designed from existing genomes, transcriptomes, and expressed sequence tags and was used to capture sequence data from 54 species from 23 lepidopteran families. Phylogenies estimated from AHE data were largely congruent with trees generated from transcriptomes, with strong support for relationships at all but the deepest taxonomic levels. We combine AHE and transcriptomic data to generate a new Lepidoptera phylogeny, representing 76 exemplar species in 42 families. The tree provides robust support for many relationships, including those among the seven butterfly families. The addition of AHE data to an existing transcriptomic dataset lowers node support along the Lepidoptera backbone, but firmly places taxa with AHE data on the phylogeny. Combining taxa sequenced for AHE with existing transcriptomes and genomes resulted in a tree with strong support for (Calliduloidea $+$ Gelechioidea $+$ Thyridoidea) $+$ (Papilionoidea $+$ Pyraloidea $+$ Macroheterocera). To examine the efficacy of AHE at a shallow taxonomic level, phylogenetic analyses were also conducted on a sister group representing a more recent divergence, the Saturniidae and Sphingidae. These analyses utilized sequences from the probe region and data flanking it, nearly doubled the size of the dataset; resulting trees supported new phylogenetics relationships, especially within the Saturniidae and Sphingidae (e.g., Hemarina derived in the latter). We hope that our data processing pipeline, hybrid enrichment gene set, and approach of combining AHE data with transcriptomes will be useful for the broader systematics community. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Rangannan, Vetriselvi; Bansal, Manju
2009-12-01
The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool PromPredict. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.
Janecek, S.
1995-01-01
Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed. PMID:7549888
Janecek, S
1995-06-01
Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tully, D.B.; Hillman, D.; Herbert, E.
1986-05-01
Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less
A novel DSPP mutation causes dentinogenesis imperfecta type II in a large Mongolian family
2010-01-01
Background Several studies have shown that the clinical phenotypes of dentinogenesis imperfecta type II (DGI-II) may be caused by mutations in dentin sialophosphoprotein (DSPP). However, no previous studies have documented the clinical phenotype and genetic basis of DGI-II in a Mongolian family from China. Methods We identified a large five-generation Mongolian family from China with DGI-II, comprising 64 living family members of whom 22 were affected. Linkage analysis of five polymorphic markers flanking DSPP gene was used to genotype the families and to construct the haplotypes of these families. All five DSPP exons including the intron-exon boundaries were PCR-amplified and sequenced in 48 members of this large family. Results All affected individuals showed discoloration and severe attrition of their teeth, with obliterated pulp chambers and without progressive high frequency hearing loss or skeletal abnormalities. No recombination was found at five polymorphic markers flanking DSPP in the family. Direct DNA sequencing identified a novel A→G transition mutation adjacent to the donor splicing site within intron 3 in all affected individuals but not in the unaffected family members and 50 unrelated Mongolian individuals. Conclusion This study identified a novel mutation (IVS3+3A→G) in DSPP, which caused DGI-II in a large Mongolian family. This expands the spectrum of mutations leading to DGI-II. PMID:20146806
2010-01-01
Background The large serine recombinase phiC31 from broad host range Streptomyces temperate phage, catalyzes the site-specific recombination of two recognition sites that differ in sequence, typically known as attachment sites attB and attP. Previously, we characterized the phiC31 catalytic activity and modes of action in the fission yeast Schizosaccharomyces pombe. Results In this work, the phiC31 recombinase gene was placed under the control of the Arabidopsis OXS3 promoter and introduced into Arabidopsis harboring a chromosomally integrated attB and attP-flanked target sequence. The phiC31 recombinase excised the attB and attP-flanked DNA, and the excision event was detected in subsequent generations in the absence of the phiC31 gene, indicating germinal transmission was possible. We further verified that the genomic excision was conservative and that introduction of a functional recombinase can be achieved through secondary transformation as well as manual crossing. Conclusion The phiC31 system performs site-specific recombination in germinal tissue, a prerequisite for generating stable lines with unwanted DNA removed. The precise site-specific deletion by phiC31 in planta demonstrates that the recombinase can be used to remove selectable markers or other introduced transgenes that are no longer desired and therefore can be a useful tool for genome engineering in plants. PMID:20178628
NASA Astrophysics Data System (ADS)
Leceta Gobitz, Fernando; Mächtle, Bertil; Schukraft, Gerd; Meyer, Hans-Peter; Eitel, Bernhard
2016-04-01
An integrated research project of environmental sciences focuses on a group of four Andosol profiles in Western flank of the Peruvian southern Andes. Aim of this study is to contribute to the reconstruction of the paleo environmental conditions in the Western Cordillera of the Peruvian Andes. Standard pedological and sedimentological analysis has been conducted in order to identify morphological and geochemical features generated by climatic variations during the middle and late Holocene. Though a provenance analysis of sediments, all potential lithological sources around the town of Laramate are being examined under the scanning electron microscope, in order to find significant mineralogical associations downward the soil-profile. Preliminary results reveal two edaphic cycles within a soil-paleo soil-sequence: a relative poor developed "Ah" topsoil, mostly composed by fine grain sediments, is underlain by a well preserved "2Ah" paleo soil; a "2Bwt" subsoil exhibits signs of alteration and clay translocation; parent material in slight weathered statement at "2C" culminates the sequence. Mineralogical analytical data supports the premise, that materials in the uppermost horizons are relatable to distal geological units of the Western and Eastern Cordillera, therefore also related to other described aeolian archives from the region: "Desert Margin Loess" at the Andean foot-zone and "Mixed Loess" in the Puna grassland. The amphibole varieties Actinolite, Mg-Hornblende and Edenite could be only distinguished within the soil sediments. The fluvial transport to its current position is excluded, insofar mentioned varieties stem from the granodiorites of Coastal Batholite (downstream the study area), and the vulcanites of the Anta und Andahuaylas Formation (eastward the continental divide). References: Eitel, B., et al. (2005). "Geoarchaeological evidence from desert loess in the Nazca-Palpa region, southern Peru : Palaeoenvironmental changes and their impact on Pre-Columbian cultures." Archaeometry 47: 137-185. Miller, D. C. and P. W. Birkeland (1992). "Soil catena variation along an alpine climatic transect, northern Peruvian Andes." Geoderma 55(3): 211-223. Schittek, K., et al. (2014). "Holocene environmental changes in the highlands of the southern Peruvian Andes (14° S) and their impact on pre-Columbian cultures." Climate of the past discussions 10: 1707-1746.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Joint Estimation of Contamination, Error and Demography for Nuclear DNA from Ancient Humans
Slatkin, Montgomery
2016-01-01
When sequencing an ancient DNA sample from a hominin fossil, DNA from present-day humans involved in excavation and extraction will be sequenced along with the endogenous material. This type of contamination is problematic for downstream analyses as it will introduce a bias towards the population of the contaminating individual(s). Quantifying the extent of contamination is a crucial step as it allows researchers to account for possible biases that may arise in downstream genetic analyses. Here, we present an MCMC algorithm to co-estimate the contamination rate, sequencing error rate and demographic parameters—including drift times and admixture rates—for an ancient nuclear genome obtained from human remains, when the putative contaminating DNA comes from present-day humans. We assume we have a large panel representing the putative contaminant population (e.g. European, East Asian or African). The method is implemented in a C++ program called ‘Demographic Inference with Contamination and Error’ (DICE). We applied it to simulations and genome data from ancient Neanderthals and modern humans. With reasonable levels of genome sequence coverage (>3X), we find we can recover accurate estimates of all these parameters, even when the contamination rate is as high as 50%. PMID:27049965
A Spiking Neural Network System for Robust Sequence Recognition.
Yu, Qiang; Yan, Rui; Tang, Huajin; Tan, Kay Chen; Li, Haizhou
2016-03-01
This paper proposes a biologically plausible network architecture with spiking neurons for sequence recognition. This architecture is a unified and consistent system with functional parts of sensory encoding, learning, and decoding. This is the first systematic model attempting to reveal the neural mechanisms considering both the upstream and the downstream neurons together. The whole system is a consistent temporal framework, where the precise timing of spikes is employed for information processing and cognitive computing. Experimental results show that the system is competent to perform the sequence recognition, being robust to noisy sensory inputs and invariant to changes in the intervals between input stimuli within a certain range. The classification ability of the temporal learning rule used in the system is investigated through two benchmark tasks that outperform the other two widely used learning rules for classification. The results also demonstrate the computational power of spiking neurons over perceptrons for processing spatiotemporal patterns. In summary, the system provides a general way with spiking neurons to encode external stimuli into spatiotemporal spikes, to learn the encoded spike patterns with temporal learning rules, and to decode the sequence order with downstream neurons. The system structure would be beneficial for developments in both hardware and software.
Spatial organization of the gastrointestinal microbiota in urban Canada geese
Drovetski, Sergei V.; O'Mahoney, Michael; Ransome, Emma J.; Matterson, Kenan O.; Lim, Haw Chuan; Chesser, Terry; Graves, Gary R.
2018-01-01
Recent reviews identified the reliance on fecal or cloacal samples as a significant limitation hindering our understanding of the avian gastrointestinal (gut) microbiota and its function. We investigated the microbiota of the esophagus, duodenum, cecum, and colon of a wild urban population of Canada goose (Branta canadensis). From a population sample of 30 individuals, we sequenced the V4 region of the 16S SSU rRNA on an Illumina MiSeq and obtained 8,628,751 sequences with a median of 76,529 per sample. These sequences were assigned to 420 bacterial OTUs and a single archaeon. Firmicutes, Proteobacteria, and Bacteroidetes accounted for 90% of all sequences. Microbiotas from the four gut regions differed significantly in their richness, composition, and variability among individuals. Microbial communities of the esophagus were the most distinctive whereas those of the colon were the least distinctive, reflecting the physical downstream mixing of regional microbiotas. The downstream mixing of regional microbiotas was also responsible for the majority of observed co-occurrence patterns among microbial families. Our results indicate that fecal and cloacal samples inadequately represent the complex patterns of richness, composition, and variability of the gut microbiota and obscure patterns of co-occurrence of microbial lineages.
Tanaka, Masashi; Singh Alvarado, Jonnathan; Murugan, Malavika; Mooney, Richard
2016-01-01
The basal ganglia (BG) promote complex sequential movements by helping to select elementary motor gestures appropriate to a given behavioral context. Indeed, Huntington’s disease (HD), which causes striatal atrophy in the BG, is characterized by hyperkinesia and chorea. How striatal cell loss alters activity in the BG and downstream motor cortical regions to cause these disorganized movements remains unknown. Here, we show that expressing the genetic mutation that causes HD in a song-related region of the songbird BG destabilizes syllable sequences and increases overall vocal activity, but leave the structure of individual syllables intact. These behavioral changes are paralleled by the selective loss of striatal neurons and reduction of inhibitory synapses on pallidal neurons that serve as the BG output. Chronic recordings in singing birds revealed disrupted temporal patterns of activity in pallidal neurons and downstream cortical neurons. Moreover, reversible inactivation of the cortical neurons rescued the disorganized vocal sequences in transfected birds. These findings shed light on a key role of temporal patterns of cortico-BG activity in the regulation of complex motor sequences and show how a genetic mutation alters cortico-BG networks to cause disorganized movements. PMID:26951661
Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603
PCR Amplification Strategies towards full-length HIV-1 Genome sequencing.
Liu, Chao Chun; Ji, Hezhao
2018-06-26
The advent of next generation sequencing has enabled greater resolution of viral diversity and improved feasibility of full viral genome sequencing allowing routine HIV-1 full genome sequencing in both research and diagnostic settings. Regardless of the sequencing platform selected, successful PCR amplification of the HIV-1 genome is essential for sequencing template preparation. As such, full HIV-1 genome amplification is a crucial step in dictating the successful and reliable sequencing downstream. Here we reviewed existing PCR protocols leading to HIV-1 full genome sequencing. In addition to the discussion on basic considerations on relevant PCR design, the advantages as well as the pitfalls of published protocols were reviewed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
do Carmo Ferreira, Natália; Schuenck, Ricardo P; dos Santos, Kátia Regina Netto; de Freire Bastos, Maria do Carmo; Giambiagi-deMarval, Marcia
2011-03-01
The coagulase-negative staphylococci are known for their ability to acquire resistance genes, which limits the choice of therapeutic options for the treatment of infections caused by these microorganisms. In this study, the diversity of high-level mupirocin resistance plasmids (Mup(R) ) was investigated in four strains of Staphylococcus haemolyticus belonging to different pulsed-field gel electrophoresis (PFGE) types or subtypes, isolated in a Brazilian hospital. These strains harbor the mupA gene in large plasmids. In addition, the presence of IS257 sequences flanking the mupA gene was also shown. Two isolates belonging to two different PFGE types exhibited a similar polymorphism for a fragment of the mupA gene and the closest proximal flanking copies of the IS257, suggesting horizontal transmission of S. haemolyticus mupirocin resistance plasmids in the environment and a role of this species as a reservoir of the mupA gene. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.
Wang, Limei; Beer, Steven V
2006-12-01
To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.
Capturing the fingerprint of Etna volcano activity in gravity and satellite radar data
Negro, Ciro Del; Currenti, Gilda; Solaro, Giuseppe; Greco, Filippo; Pepe, Antonio; Napoli, Rosalba; Pepe, Susi; Casu, Francesco; Sansosti, Eugenio
2013-01-01
Long-term and high temporal resolution gravity and deformation data move us toward a better understanding of the behavior of Mt Etna during the June 1995 – December 2011 period in which the volcano exhibited magma charging phases, flank eruptions and summit crater activity. Monthly repeated gravity measurements were coupled with deformation time series using the Differential Synthetic Aperture Radar Interferometry (DInSAR) technique on two sequences of interferograms from ERS/ENVISAT and COSMO-SkyMed satellites. Combining spatiotemporal gravity and DInSAR observations provides the signature of three underlying processes at Etna: (i) magma accumulation in intermediate storage zones, (ii) magmatic intrusions at shallow depth in the South Rift area, and (iii) the seaward sliding of the volcano's eastern flank. Here we demonstrate the strength of the complementary gravity and DInSAR analysis in discerning among different processes and, thus, in detecting deep magma uprising in months to years before the onset of a new Etna eruption. PMID:24169569
Circular RNA biogenesis can proceed through an exon-containing lariat precursor
Barrett, Steven P; Wang, Peter L; Salzman, Julia
2015-01-01
Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical ‘backsplicing’ event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in Schizosaccharomyces pombe is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure. DOI: http://dx.doi.org/10.7554/eLife.07540.001 PMID:26057830
Taylor, Steve M.; Antonia, Alejandro L.; Parobek, Christian M.; Juliano, Jonathan J.; Janko, Mark; Emch, Michael; Alam, Md Tauqeer; Udhayakumar, Venkatachalam; Tshefu, Antoinette K.; Meshnick, Steven R.
2013-01-01
Understanding the spatial clustering of Plasmodium falciparum populations can assist efforts to contain drug-resistant parasites and maintain the efficacy of future drugs. We sequenced single nucleotide polymorphisms (SNPs) in the dihydropteroate synthase gene (dhps) associated with sulfadoxine resistance and 5 microsatellite loci flanking dhps in order to investigate the genetic backgrounds, genetic relatedness, and geographic clustering of falciparum parasites in the Democratic Republic of the Congo (DRC). Resistant haplotypes were clustered into subpopulations: one in the northeast DRC, and the other in the balance of the DRC. Network and clonal lineage analyses of the flanking microsatellites indicate that geographically-distinct mutant dhps haplotypes derive from separate lineages. The DRC is therefore a watershed for haplotypes associated with sulfadoxine resistance. Given the importance of central Africa as a corridor for the spread of antimalarial resistance, the identification of the mechanisms of this transit can inform future policies to contain drug-resistant parasite strains. PMID:23372922
NASA Astrophysics Data System (ADS)
Gresh, Nohad; Perrée-fauvet, Martine
1999-03-01
On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.
Vaughn, J C; Mason, M T; Sper-Whitis, G L; Kuhlman, P; Palmer, J D
1995-11-01
We present phylogenetic evidence that a group I intron in an angiosperm mitochondrial gene arose recently by horizontal transfer from a fungal donor species. A 1,716-bp fragment of the mitochondrial coxI gene from the angiosperm Peperomia polybotrya was amplified via the polymerase chain reaction and sequenced. Comparison to other coxI genes revealed a 966-bp group I intron, which, based on homology with the related yeast coxI intron aI4, potentially encodes a 279-amino-acid site-specific DNA endonuclease. This intron, which is believed to function as a ribozyme during its own splicing, is not present in any of 19 coxI genes examined from other diverse vascular plant species. Phylogenetic analysis of intron origin was carried out using three different tree-generating algorithms, and on a variety of nucleotide and amino acid data sets from the intron and its flanking exon sequences. These analyses show that the Peperomia coxI gene intron and exon sequences are of fundamentally different evolutionary origin. The Peperomia intron is more closely related to several fungal mitochondrial introns, two of which are located at identical positions in coxI, than to identically located coxI introns from the land plant Marchantia and the green alga Prototheca. Conversely, the exon sequence of this gene is, as expected, most closely related to other angiosperm coxI genes. These results, together with evidence suggestive of co-conversion of exonic markers immediately flanking the intron insertion site, lead us to conclude that the Peperomia coxI intron probably arose by horizontal transfer from a fungal donor, using the double-strand-break repair pathway. The donor species may have been one of the symbiotic mycorrhizal fungi that live in close obligate association with most plants.
Rayko, E; Goursot, R; Cherif-Zahar, B; Melis, R; Bernardi, G
1988-03-31
The mitochondrial genomes of progenies from 26 crosses between 17 cytoplasmic, spontaneous, suppressive, ori+ petite mutants of Saccharomyces cerevisiae have been studied by electrophoresis of restriction fragments. Only parental genomes (or occasionally, genomes derived from them by secondary excisions) were found in the progenies of the almost 500 diploids investigated; no evidence for illegitimate, site-specific mitochondrial recombination was detected. One of the parental genomes was always found to be predominate over the other one, although to different extents in different crosses. This predominance appears to be due to a higher replication efficiency, which is correlated with a greater density of ori sequences on the mitochondrial genome (and with a shorter repeat unit size of the latter). Exceptions to the 'repeat-unit-size rule' were found, however, even when the parental mitochondrial genomes carried the same ori sequence. This indicates that noncoding, intergenic sequences outside ori sequences also play a role in modulating replication efficiency. Since in different petites such sequences differ in primary structure, size, and position relative to ori sequences, this modulation is likely to take place through an indirect effect on DNA and nucleoid structure.
Optimisation of DNA extraction from the crustacean Daphnia
Athanasio, Camila Gonçalves; Chipman, James K.; Viant, Mark R.
2016-01-01
Daphnia are key model organisms for mechanistic studies of phenotypic plasticity, adaptation and microevolution, which have led to an increasing demand for genomics resources. A key step in any genomics analysis, such as high-throughput sequencing, is the availability of sufficient and high quality DNA. Although commercial kits exist to extract genomic DNA from several species, preparation of high quality DNA from Daphnia spp. and other chitinous species can be challenging. Here, we optimise methods for tissue homogenisation, DNA extraction and quantification customised for different downstream analyses (e.g., LC-MS/MS, Hiseq, mate pair sequencing or Nanopore). We demonstrate that if Daphnia magna are homogenised as whole animals (including the carapace), absorbance-based DNA quantification methods significantly over-estimate the amount of DNA, resulting in using insufficient starting material for experiments, such as preparation of sequencing libraries. This is attributed to the high refractive index of chitin in Daphnia’s carapace at 260 nm. Therefore, unless the carapace is removed by overnight proteinase digestion, the extracted DNA should be quantified with fluorescence-based methods. However, overnight proteinase digestion will result in partial fragmentation of DNA therefore the prepared DNA is not suitable for downstream methods that require high molecular weight DNA, such as PacBio, mate pair sequencing and Nanopore. In conclusion, we found that the MasterPure DNA purification kit, coupled with grinding of frozen tissue, is the best method for extraction of high molecular weight DNA as long as the extracted DNA is quantified with fluorescence-based methods. This method generated high yield and high molecular weight DNA (3.10 ± 0.63 ng/µg dry mass, fragments >60 kb), free of organic contaminants (phenol, chloroform) and is suitable for large number of downstream analyses. PMID:27190714
Comparative transgenic analysis of enhancers from the human SHOX and mouse Shox2 genomic regions.
Rosin, Jessica M; Abassah-Oppong, Samuel; Cobb, John
2013-08-01
Disruption of presumptive enhancers downstream of the human SHOX gene (hSHOX) is a frequent cause of the zeugopodal limb defects characteristic of Léri-Weill dyschondrosteosis (LWD). The closely related mouse Shox2 gene (mShox2) is also required for limb development, but in the more proximal stylopodium. In this study, we used transgenic mice in a comparative approach to characterize enhancer sequences in the hSHOX and mShox2 genomic regions. Among conserved noncoding elements (CNEs) that function as enhancers in vertebrate genomes, those that are maintained near paralogous genes are of particular interest given their ancient origins. Therefore, we first analyzed the regulatory potential of a genomic region containing one such duplicated CNE (dCNE) downstream of mShox2 and hSHOX. We identified a strong limb enhancer directly adjacent to the mShox2 dCNE that recapitulates the expression pattern of the endogenous gene. Interestingly, this enhancer requires sequences only conserved in the mammalian lineage in order to drive strong limb expression, whereas the more deeply conserved sequences of the dCNE function as a neural enhancer. Similarly, we found that a conserved element downstream of hSHOX (CNE9) also functions as a neural enhancer in transgenic mice. However, when the CNE9 transgenic construct was enlarged to include adjacent, non-conserved sequences frequently deleted in LWD patients, the transgene drove expression in the zeugopodium of the limbs. Therefore, both hSHOX and mShox2 limb enhancers are coupled to distinct neural enhancers. This is the first report demonstrating the activity of cis-regulatory elements from the hSHOX and mShox2 genomic regions in mammalian embryos.
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Dharmadhikari, Avinash V.; Kang, Sung-Hae L.; Szafranski, Przemyslaw; Person, Richard E.; Sampath, Srirangan; Prakash, Siddharth K.; Bader, Patricia I.; Phillips, John A.; Hannig, Vickie; Williams, Misti; Vinson, Sherry S.; Wilfong, Angus A.; Reimschisel, Tyler E.; Craigen, William J.; Patel, Ankita; Bi, Weimin; Lupski, James R.; Belmont, John; Cheung, Sau Wai; Stankiewicz, Pawel
2012-01-01
We have identified a rare small (∼450 kb unique sequence) recurrent deletion in a previously linked attention-deficit hyperactivity disorder (ADHD) locus at 2q21.1 in five unrelated families with developmental delay (DD)/intellectual disability (ID), ADHD, epilepsy and other neurobehavioral abnormalities from 17 035 samples referred for clinical chromosomal microarray analysis. Additionally, a DECIPHER (http://decipher.sanger.ac.uk) patient 2311 was found to have the same deletion and presented with aggressive behavior. The deletion was not found in either six control groups consisting of 13 999 healthy individuals or in the DGV database. We have also identified reciprocal duplications in five unrelated families with autism, developmental delay (DD), seizures and ADHD. This genomic region is flanked by large, complex low-copy repeats (LCRs) with directly oriented subunits of ∼109 kb in size that have 97.7% DNA sequence identity. We sequenced the deletion breakpoints within the directly oriented paralogous subunits of the flanking LCR clusters, demonstrating non-allelic homologous recombination as a mechanism of formation. The rearranged segment harbors five genes: GPR148, FAM123C, ARHGEF4, FAM168B and PLEKHB2. Expression of ARHGEF4 (Rho guanine nucleotide exchange factor 4) is restricted to the brain and may regulate the actin cytoskeletal network, cell morphology and migration, and neuronal function. GPR148 encodes a G-protein-coupled receptor protein expressed in the brain and testes. We suggest that small rare recurrent deletion of 2q21.1 is pathogenic for DD/ID, ADHD, epilepsy and other neurobehavioral abnormalities and, because of its small size, low frequency and more severe phenotype might have been missed in other previous genome-wide screening studies using single-nucleotide polymorphism analyses. PMID:22543972
Yang, Christine; McLeod, Andrea J.; Cotton, Allison M.; de Leeuw, Charles N.; Laprise, Stéphanie; Banks, Kathleen G.; Simpson, Elizabeth M.; Brown, Carolyn J.
2012-01-01
Regulatory sequences can influence the expression of flanking genes over long distances, and X chromosome inactivation is a classic example of cis-acting epigenetic gene regulation. Knock-ins directed to the Mus musculus Hprt locus offer a unique opportunity to analyze the spread of silencing into different human DNA sequences in the identical genomic environment. X chromosome inactivation of four knock-in constructs, including bacterial artificial chromosome (BAC) integrations of over 195 kb, was demonstrated by both the lack of expression from the inactive X chromosome in females with nonrandom X chromosome inactivation and promoter DNA methylation of the human transgene in females. We further utilized promoter DNA methylation to assess the inactivation status of 74 human reporter constructs comprising >1.5 Mb of DNA. Of the 47 genes examined, only the PHB gene showed female DNA hypomethylation approaching the level seen in males, and escape from X chromosome inactivation was verified by demonstration of expression from the inactive X chromosome. Integration of PHB resulted in lower DNA methylation of the flanking HPRT promoter in females, suggesting the action of a dominant cis-acting escape element. Female-specific DNA hypermethylation of CpG islands not associated with promoters implies a widespread imposition of DNA methylation during X chromosome inactivation; yet transgenes demonstrated differential capacities to accumulate DNA methylation when integrated into the identical location on the inactive X chromosome, suggesting additional cis-acting sequence effects. As only one of the human transgenes analyzed escaped X chromosome inactivation, we conclude that elements permitting ongoing expression from the inactive X are rare in the human genome. PMID:23023002
Identification of genes from the Treacher Collins candidate region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dixon, M.; Dixon, J.; Edwards, S.
Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less
Identification of an inducible regulator of c-myb expression during T-cell activation.
Phan, S C; Feeley, B; Withers, D; Boxer, L M
1996-01-01
Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306
Sedimentary record of erg migration
NASA Astrophysics Data System (ADS)
Porter, M. L.
1986-06-01
The sedimentary record of erg (eolian sand sea) migration consists of an idealized threefold division of sand-sea facies sequences. The basal division, here termed the fore-erg, is composed of a hierarchy of eolian sand bodies contained within sediments of the flanking depositional environment. These sand bodies consist of eolian strata deposited by small dune complexes, zibars, and sand sheets. The fore-erg represents the downwind, leading edge of the erg and records the onset of eolian sedimentation. Basin subsidence coupled with erg migration places the medial division, termed the central erg, over the fore-erg strata. The central erg, represented by a thick accumulation of large-scale, cross-stratified sandstone, is the product of large draa complexes. Eolian influence on regional sedimentation patterns is greatest in the central erg, and most of the sand transported and deposited in the erg is contained within this region. Reduction in sand supply and continued erg migration will cover the central-erg deposits with a veneer of back-erg deposits. This upper division of the erg facies sequence resembles closely the fore-erg region. Similar types of eolian strata are present and organized in sand bodies encased in sediments of the upwind flanking depositional environment(s). Back-erg deposits may be thin due to limited eolian influence on sedimentation or incomplete erg migration, or they may be completely absent because of great susceptibility to postdepositional erosion. Tectonic, climatic, and eustatic influences on sand-sea deposition will produce distinctive variations or modifications of the idealized erg facies sequence. The resulting variants in the sedimentary record of erg migration are illustrated with ancient examples from western North America, Europe, southern Africa, and South America.
Genetics, structure, and prevalence of FP967 (CDC Triffid) T-DNA in flax.
Young, Lester; Hammerlindl, Joseph; Babic, Vivijan; McLeod, Jamille; Sharpe, Andrew; Matsalla, Chad; Bekkaoui, Faouzi; Marquess, Leigh; Booker, Helen M
2015-01-01
The detection of T-DNA from a genetically modified flaxseed line (FP967, formally CDC Triffid) in a shipment of Canadian flaxseed exported to Europe resulted in a large decrease in the amount of flax planted in Canada. The Canadian flaxseed industry undertook major changes to ensure the removal of FP967 from the supply chain. This study aimed to resolve the genetics and structure of the FP967 transfer DNA (T-DNA). The FP967 T-DNA is thought to be inserted in at single genomic locus. The junction between the T-DNA and genomic DNA consisted of two inverted Right Borders with no Left Border (LB) flanking genomic DNA sequences recovered. This information was used to develop an event-specific quantitative PCR (qPCR) assay. This assay and an existing assay specific to the T-DNA construct were used to determine the genetics and prevalence of the FP967 T-DNA. These data supported the hypothesis that the T-DNA is present at a single location in the genome. The FP967 T-DNA is present at a low level (between 0.01 and 0.1%) in breeder seed lots from 2009 and 2010. None of the 11,000 and 16,000 lines selected for advancement through the Flax Breeding Program in 2010 and 2011, respectively, tested positive for the FP967 T-DNA, however. Most of the FP967 T-DNA sequence was resolved via PCR cloning and next generation sequencing. A 3,720 bp duplication of an internal portion of the T-DNA (including a Right Border) was discovered between the flanking genomic DNA and the LB. An event-specific assay, SAT2-LB, was developed for the junction between this repeat and the LB.
Yukawa, Yasushi; Akama, Kazuhito; Noguchi, Kanta; Komiya, Masaaki; Sugiura, Masahiro
2013-01-10
Nuclear tRNA genes are transcribed by RNA polymerase III. The A- and B-boxes located within the transcribed regions are essential promoter elements for nuclear tRNA gene transcription. The Arabidopsis genome contains ten annotated genes encoding identical tRNA(Lys)(UUU) molecules, which are scattered on the five chromosomes. In this study, we prepared ten tDNA constructs including each of the tRNA(Lys)(UUU) coding sequences with their individual 5' and 3' flanking sequences, and assayed tRNA expression using an in vitro RNA polymerase III-dependent transcription system. Transcription levels differed significantly among the ten genes and two of the tRNA genes were transcribed at a very low level, despite possessing A- and B-boxes identical to those of the other tRNA genes. To examine whether the in vitro results were reproducible in vivo, the 5' flanking sequence of an amber suppressor tRNA gene was then replaced with those of the ten tRNA(Lys) genes. An in vivo experiment based on an amber suppressor tRNA that mediates suppression of a premature amber codon in a β-glucuronidase (GUS) reporter gene in plant tissues generated nearly identical results to those obtained in vitro. Analysis of mutated versions of the amber suppressor tRNA gene, which contained base substitutions around the transcription start site (TSS), showed that the context around the transcription start sites is a crucial determinant for transcription of plant tRNA(Lys)(UUU) both in vitro and in vivo. The above transcription regulation by context around TSS differed between tRNA genes and other Pol III-dependent genes. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Leary, K. C. P.; Schmeeckle, M. W.
2017-12-01
Flow separation/reattachment on the lee side of alluvial bed forms is known to produce a complex turbulence field, but the spatiotemporal details of the associated patterns of bed load sediment transported remain largely unknown. Here we report turbulence-resolving, simultaneous measurements of bed load motion and near-bed fluid velocity downstream of a backward facing step in a laboratory flume. Two synchronized high-speed video cameras simultaneously observed bed load motion and the motion of neutrally buoyant particles in a laser light sheet 6 mm above the bed at 250 frames/s downstream of a 3.8 cm backward facing step. Particle Imaging Velocimetry (PIV) and Acoustic Doppler Velocimetry (ADV) were used to characterize fluid turbulent patterns, while manual particle tracking techniques were used to characterize bed load transport. Octant analysis, conducted using ADV data, coupled with Markovian sequence probability analysis highlights differences in the flow near reattachment versus farther downstream. Near reattachment, three distinct flow patterns are apparent. Farther downstream we see the development of a dominant flow sequence. Localized, intermittent, high-magnitude transport events are more apparent near flow reattachment. These events are composed of streamwise and cross-stream fluxes of comparable magnitudes. Transport pattern and fluid velocity data are consistent with the existence of permeable "splat events," wherein a volume of fluid moves toward and impinges on the bed (sweep) causing a radial movement of fluid in all directions around the point of impingement (outward interaction). This is congruent with flow patterns, identified with octant analysis, proximal to flow reattachment.
Waterholes and their significance in the anastomosing channel system of Cooper Creek, Australia
NASA Astrophysics Data System (ADS)
Knighton, A. David; Nanson, Gerald C.
1994-06-01
Cooper Creek has developed a very extensive system of anastomosing channels, a distinctive feature of which is the preponderance of waterholes, which are readily identified as deepened and widened reaches of channel with more or less permanent water. They are widely distributed over the floodplain but tend to decrease in number downstream, possibly as a result of transmission losses which reduce erosive potential, and to develop preferentially towards the west, which has implications for the long-term relocation of the system. Classification of waterholes according to degree of lateral restriction and flow status reveals only muted contrasts in waterhole form between the various types. The one clear distinction is the unexpectedly low width/length ratio of the most restricted (dune-flanked) type, its squat form being attributable to erodible banks and limited downstream confinement. That waterholes have developed in abundance along Cooper Creek appears to be related to the presence of a more easily eroded sand sheet at depths of only 2-9 m below cohesive surface sediments. Sediment splays at their downstream ends indicate that waterholes can be maintained by the present regime but whether they were formed by that or a prior regime is a matter of debate. Some degree of inheritance cannot be discounted but a contemporary origin is favoured in view of the fact that most waterholes are located at points of flow convergence. By focusing erosional energy when the floodplain is extremely broad, waterholes play a significant role not only in maintaining existing channel lines but also in promoting the development of new ones, as the invasion of a dune field testifies.
NASA Astrophysics Data System (ADS)
Tuzlak, D.; Pederson, J. L.
2015-12-01
Understanding patterns of deformation and testing geophysical models in the dynamic region of the Yellowstone Hotspot requires Quaternary-scale records of incision and uplift, which are currently absent. This study examines fluvial terraces and longitudinal-profile metrics along Alpine Canyon of the Snake River, WY. Because the Snake is the only regional river crossing from the uplifting Yellowstone Plateau and flowing into the subsiding Eastern Snake River Plain, it provides an opportunity to investigate both ends of the phenomenon. Field observations through Alpine Canyon indicate that Pleistocene incision rates in this region are relatively high for the interior western U.S., that the river switches between bedrock and alluvial forms, and that incision/uplift is not uniform. Two endmembers of regional deformation may be tested: 1) the arch of high topography surrounding Yellowstone is uplifting and terraces converge downstream as incision rates decrease towards the Snake River Plain, or 2) baselevel fall originates at the subsiding Snake River Plain and terraces diverge as incision rates increase downstream. Datasets include surficial mapping, rock strength measurements, surveying of the longitudinal profile and terraces using RTK-GPS, optically stimulated luminescence dating of fluvial-terrace deposits, and investigation of drainages through ksn and χ analyses. Initial results indicate that there are four primary terrace deposits along the canyon, three of which are timed with glacial epochs. Considering the relative heights of terrace straths and preliminary ages, incision rates are indeed relatively high. There is a major knickzone covering the last 15 km of the canyon that is also reflected in tributary profiles and is consistent with a wave of incision propagating upstream, favoring the second endmember of active baselevel fall downstream.
Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.
Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris
2010-07-15
The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net
Bouma, Arnold H.; Feeley, Mary H.; Kindinger, Jack G.; Stelting, Charles E.; Hilde, Thomas W.C.
1981-01-01
A high-resolution seismic reflection survey was conducted in a small area of the upper Louisiana Continental Slope known as Green Canyon Area. This area includes tracts 427, 428, 471, 472, 515, and 516, that will be offered for sale in March 1982 as part of Lease Sale 67.The sea floor of this region is, slightly hummocky and is underlain by salt diapirs that are mantled by early Tertiary shale. Most of the shale is overlain by younger Tertiary and Quaternary deposits, although locally some of the shale protrudes the sea floor. Because of proximity to older Mississippi River sources, the sediments are thick. The sediment cover shows an abundance of geologic phenomena such as horsts, grabens, growth faults, normal faults, and consolidation faults, zones with distinct and indistinct parallel reflections, semi-transparent zones, distorted zones, and angular unconformities.The major feature of this region is a N-S linear zone of uplifted and intruded sedimentary deposits formed due to diapiric intrusion.Small scale graben development over the crest of the structure can be attributed to extension and collapse. Large scale undulations of reflections well off the flanks of the uplifted structure suggest sediment creep and slumping. Dipping of parallel reflections show block faulting and tilting.Air gun (5 and 40 cubic inch) records reveal at least five major sequences that show masked onlap and slumping in their lower parts grading into more distinct parallel reflections in their upper parts. Such sequences can be related to local uplift and sea level changes. Minisparker records of this area show similar sequences but on a smaller scale. The distinct parallel reflections often onlap the diapir flanks. The highly reflective parts of these sequences may represent turbidite-type deposition, possibly at times of lower sea level. The acoustically more transparent parts of each sequence may represent deposits containing primarily hemipelagic and pelagic sediment.A complex ridge system is present along the west side of the area and distinct parallel reflections onlap onto this structure primarily from the east. Much of this deposition may be ascribed to sedimentation within a submarine canyon whose position is controlled by this ridge.
Yoshino, T P; Wu, X J; Liu, H D
1998-09-01
Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.
Deucher, Anne; Chiang, Tsoyu; Schrijver, Iris
2010-01-01
Typing of STR (short tandem repeat) alleles is used in a variety of applications in clinical molecular pathology, including evaluations for maternal cell contamination. Using a commercially available STR typing assay for maternal cell contamination performed in conjunction with prenatal diagnostic testing, we were posed with apparent nonmaternity when the two fetal samples did not demonstrate the expected maternal allele at one locus. By designing primers external to the region amplified by the primers from the commercial assay and by performing direct sequencing of the resulting amplicon, we were able to determine that a guanine to adenine sequence variation led to primer mismatch and allele dropout. This explained the apparent null allele shared between the maternal and fetal samples. Therefore, although rare, allele dropout must be considered whenever unexplained homozygosity at an STR locus is observed. PMID:20203001
Biswas, Ambarish; Gagnon, Joshua N.; Brouns, Stan J.J.; Fineran, Peter C.; Brown, Chris M.
2013-01-01
The bacterial and archaeal CRISPR/Cas adaptive immune system targets specific protospacer nucleotide sequences in invading organisms. This requires base pairing between processed CRISPR RNA and the target protospacer. For type I and II CRISPR/Cas systems, protospacer adjacent motifs (PAM) are essential for target recognition, and for type III, mismatches in the flanking sequences are important in the antiviral response. In this study, we examine the properties of each class of CRISPR. We use this information to provide a tool (CRISPRTarget) that predicts the most likely targets of CRISPR RNAs (http://bioanalysis.otago.ac.nz/CRISPRTarget). This can be used to discover targets in newly sequenced genomic or metagenomic data. To test its utility, we discover features and targets of well-characterized Streptococcus thermophilus and Sulfolobus solfataricus type II and III CRISPR/Cas systems. Finally, in Pectobacterium species, we identify new CRISPR targets and propose a model of temperate phage exposure and subsequent inhibition by the type I CRISPR/Cas systems. PMID:23492433
Evolution of the chalcone synthase gene family in the genus Ipomoea.
Durbin, M L; Learn, G H; Huttley, G A; Clegg, M T
1995-01-01
The evolution of the chalcone synthase [CHS; malonyl-CoA:4-coumaroyl-CoA malonyltransferase (cyclizing), EC 2.3.1.74] multigene family in the genus Ipomoea is explored. Thirteen CHS genes from seven Ipomoea species (family Convolvulaceae) were sequenced--three from genomic clones and the remainder from PCR amplification with primers designed from the 5' flanking region and the end of the 3' coding region of Ipomoea purpurea Roth. Analysis of the data indicates a duplication of CHS that predates the divergence of the Ipomoea species in this study. The Ipomoea CHS genes are among the most rapidly evolving of the CHS genes sequenced to date. The CHS genes in this study are most closely related to the Petunia CHS-B gene, which is also rapidly evolving and highly divergent from the rest of the Petunia CHS sequences. PMID:7724563
Specificity determinants for the abscisic acid response element.
Sarkar, Aditya Kumar; Lahiri, Ansuman
2013-01-01
Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.
Zhang, J R; Norris, S J
1998-08-01
The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5' and 3' coding sequences of vlsE that flank the cassette region are not subject to sequence variation during these recombination events. The segments of the silent vls cassettes recombine in the vlsE cassette region through a unidirectional process such that the sequence and organization of the silent vls loci are not affected. As a result of recombination, the previously expressed segments are replaced by incoming segments and apparently degraded. These results provide evidence for a gene conversion mechanism in VlsE antigenic variation.
Internal control regions for transcription of eukaryotic tRNA genes.
Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D
1981-01-01
We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, Kelly P.
2013-10-03
This package assists in genome assembly. extendFromReads takes as input a set of Illumina (eg, MiSeq) DNA sequencing reads, a query seed sequence and a direction to extend the seed. The algorithm collects all seed-- ]matching reads (flipping reverse-- ]orientation hits), trims off the seed and additional sequence in the other direction, sorts the remaining sequences alphabetically, and prints them aligned without gaps from the point of seed trimming. This produces a visual display distinguishing the flanks of multi- ]copy seeds. A companion script hitMates.pl collects the mates of seed-- ]hi]ng reads, whose alignment reveals longer extensions from the seed.more » The collect/trim/sort strategy was made iterative and scaled up in the script denovo.pl, for de novo contig assembly. An index is pre-- ]built using indexReads.pl that for each unique 21-- ]mer found in all the reads, records its gfate h of extension (whether extendable, blocked by low coverage, or blocked by branching after a duplicated sequence) and other characteristics. Importantly, denovo.pl records all branchings that follow a branching contig endpoint, providing contig- ]extension information« less
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Li, Ming; Wang, Rui; Xiang, Hua
2014-01-01
The prokaryotic immune system CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated genes) adapts to foreign invaders by acquiring their short deoxyribonucleic acid (DNA) fragments as spacers, which guide subsequent interference to foreign nucleic acids based on sequence matching. The adaptation mechanism avoiding acquiring ‘self’ DNA fragments is poorly understood. In Haloarcula hispanica, we previously showed that CRISPR adaptation requires being primed by a pre-existing spacer partially matching the invader DNA. Here, we further demonstrate that flanking a fully-matched target sequence, a functional PAM (protospacer adjacent motif) is still required to prime adaptation. Interestingly, interference utilizes only four PAM sequences, whereas adaptation-priming tolerates as many as 23 PAM sequences. This relaxed PAM selectivity explains how adaptation-priming maximizes its tolerance of PAM mutations (that escape interference) while avoiding mis-targeting the spacer DNA within CRISPR locus. We propose that the primed adaptation, which hitches and cooperates with the interference pathway, distinguishes target from non-target by CRISPR ribonucleic acid guidance and PAM recognition. PMID:24803673
Stress-induced rearrangement of Fusarium retrotransposon sequences.
Anaya, N; Roncero, M I
1996-11-27
Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.
Geology of El Chichon volcano, Chiapas, Mexico
NASA Astrophysics Data System (ADS)
Duffield, Wendell A.; Tilling, Robert I.; Canul, Rene
1984-03-01
The (pre-1982) 850-m-high andesitic stratovolcano El Chichón, active during Pleistocene and Holocene time, is located in rugged, densely forested terrain in northcentral Chiapas, México. The nearest neighboring Holocene volcanoes are 275 km and 200 km to the southeast and northwest, respectively. El Chichón is built on Tertiary siltstone and sandstone, underlain by Cretaceous dolomitic limestone; a 4-km-deep bore hole near the east base of the volcano penetrated this limestone and continued 770 m into a sequence of Jurassic or Cretaceous evaporitic anhydrite and halite. The basement rocks are folded into generally northwest-trending anticlines and synclines. El Chichón is built over a small dome-like structure superposed on a syncline, and this structure may reflect cumulative deformation related to growth of a crustal magma reservoir beneath the volcano. The cone of El Chichón consists almost entirely of pyroclastic rocks. The pre-1982 cone is marked by a 1200-m-diameter (explosion?) crater on the southwest flank and a 1600-m-diameter crater apparently of similar origin at the summit, a lava dome partly fills each crater. The timing of cone and dome growth is poorly known. Field evidence indicates that the flank dome is older than the summit dome, and K-Ar ages from samples high on the cone suggest that the flank dome is older than about 276,000 years. At least three pyroclastic eruptions have occurred during the past 1250 radiocarbon years. Nearly all of the pyroclastic and dome rocks are moderately to highly porphyritic andesite, with plagioclase, hornblende and clinopyroxene the most common phenocrysts. Geologists who mapped El Chichón in 1980 and 1981 warned that the volcano posed a substantial hazard to the surrounding region. This warning was proven to be prophetic by violent eruptions that occurred in March and April of 1982. These eruptions blasted away nearly all of the summit dome, blanketed the surrounding region with tephra, and sent pyroclastic flows down radial drainages on the flanks of the cone; about 0.3 km 3 of material (density of all products normalized to 2.6 g cm -3) was erupted. More debris entered the stratosphere than from any other volcanic eruption within at least the past two decades. Halite and a calcium sulfate mineral (anhydrite?) recovered from the stratospheric cloud, and anhydrite as a common accessory mineral in 1982 juvenile erupted products may reflect contamination of El Chichón magma by the evaporite sequence revealed by drilling.
Geology of El Chichon volcano, Chiapas, Mexico
Duffield, W.A.; Tilling, R.I.; Canul, R.
1984-01-01
The (pre-1982) 850-m-high andesitic stratovolcano El Chicho??n, active during Pleistocene and Holocene time, is located in rugged, densely forested terrain in northcentral Chiapas, Me??xico. The nearest neighboring Holocene volcanoes are 275 km and 200 km to the southeast and northwest, respectively. El Chicho??n is built on Tertiary siltstone and sandstone, underlain by Cretaceous dolomitic limestone; a 4-km-deep bore hole near the east base of the volcano penetrated this limestone and continued 770 m into a sequence of Jurassic or Cretaceous evaporitic anhydrite and halite. The basement rocks are folded into generally northwest-trending anticlines and synclines. El Chicho??n is built over a small dome-like structure superposed on a syncline, and this structure may reflect cumulative deformation related to growth of a crustal magma reservoir beneath the volcano. The cone of El Chicho??n consists almost entirely of pyroclastic rocks. The pre-1982 cone is marked by a 1200-m-diameter (explosion?) crater on the southwest flank and a 1600-m-diameter crater apparently of similar origin at the summit, a lava dome partly fills each crater. The timing of cone and dome growth is poorly known. Field evidence indicates that the flank dome is older than the summit dome, and K-Ar ages from samples high on the cone suggest that the flank dome is older than about 276,000 years. At least three pyroclastic eruptions have occurred during the past 1250 radiocarbon years. Nearly all of the pyroclastic and dome rocks are moderately to highly porphyritic andesite, with plagioclase, hornblende and clinopyroxene the most common phenocrysts. Geologists who mapped El Chicho??n in 1980 and 1981 warned that the volcano posed a substantial hazard to the surrounding region. This warning was proven to be prophetic by violent eruptions that occurred in March and April of 1982. These eruptions blasted away nearly all of the summit dome, blanketed the surrounding region with tephra, and sent pyroclastic flows down radial drainages on the flanks of the cone; about 0.3 km3 of material (density of all products normalized to 2.6 g cm-3) was erupted. More debris entered the stratosphere than from any other volcanic eruption within at least the past two decades. Halite and a calcium sulfate mineral (anhydrite?) recovered from the stratospheric cloud, and anhydrite as a common accessory mineral in 1982 juvenile erupted products may reflect contamination of El Chicho??n magma by the evaporite sequence revealed by drilling. ?? 1984.
The A.D. 1835 eruption of Volcán Cosigüina, Nicaragua: A guide for assessing local volcanic hazards
Scott, William E.; Gardner, Cynthia A.; Devoli, Graziella; Alvarez, Antonio
2006-01-01
The January 1835 eruption of Volcán Cosigüina in northwestern Nicaragua was one of the largest and most explosive in Central America since Spanish colonization. We report on the results of reconnaissance stratigraphic studies and laboratory work aimed at better defining the distribution and character of deposits emplaced by the eruption as a means of developing a preliminary hazards assessment for future eruptions. On the lower flanks of the volcano, a basal tephra-fall deposit comprises either ash and fine lithic lapilli or, locally, dacitic pumice. An overlying tephra-fall deposit forms an extensive blanket of brown to gray andesitic scoria that is 35–60 cm thick at 5–10 km from the summit-caldera rim, except southwest of the volcano, where it is considerably thinner. The scoria fall produced the most voluminous deposit of the eruption and underlies pyroclastic-surge and -flow deposits that chiefly comprise gray andesitic scoria. In northern and southeastern sectors of the volcano, these flowage deposits form broad fans and valley fills that locally reach the Gulf of Fonseca. An arcuate ridge 2 km west of the caldera rim and a low ridge east of the caldera deflected pyroclastic flows northward and southeastward. Pyroclastic flows did not reach the lower west and southwest flanks, which instead received thick, fine-grained, accretionary-lapilli–rich ashfall deposits that probably derived chiefly from ash clouds elutriated from pyroclastic flows. We estimate the total bulk volume of erupted deposits to be ∼6 km3. Following the eruption, lahars inundated large portions of the lower flanks, and erosion of deposits and creation of new channels triggered rapid alluviation. Pre-1835 eruptions are poorly dated; however, scoria-fall, pyroclastic-flow, and lahar deposits record a penultimate eruption of smaller magnitude than that of 1835. It occurred a few centuries earlier—perhaps in the fifteenth century. An undated sequence of thick tephra-fall deposits on the west flank of the volcano records tens of eruptions, some of which were greater in magnitude than that of 1835. Weathering evidence suggests this sequence is at least several thousand years old. The wide extent of pyroclastic flows and thick tephra fall during 1835, the greater magnitude of some previous Holocene eruptions, and the location of Cosigüina on a peninsula limit the options to reduce risk during future unrest and eruption.
A Simple Base-Mediated Halogenation of Acidic sp2 C-H Bonds under Non-Cryogenic Conditions
Do, Hien-Quang; Daugulis, Olafs
2009-01-01
A new method has been developed for in situ halogenation of acidic sp2 carbon-hydrogen bonds in heterocycles and electron-deficient arenes. Either selective monohalogenation or one-step exhaustive polyhalogenation is possible for substrates possessing several C-H bonds that are flanked by electron-withdrawing groups. For the most acidic arenes, such as pentafluorobenzene, K3PO4 base can be employed instead of BuLi for metalation/halogenation sequences. PMID:19102661
Development of a Diagnostic Tool to Detect DNA Methylation Biomarkers for Early-Stage Lung Cancer
2015-02-01
include: 1) a DNA recognition domain that recognizes the specific DNA sequence of interest and 2) one half of the leucine zipper pair. The second...piece will include 1) the second half of the leucine zipper pair, 2) a flexible linker flanked by a FRET pair that determines the local (within 30 bp...each other to determine the resolution of our probes. All DNA fragments are methylated using bacterial methyltransferase. Since only a single CG
Reverse genetics: Its origins and prospects
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berg, P.
1991-04-01
The nucleotide sequence of a gene and its flanking segments alone will not tell us how its expression is regulated during development and differentiation, or in response to environmental changes. To comprehend the physiological significance of the molecular details requires biological analysis. Recombinant DNA techniques provide a powerful experimental approach. A strategy termed reverse genetics' utilizes the analysis of the activities of mutant and normal genes and experimentally constructed mutants to explore the relationship between gene structure and function thereby helping elucidate the relationship between genotype and phenotype.
Johnson, C.L.; Franseen, E.K.; Goldstein, R.H.
2005-01-01
This study utilized three-dimensional exposures to evaluate how sea-level position and palaeotopography control the facies and geometries of heterozoan carbonates. Heterozoan carbonates were deposited on top of a Neogene volcanic substrate characterized by palaeotopographic highs, palaeovalleys, and straits that were formed by subaerial erosion, possibly original volcanic topography, and faults prior to carbonate deposition. The depositional sequence that is the focus of this study (DS1B) consists of 7-10 fining upward cycles that developed in response to relative sea-level fluctuations. A complete cycle has a basal erosion surface overlain by deposits of debrisflows and high-density turbidity currents, which formed during relative sea-level fall. Overlying tractive deposits most likely formed during the lowest relative position of sea level. Overlying these are debrites grading upward to high-density turbidites and low-density turbidites that formed during relative sea-level rise. The tops of the cycles consist of hemipelagic deposits that formed during the highest relative position of sea level. The cycles fine upward because upslope carbonate production decreased as relative sea level rose due to less surface area available for shallow-water carbonate production and partial drowning of substrates. The cycles are dominated by two end-member types of facies associations and stratal geometries that formed in response to fluctuating sea-level position over variable substrate palaeotopography. One end-member is termed 'flank flow cycle' because this type of cycle indicates dominant sediment transport down the flanks of palaeovalleys. Those cycles drape the substrate, have more debrites, high-density turbidites and erosion on palaeovalley flanks, and in general, the lithofacies fine down the palaeovalley flanks into the palaeovalley axes. The second end-member is termed 'axial flow cycle' because it indicates a dominance of sediment transport down the axes of palaeovalleys. Those cycles are characterized by debrites and high-density turbidites in palaeovalley axes, and lap out of strata against the flanks of palaeovalleys. Where and when an axial flow cycle or flank flow cycle developed appears to be related to the intersection of sea level with areas of gentle or steep substrate slopes, during an overall relative rise in sea level. Results from this study provide a model for similar systems that must combine carbonate principles for sediment production, palaeotopographic controls, and physical principles of sediment remobilization into deep water. ?? 2005 International Association of Sedimentologists.
Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.
Lowe, A M; Deresiewicz, R L
1999-01-01
Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.
Efficient engineering of a bacteriophage genome using the type I-E CRISPR-Cas system.
Kiro, Ruth; Shitrit, Dror; Qimron, Udi
2014-01-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) system has recently been used to engineer genomes of various organisms, but surprisingly, not those of bacteriophages (phages). Here we present a method to genetically engineer the Escherichia coli phage T7 using the type I-E CRISPR-Cas system. T7 phage genome is edited by homologous recombination with a DNA sequence flanked by sequences homologous to the desired location. Non-edited genomes are targeted by the CRISPR-Cas system, thus enabling isolation of the desired recombinant phages. This method broadens CRISPR Cas-based editing to phages and uses a CRISPR-Cas type other than type II. The method may be adjusted to genetically engineer any bacteriophage genome.
Meyer, E; Butler, A; Dubrana, K; Duharcourt, S; Caron, F
1997-01-01
In ciliates, the germ line genome is extensively rearranged during the development of the somatic macronucleus from a mitotic product of the zygotic nucleus. Germ line chromosomes are fragmented in specific regions, and a large number of internal sequence elements are eliminated. It was previously shown that transformation of the vegetative macronucleus of Paramecium primaurelia with a plasmid containing a subtelomeric surface antigen gene can affect the processing of the homologous germ line genomic region during development of a new macronucleus in sexual progeny of transformed clones. The gene and telomere-proximal flanking sequences are deleted from the new macronuclear genome, although the germ line genome remains wild type. Here we show that plasmids containing nonoverlapping segments of the same genomic region are able to induce similar terminal deletions; the locations of deletion end points depend on the particular sequence used. Transformation of the maternal macronucleus with a sequence internal to a macronuclear chromosome also causes the occurrence of internal deletions between short direct repeats composed of alternating thymines and adenines. The epigenetic influence of maternal macronuclear sequences on developmental rearrangements of the zygotic genome thus appears to be both sequence specific and general, suggesting that this trans-nucleus effect is mediated by pairing of homologous sequences. PMID:9199294
Potent and Selective Peptide-based Inhibition of the G Protein Gαq*
Charpentier, Thomas H.; Waldo, Gary L.; Lowery-Gionta, Emily G.; Krajewski, Krzysztof; Strahl, Brian D.; Kash, Thomas L.; Harden, T. Kendall; Sondek, John
2016-01-01
In contrast to G protein-coupled receptors, for which chemical and peptidic inhibitors have been extensively explored, few compounds are available that directly modulate heterotrimeric G proteins. Active Gαq binds its two major classes of effectors, the phospholipase C (PLC)-β isozymes and Rho guanine nucleotide exchange factors (RhoGEFs) related to Trio, in a strikingly similar fashion: a continuous helix-turn-helix of the effectors engages Gαq within its canonical binding site consisting of a groove formed between switch II and helix α3. This information was exploited to synthesize peptides that bound active Gαq in vitro with affinities similar to full-length effectors and directly competed with effectors for engagement of Gαq. A representative peptide was specific for active Gαq because it did not bind inactive Gαq or other classes of active Gα subunits and did not inhibit the activation of PLC-β3 by Gβ1γ2. In contrast, the peptide robustly prevented activation of PLC-β3 or p63RhoGEF by Gαq; it also prevented G protein-coupled receptor-promoted neuronal depolarization downstream of Gαq in the mouse prefrontal cortex. Moreover, a genetically encoded form of this peptide flanked by fluorescent proteins inhibited Gαq-dependent activation of PLC-β3 at least as effectively as a dominant-negative form of full-length PLC-β3. These attributes suggest that related, cell-penetrating peptides should effectively inhibit active Gαq in cells and that these and genetically encoded sequences may find application as molecular probes, drug leads, and biosensors to monitor the spatiotemporal activation of Gαq in cells. PMID:27742837
Potent and Selective Peptide-based Inhibition of the G Protein Gαq.
Charpentier, Thomas H; Waldo, Gary L; Lowery-Gionta, Emily G; Krajewski, Krzysztof; Strahl, Brian D; Kash, Thomas L; Harden, T Kendall; Sondek, John
2016-12-02
In contrast to G protein-coupled receptors, for which chemical and peptidic inhibitors have been extensively explored, few compounds are available that directly modulate heterotrimeric G proteins. Active Gα q binds its two major classes of effectors, the phospholipase C (PLC)-β isozymes and Rho guanine nucleotide exchange factors (RhoGEFs) related to Trio, in a strikingly similar fashion: a continuous helix-turn-helix of the effectors engages Gα q within its canonical binding site consisting of a groove formed between switch II and helix α3. This information was exploited to synthesize peptides that bound active Gα q in vitro with affinities similar to full-length effectors and directly competed with effectors for engagement of Gα q A representative peptide was specific for active Gα q because it did not bind inactive Gα q or other classes of active Gα subunits and did not inhibit the activation of PLC-β3 by Gβ 1 γ 2 In contrast, the peptide robustly prevented activation of PLC-β3 or p63RhoGEF by Gα q ; it also prevented G protein-coupled receptor-promoted neuronal depolarization downstream of Gα q in the mouse prefrontal cortex. Moreover, a genetically encoded form of this peptide flanked by fluorescent proteins inhibited Gα q -dependent activation of PLC-β3 at least as effectively as a dominant-negative form of full-length PLC-β3. These attributes suggest that related, cell-penetrating peptides should effectively inhibit active Gα q in cells and that these and genetically encoded sequences may find application as molecular probes, drug leads, and biosensors to monitor the spatiotemporal activation of Gα q in cells. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Yamaguchi, Kazuaki; Chijiwa, Takahito; Ikeda, Naoki; Shibata, Hiroki; Fukumaki, Yasuyuki; Oda-Ueda, Naoko; Hattori, Shosaku; Ohno, Motonori
2014-01-01
The genes encoding group IIE phospholipase A2, abbreviated as IIE PLA2, and its 5' and 3' flanking regions of Crotalinae snakes such as Protobothrops flavoviridis, P. tokarensis, P. elegans, and Ovophis okinavensis, were found and sequenced. The genes consisted of four exons and three introns and coded for 22 or 24 amino acid residues of the signal peptides and 134 amino acid residues of the mature proteins. These IIE PLA2s show high similarity to those from mammals and Colubridae snakes. The high expression level of IIE PLA2s in Crotalinae venom glands suggests that they should work as venomous proteins. The blast analysis indicated that the gene encoding OTUD3, which is ovarian tumor domain-containing protein 3, is located in the 3' downstream of IIE PLA2 gene. Moreover, a group IIA PLA2 gene was found in the 5' upstream of IIE PLA2 gene linked to the OTUD3 gene (OTUD3) in the P. flavoviridis genome. It became evident that the specified arrangement of IIA PLA2 gene, IIE PLA2 gene, and OTUD3 in this order is common in the genomes of humans to snakes. The present finding that the genes encoding various secretory PLA2s form a cluster in the genomes of humans to birds is closely related to the previous finding that six venom PLA2 isozyme genes are densely clustered in the so-called NIS-1 fragment of the P. flavoviridis genome. It is also suggested that venom IIA PLA2 genes may be evolutionarily derived from the IIE PLA2 gene. PMID:25529307
Koch, K S; Gleiberman, A S; Aoki, T; Leffert, H L; Feren, A; Jones, A L; Fodor, E J
1995-01-01
An unusual S1-nuclease sensitive microsatellite (STMS) has been found in the single copy, rat polymeric immunoglobulin receptor gene (PIGR) terminal exon. In Fisher rats, elements within or beyond the STMS are expressed variably in the 3' untranslated regions (3'UTRs) of two 'Groups' of PIGR-encoded hepatic mRNAs (pIg-R) during liver regeneration. STMS elements include neighboring constant regions (a 60-bp d[GA]-rich tract with a chi-like octamer, followed by 15 tandem d[GGA] repeats) that merge directly with 36 or 39 tandem d[GAA] repeats (Fisher or Wistar strains, respectively) interrupted by d[AA] between their 5th-6th repeat units. The Wistar STMS is flanked upstream by two regions of nearly contiguous d[CA] or d[CT] repeats in the 3' end of intron 8; and downstream, by a 283 bp 'unit' containing several inversions at its 5' end, and two polyadenylation signals at its 3' end. The 283 nt unit is expressed in Group 1 pIg-R mRNAs; but it is absent in the Group 2 family so that their GAA repeats merge with their poly A tails. In contrast to genomic sequence, GGA triplet repeats are amplified (n > or = 24-26), whereas GAA triplet repeats are truncated variably (n < or = 9-37) and expressed uninterruptedly in both mRNA Groups. These results suggest that 3' end processing of the rat PIGR gene may involve misalignment, slippage and premature termination of RNA polymerase II. The function of this unusual processing and possible roles of chi-like octamers in quiescent or extrahepatic tissues are discussed. Images PMID:7739889
Smet-Nocca, Caroline; Page, Adeline; Cantrelle, François-Xavier; Nikolakaki, Eleni; Landrieu, Isabelle; Giannakouros, Thomas
2018-04-01
Lamin B Receptor (LBR) is an integral protein of the interphase inner nuclear membrane that is implicated in chromatin anchorage to the nuclear envelope. Phosphorylation of a stretch of arginine-serine (RS) dipeptides in the amino-terminal nucleoplasmic domain of LBR regulates the interactions of the receptor with other nuclear proteins, DNA and RNA and thus modulates tethering of heterochromatin to the nuclear envelope. While phosphorylation has been extensively studied, very little is known about other post-translational modifications of the protein. There is only one report on the O-β-linked N-acetyl-glucosaminylation (O-GlcNAcylation) of a serine residue downstream of the RS domain of rat LBR. In the present study we identify additional O-GlcNAcylation sites by using as substrates of O-β-N-acetylglucosaminyltransferase (OGT) a set of peptides containing the entire LBR RS domain or parts of it as well as flanking sequences. The in vitro activity of OGT was assessed by tandem mass spectrometry and NMR spectroscopy. Furthermore, we provide evidence that O-GlcNAcylation hampers DNA binding while it marginally affects RS domain phosphorylation mediated by SRPK1, Akt2 and cdk1 kinases. Our methodology providing a quantitative description of O-GlcNAc patterns based on a combination of mass spectrometry and high resolution NMR spectroscopy on short peptide substrates allows subsequent functional analyses. Hence, our approach is of general interest to a wide audience of biologists aiming at deciphering the functional role of O-GlcNAc glycosylation and its crosstalk with phosphorylation. Copyright © 2018 Elsevier B.V. All rights reserved.
Wiltscheck, R.; Kammerer, R. A.; Dames, S. A.; Schulthess, T.; Blommers, M. J.; Engel, J.; Alexandrescu, A. T.
1997-01-01
The C-terminal oligomerization domain of chicken cartilage matrix protein is a trimeric coiled coil comprised of three identical 43-residue chains. NMR spectra of the protein show equivalent magnetic environments for each monomer, indicating a parallel coiled coil structure with complete threefold symmetry. Sequence-specific assignments for 1H-, 15N-, and 13C-NMR resonances have been obtained from 2D 1H NOESY and TOCSY spectra, and from 3D HNCA, 15N NOESY-HSQC, and HCCH-TOCSY spectra. A stretch of alpha-helix encompassing five heptad repeats (35 residues) has been identified from intra-chain HN-HN and HN-H alpha NOE connectivities. 3JHNH alpha coupling constants, and chemical shift indices. The alpha-helix begins immediately downstream of inter-chain disulfide bonds between residues Cys 5 and Cys 7, and extends to near the C-terminus of the molecule. The threefold symmetry of the molecule is maintained when the inter-chain disulfide bonds that flank the N-terminus of the coiled coil are reduced. Residues Ile 21 through Glu 36 show conserved chemical shifts and NOE connectivities, as well as strong protection from solvent exchange in the oxidized and reduced forms of the protein. By contrast, residues Ile 10 through Val 17 show pronounced chemical shift differences between the oxidized and reduced protein. Strong chemical exchange NOEs between HN resonances and water indicate solvent exchange on time scales faster than 10 s, and suggests a dynamic fraying of the N-terminus of the coiled coil upon reduction of the disulfide bonds. Possible roles for the disulfide crosslinks of the oligomerization domain in the function of cartilage matrix protein are proposed. PMID:9260286
Rosenthal, Sun Hee; Diamos, Andrew G; Mason, Hugh S
2018-03-01
We have found interesting features of a plant gene (extensin) 3' flanking region, including extremely efficient polyadenylation which greatly improves transient expression of transgenes when an intron is removed. Its use will greatly benefit studies of gene expression in plants, research in molecular biology, and applications for recombinant proteins. Plants are a promising platform for the production of recombinant proteins. To express high-value proteins in plants efficiently, the optimization of expression cassettes using appropriate regulatory sequences is critical. Here, we characterize the activity of the tobacco extensin (Ext) gene terminator by transient expression in Nicotiana benthamiana, tobacco, and lettuce. Ext is a member of the hydroxyproline-rich glycoprotein (HRGP) superfamily and constitutes the major protein component of cell walls. The present study demonstrates that the Ext terminator with its native intron removed increased transient gene expression up to 13.5-fold compared to previously established terminators. The enhanced transgene expression was correlated with increased mRNA accumulation and reduced levels of read-through transcripts, which could impair gene expression. Analysis of transcript 3'-ends found that the majority of polyadenylated transcripts were cleaved at a YA dinucleotide downstream from a canonical AAUAAA motif and a UG-rich region, both of which were found to be highly conserved among related extensin terminators. Deletion of either of these regions eliminated most of the activity of the terminator. Additionally, a 45 nt polypurine sequence ~ 175 nt upstream from the polyadenylation sites was found to also be necessary for the enhanced expression. We conclude that the use of Ext terminator has great potential to benefit the production of recombinant proteins in plants.
Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.
Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang
2013-02-01
Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.
Tronik, D; Dreyfus, M; Babinet, C; Rougeon, F
1987-01-01
The Ren-2 gene encoding the mouse submaxillary gland (SMG) renin was microinjected into the pronuclei of fertilized eggs from mice carrying only the Ren-1 gene. In addition to the whole transcription unit, the injected DNA contained 2.5 and 3 kb of upstream and downstream flanking sequences, respectively. Three independent transgenic mice lines were obtained; two of them had integrated one copy of the Ren-2 gene, the last one had integrated five and eleven copies at two independent sites. Independently of the number of Ren-2 copies integrated, the pattern of Ren-2 gene expression in all the transgenic mice was identical to that observed in wild-type animals in which Ren-1 and Ren-2 are closely linked on chromosome 1. In particular, the exogenous Ren-2 gene was only transcribed in the kidney and in the SMG. In the kidney, Ren-1 and Ren-2 mRNAs were present at a comparable level, whereas in the SMG Ren-2 mRNA was at least 100-fold more abundant than Ren-1 mRNA. Moreover, Ren-2 expression in the SMG was positively regulated by androgens. Only one difference between transgenic mice and wild-type mice carrying the Ren-2 gene has been observed: the basal level of Ren-2 transcription in the SMG of transgenic females was lower than in two-gene strain females. Androgen treatment of transgenic females induced SMG renin mRNA to a level identical to that of transgenic males. This suggests that the basal level of SMG renin mRNA is dependent upon cis-acting elements which are not present in the microinjected fragment. Images Fig. 1. Fig. 2. Fig. 3. PMID:3297677
NASA Technical Reports Server (NTRS)
Vitart, V.; Christodoulou, J.; Huang, J. F.; Chazin, W. J.; Harper, J. F.; Evans, M. L. (Principal Investigator)
2000-01-01
Ca(2+)-dependent protein kinases (CDPK) have a calmodulin-like domain (CaM-LD) tethered to the C-terminal end of the kinase. Activation is proposed to involve intramolecular binding of the CaM-LD to a junction sequence that connects the CaM-LD to the kinase domain. Consistent with this model, a truncated CDPK (DeltaNC) in which the CaM-LD has been deleted can be activated in a bimolecular interaction with an isolated CaM-LD or calmodulin, similar to the activation of a calmodulin-dependent protein kinase (CaMK) by calmodulin. Here we provide genetic evidence that this bimolecular activation requires a nine-residue binding segment from F436 to I444 (numbers correspond to CPK-1 accession number L14771). Two mutations at either end of this core segment (F436/A and VI444/AA) severely disrupted bimolecular activation, whereas flanking mutations had only minor effects. Intramolecular activation of a full-length kinase was also disrupted by a VI444/AA mutation, but surprisingly not by a F436/A mutation (at the N-terminal end of the binding site). Interestingly, intramolecular but not bimolecular activation was disrupted by insertion mutations placed immediately downstream of I444. To show that mutant enzymes were not misfolded, latent kinase activity was stimulated through binding of an antijunction antibody. Results here support a model of intramolecular activation in which the tether (A445 to G455) that connects the CaM-LD to the kinase provides an important structural constraint and is not just a simple flexible connection.
Shah, Neel H; Wang, Qi; Yan, Qingrong; Karandur, Deepti; Kadlecek, Theresa A; Fallahee, Ian R; Russ, William P; Ranganathan, Rama; Weiss, Arthur; Kuriyan, John
2016-01-01
The sequence of events that initiates T cell signaling is dictated by the specificities and order of activation of the tyrosine kinases that signal downstream of the T cell receptor. Using a platform that combines exhaustive point-mutagenesis of peptide substrates, bacterial surface-display, cell sorting, and deep sequencing, we have defined the specificities of the first two kinases in this pathway, Lck and ZAP-70, for the T cell receptor ζ chain and the scaffold proteins LAT and SLP-76. We find that ZAP-70 selects its substrates by utilizing an electrostatic mechanism that excludes substrates with positively-charged residues and favors LAT and SLP-76 phosphosites that are surrounded by negatively-charged residues. This mechanism prevents ZAP-70 from phosphorylating its own activation loop, thereby enforcing its strict dependence on Lck for activation. The sequence features in ZAP-70, LAT, and SLP-76 that underlie electrostatic selectivity likely contribute to the specific response of T cells to foreign antigens. DOI: http://dx.doi.org/10.7554/eLife.20105.001 PMID:27700984
Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz
2016-02-24
Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.
Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh
2017-11-01
Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu
2010-06-01
Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.
Cleary, John D; Tomé, Stéphanie; López Castel, Arturo; Panigrahi, Gagan B; Foiry, Laurent; Hagerman, Katharine A; Sroka, Hana; Chitayat, David; Gourdon, Geneviève; Pearson, Christopher E
2010-09-01
Myotonic dystrophy, caused by DM1 CTG/CAG repeat expansions, shows varying instability levels between tissues and across ages within patients. We determined DNA replication profiles at the DM1 locus in patient fibroblasts and tissues from DM1 transgenic mice of various ages showing different instability. In patient cells, the repeat is flanked by two replication origins demarcated by CTCF sites, with replication diminished at the expansion. In mice, the expansion replicated from only the downstream origin (CAG as lagging template). In testes from mice of three different ages, replication toward the repeat paused at the earliest age and was relieved at later ages-coinciding with increased instability. Brain, pancreas and thymus replication varied with CpG methylation at DM1 CTCF sites. CTCF sites between progressing forks and repeats reduced replication depending on chromatin. Thus, varying replication progression may affect tissue- and age-specific repeat instability.
Mozambique upper fan: origin of depositional units
DOE Office of Scientific and Technical Information (OSTI.GOV)
Droz, L.; Mougenot, D.
1987-11-01
The upper Mozambique Fan includes a stable down-stream region, with a north-south channel flanked by thick (1.5 sec two-way traveltime) asymmetric levees, and a migrating upstream region where at least two main feeding paths have been successively dominant. From the Oligocene to early Miocene, the north-south Serpa Pinto Valley acted as the main conduit for the north Mozambique terrigenous sediments. From the middle Miocene, the west-east Zambezi Valley became the dominant path and supplied the fan with sediments transported by the Zambezi River from the central part of Mozanbique. The transfer from one sediment-feeding system to the other is relatedmore » to the abandonment of the Serpa Pinto Valley because of graben formation along the Davie Ridge, which trapped the sediments, and the increase of the Zambezi River sediment supply because of the creation and erosion of the East African Rift. 13 figures.« less
Mongini, Patricia K. A.; Kramer, Jill M.; Ishikawa, Tomo-o; Herschman, Harvey; Esposito, Donna
2014-01-01
Sjogren’s syndrome (SS) is characterized by salivary gland leukocytic infiltrates and impaired salivation (xerostomia). Cox-2 (Ptgs2) is located on chromosome 1 within the span of the Aec2 region. In an attempt to demonstrate that COX-2 drives antibody-dependent hyposalivation, NOD.B10 congenic mice bearing a Cox-2flox gene were generated. A congenic line with non-NOD alleles in Cox-2-flanking genes failed manifest xerostomia. Further backcrossing yielded disease-susceptible NOD.B10 Cox-2flox lines; fine genetic mapping determined that critical Aec2 genes lie within a 1.56 to 2.17 Mb span of DNA downstream of Cox-2. Bioinformatics analysis revealed that susceptible and non-susceptible lines exhibit non-synonymous coding SNPs in 8 protein-encoding genes of this region, thereby better delineating candidate Aec2 alleles needed for SS xerostomia. PMID:24685748
A nonsingular model of the open magnetosphere
NASA Technical Reports Server (NTRS)
Toffoletto, F. R.; Hill, T. W.
1993-01-01
We present a modified version of the Toffoletto and Hill (1989) open magnetosphere model that incorporates a tail-like interconection field with a discontinuity 10 represent the slow-mode expansion fan that defines the high-latitude tail magnetopause. (The interconnection field is defined as the perturbation on an initially closed magnetosphere model to make it open.) The expansion fan controls the open field line region in the tail, and the intersection of the fan with the tail current sheet is, by design, the x line. The new interconnection field allows greater control of the tail field structure; in particular, it enables us to eliminate the nightside mapping singularity that occurs in previous models when the interplanetary magnetic field is nonsouthward. Also, in contrast to earlier models, the far tail x line extends farther downstream on the flanks than in the center of the tail, consistent with observations.