Sample records for drain induced barrier

  1. Charge trapping induced drain-induced-barrier-lowering in HfO2/TiN p-channel metal-oxide-semiconductor-field-effect-transistors under hot carrier stress

    NASA Astrophysics Data System (ADS)

    Lo, Wen-Hung; Chang, Ting-Chang; Tsai, Jyun-Yu; Dai, Chih-Hao; Chen, Ching-En; Ho, Szu-Han; Chen, Hua-Mao; Cheng, Osbert; Huang, Cheng-Tung


    This letter studies the channel hot carrier stress (CHCS) behaviors on high dielectric constant insulator and metal gate HfO2/TiN p-channel metal-oxide-semiconductor field effect transistors. It can be found that the degradation is associated with electron trapping, resulting in Gm decrease and positive Vth shift. However, Vth under saturation region shows an insignificant degradation during stress. To compare that, the CHC-induced electron trapping induced DIBL is proposed to demonstrate the different behavior of Vth between linear and saturation region. The devices with different channel length are used to evidence the trapping-induced DIBL behavior.

  2. Liquid draining shut-off induced geyser and slosh wave excitation at suction dip during draining in microgravity

    NASA Technical Reports Server (NTRS)

    Hung, R. J.; Shyu, K. L.


    The dynamical behavior of vapor ingestion, liquid residual at the incipience of suction dip, liquid hydrogen shut-off at the incipience of suction dip, and slosh wave excitation under normal and various reduced gravity environments and different flow rates of liquid during draining have been investigated. It shows that the liquid residual at the incipience of suction dip increases as the values of gravity environment decrease from normal gravity to lower reduced gravity, and also that the liquid residual increases as the flow rates of liquid increase during the courses of liquid hydrogen draining. It also shows that slosh waves accompanied by strong geyser are developed for surge-related flowfields at the moment of liquid hydrogen shut-off. Slosh wave excitation, during the liquid hydrogen shut-off, shift the fluid mass distribution in the container which imposes time-dependent variation in spacecraft moment of inertia.

  3. Enhancement of programming speed on gate-all-around poly-silicon nanowire nonvolatile memory using self-aligned NiSi Schottky barrier source/drain

    NASA Astrophysics Data System (ADS)

    Ho, Ching-Yuan; Chang, Yaw-Jen; Chiou, Y. L.


    The programming characteristics of gate-all-around silicon-oxide-nitride-oxide silicon (SONOS) nonvolatile memories are presented using NiSi/poly-Si nanowires (SiNW) Schottky barrier (SB) heterojunctions. The non-uniform thermal stress distribution on SiNW channels due to joule heating affected the carrier transport behavior. Under a high drain voltage, impact ionization was found as a large lateral field enhances carrier velocity. As gate voltage (Vg) increased, the difference in the drain current within a range of various temperature conditions can be mitigated because a high gate field lowers the SB height of a NiSi source/SiNW/NiSi drain junction to ensure efficient hot-carrier generation. By applying the Fowler-Nordheim programming voltage to the SONOS nanowire memory, the SB height (Φn = 0.34 eV) could be reduced by image force; thus, hot electrons could be injected from SB source/drain electrodes into the SiN storage node. To compare both SiNW and Si nanocrystal SONOS devices, the SB SiNW SONOS device was characterized experimentally to propose a wider threshold-voltage window, exhibiting efficient programming characteristics.

  4. Hsp70 vaccination-induced primary immune responses in efferent lymph of the draining lymph node.


    Vrieling, Manouk; Santema, Wiebren; Vordermeier, Martin; Rutten, Victor; Koets, Ad


    Bovine paratuberculosis is a highly prevalent chronic infection of the small intestine in cattle, caused by Mycobacterium avium subspecies paratuberculosis (MAP). In earlier studies we showed the protective effect of Hsp70/DDA subunit vaccination against paratuberculosis. In the current study we set out to measure primary immune responses generated at the site of Hsp70 vaccination. Lymph vessel cannulation was performed to obtain efferent lymph from the prescapular lymph node draining the neck area where the vaccine was applied. Hsp70 vaccination induced a significant increase of CD21(+) B cells in efferent lymph, accounting for up to 40% of efferent cells post-vaccination. Proliferation (Ki67(+)) within the CD21(+) B cell and CD4(+) T cell populations peaked between day 3 and day 5 post-vaccination. From day 7, Hsp70-specific antibody secreting cells (ASCs) could be detected in efferent lymph. Hsp70-specific antibodies, mainly of the IgG1 isotype, were also detected from this time point onwards. However, post-vaccination IFN-γ production in efferent lymph was non-sustained. In conclusion, Hsp70-vaccination induces only limited Th1 type immune responsiveness as reflected in efferent lymph draining the vaccination site. This is in line with our previous observations in peripheral blood. The main primary immunological outcome of the Hsp70/DDA subunit vaccination is B cell activation and abundant Hsp70-specific IgG1 production. This warrants the question whether Hsp70-specific antibodies contribute to the observed protective effect of Hsp70 vaccination in calves.

  5. Barrier reduction via implementation of InGaN interlayer in wafer-bonded current aperture vertical electron transistors consisting of InGaAs channel and N-polar GaN drain

    SciTech Connect

    Kim, Jeonghee Laurent, Matthew A.; Li, Haoran; Lal, Shalini; Mishra, Umesh K.


    This letter reports the influence of the added InGaN interlayer on reducing the inherent interfacial barrier and hence improving the electrical characteristics of wafer-bonded current aperture vertical electron transistors consisting of an InGaAs channel and N-polar GaN drain. The current-voltage characteristics of the transistors show that the implementation of N-polar InGaN interlayer effectively reduces the barrier to electron transport across the wafer-bonded interface most likely due to its polarization induced downward band bending, which increases the electron tunneling probability. Fully functional wafer-bonded transistors with nearly 600 mA/mm of drain current at V{sub GS} = 0 V and L{sub go} = 2 μm have been achieved, and thus demonstrate the feasibility of using wafer-bonded heterostructures for applications that require active carrier transport through both materials.

  6. Barrier island bistability induced by biophysical interactions

    NASA Astrophysics Data System (ADS)

    Durán Vinent, Orencio; Moore, Laura J.


    Barrier islands represent about 10% of the world’s coastline, sustain rich ecosystems, host valuable infrastructure and protect mainland coasts from storms. Future climate-change-induced increases in the intensity and frequency of major hurricanes and accelerations in sea-level rise will have a significant impact on barrier islands--leading to increased coastal hazards and flooding--yet our understanding of island response to external drivers remains limited. Here, we find that island response is intrinsically bistable and controlled by previously unrecognized dynamics: the competing, and quantifiable, effects of storm erosion, sea-level rise, and the aeolian and biological processes that enable and drive dune recovery. When the biophysical processes driving dune recovery dominate, islands tend to be high in elevation and vulnerability to storms is minimized. Alternatively, when the effects of storm erosion dominate, islands may become trapped in a perpetual state of low elevation and maximum vulnerability to storms, even under mild storm conditions. When sea-level rise dominates, islands become unstable and face possible disintegration. This quantification of barrier island dynamics is supported by data from the Virginia Barrier Islands, USA and provides a broader context for considering island response to climate change and the likelihood of potentially abrupt transitions in island state.

  7. Cystic Fibrosis patients have inducible IL-17+IL-22+ memory cells in lung draining lymph nodes

    PubMed Central

    Chan, Yvonne R.; Chen, Kong; Duncan, Steven R.; Lathrop, Kira; Latoche, Joseph; Logar, Alison; Pociask, Derek A.; Wahlberg, Brendon; Ray, Prabir; Ray, Anuradha; Pilewski, Joseph M.; Kolls, Jay K.


    Background Interleukin (IL)-17 is an important cytokine signature of a T helper differentiation pathway, Th17. This T cell subset is crucial in mediating autoimmune disease or antimicrobial immunity in animal models, but its presence and role in human disease remains to be completely characterized. Objective We set out to determine the frequency of Th17 cells in cystic fibrosis (CF), a disease in which there is recurrent infection with known pathogens. Methods Explanted lungs from patients undergoing transplant or organ donors (CF = 18, non-CF, non-bronchiectatic = 10) were collected. Hilar nodes and parenchymal lung tissue were processed. We examined them for Th17 signature by immunofluorescence and quantitative real time PCR. T cells were isolated and stimulated with antigens from Pseudomonas aeruginosa and Aspergillus. Cytokine profiles and staining by flow cytometry were used to assess the reactivity of these cells to antigen stimulation. Results We found a strong IL-17 phenotype in CF compared to non-CF controls. Within this tissue, we found pathogen-antigen-responsive CD4+IL17+ cells. There were double positive IL-17+IL-22+ cells and the IL-22+ population had higher proportions of memory characteristics. Antigen-specific Th17 responses were stronger in the draining lymph nodes compared to matched parenchymal lung. Conclusion Inducible proliferation of Th17(22) with memory cell characteristics is seen in CF lung. The function of these individual subpopulations will require further study regarding their development. T-cells are likely not the exclusive producers of IL-17 and IL-22 and this will require further characterization. PMID:22795370

  8. An analysis of molten-corium-induced failure of drain pipes in BWR Mark 2 containments

    SciTech Connect

    Taleyarkhan, R.P. ); Podowski, M.Z. )


    This study has focused on mechanistic simulation and analysis of potential failure modes for inpedestal drywell drain pipes in the Limerick boiling water reactor (BWR) Mark 2 containment. Physical phenomena related to surface tension breakdown, heatup, melting, ablation, crust formation and failure, and core material relocation into drain pipes with simultaneous melting of pipe walls were modeled and analyzed. The results of analysis have been used to assess the possibility of drain pipe failure and the resultant loss of pressure-suppression capability. Estimates have been made for the timing and amount of molten corium released to the wetwell. The study has revealed that significantly different melt progression sequences can result depending upon the failure characteristics of the frozen metallic crust which forms over the drain cover during the initial stages of debris pour. Another important result is that it can take several days for the molten fuel to ablate the frozen metallic debris layer -- if the frozen layer has cooled below 1100 K before fuel attack. 10 refs., 3 figs., 4 tabs.

  9. Influence of the Thickness of the Barrier Layer in Nanoheterostructures and the Gate-Drain Capacitance on the Microwave and Noise Parameters of Field-Effect AlGaN/GaN HEMT

    NASA Astrophysics Data System (ADS)

    Mikhaylovich, S. V.; Fedorov, Yu. V.


    We perform a computational and analytical study of how the thickness of the barrier layer in nanoheterostructures and the gate-drain capacitance C gd influence the microwave parameters (limiting frequency of current amplification and maximum generation frequency) and noise parameters (noise factor) of a field-effect AlGaN/GaN high electron mobility transistor. The results of complex measurements of the parameters of such transistors based on nanoheterostructures with a barrier layer thickness of 3.5-15.7 nm, which were performed within the framework of four technological routes in the range 0.1-67 GHz, are presented. It is shown that in order to reduce the noise ratio and improve the microwave parameters, it is necessary to optimize both the parameters of nanoheterostructures and the manufacturing techniques. In particular, the thickness of the barrier layer should be reduced, and the gate length should be chosen such as to maximize the product of the squared maximum current amplification frequency in the interior of the transistor and the output impedance between the drain and the source. Additionally, attention should be given to the shape of the gate to reduce the capacitance C gd. Under certain conditions of manufacture of nitride field-effect HEMT, one can achieve a lower noise factor compared with the transistors based on arsenide nanoheterostructures.

  10. Melanoma cell lysate induces CCR7 expression and in vivo migration to draining lymph nodes of therapeutic human dendritic cells.


    González, Fermín E; Ortiz, Carolina; Reyes, Montserrat; Dutzan, Nicolás; Patel, Vyomesh; Pereda, Cristián; Gleisner, Maria A; López, Mercedes N; Gutkind, J Silvio; Salazar-Onfray, Flavio


    We have previously reported a novel method for the production of tumour-antigen-presenting cells (referred to as TAPCells) that are currently being used in cancer therapy, using an allogeneic melanoma-derived cell lysate (referred to as TRIMEL) as an antigen provider and activation factor. It was recently demonstrated that TAPCell-based immunotherapy induces T-cell-mediated immune responses resulting in improved long-term survival of stage IV melanoma patients. Clinically, dendritic cell (DC) migration from injected sites to lymph nodes is an important requirement for an effective anti-tumour immunization. This mobilization of DCs is mainly driven by the C-C chemokine receptor type 7 (CCR7), which is up-regulated on mature DCs. Using flow cytometry and immunohistochemistry, we investigated if TRIMEL was capable of inducing the expression of the CCR7 on TAPCells and enhancing their migration in vitro, as well as their in vivo relocation to lymph nodes in an ectopic xenograft animal model. Our results confirmed that TRIMEL induces a phenotypic maturation and increases the expression of surface CCR7 on melanoma patient-derived DCs, and also on the monocytic/macrophage cell line THP-1. Moreover, in vitro assays showed that TRIMEL-stimulated DCs and THP-1 cells were capable of migrating specifically in the presence of the CCR7 ligand CCL19. Finally, we demonstrated that TAPCells could migrate in vivo from the injection site into the draining lymph nodes. This work contributes to an increased understanding of the biology of DCs produced ex vivo allowing the design of new strategies for effective DC-based vaccines for treating aggressive melanomas.

  11. Scaling of lowered source/drain (LSD) and raised source/drain (RSD) ultra-thin body (UTB) SOI MOSFETs

    NASA Astrophysics Data System (ADS)

    An, Xia; Huang, Ru; Zhang, Xing; Wang, Yangyuan


    Ultra-thin body (UTB) SOI MOSFETs are considered as one of most promising candidates for deca-nano-scale regimes. The device characteristics of two different UTB MOSFETs with raised source/drain (RSD) and lowered source/drain (LSD), respectively, are investigated with DC and AC considerations. The results suggest that LSD-UTB SOI MOSFETs show better control of the off-state leakage current, about one order of magnitude lower than that of RSD-UTB MOSFETs. The short-channel effect (SCE) and drain-induced-barrier-lowering (DIBL) effect are more effectively suppressed in LSD-UTB MOSFETs. And the intrinsic delay of LSD-UTB device is smaller than that of RSD-UTB as a result of the greatly reduced parasitic capacitance. In addition, the LSD-UTB MOSFETs demonstrate better scaling capability than RSD-UTB MOSFETs. And LSD-UTB can greatly relax the requirement for silicon body thickness by ˜60%.

  12. Drain vs No Drain After Colorectal Surgery.


    Tsujinaka, Shingo; Konishi, Fumio


    In colorectal surgery, drains are expected to prevent hematoma, fluid collection, or abscess formation, to act as an indicator of postoperative complication, or to minimize the severity of complication-related symptoms. Routine drainage has not been advocated by meta-analyses as they failed to demonstrate any benefit in reducing anastomotic leak rate, minimizing symptoms, or serving as a warning function. Moreover, some reports even showed that drain itself is an independent risk factor of anastomosis. The introduction of total mesorectal excision (TME) for rectal cancer surgery has given further concern to this controversial issue, that the use of drain decreased anastomotic failure rate and the need for surgical re-intervention. While controversy still remains, the choice of using drain is left to the individual surgeon's preference in daily practice. Therefore, surgeons should be well acquainted with purpose of drainage (prophylaxis, information, or treatment), characteristics (materials), clinical application of drain (type of drainage system, timing of removal), surgical outcomes after using drain (incidence of postoperative complication), and drain-related complications. If drains are used, careful observation with proper use is crucial for the management. It is important that the duration of drainage should not be inadequately extended. Any complications directly associated with the use of drain should be avoided. New concepts of drain have been proposed as diagnostic tool using biomarkers, and as preventive device against anastomotic leak. This article overviews the available, published data on the use of drain in colorectal surgery.

  13. Electrically Induced Redox Barriers for Treatment of Groundwater

    DTIC Science & Technology


    Chloride Calcium Nitrate Potassium Nitrite Magnesium Phosphate Sodium Fluoride Iron Sulfate Manganese Carbonate Chromium Bicarbonate Cadmium...mediated under field conditions. To assess changes in the microbial populations induced by the operation of the e-barrier, and to obtain a first-level...analysis and (b) total soil microbial DNA measurements. Produced Gases – At an electrical potential of 6.5 volts, gases were collected from the surface

  14. Zinc reduces epithelial barrier compromise induced by human seminal plasma

    PubMed Central

    Mullin, James M.; Diguilio, Katherine M.; Valenzano, Mary C.; Deis, Rachael; Thomas, Sunil; Zurbach, E. Peter; Abdulhaqq, Shaheed; Montaner, Luis J.


    Human semen has the potential to modulate the epithelial mucosal tissues it contacts, as seminal plasma (SP) is recognized to contain both pro- and anti-barrier components, yet its effects on epithelial barrier function are largely unknown. We addressed the role of human SP when exposed to the basal-lateral epithelial surface, a situation that would occur clinically with prior mechanical or disease-related injury of the human epithelial mucosal cell layers in contact with semen. The action of SP on claudins-2, -4, -5, and -7 expression, as well as on a target epithelium whose basolateral surface has been made accessible to SP, showed upregulation of claudins-4 and -5 in CACO-2 human epithelial cell layers, despite broad variance in SP-induced modulation of transepithelial electrical resistance and mannitol permeability. Upregulation of claudin-2 by SP also exhibited such variance by SP sample. We characterize individual effects on CACO-2 barrier function of nine factors known to be present abundantly in seminal plasma (zinc, EGF, citrate, spermine, fructose, urea, TGF, histone, inflammatory cytokines) to establish that zinc, spermine and fructose had significant potential to raise CACO-2 transepithelial resistance, whereas inflammatory cytokines and EGF decreased this measure of barrier function. The role of zinc as a dominant factor in determining higher levels of transepithelial resistance and lower levels of paracellular leak were confirmed by zinc chelation and exogenous zinc addition. As expected, SP presentation to the basolateral cell surface also caused a very dramatic yet transient elevation of pErk levels. Results suggest that increased zinc content in SP can compete against the barrier-compromising effect of negative modulators in SP when SP gains access to that epithelium’s basolateral surface. Prophylactic elevation of zinc in an epithelial cell layer prior to contact by SP may help to protect an epithelial barrier from invasion by SP-containing STD

  15. Barriers to Radiation-Induced In Situ Tumor Vaccination

    PubMed Central

    Wennerberg, Erik; Lhuillier, Claire; Vanpouille-Box, Claire; Pilones, Karsten A.; García-Martínez, Elena; Rudqvist, Nils-Petter; Formenti, Silvia C.; Demaria, Sandra


    The immunostimulatory properties of radiation therapy (RT) have recently generated widespread interest due to preclinical and clinical evidence that tumor-localized RT can sometimes induce antitumor immune responses mediating regression of non-irradiated metastases (abscopal effect). The ability of RT to activate antitumor T cells explains the synergy of RT with immune checkpoint inhibitors, which has been well documented in mouse tumor models and is supported by observations of more frequent abscopal responses in patients refractory to immunotherapy who receive RT during immunotherapy. However, abscopal responses following RT remain relatively rare in the clinic, and antitumor immune responses are not effectively induced by RT against poorly immunogenic mouse tumors. This suggests that in order to improve the pro-immunogenic effects of RT, it is necessary to identify and overcome the barriers that pre-exist and/or are induced by RT in the tumor microenvironment. On the one hand, RT induces an immunogenic death of cancer cells associated with release of powerful danger signals that are essential to recruit and activate dendritic cells (DCs) and initiate antitumor immune responses. On the other hand, RT can promote the generation of immunosuppressive mediators that hinder DCs activation and impair the function of effector T cells. In this review, we discuss current evidence that several inhibitory pathways are induced and modulated in irradiated tumors. In particular, we will focus on factors that regulate and limit radiation-induced immunogenicity and emphasize current research on actionable targets that could increase the effectiveness of radiation-induced in situ tumor vaccination. PMID:28348554

  16. Self-induced dust traps: overcoming planet formation barriers

    NASA Astrophysics Data System (ADS)

    Gonzalez, J.-F.; Laibe, G.; Maddison, S. T.


    Planet formation is thought to occur in discs around young stars by the aggregation of small dust grains into much larger objects. The growth from grains to pebbles and from planetesimals to planets is now fairly well understood. The intermediate stage has however been found to be hindered by the radial-drift and fragmentation barriers. We identify a powerful mechanism in which dust overcomes both barriers. Its key ingredients are i) backreaction from the dust onto the gas, ii) grain growth and fragmentation, and iii) large-scale gradients. The pile-up of growing and fragmenting grains modifies the gas structure on large scales and triggers the formation of pressure maxima, in which particles are trapped. We show that these self-induced dust traps are robust: they develop for a wide range of disc structures, fragmentation thresholds and initial dust-to-gas ratios. They are favored locations for pebbles to grow into planetesimals, thus opening new paths towards the formation of planets.

  17. The Draining Cylinder

    ERIC Educational Resources Information Center

    James Graham-Eagle


    This article explores the time it takes for a liquid to drain from a cylindrical container through a hole in the bottom. Using dimensional analysis and some thought experiments this time is determined and Torricelli's law derived as a consequence. Finally, the effect of pouring liquid into the container as it drains is considered.

  18. Effects of drain bias on the statistical variation of double-gate tunnel field-effect transistors

    NASA Astrophysics Data System (ADS)

    Choi, Woo Young


    The effects of drain bias on the statistical variation of double-gate (DG) tunnel field-effect transistors (TFETs) are discussed in comparison with DG metal–oxide–semiconductor FETs (MOSFETs). Statistical variation corresponds to the variation of threshold voltage (V th), subthreshold swing (SS), and drain-induced barrier thinning (DIBT). The unique statistical variation characteristics of DG TFETs and DG MOSFETs with the variation of drain bias are analyzed by using full three-dimensional technology computer-aided design (TCAD) simulation in terms of the three dominant variation sources: line-edge roughness (LER), random dopant fluctuation (RDF) and workfunction variation (WFV). It is observed than DG TFETs suffer from less severe statistical variation as drain voltage increases unlike DG MOSFETs.

  19. Ionic liquid gating on atomic layer deposition passivated GaN: Ultra-high electron density induced high drain current and low contact resistance

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Du, Yuchen; Ye, Peide D.


    Herein, we report on achieving ultra-high electron density (exceeding 1014 cm-2) in a GaN bulk material device by ionic liquid gating, through the application of atomic layer deposition (ALD) of Al2O3 to passivate the GaN surface. Output characteristics demonstrate a maximum drain current of 1.47 A/mm, the highest reported among all bulk GaN field-effect transistors, with an on/off ratio of 105 at room temperature. An ultra-high electron density exceeding 1014 cm-2 accumulated at the surface is confirmed via Hall-effect measurement and transfer length measurement. In addition to the ultra-high electron density, we also observe a reduction of the contact resistance due to the narrowing of the Schottky barrier width on the contacts. Taking advantage of the ALD surface passivation and ionic liquid gating technique, this work provides a route to study the field-effect and carrier transport properties of conventional semiconductors in unprecedented ultra-high charge density regions.

  20. Ultrasound-Induced Blood-Brain Barrier Opening

    PubMed Central

    Konofagou, Elisa E.; Tung, Yao-Sheng; Choi, James; Deffieux, Thomas; Baseri, Babak; Vlachos, Fotios


    Over 4 million U.S. men and women suffer from Alzheimer's disease; 1 million from Parkinson's disease; 350,000 from multiple sclerosis (MS); and 20,000 from amyotrophic lateral sclerosis (ALS). Worldwide, these four diseases account for more than 20 million patients. In addition, aging greatly increases the risk of neurodegenerative disease. Although great progress has been made in recent years toward understanding of these diseases, few effective treatments and no cures are currently available. This is mainly due to the impermeability of the blood-brain barrier (BBB) that allows only 5% of the 7000 small-molecule drugs available to treat only a tiny fraction of these diseases. On the other hand, safe and localized opening of the BBB has been proven to present a significant challenge. Of the methods used for BBB disruption shown to be effective, Focused Ultrasound (FUS), in conjunction with microbubbles, is the only technique that can induce localized BBB opening noninvasively and regionally. FUS may thus have a huge impact in trans-BBB brain drug delivery. The primary objective in this paper is to elucidate the interactions between ultrasound, microbubbles and the local microenvironment during BBB opening with FUS, which are responsible for inducing the BBB disruption. The mechanism of the BBB opening in vivo is monitored through the MRI and passive cavitation detection (PCD), and the safety of BBB disruption is assessed using H&E histology at distinct pressures, pulse lengths and microbubble diameters. It is hereby shown that the BBB can be disrupted safely and transiently under specific acoustic pressures (under 0.45 MPa) and microbubble (diameter under 8 μm) conditions. PMID:22201586

  1. Ultrasound-induced blood-brain barrier opening.


    Konofagou, Elisa E; Tung, Yao-Sheng; Choi, James; Deffieux, Thomas; Baseri, Babak; Vlachos, Fotios


    Over 4 million U.S. men and women suffer from Alzheimer's disease; 1 million from Parkinson's disease; 350,000 from multiple sclerosis (MS); and 20,000 from amyotrophic lateral sclerosis (ALS). Worldwide, these four diseases account for more than 20 million patients. In addition, aging greatly increases the risk of neurodegenerative disease. Although great progress has been made in recent years toward understanding of these diseases, few effective treatments and no cures are currently available. This is mainly due to the impermeability of the blood-brain barrier (BBB) that allows only 5% of the 7000 small-molecule drugs available to treat only a tiny fraction of these diseases. On the other hand, safe and localized opening of the BBB has been proven to present a significant challenge. Of the methods used for BBB disruption shown to be effective, Focused Ultrasound (FUS), in conjunction with microbubbles, is the only technique that can induce localized BBB opening noninvasively and regionally. FUS may thus have a huge impact in trans-BBB brain drug delivery. The primary objective in this paper is to elucidate the interactions between ultrasound, microbubbles and the local microenvironment during BBB opening with FUS, which are responsible for inducing the BBB disruption. The mechanism of the BBB opening in vivo is monitored through the MRI and passive cavitation detection (PCD), and the safety of BBB disruption is assessed using H&E histology at distinct pressures, pulse lengths and microbubble diameters. It is hereby shown that the BBB can be disrupted safely and transiently under specific acoustic pressures (under 0.45 MPa) and microbubble (diameter under 8 μm) conditions.

  2. Osteopontin deficiency affects imiquimod-induced psoriasis-like murine skin inflammation and lymphocyte distribution in skin, draining lymph nodes and spleen.


    Frenzel, Denis F; Borkner, Lisa; Scheurmann, Jan; Singh, Kamayani; Scharffetter-Kochanek, Karin; Weiss, Johannes M


    Osteopontin (OPN) that enhances autoimmunity is expressed in psoriasis lesions; however, its functions in psoriatic inflammation are unknown. We investigated the role of OPN in OPN deficient mice (OPN-/-) by inducing psoriasis-like inflammation through skin application of imiquimod (IMQ). OPN-/- mice treated with IMQ showed delayed onset ear swelling and attracted less inflammatory cells to the skin. IMQ-induced lymph node swelling was reduced in the absence of OPN, and IMQ-mediated expansion of B cells was inhibited. Further, reduction of CD4(+) T-cell numbers by IMQ in lymph nodes was suppressed in OPN-/- mice, with an increase in the CD4/CD8 ratio. A comparable pattern was found in spleen. Importantly, IMQ-induced IL-17 and IL-4 expression by CD4(+) lymph node T cells was reduced in OPN-/- mice. In conclusion, OPN may modulate psoriasis-like inflammation through altering lymphocyte distribution in skin and draining lymph nodes and by inducing IL-17 expression of inflammatory T cells.

  3. Murine filaggrin-2 is involved in epithelial barrier function and down-regulated in metabolically induced skin barrier dysfunction.


    Hansmann, Britta; Ahrens, Kerstin; Wu, Zhihong; Proksch, Ehrhardt; Meyer-Hoffert, Ulf; Schröder, Jens-Michael


    The S100 fused-type proteins (SFTPs) are thought to be involved in the barrier formation and function of the skin. Mutations in the profilaggrin gene, one of the best investigated members of this family, are known to be the major risk factors for ichthyosis vulgaris and atopic dermatitis. Recently, we identified human filaggrin-2 as a new member of the SFTP family. To achieve further insight into its function, here the murine filaggrin-2 was analysed as a possible orthologue. The 5' and 3' ends of the mouse filaggrin-2 cDNA of the BALB/c strain were sequenced and confirmed an organization typical for SFTPs. Murine filaggrin-2 showed an expression pattern mainly in keratinizing epithelia in the upper cell layers on both mRNA and protein levels. The expression in cultured mouse keratinocytes was increased upon elevated Ca(2+) levels. Immunoblotting experiments indicated an intraepidermal processing of the 250-kDa full-length protein. In metabolically (essential fatty acid-deficient diet) induced skin barrier dysfunction, filaggrin-2 expression was significantly reduced, whereas filaggrin expression was up-regulated. In contrast, mechanical barrier disruption with acetone treatment did not affect filaggrin-2 mRNA expression. These results suggest that filaggrin-2 may contribute to epidermal barrier function and its regulation differs, at least in parts, from that of filaggrin.

  4. Short-Channel Tunneling Field-Effect Transistor with Drain-Overlap and Dual-Metal Gate Structure for Low-Power and High-Speed Operations.


    Yoon, Young Jun; Eun, Hye Rim; Seo, Jae Hwa; Kang, Hee-Sung; Lee, Seong Min; Lee, Jeongmin; Cho, Seongjae; Tae, Heung-Sik; Lee, Jung-Hee; Kang, In Man


    We have investigated and proposed a highly scaled tunneling field-effect transistor (TFET) based on Ge/GaAs heterojunction with a drain overlap to suppress drain-induced barrier thinning (DIBT) and improve low-power (LP) performance. The highly scaled TFET with a drain overlap achieves lower leakage tunneling current because of the decrease in tunneling events between the source and drain, whereas a typical short-channel TFET suffers from a great deal of tunneling leakage current due to the DIBT at the off-state. However, the drain overlap inevitably increases the gate-to-drain capacitance (Cgd) because of the increase in the overlap capacitance (Cov) and inversion capacitance (Cinv). Thus, in this work, a dual-metal gate structure is additionally applied along with the drain overlap. The current performance and the total gate capacitance (Cgg) of the device with a dual-metal gate can be possibly controlled by adjusting the metal gate workfunction (φgate) and φoverlap-gate in the overlapping regions. As a result, the intrinsic delay time (τ) is greatly reduced by obtaining lower Cgg divided by the on-state current (Ion), i.e., Cgg/Ion. We have successfully demonstrated excellent LP and high-speed performance of a highly scaled TFET by adopting both drain overlap and dual-metal gate with DIBT minimization.

  5. TNF-induced endothelial barrier disruption: beyond actin and Rho.


    Marcos-Ramiro, B; García-Weber, D; Millán, J


    The decrease of endothelial barrier function is central to the long-term inflammatory response. A pathological alteration of the ability of endothelial cells to modulate the passage of cells and solutes across the vessel underlies the development of inflammatory diseases such as atherosclerosis and multiple sclerosis. The inflammatory cytokine tumour necrosis factor (TNF) mediates changes in the barrier properties of the endothelium. TNF activates different Rho GTPases, increases filamentous actin and remodels endothelial cell morphology. However, inhibition of actin-mediated remodelling is insufficient to prevent endothelial barrier disruption in response to TNF, suggesting that additional molecular mechanisms are involved. Here we discuss, first, the pivotal role of Rac-mediated generation of reactive oxygen species (ROS) to regulate the integrity of endothelial cell-cell junctions and, second, the ability of endothelial adhesion receptors such as ICAM-1, VCAM-1 and PECAM-1, involved in leukocyte transendothelial migration, to control endothelial permeability to small molecules, often through ROS generation. These adhesion receptors regulate endothelial barrier function in ways both dependent on and independent of their engagement by immune cells, and orchestrate the crosstalk between leukocyte transendothelial migration and endothelial permeability during inflammation.

  6. Influence of Field-Induced Drain on the Characteristics of Poly-Si Thin-Film Transistor using a Self-Aligned Double Spacer Process

    NASA Astrophysics Data System (ADS)

    Ahn, Jeong-Ah; Kim, Ohyun


    The electric characteristics of field-induced drain (FID) poly-Si thin-film transistors (poly-Si TFT) with an independently biased self-aligned sub-gate using a double space process are investigated. The on/off current ratio of this FID TFT is approximately 9.3× 107 and the off-state leakage current is 200 times lower than that of the conventional TFT and 60 times lower than that of the LDD TFT at VSG=VDS=5 V. The self-aligned double spacer process can remove the sub-gate misalignment error and the length of the sub-gate can be easily controlled by the poly-Si thickness and a hard mask. In particular, the use of the dual hard mask can realize a long sub-gate without thick sub-gate poly-Si (>500 nm). The optimum sub-gate voltage is about 5 V and the optimum effective sub-gate length is between 200 nm and 300 nm in these FID TFTs.

  7. Impaired skin barrier function in mice with colon carcinoma induced by azoxymethane and dextran sodium sulfate.


    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya


    We have previously reported that impaired skin barrier function was induced by small intestinal injury in mice. Therefore, we postulated that other intestinal diseases might also influence skin barrier function. In this study, we evaluated the skin barrier function of hairless mice with colon carcinoma that was induced by azoxymethane (AOM) and dextran sodium sulfate (DSS). In mice treated with these drugs, we observed elevated transepidermal water loss and reduced skin hydration levels, compared to those in the control mice. In addition, plasma nitrogen di/trioxide (NO2(-)/NO3(-)) levels were significantly elevated, and expression of type I collagen was significantly reduced in the treated mice, compared to those in control. These results suggest that impaired skin barrier function occurs in mice when colon carcinoma is present.

  8. Histamine Induces Vascular Hyperpermeability by Increasing Blood Flow and Endothelial Barrier Disruption In Vivo.


    Ashina, Kohei; Tsubosaka, Yoshiki; Nakamura, Tatsuro; Omori, Keisuke; Kobayashi, Koji; Hori, Masatoshi; Ozaki, Hiroshi; Murata, Takahisa


    Histamine is a mediator of allergic inflammation released mainly from mast cells. Although histamine strongly increases vascular permeability, its precise mechanism under in vivo situation remains unknown. We here attempted to reveal how histamine induces vascular hyperpermeability focusing on the key regulators of vascular permeability, blood flow and endothelial barrier. Degranulation of mast cells by antigen-stimulation or histamine treatment induced vascular hyperpermeability and tissue swelling in mouse ears. These were abolished by histamine H1 receptor antagonism. Intravital imaging showed that histamine dilated vasculature, increased blood flow, while it induced hyperpermeability in venula. Whole-mount staining showed that histamine disrupted endothelial barrier formation of venula indicated by changes in vascular endothelial cadherin (VE-cadherin) localization at endothelial cell junction. Inhibition of nitric oxide synthesis (NOS) by L-NAME or vasoconstriction by phenylephrine strongly inhibited the histamine-induced blood flow increase and hyperpermeability without changing the VE-cadherin localization. In vitro, measurements of trans-endothelial electrical resistance of human dermal microvascular endothelial cells (HDMECs) showed that histamine disrupted endothelial barrier. Inhibition of protein kinase C (PKC) or Rho-associated protein kinase (ROCK), NOS attenuated the histamine-induced barrier disruption. These observations suggested that histamine increases vascular permeability mainly by nitric oxide (NO)-dependent vascular dilation and subsequent blood flow increase and maybe partially by PKC/ROCK/NO-dependent endothelial barrier disruption.

  9. Inflammation-induced alterations in the skin barrier function: implications in atopic dermatitis.


    Vestergaard, Christian; Hvid, Malene; Johansen, Claus; Kemp, Kaare; Deleuran, Bent; Deleuran, Mette


    The pathogenesis of atopic dermatitis (AD) is very complex, but best characterized by an inflammatory reaction in the skin and a disrupted skin barrier. Until recently, these two factors have been studied as separate entities; however, it has been shown that inflammatory cytokines can regulate filaggrin, a very important component of the skin barrier, as well as proteins involved in the processing and maturation of filaggrin. Therefore, inflammation itself may be able to induce a functional skin barrier dysfunction and thereby aggravate the eczematous reaction in AD.

  10. Stacking fault induced tunnel barrier in platelet graphite nanofiber

    SciTech Connect

    Lan, Yann-Wen E-mail:; Chang, Yuan-Chih; Chang, Chia-Seng; Chen, Chii-Dong E-mail:; Chang, Wen-Hao; Li, Yuan-Yao


    A correlation study using image inspection and electrical characterization of platelet graphite nanofiber devices is conducted. Close transmission electron microscopy and diffraction pattern inspection reveal layers with inflection angles appearing in otherwise perfectly stacked graphene platelets, separating nanofibers into two domains. Electrical measurement gives a stability diagram consisting of alternating small-large Coulomb blockade diamonds, suggesting that there are two charging islands coupled together through a tunnel junction. Based on these two findings, we propose that a stacking fault can behave as a tunnel barrier for conducting electrons and is responsible for the observed double-island single electron transistor characteristics.

  11. Induced phytoextraction/soil washing of lead using biodegradable chelate and permeable barriers.


    Kos, Bostjan; Lestan, Domen


    Chelate-induced remediation has been proposed as an effective tool for the extraction of lead (Pb) from contaminated soils by plants. However, side-effects, mainly mobilization and leaching of Pb, raise environmental concerns. Biodegradable, synthetic organic chelate ethylenediaminedisuccinic acid (EDDS), and commonly used ethylenedimanetetraacetic acid (EDTA) were used for induced phytoextraction with a test plant Brassica rapa and in situ washing of soil contaminated with 1350 mg/kg of Pb. Horizontal permeable barriers were placed 20 cm deep in soil columns and tested for their ability to prevent leaching of Pb. The reactive materials in the barriers were nutrient enriched vermiculite, peat or agricultural hydrogel, and apatite. EDTA and EDDS addition increased Pb concentrations in the test plant by 158 and 89 times compared to the control, to 817 and 464 mg/kg, respectively. In EDTA treatments, approximately 25% or more of total initial soil Pb was leached in single cycle of chelate addition. In EDDS treatments, 20% of the initial Pb was leached from columns with no barrier, while barriers with vermiculite or hydrogel and apatite decreased leaching by more than 60 times, to 0.35%. 11.6% of total initial Pb was washed from the soil above the barrier with vermiculite and apatite, where almost all leached Pb was accumulated. Results indicate that use of biodegradable chelate EDDS and permeable barriers may lead to environmentally safe induced Pb phytoextraction and in situ washing of Pb.

  12. Pavement base drain evaluation

    NASA Astrophysics Data System (ADS)

    Hoffman, G. L.


    Portions of a highway drainage system design was revised. Essentially, the longitudinal drainage trench was moved closer to the pavement/shoulder joint, and the fine concrete sand layer was eliminated as a trench backfill material. The specified backfill material is a coarser crushed aggregate (pea gravel). An evaluation of the effects of these changes on pavement performance is given and the new pavement base drain system is compared to the older pipe foundation underdrain system at the same site.

  13. Modeling Oxidation Induced Stresses in Thermal Barrier Coatings

    NASA Technical Reports Server (NTRS)

    Ferguson, B. L.; Freborg, A. M.; Petrus, G. J.; Brindley, William J.


    The use of thermal barrier coatings (TBC's) in gas turbines has increased dramatically in recent years, due mainly to the need for component protection from ever increasing service temperatures. Oxidation of the bond coat has been identified as an important contributing factor to spallation of the ceramic top coat during service. Additional variables found to influence TBC thermal cycle life include bond coat coefficient of thermal expansion, creep behavior of both the ceramic and bond coat layers, and modulus of elasticity. The purpose of this work was to characterize the effects of oxidation on the stress states within the TBC system, as well as to examine the interaction of oxidation with other factors affecting TBC life.

  14. Two-barrier stability that allows low-power operation in current-induced domain-wall motion.


    Kim, Kab-Jin; Hiramatsu, Ryo; Koyama, Tomohiro; Ueda, Kohei; Yoshimura, Yoko; Chiba, Daichi; Kobayashi, Kensuke; Nakatani, Yoshinobu; Fukami, Shunsuke; Yamanouchi, Michihiko; Ohno, Hideo; Kohno, Hiroshi; Tatara, Gen; Ono, Teruo


    Energy barriers in magnetization reversal dynamics have long been of interest because the barrier height determines the thermal stability of devices as well as the threshold force triggering their dynamics. Especially in memory and logic applications, there is a dilemma between the thermal stability of bit data and the operation power of devices, because larger energy barriers for higher thermal stability inevitably lead to larger magnetic fields (or currents) for operation. Here we show that this is not the case for current-induced magnetic domain-wall motion induced by adiabatic spin-transfer torque. By quantifying domain-wall depinning energy barriers by magnetic field and current, we find that there exist two different pinning barriers, extrinsic and intrinsic energy barriers, which govern the thermal stability and threshold current, respectively. This unique two-barrier system allows low-power operation with high thermal stability, which is impossible in conventional single-barrier systems.

  15. Two-barrier stability that allows low-power operation in current-induced domain-wall motion

    NASA Astrophysics Data System (ADS)

    Kim, Kab-Jin; Hiramatsu, Ryo; Koyama, Tomohiro; Ueda, Kohei; Yoshimura, Yoko; Chiba, Daichi; Kobayashi, Kensuke; Nakatani, Yoshinobu; Fukami, Shunsuke; Yamanouchi, Michihiko; Ohno, Hideo; Kohno, Hiroshi; Tatara, Gen; Ono, Teruo


    Energy barriers in magnetization reversal dynamics have long been of interest because the barrier height determines the thermal stability of devices as well as the threshold force triggering their dynamics. Especially in memory and logic applications, there is a dilemma between the thermal stability of bit data and the operation power of devices, because larger energy barriers for higher thermal stability inevitably lead to larger magnetic fields (or currents) for operation. Here we show that this is not the case for current-induced magnetic domain-wall motion induced by adiabatic spin-transfer torque. By quantifying domain-wall depinning energy barriers by magnetic field and current, we find that there exist two different pinning barriers, extrinsic and intrinsic energy barriers, which govern the thermal stability and threshold current, respectively. This unique two-barrier system allows low-power operation with high thermal stability, which is impossible in conventional single-barrier systems.

  16. Nifedipine prevents sodium caprate-induced barrier dysfunction in human epidermal keratinocyte cultures.


    Uchino, Yoshihiro; Matsumoto, Junichi; Watanabe, Takuya; Hamabashiri, Masato; Tsuchiya, Takashi; Kimura, Ikuya; Yamauchi, Atsushi; Kataoka, Yasufumi


    Tight junctions (TJs) of the epidermis play an important role in maintaining the epidermal barrier. TJ breakdown is associated with skin problems, such as wrinkles and transepidermal water loss (TEWL). Clinical studies have reported that topical nifedipine is effective in reducing the depth of wrinkles and improving TEWL. However, it remains unknown whether nifedipine influences the TJ function in the epidermis. In the present study, we investigated the effect of nifedipine on epidermal barrier dysfunction in normal human epidermal keratinocytes (NHEKs) treated with sodium caprate (C10), a TJ inhibitor. Nifedipine reversed the C10-decreased transepithelial electrical resistance values as a measure of disruption of the epidermal barrier. Immunocytochemical observations revealed that nifedipine improved the C10-induced irregular arrangement of claudin-1, a key protein in TJs. Taken together, these findings suggest that nifedipine prevents epidermal barrier dysfunction, at least in part, by reconstituting the irregular claudin-1 localization at TJs in C10-treated NHEKs.

  17. Selective HDAC6 inhibition prevents TNF-α-induced lung endothelial cell barrier disruption and endotoxin-induced pulmonary edema.


    Yu, Jinyan; Ma, Zhongsen; Shetty, Sreerama; Ma, Mengshi; Fu, Jian


    Lung endothelial damage contributes to the pathogenesis of acute lung injury. New strategies against lung endothelial barrier dysfunction may provide therapeutic benefits against lung vascular injury. Cell-cell junctions and microtubule cytoskeleton are basic components in maintaining endothelial barrier integrity. HDAC6, a deacetylase primarily localized in the cytoplasm, has been reported to modulate nonnuclear protein function through deacetylation. Both α-tubulin and β-catenin are substrates for HDAC6. Here, we examined the effects of tubastatin A, a highly selective HDAC6 inhibitor, on TNF-α induced lung endothelial cell barrier disruption and endotoxin-induced pulmonary edema. Selective HDAC6 inhibition by tubastatin A blocked TNF-α-induced lung endothelial cell hyperpermeability, which was associated with increased α-tubulin acetylation and microtubule stability. Tubastatin A pretreatment inhibited TNF-α-induced endothelial cell contraction and actin stress fiber formation with reduced myosin light chain phosphorylation. Selective HDAC6 inhibition by tubastatin A also induced β-catenin acetylation in human lung endothelial cells, which was associated with increased membrane localization of β-catenin and stabilization of adherens junctions. HDAC6 knockdown by small interfering RNA also prevented TNF-α-induced barrier dysfunction and increased α-tubulin and β-catenin acetylation in endothelial cells. Furthermore, in a mouse model of endotoxemia, tubastatin A was able to prevent endotoxin-induced deacetylation of α-tubulin and β-catenin in lung tissues, which was associated with reduced pulmonary edema. Collectively, our data indicate that selective HDAC6 inhibition by tubastatin A is a potent approach against lung endothelial barrier dysfunction.

  18. Low Barrier Carbon Induced CO Dissociation on Stepped Cu

    NASA Astrophysics Data System (ADS)

    Ng, M. L.; Abild-Pedersen, F.; Kaya, S.; Mbuga, F.; Ogasawara, H.; Nilsson, A.


    Using x-ray photoelectron spectroscopy we observe the breaking of the strong interatomic bond in molecular CO at low temperature on a stepped Cu surface. Since the electronic structure of Cu does not allow for the splitting of CO at such low temperatures it suggests that there may be a less obvious pathway for the process. Through x-ray photoelectron spectroscopy we can clearly identify products associated with the dissociation of CO and the subsequent formation of stable graphitic carbon on the surface. However, the dissociation of CO can be inhibited when the stepped Cu surface is kept clean from surface carbon. These observations imply that the reaction is driven by the presence of small amounts of weakly bound carbon at the surface. Density-functional theory calculations confirm that carbon atoms on a stepped Cu surface indeed are the preferred adsorption sites for CO, which increases the stabilization of CO on the surface and weakens the C-O bond. This results in the breaking of the C-O bond at the step edge via the Boudouard reaction (2 COads→Cads+CO2 ) with a barrier of 0.71 eV.


    EPA Science Inventory

    Nitrotyrosination of a-Tubulin Induces Epithelial Transport Dysfunction. Yuh-Chin Huang, Lisa Dailey, Wen-Li Zhang and Ilona Jaspers. ORD, Environmental Protection Agency and CEMLB, University of North Carolina

    a-Tubulin undergoes a cyclic removal and readdition of tyrosin...

  20. Dielectric barrier discharge plasma induced degradation of aqueous atrazine.


    Feng, Jingwei; Jiang, Lin; Zhu, Dan; Su, Kuizu; Zhao, Dayong; Zhang, Jibiao; Zheng, Zheng


    Degradation of herbicide atrazine in aqueous solution was investigated using a plate type dielectric barrier discharge (DBD) plasma reactor. DBD plasma was generated at the gas-liquid interface of the formed water film. At discharge time of 14 min, atrazine was degradated effectively with a degradation rate of 99 % at the discharge power of 200 W. The experimental data fitted well with first-order kinetics and the energy efficiency for 90 % degradation of atrazine (G value) was calculated, obtaining a rate constant of 0.35 min(-1) and a G value of 1.27 × 10(-10) mol J(-1) (98.76 mg kW(-1) h(-1)) at a discharge power of 200 W, respectively. The addition of Fe(2+) increased the rate constant and G value dramatically, and a significant decrease of the rate constant and G value was observed with the addition of radical scavengers (tert-butyl alcohol, isopropyl alcohol, or Na2CO3). The generated aqueous O3 and H2O2 were determined, which promoted the degradation of herbicide atrazine. Dechlorination was observed and the experimentally detected Cl(-) was 1.52 mg L(-1) at a discharge time of 14 min. The degradation intermediates of atrazine were detected by means of liquid chromatography-mass spectrometry; dechlorination, hydroxylation, dealkylation, and alkyl oxidation processes were involved in the degradation pathways of atrazine.

  1. Atrial natriuretic peptide protects against Staphylococcus aureus-induced lung injury and endothelial barrier dysfunction

    PubMed Central

    Xing, Junjie; Moldobaeva, Nurgul


    Lung inflammation and alterations in endothelial cell (EC) permeability are key events to development of acute lung injury (ALI). Protective effects of atrial natriuretic peptide (ANP) have been shown against inflammatory signaling and endothelial barrier dysfunction induced by gram-negative bacterial wall liposaccharide. We hypothesized that ANP may possess more general protective effects and attenuate lung inflammation and EC barrier dysfunction by suppressing inflammatory cascades and barrier-disruptive mechanisms shared by gram-negative and gram-positive pathogens. C57BL/6J wild-type or ANP knockout mice (Nppa−/−) were treated with gram-positive bacterial cell wall compounds, Staphylococcus aureus-derived peptidoglycan (PepG) and/or lipoteichoic acid (LTA) (intratracheal, 2.5 mg/kg each), with or without ANP (intravenous, 2 μg/kg). In vitro, human pulmonary EC barrier properties were assessed by morphological analysis of gap formation and measurements of transendothelial electrical resistance. LTA and PepG markedly increased pulmonary EC permeability and activated p38 and ERK1/2 MAP kinases, NF-κB, and Rho/Rho kinase signaling. EC barrier dysfunction was further elevated upon combined LTA and PepG treatment, but abolished by ANP pretreatment. In vivo, LTA and PepG-induced accumulation of protein and cells in the bronchoalveolar lavage fluid, tissue neutrophil infiltration, and increased Evans blue extravasation in the lungs was significantly attenuated by intravenous injection of ANP. Accumulation of bronchoalveolar lavage markers of LTA/PepG-induced lung inflammation and barrier dysfunction was further augmented in ANP−/− mice and attenuated by exogenous ANP injection. These results strongly suggest a protective role of ANP in the in vitro and in vivo models of ALI associated with gram-positive infection. Thus ANP may have important implications in therapeutic strategies aimed at the treatment of sepsis and ALI-induced gram-positive bacterial

  2. Regulation of Thrombin-Induced Lung Endothelial Cell Barrier Disruption by Protein Kinase C Delta

    PubMed Central

    Xie, Lishi; Chiang, Eddie T.; Kelly, Gabriel T.; Kanteti, Prasad; Singleton, Patrick A.; Camp, Sara M.; Zhou, Tingting; Dudek, Steven M.; Natarajan, Viswanathan; Wang, Ting; Black, Steven M.; Garcia, Joe G. N.; Jacobson, Jeffrey R.


    Protein Kinase C (PKC) plays a significant role in thrombin-induced loss of endothelial cell (EC) barrier integrity; however, the existence of more than 10 isozymes of PKC and tissue–specific isoform expression has limited our understanding of this important second messenger in vascular homeostasis. In this study, we show that PKCδ isoform promotes thrombin-induced loss of human pulmonary artery EC barrier integrity, findings substantiated by PKCδ inhibitory studies (rottlerin), dominant negative PKCδ construct and PKCδ silencing (siRNA). In addition, we identified PKCδ as a signaling mediator upstream of both thrombin-induced MLC phosphorylation and Rho GTPase activation affecting stress fiber formation, cell contraction and loss of EC barrier integrity. Our inhibitor-based studies indicate that thrombin-induced PKCδ activation exerts a positive feedback on Rho GTPase activation and contributes to Rac1 GTPase inhibition. Moreover, PKD (or PKCμ) and CPI-17, two known PKCδ targets, were found to be activated by PKCδ in EC and served as modulators of cytoskeleton rearrangement. These studies clarify the role of PKCδ in EC cytoskeleton regulation, and highlight PKCδ as a therapeutic target in inflammatory lung disorders, characterized by the loss of barrier integrity, such as acute lung injury and sepsis. PMID:27442243

  3. Activation barrier scaling and crossover for noise-induced switching in micromechanical parametric oscillators.


    Chan, H B; Stambaugh, C


    We explore fluctuation-induced switching in parametrically driven micromechanical torsional oscillators. The oscillators possess one, two, or three stable attractors depending on the modulation frequency. Noise induces transitions between the coexisting attractors. Near the bifurcation points, the activation barriers are found to have a power law dependence on frequency detuning with critical exponents that are in agreement with predicted universal scaling relationships. At large detuning, we observe a crossover to a different power law dependence with an exponent that is device specific.

  4. High glucose induces dysfunction of airway epithelial barrier through down-regulation of connexin 43.


    Yu, Hongmei; Yang, Juan; Zhou, Xiangdong; Xiao, Qian; Lü, Yang; Xia, Li


    The airway epithelium is a barrier to the inhaled antigens and pathogens. Connexin 43 (Cx43) has been found to play critical role in maintaining the function of airway epithelial barrier and be involved in the pathogenesis of the diabetic retinal vasculature, diabetes nephropathy and diabetes skin. Hyperglycemia has been shown to be an independent risk factor for respiratory infections. We hypothesize that the down-regulation of Cx43 induced by HG alters the expression of tight junctions (zonula occludens-1 (ZO-1) and occludin) and contributes to dysfunction of airway epithelial barrier, and Cx43 plays a critical role in the process in human airway epithelial cells (16 HBE). We show that high glucose (HG) decreased the expression of ZO-1 and occludin, disassociated interaction between Cx43 and tight junctions, and then increased airway epithelial transepithelial electrical resistance (TER) and permeability by down-regulation of Cx43 in human airway epithelial cells. These observations demonstrate an important role for Cx43 in regulating HG-induced dysfunction of airway epithelial barrier. These findings may bring new insights into the molecular pathogenesis of pulmonary infection related to diabetes mellitus and lead to novel therapeutic intervention for the dysfunction of airway epithelial barrier in chronic inflammatory airway diseases.

  5. On the drain bias dependence of long-channel silicon-on-insulator-based tunnel field-effect transistors

    NASA Astrophysics Data System (ADS)

    Fukuda, Koichi; Mori, Takahiro; Asai, Hidehiro; Hattori, Junichi; Mizubayashi, Wataru; Morita, Yukinori; Fuketa, Hiroshi; Migita, Shinji; Ota, Hiroyuki; Masahara, Meishoku; Endo, Kazuhiko; Matsukawa, Takashi


    The drain bias dependence of tunnel field-effect transistors (TFETs) is examined on the basis of the measured characteristics and device simulation to understand the electrical behavior of TFETs. Our analyses focus on the long-channel silicon-on-insulator (SOI)-based TFETs as a good basis for further studies of short-channel effects, scaling issues, and more complicated device structures, such as multigate or nanowire TFETs. By device simulation, it is revealed that the drain bias dependence of the transfer characteristics of the measured TFETs is governed by two physical mechanisms: the density of states (DOS) occupancy factor, which depends on drain-to-source bias voltage, and channel electrostatic potential, which is limited by the drain bias through strong carrier accumulation. These mechanisms differ from the drain-induced barrier lowering (DIBL) of metal–oxide–semiconductor field-effect-transistors (MOSFETs), and cause a significant impact even in long-channel SOIs. Finally, the obtained insights are successfully implemented in a TFET compact model.

  6. Methamphetamine-induced nitric oxide promotes vesicular transport in blood-brain barrier endothelial cells.


    Martins, Tânia; Burgoyne, Thomas; Kenny, Bridget-Ann; Hudson, Natalie; Futter, Clare E; Ambrósio, António F; Silva, Ana P; Greenwood, John; Turowski, Patric


    Methamphetamine's (METH) neurotoxicity is thought to be in part due to its ability to induce blood-brain barrier (BBB) dysfunction. Here, we investigated the effect of METH on barrier properties of cultured rat primary brain microvascular endothelial cells (BMVECs). Transendothelial flux doubled in response to METH, irrespective of the size of tracer used. At the same time, transendothelial electrical resistance was unchanged as was the ultrastructural appearance of inter-endothelial junctions and the distribution of key junction proteins, suggesting that METH promoted vesicular but not junctional transport. Indeed, METH significantly increased uptake of horseradish peroxidase into vesicular structures. METH also enhanced transendothelial migration of lymphocytes indicating that the endothelial barrier against both molecules and cells was compromised. Barrier breakdown was only observed in response to METH at low micromolar concentrations, with enhanced vesicular uptake peaking at 1 μM METH. The BMVEC response to METH also involved rapid activation of endothelial nitric oxide synthase and its inhibition abrogated METH-induced permeability and lymphocyte migration, indicating that nitric oxide was a key mediator of BBB disruption in response to METH. This study underlines the key role of nitric oxide in BBB function and describes a novel mechanism of drug-induced fluid-phase transcytosis at the BBB.

  7. Fluticasone Induces Epithelial Injury and Alters Barrier Function in Normal Subjects

    PubMed Central

    MacRedmond, Ruth E.; Singhera, Gurpreet K.; Wadsworth, Samuel J.; Attridge, Susan; Bahzad, Mohammed; Williams, Kristy; Coxson, Harvey O.; White, Steven R.; Dorscheid, Delbert R.


    Objective The airway epithelium has a number of roles pivotal to the pathogenesis of asthma, including provision of a physical and immune barrier to the inhaled environment. Dysregulated injury and repair responses in asthma result in loss of airway epithelial integrity. Inhaled corticosteroids are a corner stone of asthma treatment. While effective in controlling asthma symptoms, they fail to prevent airway remodeling. Direct cytopathic effects on the airway epithelium may contribute to this. Methods This study examined the effects of a 4-week treatment regimen of inhaled fluticasone 500 μg twice daily in healthy human subjects. Induced sputum was collected for cell counts and markers of inflammation. Barrier function was examined by diethylenetriaminepentacetic acid (DTPA) clearance measured by nuclear scintillation scan, and albumin concentration in induced sputum. Results Steroid exposure resulted in epithelial injury as measured by a significant increase in the number of airway epithelial cells in induced sputum. There was no change in airway inflammation by induced sputum inflammatory cell counts or cytokine levels. Epithelial shedding was associated with an increase in barrier function, as measured by both a decrease in DTPA clearance and decreased albumin in induced sputum. This likely reflects the normal repair response. Conclusion Inhaled corticosteroids cause injury to normal airway epithelium. These effects warrant further evaluation in asthma, where the dysregulated repair response may contribute to airway remodeling. PMID:25324978

  8. Asef mediates HGF protective effects against LPS-induced lung injury and endothelial barrier dysfunction.


    Meng, Fanyong; Meliton, Angelo; Moldobaeva, Nurgul; Mutlu, Gokhan; Kawasaki, Yoshihiro; Akiyama, Tetsu; Birukova, Anna A


    Increased vascular endothelial permeability and inflammation are major pathological mechanisms of pulmonary edema and its life-threatening complication, the acute respiratory distress syndrome (ARDS). We have previously described potent protective effects of hepatocyte growth factor (HGF) against thrombin-induced hyperpermeability and identified the Rac pathway as a key mechanism of HGF-mediated endothelial barrier protection. However, anti-inflammatory effects of HGF are less understood. This study examined effects of HGF on the pulmonary endothelial cell (EC) inflammatory activation and barrier dysfunction caused by the gram-negative bacterial pathogen lipopolysaccharide (LPS). We tested involvement of the novel Rac-specific guanine nucleotide exchange factor Asef in the HGF anti-inflammatory effects. HGF protected the pulmonary EC monolayer against LPS-induced hyperpermeability, disruption of monolayer integrity, activation of NF-kB signaling, expression of adhesion molecules intercellular adhesion molecule-1 and vascular cell adhesion molecule-1, and production of IL-8. These effects were critically dependent on Asef. Small-interfering RNA-induced downregulation of Asef attenuated HGF protective effects against LPS-induced EC barrier failure. Protective effects of HGF against LPS-induced lung inflammation and vascular leak were also diminished in Asef knockout mice. Taken together, these results demonstrate potent anti-inflammatory effects by HGF and delineate a key role of Asef in the mediation of the HGF barrier protective and anti-inflammatory effects. Modulation of Asef activity may have important implications in therapeutic strategies aimed at the treatment of sepsis and acute lung injury/ARDS-induced gram-negative bacterial pathogens.

  9. Bacillus cereus induces permeability of an in vitro blood-retina barrier.


    Moyer, A L; Ramadan, R T; Thurman, J; Burroughs, A; Callegan, M C


    Most Bacillus cereus toxin production is controlled by the quorum-sensing-dependent, pleiotropic global regulator plcR, which contributes to the organism's virulence in the eye. The purpose of this study was to analyze the effects of B. cereus infection and plcR-regulated toxins on the barrier function of retinal pigment epithelium (RPE) cells, the primary cells of the blood-retina barrier. Human ARPE-19 cells were apically inoculated with wild-type or quorum-sensing-deficient B. cereus, and cytotoxicity was analyzed. plcR-regulated toxins were not required for B. cereus-induced RPE cytotoxicity, but these toxins did increase the rate of cell death, primarily by necrosis. B. cereus infection of polarized RPE cell monolayers resulted in increased barrier permeability, independent of plcR-regulated toxins. Loss of both occludin and ZO-1 expression occurred by 8 h postinfection, but alterations in tight junctions appeared to precede cytotoxicity. Of the several proinflammatory cytokines analyzed, only interleukin-6 was produced in response to B. cereus infection. These results demonstrate the deleterious effects of B. cereus infection on RPE barrier function and suggest that plcR-regulated toxins may not contribute significantly to RPE barrier permeability during infection.

  10. Influence of antioxidants on blood-brain barrier permeability during adrenaline-induced hypertension.


    Oztaş, B; Erkin, E; Dural, E; Isbir, T


    We have examined the effect of antioxidants (vitamin E, and selenium) on the blood-brain barrier permeability during adreneline-induced acute hypertension in the female rats. The rats supplemented with nontoxic doses of sodium selenite in drinking water for three months or vitamin E was given intraperitoneally before adrenaline-induced acute hypertension. Evans-blue was used as a blood-brain barrier tracer. Mean values for Evans-blue dye were found to be 0.28 +/- 0.04 microg/g tissue in control animals and 1.0 +/- 0.2 microg tissue after adrenaline-induced acute hypertension (p < .01). Rats pretreated with selenium or vitamin E also showed macroscopic leakage of Evans-blue albumin after adrenaline injection i.e., there was no significant difference in protein extravasation between untreated and treated animals (p > .5). The mean value for Evans-blue dye was found to be 1.0 +/- 0.2 microg/g tissue in acute hypertension group, 0.9 +/- 0.2 microg/g tissue in selenium pretreated animals and 1.0 +/- 0.2 micrg/g tissue vitamin E injected animals after acute hypertension. The results show that antioxidants did not influence the blood-brain barrier breakdown during adrenaline-induced acute hypertension.

  11. Minocycline ameliorates prenatal valproic acid induced autistic behaviour, biochemistry and blood brain barrier impairments in rats.


    Kumar, Hariom; Sharma, Bhupesh


    Autism is a neurodevelopment disorder. One percent worldwide population suffers with autism and males suffer more than females. Microglia plays an important role in neurodevelopment, neuropsychiatric and neurodegenerative disorders. The present study has been designed to investigate the role of minocycline in prenatal valproic acid induced autism in rats. Animals with prenatal valproic acid have reduced social interaction (three chamber social behaviour apparatus), spontaneous alteration (Y-Maze), exploratory activity (Hole board test), intestinal motility, serotonin levels (both in prefrontal cortex and ileum) and prefrontal cortex mitochondrial complex activity (complexes I, II, IV). Furthermore, prenatal valproic acid treated animals have shown an increase in locomotion (actophotometer), anxiety (elevated plus maze), brain oxidative stress (thiobarbituric acid reactive species, glutathione, catalase), nitrosative stress (nitrite/nitrate), inflammation (both in brain and ileum myeloperoxidase activity), calcium and blood brain barrier permeability. Treatment with minocycline significantly attenuated prenatal valproic acid induced reduction in social interaction, spontaneous alteration, exploratory activity intestinal motility, serotonin levels and prefrontal cortex mitochondrial complex activity. Furthermore, minocycline has also attenuated prenatal valproic acid induced increase in locomotion, anxiety, brain oxidative and nitrosative stress, inflammation, calcium and blood brain barrier permeability. Thus, it may be concluded that prenatal valproic acid has induced autistic behaviour, biochemistry and blood brain barrier impairment in animals, which were significantly attenuated by minocycline. Minocycline should be explored further for its therapeutic benefits in autism.

  12. The role of intrinsic apoptotic signaling in hemorrhagic shock-induced microvascular endothelial cell barrier dysfunction.


    Sawant, Devendra A; Tharakan, Binu; Hunter, Felicia A; Childs, Ed W


    Hemorrhagic shock leads to endothelial cell barrier dysfunction resulting in microvascular hyperpermeability. Hemorrhagic shock-induced microvascular hyperpermeability is associated with worse clinical outcomes in patients with traumatic injuries. The results from our laboratory have illustrated a possible pathophysiological mechanism showing involvement of mitochondria-mediated "intrinsic" apoptotic signaling in regulating hemorrhagic shock-induced microvascular hyperpermeability. Hemorrhagic shock results in overexpression of Bcl-2 family of pro-apoptotic protein, BAK, in the microvascular endothelial cells. The increase in BAK initiates "intrinsic" apoptotic signaling cascade with the release of mitochondrial cytochrome c in the cytoplasm and activation of downstream effector caspase-3, leading to loss of endothelial cell barrier integrity. Thus, this review article offers a brief overview of important findings from our past and present research work along with new leads for future research. The summary of our research work will provide information leading to different avenues in developing novel strategies against microvascular hyperpermeability following hemorrhagic shock.

  13. Cluster Model for Near-barrier Fusion Induced by Weakly Bound and Halo Nuclei

    SciTech Connect

    Beck, C.; Keeley, N.


    The influence on the fusion process of coupling transfer/breakup channels is investigated for the medium weight {sup 6,7}Li+{sup 59}Co systems in the vicinity of the Coulomb barrier. Coupling effects are discussed within a comparison of predictions of the Continuum Discretized Coupled-Channels model. Applications to {sup 6}He+{sup 59}Co induced by the borromean halo nucleus {sup 6}He are also proposed.

  14. Near-barrier Fusion Induced by Stable Weakly Bound and Exotic Halo Light Nuclei

    SciTech Connect

    Beck, C.; Zafra, A. Sanchez I.; Diaz-Torres, A.; Thompson, I. J.; Keeley, N.


    The effect of breakup is investigated for the medium weight 6Li+59Co system in the vicinity of the Coulomb barrier. The strong coupling of breakup/transfer channels to fusion is discussed within a comparison of predictions of the Continuum Discretized Coupled-Channels model which is also applied to 6He+59Co a reaction induced by the borromean halo nucleus 6He.

  15. Edge-induced Schottky barrier modulation at metal contacts to exfoliated molybdenum disulfide flakes

    NASA Astrophysics Data System (ADS)

    Nouchi, Ryo


    Ultrathin two-dimensional semiconductors obtained from layered transition-metal dichalcogenides such as molybdenum disulfide (MoS2) are promising for ultimately scaled transistors beyond Si. Although the shortening of the semiconductor channel is widely studied, the narrowing of the channel, which should also be important for scaling down the transistor, has been examined to a lesser degree thus far. In this study, the impact of narrowing on mechanically exfoliated MoS2 flakes was investigated according to the channel-width-dependent Schottky barrier heights at Cr/Au contacts. Narrower channels were found to possess a higher Schottky barrier height, which is ascribed to the edge-induced band bending in MoS2. The higher barrier heights degrade the transistor performance as a higher electrode-contact resistance. Theoretical analyses based on Poisson's equation showed that the edge-induced effect can be alleviated by a high dopant impurity concentration, but this strategy should be limited to channel widths of roughly 0.7 μm because of the impurity-induced charge-carrier mobility degradation. Therefore, proper termination of the dangling bonds at the edges should be necessary for aggressive scaling with layered semiconductors.

  16. Effects of drain doping concentration on switching characteristics of tunnel field-effect transistor inverters

    NASA Astrophysics Data System (ADS)

    Kwon, Dae Woong; Kim, Jang Hyun; Park, Byung-Gook


    In order to investigate the effects of the modulation of drain doping concentration (N drain) on alternating current (AC) switching characteristics of a tunnel filed-effect transistor (TFET) inverter, the characteristics of TFETs with various N drains are analyzed rigorously through mixed-mode device and circuit TCAD simulations. As the N drain gets decreased, the drain current (I D) becomes reduced and the gate-to-drain capacitance (C GD) reflects the entire gate capacitance (C GG) at a lower gate voltage (V G), which leads to the degradation of falling/rising delay in TFET inverters. These phenomena are explained successfully by the change of quasi-Fermi energy in the drain (E F_drain) as a function of V G. The E F_drain rises dramatically from when tunneling current starts to flow from the source in the n-type TFET with low N drain. As a result, drain-side channel inversion occurs at a lower V G due to the reduction of the energy barrier between the E F_drain and the conduction band edge of the channel.

  17. Gut microbiota facilitates dietary heme-induced epithelial hyperproliferation by opening the mucus barrier in colon

    PubMed Central

    Ijssennagger, Noortje; Belzer, Clara; Hooiveld, Guido J.; Dekker, Jan; van Mil, Saskia W. C.; Müller, Michael; Kleerebezem, Michiel; van der Meer, Roelof


    Colorectal cancer risk is associated with diets high in red meat. Heme, the pigment of red meat, induces cytotoxicity of colonic contents and elicits epithelial damage and compensatory hyperproliferation, leading to hyperplasia. Here we explore the possible causal role of the gut microbiota in heme-induced hyperproliferation. To this end, mice were fed a purified control or heme diet (0.5 μmol/g heme) with or without broad-spectrum antibiotics for 14 d. Heme-induced hyperproliferation was shown to depend on the presence of the gut microbiota, because hyperproliferation was completely eliminated by antibiotics, although heme-induced luminal cytotoxicity was sustained in these mice. Colon mucosa transcriptomics revealed that antibiotics block heme-induced differential expression of oncogenes, tumor suppressors, and cell turnover genes, implying that antibiotic treatment prevented the heme-dependent cytotoxic micelles to reach the epithelium. Our results indicate that this occurs because antibiotics reinforce the mucus barrier by eliminating sulfide-producing bacteria and mucin-degrading bacteria (e.g., Akkermansia). Sulfide potently reduces disulfide bonds and can drive mucin denaturation and microbial access to the mucus layer. This reduction results in formation of trisulfides that can be detected in vitro and in vivo. Therefore, trisulfides can serve as a novel marker of colonic mucolysis and thus as a proxy for mucus barrier reduction. In feces, antibiotics drastically decreased trisulfides but increased mucin polymers that can be lysed by sulfide. We conclude that the gut microbiota is required for heme-induced epithelial hyperproliferation and hyperplasia because of the capacity to reduce mucus barrier function. PMID:26216954

  18. Gut microbiota facilitates dietary heme-induced epithelial hyperproliferation by opening the mucus barrier in colon.


    Ijssennagger, Noortje; Belzer, Clara; Hooiveld, Guido J; Dekker, Jan; van Mil, Saskia W C; Müller, Michael; Kleerebezem, Michiel; van der Meer, Roelof


    Colorectal cancer risk is associated with diets high in red meat. Heme, the pigment of red meat, induces cytotoxicity of colonic contents and elicits epithelial damage and compensatory hyperproliferation, leading to hyperplasia. Here we explore the possible causal role of the gut microbiota in heme-induced hyperproliferation. To this end, mice were fed a purified control or heme diet (0.5 μmol/g heme) with or without broad-spectrum antibiotics for 14 d. Heme-induced hyperproliferation was shown to depend on the presence of the gut microbiota, because hyperproliferation was completely eliminated by antibiotics, although heme-induced luminal cytotoxicity was sustained in these mice. Colon mucosa transcriptomics revealed that antibiotics block heme-induced differential expression of oncogenes, tumor suppressors, and cell turnover genes, implying that antibiotic treatment prevented the heme-dependent cytotoxic micelles to reach the epithelium. Our results indicate that this occurs because antibiotics reinforce the mucus barrier by eliminating sulfide-producing bacteria and mucin-degrading bacteria (e.g., Akkermansia). Sulfide potently reduces disulfide bonds and can drive mucin denaturation and microbial access to the mucus layer. This reduction results in formation of trisulfides that can be detected in vitro and in vivo. Therefore, trisulfides can serve as a novel marker of colonic mucolysis and thus as a proxy for mucus barrier reduction. In feces, antibiotics drastically decreased trisulfides but increased mucin polymers that can be lysed by sulfide. We conclude that the gut microbiota is required for heme-induced epithelial hyperproliferation and hyperplasia because of the capacity to reduce mucus barrier function.

  19. Plumbing the brain drain.


    Saravia, Nancy Gore; Miranda, Juan Francisco


    Opportunity is the driving force of migration. Unsatisfied demands for higher education and skills, which have been created by the knowledge-based global economy, have generated unprecedented opportunities in knowledge-intensive service industries. These multi-trillion dollar industries include information, communication, finance, business, education and health. The leading industrialized nations are also the focal points of knowledge-intensive service industries and as such constitute centres of research and development activity that proactively draw in talented individuals worldwide through selective immigration policies, employment opportunities and targeted recruitment. Higher education is another major conduit of talent from less-developed countries to the centres of the knowledge-based global economy. Together career and educational opportunities drive "brain drain and recirculation". The departure of a large proportion of the most competent and innovative individuals from developing nations slows the achievement of the critical mass needed to generate the enabling context in which knowledge creation occurs. To favourably modify the asymmetric movement and distribution of global talent, developing countries must implement bold and creative strategies that are backed by national policies to: provide world-class educational opportunities, construct knowledge-based research and development industries, and sustainably finance the required investment for these strategies. Brazil, China and India have moved in this direction, offering world-class education in areas crucial to national development, such as biotechnology and information technology, paralleled by investments in research and development. As a result, only a small proportion of the most highly educated individuals migrate from these countries, and research and development opportunities employ national talent and even attract immigrants.

  20. Plumbing the brain drain.

    PubMed Central

    Saravia, Nancy Gore; Miranda, Juan Francisco


    Opportunity is the driving force of migration. Unsatisfied demands for higher education and skills, which have been created by the knowledge-based global economy, have generated unprecedented opportunities in knowledge-intensive service industries. These multi-trillion dollar industries include information, communication, finance, business, education and health. The leading industrialized nations are also the focal points of knowledge-intensive service industries and as such constitute centres of research and development activity that proactively draw in talented individuals worldwide through selective immigration policies, employment opportunities and targeted recruitment. Higher education is another major conduit of talent from less-developed countries to the centres of the knowledge-based global economy. Together career and educational opportunities drive "brain drain and recirculation". The departure of a large proportion of the most competent and innovative individuals from developing nations slows the achievement of the critical mass needed to generate the enabling context in which knowledge creation occurs. To favourably modify the asymmetric movement and distribution of global talent, developing countries must implement bold and creative strategies that are backed by national policies to: provide world-class educational opportunities, construct knowledge-based research and development industries, and sustainably finance the required investment for these strategies. Brazil, China and India have moved in this direction, offering world-class education in areas crucial to national development, such as biotechnology and information technology, paralleled by investments in research and development. As a result, only a small proportion of the most highly educated individuals migrate from these countries, and research and development opportunities employ national talent and even attract immigrants. PMID:15375451

  1. Lipopolysaccharide-induced pulmonary endothelial barrier disruption and lung edema: critical role for bicarbonate stimulation of AC10

    PubMed Central

    Nickols, Jordan; Obiako, Boniface; Ramila, K. C.; Putinta, Kevin; Schilling, Sarah


    Bacteria-induced sepsis is a common cause of pulmonary endothelial barrier dysfunction and can progress toward acute respiratory distress syndrome. Elevations in intracellular cAMP tightly regulate pulmonary endothelial barrier integrity; however, cAMP signals are highly compartmentalized: whether cAMP is barrier-protective or -disruptive depends on the compartment (plasma membrane or cytosol, respectively) in which the signal is generated. The mammalian soluble adenylyl cyclase isoform 10 (AC10) is uniquely stimulated by bicarbonate and is expressed in pulmonary microvascular endothelial cells (PMVECs). Elevated extracellular bicarbonate increases cAMP in PMVECs to disrupt the endothelial barrier and increase the filtration coefficient (Kf) in the isolated lung. We tested the hypothesis that sepsis-induced endothelial barrier disruption and increased permeability are dependent on extracellular bicarbonate and activation of AC10. Our findings reveal that LPS-induced endothelial barrier disruption is dependent on extracellular bicarbonate: LPS-induced barrier failure and increased permeability are exacerbated in elevated bicarbonate compared with low extracellular bicarbonate. The AC10 inhibitor KH7 attenuated the bicarbonate-dependent LPS-induced barrier disruption. In the isolated lung, LPS failed to increase Kf in the presence of minimal perfusate bicarbonate. An increase in perfusate bicarbonate to the physiological range (24 mM) revealed the LPS-induced increase in Kf, which was attenuated by KH7. Furthermore, in PMVECs treated with LPS for 6 h, there was a dose-dependent increase in AC10 expression. Thus these findings reveal that LPS-induced pulmonary endothelial barrier failure requires bicarbonate activation of AC10. PMID:26475732

  2. Cannabidiol attenuates high glucose-induced endothelial cell inflammatory response and barrier disruption.


    Rajesh, Mohanraj; Mukhopadhyay, Partha; Bátkai, Sándor; Haskó, György; Liaudet, Lucas; Drel, Viktor R; Obrosova, Irina G; Pacher, Pál


    A nonpsychoactive cannabinoid cannabidiol (CBD) has been shown to exert potent anti-inflammatory and antioxidant effects and has recently been reported to lower the incidence of diabetes in nonobese diabetic mice and to preserve the blood-retinal barrier in experimental diabetes. In this study we have investigated the effects of CBD on high glucose (HG)-induced, mitochondrial superoxide generation, NF-kappaB activation, nitrotyrosine formation, inducible nitric oxide synthase (iNOS) and adhesion molecules ICAM-1 and VCAM-1 expression, monocyte-endothelial adhesion, transendothelial migration of monocytes, and disruption of endothelial barrier function in human coronary artery endothelial cells (HCAECs). HG markedly increased mitochondrial superoxide generation (measured by flow cytometry using MitoSOX), NF-kappaB activation, nitrotyrosine formation, upregulation of iNOS and adhesion molecules ICAM-1 and VCAM-1, transendothelial migration of monocytes, and monocyte-endothelial adhesion in HCAECs. HG also decreased endothelial barrier function measured by increased permeability and diminished expression of vascular endothelial cadherin in HCAECs. Remarkably, all the above mentioned effects of HG were attenuated by CBD pretreatment. Since a disruption of the endothelial function and integrity by HG is a crucial early event underlying the development of various diabetic complications, our results suggest that CBD, which has recently been approved for the treatment of inflammation, pain, and spasticity associated with multiple sclerosis in humans, may have significant therapeutic benefits against diabetic complications and atherosclerosis.

  3. Pathogen induced chemo-attractant hepoxilin A3 drives neutrophils, but not eosinophils across epithelial barriers.


    Kubala, S A; Patil, S U; Shreffler, W G; Hurley, B P


    Pathogen induced migration of neutrophils across mucosal epithelial barriers requires epithelial production of the chemotactic lipid mediator, hepoxilin A3 (HXA3). HXA3 is an eicosanoid derived from arachidonic acid. Although eosinophils are also capable of penetrating mucosal surfaces, eosinophilic infiltration occurs mainly during allergic processes whereas neutrophils dominate mucosal infection. Both neutrophils and eosinophils can respond to chemotactic gradients of certain eicosanoids, however, it is not known whether eosinophils respond to pathogen induced lipid mediators such as HXA3. In this study, neutrophils and eosinophils were isolated from human blood and placed on the basolateral side of polarized epithelial monolayers grown on permeable Transwell filters and challenged by various chemotactic gradients of distinct lipid mediators. We observed that both cell populations migrated across epithelial monolayers in response to a leukotriene B4 (LTB4) gradient, whereas only eosinophils migrated toward a prostaglandin D2 (PGD2) gradient. Interestingly, while pathogen induced neutrophil trans-epithelial migration was substantial, pathogen induced eosinophil trans-epithelial migration was not observed. Further, gradients of chemotactic lipids derived from pathogen infected epithelial cells known to be enriched for HXA3 as well as purified HXA3 drove significant numbers of neutrophils across epithelial barriers, whereas eosinophils failed to respond to these gradients. These data suggest that although the eicosanoid HXA3 serves as an important neutrophil chemo-attractant at mucosal surfaces during pathogenic infection, HXA3 does not appear to exhibit chemotactic activity toward eosinophils.

  4. IL-25 induces both inflammation and skin barrier dysfunction in atopic dermatitis.


    Deleuran, Mette; Hvid, Malene; Kemp, Kaare; Christensen, Gitte B; Deleuran, Bent; Vestergaard, Christian


    Atopic dermatitis (AD) is a chronic relapsing skin disease characterized by having both an epidermal and a dermal component, shown as a barrier deficiency and inflammation. The mechanisms resulting in skewing the immune response in a Th2 direction in AD are still not fully elucidated. We suggest that IL-25 could be a major target in AD. IL-25 is produced by cells within the dermis of AD patients, and we suggest these to be dendritic cells (DCs). Furthermore, we show that IL-25 can inhibit filaggrin synthesis in keratinocytes. These results point towards a central role of IL-25 producing DCs that can induce both a Th2 response and inhibit filaggrin synthesis. We believe this strongly supports a role for IL-25 in AD, bridging the gap between inflammation and impaired skin barrier function.

  5. Effects of 2,4-dinitrophenol on ischemia-induced blood-brain barrier disruption.


    Ennis, S R; Keep, R F


    This study examines the effect of 2,4-dinitrophenol (DNP), a mitochondrial uncoupling agent, during focal brain ischemia induced by middle cerebral artery (MCA) occlusion. Blood-brain barrier (BBB) disruption was assessed after 2 hours of occlusion with 2 hours of reperfusion or 4 hours of permanent occlusion by measurement of the influx rate constant (K(i)) for 3H-inulin in the MCA territory ipsi- and contralateral to the occlusion. Three experimental groups were examined: vehicle and 1 and 5 mg/kg DNP treated animals (given 30 minutes prior to occlusion). Four hours of permanent MCA occlusion only induced a modest increase in the K(i) for inulin in vehicle-treated animals (0.09 +/- 0.01 vs. 0.07 +/- 0.01 microL/g/min in contralateral tissue). Although 5 mg/kg DNP significantly increased this disruption (p < 0.01), this effect was relatively minor (0.14 +/- 0.02 microL/g/min). In contrast, DNP treatment in transient ischemia markedly increased barrier disruption. The ipsilateral K(i) for 3H-inulin were 0.15 +/- 0.04, 0.37 +/- 0.06, and 0.79 +/- 0.17 microL/g/min in vehicle, 1 mg/kg DNP and 5 mg/kg DNP groups, respectively. DNP did not induce barrier disruption in the contralateral hemisphere. Thus, while there is evidence that DNP can be neuroprotective, it has adverse effects on the BBB during ischemia, particularly with reperfusion. Considering the importance of naturally- or therapeutically-induced reperfusion in limiting brain damage, this may limit the utility of DNP and mitochondrial uncouplers as therapeutic agents.

  6. Iloprost improves endothelial barrier function in lipopolysaccharide-induced lung injury.


    Birukova, Anna A; Wu, Tinghuai; Tian, Yufeng; Meliton, Angelo; Sarich, Nicolene; Tian, Xinyong; Leff, Alan; Birukov, Konstantin G


    The protective effects of prostacyclin and its stable analogue iloprost are mediated by elevation of intracellular cyclic AMP (cAMP) leading to enhancement of the peripheral actin cytoskeleton and cell-cell adhesive structures. This study tested the hypothesis that iloprost may exhibit protective effects against lung injury and endothelial barrier dysfunction induced by bacterial wall lipopolysaccharide (LPS). Endothelial barrier dysfunction was assessed by measurements of transendothelial permeability, morphologically and by analysis of LPS-activated inflammatory signalling. In vivo, C57BL/6J mice were challenged with LPS with or without iloprost or 8-bromoadenosine-3',5'-cyclic monophosphate (Br-cAMP) treatment. Lung injury was monitored by measurements of bronchoalveolar lavage protein content, cell count and Evans blue extravasation. Iloprost and Br-cAMP attenuated the disruption of the endothelial monolayer, and suppressed the activation of p38 mitogen-activated protein kinase (MAPK), the nuclear factor (NF)-κB pathway, Rho signalling, intercellular adhesion molecular (ICAM)-1 expression and neutrophil migration after LPS challenge. In vivo, iloprost was effective against LPS-induced protein and neutrophil accumulation in bronchoalveolar lavage fluid, and reduced myeloperoxidase activation, ICAM-1 expression and Evans blue extravasation in the lungs. Inhibition of Rac activity abolished the barrier-protective and anti-inflammatory effects of iloprost and Br-cAMP. Iloprost-induced elevation of intracellular cAMP triggers Rac signalling, which attenuates LPS-induced NF-κB and p38 MAPK inflammatory pathways and the Rho-dependent mechanism of endothelial permeability.

  7. IL17A impairs blood-testis barrier integrity and induces testicular inflammation.


    Pérez, Cecilia Valeria; Pellizzari, Eliana Herminia; Cigorraga, Selva Beatriz; Galardo, María Noel; Naito, Munekazu; Lustig, Livia; Jacobo, Patricia Verónica


    Experimental autoimmune orchitis is a useful model for studying testicular inflammation and germ/immune cell interactions. Th17 cells and their hallmark cytokine IL17A were reported to be involved in the development of autoimmune orchitis. The aim of the present work is to investigate the pathogenic role of IL17A in rat testis. In vitro experiments were performed in order to analyze effects of IL17A on Sertoli cell tight junctions. The addition of IL17A to normal rat Sertoli cell cultures induced a significant decline in transepithelial electrical resistance and a reduction of occludin expression and redistribution of occludin and claudin 11, altering the Sertoli cell tight junction barrier. Intratesticular injection of 1 μg of recombinant rat IL17A to Sprague-Dawley rats induced increased blood-testis barrier permeability, as shown by the presence of biotin tracer in the seminiferous tubule adluminal compartment, and delocalization of occludin and claudin 11. Results showed that IL17A induced focal inflammatory cell infiltration in the interstitium and germ cell sloughing in adjacent seminiferous tubules. Moreover, an increase in TUNEL+ apoptotic germ cells was also observed. Inflammatory ED1+ macrophages were the main population infiltrating the interstitium following IL17A injection. This correlated with an increase in mRNA expression of the monocyte chemoattractant protein Ccl2, its receptor Ccr2 and the vascular cell adhesion molecule Vcam1. Overall results suggest a relevant role of IL17A in the development of testicular inflammation, facilitating the recruitment of immune cells to the testicular interstitium and inducing impairment of blood-testis barrier function.

  8. Akt1 promotes stimuli-induced endothelial-barrier protection through FoxO-mediated tight-junction protein turnover.


    Gao, Fei; Artham, Sandeep; Sabbineni, Harika; Al-Azayzih, Ahmad; Peng, Xiao-Ding; Hay, Nissim; Adams, Ralf H; Byzova, Tatiana V; Somanath, Payaningal R


    Vascular permeability regulated by the vascular endothelial growth factor (VEGF) through endothelial-barrier junctions is essential for inflammation. Mechanisms regulating vascular permeability remain elusive. Although 'Akt' and 'Src' have been implicated in the endothelial-barrier regulation, it is puzzling how both agents that protect and disrupt the endothelial-barrier activate these kinases to reciprocally regulate vascular permeability. To delineate the role of Akt1 in endothelial-barrier regulation, we created endothelial-specific, tamoxifen-inducible Akt1 knockout mice and stable ShRNA-mediated Akt1 knockdown in human microvascular endothelial cells. Akt1 loss leads to decreased basal and angiopoietin1-induced endothelial-barrier resistance, and enhanced VEGF-induced endothelial-barrier breakdown. Endothelial Akt1 deficiency resulted in enhanced VEGF-induced vascular leakage in mice ears, which was rescued upon re-expression with Adeno-myrAkt1. Furthermore, co-treatment with angiopoietin1 reversed VEGF-induced vascular leakage in an Akt1-dependent manner. Mechanistically, our study revealed that while VEGF-induced short-term vascular permeability is independent of Akt1, its recovery is reliant on Akt1 and FoxO-mediated claudin expression. Pharmacological inhibition of FoxO transcription factors rescued the defective endothelial barrier due to Akt1 deficiency. Here we provide novel insights on the endothelial-barrier protective role of VEGF in the long term and the importance of Akt1-FoxO signaling on tight-junction stabilization and prevention of vascular leakage through claudin expression.

  9. Interactions between surface discharges induced by volume discharges in a dielectric barrier discharge system

    SciTech Connect

    Gao, Yenan; Dong, Lifang Zhao, Longhu; Wang, Yongjie; Pan, Yuyang; Li, Ben


    The interaction between micro-discharges involved in surface discharges (SDs) is studied in dielectric barrier discharge system. Instantaneous images taken by high speed cameras show that the SDs are induced by volume discharges (VDs). They cannot cross the midperpendicular of two neighbouring volume charges at low voltage while they stretch along it at high voltage, indicating that there is interaction between SDs. The differences of plasma parameters between SD and VD are studied by optical emission spectroscopy. The simulation of the electric fields of the wall charges accumulated by VD further confirms the existence of the interaction.

  10. Under-the-barrier dynamics in laser-induced relativistic tunneling.


    Klaiber, Michael; Yakaboylu, Enderalp; Bauke, Heiko; Hatsagortsyan, Karen Z; Keitel, Christoph H


    The tunneling dynamics in relativistic strong-field ionization is investigated with the aim to develop an intuitive picture for the relativistic tunneling regime. We demonstrate that the tunneling picture applies also in the relativistic regime by introducing position dependent energy levels. The quantum dynamics in the classically forbidden region features two time scales, the typical time that characterizes the probability density's decay of the ionizing electron under the barrier (Keldysh time) and the time interval which the electron spends inside the barrier (Eisenbud-Wigner-Smith tunneling time). In the relativistic regime, an electron momentum shift as well as a spatial shift along the laser propagation direction arise during the under-the-barrier motion which are caused by the laser magnetic field induced Lorentz force. The momentum shift is proportional to the Keldysh time, while the wave-packet's spatial drift is proportional to the Eisenbud-Wigner-Smith time. The signature of the momentum shift is shown to be present in the ionization spectrum at the detector and, therefore, observable experimentally. In contrast, the signature of the Eisenbud-Wigner-Smith time delay disappears at far distances for pure quasistatic tunneling dynamics.

  11. Pitch glide effect induced by a nonlinear string-barrier interaction

    NASA Astrophysics Data System (ADS)

    Kartofelev, Dmitri; Stulov, Anatoli; Välimäki, Vesa


    Interactions of a vibrating string with its supports and other spatially distributed barriers play a significant role in the physics of many stringed musical instruments. It is well known that the tone of the string vibrations is determined by the string supports, and that the boundary conditions of the string termination may cause a short-lasting initial fundamental frequency shifting. Generally, this phenomenon is associated with the nonlinear modulation of the stiff string tension. The aim of this paper is to study the initial frequency glide phenomenon that is induced only by the string-barrier interaction, apart from other possible physical causes, and without the interfering effects of dissipation and dispersion. From a numerical simulation perspective, this highly nonlinear problem may present various difficulties, not the least of which is the risk of numerical instability. We propose a numerically stable and a purely kinematic model of the string-barrier interaction, which is based on the travelling wave solution of the ideal string vibration. The model is capable of reproducing the motion of the vibrating string exhibiting the initial fundamental frequency glide, which is caused solely by the complex nonlinear interaction of the string with its termination. The results presented in this paper can expand our knowledge and understanding of the timbre evolution and the physical principles of sound generation of numerous stringed instruments, such as lutes called the tambura, sitar and biwa.

  12. Sign preference in ion-induced nucleation: contributions to the free energy barrier.


    Keasler, Samuel J; Kim, Hyunmi; Chen, Bin


    We have performed a series of computer simulations using the AVUS-HR approach to better understand the origin of the sign preference in ion-induced nucleation. In particular, we emphasize the importance of distinguishing between the total formation free energy of a cluster, and the nucleation free energy, which involves only those steps contributing to the free energy barrier. We have separately considered how the ion-water potential energy, the water-water potential energy, and the entropy contribute to both the cluster formation free energy, and the nucleation free energy. These simulations have shown that while the ion-water potential energies make the largest contribution to the formation free energy difference between positive and negative ions, the entropy is the contribution leading to lower nucleation free energy barriers for negative ions. The primary reason for this is the larger stable (but precritical) clusters formed around negative ions. We have further shown that the distinction between formation and nucleation free energies is of particular importance when comparing small cations with larger anions where the formation free energies can be much lower for the cationic clusters, even though the nucleation barriers are lower for the anionic clusters.

  13. Neuromodulation accompanying focused ultrasound-induced blood-brain barrier opening.


    Chu, Po-Chun; Liu, Hao-Li; Lai, Hsin-Yi; Lin, Chung-Yin; Tsai, Hong-Chieh; Pei, Yu-Cheng


    Burst-mode focused ultrasound (FUS) induces microbubble cavitation in the vasculature and temporarily disrupts the blood-brain barrier (BBB) to enable therapeutic agent delivery. However, it remains unclear whether FUS-induced BBB opening is accompanied by neuromodulation. Here we characterized the functional effects of FUS-induced BBB opening by measuring changes in somatosensory evoked potentials (SSEPs) and blood-oxygen-level dependent (BOLD) responses. Rats underwent burst-mode FUS (mechanical index (MI) of 0.3, 0.55 or 0.8) to the forelimb region in the left primary somatosensory cortex to induce BBB opening. Longitudinal measurements were followed for up to 1 week to characterize the temporal dynamics of neuromodulation. We observed that 0.8-MI FUS profoundly suppressed SSEP amplitude and prolonged latency, and this effect lasted 7 days. 0.55-MI FUS resulted in minimal and short-term suppression of SSEP for less than 60 minutes and didn't affect latency. BOLD responses were also suppressed in an MI-dependent manner, mirroring the effect on SSEPs. Furthermore, repetitive delivery of 0.55-MI FUS every 3 days elicited no accumulative effects on SSEPs or tissue integrity. This is the first evidence that FUS-induced BBB opening is accompanied by reversible changes in neuron responses, and may provide valuable insight toward the development of FUS-induced BBB opening for clinical applications.

  14. Neuromodulation accompanying focused ultrasound-induced blood-brain barrier opening

    PubMed Central

    Chu, Po-Chun; Liu, Hao-Li; Lai, Hsin-Yi; Lin, Chung-Yin; Tsai, Hong-Chieh; Pei, Yu-Cheng


    Burst-mode focused ultrasound (FUS) induces microbubble cavitation in the vasculature and temporarily disrupts the blood-brain barrier (BBB) to enable therapeutic agent delivery. However, it remains unclear whether FUS-induced BBB opening is accompanied by neuromodulation. Here we characterized the functional effects of FUS-induced BBB opening by measuring changes in somatosensory evoked potentials (SSEPs) and blood-oxygen-level dependent (BOLD) responses. Rats underwent burst-mode FUS (mechanical index (MI) of 0.3, 0.55 or 0.8) to the forelimb region in the left primary somatosensory cortex to induce BBB opening. Longitudinal measurements were followed for up to 1 week to characterize the temporal dynamics of neuromodulation. We observed that 0.8-MI FUS profoundly suppressed SSEP amplitude and prolonged latency, and this effect lasted 7 days. 0.55-MI FUS resulted in minimal and short-term suppression of SSEP for less than 60 minutes and didn’t affect latency. BOLD responses were also suppressed in an MI-dependent manner, mirroring the effect on SSEPs. Furthermore, repetitive delivery of 0.55-MI FUS every 3 days elicited no accumulative effects on SSEPs or tissue integrity. This is the first evidence that FUS-induced BBB opening is accompanied by reversible changes in neuron responses, and may provide valuable insight toward the development of FUS-induced BBB opening for clinical applications. PMID:26490653

  15. Topical application of TRPM8 agonists accelerates skin permeability barrier recovery and reduces epidermal proliferation induced by barrier insult: role of cold-sensitive TRP receptors in epidermal permeability barrier homoeostasis.


    Denda, Mitsuhiro; Tsutsumi, Moe; Denda, Sumiko


    TRPA1 and TRPM8 receptors are activated at low temperature (A1: below 17 degrees C and M8: below 22 degrees C). Recently, we observed that low temperature (below 22 degrees C) induced elevation of intracellular calcium in keratinocytes. Moreover, we demonstrated that topical application of TRPA1 agonists accelerated the recovery of epidermal permeability barrier function after disruption. In this study, we examined the effect of topical application of TRPM8 modulators on epidermal permeability barrier homoeostasis. Immunohistochemical study and RT-PCR confirmed the expression of TRPM8 or TRPM8-like protein in epidermal keratinocytes. Topical application of TRPM8 agonists, menthol and WS 12 accelerated barrier recovery after tape stripping. The effect of WS12 was blocked by a non-selective TRP antagonist, Ruthenium Red, and a TRPM8-specific antagonist, BTCT. Topical application of WS12 also reduced epidermal proliferation associated with barrier disruption under low humidity, and this effect was blocked by BTCT. Our results indicate that TRPM8 or a closely related protein in epidermal keratinocytes plays a role in epidermal permeability barrier homoeostasis and epidermal proliferation after barrier insult.

  16. Effect of channel widths on negative shift of threshold voltage, including stress-induced hump phenomenon in InGaZnO thin-film transistors under high-gate and drain bias stress

    NASA Astrophysics Data System (ADS)

    Choi, Sung-Hwan; Han, Min-Koo


    We investigated the degradation of indium-gallium-zinc-oxide (IGZO) thin-film transistors (TFTs) for various channel widths under high-gate and drain bias stress. The threshold voltage of IGZO TFT with wide-channel width (W > 100 μm) was significantly shifted. This included stress-induced hump-effect in a negative direction after the stress, whereas IGZO TFT with narrow-channel width (W < 100 μm) shifted in a positive direction. This phenomenon may be attributed to the hole trapping into the back-interface region. In order to enhance the reliability of IGZO TFTs, we developed and verified that the multiple-channel device showed better bias-temperature stability (ΔVTH: -0.1 V), whereas the single-channel device exhibited a -0.4 VΔVTH shift.

  17. Dephosphorylation of Y685-VE-Cadherin Involved in Pulmonary Microvascular Endothelial Barrier Injury Induced by Angiotensin II.


    Wu, Zhiyong; Wang, Zhiwei; Dai, Feifeng; Liu, Huagang; Ren, Wei; Chang, Jinxing; Li, Bowen


    Angiotensin II (AngII) caused pulmonary microvascular endothelial barrier injury, which induced acute aortic dissection (AAD) combined with acute lung injury (ALI). However, the exact mechanism is unclear. We investigated the role of dephosphorylation of Y685-VE-cadherin in the AngII induced pulmonary microvascular endothelial barrier injury. Mice or pulmonary microvascular endothelial cells (PMVECs) were divided into control group, AngII group, AngII+PP2 (Src kinase inhibitor) group, and PP2 group. PP2 was used to inhibit the phosphorylation of Y685-VE-cadherin. Pathological changes, infiltration of macrophages and neutrophils, and pulmonary microvascular permeability were used to determine the pulmonary microvascular endothelial barrier function. Flow cytometry was used to determine the apoptosis of PMVECs, and immunofluorescence was used to determine the skeletal arrangement. Transendothelial resistance was used to detect the permeability of endothelial barrier. Phosphorylation of Y685-VE-cadherin was significantly reduced after AngII stimulation (P < 0.05), together with skeletal rearrangement, and elevation of endothelial permeability which finally induced endothelial barrier injury. After PP2 interference, the phosphorylation of Y685-VE-cadherin was further reduced and the endothelial permeability was further elevated. These data indicated that AngII could induce pulmonary injury by triggering endothelial barrier injury, and such process may be related to the dephosphorylation of Y685-VE-cadherin and the endothelial skeletal rearrangement.

  18. Dephosphorylation of Y685-VE-Cadherin Involved in Pulmonary Microvascular Endothelial Barrier Injury Induced by Angiotensin II

    PubMed Central

    Wang, Zhiwei; Dai, Feifeng; Liu, Huagang; Ren, Wei; Chang, Jinxing; Li, Bowen


    Angiotensin II (AngII) caused pulmonary microvascular endothelial barrier injury, which induced acute aortic dissection (AAD) combined with acute lung injury (ALI). However, the exact mechanism is unclear. We investigated the role of dephosphorylation of Y685-VE-cadherin in the AngII induced pulmonary microvascular endothelial barrier injury. Mice or pulmonary microvascular endothelial cells (PMVECs) were divided into control group, AngII group, AngII+PP2 (Src kinase inhibitor) group, and PP2 group. PP2 was used to inhibit the phosphorylation of Y685-VE-cadherin. Pathological changes, infiltration of macrophages and neutrophils, and pulmonary microvascular permeability were used to determine the pulmonary microvascular endothelial barrier function. Flow cytometry was used to determine the apoptosis of PMVECs, and immunofluorescence was used to determine the skeletal arrangement. Transendothelial resistance was used to detect the permeability of endothelial barrier. Phosphorylation of Y685-VE-cadherin was significantly reduced after AngII stimulation (P < 0.05), together with skeletal rearrangement, and elevation of endothelial permeability which finally induced endothelial barrier injury. After PP2 interference, the phosphorylation of Y685-VE-cadherin was further reduced and the endothelial permeability was further elevated. These data indicated that AngII could induce pulmonary injury by triggering endothelial barrier injury, and such process may be related to the dephosphorylation of Y685-VE-cadherin and the endothelial skeletal rearrangement. PMID:28119542

  19. Restraint Stress-Induced Morphological Changes at the Blood-Brain Barrier in Adult Rats

    PubMed Central

    Sántha, Petra; Veszelka, Szilvia; Hoyk, Zsófia; Mészáros, Mária; Walter, Fruzsina R.; Tóth, Andrea E.; Kiss, Lóránd; Kincses, András; Oláh, Zita; Seprényi, György; Rákhely, Gábor; Dér, András; Pákáski, Magdolna; Kálmán, János; Kittel, Ágnes; Deli, Mária A.


    Stress is well-known to contribute to the development of both neurological and psychiatric diseases. While the role of the blood-brain barrier is increasingly recognized in the development of neurodegenerative disorders, such as Alzheimer's disease, dysfunction of the blood-brain barrier has been linked to stress-related psychiatric diseases only recently. In the present study the effects of restraint stress with different duration (1, 3, and 21 days) were investigated on the morphology of the blood-brain barrier in male adult Wistar rats. Frontal cortex and hippocampus sections were immunostained for markers of brain endothelial cells (claudin-5, occluding, and glucose transporter-1) and astroglia (GFAP). Staining pattern and intensity were visualized by confocal microscopy and evaluated by several types of image analysis. The ultrastructure of brain capillaries was investigated by electron microscopy. Morphological changes and intensity alterations in brain endothelial tight junction proteins claudin-5 and occludin were induced by stress. Following restraint stress significant increases in the fluorescence intensity of glucose transporter-1 were detected in brain endothelial cells in the frontal cortex and hippocampus. Significant reductions in GFAP fluorescence intensity were observed in the frontal cortex in all stress groups. As observed by electron microscopy, 1-day acute stress induced morphological changes indicating damage in capillary endothelial cells in both brain regions. After 21 days of stress thicker and irregular capillary basal membranes in the hippocampus and edema in astrocytes in both regions were seen. These findings indicate that stress exerts time-dependent changes in the staining pattern of tight junction proteins occludin, claudin-5, and glucose transporter-1 at the level of brain capillaries and in the ultrastructure of brain endothelial cells and astroglial endfeet, which may contribute to neurodegenerative processes, cognitive and

  20. Cross sections and barriers for nuclear fission induced by high-energy nucleons

    SciTech Connect

    Grudzevich, O. T.; Yavshits, S. G.


    The cross sections for the fission of {sup 232}Th, {sup 235,238}U, {sup 237}Np, and {sup 239}Pu target nuclei that was induced by 20- to 1000-MeV neutrons and protons were calculated. The respective calculations were based on the multiconfiguration-fission (MCFx) model, which was used to describe three basic stages of the interaction of high-energy nucleons with nuclei: direct processes (intranuclear cascade), equilibration of the emerging compound system, and the decay of the compound nucleus (statistical model). Fission barriers were calculated within the microscopic approach for isotopic chains formed by 15 to 20 nuclei of the required elements. The calculated fission cross sections were compared with available experimental data. It was shown that the input data set and the theoretical model used made it possible to predict satisfactorily cross section for nuclear fission induced by 20- to 1000-MeV nucleons.

  1. Non-thermal dielectric-barrier discharge plasma damages human keratinocytes by inducing oxidative stress.


    Kim, Ki Cheon; Piao, Mei Jing; Madduma Hewage, Susara Ruwan Kumara; Han, Xia; Kang, Kyoung Ah; Jo, Jin Oh; Mok, Young Sun; Shin, Jennifer H; Park, Yeunsoo; Yoo, Suk Jae; Hyun, Jin Won


    The aim of this study was to identify the mechanisms through which dielectric-barrier discharge plasma damages human keratinocytes (HaCaT cells) through the induction of oxidative stress. For this purpose, the cells were exposed to surface dielectric-barrier discharge plasma in 70% oxygen and 30% argon. We noted that cell viability was decreased following exposure of the cells to plasma in a time-dependent manner, as shown by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. The levels of intracellular reactive oxygen species (ROS) were determined using 2',7'-dichlorodihydrofluorescein diacetate and dihydroethidium was used to monitor superoxide anion production. Plasma induced the generation of ROS, including superoxide anions, hydrogen peroxide and hydroxyl radicals. N-acetyl cysteine, which is an antioxidant, prevented the decrease in cell viability caused by exposure to plasma. ROS generated by exposure to plasma resulted in damage to various cellular components, including lipid membrane peroxidation, DNA breaks and protein carbonylation, which was detected by measuring the levels of 8-isoprostane and diphenyl-1-pyrenylphosphine assay, comet assay and protein carbonyl formation. These results suggest that plasma exerts cytotoxic effects by causing oxidative stress-induced damage to cellular components.

  2. Stress Induces Endotoxemia and Low-Grade Inflammation by Increasing Barrier Permeability

    PubMed Central

    de Punder, Karin; Pruimboom, Leo


    Chronic non-communicable diseases (NCDs) are the leading causes of work absence, disability, and mortality worldwide. Most of these diseases are associated with low-grade inflammation. Here, we hypothesize that stresses (defined as homeostatic disturbances) can induce low-grade inflammation by increasing the availability of water, sodium, and energy-rich substances to meet the increased metabolic demand induced by the stressor. One way of triggering low-grade inflammation is by increasing intestinal barrier permeability through activation of various components of the stress system. Although beneficial to meet the demands necessary during stress, increased intestinal barrier permeability also raises the possibility of the translocation of bacteria and their toxins across the intestinal lumen into the blood circulation. In combination with modern life-style factors, the increase in bacteria/bacterial toxin translocation arising from a more permeable intestinal wall causes a low-grade inflammatory state. We support this hypothesis with numerous studies finding associations with NCDs and markers of endotoxemia, suggesting that this process plays a pivotal and perhaps even a causal role in the development of low-grade inflammation and its related diseases. PMID:26029209

  3. Non-thermal dielectric-barrier discharge plasma damages human keratinocytes by inducing oxidative stress

    PubMed Central



    The aim of this study was to identify the mechanisms through which dielectric-barrier discharge plasma damages human keratinocytes (HaCaT cells) through the induction of oxidative stress. For this purpose, the cells were exposed to surface dielectric-barrier discharge plasma in 70% oxygen and 30% argon. We noted that cell viability was decreased following exposure of the cells to plasma in a time-dependent manner, as shown by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. The levels of intracellular reactive oxygen species (ROS) were determined using 2′,7′-dichlorodihydro-fluorescein diacetate and dihydroethidium was used to monitor superoxide anion production. Plasma induced the generation of ROS, including superoxide anions, hydrogen peroxide and hydroxyl radicals. N-acetyl cysteine, which is an antioxidant, prevented the decrease in cell viability caused by exposure to plasma. ROS generated by exposure to plasma resulted in damage to various cellular components, including lipid membrane peroxidation, DNA breaks and protein carbonylation, which was detected by measuring the levels of 8-isoprostane and diphenyl-1-pyrenylphosphine assay, comet assay and protein carbonyl formation. These results suggest that plasma exerts cytotoxic effects by causing oxidative stress-induced damage to cellular components. PMID:26573561

  4. Blood-ocular and blood-brain barrier function in streptozocin-induced diabetes in rats

    SciTech Connect

    Maeepea, O.; Karlsson, C.; Alm, A.


    Edetic acid labeled with chromium 51 was injected intravenously in normal rats and in rats with streptozocin-induced diabetes. One hour after the injection the animals were killed and the concentrations of edetic acid 51Cr in vitreous body, retina, and brain were determined. No significant difference was observed between the two groups for either tissue. In a second series, a mixture of tritiated 1-glucose and aminohippuric acid tagged with carbon 14 was injected instead of edetic acid. A substantial accumulation of aminohippuric acid 14C compared with tritiated 1-glucose was observed in the vitreous body and the brain of diabetic rats in comparison with the control group. It is concluded that untreated streptozocin-induced diabetes in rats for one to two weeks will not cause a generalized increase in the permeability of the blood-ocular or the blood-brain barriers, but organic acids may accumulate in the vitreous body as well as in the brain as a consequence of reduced outward transport through these barriers.

  5. Listeriolysin O affects barrier function and induces chloride secretion in HT-29/B6 colon epithelial cells.


    Richter, Jan F; Gitter, Alfred H; Günzel, Dorothee; Weiss, Siegfried; Mohamed, Walid; Chakraborty, Trinad; Fromm, Michael; Schulzke, Jörg D


    Listeria monocytogenes is a food-borne pathogen, which is able to induce diarrhea when residing in the intestine. We studied the effect of listeriolysin O (LLO), an extracellular virulence factor of L. monocytogenes, on intestinal transport and barrier function in monolayers of HT-29/B6 human colon cells using the Ussing technique to understand the pathomechanisms involved. Mucosal addition of LLO, but not a LLO mutant, induced a dose- and pH-dependent increase in short-circuit current (I(SC)). Sodium and chloride tracer flux and DIDS sensitivity studies revealed that I(SC) was mainly due to electrogenic chloride secretion. Barrier function was impaired by LLO, as assessed by transepithelial resistance (R(t)) and mannitol flux measurements. Intracellular signal transduction occurred through Ca(2+) release from intracellular stores and PKC activation. In conclusion, listeriolysin induces chloride secretion and perturbs epithelial barrier function, thus potentially contributing to Listeria-induced diarrhea.

  6. ADAM12 and ADAM17 are essential molecules for hypoxia-induced impairment of neural vascular barrier function

    PubMed Central

    Cui, Dan; Arima, Mitsuru; Takubo, Keiyo; Kimura, Tokuhiro; Horiuchi, Keisuke; Minagawa, Takuya; Matsuda, Satoshi; Ikeda, Eiji


    Neural vascular barrier is essential for the life of multicellular organisms, and its impairment by tissue hypoxia is known to be a central of pathophysiology accelerating the progression of various intractable neural diseases. Therefore, the molecules involved in hypoxia-induced impairment of vascular barrier can be the targets to establish new therapies for intractable diseases. Here, we demonstrate that a disintegrin and metalloproteinases (ADAMs) 12 and 17 expressed in endothelial cells are the molecules responsible for the impairment of neural vascular barrier by hypoxia. Brain microvascular endothelial cells in vitro lost their barrier properties immediately after hypoxic stimulation through diminished localization of claudin-5, a tight junction molecule, on cell membranes. Hypoxic disappearance of claudin-5 from cell membranes and the consequent loss of barrier properties were completely suppressed by inhibition of the metalloproteinase activity which was found to be attributed to ADAM12 and ADAM17. Inhibition of either ADAM12 or ADAM17 was sufficient to rescue the in vivo neural vasculature under hypoxia from the loss of barrier function. This is the first report to specify the molecules which are responsible for hypoxia-induced impairment of neural vascular barrier and furthermore can be the targets of new therapeutic strategies for intractable neural diseases. PMID:26242473

  7. ADAM12 and ADAM17 are essential molecules for hypoxia-induced impairment of neural vascular barrier function.


    Cui, Dan; Arima, Mitsuru; Takubo, Keiyo; Kimura, Tokuhiro; Horiuchi, Keisuke; Minagawa, Takuya; Matsuda, Satoshi; Ikeda, Eiji


    Neural vascular barrier is essential for the life of multicellular organisms, and its impairment by tissue hypoxia is known to be a central of pathophysiology accelerating the progression of various intractable neural diseases. Therefore, the molecules involved in hypoxia-induced impairment of vascular barrier can be the targets to establish new therapies for intractable diseases. Here, we demonstrate that a disintegrin and metalloproteinases (ADAMs) 12 and 17 expressed in endothelial cells are the molecules responsible for the impairment of neural vascular barrier by hypoxia. Brain microvascular endothelial cells in vitro lost their barrier properties immediately after hypoxic stimulation through diminished localization of claudin-5, a tight junction molecule, on cell membranes. Hypoxic disappearance of claudin-5 from cell membranes and the consequent loss of barrier properties were completely suppressed by inhibition of the metalloproteinase activity which was found to be attributed to ADAM12 and ADAM17. Inhibition of either ADAM12 or ADAM17 was sufficient to rescue the in vivo neural vasculature under hypoxia from the loss of barrier function. This is the first report to specify the molecules which are responsible for hypoxia-induced impairment of neural vascular barrier and furthermore can be the targets of new therapeutic strategies for intractable neural diseases.

  8. Effects of solvent on TMP photophysics. Transition from no barrier to barrier case, induced by solvent properties

    NASA Astrophysics Data System (ADS)

    Sundström, Villy; Gillbro, Tomas


    The dynamics of the radiationless relaxation of triphenylmethane (TPM) molecules in the n-alcohols methanol to octadecanol have been studied with picosecond absorption recovery techniques as a function of viscosity, temperature, and wavelength of the exciting and analyzing light. It is shown that the solvent dependence of the relaxation rate in TPM molecules cannot, as is usually done, be described by a viscosity dependence only. In going through the n-alcohol series the excited state potential surface changes from a practically flat one (E0=0) in methanol to a surface having a definitive potential barrier (E0≊15 kJ mol-1) in the higher alcohols. This variation of the potential surface implies that the relaxation is largely controlled by rotational diffusion in methanol and ethanol whereas it is mainly controlled by the potential barrier in the higher alcohols. When the viscosity dependence of the relaxation rate is obtained, by compensating for the contribution from the potential barrier, a turnover behavior such as that predicted by activated barrier crossing theories, is observed. We have fitted the expression of Skinner and Wolynes [J. Chem. Phys. 69, 2143 (1978)] to our experimental results in the solvents where a barrier exists, and obtain a frequency of 550 cm-1 at both the well and the top of the potential. The fit is consistent with a friction that is lower than that corresponding to hydrodynamic slip boundary conditions. A decrease in solute-solvent friction relative the hydrodynamic value is also observed in going from small to large solvent molecules. This effect is attributed to a decreasing solute/solvent molecular volume ratio and to the structure of the TPM molecule which could prevent large solvent molecules from coming into close contact with the relaxing groups. In addition to these features we discuss the wavelength dependence and previously suggested change from single- to bi- and multiexponential decay of the relaxation kinetics. The

  9. No drain, autologous transfusion drain or suction drain? A randomised prospective study in total hip replacement surgery of 168 patients.


    Cheung, Graham; Carmont, Michael R; Bing, Andrew J F; Kuiper, Jan-Herman; Alcock, Robert J; Graham, Niall M


    We performed a prospective, randomised controlled trial to assess the differences in the use of a conventional suction drain, an Autologous Blood Transfusion (ABT) drain and no drain, in 168 patients. There was no significant difference between the drainage from ABT drains ( mean : 345 ml) and the suction drain (314 ml). Forty percent of patients receiving a suction drain had a haemoglobin level less than 10 g/dL at 24 hours, compared to 35% with no drain and 28% with an ABT drain. Patients that had no drains had wounds that were dry significantly sooner, mean 3.0 days compared to a mean of 3.9 days with an ABT drain and a mean of 4 days with a suction drain. Patients that did not have a drain inserted stayed in hospital a significantly shorter period of time, compared with drains. We feel the benefits of quicker drying wounds, shorter hospital stays and the economic savings justify the conclusion that no drain is required after hip replacement.

  10. Quantification of storm-induced bathymetric change in a back-barrier estuary

    USGS Publications Warehouse

    Ganju, Neil K.; Suttles, Steven E.; Beudin, Alexis; Nowacki, Daniel; Miselis, Jennifer L.; Andrews, Brian D.


    Geomorphology is a fundamental control on ecological and economic function of estuaries. However, relative to open coasts, there has been little quantification of storm-induced bathymetric change in back-barrier estuaries. Vessel-based and airborne bathymetric mapping can cover large areas quickly, but change detection is difficult because measurement errors can be larger than the actual changes over the storm timescale. We quantified storm-induced bathymetric changes at several locations in Chincoteague Bay, Maryland/Virginia, over the August 2014 to July 2015 period using fixed, downward-looking altimeters and numerical modeling. At sand-dominated shoal sites, measurements showed storm-induced changes on the order of 5 cm, with variability related to stress magnitude and wind direction. Numerical modeling indicates that the predominantly northeasterly wind direction in the fall and winter promotes southwest-directed sediment transport, causing erosion of the northern face of sandy shoals; southwesterly winds in the spring and summer lead to the opposite trend. Our results suggest that storm-induced estuarine bathymetric change magnitudes are often smaller than those detectable with methods such as LiDAR. More precise fixed-sensor methods have the ability to elucidate the geomorphic processes responsible for modulating estuarine bathymetry on the event and seasonal timescale, but are limited spatially. Numerical modeling enables interpretation of broad-scale geomorphic processes and can be used to infer the long-term trajectory of estuarine bathymetric change due to episodic events, when informed by fixed-sensor methods.

  11. Controlled ultrasound-induced blood-brain barrier disruption using passive acoustic emissions monitoring.


    Arvanitis, Costas D; Livingstone, Margaret S; Vykhodtseva, Natalia; McDannold, Nathan


    The ability of ultrasonically-induced oscillations of circulating microbubbles to permeabilize vascular barriers such as the blood-brain barrier (BBB) holds great promise for noninvasive targeted drug delivery. A major issue has been a lack of control over the procedure to ensure both safe and effective treatment. Here, we evaluated the use of passively-recorded acoustic emissions as a means to achieve this control. An acoustic emissions monitoring system was constructed and integrated into a clinical transcranial MRI-guided focused ultrasound system. Recordings were analyzed using a spectroscopic method that isolates the acoustic emissions caused by the microbubbles during sonication. This analysis characterized and quantified harmonic oscillations that occur when the BBB is disrupted, and broadband emissions that occur when tissue damage occurs. After validating the system's performance in pilot studies that explored a wide range of exposure levels, the measurements were used to control the ultrasound exposure level during transcranial sonications at 104 volumes over 22 weekly sessions in four macaques. We found that increasing the exposure level until a large harmonic emissions signal was observed was an effective means to ensure BBB disruption without broadband emissions. We had a success rate of 96% in inducing BBB disruption as measured by in contrast-enhanced MRI, and we detected broadband emissions in less than 0.2% of the applied bursts. The magnitude of the harmonic emissions signals was significantly (P<0.001) larger for sonications where BBB disruption was detected, and it correlated with BBB permeabilization as indicated by the magnitude of the MRI signal enhancement after MRI contrast administration (R(2) = 0.78). Overall, the results indicate that harmonic emissions can be a used to control focused ultrasound-induced BBB disruption. These results are promising for clinical translation of this technology.

  12. Stress-induced breakdown of intestinal barrier function in the rat: reversal by wood creosote.


    Kuge, Tomoo; Greenwood-Van Meerveld, Beverley; Sokabe, Masahiro


    Our previous studies demonstrated that wood creosote (Seirogan) inhibits intestinal secretion and normalizes the transport of electrolytes and water in rats subjected to restraint stress. The goal of the present study was to examine whether wood creosote has a protective effect against stress-induced breakdown of intestinal barrier function. F-344 rats were subjected to 90-min water avoidance stress (WAS) with wood creosote (30 mg/kg) or vehicle administered intragastrically 30 min prior to WAS. Sham stressed rats received wood creosote or vehicle treatment but did not experience the WAS. All rats were euthanized at the end of the WAS or sham-stress and the jejunum and colon were isolated. Epithelial transport was studied in modified Ussing chambers. Spontaneous secretion was assessed by electrophysiological measurement of the short circuit current (I(sc)) while electrical conductance (G) was calculated from the potential difference (PD) and I(sc) using Ohm's law. Intestinal permeability was defined by the mucosal-to-serosal flux of horseradish peroxidase (HRP). WAS significantly elevated basal I(sc) and G and increased epithelial permeability to HRP in the jejunum but not in the colon. Wood creosote resulted in a significant reduction of the stress-induced increase in I(sc), G and the mucosal-to-serosal flux of HRP compared to the vehicle-treated group. Wood creosote caused no significant effects in sham-stressed rats. The results suggest that oral administration of wood creosote may prevent stress-induced diarrhea by preventing aversive effects on small intestinal secretion and barrier function.

  13. Controlled Ultrasound-Induced Blood-Brain Barrier Disruption Using Passive Acoustic Emissions Monitoring

    PubMed Central

    Arvanitis, Costas D.; Livingstone, Margaret S.; Vykhodtseva, Natalia; McDannold, Nathan


    The ability of ultrasonically-induced oscillations of circulating microbubbles to permeabilize vascular barriers such as the blood-brain barrier (BBB) holds great promise for noninvasive targeted drug delivery. A major issue has been a lack of control over the procedure to ensure both safe and effective treatment. Here, we evaluated the use of passively-recorded acoustic emissions as a means to achieve this control. An acoustic emissions monitoring system was constructed and integrated into a clinical transcranial MRI-guided focused ultrasound system. Recordings were analyzed using a spectroscopic method that isolates the acoustic emissions caused by the microbubbles during sonication. This analysis characterized and quantified harmonic oscillations that occur when the BBB is disrupted, and broadband emissions that occur when tissue damage occurs. After validating the system's performance in pilot studies that explored a wide range of exposure levels, the measurements were used to control the ultrasound exposure level during transcranial sonications at 104 volumes over 22 weekly sessions in four macaques. We found that increasing the exposure level until a large harmonic emissions signal was observed was an effective means to ensure BBB disruption without broadband emissions. We had a success rate of 96% in inducing BBB disruption as measured by in contrast-enhanced MRI, and we detected broadband emissions in less than 0.2% of the applied bursts. The magnitude of the harmonic emissions signals was significantly (P<0.001) larger for sonications where BBB disruption was detected, and it correlated with BBB permeabilization as indicated by the magnitude of the MRI signal enhancement after MRI contrast administration (R2 = 0.78). Overall, the results indicate that harmonic emissions can be a used to control focused ultrasound-induced BBB disruption. These results are promising for clinical translation of this technology. PMID:23029240

  14. Hot-carrier-induced linear drain current and threshold voltage degradation for thin layer silicon-on-insulator field P-channel lateral double-diffused metal-oxide-semiconductor

    SciTech Connect

    Zhou, Xin; Qiao, Ming; He, Yitao; Li, Zhaoji; Zhang, Bo


    Hot-carrier-induced linear drain current (I{sub dlin}) and threshold voltage (V{sub th}) degradations for the thin layer SOI field p-channel lateral double-diffused MOS (pLDMOS) are investigated. Two competition degradation mechanisms are revealed and the hot-carrier conductance modulation model is proposed. In the channel, hot-hole injection induced positive oxide trapped charge and interface trap gives rise to the V{sub th} increasing and the channel conductance (G{sub ch}) decreasing, then reduces I{sub dlin}. In the p-drift region, hot-electron injection induced negative oxide trapped charge enhances the conductance of drift doping resistance (G{sub d}), and then increases I{sub dlin}. Consequently, the eventual I{sub dlin} degradation is controlled by the competition of the two mechanisms due to conductance modulation in the both regions. Based on the model, it is explained that the measured I{sub dlin} anomalously increases while the V{sub th} is increasing with power law. The thin layer field pLDMOS exhibits more severe V{sub th} instability compared with thick SOI layer structure; as a result, it should be seriously evaluated in actual application in switching circuit.

  15. Perifosine induced release of contents of trans cell-barrier transport efficient liposomes.


    Koklic, Tilen


    Perifosine (OPP) containing liposomal formulation was previously found to deliver almost half of liposome encapsulated content through a tight cellular barrier in vitro. In order to understand the role of different liposome components, especially perifosine, in transendothelial transport the physical characteristics of liposome membranes composed of phosphatidylcholine, and cholesterol, as a main lipid constituents, and variable amount of helper lipids: dioleoyl phosphatidylethanolamine (DOPE), and alkylphospholipid perifosine. For this purpose, electron paramagnetic resonance (EPR) with computer aided EPR spectra simulation and fluorescence polarization spectroscopy were used to investigate how different membrane components influence membrane characteristics and the release of liposome entrapped substances. Beside methylester of palmitic acid with nitroxide group at different position on acyl chain usually used for such studies, the spin labeled and fluorescent labeled analog of perifosine were introduced. OPP increases membrane fluidity of liposomes as well as the release of liposome encapsulated content. The release of neutral molecules increases with OPP concentration, while the release of charged molecules is about an order of magnitude slower. Optimal OPP concentration, for release of charged molecules, is about 15 mol%. These results are one step further toward the conclusion that the lysolipid-containing liposomes could be promising trans endothelial delivery system, since lysolipids, such as OPP, open tight cellular barriers, as was published before, and in the same time induce the release of liposome encapsulated content at physiological temperature, as shown here. Since many drug delivery systems are being developed, which mainly exploit the transcellular route of delivery through barrier-forming cells, we hope that the uniqueness of lysolipid-containing liposomes, exploiting the paracellular route, and thus avoiding efflux transporters, will foster

  16. Atmospheric pressure resistive barrier air plasma jet induced bacterial inactivation in aqueous environment

    NASA Astrophysics Data System (ADS)

    Thiyagarajan, Magesh; Sarani, Abdollah; Gonzales, Xavier


    An atmospheric pressure resistive barrier air plasma jet is designed to inactivate bacteria in aqueous media in direct and indirect exposure modes of treatment. The resistive barrier plasma jet is designed to operate at both dc and standard 50-60 Hz low frequency ac power input and the ambient air at 50% humidity level was used as the operating gas. The voltage-current characteristics of the plasma jet were analyzed and the operating frequency of the discharge was measured to be 20 kHz and the plasma power was measured to be 26 W. The plasma jet rotational temperatures (Trot) are obtained from the optical emission spectra, from the N2C-B(2+) transitions by matching the experimental spectrum results with the Spectra Air (SPECAIR) simulation spectra. The reactive oxygen and nitrogen species were measured using optical emission spectroscopy and gas analyzers, for direct and indirect treatment modes. The nitric oxides (NO) were observed to be the predominant long lived reactive nitrogen species produced by the plasma. Three different bacteria including Staphylococcus aureus (Gram-positive), Escherichia coli (Gram-negative), and Neisseria meningitidis (Gram-negative) were suspended in an aqueous media and treated by the resistive barrier air plasma jet in direct and indirect exposure modes. The results show that a near complete bacterial inactivation was achieved within 120 s for both direct and indirect plasma treatment of S. aureus and E. coli bacteria. Conversely, a partial inactivation of N. meningitidis was observed by 120 s direct plasma exposure and insignificant inactivation was observed for the indirect plasma exposure treatment. Plasma induced shifts in N. meningitidis gene expression was analyzed using pilC gene expression as a representative gene and the results showed a reduction in the expression of the pilC gene compared to untreated samples suggesting that the observed protection against NO may be regulated by other genes.

  17. Opioid-induced gut microbial disruption and bile dysregulation leads to gut barrier compromise and sustained systemic inflammation

    PubMed Central

    Banerjee, Santanu; Sindberg, Gregory; Wang, Fuyuan; Meng, Jingjing; Sharma, Umakant; Zhang, Li; Dauer, Patricia; Chen, Chi; Dalluge, Joseph; Johnson, Timothy; Roy, Sabita


    Morphine and its pharmacological derivatives are the most prescribed analgesics for moderate to severe pain management. However, chronic use of morphine reduces pathogen clearance and induces bacterial translocation across the gut barrier. The enteric microbiome has been shown to play a critical role in the preservation of the mucosal barrier function and metabolic homeostasis. Here, we show for the first time, using bacterial 16s rDNA sequencing, that chronic morphine treatment significantly alters the gut microbial composition and induces preferential expansion of gram-positive pathogenic and reduction in bile-deconjugating bacterial strains. A significant reduction in both primary and secondary bile acid levels was seen in the gut, but not in the liver with morphine treatment. Morphine induced microbial dysbiosis and gut barrier disruption was rescued by transplanting placebo-treated microbiota into morphine-treated animals, indicating that microbiome modulation could be exploited as a therapeutic strategy for patients using morphine for pain management. PMID:26906406

  18. Sustained inflammation after pericyte depletion induces irreversible blood-retina barrier breakdown.


    Ogura, Shuntaro; Kurata, Kaori; Hattori, Yuki; Takase, Hiroshi; Ishiguro-Oonuma, Toshina; Hwang, Yoonha; Ahn, Soyeon; Park, Inwon; Ikeda, Wataru; Kusuhara, Sentaro; Fukushima, Yoko; Nara, Hiromi; Sakai, Hideto; Fujiwara, Takashi; Matsushita, Jun; Ema, Masatsugu; Hirashima, Masanori; Minami, Takashi; Shibuya, Masabumi; Takakura, Nobuyuki; Kim, Pilhan; Miyata, Takaki; Ogura, Yuichiro; Uemura, Akiyoshi


    In the central nervous system, endothelial cells (ECs) and pericytes (PCs) of blood vessel walls cooperatively form a physical and chemical barrier to maintain neural homeostasis. However, in diabetic retinopathy (DR), the loss of PCs from vessel walls is assumed to cause breakdown of the blood-retina barrier (BRB) and subsequent vision-threatening vascular dysfunctions. Nonetheless, the lack of adequate DR animal models has precluded disease understanding and drug discovery. Here, by using an anti-PDGFRβ antibody, we show that transient inhibition of the PC recruitment to developing retinal vessels sustained EC-PC dissociations and BRB breakdown in adult mouse retinas, reproducing characteristic features of DR such as hyperpermeability, hypoperfusion, and neoangiogenesis. Notably, PC depletion directly induced inflammatory responses in ECs and perivascular infiltration of macrophages, whereby macrophage-derived VEGF and placental growth factor (PlGF) activated VEGFR1 in macrophages and VEGFR2 in ECs. Moreover, angiopoietin-2 (Angpt2) upregulation and Tie1 downregulation activated FOXO1 in PC-free ECs locally at the leaky aneurysms. This cycle of vessel damage was shut down by simultaneously blocking VEGF, PlGF, and Angpt2, thus restoring the BRB integrity. Together, our model provides new opportunities for identifying the sequential events triggered by PC deficiency, not only in DR, but also in various neurological disorders.

  19. Parameterization of fusion barriers for light-projectiles-induced reactions using the proximity approach

    NASA Astrophysics Data System (ADS)

    Gharaei, R.; Sheibani, J.


    In this article we propose a pocket formula for fusion barriers calculated by three versions of the proximity formalism, namely AW 95, Bass 80 and Prox. 2010 potentials, for fusion reactions involving the collisions of the proton and helium projectiles with different targets in mass ranges 51≤ AT ≤ 130 and 40≤ AT ≤ 233 , respectively. For the first type of the colliding systems, it is shown that the proposed pocket formulas are able to predict the actual values of RB and VB within accuracies of ±0.4% and ±0.45% , respectively. Moreover, for the second type of the selected reactions, these accuracies are obtained ±0.24% and ±0.36% , respectively. In this study, the ability of the present pocket formulas is also demonstrated to predict the exact values of the fusion cross sections for our selected mass ranges. A comparison with the results of the previous pocket formulas reveals that our parameterized forms are more successful to reproduce the empirical data of the barrier height and position in the proton- and helium-induced reactions.

  20. Sustained inflammation after pericyte depletion induces irreversible blood-retina barrier breakdown

    PubMed Central

    Ogura, Shuntaro; Kurata, Kaori; Hattori, Yuki; Takase, Hiroshi; Ishiguro-Oonuma, Toshina; Hwang, Yoonha; Ahn, Soyeon; Ikeda, Wataru; Kusuhara, Sentaro; Fukushima, Yoko; Nara, Hiromi; Sakai, Hideto; Fujiwara, Takashi; Matsushita, Jun; Ema, Masatsugu; Hirashima, Masanori; Shibuya, Masabumi; Takakura, Nobuyuki; Kim, Pilhan; Miyata, Takaki; Ogura, Yuichiro


    In the central nervous system, endothelial cells (ECs) and pericytes (PCs) of blood vessel walls cooperatively form a physical and chemical barrier to maintain neural homeostasis. However, in diabetic retinopathy (DR), the loss of PCs from vessel walls is assumed to cause breakdown of the blood-retina barrier (BRB) and subsequent vision-threatening vascular dysfunctions. Nonetheless, the lack of adequate DR animal models has precluded disease understanding and drug discovery. Here, by using an anti-PDGFRβ antibody, we show that transient inhibition of the PC recruitment to developing retinal vessels sustained EC-PC dissociations and BRB breakdown in adult mouse retinas, reproducing characteristic features of DR such as hyperpermeability, hypoperfusion, and neoangiogenesis. Notably, PC depletion directly induced inflammatory responses in ECs and perivascular infiltration of macrophages, whereby macrophage-derived VEGF and placental growth factor (PlGF) activated VEGFR1 in macrophages and VEGFR2 in ECs. Moreover, angiopoietin-2 (Angpt2) upregulation and Tie1 downregulation activated FOXO1 in PC-free ECs locally at the leaky aneurysms. This cycle of vessel damage was shut down by simultaneously blocking VEGF, PlGF, and Angpt2, thus restoring the BRB integrity. Together, our model provides new opportunities for identifying the sequential events triggered by PC deficiency, not only in DR, but also in various neurological disorders. PMID:28194443

  1. Structure Effects in Collisions Induced by Halo and Weakly Bound Nuclei around the Coulomb Barrier

    NASA Astrophysics Data System (ADS)

    Scuderi, V.; di Pietro, A.; Acosta, L.; Amorini, F.; Borge, M. J. G.; Figuera, P.; Fisichella, M.; Fraile, L. M.; Gomez-Camacho, J.; Jeppesen, H.; Lattuada, M.; Martel, I.; Milin, M.; Musumarra, A.; Papa, M.; Pellegriti, M. G.; Raabe, R.; Randisi, G.; Rizzo, F.; Santonocito, D.; Sanchez, E. M. R.; Scalia, G.; Tengblad, O.; Torresi, D.; Vidal, A. M.; Zadro, M.

    In this contribution, results concerning different reaction channels for the collisions induced by the three Be isotopes, 9,10,11Be, on a 64Zn target at energies around the Coulomb barrier will be presented. The experiments with the radioactive 10,11Be beams were performed at REX-ISOLDE (CERN) whereas the experiment with the stable weakly bound 9Be beam was performed at LNS Catania. Elastic scattering angular distributions have been measured for the three systems 9,10,11Be + 64Zn at the same center of mass energy. The angular distributions were analyzed with optical potentials and reaction cross sections were obtained from optical model calculations, performed with the code PTOLEMY. For the 11Be + 64Zn reaction, the break-up angular distribution was also measured.

  2. Photo-induced potential barrier in As-Se-Ge films

    NASA Astrophysics Data System (ADS)

    Katyal, S. C.; Okano, S.; Suzuki, M.; Bando, T.


    Photo-excited effects in AsSeGe and AsSeGeSn amorphous films have been studied under illumination of different light sources. AsSeGe system exhibited rectifying characteristics under illumination of the light with hν > E g, while AsSeGeSn film did not show such phenomena. The illumination of the IR light along with the light of hν > E g weakened the rectification behavior. The photovoltage and I-V characteristics results suggest the existence of "photo-induced" potential barrier in AsSeGe system, which is considered to concern the creation and destruction of neutral defect states D°.

  3. Optical Diagnostics of Air Flows Induced in Surface Dielectric Barrier Discharge Plasma Actuator

    NASA Astrophysics Data System (ADS)

    Kobatake, Takuya; Deguchi, Masanori; Suzuki, Junya; Eriguchi, Koji; Ono, Kouichi


    A surface dielectric barrier discharge (SDBD) plasma actuator has recently been intensively studied for the flow control over airfoils and turbine blades in the fields of aerospace and aeromechanics. It consists of two electrodes placed on both sides of the dielectric, where one is a top powered electrode exposed to the air, and the other is a bottom grounded electrode encapsulated with an insulator. The unidirectional gas flow along the dielectric surfaces is induced by the electrohydrodynamic (EHD) body force. It is known that the thinner the exposed electrode, the greater the momentum transfer to the air is, indicating that the thickness of the plasma is important. To analyze plasma profiles and air flows induced in the SDBD plasma actuator, we performed time-resolved and -integrated optical emission and schlieren imaging of the side view of the SDBD plasma actuator in atmospheric air. We applied a high voltage bipolar pulse (4-8 kV, 1-10 kHz) between electrodes. Experimental results indicated that the spatial extent of the plasma is much smaller than that of the induced flows. Experimental results further indicated that in the positive-going phase, a thin and long plasma is generated, where the optical emission is weak and uniform; on the other hand, in the negative-going phase, a thick and short plasma is generated, where a strong optical emission is observed near the top electrode.

  4. Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

    PubMed Central

    Wu, Richard Y.; Abdullah, Majd; Määttänen, Pekka; Pilar, Ana Victoria C.; Scruten, Erin; Johnson-Henry, Kathene C.; Napper, Scott; O’Brien, Catherine; Jones, Nicola L.; Sherman, Philip M.


    Prebiotics are non-digestible oligosaccharides that promote the growth of beneficial gut microbes, but it is unclear whether they also have direct effects on the intestinal mucosal barrier. Here we demonstrate two commercial prebiotics, inulin and short-chain fructo-oligosaccharide (scFOS), when applied onto intestinal epithelia in the absence of microbes, directly promote barrier integrity to prevent pathogen-induced barrier disruptions. We further show that these effects involve the induction of select tight junction (TJ) proteins through a protein kinase C (PKC) δ-dependent mechanism. These results suggest that in the absence of microbiota, prebiotics can directly exert barrier protective effects by activating host cell signaling in the intestinal epithelium, which represents a novel alternative mechanism of action of prebiotics. PMID:28098206

  5. A2A Adenosine Receptor Antagonism Reverts the Blood-Brain Barrier Dysfunction Induced by Sleep Restriction

    PubMed Central

    Hurtado-Alvarado, Gabriela; Domínguez-Salazar, Emilio; Velázquez-Moctezuma, Javier


    Chronic sleep restriction induces blood-brain barrier disruption and increases pro-inflammatory mediators in rodents. Those inflammatory mediators may modulate the blood-brain barrier and constitute a link between sleep loss and blood-brain barrier physiology. We propose that adenosine action on its A2A receptor may be modulating the blood-brain barrier dynamics in sleep-restricted rats. We administrated a selective A2A adenosine receptor antagonist (SCH58261) in sleep-restricted rats at the 10th day of sleep restriction and evaluated the blood-brain barrier permeability to dextrans coupled to fluorescein (FITC-dextrans) and Evans blue. In addition, we evaluated by western blot the expression of tight junction proteins (claudin-5, occludin, ZO-1), adherens junction protein (E-cadherin), A2A adenosine receptor, adenosine-synthesizing enzyme (CD73), and neuroinflammatory markers (Iba-1 and GFAP) in the cerebral cortex, hippocampus, basal nuclei and cerebellar vermis. Sleep restriction increased blood-brain barrier permeability to FITC-dextrans and Evans blue, and the effect was reverted by the administration of SCH58261 in almost all brain regions, excluding the cerebellum. Sleep restriction increased the expression of A2A adenosine receptor only in the hippocampus and basal nuclei without changing the expression of CD73 in all brain regions. Sleep restriction reduced the expression of tight junction proteins in all brain regions, except in the cerebellum; and SCH58261 restored the levels of tight junction proteins in the cortex, hippocampus and basal nuclei. Finally, sleep restriction induced GFAP and Iba-1 overexpression that was attenuated with the administration of SCH58261. These data suggest that the action of adenosine on its A2A receptor may have a crucial role in blood-brain barrier dysfunction during sleep loss probably by direct modulation of brain endothelial cell permeability or through a mechanism that involves gliosis with subsequent inflammation and

  6. The effect of damaged skin barrier induced by subclinical irritation on the sequential irritant contact dermatitis.


    Yan-yu, Wu; Xue-min, Wang; Yi-Mei, Tan; Ying, Cheng; Na, Liu


    Skin damage caused by a single specific stimulus has been extensively studied. However, many additional mild skin irritants are experienced every day before obvious irritant contact dermatitis (ICD) appears. The effect that these previously experienced mild irritations have on the incidence and severity of sequential ICD remains undefined. The purpose of this work was to explore whether the effects of skin barrier damage induced by either the open patch test with 1% sodium lauryl sulfate (SLS), tape stripping test (TAP) (10×), or irradiation with 0.75 median erythemal dose UVB (MED) will affect the severity of sequential irritant dermatitis induced by a 0.5% SLS occlusive patch test (PT). Nine treatments were applied to nine different locations of the ventral forearm of each subject at random. The nine treatment types were as follows: open patch test with 1% SLS; 10× TAP; UVB irradiation with 0.75 MED; open patch test with 1% SLS + PT with 0.5% SLS (SLSPT); 10× TAP + PT with 0.5% SLS (TAPPT); UVB irradiation with 0.75 MED + PT with 0.5% SLS (UVPT); PT with distilled water (DISPT); PT with 0.5% SLS (PT); and the CONTROL (no treatment). After 5 days of subclinical irritation, the PT was applied on day 6. Transepidermal water loss (TEWL), capacitance (CAP), and skin color (a*) were measured at baseline and on days 6, 7, and 8. After the PT, indices of irritancy of PT, UVPT, SLSPT, and TAPPT were 60, 80, 87 and 100%, respectively. The index of irritancy of TAPPT and SLSPT were significantly higher than that of PT (p < 0.05). Clinical scores of SLSPT and TAPPT were also significantly higher than PT (p < 0.05). After 5 days of irritation, TEWL of SLS, TAP, SLSPT, and TAPPT were increased significantly compared to that of baseline. After the PT, D-value of TEWL between day 8 and day 6 ((≥6-8)TEWL) of SLSPT and TAPPT were greater than that of PT, and D-value of TEWL between day 8 and day 7 ((≥7-8)TEWL) of SLSPT and TAPPT were less than that of PT values. After the

  7. Salmonella enterica induces joint inflammation and expression of interleukin-17 in draining lymph nodes early after onset of enterocolitis in mice.


    Noto Llana, Mariángeles; Sarnacki, Sebastián Hernán; Vázquez, María Victoria; Gartner, Alejandra Sonia; Giacomodonato, Mónica Nancy; Cerquetti, María Cristina


    In developing countries, one-third of reactive arthritis (ReA) cases are associated with Salmonella enterocolitis; nevertheless, there is no animal model for studying this pathology. Here we induced a self-limiting Salmonella enterica serovar Enteritidis enterocolitis in mice to analyze the onset of ReA. BALB/c mice received orally 20 μg of streptomycin 24 h before intragastric inoculation of a low dose (3 × 10(3) to 4 × 10(3) CFU) of S. Enteritidis. In response to Salmonella infection, a 30-fold increase in the expression of interleukin-17 (IL-17), measured by quantitative PCR, was observed in mesenteric lymph nodes 5 days postinfection. At this time synovitis was already evident, and concomitantly, a significant increase in joint tumor necrosis factor alpha (TNF-α) was detected by enzyme-linked immunosorbent assay (ELISA). The early development of joint lesions was accompanied by an increased expression of IL-17 in inguinal and popliteal lymph nodes. Infection with 10(7) CFU of an isogenic ΔinvG mutant bearing a defective type III secretion system of Salmonella encoded in the pathogenicity island 1 apparatus (TTSS-1) induced enterocolitis histologically similar to that triggered by the wild-type strain. Interestingly, despite the higher infective dose used, the mutant did not trigger intestinal IL-17. Moreover, no synovitis was observed in mice suffering ΔinvG enterocolitis. Neutralization of IL-17 in mice infected with S. Enteritidis prevented both synovitis and the increment of TNF-α in the joints, suggesting that IL-17 participates in the generation of Salmonella-induced ReA through the induction of TNF-α in the joints.

  8. Paracoccidioides brasilinsis-Induced Migration of Dendritic Cells and Subsequent T-Cell Activation in the Lung-Draining Lymph Nodes

    PubMed Central

    Silvana dos Santos, Suelen; Ferreira, Karen Spadari; Almeida, Sandro Rogerio


    Paracoccidioidomycosis is a mycotic disease caused by a dimorphic fungus, Paracoccidioides brasiliensis (Pb), that starts with inhalation of the fungus; thus, lung cells such as DC are part of the first line of defense against this microorganism. Migration of DC to the lymph nodes is the first step in initiating T cell responses. The mechanisms involved in resistance to Pb infection are poorly understood, but it is likely that DC play a pivotal role in the induction of effector T cells that control Pb infection. In this study, we showed that after Pb Infection, an important modification of lung DC receptor expression occurred. We observed an increased expression of CCR7 and CD103 on lung DC after infection, as well as MHC-II. After Pb infection, bone marrow-derived DC as well lung DC, migrate to lymph nodes. Migration of lung DC could represent an important mechanism of pathogenesis during PCM infection. In resume our data showed that Pb induced DC migration. Furthermore, we demonstrated that bone marrow-derived DC stimulated by Pb migrate to the lymph nodes and activate a T helper (Th) response. To the best of our knowledge, this is the first reported data showing that Pb induces migration of DC and activate a T helper (Th) response. PMID:21611175

  9. Aquaporin 5 regulates cigarette smoke induced emphysema by modulating barrier and immune properties of the epithelium.


    Aggarwal, Neil R; Chau, Eric; Garibaldi, Brian T; Mock, Jason R; Sussan, Thomas; Rao, Keshav; Rao, Kaavya; Menon, Anil G; D'Alessio, Franco R; Damarla, Mahendra; Biswal, Shyam; King, Landon S; Sidhaye, Venkataramana K


    Chronic obstructive pulmonary disease (COPD) causes significant morbidity and mortality. Cigarette smoke, the most common risk factor for COPD, induces airway and alveolar epithelial barrier permeability and initiates an innate immune response. Changes in abundance of aquaporin 5 (AQP5), a water channel, can affect epithelial permeability and immune response after cigarette smoke exposure. To determine how AQP5-derived epithelial barrier modulation affects epithelial immune response to cigarette smoke and development of emphysema, WT and AQP5(-/-) mice were exposed to cigarette smoke (CS). We measured alveolar cell counts and differentials, and assessed histology, mean-linear intercept (MLI), and surface-to-volume ratio (S/V) to determine severity of emphysema. We quantified epithelial-derived signaling proteins for neutrophil trafficking, and manipulated AQP5 levels in an alveolar epithelial cell line to determine specific effects on neutrophil transmigration after CS exposure. We assessed paracellular permeability and epithelial turnover in response to CS. In contrast to WT mice, AQP5(-/-) mice exposed to 6 months of CS did not demonstrate a significant increase in MLI or a significant decrease in S/V compared with air-exposed mice, conferring protection against emphysema. After sub-acute (4 weeks) and chronic (6 mo) CS exposure, AQP5(-/-) mice had fewer alveolar neutrophil but similar lung neutrophil numbers as WT mice. The presence of AQP5 in A549 cells, an alveolar epithelial cell line, was associated with increase neutrophil migration after CS exposure. Compared with CS-exposed WT mice, neutrophil ligand (CD11b) and epithelial receptor (ICAM-1) expression were reduced in CS-exposed AQP5(-/-) mice, as was secreted LPS-induced chemokine (LIX), an epithelial-derived neutrophil chemoattractant. CS-exposed AQP5(-/-) mice demonstrated decreased type I pneumocytes and increased type II pneumocytes compared with CS-exposed WT mice suggestive of enhanced epithelial

  10. Effect of "rose essential oil" inhalation on stress-induced skin-barrier disruption in rats and humans.


    Fukada, Mika; Kano, Eri; Miyoshi, Michio; Komaki, Ryoichi; Watanabe, Tatsuo


    In stressed animals, several brain regions (e.g., hypothalamic paraventricular nucleus [PVN]) exhibit neuronal activation, which increases plasma adrenocorticotropic hormone (ACTH) and glucocorticoids. We previously reported that so-called "green odor" inhibits stress-induced activation of the hypothalamo-pituitary-adrenocortical axis (HPA axis) and thereby prevents the chronic stress-induced disruption of the skin barrier. Here, we investigated whether rose essential oil, another sedative odorant, inhibits the stress-induced 1) increases in PVN neuronal activity in rats and plasma glucocorticoids (corticosterone [CORT] in rats and cortisol in humans) and 2) skin-barrier disruption in rats and humans. The results showed that in rats subjected to acute restraint stress, rose essential oil inhalation significantly inhibited the increase in plasma CORT and reduced the increases in the number of c-Fos-positive cells in PVN. Inhalation of rose essential oil significantly inhibited the following effects of chronic stress: 1) the elevation of transepidermal water loss (TEWL), an index of the disruption of skin-barrier function, in both rats and humans and 2) the increase in the salivary concentration of cortisol in humans. These results suggest that in rats and humans, chronic stress-induced disruption of the skin barrier can be limited or prevented by rose essential oil inhalation, possibly through its inhibitory effect on the HPA axis.

  11. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function

    PubMed Central

    Zheng, Wei; Sivasankar, M. Preeti


    Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (p<0.05) and a reduction in transepithelial electrical resistance (TEER) by 180.0% (p<0.001). While the expression of tight junctional protein did not change in acrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (p<0.05). Taken together, these data provide evidence that acute acrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium. PMID:27643990

  12. Cellular mechanisms of the blood-brain barrier opening induced by ultrasound in presence of microbubbles.


    Sheikov, Nickolai; McDannold, Nathan; Vykhodtseva, Natalia; Jolesz, Ferenc; Hynynen, Kullervo


    Local blood-brain barrier (BBB) opening is an advantageous approach for targeted drug delivery to the brain. Recently, it has been shown that focused ultrasound (US) exposures (sonications), when applied in the presence of preformed gas bubbles, caused magnetic-resonance (MR) proven reversible opening of the BBB in targeted locations. The cellular mechanisms of such transient barrier disruption are largely unknown. We investigated US-induced changes in endothelial cell fine morphology that resulted in the BBB opening in rabbits. To obtain evidence for the passage of blood-borne macromolecules through the opened transvascular routes, an immunocytochemical procedure for endogenous immunoglobulinG (IgG) was performed, in addition to the routine electron microscopy. An increased number of vesicles and vacuoles, fenestration and channel formation, as well as opening of some tight junctions, were seen in capillaries after low-power (0.55 W) sonication. Immunosignals presented in some of the vesicles and vacuoles, in the cytoplasmic channels and, so rarely, in intercellular clefts; immunosignals could also be seen in neuropil around the blood vessels. Damage to the cellular ultrastructure was not seen in these areas. However, cell destruction and leakage of IgG through defects of the endothelial lining took place at 3 W sonications. The data reveals that several mechanisms of transcapillary passage are possible after such sonications: 1. transcytosis; 2. endothelial cell cytoplasmic openings--fenestration and channel formation; 3. opening of a part of tight junctions; and 4. free passage through the injured endothelium (with the higher power sonications). These findings could be considered in further development of the strategy for drug delivery to brain parenchyma.

  13. 21 CFR 884.3200 - Cervical drain.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cervical drain. 884.3200 Section 884.3200 Food and... OBSTETRICAL AND GYNECOLOGICAL DEVICES Obstetrical and Gynecological Prosthetic Devices § 884.3200 Cervical drain. (a) Identification. A cervical drain is a device designed to provide an exit channel for...

  14. Nitric oxide attenuates hydrogen peroxide-induced barrier disruption and protein tyrosine phosphorylation in monolayers of intestinal epithelial cell.


    Katsube, Takanori; Tsuji, Hideo; Onoda, Makoto


    The intestinal epithelium provides a barrier to the transport of harmful luminal molecules into the systemic circulation. A dysfunctional epithelial barrier is closely associated with the pathogenesis of a variety of intestinal and systemic disorders. We investigated here the effects of nitric oxide (NO) and hydrogen peroxide (H(2)O(2)) on the barrier function of a human intestinal epithelial cell line, Caco-2. When treated with H(2)O(2), Caco-2 cell monolayers grown on permeable supports exhibited several remarkable features of barrier dysfunction as follows: a decrease in transepithelial electrical resistance, an increase in paracellular permeability to dextran, and a disruption of the intercellular junctional localization of the scaffolding protein ZO-1. In addition, an induction of tyrosine phosphorylation of numerous cellular proteins including ZO-1, E-cadherin, and beta-catenin, components of tight and adherens junctions, was observed. On the other hand, combined treatment of Caco-2 monolayers with H(2)O(2) and an NO donor (NOC5 or NOC12) relieved the damage to the barrier function and suppressed the protein tyrosine phosphorylation induced by H(2)O(2) alone. These results suggest that NO protects the barrier function of intestinal epithelia from oxidative stress by modulating some intracellular signaling pathways of protein tyrosine phosphorylation in epithelial cells.

  15. Bifidobacteria Prevent Tunicamycin-Induced Endoplasmic Reticulum Stress and Subsequent Barrier Disruption in Human Intestinal Epithelial Caco-2 Monolayers

    PubMed Central

    Akiyama, Takuya; Oishi, Kenji


    Endoplasmic reticulum (ER) stress is caused by accumulation of unfolded and misfolded proteins in the ER, thereby compromising its vital cellular functions in protein production and secretion. Genome wide association studies in humans as well as experimental animal models linked ER stress in intestinal epithelial cells (IECs) with intestinal disorders including inflammatory bowel diseases. However, the mechanisms linking the outcomes of ER stress in IECs to intestinal disease have not been clarified. In this study, we investigated the impact of ER stress on intestinal epithelial barrier function using human colon carcinoma-derived Caco-2 monolayers. Tunicamycin-induced ER stress decreased the trans-epithelial electrical resistance of Caco-2 monolayers, concomitant with loss of cellular plasma membrane integrity. Epithelial barrier disruption in Caco-2 cells after ER stress was not caused by caspase- or RIPK1-dependent cell death but was accompanied by lysosomal rupture and up-regulation of the ER stress markers Grp78, sXBP1 and Chop. Interestingly, several bifidobacteria species inhibited tunicamycin-induced ER stress and thereby diminished barrier disruption in Caco-2 monolayers. Together, these results showed that ER stress compromises the epithelial barrier function of Caco-2 monolayers and demonstrate beneficial impacts of bifidobacteria on ER stress in IECs. Our results identify epithelial barrier loss as a potential link between ER stress and intestinal disease development, and suggest that bifidobacteria could exert beneficial effects on this phenomenon. PMID:27611782

  16. Geniposide ameliorates TNBS-induced experimental colitis in rats via reducing inflammatory cytokine release and restoring impaired intestinal barrier function.


    Xu, Bin; Li, Yan-Li; Xu, Ming; Yu, Chang-Chun; Lian, Meng-Qiao; Tang, Ze-Yao; Li, Chuan-Xun; Lin, Yuan


    Geniposide is an iridoid glycosides purified from the fruit of Gardenia jasminoides Ellis, which is known to have antiinflammatory, anti-oxidative and anti-tumor activities. The present study aimed to investigate the effects of geniposide on experimental rat colitis and to reveal the related mechanisms. Experimental rat colitis was induced by rectal administration of a TNBS solution. The rats were treated with geniposide (25, 50 mg·kg(-1)·d(-1), ig) or with sulfasalazine (SASP, 100 mg·kg(-1)·d(-1), ig) as positive control for 14 consecutive days. A Caco-2 cell monolayer exposed to lipopolysaccharides (LPS) was used as an epithelial barrier dysfunction model. Transepithelial electrical resistance (TER) was measured to evaluate intestinal barrier function. In rats with TNBS-induced colitis, administration of geniposide or SASP significantly increased the TNBS-decreased body weight and ameliorated TNBS-induced experimental colitis and related symptoms. Geniposide or SASP suppressed inflammatory cytokine (TNF-α, IL-1β, and IL-6) release and neutrophil infiltration (myeloperoxidase activity) in the colon. In Caco-2 cells, geniposide (25-100 μmol/L) ameliorated LPS-induced endothelial barrier dysfunction via dose-dependently increasing transepithelial electrical resistance (TER). The results from both in vivo and in vitro studies revealed that geniposide down-regulated NF-κB, COX-2, iNOS and MLCK protein expression, up-regulated the expression of tight junction proteins (occludin and ZO-1), and facilitated AMPK phosphorylation. Both AMPK siRNA transfection and AMPK overexpression abrogated the geniposide-reduced MLCK protein expression, suggesting that geniposide ameliorated barrier dysfunction via AMPK-mediated inhibition of the MLCK pathway. In conclusion, geniposide ameliorated TNBS-induced experimental rat colitis by both reducing inflammation and modulating the disrupted epithelial barrier function via activating the AMPK signaling pathway..

  17. Study of flow fields induced by surface dielectric barrier discharge actuator in low-pressure air

    SciTech Connect

    Che, Xueke E-mail:; Nie, Wansheng; Tian, Xihui; Hou, Zhiyong; He, Haobo; Zhou, Penghui; Zhou, Siyin; Yang, Chao; Shao, Tao E-mail:


    Surface dielectric barrier discharge (SDBD) is a promising method for a flow control. Flow fields induced by a SDBD actuator driven by the ac voltage in static air at low pressures varying from 1.0 to 27.7 kPa are measured by the particle image velocimetry method. The influence of the applied ac voltage frequency and magnitude on the induced flow fields is studied. The results show that three different classes of flow fields (wall jet flow field, complex flow field, and vortex-shape flow field) can be induced by the SDBD actuator in the low-pressure air. Among them, the wall jet flow field is the same as the tangential jet at atmospheric pressure, which is, together with the vertical jet, the complex flow field. The vortex-shape flow field is composed of one vertical jet which points towards the wall and two opposite tangential jets. The complex and the vortex-shape flow fields can be transformed to the wall jet flow field when the applied ac voltage frequency and magnitude are changed. It is found that the discharge power consumption increases initially, decreases, and then increases again at the same applied ac voltage magnitude when the air pressure decreases. The tangential velocity of the wall jet flow field increases when the air pressure decreases. It is however opposite for the complex flow field. The variation of the applied ac voltage frequency influences differently three different flow fields. When the applied ac voltage magnitude increases at the same applied ac voltage frequency, the maximal jet velocity increases, while the power efficiency increases only initially and then decreases again. The discharge power shows either linear or exponential dependences on the applied ac voltage magnitude.



    Yang, Tao; Wang, Lu; Sun, Ruiqiang; Chen, Hongguang; Zhang, Hongtao; Yu, Yang; Wang, Yanyan; Wang, Guolin; Yu, Yonghao; Xie, Keliang


    Gastrointestinal barrier dysfunction is associated with the severity and prognosis of sepsis. Hydrogen gas (H2) can ameliorate multiple organ damage in septic animals. Ras homolog gene family member A (RhoA) and mammalian diaphanous-related formin 1 (mDia1) are important to regulate tight junction (TJ) and adherens junction (AJ), both of which determine the integrity of the intestinal barrier. This study was aimed to investigate whether H2 could modulate lipopolysaccharide (LPS)-stimulated dysfunction of the intestinal barrier and whether RhoA-mDia1 signaling is involved. Caco-2 cells were exposed to different concentrations of LPS (1 μg/mL-1 mg/mL). The permeability of the intestinal barrier was evaluated by transepithelial resistance (TER) and fluorescein-isothiocyanate-dextran flux. Expression and distribution of occludin and E-cadherin were analyzed by Western blot and immunofluorescence. RhoA activity was measured by G-Lisa assay, and mDia1 expression was assessed by Western blot. LPS (100 μg/mL) decreased TER and increased fluorescein-isothiocyanate-dextran flux, which were alleviated by H2-rich medium. Also, H2 down-regulated LPS-induced oxidative stress. Moreover, H2 improved the down-regulated expression and redistribution of occludin and E-cadherin caused by LPS. Additionally, H2 alleviated LPS-caused RhoA activation, and the beneficial effects of H2 on barrier were counteracted by RhoA agonist CN03. Rho inhibitor C3 exoenzyme mitigated LPS-induced barrier breakdown. Furthermore, H2-rich medium increased mDia1 expression, and mDia1 knockdown abolished protections of H2 on barrier permeability. mDia1 knockdown eliminated H2-induced benefits for occludin and E-cadherin. These findings suggest that H2 improves LPS-induced hyperpermeability of the intestinal barrier and disruptions of TJ and AJ by moderating RhoA-mDia1 signaling.

  19. Safety drain system for fluid reservoir

    NASA Technical Reports Server (NTRS)

    England, John Dwight (Inventor); Kelley, Anthony R. (Inventor); Cronise, Raymond J. (Inventor)


    A safety drain system includes a plurality of drain sections, each of which defines distinct fluid flow paths. At least a portion of the fluid flow paths commence at a side of the drain section that is in fluid communication with a reservoir's fluid. Each fluid flow path at the side communicating with the reservoir's fluid defines an opening having a smallest dimension not to exceed approximately one centimeter. The drain sections are distributed over at least one surface of the reservoir. A manifold is coupled to the drain sections.

  20. Blood-Brain Barrier Disruption Induced by Chronic Sleep Loss: Low-Grade Inflammation May Be the Link

    PubMed Central

    Velázquez-Moctezuma, J.


    Sleep is a vital phenomenon related to immunomodulation at the central and peripheral level. Sleep deficient in duration and/or quality is a common problem in the modern society and is considered a risk factor to develop neurodegenerative diseases. Sleep loss in rodents induces blood-brain barrier disruption and the underlying mechanism is still unknown. Several reports indicate that sleep loss induces a systemic low-grade inflammation characterized by the release of several molecules, such as cytokines, chemokines, and acute-phase proteins; all of them may promote changes in cellular components of the blood-brain barrier, particularly on brain endothelial cells. In the present review we discuss the role of inflammatory mediators that increase during sleep loss and their association with general disturbances in peripheral endothelium and epithelium and how those inflammatory mediators may alter the blood-brain barrier. Finally, this manuscript proposes a hypothetical mechanism by which sleep loss may induce blood-brain barrier disruption, emphasizing the regulatory effect of inflammatory molecules on tight junction proteins. PMID:27738642

  1. Blood-Brain Barrier Disruption Induced by Chronic Sleep Loss: Low-Grade Inflammation May Be the Link.


    Hurtado-Alvarado, G; Domínguez-Salazar, E; Pavon, L; Velázquez-Moctezuma, J; Gómez-González, B


    Sleep is a vital phenomenon related to immunomodulation at the central and peripheral level. Sleep deficient in duration and/or quality is a common problem in the modern society and is considered a risk factor to develop neurodegenerative diseases. Sleep loss in rodents induces blood-brain barrier disruption and the underlying mechanism is still unknown. Several reports indicate that sleep loss induces a systemic low-grade inflammation characterized by the release of several molecules, such as cytokines, chemokines, and acute-phase proteins; all of them may promote changes in cellular components of the blood-brain barrier, particularly on brain endothelial cells. In the present review we discuss the role of inflammatory mediators that increase during sleep loss and their association with general disturbances in peripheral endothelium and epithelium and how those inflammatory mediators may alter the blood-brain barrier. Finally, this manuscript proposes a hypothetical mechanism by which sleep loss may induce blood-brain barrier disruption, emphasizing the regulatory effect of inflammatory molecules on tight junction proteins.

  2. An improved performance of copper phthalocyanine OFETs with channel and source/drain contact modifications

    NASA Astrophysics Data System (ADS)

    Huanqin, Dang; Xiaoming, Wu; Xiaowei, Sun; Runqiu, Zou; Ruochuan, Zhang; Shougen, Yin


    We report an effective method to improve the performance of p-type copper phthalocyanine (CuPc) based organic field-effect transistors (OFETs) by employing a thin para-quaterphenyl (p-4p) film and simultaneously applying V2O5 to the source/drain regions. The p-4p layer was inserted between the insulating layer and the active layer, and V2O5 layer was added between CuPc and Al in the source-drain (S/D) area. As a result, the field-effect saturation mobility and on/off current ratio of the optimized device were improved to 5 × 10-2 cm2/(V·s) and 104, respectively. We believe that because p-4p could induce CuPc to form a highly oriented and continuous film, this resulted in the better injection and transport of the carriers. Moreover, by introducing the V2O5 electrode's modified layers, the height of the carrier injection barrier could be effectively tuned and the contact resistance could be reduced. Project supported by the National Natural Science Foundation of China (No. 60676051), the National High Technology Research and Development Program of China (No. 2013A A014201), the Scientific Developing Foundation of Tianjin Education Commission (No. 2011ZD02), the Key Science and Technology Support Program of Tianjin (No. 14ZCZDGX00006), and the Foundation of Key Discipline of Material Physics and Chemistry of Tianjin.

  3. Self-screening of the quantum confined Stark effect by the polarization induced bulk charges in the quantum barriers

    SciTech Connect

    Zhang, Zi-Hui; Liu, Wei; Ju, Zhengang; Tiam Tan, Swee; Ji, Yun; Kyaw, Zabu; Zhang, Xueliang; Wang, Liancheng; Wei Sun, Xiao E-mail:; Volkan Demir, Hilmi E-mail:


    InGaN/GaN light-emitting diodes (LEDs) grown along the polar orientations significantly suffer from the quantum confined Stark effect (QCSE) caused by the strong polarization induced electric field in the quantum wells, which is a fundamental problem intrinsic to the III-nitrides. Here, we show that the QCSE is self-screened by the polarization induced bulk charges enabled by designing quantum barriers. The InN composition of the InGaN quantum barrier graded along the growth orientation opportunely generates the polarization induced bulk charges in the quantum barrier, which well compensate the polarization induced interface charges, thus avoiding the electric field in the quantum wells. Consequently, the optical output power and the external quantum efficiency are substantially improved for the LEDs. The ability to self-screen the QCSE using polarization induced bulk charges opens up new possibilities for device engineering of III-nitrides not only in LEDs but also in other optoelectronic devices.

  4. Protective Capacity of Resveratrol, a Natural Polyphenolic Compound, against Deoxynivalenol-Induced Intestinal Barrier Dysfunction and Bacterial Translocation.


    Ling, Ka-Ho; Wan, Murphy Lam Yim; El-Nezami, Hani; Wang, Mingfu


    Contamination of food/feedstuffs by mycotoxins is a serious problem worldwide, causing severe economic losses and serious health problems in animals/humans. Deoxynivalenol (DON) is a major mycotoxin contaminant and is known to impair intestinal barrier function. Grapes and red wine are rich in polyphenols, such as resveratrol (RES), which has striking antioxidant and anti-inflammatory activities. RES is a food-derived component; therefore, it may be simultaneously present with DON in the gastrointestinal tract. The aim of this study was to explore in vitro protective effects of RES against DON-induced intestinal damage. The results showed that RES could protect DON-induced bacteria translocation because of enhanced of intestinal barrier function by restoring the DON-induced decrease in transepithelial electrical resistance and increase in paracellular permeability. Further mechanistic studies demonstrated that RES protects against DON-induced barrier dysfunction by promoting the assembly of claudin-4 in the tight junction complex. This is probably mediated through modulation of IL-6 and IL-8 secretion via mitogen-activated protein kinase-dependent pathways. Our results imply that RES can protect against DON-induced intestinal damage and that RES may be used as a novel dietary intervention strategy to reduce DON toxicity in animals/humans.

  5. Analysis of the impedance field of saturated MOSFETs and drain thermal noise

    NASA Astrophysics Data System (ADS)

    Lee, Kie-Young


    The effect of the velocity saturation region (VSR) on the impedance field of proto-type MOSFET devices, which operate in the saturation region, was investigated to analyze the drain thermal noise. An enhanced impedance field for the drain thermal noise was derived based on the well-known physical analyses of MOSFET noise. The mechanism of the VSR in inducing the drain thermal noise has been explicated by using a self-consistent equivalent circuit model of the saturated MOSFETs. This alternative description was found to be consistent with the analytical derivation. The present analysis has been demonstrated to be consistent with the behavior of empirical drain thermal noise.

  6. Dissipated power and induced velocity fields data of a micro single dielectric barrier discharge plasma actuator for active flow control.


    Pescini, E; Martínez, D S; De Giorgi, M G; Francioso, L; Ficarella, A


    In recent years, single dielectric barrier discharge (SDBD) plasma actuators have gained great interest among all the active flow control devices typically employed in aerospace and turbomachinery applications [1,2]. Compared with the macro SDBDs, the micro single dielectric barrier discharge (MSDBD) actuators showed a higher efficiency in conversion of input electrical power to delivered mechanical power [3,4]. This article provides data regarding the performances of a MSDBD plasma actuator [5,6]. The power dissipation values [5] and the experimental and numerical induced velocity fields [6] are provided. The present data support and enrich the research article entitled "Optimization of micro single dielectric barrier discharge plasma actuator models based on experimental velocity and body force fields" by Pescini et al. [6].

  7. Dissipated power and induced velocity fields data of a micro single dielectric barrier discharge plasma actuator for active flow control☆

    PubMed Central

    Pescini, E.; Martínez, D.S.; De Giorgi, M.G.; Francioso, L.; Ficarella, A.


    In recent years, single dielectric barrier discharge (SDBD) plasma actuators have gained great interest among all the active flow control devices typically employed in aerospace and turbomachinery applications [1,2]. Compared with the macro SDBDs, the micro single dielectric barrier discharge (MSDBD) actuators showed a higher efficiency in conversion of input electrical power to delivered mechanical power [3,4]. This article provides data regarding the performances of a MSDBD plasma actuator [5,6]. The power dissipation values [5] and the experimental and numerical induced velocity fields [6] are provided. The present data support and enrich the research article entitled “Optimization of micro single dielectric barrier discharge plasma actuator models based on experimental velocity and body force fields” by Pescini et al. [6]. PMID:26425667

  8. Evaluation of pathogen inactivation on sliced cheese induced by encapsulated atmospheric pressure dielectric barrier discharge plasma.


    Yong, Hae In; Kim, Hyun-Joo; Park, Sanghoo; Alahakoon, Amali U; Kim, Kijung; Choe, Wonho; Jo, Cheorun


    Pathogen inactivation induced by atmospheric pressure dielectric barrier discharge (DBD) (250 W, 15 kHz, air discharge) produced in a rectangular plastic container and the effect of post-treatment storage time on inactivation were evaluated using agar plates and cheese slices. When agar plates were treated with plasma, populations of Escherichia coli, Salmonella Typhimurium, and Listeria monocytogenes showed 3.57, 6.69, and 6.53 decimal reductions at 60 s, 45 s, and 7 min, respectively. When the pathogens tested were inoculated on cheese slices, 2.67, 3.10, and 1.65 decimal reductions were achieved at the same respective treatment times. The post-treatment storage duration following plasma treatment potently affected further reduction in pathogen populations. Therefore, the newly developed encapsulated DBD-plasma system for use in a container can be applied to improve the safety of sliced cheese, and increasing post-treatment storage time can greatly enhance the system's pathogen-inactivation efficiency.

  9. Radiation-induced blood-brain barrier changes: pathophysiological mechanisms and clinical implications.


    d'Avella, D; Cicciarello, R; Angileri, F F; Lucerna, S; La Torre, D; Tomasello, F


    The pathophysiology of whole-brain radiation (WBR) toxicity remains incompletely understood. The possibility of a primary change in blood-brain barrier (BBB) associated with microvascular damage was investigated. Rats were exposed to conventional fractionation in radiation (200 +/- cGy/d, 5d/wk; total dose, 4,000 cGy). BBB changes were assessed by means of the quantitative 14C-alpha-aminoisobutyric acid (AIB) technique coupled with standard electron microscopy (EM) and morphometric techniques as well as studies of the transcapillary passage of horseradish peroxidase (HRP). At 15 days after WBR, AIB transport across BBB increased significantly in cerebral cortex. EM disclosed vesicular transport of HRP across the intact endothelium without opening of the tight junctions. Ninety days after WBR, well-defined alterations of the microvasculature were observed. The main feature of cortical microvessels was their collapsed aspect, associated with perivascular edema containing cell debris. Data suggest a possible association between damage of the microvascular/glial unit of tissue injury and development of radiation-induced brain cerebral dysfunction. We hypothesize the following sequence of pathophysiological events: WBR causes an early increase in BBB permeability, which produces perivascular edema and microvascular collapse. The interference with microcirculation affects blood flow and energy supply to the tissue, resulting in structural damage on an ischemic/dysmetabolic basis.

  10. Interleukin-1β induces blood-brain barrier disruption by downregulating Sonic hedgehog in astrocytes.


    Wang, Yue; Jin, Shijie; Sonobe, Yoshifumi; Cheng, Yi; Horiuchi, Hiroshi; Parajuli, Bijay; Kawanokuchi, Jun; Mizuno, Tetsuya; Takeuchi, Hideyuki; Suzumura, Akio


    The blood-brain barrier (BBB) is composed of capillary endothelial cells, pericytes, and perivascular astrocytes, which regulate central nervous system homeostasis. Sonic hedgehog (SHH) released from astrocytes plays an important role in the maintenance of BBB integrity. BBB disruption and microglial activation are common pathological features of various neurologic diseases such as multiple sclerosis, Parkinson's disease, amyotrophic lateral sclerosis, and Alzheimer's disease. Interleukin-1β (IL-1β), a major pro-inflammatory cytokine released from activated microglia, increases BBB permeability. Here we show that IL-1β abolishes the protective effect of astrocytes on BBB integrity by suppressing astrocytic SHH production. Astrocyte conditioned media, SHH, or SHH signal agonist strengthened BBB integrity by upregulating tight junction proteins, whereas SHH signal inhibitor abrogated these effects. Moreover, IL-1β increased astrocytic production of pro-inflammatory chemokines such as CCL2, CCL20, and CXCL2, which induce immune cell migration and exacerbate BBB disruption and neuroinflammation. Our findings suggest that astrocytic SHH is a potential therapeutic target that could be used to restore disrupted BBB in patients with neurologic diseases.

  11. Response of upper ocean and impact of barrier layer on Sidr cyclone induced sea surface cooling

    NASA Astrophysics Data System (ADS)

    Vissa, Naresh Krishna; Satyanarayana, A. N. V.; Kumar, B. Prasad


    In the present study an attempt has been made to investigate the impact of salinity stratification on the SST during the tropical cyclone (TC) passage. In this context, a severe post monsoon cyclone, Sidr, (Category 4) that developed over the south-eastern Bay of Bengal (BoB) during 11-16 November, 2007 was chosen as a case study. Pre-existence of a thick barrier layer (BL), temperature inversions and a higher effective oceanic layer for cyclogenesis (EOLC) were noticed along the path of the Sidr cyclone. The analysis of available Argo floats along the Sidr cyclone track also revealed less cooling during as well as after its passage as was reported from satellite derived SST. The role of BL on Sidr induced sea surface cooling was investigated using a diagnostic mixed layer model. Model results also depict the reduced sea surface cooling during the passage of Sidr. This is attributed to the presence of BL which results in the inhibition of the entrainment of cool thermocline water into the shallow mixed layer. Climatological as well as in situ observations of tropical cyclone heat potential (TCHP) and EOLC shows that the Sidr cyclone propagated towards the regions of higher EOLC.

  12. Propofol protects against blood-spinal cord barrier disruption induced by ischemia/reperfusion injury

    PubMed Central

    Xie, Li-jie; Huang, Jin-xiu; Yang, Jian; Yuan, Fen; Zhang, Shuang-shuang; Yu, Qi-jing; Hu, Ji


    Propofol has been shown to exert neuroprotective effects on the injured spinal cord. However, the effect of propofol on the blood-spinal cord barrier (BSCB) after ischemia/reperfusion injury (IRI) is poorly understood. Therefore, we investigated whether propofol could maintain the integrity of the BSCB. Spinal cord IRI (SCIRI) was induced in rabbits by infrarenal aortic occlusion for 30 minutes. Propofol, 30 mg/kg, was intravenously infused 10 minutes before aortic clamping as well as at the onset of reperfusion. Then, 48 hours later, we performed histological and mRNA/protein analyses of the spinal cord. Propofol decreased histological damage to the spinal cord, attenuated the reduction in BSCB permeability, downregulated the mRNA and protein expression levels of matrix metalloprotease-9 (MMP-9) and nuclear factor-κB (NF-κB), and upregulated the protein expression levels of occludin and claudin-5. Our findings suggest that propofol helps maintain BSCB integrity after SCIRI by reducing MMP-9 expression, by inhibiting the NF-κB signaling pathway, and by maintaining expression of tight junction proteins. PMID:28250758

  13. Saffman-Taylor-like instability in a narrow gap induced by dielectric barrier discharge.


    Hou, Shang-Yan; Chu, Hong-Yu


    This work is inspired by the expansion of the plasma bubble in a narrow gap reported by Chu and Lee [Phys. Rev. Lett. 107, 225001 (2011)]. We report the unstable phenomena of the plasma-liquid interface with different curvature in a Hele-Shaw cell. Dielectric barrier discharge is produced in the cell at atmospheric pressure which is partially filled with silicone oil. We show that the Saffman-Taylor-like instability is observed on the bubble-type, channel-type, and drop-type interfaces. The Schlieren observation of the plasma-drop interaction reveals that there is a vapor layer around the drop and the particle image velocimetry shows the liquid flow inside the drop. We propose that the thermal Marangoni effect induced by the plasma heating is responsible for the unstable phenomena of the plasma-liquid interaction. The fluctuation of the interface is shown consistently with the Saffman-Taylor instability modified by the temperature-dependent velocity and surface tension.

  14. Vaccinia virus-induced smallpox postvaccinal encephalitis in case of blood-brain barrier damage.


    Garcel, Aude; Fauquette, William; Dehouck, Marie-Pierre; Crance, Jean-Marc; Favier, Anne-Laure


    Smallpox vaccination is the only currently effective mean to combat the threat of variola virus used as a bioterrorism agent, although it is responsible for a rare but serious complication, the postvaccinal encephalitis (PVE). Development of safer vaccines therefore is a high priority as the PVE physiopathology is not well understood to date. If vaccinia virus (VACV) is responsible for PVE by central nervous system (CNS) dissemination, trans-migration of the VACV across the blood-brain barrier (BBB) would be supposed to be essential. Given the complexity of the pathogenesis of vaccinia neurovirulence, an in vitro BBB model was used to explore the mechanism of VACV to induce BBB permeability. Two VACV strains were studied, the neurovirulent Western Reserve strain (VACV-WR) and the vaccine reference Lister strain (VACV-List). A mouse model was also developed to study the ability of these two viral strains to propagate in the brain from the blood compartment, their neurovirulence and their neuropathogenesis. In vitro, the loss of permeability resulted from the tight-junctions disruption was induced by virus replication. The ability of VACV to release infectious particles at the abluminal side suggests the capacity of both VACV strains to migrate across the BBB from the blood to the CNS. In vivo, the virus replication in mice CNS was strain-dependent. The VACV-WR laboratory strain proved to be neuroinvasive and neurovirulent, whereas the VACV-List strain is safe in physiological conditions. Mice PVE was observed only with VACV-WR in the co-infection model, when BBB opening was obtained by lipopolysaccharide (LPS) treatment. This study suggests that VACV is able to cross the BBB but encephalitis occurs only in the presence of a co-infection by bacteria. So, a model of co-infection, mimicked by LPS treatment, could have important implication towards the assessment of neurovirulence of new vaccines.

  15. Probiotics ameliorate the hydrogen peroxide-induced epithelial barrier disruption by a PKC- and MAP kinase-dependent mechanism

    PubMed Central

    Seth, A.; Yan, Fang; Polk, D.Brent; Rao, R. K.


    Probiotics promote intestinal epithelial integrity and reduce infection and diarrhea. We evaluated the effect of Lactobacillus rhamnosus GG-produced soluble proteins (p40 and p75) on the hydrogen peroxide-induced disruption of tight junctions and barrier function in Caco-2 cell monolayers. Pretreatment of cell monolayers with p40 or p75 attenuated the hydrogen peroxide-induced decrease in transepithelial resistance and increase in inulin permeability in a time- and dose-dependent manner. p40 and p75 also prevented hydrogen peroxide-induced redistribution of occludin, ZO-1, E-cadherin, and β-catenin from the intercellular junctions and their dissociation from the detergent-insoluble fractions. Both p40 and p75 induced a rapid increase in the membrane translocation of PKCβI and PKCε. The attenuation of hydrogen peroxide-induced inulin permeability and redistribution of tight junction proteins by p40 and p75 was abrogated by Ro-32-0432, a PKC inhibitor. p40 and p75 also rapidly increased the levels of phospho-ERK1/2 in the detergent-insoluble fractions. U0126 (a MAP kinase inhibitor) attenuated the p40- and p75-mediated reduction of hydrogen peroxide-induced tight junction disruption and inulin permeability. These studies demonstrate that probiotic-secretory proteins protect the intestinal epithelial tight junctions and the barrier function from hydrogen peroxide-induced insult by a PKC- and MAP kinase-dependent mechanism. PMID:18292183

  16. Probiotics ameliorate the hydrogen peroxide-induced epithelial barrier disruption by a PKC- and MAP kinase-dependent mechanism.


    Seth, A; Yan, Fang; Polk, D Brent; Rao, R K


    Probiotics promote intestinal epithelial integrity and reduce infection and diarrhea. We evaluated the effect of Lactobacillus rhamnosus GG-produced soluble proteins (p40 and p75) on the hydrogen peroxide-induced disruption of tight junctions and barrier function in Caco-2 cell monolayers. Pretreatment of cell monolayers with p40 or p75 attenuated the hydrogen peroxide-induced decrease in transepithelial resistance and increase in inulin permeability in a time- and dose-dependent manner. p40 and p75 also prevented hydrogen peroxide-induced redistribution of occludin, ZO-1, E-cadherin, and beta-catenin from the intercellular junctions and their dissociation from the detergent-insoluble fractions. Both p40 and p75 induced a rapid increase in the membrane translocation of PKCbetaI and PKCepsilon. The attenuation of hydrogen peroxide-induced inulin permeability and redistribution of tight junction proteins by p40 and p75 was abrogated by Ro-32-0432, a PKC inhibitor. p40 and p75 also rapidly increased the levels of phospho-ERK1/2 in the detergent-insoluble fractions. U0126 (a MAP kinase inhibitor) attenuated the p40- and p75-mediated reduction of hydrogen peroxide-induced tight junction disruption and inulin permeability. These studies demonstrate that probiotic-secretory proteins protect the intestinal epithelial tight junctions and the barrier function from hydrogen peroxide-induced insult by a PKC- and MAP kinase-dependent mechanism.

  17. Benefits of agomelatine in behavioral, neurochemical and blood brain barrier alterations in prenatal valproic acid induced autism spectrum disorder.


    Kumar, Hariom; Sharma, B M; Sharma, Bhupesh


    Valproic acid administration during gestational period causes behavior and biochemical deficits similar to those observed in humans with autism spectrum disorder. Although worldwide prevalence of autism spectrum disorder has been increased continuously, therapeutic agents to ameliorate the social impairment are very limited. The present study has been structured to investigate the therapeutic potential of melatonin receptor agonist, agomelatine in prenatal valproic acid (Pre-VPA) induced autism spectrum disorder in animals. Pre-VPA has produced reduction in social interaction (three chamber social behavior apparatus), spontaneous alteration (Y-Maze), exploratory activity (Hole board test), intestinal motility, serotonin levels (prefrontal cortex and ileum) and prefrontal cortex mitochondrial complex activity (complex I, II, IV). Furthermore, Pre-VPA has increased locomotor activity (actophotometer), anxiety, brain oxidative stress (thiobarbituric acid reactive species, glutathione, and catalase), nitrosative stress (nitrite/nitrate), inflammation (brain and ileum myeloperoxidase activity), calcium levels and blood brain barrier leakage in animals. Treatment with agomelatine has significantly attenuated Pre-VPA induced reduction in social interaction, spontaneous alteration, exploratory activity intestinal motility, serotonin levels and prefrontal cortex mitochondrial complex activity. Furthermore, agomelatine also attenuated Pre-VPA induced increase in locomotion, anxiety, brain oxidative stress, nitrosative stress, inflammation, calcium levels and blood brain barrier leakage. It is concluded that, Pre-VPA has induced autism spectrum disorder, which was attenuated by agomelatine. Agomelatine has shown ameliorative effect on behavioral, neurochemical and blood brain barrier alteration in Pre-VPA exposed animals. Thus melatonin receptor agonists may provide beneficial therapeutic strategy for managing autism spectrum disorder.

  18. Barrier protective effects of withaferin A in HMGB1-induced inflammatory responses in both cellular and animal models

    SciTech Connect

    Lee, Wonhwa; Kim, Tae Hoon; Ku, Sae-Kwang; Min, Kyoung-jin; Lee, Hyun-Shik; Kwon, Taeg Kyu; Bae, Jong-Sup


    Withaferin A (WFA), an active compound from Withania somnifera, is widely researched for its anti-inflammatory, cardioactive and central nervous system effects. In this study, we first investigated the possible barrier protective effects of WFA against pro-inflammatory responses in human umbilical vein endothelial cells (HUVECs) and in mice induced by high mobility group box 1 protein (HMGB1) and the associated signaling pathways. The barrier protective activities of WFA were determined by measuring permeability, leukocytes adhesion and migration, and activation of pro-inflammatory proteins in HMGB1-activated HUVECs. We found that WFA inhibited lipopolysaccharide (LPS)-induced HMGB1 release and HMGB1-mediated barrier disruption, expression of cell adhesion molecules (CAMs) and adhesion/transendothelial migration of leukocytes to human endothelial cells. WFA also suppressed acetic acid-induced hyperpermeability and carboxymethylcellulose-induced leukocytes migration in vivo. Further studies revealed that WFA suppressed the production of interleukin 6, tumor necrosis factor-α (TNF-α) and activation of nuclear factor-κB (NF-κB) by HMGB1. Collectively, these results suggest that WFA protects vascular barrier integrity by inhibiting hyperpermeability, expression of CAMs, adhesion and migration of leukocytes, thereby endorsing its usefulness as a therapy for vascular inflammatory diseases. -- Highlights: ► Withaferin A inhibited LPS induced HMGB1 release. ► Withaferin A reduced HMGB1-mediated hyperpermeability. ► Withaferin A inhibited HMGB1-mediated adhesion and migration of leukocytes. ► Withaferin A inhibited HMGB1-mediated activation of NF-κB, IL-6 and TNF-α.

  19. Double frequency absorption induced by Al-Si Schottky barrier potential and mechanism of two-photon response

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoting; Gao, Yanjun; Chen, Zhanguo; Jia, Gang; Liu, Yunlong; Liu, Xiuhuan; Zh, Yuhong


    By observing two-photon response and anisotropy of the light-induced voltage in Si-Al Schottky barrier potential of the Si MSM (Metal-Semiconductor-Metal) planar structure two-photon response optical detector. It is certified from the experimental and theoretical analysis that the built-in electric field generated by the Schottky barrier potential will induce the phenomena of optical rectification in Si photodiode. Thus, it is deduced that there must be double-frequency absorption (DFA) caused by phase-mismatch in the mechanism of two-photon response of Si photodiode. If the intensity of the built-in electric field is strong enough, the DFA will be the main feature of the two-photon response.

  20. Acute intensive insulin therapy exacerbates diabetic blood-retinal barrier breakdown via hypoxia-inducible factor-1α and VEGF

    PubMed Central

    Poulaki, Vassiliki; Qin, Wenying; Joussen, Antonia M.; Hurlbut, Peter; Wiegand, Stanley J.; Rudge, John; Yancopoulos, George D.; Adamis, Anthony P.


    Acute intensive insulin therapy is an independent risk factor for diabetic retinopathy. Here we demonstrate that acute intensive insulin therapy markedly increases VEGF mRNA and protein levels in the retinae of diabetic rats. Retinal nuclear extracts from insulin-treated rats contain higher hypoxia-inducible factor-1α (HIF-1α) levels and demonstrate increased HIF-1α–dependent binding to hypoxia-responsive elements in the VEGF promoter. Blood-retinal barrier breakdown is markedly increased with acute intensive insulin therapy but can be reversed by treating animals with a fusion protein containing a soluble form of the VEGF receptor Flt; a control fusion protein has no such protective effect. The insulin-induced retinal HIF-1α and VEGF increases and the related blood-retinal barrier breakdown are suppressed by inhibitors of p38 mitogen-activated protein kinase (MAPK) and phosphatidylinositol (PI) 3-kinase, but not inhibitors of p42/p44 MAPK or protein kinase C. Taken together, these findings indicate that acute intensive insulin therapy produces a transient worsening of diabetic blood-retinal barrier breakdown via an HIF-1α–mediated increase in retinal VEGF expression. Insulin-induced VEGF expression requires p38 MAPK and PI 3-kinase, whereas hyperglycemia-induced VEGF expression is HIF-1α–independent and requires PKC and p42/p44 MAPK. To our knowledge, these data are the first to identify a specific mechanism for the transient worsening of diabetic retinopathy, specifically blood-retinal barrier breakdown, that follows the institution of intensive insulin therapy. PMID:11901189

  1. Investigation of contribution of incomplete fusion in the total fusion process induced by 9Be on 181Ta target at near barrier energies

    NASA Astrophysics Data System (ADS)

    Kharab, Rajesh; Chahal, Rajiv; Kumar, Rajiv


    We have studied the relative contribution of incomplete fusion (ICF) and complete fusion (CF) in total fusion (TF) induced by 9Be on 181Ta target at energies in the vicinity of Coulomb barrier using classical dynamical model and Wong's formula in conjugation with energy dependent Woods-Saxon formula. It is found that at above barrier energies ICF contributes almost 30% in TF while at energies below the barrier qualitatively its contribution is much more than thirty percent.

  2. Iron supplement prevents lead-induced disruption of the blood-brain barrier during rat development

    SciTech Connect

    Wang Qiang; Luo Wenjing; Zheng Wei; Liu Yiping; Xu Hui; Zheng Gang; Dai Zhongming; Zhang Wenbin; Chen Yaoming; Chen Jingyuan . E-mail:


    Children are known to be venerable to lead (Pb) toxicity. The blood-brain barrier (BBB) in immature brain is particularly vulnerable to Pb insults. This study was designed to test the hypothesis that Pb exposure damaged the integrity of the BBB in young animals and iron (Fe) supplement may prevent against Pb-induced BBB disruption. Male weanling Sprague-Dawley rats were divided into four groups. Three groups of rats were exposed to Pb in drinking water containing 342 {mu}g Pb/mL as Pb acetate, among which two groups were concurrently administered by oral gavage once every other day with 7 mg Fe/kg and 14 mg Fe/kg as FeSO{sub 4} solution as the low and high Fe treatment group, respectively, for 6 weeks. The control group received sodium acetate in drinking water. Pb exposure significantly increased Pb concentrations in blood by 6.6-folds (p < 0.05) and brain tissues by 1.5-2.0-folds (p < 0.05) as compared to controls. Under the electron microscope, Pb exposure in young animals caused an extensive extravascular staining of lanthanum nitrate in brain parenchyma, suggesting a leakage of cerebral vasculature. Western blot showed that Pb treatment led to 29-68% reduction (p < 0.05) in the expression of occludin as compared to the controls. Fe supplement among Pb-exposed rats maintained the normal ultra-structure of the BBB and restored the expression of occludin to normal levels. Moreover, the low dose Fe supplement significantly reduced Pb levels in blood and brain tissues. These data suggest that Pb exposure disrupts the structure of the BBB in young animals. The increased BBB permeability may facilitate the accumulation of Pb. Fe supplement appears to protect the integrity of the BBB against Pb insults, a beneficial effect that may have significant clinical implications.

  3. Non-thermal dielectric barrier discharge plasma induces angiogenesis through reactive oxygen species

    PubMed Central

    Arjunan, Krishna Priya; Friedman, Gary; Fridman, Alexander; Clyne, Alisa Morss


    Vascularization plays a key role in processes such as wound healing and tissue engineering. Non-thermal plasma, which primarily produces reactive oxygen species (ROS), has recently emerged as an efficient tool in medical applications including blood coagulation, sterilization and malignant cell apoptosis. Liquids and porcine aortic endothelial cells were treated with a non-thermal dielectric barrier discharge plasma in vitro. Plasma treatment of phosphate-buffered saline (PBS) and serum-free medium increased ROS concentration in a dose-dependent manner, with a higher concentration observed in serum-free medium compared with PBS. Species concentration inside cells peaked 1 h after treatment, followed by a decrease 3 h post treatment. Endothelial cells treated with a plasma dose of 4.2 J cm–2 had 1.7 times more cells than untreated samples 5 days after plasma treatment. The 4.2 J cm–2 plasma dose increased two-dimensional migration distance by 40 per cent compared with untreated control, while the number of cells that migrated through a three-dimensional collagen gel increased by 15 per cent. Tube formation was also enhanced by plasma treatment, with tube lengths in plasma-treated samples measuring 2.6 times longer than control samples. A fibroblast growth factor-2 (FGF-2) neutralizing antibody and ROS scavengers abrogated these angiogenic effects. These data indicate that plasma enhanced proliferation, migration and tube formation is due to FGF-2 release induced by plasma-produced ROS. Non-thermal plasma may be used as a potential tool for applying ROS in precise doses to enhance vascularization. PMID:21653568

  4. Claudin-3 expression in radiation-exposed rat models: A potential marker for radiation-induced intestinal barrier failure

    SciTech Connect

    Shim, Sehwan; Lee, Jong-geol; Bae, Chang-hwan; Lee, Seung Bum; Jang, Won-Suk; Lee, Sun-Joo; Lee, Seung-Sook; Park, Sunhoo


    Highlights: • Irradiation increased intestinal bacterial translocation, accompanied by claudin protein expression in rats. • Neurotensin decreased the bacterial translocation and restored claudin-3 expression. • Claudin-3 can be used as a marker in evaluating radiation induced intestinal injury. - Abstract: The molecular events leading to radiation-induced intestinal barrier failure are not well known. The influence of the expression of claudin proteins in the presence and absence of neurotensin was investigated in radiation-exposed rat intestinal epithelium. Wistar rats were randomly divided into control, irradiation, and irradiation + neurotensin groups, and bacterial translocation to the mesenteric lymph node and expression of claudins were determined. Irradiation led to intestinal barrier failure as demonstrated by significant bacterial translocation. In irradiated terminal ilea, expression of claudin-3 and claudin-4 was significantly decreased, and claudin-2 expression was increased. Administration of neurotensin significantly reduced bacterial translocation and restored the structure of the villi as seen by histologic examination. Among the three subtype of claudins, only claudin-3 expression was restored. These results suggest that the therapeutic effect of neurotensin on the disruption of the intestinal barrier is associated with claudin-3 alteration and that claudin-3 could be used as a marker in evaluating radiation-induced intestinal injury.

  5. Hypo-osmotic shock-induced subclinical inflammation of skin in a rat model of disrupted skin barrier function.


    Kishi, Chihiro; Minematsu, Takeo; Huang, Lijuan; Mugita, Yuko; Kitamura, Aya; Nakagami, Gojiro; Yamane, Takumi; Yoshida, Mikako; Noguchi, Hiroshi; Funakubo, Megumi; Mori, Taketoshi; Sanada, Hiromi


    Aging disrupts skin barrier function and induces xerosis accompanied by pruritus. In many cases, elderly patients complain of pruritus during skin hygiene care, a condition called aquagenic pruritus of the elderly (APE). To date, the pathophysiology and mechanism of action of APE have not been elucidated. We conducted the present study to test the hypothesis that hypo-osmotic shock of epidermal cells induces skin inflammation and elongation of C-fibers by nerve growth factor β (NGFβ) as a basic mechanism of APE. The dorsal skin of HWY rats, which are a model for disrupted skin barrier function, was treated with distilled water (hypotonic treatment [Hypo] group) or normal saline (isotonic treatment [Iso] group) by applying soaked gauze for 7 days. Untreated rats were used as a control (no-treatment [NT] group). Histochemical and immunohistochemical analyses revealed inflammatory responses in the epidermis and the dermal papillary layer in the Hypo group, while no alterations were observed in the Iso or NT groups. Induction of expression and secretion of NGFβ and elongation of C-fibers into the epidermis were found in the Hypo group. In contrast, secretion of NGFβ was significantly lower and elongation of C-fibers was not observed in the Iso group. These results suggest that hypo-osmotic shock-induced inflammatory reactions promote hypersensitivity to pruritus in skin with disrupted barrier function.

  6. Baicalein induces CD4+Foxp3+ T cells and enhances intestinal barrier function in a mouse model of food allergy

    PubMed Central

    Bae, Min-Jung; Shin, Hee Soon; See, Hye-Jeong; Jung, Sun Young; Kwon, Da-Ae; Shon, Dong-Hwa


    The incidence of food allergy, which is triggered by allergen permeation of the gastrointestinal tract followed by a T-helper (Th) 2-mediated immune response, has been increasing annually worldwide. We examined the effects of baicalein (5,6,7-trihydroxyflavone), a flavonoid from Scutellaria baicalensis used in oriental herbal medicine, on regulatory T (Treg) cell induction and intestinal barrier function through the regulation of tight junctions in a mouse model of food allergy. An allergic response was induced by oral challenge with ovalbumin, and the incidence of allergic symptoms and T cell-related activity in the mesenteric lymph nodes were analyzed with and without the presence of baicalein. Our results demonstrated that the administration of baicalein ameliorated the symptoms of food allergy and attenuated serum IgE and effector T cells. However, Treg-related factors were up-regulated by baicalein. Furthermore, baicalein was shown to enhance intestinal barrier function through the regulation of tight junctions. We also found that baicalein treatment induced the differentiation of Treg cells via aryl hydrocarbon receptors (AhRs). Thus, the action of baicalein as an agonist of AhR can induce Treg differentiation and enhance barrier function, suggesting that baicalein might serve as an effective immune regulator derived from foods for the treatment of food allergy. PMID:27561877

  7. Novel Peptide for Attenuation of Hyperoxia-induced Disruption of Lung Endothelial Barrier and Pulmonary Edema via Modulating Peroxynitrite Formation*

    PubMed Central

    Kondrikov, Dmitry; Gross, Christine; Black, Stephen M.; Su, Yunchao


    Pulmonary damages of oxygen toxicity include vascular leakage and pulmonary edema. We have previously reported that hyperoxia increases the formation of NO and peroxynitrite in lung endothelial cells via increased interaction of endothelial nitric oxide (eNOS) with β-actin. A peptide (P326TAT) with amino acid sequence corresponding to the actin binding region of eNOS residues 326–333 has been shown to reduce the hyperoxia-induced formation of NO and peroxynitrite in lung endothelial cells. In the present study, we found that exposure of pulmonary artery endothelial cells to hyperoxia (95% oxygen and 5% CO2) for 48 h resulted in disruption of monolayer barrier integrity in two phases, and apoptosis occurred in the second phase. NOS inhibitor NG-nitro-l-arginine methyl ester attenuated the endothelial barrier disruption in both phases. Peroxynitrite scavenger uric acid did not affect the first phase but ameliorated the second phase of endothelial barrier disruption and apoptosis. P326TAT inhibited hyperoxia-induced disruption of monolayer barrier integrity in two phases and apoptosis in the second phase. More importantly, injection of P326TAT attenuated vascular leakage, pulmonary edema, and endothelial apoptosis in the lungs of mice exposed to hyperoxia. P326TAT also significantly reduced the increase in eNOS-β-actin association and protein tyrosine nitration. Together, these results indicate that peptide P326TAT ameliorates barrier dysfunction of hyperoxic lung endothelial monolayer and attenuates eNOS-β-actin association, peroxynitrite formation, endothelial apoptosis, and pulmonary edema in lungs of hyperoxic mice. P326TAT can be a novel therapeutic agent to treat or prevent acute lung injury in oxygen toxicity. PMID:25315770

  8. Early radiation-induced endothelial cell loss and blood-spinal cord barrier breakdown in the rat spinal cord.


    Li, Yu-Qing; Chen, Paul; Jain, Vipan; Reilly, Raymond M; Wong, C Shun


    Using a rat spinal cord model, this study was designed to characterize radiation-induced vascular endothelial cell loss and its relationship to early blood-brain barrier disruption in the central nervous system. Adult rats were given a single dose of 0, 2, 8, 19.5, 22, 30 or 50 Gy to the cervical spinal cord. At various times up to 2 weeks after irradiation, the spinal cord was processed for histological and immunohistochemical analysis. Radiation-induced apoptosis was assessed by morphology and TdT-mediated dUTP nick end labeling combined with immunohistochemical markers for endothelial and glial cells. Image analysis was performed to determine endothelial cell and microvessel density using immunohistochemistry with endothelial markers, namely endothelial barrier antigen, glucose transporter isoform 1, laminin and zonula occludens 1. Blood-spinal cord barrier permeability was assessed using immunohistochemistry for albumin and (99m)Tc-diethylenetriamine pentaacetic acid as a vascular tracer. Endothelial cell proliferation was assessed using in vivo BrdU labeling. During the first 24 h after irradiation, apoptotic endothelial cells were observed in the rat spinal cord. The decrease in endothelial cell density at 24 h after irradiation was associated with an increase in albumin immunostaining around microvessels. The decrease in the number of endothelial cells persisted for 7 days and recovery of endothelial density was apparent by day 14. A similar pattern of blood-spinal cord barrier disruption and recovery of permeability was observed over the 2 weeks, and an increase in BrdU-labeled endothelial cells was seen at day 3. These results are consistent with an association between endothelial cell death and acute blood-spinal cord barrier disruption in the rat spinal cord after irradiation.

  9. Microbubble type and distribution dependence of focused ultrasound-induced blood-brain barrier opening.


    Wang, Shutao; Samiotaki, Gesthimani; Olumolade, Oluyemi; Feshitan, Jameel A; Konofagou, Elisa E


    Focused ultrasound, in the presence of microbubbles, has been used non-invasively to induce reversible blood-brain barrier (BBB) opening in both rodents and non-human primates. This study was aimed at identifying the dependence of BBB opening properties on polydisperse microbubble (all clinically approved microbubbles are polydisperse) type and distribution by using a clinically approved ultrasound contrast agent (Definity microbubbles) and in-house prepared polydisperse (IHP) microbubbles in mice. A total of 18 C57 BL/6 mice (n = 3) were used in this study, and each mouse was injected with either Definity or IHP microbubbles via the tail vein. The concentration and size distribution of activated Definity and IHP microbubbles were measured, and the microbubbles were diluted to 6 × 10(8)/mL before injection. Immediately after microbubble administration, mice were subjected to focused ultrasound with the following parameters: frequency = 1.5 MHz, pulse repetition frequency = 10 Hz, 1000 cycles, in situ peak rarefactional acoustic pressures = 0.3, 0.45 and 0.6 MPa for a sonication duration of 60 s. Contrast-enhanced magnetic resonance imaging was used to confirm BBB opening and allowed for image-based analysis. Permeability of the treated region and volume of BBB opening did not significantly differ between the two types of microbubbles (p > 0.05) at peak rarefractional acoustic pressures of 0.45 and 0.6 MPa, whereas IHP microbubbles had significantly higher permeability and opening volume (p < 0.05) at the relatively lower pressure of 0.3 MPa. The results from this study indicate that microbubble type and distribution could have significant effects on focused ultrasound-induced BBB opening at lower pressures, but less important effects at higher pressures, possibly because of the stable cavitation that governs the former. This difference may have become less significant at higher pressures, where inertial cavitation typically occurs.

  10. Americium/curium bushing melter drain tests

    SciTech Connect

    Smith, M.E.; Hardy, B.J.; Smith, M.E.


    Americium and curium were produced in the past at the Savannah River Site (SRS) for research, medical, and radiological applications. They have been stored in a nitric acid solution in an SRS reprocessing facility for a number of years. Vitrification of the americium/curium (Am/Cm) solution will allow the material to be safely stored or transported to the DOE Oak Ridge Reservation. Oak Ridge is responsible for marketing radionuclides for research and medical applications. The bushing melter technology being used in the Am/Cm vitrification research work is also under consideration for the stabilization of other actinides such as neptunium and plutonium. A series of melter drain tests were conducted at the Savannah River Technology Center to determine the relationship between the drain tube assembly operating variables and the resulting pour initiation times, glass flowrates, drain tube temperatures, and stop pour times. Performance criteria such as ability to start and stop pours in a controlled manner were also evaluated. The tests were also intended to provide support of oil modeling of drain tube performance predictions and thermal modeling of the drain tube and drain tube heater assembly. These drain tests were instrumental in the design of subsequent melter drain tube and drain tube heaters for the Am/Cm bushing melter, and therefore in the success of the Am/Cm vitrification and plutonium immobilization programs.

  11. Rhinovirus-Induced Barrier Dysfunction in Polarized Airway Epithelial Cells Is Mediated by NADPH Oxidase 1▿

    PubMed Central

    Comstock, Adam T.; Ganesan, Shyamala; Chattoraj, Asamanja; Faris, Andrea N.; Margolis, Benjamin L.; Hershenson, Marc B.; Sajjan, Umadevi S.


    Previously, we showed that rhinovirus (RV), which is responsible for the majority of common colds, disrupts airway epithelial barrier function, as evidenced by reduced transepithelial resistance (RT), dissociation of zona occludins 1 (ZO-1) from the tight junction complex, and bacterial transmigration across polarized cells. We also showed that RV replication is required for barrier function disruption. However, the underlying biochemical mechanisms are not known. In the present study, we found that a double-stranded RNA (dsRNA) mimetic, poly(I:C), induced tight junction breakdown and facilitated bacterial transmigration across polarized airway epithelial cells, similar to the case with RV. We also found that RV and poly(I:C) each stimulated Rac1 activation, reactive oxygen species (ROS) generation, and Rac1-dependent NADPH oxidase 1 (NOX1) activity. Inhibitors of Rac1 (NSC23766), NOX (diphenylene iodonium), and NOX1 (small interfering RNA [siRNA]) each blocked the disruptive effects of RV and poly(I:C) on RT, as well as the dissociation of ZO-1 and occludin from the tight junction complex. Finally, we found that Toll-like receptor 3 (TLR3) is not required for either poly(I:C)- or RV-induced reductions in RT. Based on these results, we concluded that Rac1-dependent NOX1 activity is required for RV- or poly(I:C)-induced ROS generation, which in turn disrupts the barrier function of polarized airway epithelia. Furthermore, these data suggest that dsRNA generated during RV replication is sufficient to disrupt barrier function. PMID:21507984

  12. Sepsis induces albuminuria and alterations in the glomerular filtration barrier: a morphofunctional study in the rat

    PubMed Central


    Introduction Increased vascular permeability represents one of the hallmarks of sepsis. In the kidney, vascular permeability is strictly regulated by the 'glomerular filtration barrier' (GFB), which is comprised of glomerular endothelium, podocytes, their interposed basement membranes and the associated glycocalyx. Although it is likely that the GFB and its glycocalyx are altered during sepsis, no study has specifically addressed this issue. The aim of this study was to evaluate whether albuminuria -- the hallmark of GFB perm-selectivity -- occurs in the initial stage of sepsis and whether it is associated with morphological and biochemical changes of the GFB. Methods Cecal ligation and puncture (CLP) was used to induce sepsis in the rat. Tumor necrosis factor (TNF)-alpha levels in plasma and growth of microorganisms in the peritoneal fluid were evaluated at 0, 3 and 7 hours after CLP or sham-operation. At the same times, kidney specimens were collected and structural and ultrastructural alterations in the GFB were assessed. In addition, several components of GFB-associated glycocalyx, syndecan-1, hyluronan (HA) and sialic acids were evaluated by immunofluorescence, immunohistochemistry and lectin histochemistry techniques. Serum creatinine and creatinine clearance were measured to assess kidney function and albuminuria for changes in GFB permeability. Analysis of variance followed by Tukey's multiple comparison test was used. Results Septic rats showed increased TNF-alpha levels and growth of microorganisms in the peritoneal fluid. Only a few renal corpuscles had major ultrastructural and structural alterations and no change in serum creatinine or creatinine clearance was observed. Contrarily, urinary albumin significantly increased after CLP and was associated with diffuse alteration in the glycocalyx of the GFB, which consisted in a decrease in syndecan-1 expression and in HA and sialic acids contents. Sialic acids were also changed in their structure

  13. Defect distribution and Schottky barrier at metal/Ge interfaces: Role of metal-induced gap states

    NASA Astrophysics Data System (ADS)

    Sasaki, Shogo; Nakayama, Takashi


    The defect distribution and Schottky barrier at metal/Ge interfaces were studied using first-principles calculation. It was shown that the defect density markedly increases around the interface owing to the stabilization caused by the hybridization of defect electronic states with metal-induced gap states (MIGS) and by the associated small elastic energy loss around the interface. By comparing the formation energies of various defects at a variety of metal/substrate interfaces, we showed that MIGS not only control the Schottky barrier but also promote a defect-density increase at most metal/semiconductor interfaces. Moreover, we showed that interface oxide layers block MIGS penetration into the Ge substrate and promote the observed breakdown of Fermi-level pinning.


    NASA Astrophysics Data System (ADS)

    Duhan, Sukhvinder S.; Singh, Manjeet; Kharab, Rajesh


    We have studied the effects of nuclear induced breakup channel coupling on the fusion cross-section for 6Li+12C and 6He+12C systems in the near barrier energy regime using the dynamic polarization potential (DPP) approach. It has been found that there is enhancement in the fusion cross-section with respect to standard one-dimensional barrier penetration model in the below barrier energy regime while at energies above the barrier there is suppression of fusion cross-section with respect to simple barrier penetration model is observed. The agreement between data and predictions for 6Li+12C system improves significantly as a result of the inclusion of nuclear induced DPP.

  15. Statins Inhibit Fibrillary β-Amyloid Induced Inflammation in a Model of the Human Blood Brain Barrier

    PubMed Central

    Griffin, Jarred M.; Kho, Dan; Graham, E. Scott; Nicholson, Louise F. B.; O’Carroll, Simon J.


    Background Astrocytes and cerebral endothelial cells are important components of the blood-brain barrier (BBB). Disruption to this barrier through inflammation is a major contributor to Alzheimer’s disease (AD) pathology. The amyloid beta (Aβ) protein is known to exist in several forms and is a key modulator of AD that is known to cause inflammation and changes to BBB function. While one of these forms, fibrillary Aβ (fAβ), is known to cause endothelial cell death at the BBB, no studies have looked specifically at its role on inflammation in a model of the human BBB. Aims To determine if fAβ is inflammatory to the human BBB. As statins have been shown to be anti-inflammatory and protective in AD, we also tested if these could inhibit the inflammatory effect of fAβ. Methods Using cultured cerebral endothelial cells and astrocytes we determined changes in cytokine release, cell toxicity and barrier function in response to fibrillary β-amyloid1–42 (fAβ1–42) alone and in combination with statins. Results fAβ1–42 induced inflammatory cytokine release from endothelial cells in the absence of cell toxicity. It also induced astrocyte cytokine release and cell death and caused a loss of barrier integrity. Statin treatment inhibited all of these effects. Conclusions We conclude that fAβ1–42 has both inflammatory and cytotoxic effects on the BBB and the protective effect of statins in AD may in part be through inhibiting these effects. PMID:27309956

  16. Effect of heat stress on endotoxin flux across mesenteric-drained and portal-drained viscera of dairy goat.


    Wang, L; Xue, B; Wang, K; Li, S; Li, Z


    This study was designed to evaluate the effect of heat stress on endotoxin flux across mesenteric-drained and portal-drained viscera of dairy goats. Three Saanen first lactation dairy goats were surgically fitted with indwelling catheters in the portal vein, the mesenteric vein and carotid, and were kept in thermal-neutral and then heat stress environment, for examining the effect of heat stress on endotoxin absorption and redox status. Average net absorption of endotoxin (EU/h) across mesenteric-drained viscera (MDV) and portal-drained viscera (PDV) during the whole period of heat stress increased by 279.05% and 227.92% in relation to thermo-neutral period. Plasma concentration of glutathione peroxidase (GSH-Px) and catalase (CAT) in mesenteric and portal vein, and that of superoxide dismutase (SOD) in mesenteric vein, increased significantly during heat stress. Main conclusions were: (i) net absorption of endotoxin in portal vein is mainly from non-mesenteric tissues both in heat stress and in thermo-neutral condition; (ii) heat stress may lead to the significant decrease in plasma SOD, GSH-Px, CAT flux across PDV and MDV, and the significant increase in endotoxin flux across PDV and MDV; and (iii) the increase in gastrointestinal permeability in dairy goats during heat stress may not be induced by the increase in oxidative stress.

  17. 14 CFR 25.1021 - Oil system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Oil system drains. 25.1021 Section 25.1021... STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Oil System § 25.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be...

  18. 14 CFR 25.1021 - Oil system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Oil system drains. 25.1021 Section 25.1021... STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Oil System § 25.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be...

  19. 14 CFR 27.1021 - Oil system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Oil system drains. 27.1021 Section 27.1021... STANDARDS: NORMAL CATEGORY ROTORCRAFT Powerplant Oil System § 27.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be accessible; and...

  20. 14 CFR 27.1021 - Oil system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Oil system drains. 27.1021 Section 27.1021... STANDARDS: NORMAL CATEGORY ROTORCRAFT Powerplant Oil System § 27.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be accessible; and...

  1. 14 CFR 29.1021 - Oil system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Oil system drains. 29.1021 Section 29.1021... STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Oil System § 29.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be...

  2. 14 CFR 27.1021 - Oil system drains.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Oil system drains. 27.1021 Section 27.1021... STANDARDS: NORMAL CATEGORY ROTORCRAFT Powerplant Oil System § 27.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be accessible; and...

  3. 14 CFR 27.1021 - Oil system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Oil system drains. 27.1021 Section 27.1021... STANDARDS: NORMAL CATEGORY ROTORCRAFT Powerplant Oil System § 27.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be accessible; and...

  4. 14 CFR 25.1021 - Oil system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Oil system drains. 25.1021 Section 25.1021... STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Oil System § 25.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be...

  5. 14 CFR 25.1021 - Oil system drains.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Oil system drains. 25.1021 Section 25.1021... STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Oil System § 25.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be...

  6. 14 CFR 29.1021 - Oil system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Oil system drains. 29.1021 Section 29.1021... STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Oil System § 29.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be...

  7. 14 CFR 29.1021 - Oil system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Oil system drains. 29.1021 Section 29.1021... STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Oil System § 29.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each drain must— (a) Be...

  8. Transforming Growth Factor-β Regulation of Epithelial Tight Junction Proteins Enhances Barrier Function and Blocks Enterohemorrhagic Escherichia coli O157:H7-Induced Increased Permeability

    PubMed Central

    Howe, Kathryn L.; Reardon, Colin; Wang, Arthur; Nazli, Aisha; McKay, Derek M.


    Enterohemorrhagic Escherichia coli O157:H7 (EHEC) is an enteric pathogen that causes potentially fatal symptoms after intimate adhesion, modulation of intestinal epithelial signal transduction, and alteration of epithelial function (eg, barrier disruption). Although the epithelial barrier is critical to gut homeostasis, only a few agents, such as transforming growth factor (TGF)-β, can enhance or protect epithelial barrier function. Our aims were to delineate the mechanism(s) behind TGF-β-induced barrier enhancement and to determine whether TGF-β could prevent EHEC-induced barrier disruption. Using monolayers of the human T84 colonic epithelial cell line, we found that TGF-β induced a significant increase in transepithelial electrical resistance (a measure of paracellular permeability) through activation of ERK MAPK and SMAD signaling pathways and up-regulation of the tight junction protein claudin-1. Additionally, TGF-β pretreatment of epithelia blocked the decrease in transepithelial electrical resistance and the increase in transepithelial passage of [3H]-mannitol caused by EHEC infection. EHEC infection was associated with reduced expression of zonula occludens-1, occludin, and claudin-2 (but not claudin-1 or claudin-4); TGF-β pretreatment prevented these changes. These studies provide insight into EHEC pathogenesis by illustrating the mechanisms underlying TGF-β-induced epithelial barrier enhancement and identifying TGF-β as an agent capable of blocking EHEC-induced increases in epithelial permeability via maintenance of claudin-2, occludin, and zonula occludens-1 levels. PMID:16314472

  9. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice

    PubMed Central

    Okano, Junko; Kojima, Hideto; Katagi, Miwako; Nakagawa, Takahiko; Nakae, Yuki; Terashima, Tomoya; Kurakane, Takeshi; Kubota, Mamoru; Maegawa, Hiroshi; Udagawa, Jun


    Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyperglycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/without insulin therapy. The results showed that dye leakages were prominent, and transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of the protein associated with the tight junction structure, tight junction protein-1 (ZO-1), was characterized by diffuse and significantly wider expression in the diabetic mice compared to that in the control mice. In turn, epidermal cell number was significantly reduced and basal cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the number of corneocytes, namely, denucleated and terminally differentiated keratinocytes significantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic mice. We found that cell proliferation was significantly decreased, while apoptotic cells were comparable in the skin of diabetic mice, compared to those in the control mice. In the epidermis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were ectopically induced in diabetic mice. These data suggest that hyperglycemia altered keratinocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the proliferation/differentiation process could be the underlying mechanisms for impaired skin barrier functions in diabetic mice. PMID:27846299

  10. Remediation of hemorrhagic shock-induced intestinal barrier dysfunction by treatment with diphenyldihaloketones EF24 and CLEFMA.


    Yadav, Vivek R; Hussain, Alamdar; Sahoo, Kaustuv; Awasthi, Vibhudutta


    Gut is very sensitive to hypoperfusion and hypoxia, and deranged gastrointestinal barrier is implicated in systemic failure of various organs. We recently demonstrated that diphenyldihaloketone EF24 [3,5-bis(2-fluorobenzylidene)piperidin-4-one] improves survival in a rat model of hemorrhagic shock. In this study, we tested EF24 and its other analog CLEFMA (4-[3,5-bis(2-chlorobenzylidene)-4-oxo-piperidine-1-yl]-4-oxo-2-butenoic acid) for their effect on intestinal barrier dysfunction in hypovolemic shock. Hypovolemia was induced in rats by withdrawing 50% of blood. EF24 or CLEFMA (0.4 mg/kg i.p.) treatment was provided, without volume resuscitation, after 1 hour of hemorrhage. Ileum was collected 5 hours after the treatment to investigate the expression of tight junction proteins (zonula occludens, claudin, and occludin) and epithelial injury markers [myeloperoxidase, ileal lipid-binding protein (ILBP), CD163, and plasma citrulline]. The ileal permeability for dextran-fluoroisothiocyanate and Evan's blue dye was determined. EF24 and CLEFMA reduced the hypovolemia-induced plasma citrulline levels and the ileal expression of myeloperoxidase, ILBP, and CD163. The drugs also restored the basal expression levels of zonula occludens, claudin, and occludin, which were substantially deranged by hypovolemia. In ischemic ileum, the expression of phospho(tyrosine)-zonula occludens-1 was reduced, which was reinstated by EF24 and CLEFMA. In contrast, the drug treatments maintained the hypovolemia-induced expression of phospho(threonine)-occludin, but reduced that of phospho(tyrosine)-occludin. Both EF24 and CLEFMA treatments reduced the intestinal permeability enhanced by hypovolemia. EF24 and CLEFMA attenuate hypovolemic gut pathology and protect barrier function by restoring the status of tight junction proteins. These effects were observed in unresuscitated shock, implying the benefit of EF24 and CLEFMA in prehospital care of shock.

  11. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice.


    Okano, Junko; Kojima, Hideto; Katagi, Miwako; Nakagawa, Takahiko; Nakae, Yuki; Terashima, Tomoya; Kurakane, Takeshi; Kubota, Mamoru; Maegawa, Hiroshi; Udagawa, Jun


    Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyperglycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/without insulin therapy. The results showed that dye leakages were prominent, and transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of the protein associated with the tight junction structure, tight junction protein-1 (ZO-1), was characterized by diffuse and significantly wider expression in the diabetic mice compared to that in the control mice. In turn, epidermal cell number was significantly reduced and basal cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the number of corneocytes, namely, denucleated and terminally differentiated keratinocytes significantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic mice. We found that cell proliferation was significantly decreased, while apoptotic cells were comparable in the skin of diabetic mice, compared to those in the control mice. In the epidermis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were ectopically induced in diabetic mice. These data suggest that hyperglycemia altered keratinocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the proliferation/differentiation process could be the underlying mechanisms for impaired skin barrier functions in diabetic mice.

  12. Unsteady draining flows from a rectangular tank

    NASA Astrophysics Data System (ADS)

    Forbes, Lawrence K.; Hocking, Graeme C.


    Two-dimensional, unsteady flow of a two-layer fluid in a tank is considered. Each fluid is inviscid and flows irrotationally. The lower, denser fluid flows with constant speed out through a drain hole of finite width in the bottom of the tank. The upper, lighter fluid is recharged at the top of the tank, with an input volume flux that matches the outward flux through the drain. As a result, the interface between the two fluids moves uniformly downwards, and is eventually withdrawn through the drain hole. However, waves are present at the interface, and they have a strong effect on the time at which the interface is first drawn into the drain. A linearized theory valid for small extraction rates is presented. Fully nonlinear, unsteady solutions are computed by means of a novel numerical technique based on Fourier series. For impulsive start of the drain, the nonlinear results are found to agree with the linearized theory initially, but the two theories differ markedly as the interface approaches the drain and nonlinear effects dominate. For wide drains, curvature singularities appear to form at the interface within finite time.

  13. Activation of RhoA, but Not Rac1, Mediates Early Stages of S1P-Induced Endothelial Barrier Enhancement.


    Zhang, Xun E; Adderley, Shaquria P; Breslin, Jerome W


    Compromised endothelial barrier function is a hallmark of inflammation. Rho family GTPases are critical in regulating endothelial barrier function, yet their precise roles, particularly in sphingosine-1-phosphate (S1P)-induced endothelial barrier enhancement, remain elusive. Confluent cultures of human umbilical vein endothelial cells (HUVEC) or human dermal microvascular endothelial cells (HDMEC) were used to model the endothelial barrier. Barrier function was assessed by determining the transendothelial electrical resistance (TER) using an electrical cell-substrate impedance sensor (ECIS). The roles of Rac1 and RhoA were tested in S1P-induced barrier enhancement. The results show that pharmacologic inhibition of Rac1 with Z62954982 failed to block S1P-induced barrier enhancement. Likewise, expression of a dominant negative form of Rac1, or knockdown of native Rac1 with siRNA, failed to block S1P-induced elevations in TER. In contrast, blockade of RhoA with the combination of the inhibitors Rhosin and Y16 significantly reduced S1P-induced increases in TER. Assessment of RhoA activation in real time using a fluorescence resonance energy transfer (FRET) biosensor showed that S1P increased RhoA activation primarily at the edges of cells, near junctions. This was complemented by myosin light chain-2 phosphorylation at cell edges, and increased F-actin and vinculin near intercellular junctions, which could all be blocked with pharmacologic inhibition of RhoA. The results suggest that S1P causes activation of RhoA at the cell periphery, stimulating local activation of the actin cytoskeleton and focal adhesions, and resulting in endothelial barrier enhancement. S1P-induced Rac1 activation, however, does not appear to have a significant role in this process.

  14. Temperature dependent study of Fin-FET drain current through optimization of controlling gate parameters and dielectric material

    NASA Astrophysics Data System (ADS)

    Das, Rinku Rani; Maity, Santanu; Muchahary, Deboraj; Bhunia, Chandan Tilak


    Various limitations, such as gate leakage through hot carrier tunnelling, parasitic resistance and capacitance, Drain Induced Barrier Lowering (DIBL), subthreshold slope (SS), and threshold voltage roll-off are present due to size reduction. Improvements in transistor speed and performance while, reducing the device dimensions is possible using the concept of Multiple-gate Field Effect phenomenon. Temperature dependency in thin fin transistor has been systematically studied with respect to the dependence on the fin width, fin height, and gate length. In this paper the performance of miniaturized Fin-FET structure is optimized. Also, temperature (300K, 400K and 500K) dependent performances on DIBL, SS and threshold voltage are observed and optimized.

  15. Hypoxia/Aglycemia-induced endothelial barrier dysfunction and tight junction protein downregulation can be ameliorated by citicoline.


    Ma, Xiaotang; Zhang, Huiting; Pan, Qunwen; Zhao, Yuhui; Chen, Ji; Zhao, Bin; Chen, Yanfang


    This study explores the effect of citicoline on the permeability and expression of tight junction proteins (TJPs) in endothelial cells under hypoxia/aglycemia conditions. Hypoxia or oxygen and glucose deprivation (OGD) was utilized to induce endothelial barrier breakdown model on human umbilical vein endothelial cells (HUVECs) and mouse brain microvascular endothelial cells (bEnd.3s). The effect of citicoline on endothelial barrier breakdown models was determined at either low or high concentrations. FITC-Dextran flux was used to examine the endothelial permeability. The expression of TJPs was measured by immunofluorescence, Real-time PCR and Western Blot methods. Results showed that hypoxia or OGD increased the permeability of HUVECs accompanied with down-regulation of occludens-1 (ZO-1) and occludin at both mRNA and protein levels. Similarly in bEnd.3s, hypoxia increased the permeability and decreased the expression of ZO-1 and claudin-5. Citicoline treatment dose-dependently decreased the permeability in these two models, which paralleled with elevated expression of TJPs. The data demonstrate that citicoline restores the barrier function of endothelial cells compromised by hypoxia/aglycemia probably via up-regulating the expression of TJPs.

  16. Enteric Pathogens and Their Toxin-Induced Disruption of the Intestinal Barrier through Alteration of Tight Junctions in Chickens

    PubMed Central

    Awad, Wageha A.; Hess, Claudia; Hess, Michael


    Maintaining a healthy gut environment is a prerequisite for sustainable animal production. The gut plays a key role in the digestion and absorption of nutrients and constitutes an initial organ exposed to external factors influencing bird’s health. The intestinal epithelial barrier serves as the first line of defense between the host and the luminal environment. It consists of a continuous monolayer of intestinal epithelial cells connected by intercellular junctional complexes which shrink the space between adjacent cells. Consequently, free passing of solutes and water via the paracellular pathway is prevented. Tight junctions (TJs) are multi-protein complexes which are crucial for the integrity and function of the epithelial barrier as they not only link cells but also form channels allowing permeation between cells, resulting in epithelial surfaces of different tightness. Tight junction’s molecular composition, ultrastructure, and function are regulated differently with regard to physiological and pathological stimuli. Both in vivo and in vitro studies suggest that reduced tight junction integrity greatly results in a condition commonly known as “leaky gut”. A loss of barrier integrity allows the translocation of luminal antigens (microbes, toxins) via the mucosa to access the whole body which are normally excluded and subsequently destroys the gut mucosal homeostasis, coinciding with an increased susceptibility to systemic infection, chronic inflammation and malabsorption. There is considerable evidence that the intestinal barrier dysfunction is an important factor contributing to the pathogenicity of some enteric bacteria. It has been shown that some enteric pathogens can induce permeability defects in gut epithelia by altering tight junction proteins, mediated by their toxins. Resolving the strategies that microorganisms use to hijack the functions of tight junctions is important for our understanding of microbial pathogenesis, because some pathogens

  17. Enteric Pathogens and Their Toxin-Induced Disruption of the Intestinal Barrier through Alteration of Tight Junctions in Chickens.


    Awad, Wageha A; Hess, Claudia; Hess, Michael


    Maintaining a healthy gut environment is a prerequisite for sustainable animal production. The gut plays a key role in the digestion and absorption of nutrients and constitutes an initial organ exposed to external factors influencing bird's health. The intestinal epithelial barrier serves as the first line of defense between the host and the luminal environment. It consists of a continuous monolayer of intestinal epithelial cells connected by intercellular junctional complexes which shrink the space between adjacent cells. Consequently, free passing of solutes and water via the paracellular pathway is prevented. Tight junctions (TJs) are multi-protein complexes which are crucial for the integrity and function of the epithelial barrier as they not only link cells but also form channels allowing permeation between cells, resulting in epithelial surfaces of different tightness. Tight junction's molecular composition, ultrastructure, and function are regulated differently with regard to physiological and pathological stimuli. Both in vivo and in vitro studies suggest that reduced tight junction integrity greatly results in a condition commonly known as "leaky gut". A loss of barrier integrity allows the translocation of luminal antigens (microbes, toxins) via the mucosa to access the whole body which are normally excluded and subsequently destroys the gut mucosal homeostasis, coinciding with an increased susceptibility to systemic infection, chronic inflammation and malabsorption. There is considerable evidence that the intestinal barrier dysfunction is an important factor contributing to the pathogenicity of some enteric bacteria. It has been shown that some enteric pathogens can induce permeability defects in gut epithelia by altering tight junction proteins, mediated by their toxins. Resolving the strategies that microorganisms use to hijack the functions of tight junctions is important for our understanding of microbial pathogenesis, because some pathogens can

  18. Might digital drains speed up the time to thoracic drain removal?


    Afoke, Jonathan; Tan, Carol; Hunt, Ian; Zakkar, Mustafa


    A best evidence topic in thoracic surgery was written according to a structured protocol. The question addressed was: might digital drains speed up the time to thoracic drain removal in terms of time till chest drain removal, hospital stay and overall cost? A total of 296 papers were identified as a result of the search as described below. Of these, five papers provided the best evidence to answer the clinical question. The author, date and country of publication, patient group studied, study type, relevant outcomes, results and study weaknesses of the papers are tabulated. A literature search revealed that several single-centre prospective randomized studies have shown significantly earlier removal of chest drains with digital drains ranging between 0.8 and 2.1 days sooner. However, there was heterogeneity in studies in the management protocol of chest drains in terms of the use of suction, number of drains and assessment for drain removal. Some protocols such as routinely keeping drains irrespective of the presence of air leak or drain output may have skewed results. Differences in exclusion criteria and protocols for discharging home with portable devices may have biased results. Due to heterogeneity in the management protocol of chest drains, there is conflicting evidence regarding hospital stay. The limited data on cost suggest that there may be significantly lower postoperative costs in the digital drain group. All the studies were single-centre series generally including patients with good preoperative lung function tests. Further larger studies with more robust chest drain management protocols are required especially to assess length of hospital stay, cost and whether the results are applicable to a larger patient population.

  19. Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis

    PubMed Central

    van den Bogaard, Ellen H.; Bergboer, Judith G.M.; Vonk-Bergers, Mieke; van Vlijmen-Willems, Ivonne M.J.J.; Hato, Stanleyson V.; van der Valk, Pieter G.M.; Schröder, Jens Michael; Joosten, Irma; Zeeuwen, Patrick L.J.M.; Schalkwijk, Joost


    Topical application of coal tar is one of the oldest therapies for atopic dermatitis (AD), a T helper 2 (Th2) lymphocyte–mediated skin disease associated with loss-of-function mutations in the skin barrier gene, filaggrin (FLG). Despite its longstanding clinical use and efficacy, the molecular mechanism of coal tar therapy is unknown. Using organotypic skin models with primary keratinocytes from AD patients and controls, we found that coal tar activated the aryl hydrocarbon receptor (AHR), resulting in induction of epidermal differentiation. AHR knockdown by siRNA completely abrogated this effect. Coal tar restored filaggrin expression in FLG-haploinsufficient keratinocytes to wild-type levels, and counteracted Th2 cytokine–mediated downregulation of skin barrier proteins. In AD patients, coal tar completely restored expression of major skin barrier proteins, including filaggrin. Using organotypic skin models stimulated with Th2 cytokines IL-4 and IL-13, we found coal tar to diminish spongiosis, apoptosis, and CCL26 expression, all AD hallmarks. Coal tar interfered with Th2 cytokine signaling via dephosphorylation of STAT6, most likely due to AHR-regulated activation of the NRF2 antioxidative stress pathway. The therapeutic effect of AHR activation herein described opens a new avenue to reconsider AHR as a pharmacological target and could lead to the development of mechanism-based drugs for AD. PMID:23348739

  20. Protective Effects of Ferulic Acid against Heat Stress-Induced Intestinal Epithelial Barrier Dysfunction In Vitro and In Vivo.


    He, Shasha; Liu, Fenghua; Xu, Lei; Yin, Peng; Li, Deyin; Mei, Chen; Jiang, Linshu; Ma, Yunfei; Xu, Jianqin


    Heat stress is important in the pathogenesis of intestinal epithelial barrier dysfunction. Ferulic acid (FA), a phenolic acid widely found in fruits and vegetables, can scavenge free radicals and activate cell stress responses. This study is aimed at investigating protective effects of FA on heat stress-induced dysfunction of the intestinal epithelial barrier in vitro and in vivo. Intestinal epithelial (IEC-6) cells were pretreated with FA for 4 h and then exposed to heat stress. Heat stress caused decreased transepithelial electrical resistance (TER) and increased permeability to 4-kDa fluorescein isothiocyanate (FITC)-dextran (FD4). Both effects were inhibited by FA in a dose-dependent manner. FA significantly attenuated the decrease in occludin, ZO-1 and E-cadherin expression observed with heat stress. The distortion and redistribution of occludin, ZO-1 and E-cadherin proteins were also effectively prevented by FA pretreatment. Moreover, heat stress diminished electron-dense material detected in tight junctions (TJs), an effect also alleviated by FA in a dose-dependent manner. In an in vivo heat stress model, FA (50 mg/kg) was administered to male Sprague-Dawley rats for 7 consecutive days prior to exposure to heat stress. FA pretreatment significantly attenuated the effects of heat stress on the small intestine, including the increased FD4 permeability, disrupted tight junctions and microvilli structure, and reduced occludin, ZO-1 and E-cadherin expression. Taken together, our results demonstrate that FA pretreatment is potentially protective against heat stress-induced intestinal epithelial barrier dysfunction.

  1. Propionate Ameliorates Dextran Sodium Sulfate-Induced Colitis by Improving Intestinal Barrier Function and Reducing Inflammation and Oxidative Stress

    PubMed Central

    Tong, Ling-chang; Wang, Yue; Wang, Zhi-bin; Liu, Wei-ye; Sun, Sheng; Li, Ling; Su, Ding-feng; Zhang, Li-chao


    Propionate is a short chain fatty acid that is abundant as butyrate in the gut and blood. However, propionate has not been studied as extensively as butyrate in the treatment of colitis. The present study was to investigate the effects of sodium propionate on intestinal barrier function, inflammation and oxidative stress in dextran sulfate sodium (DSS)-induced colitis mice. Animals in DSS group received drinking water from 1 to 6 days and DSS [3% (w/v) dissolved in double distilled water] instead of drinking water from 7 to 14 days. Animals in DSS+propionate (DSS+Prop) group were given 1% sodium propionate for 14 consecutive days and supplemented with 3% DSS solution on day 7–14. Intestinal barrier function, proinflammatory factors, oxidative stress, and signal transducer and activator of transcription 3 (STAT3) signaling pathway in the colon were determined. It was found that sodium propionate ameliorated body weight loss, colon-length shortening and colonic damage in colitis mice. Sodium propionate significantly inhibited the increase of FITC-dextran in serum and the decrease of zonula occludens-1 (ZO-1), occludin, and E-cadherin expression in the colonic tissue. It also inhibited the expression of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α) mRNA and phosphorylation of STAT3 in colitis mice markedly, reduced the myeloperoxidase (MPO) level, and increased the superoxide dismutase and catalase level in colon and serum compared with DSS group. Sodium propionate inhibited macrophages with CD68 marker infiltration into the colonic mucosa of colitis mice. These results suggest that oral administration of sodium propionate could ameliorate DSS-induced colitis mainly by improving intestinal barrier function and reducing inflammation and oxidative stress via the STAT3 signaling pathway. PMID:27574508

  2. Alpha-Melanocyte Stimulating Hormone Protects against Cytokine-Induced Barrier Damage in Caco-2 Intestinal Epithelial Monolayers

    PubMed Central

    Váradi, Judit; Harazin, András; Fenyvesi, Ferenc; Réti-Nagy, Katalin; Gogolák, Péter; Vámosi, György; Bácskay, Ildikó; Fehér, Pálma; Ujhelyi, Zoltán; Vasvári, Gábor; Róka, Eszter; Haines, David; Deli, Mária A.; Vecsernyés, Miklós


    Alpha-melanocyte-stimulating hormone (α-MSH) is a potent anti-inflammatory peptide with cytoprotective effect in various tissues. The present investigation demonstrates the ability of α-MSH to interact with intestinal epithelial cell monolayers and mitigate inflammatory processes of the epithelial barrier. The protective effect of α-MSH was studied on Caco-2 human intestinal epithelial monolayers, which were disrupted by exposure to tumor necrosis factor-α and interleukin-1β. The barrier integrity was assessed by measuring transepithelial electric resistance (TEER) and permeability for marker molecules. Caco-2 monolayers were evaluated by immunohistochemistry for expression of melanocortin-1 receptor and tight junction proteins ZO-1 and claudin-4. The activation of nuclear factor kappa beta (NF-κB) was detected by fluorescence microscopy and inflammatory cytokine expression was assessed by flow cytometric bead array cytokine assay. Exposure of Caco-2 monolayers to proinflammatory cytokines lowered TEER and increased permeability for fluorescein and albumin, which was accompanied by changes in ZO-1 and claudin-4 immunostaining. α-MSH was able to prevent inflammation-associated decrease of TEER in a dose-dependent manner and reduce the increased permeability for paracellular marker fluorescein. Further immunohistochemistry analysis revealed proinflammatory cytokine induced translocation of the NF-κB p65 subunit into Caco-2 cell nuclei, which was inhibited by α-MSH. As a result the IL-6 and IL-8 production of Caco-2 monolayers were also decreased with different patterns by the addition of α-MSH to the culture medium. In conclusion, Caco-2 cells showed a positive immunostaining for melanocortin-1 receptor and α-MSH protected Caco-2 cells against inflammatory barrier dysfunction and inflammatory activation induced by tumor necrosis factor-α and interleukin-1β cytokines. PMID:28103316

  3. Super natural killer cells that target metastases in the tumor draining lymph nodes.


    Chandrasekaran, Siddarth; Chan, Maxine F; Li, Jiahe; King, Michael R


    Tumor draining lymph nodes are the first site of metastasis in most types of cancer. The extent of metastasis in the lymph nodes is often used in staging cancer progression. We previously showed that nanoscale TRAIL liposomes conjugated to human natural killer cells enhance their endogenous therapeutic potential in killing cancer cells cultured in engineered lymph node microenvironments. In this work, it is shown that liposomes decorated with apoptosis-inducing ligand TRAIL and an antibody against a mouse natural killer cell marker are carried to the tumor draining inguinal lymph nodes and prevent the lymphatic spread of a subcutaneous tumor in mice. It is shown that targeting natural killer cells with TRAIL liposomes enhances their retention time within the tumor draining lymph nodes to induce apoptosis in cancer cells. It is concluded that this approach can be used to kill cancer cells within the tumor draining lymph nodes to prevent the lymphatic spread of cancer.

  4. Short-chain fatty acids activate AMP-activated protein kinase and ameliorate ethanol-induced intestinal barrier dysfunction in Caco-2 cell monolayers.


    Elamin, Elhaseen E; Masclee, Ad A; Dekker, Jan; Pieters, Harm-Jan; Jonkers, Daisy M


    Short-chain fatty acids (SCFAs) have been shown to promote intestinal barrier function, but their protective effects against ethanol-induced intestinal injury and underlying mechanisms remain essentially unknown. The aim of the study was to analyze the influence of SCFAs on ethanol-induced barrier dysfunction and to examine the role of AMP-activated protein kinase (AMPK) as a possible mechanism using Caco-2 monolayers. The monolayers were treated apically with butyrate (2, 10, or 20 mmol/L), propionate (4, 20, or 40 mmol/L), or acetate (8, 40, or 80 mmol/L) for 1 h before ethanol (40 mmol/L) for 3 h. Barrier function was analyzed by measurement of transepithelial resistance and permeation of fluorescein isothiocyanate-labeled dextran. Distribution of the tight junction (TJ) proteins zona occludens-1, occludin, and filamentous-actin (F-actin) was examined by immunofluorescence. Metabolic stress was determined by measuring oxidative stress, mitochondrial function, and ATP using dichlorofluorescein diacetate, dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide, and bioluminescence assay, respectively. AMPK was knocked down by small interfering RNA (siRNA), and its activity was assessed by a cell-based ELISA. Exposure to ethanol significantly impaired barrier function compared with controls (P < 0.0001), disrupted TJ and F-actin cytoskeleton integrity, and induced metabolic stress. However, pretreatment with 2 mmol/L butyrate, 4 mmol/L propionate, and 8 mmol/L acetate significantly alleviated the ethanol-induced barrier dysfunction, TJ and F-actin disruption, and metabolic stress compared with ethanol-exposed monolayers (P < 0.0001). The promoting effects on barrier function were abolished by inhibiting AMPK using either compound C or siRNA. These observations indicate that SCFAs exhibit protective effects against ethanol-induced barrier disruption via AMPK activation, suggesting a potential for SCFAs as prophylactic and/or therapeutic factors against ethanol-induced

  5. A unified analytical drain current model for Double-Gate Junctionless Field-Effect Transistors including short channel effects

    NASA Astrophysics Data System (ADS)

    Raksharam; Dutta, Aloke K.


    In this paper, a unified analytical model for the drain current of a symmetric Double-Gate Junctionless Field-Effect Transistor (DG-JLFET) is presented. The operation of the device has been classified into four modes: subthreshold, semi-depleted, accumulation, and hybrid; with the main focus of this work being on the accumulation mode, which has not been dealt with in detail so far in the literature. A physics-based model, using a simplified one-dimensional approach, has been developed for this mode, and it has been successfully integrated with the model for the hybrid mode. It also includes the effect of carrier mobility degradation due to the transverse electric field, which was hitherto missing in the earlier models reported in the literature. The piece-wise models have been unified using suitable interpolation functions. In addition, the model includes two most important short-channel effects pertaining to DG-JLFETs, namely the Drain Induced Barrier Lowering (DIBL) and the Subthreshold Swing (SS) degradation. The model is completely analytical, and is thus computationally highly efficient. The results of our model have shown an excellent match with those obtained from TCAD simulations for both long- and short-channel devices, as well as with the experimental data reported in the literature.

  6. Trapping in GaN-based metal-insulator-semiconductor transistors: Role of high drain bias and hot electrons

    SciTech Connect

    Meneghini, M. Bisi, D.; Meneghesso, G.; Zanoni, E.


    This paper describes an extensive analysis of the role of off-state and semi-on state bias in inducing the trapping in GaN-based power High Electron Mobility Transistors. The study is based on combined pulsed characterization and on-resistance transient measurements. We demonstrate that—by changing the quiescent bias point from the off-state to the semi-on state—it is possible to separately analyze two relevant trapping mechanisms: (i) the trapping of electrons in the gate-drain access region, activated by the exposure to high drain bias in the off-state; (ii) the trapping of hot-electrons within the AlGaN barrier or the gate insulator, which occurs when the devices are operated in the semi-on state. The dependence of these two mechanisms on the bias conditions and on temperature, and the properties (activation energy and cross section) of the related traps are described in the text.

  7. Partial Enteral Nutrition Mitigated Ischemia/Reperfusion-Induced Damage of Rat Small Intestinal Barrier

    PubMed Central

    Wu, Chao; Wang, Xinying; Jiang, Tingting; Li, Chaojun; Zhang, Li; Gao, Xuejin; Tian, Feng; Li, Ning; Li, Jieshou


    Background and Aims: This study was designed to investigate a relatively optimum dose of partial enteral nutrition (PEN) which effectively attenuates intestinal barrier dysfunction initiated by ischemia/reperfusion injury (IRI). Methods: In experiment 1, 60 male Sprague-Dawley (SD) rats were subjected to intestinal IRI and assigned to six groups according to the different proportion of EN administrations: namely total parenteral nutrition (TPN or 0%EN), 10%EN, 20%EN, 40%EN, 60%EN, and total enteral nutrition (TEN or 100%) groups, the deficits of intraluminal calorie were supplemented by PN. In experiment 2, 50 male SD rats were subjected to intestinal IRI and divided into five groups based on the results of experiment 1: TPN, TEN, 20%EN, TPN plus pretreatment with NF-κB antagonist 30 min before IRI (TPN+PDTC), and TPN plus pretreatment with HIF-1α antagonist 30 min before IRI (TPN+YC-1) groups. Results: In experiment 1, previous IRI combined with subsequent EN shortage disrupted the structure of intestinal epithelial cell and tight junctions (TJs). While 20% dose of EN had an obviously protective effect on these detrimental consequences. In experiment 2, compared with TPN only, 20%EN exerted a significant protection of barrier function of intestinal epithelium. Analogous results were observed when TPN combined with specific NF-κB/HIF-1α inhibitors (PDTC and YC-1). Meanwhile, the expression of NF-κB/HIF-1α had a similar trend among the groups. Conclusions: Our findings indicate that 20%EN is the minimally effective dosage of EN which promotes the recovery of intestinal barrier function after IRI in a rat model. Furthermore, we discreetly speculate that this benefit is, at least partly, related to NF-κB/HIF-1α pathway expression. PMID:27548209

  8. Blood-brain barrier dysfunction-induced inflammatory signaling in brain pathology and epileptogenesis.


    Kim, Soo Young; Buckwalter, Marion; Soreq, Hermona; Vezzani, Annamaria; Kaufer, Daniela


    The protection of the brain from blood-borne toxins, proteins, and cells is critical to the brain's normal function. Accordingly, a compromise in the blood-brain barrier (BBB) function accompanies many neurologic disorders, and is tightly associated with brain inflammatory processes initiated by both infiltrating leukocytes from the blood, and activation of glial cells. Those inflammatory processes contribute to determining the severity and prognosis of numerous neurologic disorders, and can both cause, and result from BBB dysfunction. In this review we examine the role of BBB and inflammatory responses, in particular activation of transforming grown factor β (TGFβ) signaling, in epilepsy, stroke, and Parkinson's disease.

  9. CD36 and Fyn kinase mediate malaria-induced lung endothelial barrier dysfunction in mice infected with Plasmodium berghei.


    Anidi, Ifeanyi U; Servinsky, Laura E; Rentsendorj, Otgonchimeg; Stephens, R Scott; Scott, Alan L; Pearse, David B


    Severe malaria can trigger acute lung injury characterized by pulmonary edema resulting from increased endothelial permeability. However, the mechanism through which lung fluid conductance is altered during malaria remains unclear. To define the role that the scavenger receptor CD36 may play in mediating this response, C57BL/6J (WT) and CD36-/- mice were infected with P. berghei ANKA and monitored for changes in pulmonary endothelial barrier function employing an isolated perfused lung system. WT lungs demonstrated a >10-fold increase in two measures of paracellular fluid conductance and a decrease in the albumin reflection coefficient (σalb) compared to control lungs indicating a loss of barrier function. In contrast, malaria-infected CD36-/- mice had near normal fluid conductance but a similar reduction in σalb. In WT mice, lung sequestered iRBCs demonstrated production of reactive oxygen species (ROS). To determine whether knockout of CD36 could protect against ROS-induced endothelial barrier dysfunction, mouse lung microvascular endothelial monolayers (MLMVEC) from WT and CD36-/- mice were exposed to H2O2. Unlike WT monolayers, which showed dose-dependent decreases in transendothelial electrical resistance (TER) from H2O2 indicating loss of barrier function, CD36-/- MLMVEC demonstrated dose-dependent increases in TER. The differences between responses in WT and CD36-/- endothelial cells correlated with important differences in the intracellular compartmentalization of the CD36-associated Fyn kinase. Malaria infection increased total lung Fyn levels in CD36-/- lungs compared to WT, but this increase was due to elevated production of the inactive form of Fyn further suggesting a dysregulation of Fyn-mediated signaling. The importance of Fyn in CD36-dependent endothelial signaling was confirmed using in vitro Fyn knockdown as well as Fyn-/- mice, which were also protected from H2O2- and malaria-induced lung endothelial leak, respectively. Our results demonstrate

  10. VEGF-A165 potently induces human blood-nerve barrier endothelial cell proliferation, angiogenesis and wound healing in vitro

    PubMed Central

    Reddy, Chetan Lakshmana; Yosef, Nejla; Ubogu, Eroboghene E.


    Several mitogens such as vascular endothelial growth factor (VEGF) have been implicated in mammalian vascular proliferation and repair. However, the molecular mediators of human blood-nerve barrier (BNB) development and specialization are unknown. Primary human endoneurial endothelial cells (pHEndECs) were expanded in vitro and specific mitogen receptors detected by western blot. pHEndECs were cultured with basal medium containing different mitogen concentrations with or without heparin. Non-radioactive cell proliferation, Matrigel™-induced angiogenesis and sterile micropipette injury wound healing assays were performed. Proliferation rates, number and total length of induced microvessels and rate of endothelial cell monolayer wound healing were determined and compared to basal conditions. VEGF-A165 in the presence of heparin, was the most potent inducer of pHEndEC proliferation, angiogenesis and wound healing in vitro. 1.31 nM VEGF-A165 induced ~110% increase in cell proliferation relative to basal conditions (~51% without heparin). 2.62 pM VEGF-A165 induced a 3-fold increase in mean number of microvessels and 3.9-fold increase in total capillary length/field relative to basal conditions. In addition, 0.26 nM VEGF-A165 induced ~1.3-fold increased average rate of endothelial wound healing 4–18 hours after endothelial monolayer injury, mediated by increased cell migration. VEGF-A165 was the only mitogen capable of complete wound closure, occurring within 30 hours following injury via increased cell proliferation. This study demonstrates that VEGF-A165, in the presence of heparin, is a potent inducer of pHEndEC proliferation, angiogenesis and wound healing in vitro. VEGF-A165 may be an important mitogen necessary for human BNB development and recovery in response to peripheral nerve injury. PMID:23712256

  11. The GaN/noble metal interface: metal induced gap states and Schottky barrier heights

    NASA Astrophysics Data System (ADS)

    Picozzi, Silvia; Continenza, Alessandra; Satta, Guido; Massidda, Sandro; Freeman, Arthur J.


    We present ab-initio FLAPW (E. Wimmer, H. Krakauer, M. Weinert and A.J. Freeman, Phys. Rev. B 24), 864 (1981) calculations on N-terminated [001] ordered GaN/Ag and GaN/Au interfaces. Our results show that the density of gap states is appreciable in the interface semiconductor layer; however, the gap states are efficiently screened and become negligible already in the sub-interface layer. The gap states' decay length in the semiconductor side is about 2.0 ± 0.1 Å\\: and seems to be independent of the deposited metal, therefore being, to a good approximation, a bulk GaN property. Our estimated Schottky barrier heights for the GaN/noble-metal interfaces are both smaller than that of the GaN/Al barrier, showing a large dispersion in the values - which seems to exclude the possibility of a Fermi level pinning within the gap. Finally, we investigate the role of atomic positions and of different chemical species at the interface region in determining the final value of the potential line-up.

  12. Photon induced Schottky barrier effects in inverse-extraordinary optoconductance structures

    NASA Astrophysics Data System (ADS)

    Tran, L.; Solin, S. A.; Gilbertson, A.; Cohen, L. F.


    We expand upon our previous work and characterize the photo-dependence of the effective Schottky barrier in EOC and I-EOC heterostructures by measuring the open circuit voltage and the change in the reverse bias resistance. Under full illumination by a 5 mW, 632.8 nm HeNe laser, the barrier is effectively eliminated and the Ti-GaAs interface becomes Ohmic. The reverse bias resistance changes by a factor of 209 over an illumination intensity change of 10-5:1. While this work illustrates the behavior of the Schottky interface upon illumination, it also demonstrates the effectiveness of the four-point, van der Pauw measurement fundamental to EOC/I-EOC phenomena at monitoring changes in the active region of the mesa. The resistance is largely unaffected by the photovoltaic, DC offset of the surrounding leads, as indicated by the radial symmetry of 2-D resistance maps obtained by rastering the laser across EOC/IEOC devices.

  13. Passage of delta sleep-inducing peptide (DSIP) across the blood-cerebrospinal fluid barrier

    SciTech Connect

    Zlokovic, B.V.; Segal, M.B.; Davson, H.; Jankov, R.M.


    Unidirectional flux of /sup 125/I-labeled DSIP at the blood-tissue interface of the blood-cerebrospinal fluid (CSF) barrier was studied in the perfused in situ choroid plexuses of the lateral ventricles of the sheep. Arterio-venous loss of /sup 125/I-radioactivity suggested a low-to-moderate permeability of the choroid epithelium to the intact peptide from the blood side. A saturable mechanism with Michaelis-Menten type kinetics with high affinity and very low capacity (approximate values: Kt = 5.0 +/- 0.4 nM; Vmax = 272 +/- 10 fmol.min-1) was demonstrated at the blood-tissue interface of the choroid plexus. The clearance of DSIP from the ventricles during ventriculo-cisternal perfusion in the rabbit indicated no significant flux of the intact peptide out of the CSF. The results suggest that DSIP crosses the blood-CSF barrier, while the system lacks the specific mechanisms for removal from the CSF found with most, if not all, amino acids and several peptides.

  14. Radiation induces progenitor cell death, microglia activation, and blood-brain barrier damage in the juvenile rat cerebellum

    PubMed Central

    Zhou, Kai; Boström, Martina; Ek, C. Joakim; Li, Tao; Xie, Cuicui; Xu, Yiran; Sun, Yanyan; Blomgren, Klas; Zhu, Changlian


    Posterior fossa tumors are the most common childhood intracranial tumors, and radiotherapy is one of the most effective treatments. However, irradiation induces long-term adverse effects that can have significant negative impacts on the patient’s quality of life. The purpose of this study was to characterize irradiation-induced cellular and molecular changes in the cerebellum. We found that irradiation-induced cell death occurred mainly in the external germinal layer (EGL) of the juvenile rat cerebellum. The number of proliferating cells in the EGL decreased, and 82.9% of them died within 24 h after irradiation. Furthermore, irradiation induced oxidative stress, microglia accumulation, and inflammation in the cerebellum. Interestingly, blood-brain barrier damage and blood flow reduction was considerably more pronounced in the cerebellum compared to other brain regions. The cerebellar volume decreased by 39% and the migration of proliferating cells to the internal granule layer decreased by 87.5% at 16 weeks after irradiation. In the light of recent studies demonstrating that the cerebellum is important not only for motor functions, but also for cognition, and since treatment of posterior fossa tumors in children typically results in debilitating cognitive deficits, this differential susceptibility of the cerebellum to irradiation should be taken into consideration for future protective strategies. PMID:28382975

  15. Improving thrust by pulse-induced breakdown enhancement in AC surface dielectric barrier discharge actuators for airflow control

    NASA Astrophysics Data System (ADS)

    Yan, Huijie; Yang, Liang; Qi, Xiaohua; Ren, Chunsheng


    The characteristics of a plate-to-plate AC surface dielectric barrier discharge (SDBD) actuator using the pulse-induced breakdown enhancing method are experimentally investigated. The encapsulated electrode is supplied with a sine high AC voltage, while the exposed electrode is feed by a synchronized pulse voltage. Based on the thrust force and power consumption measurements, a parametric study was performed using a positive pulse applied at the trough phase of the AC cycles in which the thrust force was observed to increase by about 100% to 300% and the efficiency up to about 100% compared with the AC-only supply conditions for different AC voltages within the tested range. The pulse-induced breakdown effect was analyzed from the electrical and light emission waveforms to reveal the underlying mechanism. The surface potential due to the charge deposition effect was also measured using a specially designed corona-like discharge potential probe. It is shown that the pulse-induced breakdown was able to cause a temporarily intensified local electric field to enhance the glow-like discharge and meanwhile increase the time-average surface potential in the region further downstream. The improvement in the force by the enhancement in the pulse-induced breakdown was mainly due to enhancements in the glow-like discharge and the surface potential increment, with the latter being more important when the AC voltage is higher.

  16. Contrast-Enhanced Ultrasound Imaging for the Detection of Focused Ultrasound-Induced Blood-Brain Barrier Opening

    PubMed Central

    Fan, Ching-Hsiang; Lin, Wun-Hao; Ting, Chien-Yu; Chai, Wen-Yen; Yen, Tzu-Chen; Liu, Hao-Li; Yeh, Chih-Kuang


    The blood-brain barrier (BBB) can be transiently and locally opened by focused ultrasound (FUS) in the presence of microbubbles (MBs). Various imaging modalities and contrast agents have been used to monitor this process. Unfortunately, direct ultrasound imaging of BBB opening with MBs as contrast agent is not feasible, due to the inability of MBs to penetrate brain parenchyma. However, FUS-induced BBB opening is accompanied by changes in blood flow and perfusion, suggesting the possibility of perfusion-based ultrasound imaging. Here we evaluated the use of MB destruction-replenishment, which was originally developed for analysis of ultrasound perfusion kinetics, for verifying and quantifying FUS-induced BBB opening. MBs were intravenously injected and the BBB was disrupted by 2 MHz FUS with burst-tone exposure at 0.5-0.7 MPa. A perfusion kinetic map was estimated by MB destruction-replenishment time-intensity curve analysis. Our results showed that the scale and distribution of FUS-induced BBB opening could be determined at high resolution by ultrasound perfusion kinetic analysis. The accuracy and sensitivity of this approach was validated by dynamic contrast-enhanced MRI. Our successful demonstration of ultrasound imaging to monitor FUS-induced BBB opening provides a new approach to assess FUS-dependent brain drug delivery, with the benefit of high temporal resolution and convenient integration with the FUS device. PMID:25161701

  17. Intentionally induced intestinal barrier dysfunction causes inflammation, affects metabolism, and reduces productivity in lactating Holstein cows.


    Kvidera, S K; Dickson, M J; Abuajamieh, M; Snider, D B; Fernandez, M V Sanz; Johnson, J S; Keating, A F; Gorden, P J; Green, H B; Schoenberg, K M; Baumgard, L H


    Study objectives were to evaluate the effects of intentionally reduced intestinal barrier function on productivity, metabolism, and inflammatory indices in otherwise healthy dairy cows. Fourteen lactating Holstein cows (parity 2.6 ± 0.3; 117 ± 18 d in milk) were enrolled in 2 experimental periods. Period 1 (5 d) served as the baseline for period 2 (7 d), during which cows received 1 of 2 i.v. treatments twice per day: sterile saline or a gamma-secretase inhibitor (GSI; 1.5 mg/kg of body weight). Gamma-secretase inhibitors reduce intestinal barrier function by inhibiting crypt cell differentiation into absorptive enterocytes. During period 2, control cows receiving sterile saline were pair-fed (PF) to the GSI-treated cows, and all cows were killed at the end of period 2. Administering GSI increased goblet cell area 218, 70, and 28% in jejunum, ileum, and colon, respectively. In the jejunum, GSI-treated cows had increased crypt depth and reduced villus height, villus height-to-crypt depth ratio, cell proliferation, and mucosal surface area. Plasma lipopolysaccharide binding protein increased with time, and tended to be increased 42% in GSI-treated cows relative to PF controls on d 5 to 7. Circulating haptoglobin and serum amyloid A concentrations increased (585- and 4.4-fold, respectively) similarly in both treatments. Administering GSI progressively reduced dry matter intake (66%) and, by design, the pattern and magnitude of decreased nutrient intake was similar in PF controls. A similar progressive decrease (42%) in milk yield occurred in both treatments, but we observed no treatment effects on milk components. Cows treated with GSI tended to have increased plasma insulin (68%) and decreased circulating nonesterified fatty acids (29%) compared with PF cows. For both treatments, plasma glucose decreased with time while β-hydroxybutyrate progressively increased. Liver triglycerides increased 221% from period 1 to sacrifice in both treatments. No differences were

  18. Effects of poly (ADP-ribose) polymerase inhibitor 3-aminobenzamide on blood-brain barrier and dopaminergic neurons of rats with lipopolysaccharide-induced Parkinson's disease.


    Wu, Xiao-li; Wang, Ping; Liu, Yun-hui; Xue, Yi-xue


    Neuro-inflammation and dysfunction of blood-brain barrier play an important role in the occurrence, development, and neuronal degeneration of Parkinson's disease (PD). Studies have demonstrated that a variety of cytokines such as TNF-α and IL-1β destroy the structure and function of blood-brain barrier. The damage to blood-brain barrier results in death of dopaminergic neurons, while protection of blood-brain barrier slows down the progression of PD. Also, it has been shown that activation of poly (ADP-ribose) polymerase (PARP) plays an important role in causing damage to blood-brain barrier. In addition, the PARP inhibitor 3-AB has been shown to protect blood-brain barrier from damage and has neuroprotective effects. In this study, using a lipopolysaccharide (LPS)-induced PD rat model, we investigated whether 3-AB protects blood-brain barrier and dopaminergic neurons from functional damage. LPS significantly increased Evans blue content in the substantia nigra which peaked at 12 h, while administration of 3-AB significantly inhibited the LPS-induced increase in Evans blue content and also significantly increased the expression of the tight junction-associated proteins claudin-5, occludin and ZO-1. 3-AB also increased the number of tyrosine hydroxylase positive cells and reduced the IL-1β and TNF-α content significantly. According to western blot analysis, 3-AB significantly reduced the p-ERK1/2 expression, while the expression of p-p38MAPK increased. These results suggest that 3-AB protects the blood-brain barrier from functional damage in an LPS-induced PD rat model and dopaminergic neurons are protected from degeneration by upregulation of tight junction-associated proteins. These protective effects of 3-AB may be related to modulation of the ERK1/2 pathway.

  19. Src tyrosine kinase regulates the stem cell factor–induced breakdown of the blood–retinal barrier

    PubMed Central

    Im, Ji-Eun; Song, Sun-Hwa


    Purpose Stem cell factor (SCF) has been recently acknowledged as a novel endothelial permeability factor. However, the mechanisms by which SCF-induced activation of the SCF cognate receptor, cKit, enhances endothelial permeability have not been fully elucidated. This study aimed to investigate the role of Src in SCF-induced breakdown of the blood–retinal barrier (BRB). Methods In vitro endothelial permeability and in vivo retinal vascular permeability assays were performed to investigate the role of Src in SCF-induced breakdown of the BRB. Immunofluorescence staining experiments were performed to analyze the cellular distribution of phosphorylated Src and vascular endothelial (VE)-cadherin. Results SCF markedly reduced electric resistance across the human retinal vascular endothelial monolayer in vitro and enhanced extravasation of dyes in murine retinal vasculature in vivo. Inhibition of cKit activation using cKit mutant mice and chemical inhibitor substantially diminished the ability of SCF to increase endothelial permeability and retinal vascular leakage. In human retinal vascular endothelial cells, SCF induced strong phosphorylation of Src and distinct localization of phosphorylated Src in the plasma membrane. Inhibition of Src activation using chemical inhibitors abolished the SCF-induced hyperpermeability of human retinal vascular endothelial cells and retinal vascular leakage in mice. In addition, treatment with Src inhibitors restored junctional expression of VE-cadherin that disappeared in SCF-treated retinal endothelial cells and retinal vasculature. Conclusions These results showed the important role of Src in mediating SCF-induced breakdown of the BRB and retinal vascular leakage. Given that increased retinal vascular permeability is a common manifestation of various ocular diseases, the SCF/cKit/Src signaling pathway may be involved in the development of the hyperpermeable retinal vasculature in many ocular disorders. PMID:27746675

  20. Inducing injection barrier by covalent functionalization of multiwall carbon nanotubes acting as Moiré crystals

    NASA Astrophysics Data System (ADS)

    Bonnet, Roméo; Barraud, Clément; Martin, Pascal; Della Rocca, Maria Luisa; Lafarge, Philippe


    Covalent functionalization of multiwall carbon nanotubes is a direct method to suppress the conduction of the outermost shell, subject to interactions with the environment. The rehybridized sp3 external shell of the functionalized multiwall carbon nanotubes becomes naturally a hybrid injection barrier allowing the control of the contact resistances and the study of quantum transport in the more protected inner shells. Charge transport measurements performed on isolated multiwall carbon nanotubes of large diameter show an increase of the contact resistance and stabilization in the MΩ range. Electronic quantum properties of the inner shells are highlighted by the observation of superlattice structures in the conductance, recently attributed to the formation of a one-dimensional Moiré pattern.

  1. Absolute Cross Sections for Proton Induced Reactions on 147,149Sm Below the Coulomb Barrier

    NASA Astrophysics Data System (ADS)

    Gheorghe, I.; Filipescu, D.; Glodariu, T.; Bucurescu, D.; Cata-Danil, I.; Cata-Danil, G.; Deleanu, D.; Ghita, D.; Ivascu, M.; Lica, R.; Marginean, N.; Marginean, R.; Mihai, C.; Negret, A.; Sava, T.; Stroe, L.; Toma, S.; Sima, O.; Sin, M.


    Cross sections for 147,149Sm(p,n)147,149Eu and 147,149Sm(p, γ)148,150Eu were measured using the activation method. The results are compared to the predictions of the Hauser-Feshbach statistical model. Different γ-ray strength functions have been tested against the experimental values. In the case of 150Eu, in order to reproduce the experimental isomeric population cross sections, various scenarios for unknown branching ratios of certain discrete states have been discussed. The results provide constraints for the optical model parameters dedicated to this insufficiently known area of isotopes. Such cross sections for (p, γ) reactions at energies below the Coulomb barrier are valuable for p-process nucleosynthesis calculations.

  2. Ultrathin epitaxial barrier layer to avoid thermally induced phase transformation in oxide heterostructures

    SciTech Connect

    Baek, David J.; Lu, Di; Hikita, Yasuyuki; Hwang, Harold Y.; Kourkoutis, Lena F.


    Incorporating oxides with radically different physical and chemical properties into heterostructures offers tantalizing possibilities to derive new functions and structures. Recently, we have fabricated freestanding 2D oxide membranes using the water-soluble perovskite Sr3Al2O6 as a sacrificial buffer layer. Here, with atomic-resolution spectroscopic imaging, we observe that direct growth of oxide thin films on Sr3Al2O6 can cause complete phase transformation of the buffer layer, rendering it water-insoluble. More importantly, we demonstrate that an ultrathin SrTiO3 layer can be employed as an effective barrier to preserve Sr3Al2O6 during subsequent growth, thus allowing its integration in a wider range of oxide heterostructures.

  3. Effects of Barrier-Induced Nuclear Spin Magnetization Inhomogeneities on Diffusion-Attenuated MR Signal

    PubMed Central

    Sukstanskii, A.L.; Ackerman, J.J.H.; Yablonskiy, D.A.


    The spatial distribution of the transverse nuclear spin magnetization, appearing in a single compartment with impermeable boundaries in a Stejskal-Tanner gradient pulse MR experiment, is analyzed in detail. At short diffusion times the presence of diffusion-restrictive barriers (membranes) reduces effective diffusivity near the membranes and leads to an inhomogeneous spin magnetization distribution (the edge-enhancement effect). In this case, the signal reveals a quasi-two-compartment behavior and can be empirically modeled remarkably well by a biexponential function. The current results provide a framework for interpreting experimental MR data on various phenoma, including water diffusion in giant axons, metabolite diffusion in the brain, and hyperpolarized gas diffusion in lung airways. PMID:14523959

  4. Ultrathin epitaxial barrier layer to avoid thermally induced phase transformation in oxide heterostructures


    Baek, David J.; Lu, Di; Hikita, Yasuyuki; ...


    Incorporating oxides with radically different physical and chemical properties into heterostructures offers tantalizing possibilities to derive new functions and structures. Recently, we have fabricated freestanding 2D oxide membranes using the water-soluble perovskite Sr3Al2O6 as a sacrificial buffer layer. Here, with atomic-resolution spectroscopic imaging, we observe that direct growth of oxide thin films on Sr3Al2O6 can cause complete phase transformation of the buffer layer, rendering it water-insoluble. More importantly, we demonstrate that an ultrathin SrTiO3 layer can be employed as an effective barrier to preserve Sr3Al2O6 during subsequent growth, thus allowing its integration in a wider range of oxide heterostructures.

  5. Dielectric Barrier Discharge Plasma-Induced Photocatalysis and Ozonation for the Treatment of Wastewater

    NASA Astrophysics Data System (ADS)

    Mok, Young Sun; Jo, Jin-Oh; Lee, Heon-Ju


    The physicochemical processes of dielectric barrier discharge (DBD) such as in-situ formation of chemically active species and emission of ultraviolet (UV)/visible light were utilized for the treatment of a simulated wastewater formed with Acid Red 4 as the model organic contaminant. The chemically active species (mostly ozone) produced in the DBD reactor were well distributed in the wastewater using a porous gas diffuser, thereby increasing the gas-liquid contact area. For the purpose of making the best use of the light emission, a titanium oxide-based photocatalyst was incorporated in the wastewater treating system. The experimental parameters chosen were the voltage applied to the DBD reactor, the initial pH of the wastewater, and the concentration of hydrogen peroxide added to the wastewater. The results have clearly shown that the present system capable of degrading organic contaminants in two ways (photocatalysis and ozonation) may be a promising wastewater treatment technology.

  6. SEEPAGE, a new MODFLOW DRAIN package.


    Batelaan, O; De Smedt, F


    The prediction of the location of ground water discharge areas is a key aspect for the protection and (re)development of ground water-dependent wetlands. Ground water discharge areas can be simulated with MODFLOW using the DRAIN package by setting the drain level equal to the topography, while the conductance is mostly set to an arbitrary high value. However, conceptual and practical problems arise in the calculation of the ground water discharge by the DRAIN package as calculated water tables above the land surface, difficult parameterization of the conductance, and large water balance errors. To overcome these problems, a new SEEPAGE package for MODFLOW is proposed. The basic idea of this package is an adaptable constant head cell. It has a variable head, unless the ground water rises above the seepage level, in which case it has a constant head cell. The estimation of the ground water discharge location along a homogeneous, isotropic, linear sloping profile is used to verify the model and to compare it to the DRAIN solution. In an application to three basins in Belgium, it is shown that the SEEPAGE package can be used in combination with the DRAIN package in situations where an upper boundary for a free water table and additional resistance for drainage is required. It is clearly demonstrated that the identification and delineation of regional ground water discharge areas is more accurate using the SEEPAGE package.

  7. Valence-band offsets and Schottky barrier heights of layered semiconductors explained by interface-induced gap states

    NASA Astrophysics Data System (ADS)

    Mönch, Winfried


    Many metal chalcogenides are layered semiconductors. They consist of chalcogen-metal-chalcogen layers that are themselves bound by van der Waals forces. Hence, heterostructures involving layered compounds are abrupt and strain-free. Experimental valence-band offsets of heterostructures between GaSe, InSe, SnS2, SnSe2, MoS2, MoTe2, WSe2, and CuInSe2 and between some of these compounds and ZnSe, CdS, and CdTe as well as barrier heights of Au contacts on GaSe, InSe, MoS2, MoTe2, WSe2, ZnSe, CdS, and CdTe are analyzed. The valence-band discontinuities of the heterostructures and the barrier heights of the Schottky contact compounds are consistently described by the continuum of interface-induced gap states as the primary mechanism that governs the band lineup at semiconductor interfaces.

  8. Controlled aluminum-induced crystallization of an amorphous silicon thin film by using an oxide-layer diffusion barrier

    NASA Astrophysics Data System (ADS)

    Hwang, Ji-Hyun; Kwak, Hyunmin; Kwon, Myeung Hoi


    Aluminum-induced crystallization (AIC) of amorphous silicon with an Al2O3 diffusion barrier was investigated for controlling Si crystallization and preventing layer exchange during the annealing process. An Al2O3 layer was deposited between the a-Si and the Al films (a-Si/Al2O3/Al/Glass) and was blasted with an air spray gun with alumina beads to form diffusion channels between the Si and the Al layers. During the annealing process, small grain Si x Al seeds were formed at the channels. Then, the Al2O3 diffusion barrier was restructured to close the channels and prevent further diffusion of Al atoms into the a-Si layer. A polycrystalline Si film with (111), (220) and (311) crystallization peaks in the X-ray diffraction pattern was formed by annealing at 560 °C in a conventional furnace. That film showed a p-type semiconducting behavior with good crystallinity and a large grain size of up to 14.8 µm. No layer conversion occurred between the Si and the Al layers, which had been the fundamental obstacle to the applications in the crystallization of a-Si films by using the AIC method.

  9. Clearance of albumin following ultrasound-induced blood-brain barrier opening is mediated by glial but not neuronal cells.


    Alonso, Angelika; Reinz, Eileen; Fatar, Marc; Hennerici, Michael G; Meairs, Stephen


    Ultrasound-mediated opening of the blood-brain barrier (BBB) in the presence of gas-filled microbubbles is a potential strategy for drug delivery across the blood-brain barrier to promote regeneration after ischemic stroke. However, related bioeffects and potential side-effects that could limit a translation into clinical application are poorly understood so far. We therefore examined the clearance of extravasated albumin following ultrasound-mediated BBB opening. Autofluorescence of albumin-bound Evans Blue dye indicated cellular albumin uptake as soon as 30min after insonation (2±0.72 cells/optical field). Cellular albumin uptake increased constantly over 24h (22±3.33 cells/optical field, p<0.05). Initially, the majority of albumin-positive cells were located in the periphery of brain capillaries. Most albumin phagocyting cells stained positive for CD163 and Iba-1, identifying them as activated microglia. Further, a small fraction of albumin-positive cells stained positive for the astroglial markers GFAP/S100B. Some perivascular cells with intracellular albumin were shown to express the endothelial marker protein EN4. Albumin uptaking cells stained negative for the neuronal TubulinIII. Thus, ultrasound-induced BBB opening leads to albumin extravasation which is phagocytized predominantly by activated microglia, astrocytes and endothelial cells. As albumin uptake into neurons has been shown to be neurotoxic, rapid albumin clearance by microglia might prevent neuronal cell death.

  10. Lipid microbubbles as a vehicle for targeted drug delivery using focused ultrasound-induced blood-brain barrier opening.


    Sierra, Carlos; Acosta, Camilo; Chen, Cherry; Wu, Shih-Ying; Karakatsani, Maria E; Bernal, Manuel; Konofagou, Elisa E


    Focused ultrasound in conjunction with lipid microbubbles has fully demonstrated its ability to induce non-invasive, transient, and reversible blood-brain barrier opening. This study was aimed at testing the feasibility of our lipid-coated microbubbles as a vector for targeted drug delivery in the treatment of central nervous system diseases. These microbubbles were labeled with the fluorophore 5-dodecanoylaminfluorescein. Focused ultrasound targeted mouse brains in vivo in the presence of these microbubbles for trans-blood-brain barrier delivery of 5-dodecanoylaminfluorescein. This new approach, compared to previously studies of our group, where fluorescently labeled dextrans and microbubbles were co-administered, represents an appreciable improvement in safety outcome and targeted drug delivery. This novel technique allows the delivery of 5-dodecanoylaminfluorescein at the region of interest unlike the alternative of systemic exposure. 5-dodecanoylaminfluorescein delivery was assessed by ex vivo fluorescence imaging and by in vivo transcranial passive cavitation detection. Stable and inertial cavitation doses were quantified. The cavitation dose thresholds for estimating, a priori, successful targeted drug delivery were, for the first time, identified with inertial cavitation were concluded to be necessary for successful delivery. The findings presented herein indicate the feasibility and safety of the proposed microbubble-based targeted drug delivery and that, if successful, can be predicted by cavitation detection in vivo.

  11. Electrochemically induced dual reactive barriers for transformation of TCE and mixture of contaminants in groundwater

    PubMed Central

    Mao, Xuhui; Yuan, Songhu; Fallahpour, Noushin; Ciblak, Ali; Howard, Joniqua; Padilla, Ingrid; Loch-Caruso, Rita; Alshawabkeh, Akram N.


    A novel reactive electrochemical flow system consisting of iron anode and porous cathode is proposed for the remediation of mixture of contaminants in groundwater. The system consists of a series of sequentially arranged electrodes, a perforated iron anode, a porous copper cathode followed by a mesh-type mixed metal oxide anode. The iron anode generates ferrous species and a chemically reducing environment, the porous cathode provides a reactive electrochemically reducing barrier, and the inert anode provides proton and oxygen to neutralize the system. The redox conditions of the electrolyte flowing through this system can be regulated by controlling the distribution of the electric current. Column experiments are conducted to evaluate the process and study the variables. The electrochemical reduction on a copper foam cathode produced an electrode-based reductive potential capable of reducing TCE and nitrate. Rational electrodes arrangement, longer residence time of electrolytes and higher surface area of foam electrode improve the reductive transformation of TCE. More than 82.2% TCE removal efficiency is achieved for the case of low influent concentration (< 7.5 mg/L) and high current (> 45 mA). The ferrous species produced from the iron anode not only enhance the transformation of TCE on the cathode, but also facilitates transformation of other contaminants including dichromate, selenate and arsenite. Removal efficiencies greater than 80% are achieved for these contaminants from flowing contaminated water. The overall system, comprising the electrode-based and electrolyte-based barriers, can be engineered as a versatile and integrated remedial method for a relatively wide spectrum of contaminants and their mixtures. PMID:23067023

  12. Analysis of Ar plasma jets induced by single and double dielectric barrier discharges at atmospheric pressure

    NASA Astrophysics Data System (ADS)

    Judée, F.; Merbahi, N.; Wattieaux, G.; Yousfi, M.


    The aim is the comparison of different plasma parameters of single and double dielectric barrier discharge plasma jet configurations (S-DBD and D-DBD) which are potentially usable in biomedical applications. Both configurations are studied in terms of electric field distribution, electrical discharge characteristics, plasma parameters (estimated by optical emission spectroscopy analysis), and hydrodynamics of the plasma jet for electrical parameters of power supplies corresponding to an applied voltage of 10 kV, pulse duration of 1 μs, frequency of 9.69 kHz, and Ar flow of 2 l/min. We observed that the D-DBD configuration requires half the electrical power one needs to provide in the S-DBD case to generate a plasma jet with similar characteristics: excitation temperature around 4700 K, electron density around 2.5 × 1014 cm-3, gas temperature of about 320 K, a relatively high atomic oxygen concentration reaching up to 1000 ppm, the presence of reactive oxygen and nitrogen species (nitric oxide, hydroxyl radical, and atomic oxygen), and an irradiance in the UV-C range of about 20 μW cm-2. Moreover, it has been observed that D-DBD plasma jet is more sensitive to short pulse durations, probably due to the charge accumulation over the dielectric barrier around the internal electrode. This results in a significantly longer plasma length in the D-DBD configuration than in the S-DBD one up to a critical flow rate (2.25 l/min) before the occurrence of turbulence in the D-DBD case. Conversely, ionization wave velocities are significantly higher in the S-DBD setup (3.35 × 105 m/s against 1.02 × 105 m/s for D-DBD), probably due to the higher electrostatic field close to the high voltage electrode in the S-DBD plasma jet.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  14. 14 CFR 23.1021 - Oil system drains.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Oil system drains. 23.1021 Section 23.1021... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Powerplant Oil System § 23.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each...

  15. 14 CFR 23.1021 - Oil system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Oil system drains. 23.1021 Section 23.1021... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Powerplant Oil System § 23.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each...

  16. 14 CFR 23.1021 - Oil system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Oil system drains. 23.1021 Section 23.1021... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Powerplant Oil System § 23.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each...

  17. 14 CFR 23.1021 - Oil system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Oil system drains. 23.1021 Section 23.1021... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Powerplant Oil System § 23.1021 Oil system drains. A drain (or drains) must be provided to allow safe drainage of the oil system. Each...

  18. 7 CFR 52.3755 - Minimum drained weights.

    Code of Federal Regulations, 2014 CFR


    ... Ripe Olives 1 Product Description, Types, Styles, and Grades § 52.3755 Minimum drained weights. (a... drained weight of canned ripe olives is determined by emptying the contents of the container upon a U.S... allow to drain for 2 minutes. The weight of drained olives is the weight of the sieve and product...

  19. 7 CFR 52.3755 - Minimum drained weights.

    Code of Federal Regulations, 2013 CFR


    ... Ripe Olives 1 Product Description, Types, Styles, and Grades § 52.3755 Minimum drained weights. (a... drained weight of canned ripe olives is determined by emptying the contents of the container upon a U.S... allow to drain for 2 minutes. The weight of drained olives is the weight of the sieve and product...

  20. 21 CFR 868.5995 - Tee drain (water trap).

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Tee drain (water trap). 868.5995 Section 868.5995...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5995 Tee drain (water trap). (a) Identification. A tee drain (water trap) is a device intended to trap and drain water that collects in...

  1. 21 CFR 868.5995 - Tee drain (water trap).

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Tee drain (water trap). 868.5995 Section 868.5995...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5995 Tee drain (water trap). (a) Identification. A tee drain (water trap) is a device intended to trap and drain water that collects in...

  2. 21 CFR 868.5995 - Tee drain (water trap).

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tee drain (water trap). 868.5995 Section 868.5995...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5995 Tee drain (water trap). (a) Identification. A tee drain (water trap) is a device intended to trap and drain water that collects in...

  3. 21 CFR 868.5995 - Tee drain (water trap).

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Tee drain (water trap). 868.5995 Section 868.5995...) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5995 Tee drain (water trap). (a) Identification. A tee drain (water trap) is a device intended to trap and drain water that collects in...

  4. Dressings and drains in posterior spine surgery and their effect on wound complications.


    Andrew Glennie, R; Dea, Nicolas; Street, John T


    The purpose of this study was to systematically search, critically appraise and summarize published randomized control trials (RCT) and non-RCT examining the effect of drains and dressings on wound healing rates and complications in posterior spine surgery. The use of post-operative drains and the type of post-operative dressing is at the discretion of the treating surgeon with no available clinical guidelines. Drains will theoretically decrease incidence of post-operative hematoma and therefore, potentially decrease the risk of neurologic compromise when the neural elements have been exposed. Occlusive dressings have more recently been advocated, potentially maintaining a sterile barrier for longer time periods post-operatively. A systematic review of databases from 1969-2013 was undertaken. All papers examining drains in spine surgery and dressings in primary healing of surgical wounds were included. Revman (version 5.2; The Nordic Cochrane Centre, The Cochrane Collaboration, Oxford, UK) was used to test for overall treatment effect, clinical heterogeneity and risk of bias. Of the papers identified, 1348 examined post-operative drains in spine surgery and 979 wound dressings for primary wound healing of all surgical wounds. Seven studies were included for analysis for post-operative drains and 10 studies were analyzed for primary wound healing. The use of a post-operative drain did not influence healing rates and had no effect secondarily on infection (odds ratio [OR] 1.33; 95% confidence interval [CI] 0.76-2.30). We were not able to establish whether surgical drains prevent hematomas causing neurologic compromise. There was a slight advantage to using occlusive dressings versus non-occlusive dressings in wound healing (OR 2.09; 95% CI 1.44-3.02). Incisional vacuum dressings as both an occlusive barrier and superficial drainage system have shown promise for wounds at risk of dehiscence. There is a relatively high risk of bias in the methodology of many of the

  5. Neurothelin: an inducible cell surface glycoprotein of blood-brain barrier-specific endothelial cells and distinct neurons

    PubMed Central


    The blood-brain barrier is characterized by still poorly understood barrier and transport functions performed by specialized endothelial cells. Hybridoma technology has been used to identify a protein termed neurothelin that is specific for these endothelial cells. Neurothelin is defined by the species-specific mouse mAb 1W5 raised against lentil- lectin-binding proteins of neural tissue from embryonic chick. In the posthatch chick, neurothelin expression is found on endothelial cells within the brain but not on those of the systemic vascular system. Injection of the monoclonal antibody in vivo leads to labeling of brain capillaries, indicating that the corresponding antigen is expressed on the luminal surface of brain endothelial cells. Transplantation of embryonic mouse brain onto the chick chorioallantoic membrane results in rodent brain vascularization by the avian vascular system. Subsequently, normally mAb 1W5-negative endothelial cells, originating from blood vessels of the chick chorioallantoic membrane, are induced to express neurothelin when they are in contact with mouse neural tissue. In contrast to differentiated brain neurons that do not express neurothelin, neurons of the nonvascularized chick retina synthesize neurothelin. However, neurothelin is not found on retinal ganglion cell axons terminating on 1W5-negative brain cells. 1W5 immunoreactivity was also found in the pigment epithelium that forms the blood-eye barrier. Putting epithelial cells into culture results in concentration of neurothelin at cell-cell contact sites, leaving other cell surface areas devoid of antigen. Therefore, the distribution of neurothelin appears to be regulated by cell-cell interactions. In Western blot analysis, neurothelin was identified as a protein with a molecular mass of approximately 43 kD. The protein bears at least one intramolecular disulfide bridge and sulfated glucuronic acid as well as alpha-D- substituted mannose/glucose moieties. The exclusive

  6. Quantifying redox-induced Schottky barrier variations in memristive devices via in operando spectromicroscopy with graphene electrodes

    PubMed Central

    Baeumer, Christoph; Schmitz, Christoph; Marchewka, Astrid; Mueller, David N.; Valenta, Richard; Hackl, Johanna; Raab, Nicolas; Rogers, Steven P.; Khan, M. Imtiaz; Nemsak, Slavomir; Shim, Moonsub; Menzel, Stephan; Schneider, Claus Michael; Waser, Rainer; Dittmann, Regina


    The continuing revolutionary success of mobile computing and smart devices calls for the development of novel, cost- and energy-efficient memories. Resistive switching is attractive because of, inter alia, increased switching speed and device density. On electrical stimulus, complex nanoscale redox processes are suspected to induce a resistance change in memristive devices. Quantitative information about these processes, which has been experimentally inaccessible so far, is essential for further advances. Here we use in operando spectromicroscopy to verify that redox reactions drive the resistance change. A remarkable agreement between experimental quantification of the redox state and device simulation reveals that changes in donor concentration by a factor of 2–3 at electrode-oxide interfaces cause a modulation of the effective Schottky barrier and lead to >2 orders of magnitude change in device resistance. These findings allow realistic device simulations, opening a route to less empirical and more predictive design of future memory cells. PMID:27539213

  7. Quantifying redox-induced Schottky barrier variations in memristive devices via in operando spectromicroscopy with graphene electrodes

    NASA Astrophysics Data System (ADS)

    Baeumer, Christoph; Schmitz, Christoph; Marchewka, Astrid; Mueller, David N.; Valenta, Richard; Hackl, Johanna; Raab, Nicolas; Rogers, Steven P.; Khan, M. Imtiaz; Nemsak, Slavomir; Shim, Moonsub; Menzel, Stephan; Schneider, Claus Michael; Waser, Rainer; Dittmann, Regina


    The continuing revolutionary success of mobile computing and smart devices calls for the development of novel, cost- and energy-efficient memories. Resistive switching is attractive because of, inter alia, increased switching speed and device density. On electrical stimulus, complex nanoscale redox processes are suspected to induce a resistance change in memristive devices. Quantitative information about these processes, which has been experimentally inaccessible so far, is essential for further advances. Here we use in operando spectromicroscopy to verify that redox reactions drive the resistance change. A remarkable agreement between experimental quantification of the redox state and device simulation reveals that changes in donor concentration by a factor of 2-3 at electrode-oxide interfaces cause a modulation of the effective Schottky barrier and lead to >2 orders of magnitude change in device resistance. These findings allow realistic device simulations, opening a route to less empirical and more predictive design of future memory cells.

  8. Plasmin-dependent modulation of the blood–brain barrier: a major consideration during tPA-induced thrombolysis?

    PubMed Central

    Niego, Be'eri; Medcalf, Robert L


    Plasmin, the principal downstream product of tissue-type plasminogen activator (tPA), is known for its potent fibrin-degrading capacity but is also recognized for many non-fibrinolytic activities. Curiously, plasmin has not been conclusively linked to blood–brain barrier (BBB) disruption during recombinant tPA (rtPA)-induced thrombolysis in ischemic stroke. This is surprising given the substantial involvement of tPA in the modulation of BBB permeability and the co-existence of tPA and plasminogen in both blood and brain throughout the ischemic event. Here, we review the work that argues a role for plasmin together with endogenous tPA or rtPA in BBB alteration, presenting the overall controversy around the topic yet creating a rational case for an involvement of plasmin in this process. PMID:24896566

  9. Destruction of Gaseous Styrene with a Low-Temperature Plasma Induced by a Tubular Multilayer Dielectric Barrier Discharge

    NASA Astrophysics Data System (ADS)

    Zhang, Jiahui; Liu, Juanjuan; Zhang, Renxi; Hou, Huiqi; Chen, Shanping; Zhang, Yi


    The destruction of gaseous styrene was studied using a low-temperature plasma induced by tubular multilayer dielectric barrier discharge (DBD). The results indicate that the applied voltage, gas flow rate, inlet styrene concentration and reactor configuration play important roles in styrene removal efficiency (ηstyrene) and energy yield (EY). Values of ηstyrene and EY reached 96% and 15567 mg/kWh when the applied voltage, gas flow rate, inlet styrene concentration and layers of quartz tubes were set at 10.8 kV, 5.0 m/s, 229 mg/m3 and 5 layers, respectively. A qualitative analysis of the byproducts and a detailed discussion of the reaction mechanism are also presented. The results could facilitate industrial applications of the new DBD reactor for waste gas treatment.

  10. Serum-borne bioactivity caused by pulmonary multiwalled carbon nanotubes induces neuroinflammation via blood-brain barrier impairment.


    Aragon, Mario J; Topper, Lauren; Tyler, Christina R; Sanchez, Bethany; Zychowski, Katherine; Young, Tamara; Herbert, Guy; Hall, Pamela; Erdely, Aaron; Eye, Tracy; Bishop, Lindsey; Saunders, Samantha A; Muldoon, Pretal P; Ottens, Andrew K; Campen, Matthew J


    Pulmonary exposure to multiwalled carbon nanotubes (MWCNTs) causes indirect systemic inflammation through unknown pathways. MWCNTs translocate only minimally from the lungs into the systemic circulation, suggesting that extrapulmonary toxicity may be caused indirectly by lung-derived factors entering the circulation. To assess a role for MWCNT-induced circulating factors in driving neuroinflammatory outcomes, mice were acutely exposed to MWCNTs (10 or 40 µg/mouse) via oropharyngeal aspiration. At 4 h after MWCNT exposure, broad disruption of the blood-brain barrier (BBB) was observed across the capillary bed with the small molecule fluorescein, concomitant with reactive astrocytosis. However, pronounced BBB permeation was noted, with frank albumin leakage around larger vessels (>10 µm), overlain by a dose-dependent astroglial scar-like formation and recruitment of phagocytic microglia. As affirmed by elevated inflammatory marker transcription, MWCNT-induced BBB disruption and neuroinflammation were abrogated by pretreatment with the rho kinase inhibitor fasudil. Serum from MWCNT-exposed mice induced expression of adhesion molecules in primary murine cerebrovascular endothelial cells and, in a wound-healing in vitro assay, impaired cell motility and cytokinesis. Serum thrombospondin-1 level was significantly increased after MWCNT exposure, and mice lacking the endogenous receptor CD36 were protected from the neuroinflammatory and BBB permeability effects of MWCNTs. In conclusion, acute pulmonary exposure to MWCNTs causes neuroinflammatory responses that are dependent on the disruption of BBB integrity.

  11. Surgery-Induced Hippocampal Angiotensin II Elevation Causes Blood-Brain Barrier Disruption via MMP/TIMP in Aged Rats

    PubMed Central

    Li, Zhengqian; Mo, Na; Li, Lunxu; Cao, Yiyun; Wang, Wenming; Liang, Yaoxian; Deng, Hui; Xing, Rui; Yang, Lin; Ni, Cheng; Chui, Dehua; Guo, Xiangyang


    Reversible blood-brain barrier (BBB) disruption has been uniformly reported in several animal models of postoperative cognitive dysfunction (POCD). Nevertheless, the precise mechanism underlying this occurrence remains unclear. Using an aged rat model of POCD, we investigated the dynamic changes in expression of molecules involved in BBB disintegration, matrix metalloproteinase-2 (MMP-2) and -9 (MMP-9), as well as three of their endogenous tissue inhibitors of MMP (TIMP-1, -2, -3), and tried to establish the correlation between MMP/TIMP balance and surgery-induced hippocampal BBB disruption. We validated the increased hippocampal expression of angiotensin II (Ang II) and Ang II receptor type 1 (AT1) after surgery. We also found MMP/TIMP imbalance as early as 6 h after surgery, together with increased BBB permeability and decreased expression of Occludin and zonula occludens-1 (ZO-1), as well as increased basal lamina protein laminin at 24 h postsurgery. The AT1 antagonist candesartan restored MMP/TIMP equilibrium and modulated expression of Occludin and laminin, but not ZO-1, thereby improving BBB permeability. These events were accompanied by suppression of the surgery-induced canonical nuclear factor-κB (NF-κB) activation cascade. Nevertheless, AT1 antagonism did not affect nuclear receptor peroxisome proliferator-activated receptor-γ (PPARγ) expression. Collectively, these findings suggest that surgery-induced Ang II release impairs BBB integrity by activating NF-κB signaling and disrupting downstream MMP/TIMP balance via AT1 receptor. PMID:27199659

  12. Serum-borne bioactivity caused by pulmonary multiwalled carbon nanotubes induces neuroinflammation via blood–brain barrier impairment

    PubMed Central

    Aragon, Mario J.; Topper, Lauren; Tyler, Christina R.; Sanchez, Bethany; Zychowski, Katherine; Young, Tamara; Herbert, Guy; Hall, Pamela; Erdely, Aaron; Eye, Tracy; Bishop, Lindsey; Saunders, Samantha A.; Muldoon, Pretal P.; Ottens, Andrew K.; Campen, Matthew J.


    Pulmonary exposure to multiwalled carbon nanotubes (MWCNTs) causes indirect systemic inflammation through unknown pathways. MWCNTs translocate only minimally from the lungs into the systemic circulation, suggesting that extrapulmonary toxicity may be caused indirectly by lung-derived factors entering the circulation. To assess a role for MWCNT-induced circulating factors in driving neuroinflammatory outcomes, mice were acutely exposed to MWCNTs (10 or 40 µg/mouse) via oropharyngeal aspiration. At 4 h after MWCNT exposure, broad disruption of the blood-brain barrier (BBB) was observed across the capillary bed with the small molecule fluorescein, concomitant with reactive astrocytosis. However, pronounced BBB permeation was noted, with frank albumin leakage around larger vessels (>10 µm), overlain by a dose-dependent astroglial scar-like formation and recruitment of phagocytic microglia. As affirmed by elevated inflammatory marker transcription, MWCNT-induced BBB disruption and neuroinflammation were abrogated by pretreatment with the rho kinase inhibitor fasudil. Serum from MWCNT-exposed mice induced expression of adhesion molecules in primary murine cerebrovascular endothelial cells and, in a wound-healing in vitro assay, impaired cell motility and cytokinesis. Serum thrombospondin-1 level was significantly increased after MWCNT exposure, and mice lacking the endogenous receptor CD36 were protected from the neuroinflammatory and BBB permeability effects of MWCNTs. In conclusion, acute pulmonary exposure to MWCNTs causes neuroinflammatory responses that are dependent on the disruption of BBB integrity. PMID:28223486

  13. Activation of VEGF/Flk-1-ERK Pathway Induced Blood-Brain Barrier Injury After Microwave Exposure.


    Wang, Li-Feng; Li, Xiang; Gao, Ya-Bing; Wang, Shui-Ming; Zhao, Li; Dong, Ji; Yao, Bin-Wei; Xu, Xin-Ping; Chang, Gong-Min; Zhou, Hong-Mei; Hu, Xiang-Jun; Peng, Rui-Yun


    Microwaves have been suggested to induce neuronal injury and increase permeability of the blood-brain barrier (BBB), but the mechanism remains unknown. The role of the vascular endothelial growth factor (VEGF)/Flk-1-Raf/MAPK kinase (MEK)/extracellular-regulated protein kinase (ERK) pathway in structural and functional injury of the blood-brain barrier (BBB) following microwave exposure was examined. An in vitro BBB model composed of the ECV304 cell line and primary rat cerebral astrocytes was exposed to microwave radiation (50 mW/cm(2), 5 min). The structure was observed by scanning electron microscopy (SEM) and the permeability was assessed by measuring transendothelial electrical resistance (TEER) and horseradish peroxidase (HRP) transmission. Activity and expression of VEGF/Flk-1-ERK pathway components and occludin also were examined. Our results showed that microwave radiation caused intercellular tight junctions to broaden and fracture with decreased TEER values and increased HRP permeability. After microwave exposure, activation of the VEGF/Flk-1-ERK pathway and Tyr phosphorylation of occludin were observed, along with down-regulated expression and interaction of occludin with zonula occludens-1 (ZO-1). After Flk-1 (SU5416) and MEK1/2 (U0126) inhibitors were used, the structure and function of the BBB were recovered. The increase in expression of ERK signal transduction molecules was muted, while the expression and the activity of occludin were accelerated, as well as the interactions of occludin with p-ERK and ZO-1 following microwave radiation. Thus, microwave radiation may induce BBB damage by activating the VEGF/Flk-1-ERK pathway, enhancing Tyr phosphorylation of occludin, while partially inhibiting expression and interaction of occludin with ZO-1.

  14. Heat stress-induced disruption of endothelial barrier function is via PAR1 signaling and suppressed by Xuebijing injection.


    Xu, Qiulin; Liu, Jingxian; Wang, Zhenglian; Guo, Xiaohua; Zhou, Gengbiao; Liu, Yanan; Huang, Qiaobing; Su, Lei


    Increased vascular permeability leading to acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) is central to the pathogenesis of heatstroke. Protease-activated receptor 1 (PAR1), the receptor for thrombin, plays a key role in disruption of endothelial barrier function in response to extracellular stimuli. However, the role of PAR1 in heat stress-induced endothelial hyper-permeability is unknown. In this study, we measured PAR1 protein expression in heat-stressed human umbilical venous endothelial cells (HUVECs), investigated the influences of PAR1 on endothelial permeability, F-actin rearrangement, and moesin phosphorylation by inhibiting PAR1 with its siRNA, neutralizing antibody (anti-PAR1), specific inhibitor(RWJ56110), and Xuebijing injection (XBJ), a traditional Chinese medicine used for sepsis treatment, and evaluated the role of PAR1 in heatstroke-related ALI/ARDS in mice by suppressing PAR1 with RWJ56110, anti-PAR1and XBJ. We found that heat stress induced PAR1 protein expression 2h after heat stress in endothelial cells, caused the release of endothelial matrix metalloprotease 1, an activator of PAR1, after 60 or 120 min of heat stimulation, as well as promoted endothelial hyper-permeability and F-actin rearrangement, which were inhibited by suppressing PAR1 with RWJ56110, anti-PAR1 and siRNA. PAR1 mediated moesin phosphorylation, which caused F-actin rearrangement and disruption of endothelial barrier function. To corroborate findings from in vitro experiments, we found that RWJ56110 and the anti-PAR1 significantly decreased lung edema, pulmonary microvascular permeability, protein exudation, and leukocytes infiltrations in heatstroke mice. Additionally, XBJ was found to suppress PAR1-moesin signal pathway and confer protective effects on maintaining endothelial barrier function both in vitro and in vivo heat-stressed model, similar to those observed above with the inhibition of PAR1. These results suggest that PAR1 is a potential

  15. Not just the brain: methamphetamine disrupts blood-spinal cord barrier and induces acute glial activation and structural damage of spinal cord cells.


    Kiyatkin, Eugene A; Sharma, Hari S


    Acute methamphetamine (METH) intoxication induces metabolic brain activation as well as multiple physiological and behavioral responses that could result in life-threatening health complications. Previously, we showed that METH (9 mg/kg) used in freely moving rats induces robust leakage of blood-brain barrier, acute glial activation, vasogenic edema, and structural abnormalities of brain cells. These changes were tightly correlated with drug-induced brain hyperthermia and were greatly potentiated when METH was used at warm ambient temperatures (29°C), inducing more robust and prolonged hyperthermia. Extending this line of research, here we show that METH also strongly increases the permeability of the blood-spinal cord barrier as evidenced by entry of Evans blue and albumin immunoreactivity in T9-12 segments of the spinal cord. Similar to the blood-brain barrier, leakage of bloodspinal cord barrier was associated with acute glial activation, alterations of ionic homeostasis, water tissue accumulation (edema), and structural abnormalities of spinal cord cells. Similar to that in the brain, all neurochemical alterations correlated tightly with drug-induced elevations in brain temperature and they were enhanced when the drug was used at 29°C and brain hyperthermia reached pathological levels (>40°C). We discuss common features and differences in neural responses between the brain and spinal cord, two inseparable parts of the central nervous system affected by METH exposure.

  16. VE-cadherin involved in the pulmonary microvascular endothelial cell barrier injury induced by angiotensin II through modulating the cellular apoptosis and skeletal rearrangement

    PubMed Central

    Wu, Zhiyong; Liu, Huagang; Ren, Wei; Dai, Feifeng; Chang, Jinxing; Li, Bowen


    Objective: Angiotensin II (AngII) involved in the pathogenesis of pulmonary injury through impairing the integrity of pulmonary microvascular endothelial barrier, but the mechanism is still not clear. We aim to determine the roles of VE-cadherin, playing crucial roles in the adhesion of the vascular endothelial barrier and the barrier function, in the pulmonary microvascular endothelial cell (PMVEC) barrier injury mediated by AngII. Methods: Mice acute lung injury (ALI) model was induced through pumping of AngII. The infiltration of macrophages and neutrophils as well as the PMVEC permeability were determined in order to determine the barrier injury in vivo and in vitro. Knockdown of VE-cadherin was established using siRNA technique, and its roles in the apoptosis and skeletal rearrangement in the PMVECs were evaluated. Results: After AngII interference, the expression of VE-cadherin in the PMVECs and pulmonary tissues in mice was down-regulated. Upon VE-cadherin knockdown through siRNA technique, AngII induced susceptibility of PMVECs to apoptosis. Knockdown of VE-cadherin contributed to the skeletal rearrangement in the endothelial cells, together with increase of permeability. Conclusions: VE-cadherin expression is closely related to the apoptosis and skeletal rearrangement of PMVECs induced by AngII. PMID:27830014

  17. Lipopolysaccharide-Induced Middle Ear Inflammation Disrupts the cochlear Intra-Strial Fluid–Blood Barrier through Down-Regulation of Tight Junction Proteins

    PubMed Central

    Zhang, Jinhui; Chen, Songlin; Hou, Zhiqiang; Cai, Jing; Dong, Mingmin; Shi, Xiaorui


    Middle ear infection (or inflammation) is the most common pathological condition that causes fluid to accumulate in the middle ear, disrupting cochlear homeostasis. Lipopolysaccharide, a product of bacteriolysis, activates macrophages and causes release of inflammatory cytokines. Many studies have shown that lipopolysaccharides cause functional and structural changes in the inner ear similar to that of inflammation. However, it is specifically not known how lipopolysaccharides affect the blood-labyrinth barrier in the stria vascularis (intra-strial fluid–blood barrier), nor what the underlying mechanisms are. In this study, we used a cell culture-based in vitro model and animal-based in vivo model, combined with immunohistochemistry and a vascular leakage assay, to investigate lipopolysaccharide effects on the integrity of the mouse intra-strial fluid–blood barrier. Our results show lipopolysaccharide-induced local infection significantly affects intra-strial fluid–blood barrier component cells. Pericytes and perivascular-resident macrophage-like melanocytes are particularly affected, and the morphological and functional changes in these cells are accompanied by substantial changes in barrier integrity. Significant vascular leakage is found in the lipopolysaccharide treated-animals. Consistent with the findings from the in vivo animal model, the permeability of the endothelial cell monolayer to FITC-albumin was significantly higher in the lipopolysaccharide-treated monolayer than in an untreated endothelial cell monolayer. Further study has shown the lipopolysaccharide-induced inflammation to have a major effect on the expression of tight junctions in the blood barrier. Lipopolysaccharide was also shown to cause high frequency hearing loss, corroborated by previous reports from other laboratories. Our findings show lipopolysaccharide-evoked middle ear infection disrupts inner ear fluid balance, and its particular effects on the intra-strial fluid

  18. Lipopolysaccharide-induced middle ear inflammation disrupts the cochlear intra-strial fluid-blood barrier through down-regulation of tight junction proteins.


    Zhang, Jinhui; Chen, Songlin; Hou, Zhiqiang; Cai, Jing; Dong, Mingmin; Shi, Xiaorui


    Middle ear infection (or inflammation) is the most common pathological condition that causes fluid to accumulate in the middle ear, disrupting cochlear homeostasis. Lipopolysaccharide, a product of bacteriolysis, activates macrophages and causes release of inflammatory cytokines. Many studies have shown that lipopolysaccharides cause functional and structural changes in the inner ear similar to that of inflammation. However, it is specifically not known how lipopolysaccharides affect the blood-labyrinth barrier in the stria vascularis (intra-strial fluid-blood barrier), nor what the underlying mechanisms are. In this study, we used a cell culture-based in vitro model and animal-based in vivo model, combined with immunohistochemistry and a vascular leakage assay, to investigate lipopolysaccharide effects on the integrity of the mouse intra-strial fluid-blood barrier. Our results show lipopolysaccharide-induced local infection significantly affects intra-strial fluid-blood barrier component cells. Pericytes and perivascular-resident macrophage-like melanocytes are particularly affected, and the morphological and functional changes in these cells are accompanied by substantial changes in barrier integrity. Significant vascular leakage is found in the lipopolysaccharide treated-animals. Consistent with the findings from the in vivo animal model, the permeability of the endothelial cell monolayer to FITC-albumin was significantly higher in the lipopolysaccharide-treated monolayer than in an untreated endothelial cell monolayer. Further study has shown the lipopolysaccharide-induced inflammation to have a major effect on the expression of tight junctions in the blood barrier. Lipopolysaccharide was also shown to cause high frequency hearing loss, corroborated by previous reports from other laboratories. Our findings show lipopolysaccharide-evoked middle ear infection disrupts inner ear fluid balance, and its particular effects on the intra-strial fluid-blood barrier

  19. Source/drain technologies for the scaling of nanoscale CMOS device

    NASA Astrophysics Data System (ADS)

    Song, Yi; Zhou, Huajie; Xu, Qiuxia


    Continuous shrinking CMOS device into 21 nm technology node is facing fundamental challenges. The International Technology Roadmap for Semiconductors (ITRS) forecasts specific requirements to realize acceptable CMOS performance for the semiconductor industry. The innovations of various source/drain technologies are considered to be indispensable for the continuous scaling of CMOS device due to the requirements of high-performance and effective suppression of short channel effects. One of the key points is to realize ultra-shallow junction with steep concentration profile and low resistivity. There are many innovative solutions including advanced doping technologies and annealing technologies for ultra-shallow junction formation. Additionally, new source/drain structures such as raised source/drain and Schottky barrier metal source/drain, and advanced silicidation technologies also serve as the important options. The state-of-the-arts of these new technologies are extensively discussed from the view point of technical innovation and performance gain. Source/drain technologies are promising and active areas of device research down to 21 nm technology node and even beyond.

  20. Spontaneous versus induced hydrogen and deuterium helical shaped plasmas with electron internal transport barriers

    NASA Astrophysics Data System (ADS)

    Gobbin, M.; Franz, P.; Auriemma, F.; Lorenzini, R.; Marrelli, L.


    Electron internal transport barriers (eITBs) in high current plasmas with helical equilibria of the reversed field pinch experiment RFX-mod are analyzed and characterized in detail thanks to a high time resolution double filter diagnostic for the electron temperature spatial profile determination. The large amount of data provided by this diagnostic has required the development of dedicated algorithms and the identification of suitable parameters, reported and described in this paper, in order to perform automatic statistical studies. These numerical tools have been used to examine the effect of three dimensional (3D) magnetic fields applied by the RFX-mod 192 active coils in deuterium and hydrogen discharges with the aim to improve the sustainment and control of helical equilibria with eITBs. It is shown that 3D fields partially increase the occurring of helical states but with only a moderate effect on the eITBs duration; moreover, they have a different impact on the confinement properties in hydrogen and deuterium discharges. Numerical simulations, by the Hamiltonian guiding center code ORBIT, investigate the effect of magnetic topology in plasmas with and without the application of 3D fields on deuterium and hydrogen test ions transport. Results from numerical studies are in agreement with estimates of the particle confinement times showing that particle transport is reduced in deuterium plasmas but not significantly affected by the application of helical boundary conditions.

  1. Facilitating climate-change-induced range shifts across continental land-use barriers.


    Robillard, Cassandra M; Coristine, Laura E; Soares, Rosana N; Kerr, Jeremy T


    Climate changes impose requirements for many species to shift their ranges to remain within environmentally tolerable areas, but near-continuous regions of intense human land use stretching across continental extents diminish dispersal prospects for many species. We reviewed the impact of habitat loss and fragmentation on species' abilities to track changing climates and existing plans to facilitate species dispersal in response to climate change through regions of intensive land uses, drawing on examples from North America and elsewhere. We identified an emerging analytical framework that accounts for variation in species' dispersal capacities relative to both the pace of climate change and habitat availability. Habitat loss and fragmentation hinder climate change tracking, particularly for specialists, by impeding both propagule dispersal and population growth. This framework can be used to identify prospective modern-era climatic refugia, where the pace of climate change has been slower than surrounding areas, that are defined relative to individual species' needs. The framework also underscores the importance of identifying and managing dispersal pathways or corridors through semi-continental land use barriers that can benefit many species simultaneously. These emerging strategies to facilitate range shifts must account for uncertainties around population adaptation to local environmental conditions. Accounting for uncertainties in climate change and dispersal capabilities among species and expanding biological monitoring programs within an adaptive management paradigm are vital strategies that will improve species' capacities to track rapidly shifting climatic conditions across landscapes dominated by intensive human land use.

  2. Miniature Dielectric Barrier Discharge Nonthermal Plasma Induces Apoptosis in Lung Cancer Cells and Inhibits Cell Migration.


    Karki, Surya B; Yildirim-Ayan, Eda; Eisenmann, Kathryn M; Ayan, Halim


    Traditional cancer treatments like radiotherapy and chemotherapy have drawbacks and are not selective for killing only cancer cells. Nonthermal atmospheric pressure plasmas with dielectric barrier discharge (DBD) can be applied to living cells and tissues and have emerged as novel tools for localized cancer therapy. The purpose of this study was to investigate the different effects caused by miniature DBD (mDBD) plasma to A549 lung cancer cells. In this study, A549 lung cancer cells cultured in 12 well plates were treated with mDBD plasma for specified treatment times to assess the changes in the size of the area of cell detachment, the viability of attached or detached cells, and cell migration. Furthermore, we investigated an innovative mDBD plasma-based therapy for localized treatment of lung cancer cells through apoptotic induction. Our results indicate that plasma treatment for 120 sec causes apoptotic cell death in 35.8% of cells, while mDBD plasma treatment for 60 sec, 30 sec, or 15 sec causes apoptotic cell death in 20.5%, 14.1%, and 6.3% of the cell population, respectively. Additionally, we observed reduced A549 cell migration in response to mDBD plasma treatment. Thus, mDBD plasma system can be a viable platform for localized lung cancer therapy.

  3. Blood nerve barrier in rat and cellular mechanisms of lead-induced segmental demyelination

    SciTech Connect

    Dyck, P.J.; Windebank, A.J.; Low, P.A.; Baumann, W.J.


    Feeding of lead carbonate to rats causes widespread and reproducible segmental de- and remyelination of myelinated fibers (MFs) of peripheral nerve. Such segmental demyelination might be explained by increased permeability of endoneurial capillaries to serum containing protein-bound lead. The perineurium of control and lead nerves was impermeable to fluorescein-labeled bovine albumin (FBA) and to horseradish peroxidase (HRP). Epineurial capillaries in both conditions allowed HRP to pass freely between and, to a lesser extent, through endothelial cells. Contrary to expectation, flooding of the endoneurium with HRP was seen in only 1 of 36 tissue blocks of lead nerves from rats fed 4% lead carbonate for 7 1/2 and 12 weeks. Abundant HRP reaction product was seen in the epineurium in more than half of these tissue blocks. HRP was not generally found in endoneurial fluid, even in lead nerves with marked edema and widespread segmental de- and remyelination. These findings are against a massive breakdown of the blood nerve barrier. These studies suggest that there may be an increased transfer of HRP through endoneurial cells in lead neuropathy.

  4. Improved Ethanol Production from Xylose by Candida shehatae Induced by Dielectric Barrier Discharge Air Plasma

    NASA Astrophysics Data System (ADS)

    Chen, Huixia; Xiu, Zhilong; Bai, Fengwu


    Xylose fermentation is essential for ethanol production from lignocellulosic biomass. Exposure of the xylose-fermenting yeast Candida shehatae (C. shehatae) CICC1766 to atmospheric pressure dielectric barrier discharge (DBD) air plasma yields a clone (designated as C81015) with stability, which exhibits a higher ethanol fermentation rate from xylose, giving a maximal enhancement in ethanol production of 36.2% compared to the control (untreated). However, the biomass production of C81015 is lower than that of the control. Analysis of the NADH (nicotinamide adenine dinucleotide)- and NADPH (nicotinamide adenine dinucleotide phosphate)-linked xylose reductases and NAD+-linked xylitol dehydrogenase indicates that their activities are enhanced by 34.1%, 61.5% and 66.3%, respectively, suggesting that the activities of these three enzymes are responsible for improving ethanol fermentation in C81015 with xylose as a substrate. The results of this study show that DBD air plasma could serve as a novel and effective means of generating microbial strains that can better use xylose for ethanol fermentation.

  5. Understanding {sup 6}He induced reactions at energies around the Coulomb barrier

    SciTech Connect

    Moro, A. M.; Arias, J. M.; Acosta, L.; Martel, I.; Sanchez-Benitez, A. M.; Borge, M. J. G.; Escrig, D.; Tengblad, O.; Gomez-Camacho, J.; Rodriguez-Gallardo, M.


    Recent developments aimed to understand the observed features arising in the scattering of the Borromean nucleus {sup 6}He on heavy targets are discussed and compared with recent data for {sup 6}He+{sup 208}Pb measured at the RIB facility at Louvain-la-Neuve at energies around the Coulomb barrier. The analysis of the elastic scattering data in terms of the optical model, reveals the presence of a long range absorption mechanism, that manifests in the form of a large value of the imaginary diffuseness parameter. The elastic data have been also compared with three--body CDCC calculations, based on a di-neutron model of {sup 6}He, and four--body CDCC calculations, based on a more realistic three-body model of this nucleus. Finally, the angular and energy distribution of {alpha} particles emitted at backward angles are discussed and compared with different theoretical approaches. We find that these {alpha} particles are produced mainly by a two-neutron transfer mechanism to very excited states in the residual nucleus.

  6. Wire-cylinder dielectric barrier discharge induced degradation of aqueous atrazine.


    Zhu, Dan; Jiang, Lin; Liu, Run-Long; Chen, Pei; Lang, Lin; Feng, Jing-Wei; Yuan, Shou-Jun; Zhao, Da-Yong


    The wire-cylinder dielectric barrier discharge reactor was adopted for removal of aqueous atrazine. The effect of different parameters on the degradation efficiency of atrazine was investigated, and the degradation mechanism of atrazine was studied. The experimental results showed that when the discharge power was 50 W and the air flow rate was 140 L h(-1), 93.7% of atrazine was degraded after 18 min of discharge time. The concentrations of generated O3 and H2O2 increased with increasing discharge time. The pH decreased from 6.80 to 2.50, 12.7% of TOC was removed after 18 min. The concentrations of generated Cl(-) and NO3(-) increased significantly during the degradation process of atrazine, and the decreasing toxicity trend was observed for the treated atrazine solution. The degradation byproducts of atrazine were identified using liquid chromatography-time-of-flight mass spectrometry (LC-TOF-MS), which might be formed mainly in dechlorination hydroxylation, alkyl oxidation, dechlorination hydroxylation combined with alkyl oxidation and demethylation oxidation reactions.

  7. Miniature Dielectric Barrier Discharge Nonthermal Plasma Induces Apoptosis in Lung Cancer Cells and Inhibits Cell Migration

    PubMed Central

    Eisenmann, Kathryn M.


    Traditional cancer treatments like radiotherapy and chemotherapy have drawbacks and are not selective for killing only cancer cells. Nonthermal atmospheric pressure plasmas with dielectric barrier discharge (DBD) can be applied to living cells and tissues and have emerged as novel tools for localized cancer therapy. The purpose of this study was to investigate the different effects caused by miniature DBD (mDBD) plasma to A549 lung cancer cells. In this study, A549 lung cancer cells cultured in 12 well plates were treated with mDBD plasma for specified treatment times to assess the changes in the size of the area of cell detachment, the viability of attached or detached cells, and cell migration. Furthermore, we investigated an innovative mDBD plasma-based therapy for localized treatment of lung cancer cells through apoptotic induction. Our results indicate that plasma treatment for 120 sec causes apoptotic cell death in 35.8% of cells, while mDBD plasma treatment for 60 sec, 30 sec, or 15 sec causes apoptotic cell death in 20.5%, 14.1%, and 6.3% of the cell population, respectively. Additionally, we observed reduced A549 cell migration in response to mDBD plasma treatment. Thus, mDBD plasma system can be a viable platform for localized lung cancer therapy. PMID:28243603

  8. Opening of brain blood barrier induced by red light and central analgesic improvement of cobra neurotoxin.


    Ye, Yong; Li, Yue; Fang, Fei


    Cobra neurotoxin (NT) has central analgesic effects, but it is difficult to pass through brain blood barrier (BBB). A novel method of red light induction is designed to help NT across BBB, which is based on photosensitizer activation by red light to generate reactive oxygen species (ROS) to open BBB. The effects were evaluated on cell models and animals in vivo with illumination by semiconductor laser at 670nm on photosensitizer pheophorbide isolated from silkworm excrement. Brain microvascular endothelial cells and astrocytes were co-cultured to build up BBB cell model. The radioactivity of (125)I-NT was measured in cells and tissues for NT permeation. Three ways of cranial irradiation, nasal cavity and intravascular irradiation were tested with combined injection of (125)I-NT 20μg/kg and pheophorbide 100μg/kg to rats, and organs of rats were separated and determined the radioactivity. Paw pressure test in rats, hot plate and writhing test in mice were applied to appraise the analgesic effects. NT across BBB cell model increased with time of illumination, and reached stable level after 60min. So did ROS in cells. NT mainly distributed in liver and kidney of rats, significantly increased in brain after illumination, and improved analgesic effects. Excitation of pheophorbide at red light produces ROS to open BBB, help NT enter brain, and enhance its central action. This research provides a new method for drug across BBB to improve its central role.

  9. Impairment of skin barrier function via cholinergic signal transduction in a dextran sulphate sodium-induced colitis mouse model.


    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya


    Dry skin has been clinically associated with visceral diseases, including liver disease, as well as for our previously reported small intestinal injury mouse model, which have abnormalities in skin barrier function. To clarify this disease-induced skin disruption, we used a dextran sulphate sodium (DSS)-induced colitis mouse model. Following treatment with DSS, damage to the colon and skin was monitored using histological and protein analysis methods as well as the detection of inflammatory mediators in the plasma. Notably, transepidermal water loss was higher, and skin hydration was lower in DSS-treated mice compared to controls. Tumor necrosis factor-alpha (TNF-α), interleukin 6 and NO2-/NO3- levels were also upregulated in the plasma, and a decrease in body weight and colon length was observed in DSS-treated mice. However, when administered TNF-α antibody or an iNOS inhibitor, no change in skin condition was observed, indicating that another signalling mechanism is utilized. Interestingly, the number of tryptase-expressing mast cells, known for their role in immune function via cholinergic signal transduction, was elevated. To evaluate the function of cholinergic signalling in this context, atropine (a muscarinic cholinoceptor antagonist) or hexamethonium (a nicotinic cholinergic ganglion-blocking agent) was administered to DSS-treated mice. Our data indicate that muscarinic acetylcholine receptors (mAChRs) are the primary receptors functioning in colon-to-skin signal transduction, as DSS-induced skin disruption was suppressed by atropine. Thus, skin disruption is likely associated with DSS-induced colitis, and the activation of mast cells via mAChRs is critical to this association.

  10. Optimization of the Ultrasound-Induced Blood-Brain Barrier Opening

    PubMed Central

    Konofagou, Elisa E.


    Current treatments of neurological and neurodegenerative diseases are limited due to the lack of a truly non-invasive, transient, and regionally selective brain drug delivery method. The brain is particularly difficult to deliver drugs to because of the blood-brain barrier (BBB). The impermeability of the BBB is due to the tight junctions connecting adjacent endothelial cells and highly regulatory transport systems of the endothelial cell membranes. The main function of the BBB is ion and volume regulation to ensure conditions necessary for proper synaptic and axonal signaling. However, the same permeability properties that keep the brain healthy also constitute the cause of the tremendous obstacles posed in its pharmacological treatment. The BBB prevents most neurologically active drugs from entering the brain and, as a result, has been isolated as the rate-limiting factor in brain drug delivery. Until a solution to the trans-BBB delivery problem is found, treatments of neurological diseases will remain impeded. Over the past decade, methods that combine Focused Ultrasound (FUS) and microbubbles have been shown to offer the unique capability of noninvasively, locally and transiently open the BBB so as to treat central nervous system (CNS) diseases. Four of the main challenges that have been taken on by our group and discussed in this paper are: 1) assess its safety profile, 2) unveil the mechanism by which the BBB opens and closes, 3) control and predict the opened BBB properties and duration of the opening and 4) assess its premise in brain drug delivery. All these challenges will be discussed, findings in both small (mice) and large (non-human primates) animals are shown and finally the clinical potential for this technique is shown. PMID:23382778

  11. Bryostatin-1 Restores Blood Brain Barrier Integrity following Blast-Induced Traumatic Brain Injury

    PubMed Central

    Lucke-Wold, Brandon P.; Logsdon, Aric F.; Smith, Kelly E.; Turner, Ryan C.; Alkon, Daniel L.; Tan, Zhenjun; Naser, Zachary J.; Knotts, Chelsea M.; Huber, Jason D.


    Recent wars in Iraq and Afghanistan have accounted for an estimated 270,000 blast exposures among military personnel. Blast traumatic brain injury (TBI) is the ‘signature injury’ of modern warfare. Blood brain barrier (BBB) disruption following blast TBI can lead to long-term and diffuse neuroinflammation. In this study, we investigate for the first time the role of bryostatin-1, a specific protein kinase C (PKC) modulator, in ameliorating BBB breakdown. Thirty seven Sprague–Dawley rats were used for this study. We utilized a clinically relevant and validated blast model to expose animals to moderate blast exposure. Groups included: control, single blast exposure, and single blast exposure + bryostatin-1. Bryostatin-1 was administered i.p. 2.5 mg/kg after blast exposure. Evan’s blue, immunohistochemistry, and western blot analysis were performed to assess injury. Evan’s blue binds to albumin and is a marker for BBB disruption. The single blast exposure caused an increase in permeability compared to control (t=4.808, p<0.05), and a reduction back toward control levels when bryostatin-1 was administered (t=5.113, p<0.01). Three important PKC isozymes, PKCα, PKCδ, and PKCε, were co-localized primarily with endothelial cells but not astrocytes. Bryostatin-1 administration reduced toxic PKCα levels back toward control levels (t=4.559, p<0.01) and increased the neuroprotective isozyme PKCε (t=6.102, p<0.01). Bryostatin-1 caused a significant increase in the tight junction proteins VE-cadherin, ZO-1, and occludin through modulation of PKC activity. Bryostatin-1 ultimately decreased BBB breakdown potentially due to modulation of PKC isozymes. Future work will examine the role of bryostatin-1 in preventing chronic neurodegeneration following repetitive neurotrauma. PMID:25301233

  12. Bryostatin-1 Restores Blood Brain Barrier Integrity following Blast-Induced Traumatic Brain Injury.


    Lucke-Wold, Brandon P; Logsdon, Aric F; Smith, Kelly E; Turner, Ryan C; Alkon, Daniel L; Tan, Zhenjun; Naser, Zachary J; Knotts, Chelsea M; Huber, Jason D; Rosen, Charles L


    Recent wars in Iraq and Afghanistan have accounted for an estimated 270,000 blast exposures among military personnel. Blast traumatic brain injury (TBI) is the 'signature injury' of modern warfare. Blood brain barrier (BBB) disruption following blast TBI can lead to long-term and diffuse neuroinflammation. In this study, we investigate for the first time the role of bryostatin-1, a specific protein kinase C (PKC) modulator, in ameliorating BBB breakdown. Thirty seven Sprague-Dawley rats were used for this study. We utilized a clinically relevant and validated blast model to expose animals to moderate blast exposure. Groups included: control, single blast exposure, and single blast exposure + bryostatin-1. Bryostatin-1 was administered i.p. 2.5 mg/kg after blast exposure. Evan's blue, immunohistochemistry, and western blot analysis were performed to assess injury. Evan's blue binds to albumin and is a marker for BBB disruption. The single blast exposure caused an increase in permeability compared to control (t = 4.808, p < 0.05), and a reduction back toward control levels when bryostatin-1 was administered (t = 5.113, p < 0.01). Three important PKC isozymes, PKCα, PKCδ, and PKCε, were co-localized primarily with endothelial cells but not astrocytes. Bryostatin-1 administration reduced toxic PKCα levels back toward control levels (t = 4.559, p < 0.01) and increased the neuroprotective isozyme PKCε (t = 6.102, p < 0.01). Bryostatin-1 caused a significant increase in the tight junction proteins VE-cadherin, ZO-1, and occludin through modulation of PKC activity. Bryostatin-1 ultimately decreased BBB breakdown potentially due to modulation of PKC isozymes. Future work will examine the role of bryostatin-1 in preventing chronic neurodegeneration following repetitive neurotrauma.

  13. Comparison of Postoperative Drain Insertion versus No Drain Insertion in Thyroidectomies

    PubMed Central

    Al-Habsi, Asma S.; Al-Sulaimani, Al-Anood K.; Taqi, Kadhim M.; Al-Qadhi, Hani A.


    Objectives A thyroidectomy is a frequently performed surgical procedure which can result in life-threatening complications. The insertion of a drain after a thyroidectomy has been suggested to prevent such complications. This study aimed to evaluate the use of surgical drains following thyroidectomies in relation to postoperative complications and mass sizes. Methods This retrospective case-control study included all thyroidectomies conducted at the Sultan Qaboos University Hospital, Muscat, Oman, from January 2011 to December 2013. Length of hospital stay, readmission, postoperative complications and mass size were evaluated. Results During the study period, 250 surgeries were carried out on 241 patients. The majority of patients were female (87.2%). Drains were inserted postoperatively after 202 surgeries (80.8%) compared to 48 surgeries (19.2%) without drains. A total of 32 surgeries (12.8%) were conducted on patients with thyroid masses <1 cm, 138 (55.2%) on those with masses between 1–4 cm and 80 (32.0%) on those with masses >4 cm. The association between drain use and mass size was not significant (P = 0.439). Although postoperative complications were more prevalent in patients with drains, the relationship between these factors was not significant (P >0.050). Length of hospital stay was significantly longer among patients with postoperative drains (P <0.010). Conclusion The routine insertion of drains after thyroid surgeries was found to result in longer hospital stays and did not reduce rates of post-thyroidectomy complications. Thyroid mass size should not be used as an indicator for the insertion of a drain after thyroidectomy. PMID:28003893

  14. Design and construction of a French drain for groundwater diversion in solid waste storage area six at the Oak Ridge National Laboratory

    SciTech Connect

    Davis, E.C.; Stansfield, R.G.


    Engineering modifiations or engineered barriers have been suggested as a possible means of improving the performance of low-level waste disposal sites located in the humid eastern United States. Design and construction of a passive French drain, located in Solid Waste Storage Area No. 6 at the Oak Ridge National Laboratory. The drain was designed to hydrologically isolate a 0.44-ha area that contains a group of 49 low-level waste trenches by separating it from upgradient groundwater recharge areas. The 252-m drain (maximum depth = 9 m) that surrounds the group of trenches on the north and east sides was excavated, lined with filter fabric, backfilled with crushed stone, and covered with a 0.6 m layer of excavated material at an estimated cost of $153,000. Of the 17 days it took to complete the work, about 5 days were spent excavating sidewall slide material that fell into the drain during excavation. Photography of the drain wall revealed the contorted structure of the weathered shale, which was responsible for many of the slides. Monitoring wells placed at intervals on the drain centerline indicate that groundwater is draining from the surrounding Maryville Formation (Conasauga Group); flows at catch basin No. 2 ranged from a base flow of 4 to 7 L/min to a maximum of 35 L/min, recorded on October 13. In response to groundwater flow in the drain, water levels in several monitoring wells adjacent to the drain have dropped by as much as 2.24 m to an elevation only slightly higher than the bottom of the French drain. In addition to the general lowering of the water table in the vicinity of the drain, water levels in three trenches began to subside, indicating that the drain is beginning to have an effect on the water in the trenches as well. Further monitoring of both drain discharge and water levels in monitoring wells across the site is continuing.

  15. Protection of blood-brain barrier breakdown by nifedipine in adrenaline-induced acute hypertension.


    Nukhet Turkel, A; Ziya Ziylan, Y


    The question of whether influxes of ionic Ca+2 into cerebral endothelium plays an important role in increased vascular permeability consequent to an acute hypertension is not accurately resolved. We tested the effect of nifedipine, a calcium entry blocker, on the cerebrovascular permeability for proteins in adrenalin-induced acute hypertension. The experiments were carried out on male Wistar rats. The experimental groups consisted of normotensive saline controls, adrenaline-induced hypertensive rats, and adrenalin-induced hypertensive rats as pre-treated or post-treated with a bolus of nifedipine. Brains of hypertensive rats showed increased permeability to Evans Blue-Albumin complex, when blood pressure elevated rapidly to more than 170 mmHg. The number and size of areas of Evans-Blue extravasation were smaller if an increase in blood pressure was prevented. The short lasting elevation of blood pressure did not result in protein extravasation in brains of hypertensive rats. The results suggest that nifedipine can modify the permeability disruptions observed in acutely hypertensive rats. The data also support the hypothesis that Ca+2 may be responsible for the changes in permeability of BBB in hypertension by mediating the contraction of vascular muscles.

  16. Mycotoxin detoxifiers attenuate deoxynivalenol-induced pro-inflammatory barrier insult in porcine enterocytes as an in vitro evaluation model of feed mycotoxin reduction.


    Park, Seong-Hwan; Kim, Juil; Kim, Dongwook; Moon, Yuseok


    Deoxynivalenol (DON), the most prevalent mycotoxin worldwide, leads to economic losses for animal food production. Swine is a most sensitive domestic animal to DON due to rapid absorption and low detoxification by gut microbiota. Specifically, DON can severely damage pig intestinal tissue by disrupting the intestinal barrier and inducing inflammatory responses. We evaluated the effects of several mycotoxin detoxifiers including bentonites, yeast cell wall components, and mixture-typed detoxifier composed of mineral, microorganisms, and phytogenic substances on DON-insulted intestinal barrier and pro-inflammatory responses using in vitro porcine enterocyte culture model. DON-induced disruption of the in vitro gut barrier was attenuated by all three mycotoxin detoxifiers in dose-dependent manners. These mycotoxin detoxifiers also suppressed DON-induced pro-inflammatory chemokine expression to different degrees, which was mediated by downregulation of mitogen-activated kinases and early growth response-1. Of note, the mixture-typed detoxifier was the most prominent mitigating agent at the cellular levels whereas the high dose of bentonite clay also had suppressive action against DON-induced pro-inflammatory insult. The in vitro porcine enterocyte-based assessment of intestinal barrier integrity and inflammatory signals provides sensitive and simplified alternative bioassay of feed additives such as detoxifiers against enteropathogenic mycotoxins with comprehensive mechanistic confirmation.

  17. Targeted gene delivery to the mouse brain by MRI-guided focused ultrasound-induced blood-brain barrier disruption.


    Huang, Qin; Deng, Jinmu; Wang, Feng; Chen, Song; Liu, Yingjiang; Wang, Zhibiao; Wang, Zhigang; Cheng, Yuan


    This study aimed to investigate the feasibility of targeted gene transfer into central nervous system (CNS) by MRI-guided focused ultrasound-induced blood-brain barrier (BBB) disruption. Before each sonication, T2-weighted images were obtained to select the target region. Followed by injecting DNA-loaded microbubbles into the tail vein, sonication was performed. The state of local BBB, distribution of plasmid DNA through the opened BBB, the ultrastructural changes of neurons and BDNF expression were detected. The results showed that MRI-guided focused ultrasound (FUS) could accomplish noninvasive, transient, and local BBB disruption, at 1h after sonication, plasmid DNA across the opened BBB had been internalized into the neurons presenting heterogeneous distribution and numerous transparent vesicles were observed in the cytoplasm of the neurons at the sonicated region, suggesting vesicle-mediated endocytosis. At 48 h after sonication, the expressions of exogenous gene pBDNF-EGFP were observed in the cytoplasm of some neurons, and BDNF expressions were markedly enhanced by the combination of ultrasound and pBDNF-EGFP-loaded microbubbles about 20-fold than that of the control group (P<0.01). The method by using MRI-guided FUS to induce the local BBB disruption could accomplish effective targeted exogenous gene transfer in CNS. This technique may provide a new option for the treatment of various CNS diseases.

  18. Pharmacokinetics of BPA in gliomas with ultrasound induced blood-brain barrier disruption as measured by microdialysis.


    Yang, Feng-Yi; Lin, Yi-Li; Chou, Fong-In; Lin, Yu-Chuan; Hsueh Liu, Yen-Wan; Chang, Lun-Wei; Hsieh, Yu-Ling


    The blood-brain barrier (BBB) can be transiently disrupted by focused ultrasound (FUS) in the presence of microbubbles for targeted drug delivery. Previous studies have illustrated the pharmacokinetics of drug delivery across the BBB after sonication using indirect visualization techniques. In this study, we investigated the in vivo extracellular kinetics of boronophenylalanine-fructose (BPA-f) in glioma-bearing rats with FUS-induced BBB disruption by microdialysis. After simultaneous intravenous administration of BPA and FUS exposure, the boron concentration in the treated brains was quantified by inductively coupled plasma mass spectroscopy. With FUS, the mean peak concentration of BPA-f in the glioma dialysate was 3.6 times greater than without FUS, and the area under the concentration-time curve was 2.1 times greater. This study demonstrates that intracerebral microdialysis can be used to assess local BBB transport profiles of drugs in a sonicated site. Applying microdialysis to the study of metabolism and pharmacokinetics is useful for obtaining selective information within a specific brain site after FUS-induced BBB disruption.

  19. Transendothelial permeability changes induced by free radicals in an in vitro model of the blood-brain barrier.


    Lagrange, P; Romero, I A; Minn, A; Revest, P A


    In the present study, we investigated the changes in blood-brain barrier (BBB) permeability following brain endothelial cell exposure to different xenobiotics able to promote free radical generation during their metabolism. Our in vitro BBB model consisted of confluent monolayers of immortalized rat brain capillary endothelial cells (RBE4) grown on collagen-coated filters in the presence of C6 glioma cells grown in the lower compartment. We have recently shown that a range of xenobiotics, including menadione, nitrofurazone, and methylviologen (paraquat) may undergo monoelectronic redox cycling in isolated brain capillaries, giving rise to reactive oxygen species. In this study, addition of 100 microM menadione to the culture medium for 30 min significantly increased the permeability of endothelial cell monolayers to radiolabeled sucrose. The effect on endothelial permeability induced by menadione was dose-dependent and reversible. These permeability changes preceded the onset of cell death, as assessed by the Trypan blue exclusion method. Pre-incubation with superoxide dismutase and catalase blocked changes in sucrose permeability to control levels in a dose-dependent manner, suggesting the involvement of reactive oxygen species in menadione-induced BBB opening.

  20. Improving Low-Dose Blood-Brain Barrier Permeability Quantification Using Sparse High-Dose Induced Prior for Patlak Model

    PubMed Central

    Fang, Ruogu; Karlsson, Kolbeinn; Chen, Tsuhan; Sanelli, Pina C.


    Blood-brain-barrier permeability (BBBP) measurements extracted from the perfusion computed tomography (PCT) using the Patlak model can be a valuable indicator to predict hemorrhagic transformation in patients with acute stroke. Unfortunately, the standard Patlak model based PCT requires excessive radiation exposure, which raised attention on radiation safety. Minimizing radiation dose is of high value in clinical practice but can degrade the image quality due to the introduced severe noise. The purpose of this work is to construct high quality BBBP maps from low-dose PCT data by using the brain structural similarity between different individuals and the relations between the high- and low-dose maps. The proposed sparse high-dose induced (shd-Patlak) model performs by building a high-dose induced prior for the Patlak model with a set of location adaptive dictionaries, followed by an optimized estimation of BBBP map with the prior regularized Patlak model. Evaluation with the simulated low-dose clinical brain PCT datasets clearly demonstrate that the shd-Patlak model can achieve more significant gains than the standard Patlak model with improved visual quality, higher fidelity to the gold standard and more accurate details for clinical analysis. PMID:24200529

  1. Resveratrol attenuates lipopolysaccharide-induced dysfunction of blood-brain barrier in endothelial cells via AMPK activation

    PubMed Central


    Resveratrol, a phytoalexin, is reported to activate AMP-activated protein kinase (AMPK) in vascular cells. The blood-brain barrier (BBB), formed by specialized brain endothelial cells that are interconnected by tight junctions, strictly regulates paracellular permeability to maintain an optimal extracellular environment for brain homeostasis. The aim of this study was to elucidate the effects of resveratrol and the role of AMPK in BBB dysfunction induced by lipopolysaccharide (LPS). Exposure of human brain microvascular endothelial cells (HBMECs) to LPS (1 µg/ml) for 4 to 24 hours week dramatically increased the permeability of the BBB in parallel with lowered expression levels of occluding and claudin-5, which are essential to maintain tight junctions in HBMECs. In addition, LPS significantly increased the reactive oxygen species (ROS) productions. All effects induced by LPS in HBVMCs were reversed by adenoviral overexpression of superoxide dismutase, inhibition of NAD(P) H oxidase by apocynin or gain-function of AMPK by adenoviral overexpression of constitutively active mutant (AMPK-CA) or by resveratrol. Finally, upregulation of AMPK by either AMPK-CA or resveratrol abolished the levels of LPS-enhanced NAD(P)H oxidase subunits protein expressions. We conclude that AMPK activation by resveratrol improves the integrity of the BBB disrupted by LPS through suppressing the induction of NAD(P)H oxidase-derived ROS in HBMECs. PMID:27382348

  2. Acute effects of focused ultrasound-induced increases in blood-brain barrier permeability on rat microvascular transcriptome

    PubMed Central

    McMahon, Dallan; Bendayan, Reina; Hynynen, Kullervo


    Therapeutic treatment options for central nervous system diseases are greatly limited by the blood-brain barrier (BBB). Focused ultrasound (FUS), in conjunction with circulating microbubbles, can be used to induce a targeted and transient increase in BBB permeability, providing a unique approach for the delivery of drugs from the systemic circulation into the brain. While preclinical research has demonstrated the utility of FUS, there remains a large gap in our knowledge regarding the impact of sonication on BBB gene expression. This work is focused on investigating the transcriptional changes in dorsal hippocampal rat microvessels in the acute stages following sonication. Microarray analysis of microvessels was performed at 6 and 24 hrs post-FUS. Expression changes in individual genes and bioinformatic analysis suggests that FUS may induce a transient inflammatory response in microvessels. Increased transcription of proinflammatory cytokine genes appears to be short-lived, largely returning to baseline by 24 hrs. This observation may help to explain some previously observed bioeffects of FUS and may also be a driving force for the angiogenic processes and reduced drug efflux suggested by this work. While further studies are necessary, these results open up intriguing possibilities for novel FUS applications and suggest possible routes for pharmacologically modifying the technique. PMID:28374753

  3. Eosinophilic esophagitis–linked calpain 14 is an IL-13–induced protease that mediates esophageal epithelial barrier impairment

    PubMed Central

    Davis, Benjamin P.; Stucke, Emily M.; Khorki, M. Eyad; Litosh, Vladislav A.; Rymer, Jeffrey K.; Rochman, Mark; Travers, Jared; Kottyan, Leah C.


    We recently identified a genome-wide genetic association of eosinophilic esophagitis (EoE) at 2p23 spanning the calpain 14 (CAPN14) gene, yet the causal mechanism has not been elucidated. We now show that recombinant CAPN14 cleaves a calpain-specific substrate and is inhibited by 4 classical calpain inhibitors: MDL-28170, acetyl-calpastatin, E-64, and PD151746. CAPN14 is specifically induced (>100-fold) in esophageal epithelium after IL-13 treatment. Epithelial cells overexpressing CAPN14 display impaired epithelial architecture, characterized by acantholysis, epidermal clefting, and epidermolysis. CAPN14 overexpression impairs epithelial barrier function, as demonstrated by decreased transepithelial resistance (2.1-fold) and increased FITC-dextran flux (2.6-fold). Epithelium with gene-silenced CAPN14 demonstrates increased dilated intercellular spaces (5.5-fold) and less organized basal cell layering (1.5-fold) following IL-13 treatment. Finally, CAPN14 overexpression results in loss of desmoglein 1 (DSG1) expression, whereas the IL-13–induced loss of DSG1 is normalized by CAPN14 gene silencing. Importantly, these findings were specific to CAPN14, as they were not observed with modulation of CAPN1 expression. These results, along with the potent induction of CAPN14 by IL-13 and genetic linkage of EoE to the CAPN14 gene locus, demonstrate a molecular and cellular pathway that contributes to T helper type 2 responses in mucosal epithelium. PMID:27158675

  4. Nanoscale-Barrier Formation Induced by Low-Dose Electron-Beam Exposure in Ultrathin MoS2 Transistors.


    Matsunaga, Masahiro; Higuchi, Ayaka; He, Guanchen; Yamada, Tetsushi; Krüger, Peter; Ochiai, Yuichi; Gong, Yongji; Vajtai, Robert; Ajayan, Pulickel M; Bird, Jonathan P; Aoki, Nobuyuki


    Utilizing an innovative combination of scanning-probe and spectroscopic techniques, supported by first-principles calculations, we demonstrate how electron-beam exposure of field-effect transistors, implemented from ultrathin molybdenum disulfide (MoS2), may cause nanoscale structural modifications that in turn significantly modify the electrical operation of these devices. Quite surprisingly, these modifications are induced by even the relatively low electron doses used in conventional electron-beam lithography, which are found to induce compressive strain in the atomically thin MoS2. Likely arising from sulfur-vacancy formation in the exposed regions, the strain gives rise to a local widening of the MoS2 bandgap, an idea that is supported both by our experiment and by the results of first-principles calculations. A nanoscale potential barrier develops at the boundary between exposed and unexposed regions and may cause extrinsic variations in the resulting electrical characteristics exhibited by the transistor. The widespread use of electron-beam lithography in nanofabrication implies that the presence of such strain must be carefully considered when seeking to harness the potential of atomically thin transistors. At the same time, this work also promises the possibility of exploiting the strain as a means to achieve "bandstructure engineering" in such devices.

  5. Variations of Morphologic Changes induced by Tropical Storm Debby along Three Barrier Island, West-Central Florida, USA

    NASA Astrophysics Data System (ADS)

    Wang, P.; Roberts, T.


    Tropical Storm Debby generated sustained high waves and elevated water levels for nearly three days from June 24th to 26th, 2012, inducing substantial changes in beach and nearshore morphology. In addition, the storm winds and high waves approached the coast from a highly oblique angle from the south, driving substantial northward longshore sand transport, opposite to the regional net annual southward transport. A total of 145 beach and nearshore profiles along 3 adjacent barrier islands were surveyed 2 weeks before and one week after the storm impact. Overall, dune, beach, intertidal, and immediate subtidal areas suffered erosion, while deposition was measured over the nearshore bar. Beach recovery in the form of ridge and runnel development occurred as the storm energy subsided. Substantial longshore variations of storm-induced beach changes were measured, including both severe dune/beach/berm erosion and storm berm accretion, and both onshore and offshore migration of nearshore bar. Factors controlling these longshore variations include: 1) the oblique approaching of the storm forcing, 2) pre-storm beach morphology and chronic erosional or accretional trends, 3) sediment supply, and 4) tidal inlet and beach interactions. Wide spreading dune scarping occurred along the 30-km studied coast. Based on the pre- and post-storm survey data, a balanced sediment budget is obtained accounting for sand volume loss from dune, beach, intertidal, and subtidal zones, and sand gains over the nearshore bar and along the northern sections of the beach.

  6. Anti-VEGF therapy induces ECM remodeling and mechanical barriers to therapy in colorectal cancer liver metastases.


    Rahbari, Nuh N; Kedrin, Dmitriy; Incio, Joao; Liu, Hao; Ho, William W; Nia, Hadi T; Edrich, Christina M; Jung, Keehoon; Daubriac, Julien; Chen, Ivy; Heishi, Takahiro; Martin, John D; Huang, Yuhui; Maimon, Nir; Reissfelder, Christoph; Weitz, Jurgen; Boucher, Yves; Clark, Jeffrey W; Grodzinsky, Alan J; Duda, Dan G; Jain, Rakesh K; Fukumura, Dai


    The survival benefit of anti-vascular endothelial growth factor (VEGF) therapy in metastatic colorectal cancer (mCRC) patients is limited to a few months because of acquired resistance. We show that anti-VEGF therapy induced remodeling of the extracellular matrix with subsequent alteration of the physical properties of colorectal liver metastases. Preoperative treatment with bevacizumab in patients with colorectal liver metastases increased hyaluronic acid (HA) deposition within the tumors. Moreover, in two syngeneic mouse models of CRC metastasis in the liver, we show that anti-VEGF therapy markedly increased the expression of HA and sulfated glycosaminoglycans (sGAGs), without significantly changing collagen deposition. The density of these matrix components correlated with increased tumor stiffness after anti-VEGF therapy. Treatment-induced tumor hypoxia appeared to be the driving force for the remodeling of the extracellular matrix. In preclinical models, we show that enzymatic depletion of HA partially rescued the compromised perfusion in liver mCRCs after anti-VEGF therapy and prolonged survival in combination with anti-VEGF therapy and chemotherapy. These findings suggest that extracellular matrix components such as HA could be a potential therapeutic target for reducing physical barriers to systemic treatments in patients with mCRC who receive anti-VEGF therapy.

  7. Permeability assessment of the focused ultrasound-induced blood-brain barrier opening using dynamic contrast-enhanced MRI

    NASA Astrophysics Data System (ADS)

    Vlachos, F.; Tung, Y.-S.; Konofagou, E. E.


    Focused ultrasound (FUS) in conjunction with microbubbles has been shown to successfully open the blood-brain barrier (BBB) in the mouse brain. In this study, we compute the BBB permeability after opening in vivo. The spatial permeability of the BBB-opened region was assessed using dynamic contrast-enhanced MRI (DCE-MRI). The DCE-MR images were post-processed using the general kinetic model (GKM) and the reference region model (RRM). Permeability maps were generated and the Ktrans values were calculated for a predefined volume of interest in the sonicated and the control area for each mouse. The results demonstrated that Ktrans in the BBB-opened region (0.02 ± 0.0123 for GKM and 0.03 ± 0.0167 min-1 for RRM) was at least two orders of magnitude higher when compared to the contra-lateral (control) side (0 and 8.5 × 10-4 ± 12 × 10-4 min-1, respectively). The permeability values obtained with the two models showed statistically significant agreement and excellent correlation (R2 = 0.97). At histological examination, it was concluded that no macroscopic damage was induced. This study thus constitutes the first permeability assessment of FUS-induced BBB opening using DCE-MRI, supporting the fact that the aforementioned technique may constitute a safe, non-invasive and efficacious drug delivery method.

  8. Improving low-dose blood-brain barrier permeability quantification using sparse high-dose induced prior for Patlak model.


    Fang, Ruogu; Karlsson, Kolbeinn; Chen, Tsuhan; Sanelli, Pina C


    Blood-brain barrier permeability (BBBP) measurements extracted from the perfusion computed tomography (PCT) using the Patlak model can be a valuable indicator to predict hemorrhagic transformation in patients with acute stroke. Unfortunately, the standard Patlak model based PCT requires excessive radiation exposure, which raised attention on radiation safety. Minimizing radiation dose is of high value in clinical practice but can degrade the image quality due to the introduced severe noise. The purpose of this work is to construct high quality BBBP maps from low-dose PCT data by using the brain structural similarity between different individuals and the relations between the high- and low-dose maps. The proposed sparse high-dose induced (shd-Patlak) model performs by building a high-dose induced prior for the Patlak model with a set of location adaptive dictionaries, followed by an optimized estimation of BBBP map with the prior regularized Patlak model. Evaluation with the simulated low-dose clinical brain PCT datasets clearly demonstrate that the shd-Patlak model can achieve more significant gains than the standard Patlak model with improved visual quality, higher fidelity to the gold standard and more accurate details for clinical analysis.

  9. Modified Pulsatilla decoction attenuates oxazolone-induced colitis in mice through suppression of inflammation and epithelial barrier disruption

    PubMed Central

    Wang, Xuewei; Fan, Fugang; Cao, Qin


    Inflammatory bowel diseases (IBDs) are chronic inflammatory gastrointestinal disorders caused by a dysregulated mucosal immune response and epithelial barrier disruption. Conventional treatment of IBD is currently limited to overcoming patient symptoms and is often associated with severe adverse effects from the drugs used. Modified Pulsatilla decoction has been used previously to treat ulcerative colitis (UC) in clinical practice in China, however, the underlying mechanism in the treatment of UC remains to be elucidated. In the present study, the efficiency and mechanisms of modified Pulsatilla decoction in the treatment of oxazolone-induced colitis were investigated. Assessment of clinical colitis and histological examination found that the administration of modified Pulsatilla decoction attenuated the severity of oxazolone-induced colitis in mice. Measurement of cytokine concentration, western blotting and reverse transcription-quantitative polymerase chain reaction demonstrated modified Pulsatilla decoction treatment significantly reduced the secretion of pro-inflammatory cytokines and restored alterations in tight junction proteins in the colon tissues. In addition, modified Pulsatilla decoction suppressed the activation of the nuclear factor-κB signaling pathway. Thus, the findings of the present study demonstrated that modified Pulsatilla decoction offers an effective therapeutic approach for the treatment of IBD and revealed the underlying mechanisms of action offered by modified Pulsatilla decoction. PMID:27278299

  10. Nonthermal dielectric-barrier discharge plasma-induced inactivation involves oxidative DNA damage and membrane lipid peroxidation in Escherichia coli.


    Joshi, Suresh G; Cooper, Moogega; Yost, Adam; Paff, Michelle; Ercan, Utku K; Fridman, Gregory; Friedman, Gary; Fridman, Alexander; Brooks, Ari D


    Oxidative stress leads to membrane lipid peroxidation, which yields products causing variable degrees of detrimental oxidative modifications in cells. Reactive oxygen species (ROS) are the key regulators in this process and induce lipid peroxidation in Escherichia coli. Application of nonthermal (cold) plasma is increasingly used for inactivation of surface contaminants. Recently, we reported a successful application of nonthermal plasma, using a floating-electrode dielectric-barrier discharge (FE-DBD) technique for rapid inactivation of bacterial contaminants in normal atmospheric air (S. G. Joshi et al., Am. J. Infect. Control 38:293-301, 2010). In the present report, we demonstrate that FE-DBD plasma-mediated inactivation involves membrane lipid peroxidation in E. coli. Dose-dependent ROS, such as singlet oxygen and hydrogen peroxide-like species generated during plasma-induced oxidative stress, were responsible for membrane lipid peroxidation, and ROS scavengers, such as α-tocopherol (vitamin E), were able to significantly inhibit the extent of lipid peroxidation and oxidative DNA damage. These findings indicate that this is a major mechanism involved in FE-DBD plasma-mediated inactivation of bacteria.

  11. Schottky barrier MOSFET systems and fabrication thereof


    Welch, J.D.


    (MOS) device systems-utilizing Schottky barrier source and drain to channel region junctions are disclosed. Experimentally derived results which demonstrate operation of fabricated N-channel and P-channel Schottky barrier (MOSFET) devices, and of fabricated single devices with operational characteristics similar to (CMOS) and to a non-latching (SRC) are reported. Use of essentially non-rectifying Schottky barriers in (MOS) structures involving highly doped and the like and intrinsic semiconductor to allow non-rectifying interconnection of, and electrical accessing of device regions is also disclosed. Insulator effected low leakage current device geometries and fabrication procedures therefore are taught. Selective electrical interconnection of drain to drain, source to drain, or source to source, of N-channel and/or P-channel Schottky barrier (MOSFET) devices formed on P-type, N-type and Intrinsic semiconductor allows realization of Schottky Barrier (CMOS), (MOSFET) with (MOSFET) load, balanced differential (MOSFET) device systems and inverting and non-inverting single devices with operating characteristics similar to (CMOS), which devices can be utilized in modulation, as well as in voltage controlled switching and effecting a direction of rectification. 89 figs.

  12. Schottky barrier MOSFET systems and fabrication thereof


    Welch, James D.


    (MOS) device systems-utilizing Schottky barrier source and drain to channel region junctions are disclosed. Experimentally derived results which demonstrate operation of fabricated N-channel and P-channel Schottky barrier (MOSFET) devices, and of fabricated single devices with operational characteristics similar to (CMOS) and to a non-latching (SRC) are reported. Use of essentially non-rectifying Schottky barriers in (MOS) structures involving highly doped and the like and intrinsic semiconductor to allow non-rectifying interconnection of, and electrical accessing of device regions is also disclosed. Insulator effected low leakage current device geometries and fabrication procedures therefore are taught. Selective electrical interconnection of drain to drain, source to drain, or source to source, of N-channel and/or P-channel Schottky barrier (MOSFET) devices formed on P-type, N-type and Intrinsic semiconductor allows realization of Schottky Barrier (CMOS), (MOSFET) with (MOSFET) load, balanced differential (MOSFET) device systems and inverting and non-inverting single devices with operating characteristics similar to (CMOS), which devices can be utilized in modulation, as well as in voltage controled switching and effecting a direction of rectification.

  13. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.


    Lee, S H; Choi, E H; Feingold, K R; Jiang, S; Ahn, S K


    Iontophoresis increases the delivery of drugs across the stratum corneum, but the pathway by which ionized drugs transit the stratum corneum is unknown. In this study we examined the effect of iontophoresis on the skin barrier and the epidermal calcium gradient. Hairless mice were subjected to iontophoresis for 5-120 min and skin specimens were prepared for electron microscopy. Neither positive nor negative iontophoresis affected transepidermal water loss. Lacunar dilatation and partial distention of the intercellular layers of the stratum corneum were observed in rough proportion to applied time in iontophoresis skin as well as control skin. Additionally, using calcium capture cytochemistry, we demonstrated that both positive and negative iontophoresis caused the disappearance of the epidermal calcium gradient with marked decrease in calcium content in the upper epidermis. Positive iontophoresis was associated with increased calcium in the stratum basale and dermis, whereas negative iontophoresis increased calcium in the stratum corneum. Moreover, as previously shown after barrier disruption and sonophoresis, the decrease in calcium content in the upper epidermis was associated with an increase in lamellar body secretion and the build up of lamellar material at the stratum corneum-stratum granulosum interface. In conclusion, iontophoresis on the skin of hairless mice may induce the change of ionized molecules in the epidermis, as the loss of the calcium gradient, which causes the decrease of skin impedence, gives charged drugs the ability to cross the skin more easily. Also, the structural changes, such as lacunar dilatation, whether they result from hydration or occlusion, may help the transport of charged drugs across the stratum corneum.

  14. DNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier

    PubMed Central

    Santos, Margarida A.; Faryabi, Robert B.; Ergen, Aysegul V.; Day, Amanda M.; Malhowski, Amy; Canela, Andres; Onozawa, Masahiro; Lee, Ji-Eun; Callen, Elsa; Gutierrez-Martinez, Paula; Chen, Hua-Tang; Wong, Nancy; Finkel, Nadia; Deshpande, Aniruddha; Sharrow, Susan; Rossi, Derrick J.; Ito, Keisuke; Ge, Kai; Aplan, Peter D.; Armstrong, Scott A.; Nussenzweig, André


    Self-renewal is the hallmark feature both of normal stem cells and cancer stem cells1. Since the regenerative capacity of normal haematopoietic stem cells is limited by the accumulation of reactive oxygen species and DNA double-strand breaks2–4, we speculated that DNA damage might also constrain leukaemic self-renewal and malignant haematopoiesis. Here we show that the histone methyl-transferase MLL4, a suppressor of B-cell lymphoma5,6, is required for stem-cell activity and an aggressive form of acute myeloid leukaemia harbouring the MLL–AF9 oncogene. Deletion of MLL4 enhances myelopoiesis and myeloid differentiation of leukaemic blasts, which protects mice from death related to acute myeloid leukaemia. MLL4 exerts its function by regulating transcriptional programs associated with the antioxidant response. Addition of reactive oxygen species scavengers or ectopic expression of FOXO3 protects MLL4−/− MLL–AF9 cells from DNA damage and inhibits myeloid maturation. Similar to MLL4 deficiency, loss of ATM or BRCA1 sensitizes transformed cells to differentiation, suggesting that myeloid differentiation is promoted by loss of genome integrity. Indeed, we show that restriction-enzyme-induced double-strand breaks are sufficient to induce differentiation of MLL–AF9 blasts, which requires cyclin-dependent kinase inhibitor p21Cip1 (Cdkn1a) activity. In summary, we have uncovered an unexpected tumour-promoting role of genome guardians in enforcing the oncogene-induced differentiation blockade in acute myeloid leukaemia. PMID:25079327

  15. Moisture-Induced Delamination Video of an Oxidized Thermal Barrier Coating

    NASA Technical Reports Server (NTRS)

    Smialek, James L.; Zhu, Dongming; Cuy, Michael D.


    PVD TBC coatings were thermally cycled to near-failure at 1150 C. Normal failure occurred after 200 to 300 1-hr cycles with only moderate weight gains (0.5 mg/sq cm). Delamination and buckling was often delayed until well after cooldown (desktop spallation), but could be instantly induced by the application of water drops, as shown in a video clip which can be viewed by clicking on figure 2 of this report. Moisture therefore plays a primary role in delayed desktop TBC failure. Hydrogen embrittlement is proposed as the underlying mechanism.

  16. Moisture-Induced Delamination Video of an Oxidized Thermal Barrier Coating

    NASA Technical Reports Server (NTRS)

    Smialek, James L.; Zhu, Dongming; Cuy, Michael D.


    PVD TBC coatings were thermally cycled to near-failure at 1150 C. Normal failure occurred after 200-300 1-hr cycles with only moderate weight gains (0.5 mg/cm2). Delamination and buckling was often delayed until well after cooldown (desktop spallation), but could be instantly induced by the application of water drops, as shown in an accompanying video-recording. Moisture therefore plays a primary role in delayed desktop TBC failure. Hydrogen embrittlement is proposed as the underlying mechanism.

  17. The safest parameters for FUS-induced blood-brain barrier opening without effects on the opening volume

    NASA Astrophysics Data System (ADS)

    Tung, Yao-Sheng; Olumolade, Yemi; Wang, Shutao; Wu, Shih-Ying; Konofagou, Elisa E.


    Acoustic cavitation has been identified as the main physical mechanism for the focused ultrasound (FUS) induced blood-brain barrier (BBB) opening. In this paper, the mechanism of stable cavitation (SC) and inertial cavitation (IC) responsible for BBB opening was investigated. Thirty-three (n=33) mice were intravenously injected with bubbles of 4-5 μm in diameter. The right hippocampus was then sonicated using focused 1.5-MHz ultrasound and three different studies were carried out. First, pulse lengths (PLs) of 0.1, 0.5, 2, and 5 ms at 0.18- MPa peak rarefactional pressure with 5-Hz pulse repetition frequency (PRF) and 5-minute duration were used to identify the threshold of PL using SC. Second, the effects of the duty cycle and exposure time were investigated. Third, the BBB opening size was compared between the SC and the IC. In the case of IC-induced BBB opening, a burst sequence (3-cycles PL; 5-Hz burst repetition frequency (BRF); 30 s duration) at 0.45 MPa was applied. Passive cavitation detection was performed with each sonication to detect whether a broadband response was obtained, i.e., if IC occurred, during BBB opening. The properties of BBB opening were measured through MRI. The threshold of PL for BBB opening was identified between 0.1 and 0.5 ms using SC, but the BBB can be opened in few cycles using IC. The BBB opening volume and normalized intensity increased with the PL, but reached saturation when the PL was above 2 ms. Once the PL threshold was reached, the same exposure time induced a similar BBB opening volume, but longer sonication duration induced higher MR intensity. The duty cycle was found not to play an important role on the BBB opening. Comparable BBB opening volume (20-25 mm3) could be reached between long PL (7500 cycles, i.e., 5 ms) at 0.18 MPa and 3 cycles at 0.45 MPa. 3-kDa fluorescently tagged dextran may be able to diffuse to the parenchyma after IC-induced BBB opening at 0.45 MPa but not after SC-induced BBB opening at 0.18 MPa.

  18. Inflammation-induced desmoglein-2 ectodomain shedding compromises the mucosal barrier

    PubMed Central

    Kamekura, Ryuta; Nava, Porfirio; Feng, Mingli; Quiros, Miguel; Nishio, Hikaru; Weber, Dominique A.; Parkos, Charles A.; Nusrat, Asma


    Desmosomal cadherins mediate intercellular adhesion and control epithelial homeostasis. Recent studies show that proteinases play an important role in the pathobiology of cancer by targeting epithelial intercellular junction proteins such as cadherins. Here we describe the proinflammatory cytokine-induced activation of matrix metalloproteinase 9 and a disintegrin and metalloproteinase domain–containing protein 10, which promote the shedding of desmosomal cadherin desmoglein-2 (Dsg2) ectodomains in intestinal epithelial cells. Epithelial exposure to Dsg2 ectodomains compromises intercellular adhesion by promoting the relocalization of endogenous Dsg2 and E-cadherin from the plasma membrane while also promoting proliferation by activation of human epidermal growth factor receptor 2/3 signaling. Cadherin ectodomains were detected in the inflamed intestinal mucosa of mice with colitis and patients with ulcerative colitis. Taken together, our findings reveal a novel response pathway in which inflammation-induced modification of columnar epithelial cell cadherins decreases intercellular adhesion while enhancing cellular proliferation, which may serve as a compensatory mechanism to promote repair. PMID:26224314

  19. Polydeoxyribonucleotide, an Adenosine-A2A Receptor Agonist, Preserves Blood Testis Barrier from Cadmium-Induced Injury

    PubMed Central

    Squadrito, Francesco; Micali, Antonio; Rinaldi, Mariagrazia; Irrera, Natasha; Marini, Herbert; Puzzolo, Domenico; Pisani, Antonina; Lorenzini, Cesare; Valenti, Andrea; Laurà, Rosaria; Germanà, Antonino; Bitto, Alessandra; Pizzino, Gabriele; Pallio, Giovanni; Altavilla, Domenica; Minutoli, Letteria


    Cadmium (Cd) impairs blood-testis barrier (BTB). Polydeoxyribonucleotide (PDRN), an adenosine A2A agonist, has positive effects on male reproductive system. We investigated the effects of PDRN on the morphological and functional changes induced by Cd in mice testes. Adult Swiss mice were divided into four groups: controls administered with 0.9% NaCl (1 ml/kg, i.p., daily) or with PDRN (8 mg/kg, i.p. daily), animals challenged with Cd chloride (CdCl2; 2 mg/kg, i.p, daily) and animals challenged with CdCl2 (2 mg/kg, i.p., daily) and treated with PDRN (8 mg/kg, i.p., daily). Experiments lasted 14 days. Testes were processed for biochemical, structural, and ultrastructural evaluation and hormones were assayed in serum. CdCl2 increased pERK 1/2 expression and Follicle Stimulating Hormone (FSH) and Luteinizing Hormone (LH) levels; it decreased testosterone (TE) and inhibin-B levels and induced structural damages in extratubular compartment and in seminiferous epithelium, with ultrastructural features of BTB disruption. Many TUNEL-positive germ cells were present. CdCl2 increased tubular TGF-β3 immunoreactivity and reduced claudin-11, occludin, and N-cadherin immunoreactivity. PDRN administration reduced pERK 1/2 expression, FSH, and LH levels; it increased TE and inhibin-B levels, ameliorated germinal epithelium changes and protected BTB ultrastructure. Few TUNEL-positive germ cells were present and the extratubular compartment was preserved. Furthermore, PDRN decreased TGF-β3 immunoreactivity and enhanced claudin-11, occludin, and N-cadherin immunoreactivity. We demonstrate a protective effect of PDRN on Cd-induced damages of BTB and suggest that PDRN may play an important role against Cd, particularly against its harmful effects on gametogenesis. PMID:28119612

  20. Microbubble-Size Dependence of Focused Ultrasound-Induced Blood–Brain Barrier Opening in Mice In Vivo

    PubMed Central

    Choi, James J.; Feshitan, Jameel A.; Baseri, Babak; Wang, Shougang; Tung, Yao-Sheng; Borden, Mark A.; Konofagou, Elisa E.


    The therapeutic efficacy of neurological agents is severely limited, because large compounds do not cross the blood–brain barrier (BBB). Focused ultrasound (FUS) sonication in the presence of microbubbles has been shown to temporarily open the BBB, allowing systemically administered agents into the brain. Until now, polydispersed microbubbles (1–10 μm in diameter) were used, and, therefore, the bubble sizes better suited for inducing the opening remain unknown. Here, the FUS-induced BBB opening dependence on microbubble size is investigated. Bubbles at 1–2 and 4–5 μm in diameter were separately size-isolated using differential centrifugation before being systemically administered in mice (n = 28). The BBB opening pressure threshold was identified by varying the peak-rarefactional pressure amplitude. BBB opening was determined by fluorescence enhancement due to systemically administered, fluorescent-tagged, 3-kDa dextran. The identified threshold fell between 0.30 and 0.46 MPa in the case of 1–2 μm bubbles and between 0.15 and 0.30 MPa in the 4–5 μm case. At every pressure studied, the fluorescence was greater with the 4–5 μm than with the 1–2 μm bubbles. At 0.61 MPa, in the 1–2 μm bubble case, the fluorescence amount and area were greater in the thalamus than in the hippocampus. In conclusion, it was determined that the FUS-induced BBB opening was dependent on both the size distribution in the injected microbubble volume and the brain region targeted. PMID:19846365

  1. Microbubble-size dependence of focused ultrasound-induced blood-brain barrier opening in mice in vivo.


    Choi, James J; Feshitan, Jameel A; Baseri, Babak; Wang, Shougang; Tung, Yao-Sheng; Borden, Mark A; Konofagou, Elisa E


    The therapeutic efficacy of neurological agents is severely limited, because large compounds do not cross the blood-brain barrier (BBB). Focused ultrasound (FUS) sonication in the presence of microbubbles has been shown to temporarily open the BBB, allowing systemically administered agents into the brain. Until now, polydispersed microbubbles (1-10 microm in diameter) were used, and, therefore, the bubble sizes better suited for inducing the opening remain unknown. Here, the FUS-induced BBB opening dependence on microbubble size is investigated. Bubbles at 1-2 and 4-5 microm in diameter were separately size-isolated using differential centrifugation before being systemically administered in mice (n = 28). The BBB opening pressure threshold was identified by varying the peak-rarefactional pressure amplitude. BBB opening was determined by fluorescence enhancement due to systemically administered, fluorescent-tagged, 3-kDa dextran. The identified threshold fell between 0.30 and 0.46 MPa in the case of 1-2 microm bubbles and between 0.15 and 0.30 MPa in the 4-5 microm case. At every pressure studied, the fluorescence was greater with the 4-5 mum than with the 1-2 microm bubbles. At 0.61 MPa, in the 1-2 microm bubble case, the fluorescence amount and area were greater in the thalamus than in the hippocampus. In conclusion, it was determined that the FUS-induced BBB opening was dependent on both the size distribution in the injected microbubble volume and the brain region targeted.

  2. Transport and performance of a zero-Schottky barrier and doped contacts graphene nanoribbon transistors

    NASA Astrophysics Data System (ADS)

    Alam, Khairul


    The transport physics and performance of a top gate graphene nanoribbon (GNR) on an insulator transistor are studied for both the MOSFET like doped source-drain and the zero-Schottky barrier source-drain contacts. A voltage controlled tunnel barrier is the device transport physics. The doped source-drain contact device has a higher gate capacitance, higher transconductance, higher on/off current ratio and higher on-state current. The higher on-state current results in a lower switching delay of 17 fs, and the higher transconductance results in a higher intrinsic cut-off frequency of 27 THz in the doped source-drain contact device. The gate voltage, beyond the source-channel flat band condition, modulates both the tunnel and the thermal barrier in the doped source-drain contact devices and the tunnel barrier only in the Schottky contact devices. This limits the on-state current of Schottky contact devices.

  3. Overexpression of actin-depolymerizing factor blocks oxidized low-density lipoprotein-induced mouse brain microvascular endothelial cell barrier dysfunction.


    Wang, Jun; Sun, Lu; Si, Yan-Fang; Li, Bao-Min


    The aim of present work was to elucidate the role of actin-depolymerizing factor (ADF), an important regulator of actin cytoskeleton, in the oxidized low-density lipoprotein (ox-LDL)-induced blood-brain barrier (BBB) disruption. The primary mouse brain microvascular endothelial cells (MBMECs) were exposed to ox-LDL. Treatment with LDL served as control. It was found that ADF mRNA level and protein expression were decreased when exposed to ox-LDL in MBMECs. Then, we investigated the influence of ADF overexpression on ox-LDL-treated MBMECs. Structurally, overexpression of ADF inhibited ox-LDL-induced F-actin formation. Functionally, overexpression of ADF attenuated ox-LDL-induced disruption of endothelial barrier marked by restoration of transendothelial electrical resistance, permeability of Evans Blue and expression of tight junction-associated proteins including ZO-1 and occludin, and blocked ox-LDL-induced oxidative stress marked by inhibition of reactive oxygen species (ROS) formation and activity of NADPH oxidase and Nox2 expression. However, overexpression of ADF in control cells had no significant effect on endothelial permeability and ROS formation. In conclusion, overexpression of ADF blocks ox-LDL-induced disruption of endothelial barrier. In addition, siRNA-mediated downregulation of ADF expression aggravated ox-LDL-induced disruption of endothelial barrier and ROS formation. These findings identify ADF as a key signaling molecule in the regulation of BBB integrity and suggest that ADF might be used as a target to modulate diseases accompanied by ox-LDL-induced BBB compromise.

  4. Drain Current Modulation of a Single Drain MOSFET by Lorentz Force for Magnetic Sensing Application

    PubMed Central

    Chatterjee, Prasenjit; Chow, Hwang-Cherng; Feng, Wu-Shiung


    This paper reports a detailed analysis of the drain current modulation of a single-drain normal-gate n channel metal-oxide semiconductor field effect transistor (n-MOSFET) under an on-chip magnetic field. A single-drain n-MOSFET has been fabricated and placed in the center of a square-shaped metal loop which generates the on-chip magnetic field. The proposed device designed is much smaller in size with respect to the metal loop, which ensures that the generated magnetic field is approximately uniform. The change of drain current and change of bulk current per micron device width has been measured. The result shows that the difference drain current is about 145 µA for the maximum applied magnetic field. Such changes occur from the applied Lorentz force to push out the carriers from the channel. Based on the drain current difference, the change in effective mobility has been detected up to 4.227%. Furthermore, a detailed investigation reveals that the device behavior is quite different in subthreshold and saturation region. A change of 50.24 µA bulk current has also been measured. Finally, the device has been verified for use as a magnetic sensor with sensitivity 4.084% (29.6 T−1), which is very effective as compared to other previously reported works for a single device. PMID:27589747

  5. Protective Effect of Huoxiang Zhengqi Oral Liquid on Intestinal Mucosal Mechanical Barrier of Rats with Postinfectious Irritable Bowel Syndrome Induced by Acetic Acid

    PubMed Central

    Liu, Yao; Liu, Wei; Peng, Qiu-Xian; Peng, Jiang-Li; Yu, Lin-Zhong; Hu, Jian-Lan


    In this study, a rat model with acetic acid-induced PI-IBS was used to study the role of HXZQ oral liquid in repairing the colonic epithelial barrier and reducing intestinal permeability. Pathomorphism of colonic tissue, epithelial ultrastructure, DAO activity in serum, and the protein expression of ZO-1 and occludin were examined to investigate protective effect mechanisms of HXZQ on intestinal mucosa barrier and then present experimental support for its use for prevention and cure of PI-IBS. PMID:25254052

  6. Climate mitigation scenarios of drained peat soils

    NASA Astrophysics Data System (ADS)

    Kasimir Klemedtsson, Åsa; Coria, Jessica; He, Hongxing; Liu, Xiangping; Nordén, Anna


    The national inventory reports (NIR) submitted to the UNFCCC show Sweden - which as many other countries has wetlands where parts have been drained for agriculture and forestry purposes, - to annually emit 12 million tonnes carbon dioxide equivalents, which is more GHG'es than industrial energy use release in Sweden. Similar conditions can be found in other northern countries, having cool and wet conditions, naturally promoting peat accumulation, and where land use management over the last centuries have promoted draining activities. These drained peatland, though covering only 2% of the land area, have emissions corresponding to 20% of the total reported NIR emissions. This substantial emission contribution, however, is hidden within the Land Use Land Use Change and Forestry sector (LULUCF) where the forest Carbon uptake is even larger, which causes the peat soil emissions become invisible. The only drained soil emission accounted in the Swedish Kyoto reporting is the N2O emission from agricultural drained organic soils of the size 0.5 million tonnes CO2e yr-1. This lack of visibility has made incentives for land use change and management neither implemented nor suggested, however with large potential. Rewetting has the potential to decrease soil mineralization, why CO2 and N2O emissions are mitigated. However if the soil becomes very wet CH4 emission will increase together with hampered plant growth. By ecological modeling, using the CoupModel the climate change mitigation potential have been estimated for four different land use scenarios; 1, Drained peat soil with Spruce (business as usual scenario), 2, raised ground water level to 20 cm depth and Willow plantation, 3, raised ground water level to 10 cm depth and Reed Canary Grass, and 4, rewetting to an average water level in the soil surface with recolonizing wetland plants and mosses. We calculate the volume of biomass production per year, peat decomposition, N2O emission together with nitrate and DOC

  7. Ferulate protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in tert-butyl hydroperoxide-induced Caco-2 cells.


    Kim, Hyun Jung; Lee, Eun Kyeong; Park, Min Hi; Ha, Young Mi; Jung, Kyung Jin; Kim, Min-Sun; Kim, Mi Kyung; Yu, Byung Pal; Chung, Hae Young


    Epithelial barrier function is determined by both transcellular and paracellular permeability, the latter of which is mainly influenced by tight junctions (TJs) and apoptotic leaks within the epithelium. We investigated the protective effects of ferulate on epithelial barrier integrity by examining permeability, TJ protein expression, and apoptosis in Caco-2 cells treated with tert-butyl hydroperoxide (t-BHP), a strong reactive species inducer. Caco-2 cells pretreated with ferulate (5 or 15 μM) were exposed to t-BHP (100 μM), and ferulate suppressed the t-BHP-mediated increases in reactive species and epithelial permeability in Caco-2 cells. Moreover, ferulate inhibited epithelial cell leakage induced by t-BHP, which was accompanied by decreased expression of the TJ proteins zonula occludens-1 and occludin. In addition, pretreatment with ferulate markedly protected cells against t-BHP-induced apoptosis, as evidenced by decreased nuclear condensation, cytochrome c release, and caspase-3 cleavage and an increased Bax/Bcl-2 ratio. These results suggest that ferulate protects the epithelial barrier of Caco-2 cells against oxidative stress, which results in increased epithelial permeability, decreased TJ protein expression, and increased apoptosis. The most significant finding of our study is the demonstration of protective, ferulate-mediated antioxidant effects on barrier integrity, with a particular focus on intracellular molecular mechanisms.

  8. All-Manganite Tunnel Junctions with Interface-Induced Barrier Magnetism

    NASA Astrophysics Data System (ADS)

    Sefrioui, Zouhair


    The recent discovery of several unexpected phases at complex oxide interfaces is providing new insights into the physics of strongly correlated electron systems. The possibility of tailoring the electronic structure of such interfaces has triggered a great technological drive to functionalize them into devices. In this communication, we describe an alternative strategy to produce spin filtering by inducing a ferromagnetic insulating state in an ultrathin antiferromagnetic layer in contact with a ferromagnetic layer. This artificially induced spin filtering persists up to relatively high temperatures and operates at high applied bias voltages. The results suggest that after playing a key role in exchange-bias for spin-valves, uncompensated moments at engineered antiferromagnetic interfaces represent a novel route for generating highly spin-polarized currents with antiferromagnets. Work done in collaboration with M. Bibes, C. Carrétéro, A. Barthélémy (Unité Mixte de Physique CNRS/Thales, Campus de Polytechnique, 1, Avenue A. Fresnel, 91767 Palaiseau (France) and Université Paris-Sud, 91045 Orsay (France)), F.A. Cuellar, C. Visani, A. Rivera-Calzada, , C. León, J. Santamaria (Grupo de Física de Materiales Complejos, Universidad Complutense de Madrid, 28040 Madrid (Spain)), M.J. Calderón, L. Brey (Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, 28049 Madrid (Spain)), K. March, M. Walls, D. Imhoff (Laboratoire de Physique des Solides, CNRS, Université Paris-Sud, 91405 Orsay (France)), R. Lopez Anton, T.R. Charlton (ISIS, Rutherford Appleton Laboratory, Chilton, Oxon OX11 0QX (United Kingdom)), E. Iborra (Universidad Politécnica de Madrid, Escuela Técnica Superior de Ingenieros de Telecomunicaciones, 28040 Madrid (Spain)), F. Ott (Léon Brillouin, CEA/CNRS, UMR 12, 91191 Gif-sur-Yvette (France)). This work was supported by the Spanish Ministry for Science and Education programs MAT2008 06517, and the Réseau Thématique de Recherche Avanc

  9. Effect of hyperthermia and endotoxin induced fever on the blood-brain barrier

    SciTech Connect

    Gustafson, A.N.


    The purpose of this study was to determine the effect of hyperthermia and fever, on the permeability characteristics of the BBB. A group of rats were maintained in a warm environment until their body temperature became elevated by 1.5/sup 0/C. The permeability of the BBB was determined by injecting the rats with /sup 14/C-sucrose (MW 340) and /sup 3/H-dextran (MW 70,000) and calculating the permeability-surface area product. When hyperthermic animals were compared to controls maintained in a neutral environment it was found that BBB permeability was increased for the smaller radioisotope only. A third group of animals was injected with endotoxin to induce fever. Body temperature was elevated by 1.4/sup 0/C which was similar to the hyperthermic group. BBB permeability to both radioisotopes was not significantly different from control animals. Another group of animals was given a higher dose of endotoxin which produced shock. It was found that BBB permeability was increased for /sup 14/C-sucrose in all brain regions and also for /sup 3/H-dextran in the cerebellum.

  10. Process-based model predictions of hurricane induced morphodynamic change on low-lying barrier islands

    USGS Publications Warehouse

    Plant, Nathaniel G.; Thompson, David M.; Elias, Edwin; Wang, Ping; Rosati, Julie D.; Roberts, Tiffany M.


    Using Delft3D, a Chandeleur Island model was constructed to examine the sediment-transport patterns and morphodynamic change caused by Hurricane Katrina and similar storm events. The model setup included a coarse Gulf of Mexico domain and a nested finer-resolution Chandeleur Island domain. The finer-resolution domain resolved morphodynamic processes driven by storms and tides. A sensitivity analysis of the simulated morphodynamic response was performed to investigate the effects of variations in surge levels. The Chandeleur morphodynamic model reproduced several important features that matched observed morphodynamic changes. A simulation of bathymetric change driven by storm surge alone (no waves) along the central portion of the Chandeleur Islands showed (1) a general landward retreat and lowering of the island chain and (2) multiple breaches that increased the degree of island dissection. The locations of many of the breaches correspond with the low-lying or narrow sections of the initial bathymetry. The major part of the morphological change occurred prior to the peak of the surge when overtopping of the islands produced a strong water-level gradient and induced significant flow velocities.

  11. Viscosity-dependent drain current noise of AlGaN/GaN high electron mobility transistor in polar liquids

    SciTech Connect

    Fang, J. Y.; Hsu, C. P.; Kang, Y. W.; Fang, K. C.; Kao, W. L.; Yao, D. J.; Chen, C. C.; Li, S. S.; Yeh, J. A.; Wang, Y. L.; Lee, G. Y.; Chyi, J. I.; Hsu, C. H.; Huang, Y. F.; Ren, F.


    The drain current fluctuation of ungated AlGaN/GaN high electron mobility transistors (HEMTs) measured in different fluids at a drain-source voltage of 0.5 V was investigated. The HEMTs with metal on the gate region showed good current stability in deionized water, while a large fluctuation in drain current was observed for HEMTs without gate metal. The fluctuation in drain current for the HEMTs without gate metal was observed and calculated as standard deviation from a real-time measurement in air, deionized water, ethanol, dimethyl sulfoxide, ethylene glycol, 1,2-butanediol, and glycerol. At room temperature, the fluctuation in drain current for the HEMTs without gate metal was found to be relevant to the dipole moment and the viscosity of the liquids. A liquid with a larger viscosity showed a smaller fluctuation in drain current. The viscosity-dependent fluctuation of the drain current was ascribed to the Brownian motions of the liquid molecules, which induced a variation in the surface dipole of the gate region. This study uncovers the causes of the fluctuation in drain current of HEMTs in fluids. The results show that the AlGaN/GaN HEMTs may be used as sensors to measure the viscosity of liquids within a certain range of viscosity.

  12. Internally drained condenser for spacecraft thermal management

    NASA Technical Reports Server (NTRS)

    Valenzuela, Javier A.; Drew, Brian C.


    This paper presents the results obtained to date in a program to develop a high heat flux condenser for use in two-phase spacecraft thermal management loops. The objective is to obtain a several fold increase in condensation heat transfer coefficient over those which can be achieved with shear-controlled or capillary-wick condensers. The internally drained condenser relies on shaped fins to develop a capillary pressure gradient over the surface of the fins and drive the condensate toward narrow drainage grooves separating the fins. The condensate then flows through a drainage network embedded in the condenser walls. Heat transfer coefficients of up to 8 W/sq cm C were measured in steam, providing a heat transfer enhancement ratio greater than a factor of 8. In the paper the proof-of-concept experiments are described and simplified models to predict the performance of the internally drained condenser are presented.

  13. Denaturated proteins: Draining effect and molecular dimensions

    NASA Astrophysics Data System (ADS)

    Dondos, A.


    Using equations derived from the synthetic macromolecules, we calculate the dimensions in solution of the denaturated proteins. For these calculations, we use a value for the Flory’s parameter Φ obtained from an equation established for the polymers presenting a draining effect, and which is lower than the value of 2.6×10 23 (cgs) generally used. The obtained values for the dimensions of the denaturated proteins (end to end distance, statistical segment length and relation from the end to end distance and the number of residue) using the method proposed here are in good agreement with the values obtained from Flory and co-workers. On the contrary, the values obtained in this work are different from the values proposed by other authors who do not take into account the draining effect and use a value for Φ equal to 2.6×10 23.

  14. Using Smoke Injection in Drains to Identify Potential Preferential Pathways in a Drained Arable Field

    NASA Astrophysics Data System (ADS)

    Nielsen, M. H.; Petersen, C. T.; Hansen, S.


    Macropores forming a continuous pathway between the soil surface and subsurface drains favour the transport of many contaminants from agricultural fields to surface waters. The smoke injection method presented by Shipitalo and Gibbs (2000) used for demonstrating and quantifying such pathways has been further developed and used on a drained Danish sandy loam. In order to identify the preferential pathways to drains, smoke was injected in three 1.15 m deep tile drains (total drain length 93 m), and smoke emitting macropores (SEMP) at the soil surface were counted and characterized as producing either strong or weak plumes compared to reference plumes from 3 and 6 mm wide tubes. In the two situations investigated in the present study - an early spring and an autumn situation, smoke only penetrated the soil surface layer via earthworm burrows located in a 1.0 m wide belt directly above the drain lines. However, it is known from previous studies that desiccation fractures in a dry summer situation also can contribute to the smoke pattern. The distance between SEMP measured along the drain lines was on average 0.46 m whereas the average spacing between SEMP with strong plumes was 2.3 m. Ponded water was applied in 6 cm wide rings placed above 52 burrows including 17 reference burrows which did not emit smoke. Thirteen pathways in the soil were examined using dye tracer and profile excavation. SEMP with strong plumes marked the entrance of highly efficient transport pathways conducting surface applied water and dye tracer into the drain. However, no single burrow was traced all the way from the surface into the drain, the dye patterns branched off in a network of other macropores. Water infiltration rates were significantly higher (P < 0.05) in SEMP with strong plumes (average rate: 247 mL min-1 n = 19) compared to SEMP with weak plumes (average rate: 87 mL min-1 n = 16) and no plumes (average rate: 56 mL min-1 n = 17). The results suggest that the smoke injection method

  15. Bulk Friction Angles in Dry, Drained, and Saturated Gravel Beds

    NASA Astrophysics Data System (ADS)

    Holo, S.; Palucis, M. C.; Lamb, M. P.


    We examined the effect of capillary action and lubrication of grains on bulk friction angles through tilting chute experiments. In each experiment, we screed a bed of 5mm gravels in 65cm long x 18cm wide tilting chute with fixed roughness and slowly tilted the chute until a granular avalanche occurred. We performed these experiments under three conditions: with dry grains, with a bed that had been submerged and subsequently drained such that no water occupied the pore space, and with the entire apparatus submerged under water such that the bed is saturated. In addition, for each of these cases, we performed experiments with 5, 10, and 15cm bed thicknesses. In the dry case, the bed failed at ~ 41º, and bed thickness did not have a significant effect on failure angle. In the drained case, friction angles increased from 46.5º to 50.9º with increasing bed thickness. In the submerged case, the bed failed at angles not significantly different than those from the dry case, and they did not vary with bed thickness. The increase in friction angles between the dry and drained cases suggests that addition of the water induces a cohesive effect on the grains. Because the pore pressure from the saturated bed removes capillary effects but retains lubrication effects, the submerged case data suggest that capillary action is primarily responsible for the observed increases in friction angle and effects from grain lubrication are negligible. Further study is ongoing to fully understand the effect of capillary action on bulk friction angles in unsaturated gravel and why it appears to increase with bed thickness.

  16. 40 CFR 60.692-2 - Standards: Individual drain systems.

    Code of Federal Regulations, 2013 CFR


    ... Emissions From Petroleum Refinery Wastewater Systems § 60.692-2 Standards: Individual drain systems. (a)(1... section. (e) Refinery wastewater routed through new process drains and a new first common...

  17. 40 CFR 60.692-2 - Standards: Individual drain systems.

    Code of Federal Regulations, 2011 CFR


    ... Emissions From Petroleum Refinery Wastewater Systems § 60.692-2 Standards: Individual drain systems. (a)(1... section. (e) Refinery wastewater routed through new process drains and a new first common...

  18. 40 CFR 60.692-2 - Standards: Individual drain systems.

    Code of Federal Regulations, 2010 CFR


    ... Emissions From Petroleum Refinery Wastewater Systems § 60.692-2 Standards: Individual drain systems. (a)(1... section. (e) Refinery wastewater routed through new process drains and a new first common...

  19. 40 CFR 60.692-2 - Standards: Individual drain systems.

    Code of Federal Regulations, 2014 CFR


    ... Emissions From Petroleum Refinery Wastewater Systems § 60.692-2 Standards: Individual drain systems. (a)(1... section. (e) Refinery wastewater routed through new process drains and a new first common...

  20. 40 CFR 60.692-2 - Standards: Individual drain systems.

    Code of Federal Regulations, 2012 CFR


    ... Emissions From Petroleum Refinery Wastewater Systems § 60.692-2 Standards: Individual drain systems. (a)(1... section. (e) Refinery wastewater routed through new process drains and a new first common...

  1. Percutaneous Retrieval of a Retained Jackson-Pratt Drain Fragment

    SciTech Connect

    Namyslowski, Jan; Halin, Neil J.; Greenfield, Alan J.


    A retained intraabdominal Jackson-Pratt drain fragment was percutaneously retrieved using an inflated angioplasty balloon that had been maneuvered inside of the drain lumen over a hydrophilic-coated steerable guidewire.

  2. Cysteinyl leukotriene receptor (CysLT) antagonists decrease pentylenetetrazol-induced seizures and blood-brain barrier dysfunction.


    Lenz, Q F; Arroyo, D S; Temp, F R; Poersch, A B; Masson, C J; Jesse, A C; Marafiga, J R; Reschke, C R; Iribarren, P; Mello, C F


    Current evidence suggests that inflammation plays a role in the pathophysiology of seizures. In line with this view, selected pro-inflammatory arachidonic acid derivatives have been reported to facilitate seizures. Kainate-induced seizures are accompanied by leukotriene formation, and are reduced by inhibitors of LOX/COX pathway. Moreover, LTD4 receptor blockade and LTD4 synthesis inhibition suppress pentylenetetrazol (PTZ)-induced kindling and pilocarpine-induced recurrent seizures. Although there is convincing evidence supporting that blood-brain-barrier (BBB) dysfunction facilitates seizures, no study has investigated whether the anticonvulsant effect of montelukast is associated with its ability to maintain BBB integrity. In this study we investigated whether montelukast and other CysLT receptor antagonists decrease PTZ-induced seizures, as well as whether these antagonists preserve BBB during PTZ-induced seizures. Adult male albino Swiss mice were stereotaxically implanted with a cannula into the right lateral ventricle, and two electrodes were placed over the parietal cortex along with a ground lead positioned over the nasal sinus for electroencephalography (EEG) recording. The effects of montelukast (0.03 or 0.3 μmol/1 μL, i.c.v.), pranlukast (1 or 3 μmol/1 μL, i.c.v.), Bay u-9773 (0.3, 3 or 30 nmol/1 μL, i.c.v.), in the presence or absence of the agonist LTD4 (0.2, 2, 6 or 20 pmol/1 μL, i.c.v.), on PTZ (1.8 μmol/2 μL)-induced seizures and BBB permeability disruption were determined. The animals were injected with the antagonists, agonist or vehicle 30 min before PTZ, and monitored for additional 30 min for the appearance of seizures by electrographic and behavioral methods. BBB permeability was assessed by sodium fluorescein method and by confocal microscopy for CD45 and IgG immunoreactivity. Bay-u9973 (3 and 30 nmol), montelukast (0.03 and 0.3 μmol) and pranlukast (1 and 3 μmol), increased the latency to generalized seizures and decreased the

  3. Galectin-1 suppresses methamphetamine induced neuroinflammation in human brain microvascular endothelial cells: Neuroprotective role in maintaining blood brain barrier integrity.


    Parikh, Neil U; Aalinkeel, R; Reynolds, J L; Nair, B B; Sykes, D E; Mammen, M J; Schwartz, S A; Mahajan, S D


    Methamphetamine (Meth) abuse can lead to the breakdown of the blood-brain barrier (BBB) integrity leading to compromised CNS function. The role of Galectins in the angiogenesis process in tumor-associated endothelial cells (EC) is well established; however no data are available on the expression of Galectins in normal human brain microvascular endothelial cells and their potential role in maintaining BBB integrity. We evaluated the basal gene/protein expression levels of Galectin-1, -3 and -9 in normal primary human brain microvascular endothelial cells (BMVEC) that constitute the BBB and examined whether Meth altered Galectin expression in these cells, and if Galectin-1 treatment impacted the integrity of an in-vitro BBB. Our results showed that BMVEC expressed significantly higher levels of Galectin-1 as compared to Galectin-3 and -9. Meth treatment increased Galectin-1 expression in BMVEC. Meth induced decrease in TJ proteins ZO-1, Claudin-3 and adhesion molecule ICAM-1 was reversed by Galectin-1. Our data suggests that Galectin-1 is involved in BBB remodeling and can increase levels of TJ proteins ZO-1 and Claudin-3 and adhesion molecule ICAM-1 which helps maintain BBB tightness thus playing a neuroprotective role. Galectin-1 is thus an important regulator of immune balance from neurodegeneration to neuroprotection, which makes it an important therapeutic agent/target in the treatment of drug addiction and other neurological conditions.

  4. Focused ultrasound-induced blood-brain barrier opening to enhance temozolomide delivery for glioblastoma treatment: a preclinical study.


    Wei, Kuo-Chen; Chu, Po-Chun; Wang, Hay-Yan Jack; Huang, Chiung-Yin; Chen, Pin-Yuan; Tsai, Hong-Chieh; Lu, Yu-Jen; Lee, Pei-Yun; Tseng, I-Chou; Feng, Li-Ying; Hsu, Peng-Wei; Yen, Tzu-Chen; Liu, Hao-Li


    The purpose of this study is to assess the preclinical therapeutic efficacy of magnetic resonance imaging (MRI)-monitored focused ultrasound (FUS)-induced blood-brain barrier (BBB) disruption to enhance Temozolomide (TMZ) delivery for improving Glioblastoma Multiforme (GBM) treatment. MRI-monitored FUS with microbubbles was used to transcranially disrupt the BBB in brains of Fisher rats implanted with 9L glioma cells. FUS-BBB opening was spectrophotometrically determined by leakage of dyes into the brain, and TMZ was quantitated in cerebrospinal fluid (CSF) and plasma by LC-MS\\MS. The effects of treatment on tumor progression (by MRI), animal survival and brain tissue histology were investigated. Results demonstrated that FUS-BBB opening increased the local accumulation of dyes in brain parenchyma by 3.8-/2.1-fold in normal/tumor tissues. Compared to TMZ alone, combined FUS treatment increased the TMZ CSF/plasma ratio from 22.7% to 38.6%, reduced the 7-day tumor progression ratio from 24.03 to 5.06, and extended the median survival from 20 to 23 days. In conclusion, this study provided preclinical evidence that FUS BBB-opening increased the local concentration of TMZ to improve the control of tumor progression and animal survival, suggesting its clinical potential for improving current brain tumor treatment.

  5. Barrier-free intermolecular proton transfer in the uracil-glycine complex induced by excess electron attachment

    NASA Astrophysics Data System (ADS)

    Gutowski, M.; Dąbkowska, I.; Rak, J.; Xu, S.; Nilles, J. M.; Radisic, D.; Bowen, K. H., Jr.


    The photoelectron spectra (PES) of anions of uracil-glycine and uracil-phenylalanine complexes reveal broad features with maxima at 1.8 and 2.0 eV. The results of ab initio density functional B3LYP and second order Møller-Plesset theory calculations indicate that the excess electron occupies a π^* orbital localized on uracil. The excess electron attachment to the complex can induce a barrier-free proton transfer (BFPT) from the carboxylic group of glycine to the O8 atom of uracil. As a result, the four most stable structures of the anion of uracil-glycine complex can be characterized as the neutral radical of hydrogenated uracil solvated by the anion of deprotonated glycine. The similarity between the PES spectra for the uracil complexes with glycine and phenylalanine suggests that the BFPT is also operative in the case of the latter anionic species. The BFPT to the O8 atom of uracil may be related to the damage of nucleic acid bases by low energy electrons because the O8 atom is involved in a hydrogen bond with adenine in the standard Watson-Crick pairing scheme.

  6. Modeling HIV-1 Induced Neuroinflammation in Mice: Role of Platelets in Mediating Blood-Brain Barrier Dysfunction

    PubMed Central

    Jones, Letitia D.; Jackson, Joseph W.; Maggirwar, Sanjay B.


    The number of HIV-1 positive individuals developing some form of HIV-associated neurocognitive disorder (HAND) is increasing. In these individuals, the integrity of the blood-brain barrier (BBB) is compromised due to an increase in exposure to pro-inflammatory mediators, viral proteins, and virus released from infected cells. It has been shown that soluble CD40L (sCD40L) is released upon platelet activation and is an important mediator of the pathogenesis of HAND but the underlying mechanisms are unclear, emphasizing the need of an effective animal model. Here, we have utilized a novel animal model in which wild-type (WT) mice were infected with EcoHIV; a derivative of HIV-1 that contains a substitution of envelope protein gp120 with that of gp80 derived from murine leukemia virus-1 (MuLV-1). As early as two-weeks post-infection, EcoHIV led to increased permeability of the BBB associated with decreased expression of tight junction protein claudin-5, in CD40L and platelet activation-dependent manner. Treatment with an antiplatelet drug, eptifibatide, in EcoHIV-infected mice normalized BBB function, sCD40L release and platelet activity, thus implicating platelet activation and platelet-derived CD40L in virally induced BBB dysfunction. Our results also validate and underscore the importance of EcoHIV infection mouse model as a tool to explore therapeutic targets for HAND. PMID:26986758

  7. Two-photon fluorescence microscopy study of cerebrovascular dynamics in ultrasound-induced blood–brain barrier opening

    PubMed Central

    Cho, Eunice E; Drazic, Jelena; Ganguly, Milan; Stefanovic, Bojana; Hynynen, Kullervo


    Blood–brain barrier (BBB) disruption can be achieved with ultrasound (US) and circulating microbubble (MB) contrast agent. Using dorsal US sonication and Definity, an MB contrast agent, responses of the cortical cerebral vasculature to BBB opening were observed with varying acoustic peak negative pressure (0.071 to 0.25 MPa) under two-photon microscope. Wistar rats with a craniotomy were sonicated with a single piezoelectric transducer following the intravenous injection of Texas Red for visualization of vasculature and leakage from BBB opening. Based on time-dependent intensity change in the extravascular area, the leakage was classified into three types: fast, sustained, and slow. Fast leakage was characterized by a rapid increase to peak intensity during sonication, but a decrease afterwards, occurring at all pressures and vessels sizes analyzed in our study. Sustained leakage was indicated by a similar, immediate increase to peak intensity but one that remained elevated for the duration of imaging, occurring at low-to-intermediate pressures. Slow leakage began 5 to 15 minutes after sonication, dominating at low pressures, and was more prevalent among smaller vessels than fast and sustained leakage. Our study showed the possibility of controlling leakage type and vessel size in US-induced BBB opening through varying acoustic pressure. PMID:21505473

  8. The Dependence of the Ultrasound-Induced Blood-Brain Barrier Opening Characteristics on Microbubble Size In Vivo

    NASA Astrophysics Data System (ADS)

    Choi, James J.; Feshitan, Jameel A.; Wang, Shougang; Tung, Yao-Sheng; Baseri, Babak; Borden, Mark A.; Konofagou, Elisa E.


    Recent neuropharmaceutical developments have led to potent disease-modifying drugs. In spite of these advancements, most agents cannot traverse the blood-brain barrier (BBB) and deposit in the brain. Focused ultrasound (FUS) with microbubbles has been shown to induce noninvasive, localized, and transient BBB opening. Although promising, safety and efficacy concerns still remain. Previously reported experiments used conventional imaging contrast agents that have a wide size distribution. In this study, we hypothesize that BBB opening characteristics are dependent on bubble diameter. A 25 μl bolus of in-house manufactured, lipid-shelled bubbles with either 1-2 or 4-5 μm diameter ranges was injected intravenously. Pulsed FUS (frequency: 1.5 MHz, peak-negative pressure: 146-607 kPa, duty cycle: 20%, duration: 1-min) was then applied to the left hippocampus of mice (n = 16) in vivo through the intact skin and skull. MRI or fluorescence microscopy was used to determine BBB opening. Contrast-enhanced (Omniscan™; 0.75 mL; molecular weight: 574 Da) MRI (9.4-T) was acquired on multiple days after sonication to determine BBB opening and closing. Fluorescence microscopy was also used to determine the feasibility of delivering large, 3 kDa dextran compounds through the BBB. The BBB opening acoustic pressure threshold for the 4-5μm bubbles was in the 146-304 kPa range while the threshold for the 1-2μm bubbles was higher. In conclusion, FUS-induced BBB opening and closing was shown to be dependent on the bubble diameter indicating the possibility of specifically designing bubbles to enhance this therapeutic application.

  9. DNA Persistence in a Sink Drain Environment


    Winder, Eric M.; Bonheyo, George T.


    Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of themore » sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.« less

  10. DNA Persistence in a Sink Drain Environment

    SciTech Connect

    Winder, Eric M.; Bonheyo, George T.


    Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.

  11. Subarachnoid hemorrhage due to retained lumbar drain.


    Guppy, Kern H; Silverthorn, James W; Akins, Paul T


    Intrathecal spinal catheters (lumbar drains) are indicated for several medical and surgical conditions. In neurosurgical procedures, they are used to reduce intracranial and intrathecal pressures by diverting CSF. They have also been placed for therapeutic access to administer drugs, and more recently, vascular surgeons have used them to improve spinal cord perfusion during the treatment of thoracic aortic aneurysms. Insertion of these lumbar drains is not without attendant complications. One complication is the shearing of the distal end of the catheter with a resultant retained fragment. The authors report the case of a 65-year-old man who presented with a subarachnoid hemorrhage due to the migration of a retained lumbar drain that sheared off during its removal. To the best of the authors' knowledge, this is the first case of rostral migration of a retained intrathecal catheter causing subarachnoid hemorrhage. The authors review the literature on retained intrathecal spinal catheters, and their findings support either early removal of easily accessible catheters or close monitoring with serial imaging.

  12. Bed drain cover assembly for a fluidized bed


    Comparato, Joseph R.; Jacobs, Martin


    A loose fitting movable cover plate (36), suitable for the severe service encountered in a fluidized bed combustor (10), restricts the flow of solids into the combustor drain lines (30) during shutdown of the bed. This cover makes it possible to empty spent solids from the bed drain lines which would otherwise plug the piping between the drain and the downstream metering device. This enables use of multiple drain lines each with a separate metering device for the control of solids flow rate.

  13. Environmental enrichment attenuates the blood brain barrier dysfunction induced by the neonatal hypoxia-ischemia.


    Diaz, Ramiro; Miguel, Patrícia Maidana; Deniz, Bruna Ferrary; Confortim, Heloísa Deola; Barbosa, Sílvia; Mendonça, Monique Culturato Padilha; da Cruz-Höfling, Maria Alice; Pereira, Lenir Orlandi


    Environmental enrichment (EE) is considered an efficient neuroprotector against neonatal hypoxia-ischemia (HI). Nevertheless, the mechanisms involved are not yet clear. In this context, the aim of this study was to investigate the effects of neonatal HI and environmental stimulation in the hippocampus of rats at 3 different time points (PND 8, 22 and 60), evaluating some aspects of BBB structure and function. Seven-day-old Wistar rats were divided into four groups: a control group maintained in a standard environment (CTSE), a control group maintained in an enrichment environment (CTEE), an HI group maintained in a standard environment (HISE) and an HI group maintained in an enrichment environment (HIEE). At the 7th postnatal day (PND), rats were submitted to the Levine-Rice model of neonatal HI. This method consists of permanent occlusion of the right common carotid artery with subsequent exposure to hypoxia. Rats from CTEE and HIEE were stimulated with environmental enrichment. The EE protocol started 24h after HI, in which pup rats with their dams were stimulated in a maintained EE (PND 8-22). Subsequently, animals were submitted to daily EE (1h/day, PND 23-60). The expression of some proteins involved in BBB structure (β-catenin, occludin, connexin-43, aquaporin-4, glut-1 and GFAP) were quantified by western blotting in the hippocampi of rats in three periods, at PND 8, 22 and 60. The BBB permeability and integrity was assessed by Evans blue staining and the immunohistochemistry for GFAP in the CA1 region of the hippocampus were also performed. The results showed an HI-induced decreased occludin expression at PND 22 and low levels of occludin, β-catenin and GFAP at PND 60 in the hippocampus of the hypoxic-ischemic rats. Interestingly, in young and adult rats, EE reversed these effects. Evans blue extravasation into the brain parenchyma confirmed the BBB dysfunction brought on by HI. No differences were observed at PND 8, probably due to the immaturity of the

  14. 14 CFR 23.999 - Fuel system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Fuel system drains. 23.999 Section 23.999... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Powerplant Fuel System Components § 23.999 Fuel system drains. (a) There must be at least one drain to allow safe drainage of the...

  15. 46 CFR 45.157 - Scuppers and gravity drains.

    Code of Federal Regulations, 2010 CFR


    ... 46 Shipping 2 2010-10-01 2010-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from...

  16. 46 CFR 45.157 - Scuppers and gravity drains.

    Code of Federal Regulations, 2013 CFR


    ... 46 Shipping 2 2013-10-01 2013-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from...

  17. 46 CFR 45.157 - Scuppers and gravity drains.

    Code of Federal Regulations, 2014 CFR


    ... 46 Shipping 2 2014-10-01 2014-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from...

  18. 46 CFR 45.157 - Scuppers and gravity drains.

    Code of Federal Regulations, 2012 CFR


    ... 46 Shipping 2 2012-10-01 2012-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from...

  19. 46 CFR 45.157 - Scuppers and gravity drains.

    Code of Federal Regulations, 2011 CFR


    ... 46 Shipping 2 2011-10-01 2011-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from...

  20. 21 CFR 868.5995 - Tee drain (water trap).

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Tee drain (water trap). 868.5995 Section 868.5995 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Therapeutic Devices § 868.5995 Tee drain (water trap). (a) Identification. A tee drain (water trap) is a...


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  2. 14 CFR 23.999 - Fuel system drains.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Fuel system drains. 23.999 Section 23.999... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Powerplant Fuel System Components § 23.999 Fuel system drains. (a) There must be at least one drain to allow safe drainage of the...

  3. 14 CFR 25.999 - Fuel system drains.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Fuel system drains. 25.999 Section 25.999... STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Fuel System Components § 25.999 Fuel system drains. (a) Drainage of the fuel system must be accomplished by the use of fuel strainer and fuel tank sump drains....

  4. 14 CFR 125.139 - Oil system drains.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Oil system drains. 125.139 Section 125.139....139 Oil system drains. Accessible drains incorporating either a manual or automatic means for positive locking in the closed position must be provided to allow safe drainage of the entire oil system....

  5. 14 CFR 125.139 - Oil system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Oil system drains. 125.139 Section 125.139....139 Oil system drains. Accessible drains incorporating either a manual or automatic means for positive locking in the closed position must be provided to allow safe drainage of the entire oil system....

  6. 14 CFR 125.139 - Oil system drains.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Oil system drains. 125.139 Section 125.139....139 Oil system drains. Accessible drains incorporating either a manual or automatic means for positive locking in the closed position must be provided to allow safe drainage of the entire oil system....

  7. 14 CFR 125.139 - Oil system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Oil system drains. 125.139 Section 125.139....139 Oil system drains. Accessible drains incorporating either a manual or automatic means for positive locking in the closed position must be provided to allow safe drainage of the entire oil system....

  8. 14 CFR 125.139 - Oil system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Oil system drains. 125.139 Section 125.139....139 Oil system drains. Accessible drains incorporating either a manual or automatic means for positive locking in the closed position must be provided to allow safe drainage of the entire oil system....

  9. 14 CFR 27.999 - Fuel system drains.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Fuel system drains. 27.999 Section 27.999... STANDARDS: NORMAL CATEGORY ROTORCRAFT Powerplant Fuel System Components § 27.999 Fuel system drains. (a) There must be at least one accessible drain at the lowest point in each fuel system to completely...

  10. Cordyceps sinensis preserves intestinal mucosal barrier and may be an adjunct therapy in endotoxin-induced sepsis rat model: a pilot study

    PubMed Central

    Gu, Guo-Sheng; Ren, Jian-An; Li, Guan-Wei; Yuan, Yu-Jie; Li, Ning; Li, Jie-Shou


    Background: Cordyceps sinensis (C. sinensis), a traditional Chinese medicine, exhibits various pharmacological activities such as reparative, antioxidant, and apoptosis inhibitory effects. Intestinal barrier dysfunction plays a vital role in the progression of sepsis. We aimed to explore the effect of C. sinensis on the gut barrier and evaluate its efficacy in sepsis. Methods: A murine model of gut barrier dysfunction was created by intraperitoneal injection of endotoxin. C. sinensis or saline was administered orally after the induction of sepsis. Alterations of intestinal barrier were evaluated and compared in terms of epithelial cell apoptosis, proliferation index (PI), intercellular tight junction (TJ) and proliferating cell nuclear antigen (PCNA). Results: C. sinensis significantly decreased the percentage of apoptotic cells and promoted mucosal cells proliferation indicated by enhanced PI and PCNA expression in the intestinal mucosa compared to control group. The TJs between epithelial cells which were disrupted in septic rats were also restored by treatment of C. sinensis. In survival studies, C. sinensis was demonstrated to confer a protection against the lethal effect of sepsis. Conclusion: These results suggest that C. sinensis has gut barrier-protection effect in endotoxin-induced sepsis by promoting the proliferation and inhibiting the apoptosis of intestinal mucosal cells, as well as restoring the TJs of intestinal mucosa. C. sinensis may have the potential to be a useful adjunct therapy for sepsis. PMID:26221273

  11. Permeability dependence study of the focused ultrasound-induced blood-brain barrier opening at distinct pressures and microbubble diameters using DCE-MRI.


    Vlachos, Fotios; Tung, Yao-Sheng; Konofagou, Elisa


    Blood-brain barrier opening using focused ultrasound and microbubbles has been experimentally established as a noninvasive and localized brain drug delivery technique. In this study, the permeability of the opening is assessed in the murine hippocampus after the application of focused ultrasound at three different acoustic pressures and microbubble sizes. Using dynamic contrast-enhanced MRI, the transfer rates were estimated, yielding permeability maps and quantitative K(trans) values for a predefined region of interest. The volume of blood-brain barrier opening according to the K(trans) maps was proportional to both the pressure and the microbubble diameter. A K(trans) plateau of ∼0.05 min(-1) was reached at higher pressures (0.45 and 0.60 MPa) for the larger sized bubbles (4-5 and 6-8 μm), which was on the same order as the K(trans) of the epicranial muscle (no barrier). Smaller bubbles (1-2 μm) yielded significantly lower permeability values. A small percentage (7.5%) of mice showed signs of damage under histological examination, but no correlation with permeability was established. The assessment of the blood-brain barrier permeability properties and their dependence on both the pressure and the microbubble diameter suggests that K(trans) maps may constitute an in vivo tool for the quantification of the efficacy of the focused ultrasound-induced blood-brain barrier opening.

  12. Is Drain Tip Culture Prognostic of Surgical Site Infection? Results of 1380 Drain Tip Cultures in Total Hip Arthroplasty.


    Takada, Ryohei; Jinno, Tetsuya; Koga, Daisuke; Hirao, Masanobu; Muneta, Takeshi; Okawa, Atsushi


    The purpose of this study was to evaluate a prognostic value of drain tip culture for surgical site infection (SSI) after total hip arthroplasty. A total of 1380 closed suction drain tips cultured after removal in primary total hip arthroplasty were included in this study. Drains were removed in 12-72 hours after surgery. Drain tip cultures were positive in 11 cases (0.8%). SSI was found in 4 cases (0.3%), where the drain tip cultures were all negative. The sensitivity of drain tip culture for infection after surgery was 0%, and the specificity was 99.7%. We concluded that, drain tip culture cannot be prognostic for SSI after total hip arthroplasty. Routine use of drain tip culture is not supported.

  13. Beta-trace Protein as a new non-invasive immunological Marker for Quinolinic Acid-induced impaired Blood-Brain Barrier Integrity

    PubMed Central

    Baranyi, Andreas; Amouzadeh-Ghadikolai, Omid; Lewinski, Dirk von; Breitenecker, Robert J.; Stojakovic, Tatjana; März, Winfried; Robier, Christoph; Rothenhäusler, Hans-Bernd; Mangge, Harald; Meinitzer, Andreas


    Quinolinic acid, a macrophage/microglia-derived excitotoxin fulfills a plethora of functions such as neurotoxin, gliotoxin, and proinflammatory mediator, and it alters the integrity and cohesion of the blood-brain barrier in several pathophysiological states. Beta-trace protein (BTP), a monomeric glycoprotein, is known to indicate cerebrospinal fluid leakage. Thus, the prior aim of this study was to investigate whether BTP might non-invasively indicate quinolinic acid-induced impaired blood-brain barrier integrity. The research hypotheses were tested in three subsamples with different states of immune activation (patients with HCV-infection and interferon-α, patients with major depression, and healthy controls). BTP has also been described as a sensitive marker in detecting impaired renal function. Thus, the renal function has been considered. Our study results revealed highest quinolinic acid and highest BTP- levels in the subsample of patients with HCV in comparison with the other subsamples with lower or no immune activation (quinolinic acid: F = 21.027, p < 0.001 [ANOVA]; BTP: F = 6.792, p < 0.01 [ANOVA]). In addition, a two-step hierarchical linear regression model showed that significant predictors of BTP levels are quinolinic acid, glomerular filtration rate and age. The neurotoxin quinolinic acid may impair blood-brain barrier integrity. BTP might be a new non-invasive biomarker to indicate quinolinic acid-induced impaired blood-brain barrier integrity. PMID:28276430

  14. Dietary live yeast and mannan-oligosaccharide supplementation attenuate intestinal inflammation and barrier dysfunction induced by Escherichia coli in broilers.


    Wang, Weiwei; Li, Zhui; Han, Qiqi; Guo, Yuming; Zhang, Bo; D'inca, Romain


    The effects of live yeast (LY) and mannan-oligosaccharide (MOS) supplementation on intestinal disruption induced by Escherichia coli in broilers were investigated. The experimental design was a 3×2 factorial arrangement with three dietary treatments (control, 0·5 g/kg LY (Saccharomyces cerevisiae, 1·0×1010 colony-forming units/g), 0·5 g/kg MOS) and two immune treatments (with or without E. coli challenge from 7 to 11 d of age). Samples were collected at 14 d of age. The results showed that E. coli challenge impaired (P<0·05) growth performance during the grower period (1-21 d) and the overall period (1-35 d) of broilers, increased (P<0·05) serum endotoxin and diamine oxidase levels coupled with ileal myeloperoxidase and lysozyme activities, whereas reduced (P<0·05) maltase activity, and compromised the morphological structure of the ileum. Besides, it increased (P<0·05) the mRNA expressions of several inflammatory genes and reduced occludin expression in the ileum. Dietary treatment with both LY and MOS reduced (P<0·05) serum diamine oxidase and ileal myeloperoxidase levels, but elevated villus height (P<0·10) and the ratio of villus height:crypt depth (P<0·05) of the ileum. It also alleviated (P<0·05) E. coli-induced increases (P<0·05) in ileal Toll-like receptor 4, NF-κ B and IL-1 β expressions. Moreover, LY supplementation reduced (P<0·05) feed conversion ratio of birds during the grower period and enhanced (P<0·05) the community diversity (Shannon and Simpson indices) of ileal microbiota, whereas MOS addition counteracted (P<0·05) the decreased ileal IL-10 and occludin expressions in challenged birds. In conclusion, both LY and MOS supplementation could attenuate E. coli-induced intestinal disruption by alleviating intestinal inflammation and barrier dysfunction in broilers. Moreover, LY addition could improve intestinal microbial community structure and feed efficiency of broilers.

  15. Barrier Formation

    PubMed Central

    Lyaruu, D.M.; Medina, J.F.; Sarvide, S.; Bervoets, T.J.M.; Everts, V.; DenBesten, P.; Smith, C.E.; Bronckers, A.L.J.J.


    Enamel fluorosis is an irreversible structural enamel defect following exposure to supraoptimal levels of fluoride during amelogenesis. We hypothesized that fluorosis is associated with excess release of protons during formation of hypermineralized lines in the mineralizing enamel matrix. We tested this concept by analyzing fluorotic enamel defects in wild-type mice and mice deficient in anion exchanger-2a,b (Ae2a,b), a transmembrane protein in maturation ameloblasts that exchanges extracellular Cl− for bicarbonate. Defects were more pronounced in fluorotic Ae2a,b−/− mice than in fluorotic heterozygous or wild-type mice. Phenotypes included a hypermineralized surface, extensive subsurface hypomineralization, and multiple hypermineralized lines in deeper enamel. Mineral content decreased in all fluoride-exposed and Ae2a,b−/− mice and was strongly correlated with Cl−. Exposure of enamel surfaces underlying maturation-stage ameloblasts to pH indicator dyes suggested the presence of diffusion barriers in fluorotic enamel. These results support the concept that fluoride stimulates hypermineralization at the mineralization front. This causes increased release of protons, which ameloblasts respond to by secreting more bicarbonates at the expense of Cl− levels in enamel. The fluoride-induced hypermineralized lines may form barriers that impede diffusion of proteins and mineral ions into the subsurface layers, thereby delaying biomineralization and causing retention of enamel matrix proteins. PMID:24170372

  16. Simulation and comparative study of tunneling field effect transistors with dopant-segregated Schottky source/drain

    NASA Astrophysics Data System (ADS)

    Zhang, Yi Bo; Sun, Lei; Xu, Hao; Han, Jing Wen


    Dopant-segregated Schottky source/drain tunneling field effect transistors (STFET) are investigated in this paper. The working mechanisms of STFET and the influence of device parameters are studied with Synopsys Sentaurus. Schottky source/drain MOSFETs possess several advantages over conventional MOSFETs, and dopant segregation can be feasibly achieved within current silicidation process. With dopant segregation, highly doped regions can be obtained after silicidation, which is necessary for band-to-band tunneling. With proper parameter setting, STFET can achieve comparable performance as TFET. High segregation doping for STFET is required to increase band-to-band tunneling probability and suppress bipolar behaviors. Increasing the electron barrier height at source side helps to provide larger drive current and higher on/off ratio. It is also found that STFET’s on-state performance is irrelevant to the segregation length when the segregation length is larger than a certain value. Furthermore, STFET is also insensitive to the Schottky barrier at drain side when the Schottky barrier at source side is fixed, which would relax the requirement for source/drain fabrication.

  17. Enhanced carrier injection in InGaN/GaN multiple quantum wells LED with polarization-induced electron blocking barrier

    NASA Astrophysics Data System (ADS)

    Li, Chengguo; Liu, Hongfei; Chua, Soo Jin


    In this report, we designed a light emitting diode (LED) structure in which an N-polar p-GaN layer is grown on top of Ga-polar In0.1Ga0.9N/GaN quantum wells (QWs) on an n-GaN layer. Numerical simulation reveals that the large polarization field at the polarity inversion interface induces a potential barrier in the conduction band, which can block electron overflow out of the QWs. Compared with a conventional LED structure with an Al0.2Ga0.8N electron blocking layer (EBL), the proposed LED structure shows much lower electron current leakage, higher hole injection, and a significant improvement in the internal quantum efficiency (IQE). These results suggest that the polarization induced barrier (PIB) is more effective than the AlGaN EBL in suppressing electron overflow and improving hole transport in GaN-based LEDs.

  18. Diffusion barriers

    NASA Technical Reports Server (NTRS)

    Nicolet, M. A.


    The choice of the metallic film for the contact to a semiconductor device is discussed. One way to try to stabilize a contact is by interposing a thin film of a material that has low diffusivity for the atoms in question. This thin film application is known as a diffusion barrier. Three types of barriers can be distinguished. The stuffed barrier derives its low atomic diffusivity to impurities that concentrate along the extended defects of a polycrystalline layer. Sacrificial barriers exploit the fact that some (elemental) thin films react in a laterally uniform and reproducible fashion. Sacrificial barriers have the advantage that the point of their failure is predictable. Passive barriers are those most closely approximating an ideal barrier. The most-studied case is that of sputtered TiN films. Stuffed barriers may be viewed as passive barriers whose low diffusivity material extends along the defects of the polycrystalline host.

  19. Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2

    SciTech Connect

    Eum, Sung Yong Jaraki, Dima; András, Ibolya E.; Toborek, Michal


    Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP

  20. Barrier-Free Intermolecular Proton Transfer Induced by Excess Electron Attachment to the Complex of Alanine with Uracil

    SciTech Connect

    Dabkowska, Iwona; Rak, Janusz; Gutowski, Maciej S.; Nilles, J.M.; Stokes, Sarah; Bowen, Kit H.


    The photoelectron spectrum of the uracil-alanine anionic complex (UA)- has been recorded with 2.540 eV photons. This spectrum reveals a broad feature with a maximum between 1.6-2.1 eV. The vertical electron detachment energy is too large to be attributed to an (UA)- anionic complex in which an intact uracil anion is solvated by alanine, or vice versa. The neutral and anionic complexes of uracil and alanine were studied at the B3LYP and second order Moeller-Plesset level of theory with 6-31++G** basis sets. The neutral complexes form cyclic hydrogen bonds and the three most stable neutral complexes are bound by 0.72, 0.61 and 0.57 eV. The electron hole in complexes of uracil with alaninie is localized on uracil, but the formation of a complex with alanine strongly modulates the vertical ionization energy of uracil. The theoretical results indicate that the excess electron in (UA)- occupies a p* orbital localized on uracil. The excess electron attachment to the complex can induce a barrier-free proton transfer (BFPT) from the carboxylic group of alanine to the O8 atom of uracil. As a result, the four most stable structures of the uracil-alanine anionic complex can be characterized as the neutral radical of hydrogenated uracil solvated by the anion of deprotonated alanine. Our current results for the anionic complex of uracil with alanine are similar to our previous results for the anion of uracil with glycine [Eur. Phys. J. D 20, 431 (2002)], and together they indicate that the BFPT process is not very sensitive to the nature of the amino acid's hydrophobic residual group. The BFPT to the O8 atom of uracil may be relevant to the damage suffered by nucleic acid bases due to exposure to low energy electrons.

  1. Blood brain barrier dysfunction and delayed neurological deficits in mild traumatic brain injury induced by blast shock waves

    PubMed Central

    Shetty, Ashok K.; Mishra, Vikas; Kodali, Maheedhar; Hattiangady, Bharathi


    Mild traumatic brain injury (mTBI) resulting from exposure to blast shock waves (BSWs) is one of the most predominant causes of illnesses among veterans who served in the recent Iraq and Afghanistan wars. Such mTBI can also happen to civilians if exposed to shock waves of bomb attacks by terrorists. While cognitive problems, memory dysfunction, depression, anxiety and diffuse white matter injury have been observed at both early and/or delayed time-points, an initial brain pathology resulting from exposure to BSWs appears to be the dysfunction or disruption of the blood-brain barrier (BBB). Studies in animal models suggest that exposure to relatively milder BSWs (123 kPa) initially induces free radical generating enzymes in and around brain capillaries, which enhances oxidative stress resulting in loss of tight junction (TJ) proteins, edema formation, and leakiness of BBB with disruption or loss of its components pericytes and astrocyte end-feet. On the other hand, exposure to more intense BSWs (145–323 kPa) causes acute disruption of the BBB with vascular lesions in the brain. Both of these scenarios lead to apoptosis of endothelial and neural cells and neuroinflammation in and around capillaries, which may progress into chronic traumatic encephalopathy (CTE) and/or a variety of neurological impairments, depending on brain regions that are afflicted with such lesions. This review discusses studies that examined alterations in the brain milieu causing dysfunction or disruption of the BBB and neuroinflammation following exposure to different intensities of BSWs. Furthermore, potential of early intervention strategies capable of easing oxidative stress, repairing the BBB or blocking inflammation for minimizing delayed neurological deficits resulting from exposure to BSWs is conferred. PMID:25165433

  2. Radiation-Induced Astrogliosis and Blood-Brain Barrier Damage Can Be Abrogated Using Anti-TNF Treatment

    SciTech Connect

    Wilson, Christy M.; Gaber, M. Waleed Sabek, Omaima M.; Zawaski, Janice A.; Merchant, Thomas E.


    Purpose: In this article, we investigate the role of tumor necrosis factor-alpha (TNF) in the initiation of acute damage to the blood-brain barrier (BBB) and brain tissue following radiotherapy (RT) for CNS tumors. Methods and Materials: Intravital microscopy and a closed cranial window technique were used to measure quantitatively BBB permeability to FITC-dextran 4.4-kDa molecules, leukocyte adhesion (Rhodamine-6G) and vessel diameters before and after 20-Gy cranial radiation with and without treatment with anti-TNF. Immunohistochemistry was used to quantify astrogliosis post-RT and immunofluorescence was used to visualize protein expression of TNF and ICAM-1 post-RT. Recombinant TNF (rTNF) was used to elucidate the role of TNF in leukocyte adhesion and vessel diameter. Results: Mice treated with anti-TNF showed significantly lower permeability and leukocyte adhesion at 24 and 48 h post-RT vs. RT-only animals. We observed a significant decrease in arteriole diameters at 48 h post-RT that was inhibited in TNF-treated animals. We also saw a significant increase in activated astrocytes following RT that was significantly lower in the anti-TNF-treated group. In addition, immunofluorescence showed protein expression of TNF and ICAM-1 in the cerebral cortex that was inhibited with anti-TNF treatment. Finally, administration of rTNF induced a decrease in arteriole diameter and a significant increase in leukocyte adhesion in venules and arterioles. Conclusions: TNF plays a significant role in acute changes in BBB permeability, leukocyte adhesion, arteriole diameter, and astrocyte activation following cranial radiation. Treatment with anti-TNF protects the brain's microvascular network from the acute damage following RT.

  3. Weaning induces both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine.


    Boudry, Gaëlle; Péron, Vincent; Le Huërou-Luron, Isabelle; Lallès, Jean Paul; Sève, Bernard


    This study investigated intestinal physiology of piglets at weaning. Piglets (n = 60) weaned at 21 d were food deprived for 2 d and then tube-fed using 2 different diets (a conventional diet vs. a wheat-enriched diet). They were slaughtered at d 0, 2, 5, 8, or 15 postweaning. Jejunum, ileum, and colon were mounted in Ussing chambers. In addition, segments of the proximal jejunum of 4 growing pigs were studied 35 d after weaning. Secretory function was assessed by basal short-circuit current (Isc) and secretagogue-stimulated Isc. Glucose absorption was measured by the increase in Isc after the addition of glucose. Epithelial barrier function was measured by transmucosal resistance (R) and horseradish peroxidase (HRP) fluxes across the epithelium. There were no significant differences between the pigs fed the 2 diets for any of the parameters studied. As already reported, a transient villous atrophy was observed. At the same time, we observed an increased basal Isc in jejunum and colon, increased glucose absorption and a dramatic drop of R in jejunum. These parameters had returned to preweaning values by d 5. Weaning was also followed by long-lasting modifications. In jejunum, responses to the secretagogues and glucose absorption were decreased at wk 2 after weaning and were not different between d 15 and 35. Ileal transmucosal resistance increased on d 5 and was stable thereafter. HRP flux in jejunum declined on d 2 and stayed at this low level throughout the experiment. We conclude that weaning induces transient dramatic changes in intestinal physiology but is also a period of maturation of the intestine.

  4. Photoacoustic micro-imaging of focused ultrasound induced blood-brain-barrier opening in a rat model

    NASA Astrophysics Data System (ADS)

    Wang, Po-Hsun; Hsu, Po-Hung; Liu, Hao-Li; Wang, Churng-Ren Chris; Li, Meng-Lin


    Blood brain barrier (BBB) prevents most of the drug from transmitting into the brain tissue and decreases the treatment performance for brain disease. One of the methods to overcome the difficulty of drug delivery is to locally increase the permeability of BBB with high-intensity focused ultrasound. In this study, we have investigated the feasibility of photoacoustic microscopy of focused-ultrasound induced BBB opening in a rat model in vivo with gold nanorods (AuNRs) as a contrast agent. This study takes advantage of the strong near-infrared absorption of AuNRs and their extravasation tendency from BBB opening foci due to their nano-scale size. Before the experiments, craniotomy was performed on rats to provide a path for focused ultrasound beam. Localized BBB opening at the depth of about 3 mm from left cortex of rat brains was achieved by delivering 1.5 MHz focused ultrasound energy into brain tissue in the presence of microbubbles. PEGylated AuNRs with a peak optical absorption at ~800 nm were then intravenously administered. Pre-scan prior to BBB disruption and AuNR injection was taken to mark the signal background. After injection, the distribution of AuNRs in rat brains was monitored up to 2 hours. Experimental results show that imaging AuNRs reveals BBB disruption area in left brains while there are no changes observed in the right brains. From our results, photoacoustic imaging plus AuNRs shows the promise as a novel monitoring strategy in identifying the location and variation of focused-ultrasound BBB-opening in a rat model.

  5. Diesel exhaust particles induce oxidative stress, proinflammatory signaling, and P-glycoprotein up-regulation at the blood-brain barrier.


    Hartz, Anika M S; Bauer, Björn; Block, Michelle L; Hong, Jau-Shyong; Miller, David S


    Here, we report that diesel exhaust particles (DEPs), a major constituent of urban air pollution, affect blood-brain barrier function at the tissue, cellular, and molecular levels. Isolated rat brain capillaries exposed to DEPs showed increased expression and transport activity of the key drug efflux transporter, P-glycoprotein (6 h EC(50) was approximately 5 microg/ml). Up-regulation of P-glycoprotein was abolished by blocking transcription or protein synthesis. Inhibition of NADPH oxidase or pretreatment of capillaries with radical scavengers ameliorated DEP-induced P-glycoprotein up-regulation, indicating a role for reactive oxygen species in signaling. DEP exposure also increased brain capillary tumor necrosis factor-alpha (TNF-alpha) levels. DEP-induced P-glycoprotein up-regulation was abolished when TNF-receptor 1 (TNF-R1) was blocked and was not evident in experiments with capillaries from TNF-R1 knockout mice. Inhibition of JNK, but not NF-kappaB, blocked DEP-induced P-glycoprotein up-regulation, indicating a role for AP-1 in the signaling pathway. Consistent with this, DEPs increased phosphorylation of c-jun. Together, our results show for the first time that a component of air pollution, DEPs, alters blood-brain barrier function through oxidative stress and proinflammatory cytokine production. These experiments disclose a novel blood-brain barrier signaling pathway, with clear implications for environmental toxicology, CNS pathology, and the pharmacotherapy of CNS disorders.

  6. In vivo transcranial cavitation threshold detection during ultrasound-induced blood-brain barrier opening in mice.


    Tung, Yao-Sheng; Vlachos, Fotios; Choi, James J; Deffieux, Thomas; Selert, Kirsten; Konofagou, Elisa E


    The in vivo cavitation response associated with blood-brain barrier (BBB) opening as induced by transcranial focused ultrasound (FUS) in conjunction with microbubbles was studied in order to better identify the underlying mechanism in its noninvasive application. A cylindrically focused hydrophone, confocal with the FUS transducer, was used as a passive cavitation detector (PCD) to identify the threshold of inertial cavitation (IC) in the presence of Definity® microbubbles (mean diameter range: 1.1-3.3 µm, Lantheus Medical Imaging, MA, USA). A vessel phantom was first used to determine the reliability of the PCD prior to in vivo use. A cerebral blood vessel was simulated by generating a cylindrical channel of 610 µm in diameter inside a polyacrylamide gel and by saturating its volume with microbubbles. The microbubbles were sonicated through an excised mouse skull. Second, the same PCD setup was employed for in vivo noninvasive (i.e. transdermal and transcranial) cavitation detection during BBB opening. After the intravenous administration of Definity® microbubbles, pulsed FUS was applied (frequency: 1.525 or 1.5 MHz, peak-rarefactional pressure: 0.15-0.60 MPa, duty cycle: 20%, PRF: 10 Hz, duration: 1 min with a 30 s interval) to the right hippocampus of twenty-six (n = 26) mice in vivo through intact scalp and skull. T1 and T2-weighted MR images were used to verify the BBB opening. A spectrogram was generated at each pressure in order to detect the IC onset and duration. The threshold of BBB opening was found to be at a 0.30 MPa peak-rarefactional pressure in vivo. Both the phantom and in vivo studies indicated that the IC pressure threshold had a peak-rarefactional amplitude of 0.45 MPa. This indicated that BBB opening may not require IC at or near the threshold. Histological analysis showed that BBB opening could be induced without any cellular damage at 0.30 and 0.45 MPa. In conclusion, the cavitation response could be detected without craniotomy in mice

  7. Anesthesia-Induced Hypothermia Attenuates Early-Phase Blood-Brain Barrier Disruption but Not Infarct Volume following Cerebral Ischemia.


    Liu, Yu-Cheng; Lee, Yu-Da; Wang, Hwai-Lee; Liao, Kate Hsiurong; Chen, Kuen-Bao; Poon, Kin-Shing; Pan, Yu-Ling; Lai, Ted Weita


    Blood-brain barrier (BBB) disruption is thought to facilitate the development of cerebral infarction after a stroke. In a typical stroke model (such as the one used in this study), the early phase of BBB disruption reaches a peak 6 h post-ischemia and largely recovers after 8-24 h, whereas the late phase of BBB disruption begins 48-58 h post-ischemia. Because cerebral infarct develops within 24 h after the onset of ischemia, and several therapeutic agents have been shown to reduce the infarct volume when administered at 6 h post-ischemia, we hypothesized that attenuating BBB disruption at its peak (6 h post-ischemia) can also decrease the infarct volume measured at 24 h. We used a mouse stroke model obtained by combining 120 min of distal middle cerebral arterial occlusion (dMCAo) with ipsilateral common carotid arterial occlusion (CCAo). This model produced the most reliable BBB disruption and cerebral infarction compared to other models characterized by a shorter duration of ischemia or obtained with dMCAO or CCAo alone. The BBB permeability was measured by quantifying Evans blue dye (EBD) extravasation, as this tracer has been shown to be more sensitive for the detection of early-phase BBB disruption compared to other intravascular tracers that are more appropriate for detecting late-phase BBB disruption. We showed that a 1 h-long treatment with isoflurane-anesthesia induced marked hypothermia and attenuated the peak of BBB disruption when administered 6 h after the onset of dMCAo/CCAo-induced ischemia. We also demonstrated that the inhibitory effect of isoflurane was hypothermia-dependent because the same treatment had no effect on ischemic BBB disruption when the mouse body temperature was maintained at 37°C. Importantly, inhibiting the peak of BBB disruption by hypothermia had no effect on the volume of brain infarct 24 h post-ischemia. In conclusion, inhibiting the peak of BBB disruption is not an effective neuroprotective strategy, especially in comparison

  8. Anesthesia-Induced Hypothermia Attenuates Early-Phase Blood-Brain Barrier Disruption but Not Infarct Volume following Cerebral Ischemia

    PubMed Central

    Liu, Yu-Cheng; Lee, Yu-Da; Wang, Hwai-Lee; Liao, Kate Hsiurong; Chen, Kuen-Bao; Poon, Kin-Shing; Pan, Yu-Ling


    Blood-brain barrier (BBB) disruption is thought to facilitate the development of cerebral infarction after a stroke. In a typical stroke model (such as the one used in this study), the early phase of BBB disruption reaches a peak 6 h post-ischemia and largely recovers after 8–24 h, whereas the late phase of BBB disruption begins 48–58 h post-ischemia. Because cerebral infarct develops within 24 h after the onset of ischemia, and several therapeutic agents have been shown to reduce the infarct volume when administered at 6 h post-ischemia, we hypothesized that attenuating BBB disruption at its peak (6 h post-ischemia) can also decrease the infarct volume measured at 24 h. We used a mouse stroke model obtained by combining 120 min of distal middle cerebral arterial occlusion (dMCAo) with ipsilateral common carotid arterial occlusion (CCAo). This model produced the most reliable BBB disruption and cerebral infarction compared to other models characterized by a shorter duration of ischemia or obtained with dMCAO or CCAo alone. The BBB permeability was measured by quantifying Evans blue dye (EBD) extravasation, as this tracer has been shown to be more sensitive for the detection of early-phase BBB disruption compared to other intravascular tracers that are more appropriate for detecting late-phase BBB disruption. We showed that a 1 h-long treatment with isoflurane-anesthesia induced marked hypothermia and attenuated the peak of BBB disruption when administered 6 h after the onset of dMCAo/CCAo-induced ischemia. We also demonstrated that the inhibitory effect of isoflurane was hypothermia-dependent because the same treatment had no effect on ischemic BBB disruption when the mouse body temperature was maintained at 37°C. Importantly, inhibiting the peak of BBB disruption by hypothermia had no effect on the volume of brain infarct 24 h post-ischemia. In conclusion, inhibiting the peak of BBB disruption is not an effective neuroprotective strategy, especially in

  9. Sodium butyrate attenuates high-fat diet-induced steatohepatitis in mice by improving gut microbiota and gastrointestinal barrier

    PubMed Central

    Zhou, Da; Pan, Qin; Xin, Feng-Zhi; Zhang, Rui-Nan; He, Chong-Xin; Chen, Guang-Yu; Liu, Chang; Chen, Yuan-Wen; Fan, Jian-Gao


    AIM To investigate whether gut microbiota metabolite sodium butyrate (NaB) is an effective substance for attenuating non-alcoholic fatty liver disease (NAFLD) and the internal mechanisms. METHODS Male C57BL/6J mice were divided into three groups, normal control were fed standard chow and model group were fed a high-fat diet (HFD) for 16 wk, the intervention group were fed HFD for 16 wk and treated with NaB for 8 wk. Gut microbiota from each group were detected at baseline and at 16 wk, liver histology were evaluated and gastrointestinal barrier indicator such as zonula occluden-1 (ZO-1) were detected by immunohistochemistry and realtime-PCR, further serum or liver endotoxin were determined by ELISA and inflammation- or metabolism-associated genes were quantified by real-time PCR. RESULTS NaB corrected the HFD-induced gut microbiota imbalance in mice, while it considerably elevated the abundances of the beneficial bacteria Christensenellaceae, Blautia and Lactobacillus. These bacteria can produce butyric acid in what seems like a virtuous circle. And butyrate restored HFD induced intestinal mucosa damage, increased the expression of ZO-1 in small intestine, further decreased the levels of gut endotoxin in serum and liver compared with HF group. Endotoxin-associated genes such as TLR4 and Myd88, pro-inflammation genes such as MCP-1, TNF-α, IL-1, IL-2, IL-6 and IFN-γ in liver or epididymal fat were obviously downregulated after NaB intervention. Liver inflammation and fat accumulation were ameliorated, the levels of TG and cholesterol in liver were decreased after NaB intervention, NAS score was significantly decreased, metabolic indices such as FBG and HOMA-IR and liver function indicators ALT and AST were improved compared with HF group. CONCLUSION NaB may restore the dysbiosis of gut microbiota to attenuate steatohepatitis, which is suggested to be a potential gut microbiota modulator and therapeutic substance for NAFLD. PMID:28104981

  10. In vivo transcranial cavitation threshold detection during ultrasound-induced blood-brain barrier opening in mice

    NASA Astrophysics Data System (ADS)

    Tung, Yao-Sheng; Vlachos, Fotios; Choi, James J.; Deffieux, Thomas; Selert, Kirsten; Konofagou, Elisa E.


    The in vivo cavitation response associated with blood-brain barrier (BBB) opening as induced by transcranial focused ultrasound (FUS) in conjunction with microbubbles was studied in order to better identify the underlying mechanism in its noninvasive application. A cylindrically focused hydrophone, confocal with the FUS transducer, was used as a passive cavitation detector (PCD) to identify the threshold of inertial cavitation (IC) in the presence of Definity® microbubbles (mean diameter range: 1.1-3.3 µm, Lantheus Medical Imaging, MA, USA). A vessel phantom was first used to determine the reliability of the PCD prior to in vivo use. A cerebral blood vessel was simulated by generating a cylindrical channel of 610 µm in diameter inside a polyacrylamide gel and by saturating its volume with microbubbles. The microbubbles were sonicated through an excised mouse skull. Second, the same PCD setup was employed for in vivo noninvasive (i.e. transdermal and transcranial) cavitation detection during BBB opening. After the intravenous administration of Definity® microbubbles, pulsed FUS was applied (frequency: 1.525 or 1.5 MHz, peak-rarefactional pressure: 0.15-0.60 MPa, duty cycle: 20%, PRF: 10 Hz, duration: 1 min with a 30 s interval) to the right hippocampus of twenty-six (n = 26) mice in vivo through intact scalp and skull. T1 and T2-weighted MR images were used to verify the BBB opening. A spectrogram was generated at each pressure in order to detect the IC onset and duration. The threshold of BBB opening was found to be at a 0.30 MPa peak-rarefactional pressure in vivo. Both the phantom and in vivo studies indicated that the IC pressure threshold had a peak-rarefactional amplitude of 0.45 MPa. This indicated that BBB opening may not require IC at or near the threshold. Histological analysis showed that BBB opening could be induced without any cellular damage at 0.30 and 0.45 MPa. In conclusion, the cavitation response could be detected without craniotomy in mice

  11. Effect of some drugs on ethanol-induced changes in blood brain barrier permeability for /sup 14/C-tyrosine

    SciTech Connect

    Borisenko, S.A.; Burov, Yu.V.


    This investigation seeks to compare the effects of membrane stabilizers chlorpromazine and alpha-tocopherol, and also the dopaminergic antagonist haloperidol, in changes in permeability of the blood-brain barrier for carbon 14-labelled tyrosine.

  12. Energy capability enhancement for isolated extended drain NMOS transistors

    NASA Astrophysics Data System (ADS)

    Weidong, Nie; Jin, Wu; Xiaohui, Ma; Zongguang, Yu


    Isolated extended drain NMOS (EDNMOS) transistors are widely used in power signal processing. The hole current induced by a high electric field can result in a serious reliability problem due to a parasitic NPN effect. By optimizing p-type epitaxial (p-epi) thickness, n-type buried layer (BLN) and nwell doping distribution, the peak electric field is decreased by 30% and the peak hole current is decreased by 60%, which obviously suppress the parasitic NPN effect. Measured I-V characteristics and transmission line pulsing (TLP) results show that the on-state breakdown voltage is increased from 28 to 37 V when 6 V Vgs is applied and the energy capability is improved by about 30%, while the on-state resistance remains unchanged.

  13. Interaction of integrin β4 with S1P receptors in S1P- and HGF-induced endothelial barrier enhancement.


    Ni, Xiuqin; Epshtein, Yulia; Chen, Weiguo; Zhou, Tingting; Xie, Lishi; Garcia, Joe G N; Jacobson, Jeffrey R


    We previously reported sphingosine 1-phosphate (S1P) and hepatocyte growth factor (HGF) augment endothelial cell (EC) barrier function and attenuate murine acute lung inury (ALI). While the mechanisms underlying these effects are not fully understood, S1P and HGF both transactivate the S1P receptor, S1PR1 and integrin β4 (ITGB4) at membrane caveolin-enriched microdomains (CEMs). In the current study, we investigated the roles of S1PR2 and S1PR3 in S1P/HGF-mediated EC signaling and their associations with ITGB4. Our studies confirmed ITGB4 and S1PR2/3 are recruited to CEMs in human lung EC in response to either S1P (1 µM, 5 min) or HGF (25 ng/ml, 5 min). Co-immunoprecipitation experiments identified an S1P/HGF-mediated interaction of ITGB4 with both S1PR2 and S1PR3. We then employed an in situ proximity ligation assay (PLA) to confirm a direct ITGB4-S1PR3 association induced by S1P/HGF although a direct association was not detectable between S1PR2 and ITGB4. S1PR1 knockdown (siRNA), however, abrogated S1P/HGF-induced ITGB4-S1PR2 associations while there was no effect on ITGB4-S1PR3 associations. Moreover, PLA confirmed a direct association between S1PR1 and S1PR2 induced by S1P and HGF. Finally, silencing of S1PR2 significantly attenuated S1P/HGF-induced EC barrier enhancement as measured by transendothelial resistance while silencing of S1PR3 significantly augmented S1P/HGF-induced barrier enhancement. These results confirm an important role for S1PR2 and S1PR3 in S1P/HGF-mediated EC barrier responses that are associated with their complex formation with ITGB4. Our findings elucidate novel mechanisms of EC barrier regulation that may ultimately lead to new therapeutic targets for disorders characterized by increased vascular permeability including ALI.

  14. Draining skin lesion from a desert poodle.


    Beaudin, Sylvie; Rich, Lon J; Meinkoth, James H; Cowell, Rick L


    A 16-month-old intact female Poodle in Arizona had a history of intermittent coughing of a few weeks duration. Coccidiomycosis antibody screening test results were negative for immunoglobulin (Ig) M, but were positive (1:64) for IgG. Fine needle aspiration specimens of a draining lesion on the right palmar front foot contained large numbers of neutrophils, many of which contained bacteria, and lower numbers of macrophages. A few small structures also were observed, 2-5 microm in diameter with thin, nonstaining capsules and small, round to oval densely aggregated, eccentric nuclei. Cytologic findings were consistent with septic pyogranulomatous inflammation with Coccidiodes immitis endospores. Fungal culture of a sample from the draining lesion yielded white growth with barrel-shaped arthroconidia. Identification of the organism as C immitis was confirmed by a commercial DNA probe test. Although coccidioidomycosis often is diagnosed by microscopic identification of C immitis spherules in cytologic specimens, in this case only endospores, which are released from mature spherules, were observed. In cases of suspected coccidiodomycosis, the unique morphology of endospores may be useful in making a cytologic diagnosis.

  15. Cryogenic Fuel Tank Draining Analysis Model

    NASA Technical Reports Server (NTRS)

    Greer, Donald


    One of the technological challenges in designing advanced hypersonic aircraft and the next generation of spacecraft is developing reusable flight-weight cryogenic fuel tanks. As an aid in the design and analysis of these cryogenic tanks, a computational fluid dynamics (CFD) model has been developed specifically for the analysis of flow in a cryogenic fuel tank. This model employs the full set of Navier-Stokes equations, except that viscous dissipation is neglected in the energy equation. An explicit finite difference technique in two-dimensional generalized coordinates, approximated to second-order accuracy in both space and time is used. The stiffness resulting from the low Mach number is resolved by using artificial compressibility. The model simulates the transient, two-dimensional draining of a fuel tank cross section. To calculate the slosh wave dynamics the interface between the ullage gas and liquid fuel is modeled as a free surface. Then, experimental data for free convection inside a horizontal cylinder are compared with model results. Finally, cryogenic tank draining calculations are performed with three different wall heat fluxes to demonstrate the effect of wall heat flux on the internal tank flow field.

  16. Roundtable. Strategies to discourage brain drain.

    PubMed Central

    Kupfer, Linda; Hofman, Karen; Jarawan, Raya; McDermott, Jeanne; Bridbord, Ken


    Building health research expertise in developing countries often requires personnel to receive training beyond national borders. For research funding agencies that sponsor this type of training, a major goal is to ensure that trainees return to their country of origin: attaining this objective requires the use of proactive strategies. The strategies described were developed under the extramural acquired immunodeficiency syndrome (AIDS) International Training and Research Program (AITRP) funded by the Fogarty International Center (FIC) at the National Institutes of Health, United States. This programme supports universities in the United States that provide research training to scientists from developing countries to enable them to address the global epidemic of human immunodeficiency virus (HIV)/AIDS and the related tuberculosis (TB) epidemic. This paper describes the strategies employed to discourage brain drain by the principle investigators (PIs) of five of the longest-funded AITRPs (funded for 15 years). Long-term trainees in these programmes spent from 11 to 96 months (an average of 26 months) studying. Using scientific, political and economic strategies that address brain drain issues, PIs working in AITRPs have attained an average rate of return home for their trainees of 80%. PMID:15375452

  17. Distinct roles of short and long thymic stromal lymphopoietin isoforms in house dust mite-induced asthmatic airway epithelial barrier disruption

    PubMed Central

    Dong, Hangming; Hu, Yahui; Liu, Laiyu; Zou, Mengchen; Huang, Chaowen; Luo, Lishan; Yu, Changhui; Wan, Xuan; Zhao, Haijin; Chen, JiaLong; Xie, Zhefan; Le, Yanqing; Zou, Fei; Cai, Shaoxi


    Loss of airway epithelial integrity contributes significantly to asthma pathogenesis. Thymic stromal lymphopoietin (TSLP) may have dual immunoregulatory roles. In inflammatory disorders of the bowel, the long isoform of TSLP (lfTSLP) promotes inflammation while the short isoform (sfTSLP) inhibits inflammation. We hypothesize that lfTSLP contributes to house dust mite (HDM)-induced airway epithelial barrier dysfunction and that synthetic sfTSLP can prevent these effects. In vitro, airway epithelial barrier function was assessed by monitoring transepithelial electrical resistance, fluorescent-dextran permeability, and distribution of E-cadherin and β-catenin. In vivo, BALB/c mice were exposed to HDM by nasal inhalation for 5 consecutive days per week to establish an asthma model. sfTSLP and 1α,25-Dihydroxyvitamin D3 (1,25D3) were administered 1 h before HDM exposure. After 8 weeks, animal lung function tests and pathological staining were performed to evaluate asthma progression. We found that HDM and lfTSLP impaired barrier function. Treatment with sfTSLP and 1,25D3 prevented HDM-induced airway epithelial barrier disruption. Moreover, sfTSLP and 1,25D3 treatment ameliorated HDM-induced asthma in mice. Our data emphasize the importance of the different expression patterns and biological properties of sfTSLP and lfTSLP. Moreover, our results indicate that sfTSLP and 1,25D3 may serve as novel therapeutic agents for individualized treatment of asthma. PMID:27996052

  18. MicroRNA-143 inhibits IL-13-induced dysregulation of the epidermal barrier-related proteins in skin keratinocytes via targeting to IL-13Rα1.


    Zeng, Yue-Ping; Nguyen, Giang Huong; Jin, Hong-Zhong


    Atopic dermatitis is a chronic inflammatory skin disease characterized by the dysregulation of the epidermal barrier and the immune system. Interleukin (IL)-13, a key T helper 2 cytokine, has been shown to impair the epidermal barrier function via downregulating epidermal barrier proteins. MicroRNAs are small noncoding RNAs of approximately 22 nucleotides that act as negative regulators of gene expression at posttranscriptional levels. MicroRNA-143 is known to be a tumor suppressor in various tumors; however, its role in the regulation of allergic diseases including atopic dermatitis remains elusive. In this study, we investigated whether IL-13Rα1 was a microRNA-143 target to regulate the effects of IL-13 on epidermal barrier function. After the stimulation of IL-13 in human epidermal keratinocytes, the level of microRNA-143 was decreased. The luciferase activity of the vector containing 3'UTR of IL-13Rα1 was decreased in keratinocytes transfected with microRNA-143 mimic compared to those of the corresponding controls. The forced expression of microRNA-143 mimic blocked the IL-13-induced downregulation of filaggrin, loricrin, and involucrin in epidermal keratinocytes. Collectively, these data suggest that microRNA-143 suppresses IL-13 activity and inflammation through targeting of IL-13Rα1 in epidermal keratinocytes. MicroRNA-143 may serve as a potential preventive and therapeutic target in atopic dermatitis.

  19. Degradation of drained peat soils in Belarus

    NASA Astrophysics Data System (ADS)

    Bambalov, N. N.


    According to Belarusian classification, the drained peat soils with peat layer less then 30 cm and containing organic substance less then 50% are degraded soils. Degraded peat soils made up 190.2 thousand hectares in 2001 from a total area of 1062,2 thousand hectares of drained peat soils for agriculture in Belarus, but the process of degradation is prolonging now and it is expected, that their area will be extended additionally on 12 % till 2020. The degradation of peat soils is most widespread in the region of Polesie, where the area of degraded soils makes up already several thousand hectares in some administrative districts. The degradation of peat soils takes place jet locally on the comparatively not big plots but on the very many places. There is the threat of joining up of the existing now spots of degraded soils in the near future, and the new spots of degraded soils will appear in a very big amount as well. The large tracts of land will appear in the nearest 20-30 years and may be earlier. The degradation of drained peat soils proceeds step by step, and three morphological groups of new soils are forming depending on degree of humification of organic matter, namely: raw humic, humus-fibrous and humus peat soils. The complicated soil complexes with many alternating soil plots containing organic substance both more than 50 % and from 2 till 50 % are forming within one field in result of degradation. For the reason given above a rather not uniform structure of soil cover with unsatisfactory micro relief, big differences of aquatic, thermal and nutritious regimes is forming on agricultural fields, that leads to the substantial decrease of their productivity. In this connection big expanses will require to the rearrangement of drainage systems and leveling of soil fertility within every such field. A fertility of drained peat soils with the depth of peat layer more then 1 m has been estimated as 69 points, with the depth of peat layer 0.3-0.5 m as 62 points

  20. Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2.


    Eum, Sung Yong; Jaraki, Dima; András, Ibolya E; Toborek, Michal


    Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2',4,4',5,5'-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs.

  1. Glutamine supplementation attenuates ethanol-induced disruption of apical junctional complexes in colonic epithelium and ameliorates gut barrier dysfunction and fatty liver in mice.


    Chaudhry, Kamaljit K; Shukla, Pradeep K; Mir, Hina; Manda, Bhargavi; Gangwar, Ruchika; Yadav, Nikki; McMullen, Megan; Nagy, Laura E; Rao, RadhaKrishna


    Previous in vitro studies showed that glutamine (Gln) prevents acetaldehyde-induced disruption of tight junctions and adherens junctions in Caco-2 cell monolayers and human colonic mucosa. In the present study, we evaluated the effect of Gln supplementation on ethanol-induced gut barrier dysfunction and liver injury in mice in vivo. Ethanol feeding caused a significant increase in inulin permeability in distal colon. Elevated permeability was associated with a redistribution of tight junction and adherens junction proteins and depletion of detergent-insoluble fractions of these proteins, suggesting that ethanol disrupts apical junctional complexes in colonic epithelium and increases paracellular permeability. Ethanol-induced increase in colonic mucosal permeability and disruption of junctional complexes were most severe in mice fed Gln-free diet. Gln supplementation attenuated ethanol-induced mucosal permeability and disruption of tight junctions and adherens junctions in a dose-dependent manner, indicating the potential role of Gln in nutritional intervention to alcoholic tissue injury. Gln supplementation dose-dependently elevated reduced-protein thiols in colon without affecting the level of oxidized-protein thiols. Ethanol feeding depleted reduced protein thiols and elevated oxidized protein thiols. Ethanol-induced protein thiol oxidation was most severe in mice fed with Gln-free diet and absent in mice fed with Gln-supplemented diet, suggesting that antioxidant effect is one of the likely mechanisms involved in Gln-mediated amelioration of ethanol-induced gut barrier dysfunction. Ethanol feeding elevated plasma transaminase and liver triglyceride, which was accompanied by histopathologic lesions in the liver; ethanol-induced liver damage was attenuated by Gln supplementation. These results indicate that Gln supplementation ameliorates alcohol-induced gut and liver injury.

  2. Glutamine Supplementation Attenuates Ethanol-Induced Disruption of Apical Junctional Complexes in Colonic Epithelium and Ameliorates Gut Barrier Dysfunction and Fatty Liver in Mice

    PubMed Central

    Chaudhry, Kamaljit K.; Shukla, Pradeep K.; Mir, Hina; Manda, Bhargavi; Gangwar, Ruchika; Yadav, Nikki; McMullen, Megan; Nagy, Laura E.; Rao, RadhaKrishna


    Previous in vitro studies showed that glutamine (Gln) prevents acetaldehyde-induced disruption of tight junctions and adherens junctions in Caco-2 cell monolayers and human colonic mucosa. In the present study, we evaluated the effect of Gln supplementation on ethanol-induced gut barrier dysfunction and liver injury in mice in vivo. Ethanol feeding caused a significant increase in inulin permeability in distal colon. Elevated permeability was associated with a redistribution of tight junction and adherens junction proteins and depletion of detergent-insoluble fractions of these proteins, suggesting that ethanol disrupts apical junctional complexes in colonic epithelium and increases paracellular permeability. Ethanol-induced increase in colonic mucosal permeability and disruption of junctional complexes were most severe in mice fed Gln-free diet. Gln supplementation attenuated ethanol-induced mucosal permeability and disruption of tight junctions and adherens junctions in a dose-dependent manner, indicating the potential role of glutamine in nutritional intervention to alcoholic tissue injury. Gln supplementation dose-dependently elevated reduced-protein thiols in colon without affecting the level of oxidized-protein thiols. Ethanol feeding depleted reduced protein thiols and elevated oxidized protein thiols. Ethanol-induced protein thiol oxidation was most severe in mice fed Gln-free diet and absent in mice fed Gln-supplemented diet, suggesting that antioxidant effect is one of the likely mechanisms involved in Gln-mediated amelioration of ethanol-induced gut barrier dysfunction. Ethanol feeding elevated plasma transaminase and liver triglyceride, which was accompanied by histopathologic lesions in the liver; ethanol-induced liver damage was attenuated by Gln supplementation. These results indicate that Gln supplementation ameliorates alcohol-induced gut and liver injury. PMID:26365579

  3. Localized Down-regulation of P-glycoprotein by Focused Ultrasound and Microbubbles induced Blood-Brain Barrier Disruption in Rat Brain

    PubMed Central

    Cho, HongSeok; Lee, Hwa-Youn; Han, Mun; Choi, Jong-ryul; Ahn, Sanghyun; Lee, Taekwan; Chang, Yongmin; Park, Juyoung


    Multi-drug resistant efflux transporters found in Blood-Brain Barrier (BBB) acts as a functional barrier, by pumping out most of the drugs into the blood. Previous studies showed focused ultrasound (FUS) induced microbubble oscillation can disrupt the BBB by loosening the tight junctions in the brain endothelial cells; however, no study was performed to investigate its impact on the functional barrier of the BBB. In this study, the BBB in rat brains were disrupted using the MRI guided FUS and microbubbles. The immunofluorescence study evaluated the expression of the P-glycoprotein (P-gp), the most dominant multi-drug resistant protein found in the BBB. Intensity of the P-gp expression at the BBB disruption (BBBD) regions was significantly reduced (63.2 ± 18.4%) compared to the control area. The magnitude of the BBBD and the level of the P-gp down-regulation were significantly correlated. Both the immunofluorescence and histologic analysis at the BBBD regions revealed no apparent damage in the brain endothelial cells. The results demonstrate that the FUS and microbubbles can induce a localized down-regulation of P-gp expression in rat brain. The study suggests a clinically translation of this method to treat neural diseases through targeted delivery of the wide ranges of brain disorder related drugs. PMID:27510760

  4. Localized Down-regulation of P-glycoprotein by Focused Ultrasound and Microbubbles induced Blood-Brain Barrier Disruption in Rat Brain

    NASA Astrophysics Data System (ADS)

    Cho, Hongseok; Lee, Hwa-Youn; Han, Mun; Choi, Jong-Ryul; Ahn, Sanghyun; Lee, Taekwan; Chang, Yongmin; Park, Juyoung


    Multi-drug resistant efflux transporters found in Blood-Brain Barrier (BBB) acts as a functional barrier, by pumping out most of the drugs into the blood. Previous studies showed focused ultrasound (FUS) induced microbubble oscillation can disrupt the BBB by loosening the tight junctions in the brain endothelial cells; however, no study was performed to investigate its impact on the functional barrier of the BBB. In this study, the BBB in rat brains were disrupted using the MRI guided FUS and microbubbles. The immunofluorescence study evaluated the expression of the P-glycoprotein (P-gp), the most dominant multi-drug resistant protein found in the BBB. Intensity of the P-gp expression at the BBB disruption (BBBD) regions was significantly reduced (63.2 ± 18.4%) compared to the control area. The magnitude of the BBBD and the level of the P-gp down-regulation were significantly correlated. Both the immunofluorescence and histologic analysis at the BBBD regions revealed no apparent damage in the brain endothelial cells. The results demonstrate that the FUS and microbubbles can induce a localized down-regulation of P-gp expression in rat brain. The study suggests a clinically translation of this method to treat neural diseases through targeted delivery of the wide ranges of brain disorder related drugs.

  5. Acoustic cavitation-based monitoring of the reversibility and permeability of ultrasound-induced blood-brain barrier opening

    NASA Astrophysics Data System (ADS)

    Sun, Tao; Samiotaki, Gesthimani; Wang, Shutao; Acosta, Camilo; Chen, Cherry C.; Konofagou, Elisa E.


    Cavitation events seeded by microbubbles have been previously reported to be associated with MR- or fluorescent-contrast enhancement after focused ultrasound (FUS)-induced blood-brain barrier (BBB) opening. However, it is still unknown whether bubble activity can be correlated with the reversibility (the duration of opening and the likelihood of safe reinstatement) and the permeability of opened BBB, which is critical for the clinical translation of using passive cavitation detection to monitor, predict and control the opening. In this study, the dependence of acoustic cavitation on the BBB opening duration, permeability coefficient and histological damage occurrence were thus investigated. Transcranial pulsed FUS at 1.5 MHz in the presence of systemically circulating microbubbles was applied in the mouse hippocampi (n  =  60). The stable and inertial cavitation activities were monitored during sonication. Contrast-enhanced MRI was performed immediately after sonication and every 24 h up to 6 d thereafter, to assess BBB opening, brain tissue permeability and potential edema. Histological evaluations were used to assess the occurrence of neurovascular damages. It was found that stable cavitation was well correlated with: (1) the duration of the BBB opening (r2  =  0.77) (2) the permeability of the opened BBB (r2  =  0.82) (3) the likelihood of safe opening (P  <  0.05, safe opening compared to cases of damage; P  <  0.0001, no opening compared to safe opening). The inertial cavitation dose was correlated with the resulting BBB permeability (r2  =  0.72). Stable cavitation was found to be more reliable than inertial cavitation at assessing the BBB opening within the pressure range used in this study. This study demonstrates that the stable cavitation response during BBB opening holds promise for predicting and controlling the restoration and pharmacokinetics of FUS-opened BBB. The stable cavitation response therefore

  6. Focused ultrasound-induced blood-brain barrier opening for non-viral, non-invasive, and targeted gene delivery.


    Lin, Chung-Yin; Hsieh, Han-Yi; Pitt, William G; Huang, Chiung-Yin; Tseng, I-Chou; Yeh, Chih-Kuang; Wei, Kuo-Chen; Liu, Hao-Li


    Focused ultrasound (FUS) exposure in the presence of microbubbles can temporally open the blood-brain barrier (BBB) and is an emerging technique for non-invasive brain therapeutic agent delivery. Given the potential to deliver large molecules into the CNS via this technique, we propose a reliable strategy to synergistically apply FUS-BBB opening for the non-invasive and targeted delivery of non-viral genes into the CNS for therapeutic purpose. In this study, we developed a gene-liposome system, in which the liposomes are designed to carry plasmid DNA (pDNA, containing luciferase reporter gene) to form a liposomal-plasmid DNA (LpDNA) complex. Pulsed FUS exposure was delivered to induce BBB opening (500-kHz, burst length=10ms, 1% duty cycle, PRF=1Hz). The longitudinal expression of luciferase was quantitated via an in vivo imaging system (IVIS). The reporter gene expression level was confirmed via immunoblotting, and histological staining was used to identify transfected cells via fluorescent microscopy. In a comparison of gene transduction efficiency, the LpDNA system showed better cell transduction than the pDNA system. With longitudinal observation of IVIS monitoring, animals with FUS treatment showed significant promotion of LpDNA release into the CNS and demonstrated enhanced expression of genes upon sonication with FUS-BBB opening, while both the luciferase and GDNF protein expression were successfully measured via Western blotting. The gene expression peak was observed at day 2, and the gene expression level was up to 5-fold higher than that in the untreated hemisphere (compared to a 1-fold increase in the direct-inject positive-control group). The transfection efficiency was also found to be LpDNA dose-dependent, where higher payloads of pDNA resulted in a higher transfection rate. Immunoblotting and histological staining confirmed the expression of reporter genes in glial cells as well as astrocytes. This study suggests that IV administration of LpDNA in

  7. Acoustic cavitation-based monitoring of the reversibility and permeability of ultrasound-induced blood-brain barrier opening.


    Sun, Tao; Samiotaki, Gesthimani; Wang, Shutao; Acosta, Camilo; Chen, Cherry C; Konofagou, Elisa E


    Cavitation events seeded by microbubbles have been previously reported to be associated with MR- or fluorescent-contrast enhancement after focused ultrasound (FUS)-induced blood-brain barrier (BBB) opening. However, it is still unknown whether bubble activity can be correlated with the reversibility (the duration of opening and the likelihood of safe reinstatement) and the permeability of opened BBB, which is critical for the clinical translation of using passive cavitation detection to monitor, predict and control the opening. In this study, the dependence of acoustic cavitation on the BBB opening duration, permeability coefficient and histological damage occurrence were thus investigated. Transcranial pulsed FUS at 1.5 MHz in the presence of systemically circulating microbubbles was applied in the mouse hippocampi (n  =  60). The stable and inertial cavitation activities were monitored during sonication. Contrast-enhanced MRI was performed immediately after sonication and every 24 h up to 6 d thereafter, to assess BBB opening, brain tissue permeability and potential edema. Histological evaluations were used to assess the occurrence of neurovascular damages. It was found that stable cavitation was well correlated with: (1) the duration of the BBB opening (r(2)  =  0.77); (2) the permeability of the opened BBB (r(2)  =  0.82); (3) the likelihood of safe opening (P  <  0.05, safe opening compared to cases of damage; P  <  0.0001, no opening compared to safe opening). The inertial cavitation dose was correlated with the resulting BBB permeability (r(2)  =  0.72). Stable cavitation was found to be more reliable than inertial cavitation at assessing the BBB opening within the pressure range used in this study. This study demonstrates that the stable cavitation response during BBB opening holds promise for predicting and controlling the restoration and pharmacokinetics of FUS-opened BBB. The stable cavitation response

  8. Bacterial diversity of floor drain biofilms and drain waters in a Listeria monocytogenes contaminated food processing environment.


    Dzieciol, Monika; Schornsteiner, Elisa; Muhterem-Uyar, Meryem; Stessl, Beatrix; Wagner, Martin; Schmitz-Esser, Stephan


    Sanitation protocols are applied on a daily basis in food processing facilities to prevent the risk of cross-contamination with spoilage organisms. Floor drain water serves along with product-associated samples (slicer dust, brine or cheese smear) as an important hygiene indicator in monitoring Listeria monocytogenes in food processing facilities. Microbial communities of floor drains are representative for each processing area and are influenced to a large degree by food residues, liquid effluents and washing water. The microbial communities of drain water are steadily changing, whereas drain biofilms provide more stable niches. Bacterial communities of four floor drains were characterized using 16S rRNA gene pyrosequencing to better understand the composition and exchange of drain water and drain biofilm communities. Furthermore, the L. monocytogenes contamination status of each floor drain was determined by applying cultivation-independent real-time PCR quantification and cultivation-dependent detection according to ISO11290-1. Pyrosequencing of 16S rRNA genes of drain water and drain biofilm bacterial communities yielded 50,611 reads, which were clustered into 641 operational taxonomic units (OTUs), affiliated to 16 phyla dominated by Proteobacteria, Firmicutes and Bacteroidetes. The most abundant OTUs represented either product- (Lactococcus lactis) or fermentation- and food spoilage-associated phylotypes (Pseudomonas mucidolens, Pseudomonas fragi, Leuconostoc citreum, and Acetobacter tropicalis). The microbial communities in DW and DB samples were distinct in each sample type and throughout the whole processing plant, indicating the presence of indigenous specific microbial communities in each processing compartment. The microbiota of drain biofilms was largely different from the microbiota of the drain water. A sampling approach based on drain water alone may thus only provide reliable information on planktonic bacterial cells but might not allow conclusions

  9. Pesticide residues in agricultural drains, southeastern desert area, California

    USGS Publications Warehouse

    Eccles, Lawrence A.


    A study is being made to determine the occurrence and distribution of pesticides in the agricultural drains for approximately 3/4 million irrigated acres in the southeastern desert area of California. This report describes the results of the first year of sampling and analyzing (1) water in the drains , (2) bed material in the drains, (3) water from field tile-drainage lines, and (4) irrigation tailwater and water in the drains directly exposed to drift from aerial application of pesticides. Residues of almost all the pesticides selected for monitoring were found in water in the drains. Examination of the data to determine the probable source of pesticides indicated generally slight concentrations from bed material in the drains, usually no detectable concentrations from field tile-drainage lines, and apparently large concentrations from irrigation tailwater and drift from aerial application. (Woodard-USGS)

  10. Coupled-channel effects in elastic scattering and near-barrier fusion induced by weakly bound nuclei and exotic halo nuclei

    SciTech Connect

    Beck, C.; Keeley, N.


    The influence on fusion of coupling to the breakup process is investigated for reactions where at least one of the colliding nuclei has a sufficiently low binding energy for breakup to become an important process. Elastic scattering, excitation functions for sub- and near-barrier fusion cross sections, and breakup yields are analyzed for {sup 6,7}Li+{sup 59}Co. Continuum-discretized coupled-channels (CDCC) calculations describe well the data at and above the barrier. Elastic scattering with {sup 6}Li (as compared to {sup 7}Li) indicates the significant role of breakup for weakly bound projectiles. A study of {sup 4,6}He induced fusion reactions with a three-body CDCC method for the {sup 6}He halo nucleus is presented. The relative importance of breakup and bound-state structure effects on total fusion is discussed.

  11. Lung endothelial barrier protection by resveratrol involves inhibition of HMGB1 release and HMGB1-induced mitochondrial oxidative damage via an Nrf2-dependent mechanism.


    Dong, Wen-Wen; Liu, Yu-Jian; Lv, Zhou; Mao, Yan-Fei; Wang, Ying-Wei; Zhu, Xiao-Yan; Jiang, Lai


    High-mobility group box 1 (HMGB1) contributes to lung vascular hyperpermeability during ventilator-induced lung injury. We aimed to determine whether the natural antioxidant resveratrol protected against HMGB1-induced endothelial hyperpermeability both in vitro and in vivo. We found that HMGB1 decreased vascular endothelial (VE)-cadherin expression and increased endothelial permeability, leading to mitochondrial oxidative damage in primary cultured mouse lung vascular endothelial cells (MLVECs). Both the mitochondrial superoxide dismutase 2 mimetic MnTBAP and resveratrol blocked HMGB1-induced mitochondrial oxidative damage, VE-cadherin downregulation, and endothelial hyperpermeability. In in vivo studies, anesthetized male ICR mice were ventilated for 4h using low tidal volume (6 ml/kg) or high tidal volume (HVT; 30 ml/kg) ventilation. The mice were injected intraperitoneally with resveratrol immediately before the onset of ventilation. We found that resveratrol attenuated HVT-associated lung vascular hyperpermeability and HMGB1 production. HVT caused a significant increase in nuclear factor-erythroid 2-related factor 2 (Nrf2) nuclear translocation and Nrf2 target gene expression in lung tissues, which was further enhanced by resveratrol treatment. HMGB1 had no effect on Nrf2 activation, whereas resveratrol treatment activated the Nrf2 signaling pathway in HMGB1-treated MLVECs. Moreover, Nrf2 knockdown reversed the inhibitory effects of resveratrol on HMGB1-induced mitochondrial oxidative damage and endothelial hyperpermeability. The inhibitory effect of resveratrol on cyclic stretch-induced HMGB1 mRNA expression in primary cultured MLVECs was also abolished by Nrf2 knockdown. In summary, this study demonstrates that resveratrol protects against lung endothelial barrier dysfunction initiated by HVT. Lung endothelial barrier protection by resveratrol involves inhibition of mechanical stretch-induced HMGB1 release and HMGB1-induced mitochondrial oxidative damage

  12. Coronary Artery Fistula Draining into the Left Ventricle

    PubMed Central

    Sohn, Jihyun; Jang, Jeong Yoon; Sun, Byung Joo; Kim, Dae-Hee; Kang, Duk-Hyun; Song, Jae-Kwan


    We present a case of 48-year-old male who presented with coronary artery fistula draining into left ventricle. Transthoracic echocardiography showed abnormal blood flow draining into left ventricle, with enlarged coronary arteries and multiple vascular structures around ventricular myocardium. Coronary computed tomography revealed dilatation of entire left coronary artery which was wrapping around left ventricle, and draining into the posterior side of left ventricle. He did not undergo any invasive treatment, because he was not symptomatic. PMID:24753806

  13. Thermokarst lakes, drainage, and drained basins

    USGS Publications Warehouse

    Grosse, G.; Jones, B.; Arp, C.; Shroder, John F.


    Thermokarst lakes and drained lake basins are widespread in Arctic and sub-Arctic permafrost lowlands with ice-rich sediments. Thermokarst lake formation is a dominant mode of permafrost degradation and is linked to surface disturbance, subsequent melting of ground ice, surface subsidence, water impoundment, and positive feedbacks between lake growth and permafrost thaw, whereas lake drainage generally results in local permafrost aggradation. Thermokarst lakes characteristically have unique limnological, morphological, and biogeochemical characteristics that are closely tied to cold-climate conditions and permafrost properties. Thermokarst lakes also have a tendency toward complete or partial drainage through permafrost degradation and erosion. Thermokarst lake dynamics strongly affect the development of landscape geomorphology, hydrology, and the habitat characteristic of permafrost lowlands.

  14. Acoustic metric of the compressible draining bathtub

    SciTech Connect

    Cherubini, C.; Filippi, S.


    The draining bathtub flow, a cornerstone in the theory of acoustic black holes, is here extended to the case of exact solutions for compressible nonviscous flows characterized by a polytropic equation of state. Investigating the analytical configurations obtained for selected values of the polytropic index, it is found that each of them becomes nonphysical at the so called limiting circle. By studying the null geodesics structure of the corresponding acoustic line elements, it is shown that such a geometrical locus coincides with the acoustic event horizon. This region is characterized also by an infinite value of space-time curvature, so the acoustic analogy breaks down there. Possible applications for artificial and natural vortices are finally discussed.

  15. Drain Current Model for Double Gate (DG) p-n-i-n TFET: Accumulation to Inversion Region of Operation

    NASA Astrophysics Data System (ADS)

    Upasana; Narang, Rakhi; Saxena, Manoj; Gupta, Mridula


    In this paper, drain current model has been formulated for Double Gate (DG) p-n-i-n Tunnel FET (TFET) using Lambert-W function. The model includes the impact of mobile charges, gate dielectric thickness (tox) and channel thickness (tsi) on quasi fermi level, gate threshold voltage (VTG), onset voltage (VGonset) and Tunneling Barrier Width (TBW) over the entire operating range i.e. accumulation to inversion state. Important electrostatic and electrical parameters such as the effective potential (φeffective) at the center of the channel, 2-D channel potential, electric field, energy band profile and Tunneling Barrier Width (TBW) dependent drain current have been modeled. Moreover, gate and drain bias controllability in different operating regimes has also been investigated by varying oxide thickness (tox), channel thickness (tsi), intrinsic channel length (Lint) and at different temperatures. Important FOMs required for analog circuit performance such as transconductance (gm), drain conductance (gd), output resistance (Rout), early voltage (VEA) have also been evaluated and verified using ATLAS device simulation software.

  16. Minimally invasive surgical technique for tethered surgical drains

    PubMed Central

    Hess, Shane R; Satpathy, Jibanananda; Waligora, Andrew C; Ugwu-Oju, Obinna


    A feared complication of temporary surgical drain placement is from the technical error of accidentally suturing the surgical drain into the wound. Postoperative discovery of a tethered drain can frequently necessitate return to the operating room if it cannot be successfully removed with nonoperative techniques. Formal wound exploration increases anesthesia and infection risk as well as cost and is best avoided if possible. We present a minimally invasive surgical technique that can avoid the morbidity associated with a full surgical wound exploration to remove a tethered drain when other nonoperative techniques fail.

  17. Vitamin D/VDR signaling attenuates lipopolysaccharide‑induced acute lung injury by maintaining the integrity of the pulmonary epithelial barrier.


    Shi, Yong-Yan; Liu, Tian-Jing; Fu, Jian-Hua; Xu, Wei; Wu, Lin-Lin; Hou, A-Na; Xue, Xin-Dong


    Vitamin D and its receptor have a protective effect on epithelial barriers in various tissues. Low levels of vitamin D are associated with numerous pulmonary diseases, including acute lung injury (ALI) and acute respiratory distress syndrome. The present study investigated whether the vitamin D/vitamin D receptor (VDR) pathway may ameliorate lipopolysaccharide (LPS)‑induced ALI through maintaining the integrity of the alveolar epithelial barrier. This was investigated by exposing wild‑type (WT) and VDR knockout C57BL/6J mice to LPS, then comparing the healthy and LPS‑treated mice lungs and bronchoalveolar lavage fluid (BALF). More specifically, lung histology, mRNA levels of proinflammatory cytokines and chemokines, and protein expression levels of tight junction proteins were determined. In addition, a vitamin D analog (paricalcitol) was administered to WT mice in order to investigate the effect of vitamin D on the alveolar epithelial barrier following exposure to LPS. VDR knockout mice exhibited severe lung injuries (P<0.001), increased alveolar permeability [demonstrated by a higher wet‑dry ratio of lung weight (P<0.05), greater expression levels of BALF protein (P<0.001) and fluorescein isothiocyanate‑conjugated 4 kDa dextran (P<0.001) leakage into the alveolar space], elevated proinflammatory cytokine and chemokine mRNA levels, as demonstrated by reverse transcription‑quantitative polymerase chain reaction (P<0.05), and decreased protein and mRNA expression levels of occludin (P<0.01) and zonula occludens‑1 (ZO‑1; P<0.01) compared with WT mice. Paricalcitol treatment partially inhibited these pathological changes in WT mice by maintaining the mRNA and protein expression levels of occludin (P<0.01) and ZO‑1 (P<0.05). A lack of VDRs in the pulmonary epithelial barrier appeared to compromise its defense, leading to more severe LPS‑induced lung injury. Furthermore, vitamin D treatment alleviated LPS‑induced lung injury and preserved alveolar

  18. Vortex-induced phase slip dissipation in a torioidal Bose-Einstein condensate flowing through a barrier

    SciTech Connect

    Collins, Lee A


    We study the phase slips superfluid dissipation mechanism with a BEC flowing through a repulsive barrier inside a torus. The barrier is adiabatically raised across the annulus while the condensate is flowing with a finite quantized angular momentum. We found that, at a critical height, a vortex reaches the barrier moving radially from the inner region to eventually circulate along the annulus. At a slightly higher barrier, an anti-vortex also enters into the annulus from the outward region. The vortex and anti-vortex decrease the total angular momentum by leaving behind their respective paths a 2{pi} phase slip. When they collide or orbit along the same loop, the condensate suffers a global 2{pi} phase slip and the total angular momentum decreases by one quantum. The analysis is based on numerical simulations of the dynamical Gross-Pitaevskii equation both in two- and three-dimensions, the latter with the experimental parameters of the torus trap recently created at the NIST institute.

  19. Prolonged Morphine Exposure Induces Increased Firm Adhesion in an in Vitro Model of the Blood–Brain Barrier

    PubMed Central

    Strazza, Marianne; Pirrone, Vanessa; Wigdahl, Brian; Dampier, Will; Lin, Wei; Feng, Rui; Maubert, Monique E.; Weksler, Babette; Romero, Ignacio A.; Couraud, Pierre-Olivier; Nonnemacher, Michael R.


    The blood–brain barrier (BBB) has been defined as a critically important protective barrier that is involved in providing essential biologic, physiologic, and immunologic separation between the central nervous system (CNS) and the periphery. Insults to the BBB can cause overall barrier damage or deregulation of the careful homeostasis maintained between the periphery and the CNS. These insults can, therefore, yield numerous phenotypes including increased overall permeability, interendothelial gap formation, alterations in cytokine and chemokine secretion, and accelerated cellular passage. The current studies expose the human brain microvascular endothelial cell line, hCMEC/D3, to prolonged morphine exposure and aim to uncover the mechanisms underlying alterations in barrier function in vitro. These studies show alterations in the mRNA and protein levels of the cellular adhesion molecules (CAMs) intercellular adhesion molecule-1, vascular cell adhesion molecule-1, and activated leukocyte cell adhesion molecule that correlate with an increased firm adhesion of the CD3+ subpopulation of peripheral blood mononuclear cells (PBMCs). Overall, these studies suggest that prolonged morphine exposure may result in increased cell migration into the CNS, which may accelerate pathological processes in many diseases that involve the BBB. PMID:27294916

  20. Corneodesmosin gene ablation induces lethal skin-barrier disruption and hair-follicle degeneration related to desmosome dysfunction.


    Leclerc, Emilie A; Huchenq, Anne; Mattiuzzo, Nicolas R; Metzger, Daniel; Chambon, Pierre; Ghyselinck, Norbert B; Serre, Guy; Jonca, Nathalie; Guerrin, Marina


    Corneodesmosin (CDSN) is specific to desmosomes of epithelia undergoing cornification, mainly the epidermis and the inner root sheath of the hair follicles. CDSN nonsense mutations are associated with hypotrichosis simplex of the scalp, a rare disease that leads to complete baldness in young adults. CDSN displays adhesive properties, mostly attributable to its N-terminal glycine-rich domain, and is sequentially proteolyzed as corneocytes migrate towards the skin surface. K14-promoter driven Cre-mediated deletion of Cdsn in mice resulted in neonatal death as a result of epidermal tearing upon minor mechanical stress. Ultrastructural analyses revealed a desmosomal break at the interface between the living and cornified layers. After grafting onto nude mice, knockout skin showed a chronic defect in the epidermal permeability barrier. The epidermis was first hyperproliferative with a thick cornified layer, then, both the epidermis and the hair follicles degenerated. In adults, Cdsn deletion resulted in similar histological abnormalities and in a lethal barrier defect. We demonstrate that Cdsn is not essential for skin-barrier formation in utero, but is vital throughout life to preserve this barrier by maintaining desmosome integrity. The strong adhesive function that the protein confers on corneodesmosomes also seems necessary for maintaining the architecture of the hair follicle.

  1. Recessed insulator and barrier AlGaN/GaN HEMT: A novel structure for improving DC and RF characteristics

    NASA Astrophysics Data System (ADS)

    Razavi, S. M.; Zahiri, S. H.; Hosseini, S. E.


    In this study, a gallium nitride (GaN) high electron mobility transistor (HEMT) with recessed insulator and barrier is reported. In the proposed structure, insulator is recessed into the barrier at the drain side and barrier is recessed into the buffer layer at the source side. We study important device characteristics such as electric field, breakdown voltage, drain current, maximum output power density, gate-drain capacitance, short channel effects and DC transconductance using two-dimensional and two-carrier device simulator. Recessed insulator in the drain side of the proposed structure reduces maximum electric field in the channel and therefore increases the breakdown voltage and maximum output power density compared to the conventional counterpart. Also, gate-drain capacitance value in the proposed structure is less than that of the conventional structure. Overall, the proposed structure reduces short channel effects. Because of the recessed regions at both the source and the drain sides, the average barrier thickness of the proposed structure is not changed. Thus, the drain current of the proposed structure is almost equivalent to that of the conventional transistor. In this work, length ( L r) and thickness ( T r) of the recessed region of the barrier at the source side are the same as those of the insulator at the drain side.

  2. Generation of airborne Listeria innocua from model floor drains.


    Berrang, Mark E; Frank, Joseph F


    Listeria monocytogenes can colonize floor drains in poultry processing and further processing facilities, remaining present even after cleaning and disinfection. Therefore, during wash down, workers exercise caution to avoid spraying hoses directly into drains in an effort to prevent the escape and transfer of drain microflora to food contact surfaces. The objective of this study was to examine the extent to which an inadvertent water spray into a colonized floor drain can cause the spread of airborne Listeria. Listeria innocua was used to inoculate a polyvinyl chloride model floor drain, resulting in approximately 10(8) cells per ml of phosphate-buffered saline and 10(4) attached cells per square centimeter of inner surface. Each model drain was subjected to a 2-s spray of tap water at 68.9 kPa from a distance of 1 m. Drains were sprayed while filled and again after emptying. Airborne cells were collected by using sedimentation plates containing Listeria selective agar which were placed on the floor and walls of a contained room at incremental horizontal and vertical distances of 0.6, 1.2, 2.4, or 4.0 m from the drain. Sedimentation plates were exposed for 10 min. A mechanical sampler was used to also collect air by impaction on the surface of Listeria selective agar to determine the number of cells per liter of air. The experiment was conducted in triplicate rooms for each of four replications. L. innocua was detected on sedimentation plates on the floor as far as 4.0 m from the drain and on walls as high as 2.4 m above the floor and 4 m from the drain. A 2-s spray with a water hose into a contaminated drain can cause airborne spread of Listeria, resulting in the potential for cross-contamination of food contact surfaces, equipment, and exposed product.

  3. Vehicle barrier


    Hirsh, Robert A.


    A vehicle security barrier which can be conveniently placed across a gate opening as well as readily removed from the gate opening to allow for easy passage. The security barrier includes a barrier gate in the form of a cable/gate member in combination with laterally attached pipe sections fixed by way of the cable to the gate member and lateral, security fixed vertical pipe posts. The security barrier of the present invention provides for the use of cable restraints across gate openings to provide necessary security while at the same time allowing for quick opening and closing of the gate areas without compromising security.

  4. Dielectric barrier discharges with steep voltage rise: mapping of atomic nitrogen in single filaments measured by laser-induced fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Lukas, C.; Spaan, M.; Schulz-von der Gathen, V.; Thomson, M.; Wegst, R.; Döbele, H. F.; Neiger, M.


    Space and time resolved relative atomic density distributions of nitrogen have been measured for the first time at a single filament within a dielectric barrier discharge (DBD) reactor with submillimetre radial dimensions. Two-photon-Absorption Laser-Induced Fluorescence (TALIF) spectroscopy of atomic nitrogen using radiation at λ = 206.7 nm is applied to a DBD with fast rising voltage amplitudes. The decay time of the atomic nitrogen density depends strongly on the position within the discharge and the distance from the dielectric where the lifetime is maximum. Admixed oxygen leads to an increase of the N density decay by an order of magnitude even at small fractions.

  5. Metformin induces up-regulation of blood-brain barrier functions by activating AMP-activated protein kinase in rat brain microvascular endothelial cells.


    Takata, Fuyuko; Dohgu, Shinya; Matsumoto, Junichi; Machida, Takashi; Kaneshima, Shuji; Matsuo, Mai; Sakaguchi, Shinya; Takeshige, Yuki; Yamauchi, Atsushi; Kataoka, Yasufumi


    Blood-brain barrier (BBB) disruption occurs frequently in CNS diseases and injuries. Few drugs have been developed as therapeutic candidates for facilitating BBB functions. Here, we examined whether metformin up-regulates BBB functions using rat brain microvascular endothelial cells (RBECs). Metformin, concentration- and time-dependently increased transendothelial electrical resistance of RBEC monolayers, and decreased RBEC permeability to sodium fluorescein and Evans blue albumin. These effects of metformin were blocked by compound C, an inhibitor of AMP-activated protein kinase (AMPK). AMPK stimulation with an AMPK activator, AICAR, enhanced BBB functions. These findings indicate that metformin induces up-regulation of BBB functions via AMPK activation.

  6. Restructuring brain drain: strengthening governance and financing for health worker migration

    PubMed Central

    Mackey, Tim K.; Liang, Bryan A.


    Background Health worker migration from resource-poor countries to developed countries, also known as ‘‘brain drain’’, represents a serious global health crisis and a significant barrier to achieving global health equity. Resource-poor countries are unable to recruit and retain health workers for domestic health systems, resulting in inadequate health infrastructure and millions of dollars in healthcare investment losses. Methods Using acceptable methods of policy analysis, we first assess current strategies aimed at alleviating brain drain and then propose our own global health policy based solution to address current policy limitations. Results Although governments and private organizations have tried to address this policy challenge, brain drain continues to destabilise public health systems and their populations globally. Most importantly, lack of adequate financing and binding governance solutions continue to fail to prevent health worker brain drain. Conclusions In response to these challenges, the establishment of a Global Health Resource Fund in conjunction with an international framework for health worker migration could create global governance for stable funding mechanisms encourage equitable migration pathways, and provide data collection that is desperately needed. PMID:23336617

  7. B cells populating the multiple sclerosis brain mature in the draining cervical lymph nodes

    PubMed Central

    Stern, Joel N. H.; Yaari, Gur; Vander Heiden, Jason A.; Church, George; Donahue, William F.; Hintzen, Rogier Q.; Huttner, Anita J.; Laman, Jon D.; Nagra, Rashed M.; Nylander, Alyssa; Pitt, David; Ramanan, Sriram; Siddiqui, Bilal A.; Vigneault, Francois; Kleinstein, Steven H.; Hafler, David A.; O’Connor, Kevin C.


    Multiple sclerosis (MS) is an inflammatory disease of the central nervous system (CNS) characterized by autoimmune mediated demyelination and neurodegeneration. The CNS of patients with MS harbors expanded clones of antigen-experienced B cells that reside in distinct compartments including the meninges, cerebrospinal fluid (CSF) and parenchyma. It is not understood whether this immune infiltrate initiates its development in the CNS or in peripheral tissues. B cells in the CSF can exchange with those in peripheral blood, implying that CNS B cells may have access to lymphoid tissue that may be the specific compartment(s) in which CNS resident B cells encounter antigen and experience affinity maturation. In this study, paired tissues were used to determine whether the B cells that populate the CNS mature in the draining cervical lymph nodes (CLNs). High-throughput sequencing of the antibody repertoire demonstrated that clonally expanded B cells were present in both compartments. Founding members of clonal families were more often found in the draining CLNs. More mature clonal family members derived from these founders were observed in the draining CLNs and also in the CNS, including lesions. These data provide new evidence that B cells traffic freely across the tissue barrier with the majority of B cell maturation occurring outside of the CNS in the secondary lymphoid tissue. Our study may aid in further defining the mechanisms of immunomodulatory therapies that either deplete circulating B cells or impact the intrathecal B cell compartment by inhibiting lymphocyte transmigration into the CNS. PMID:25100741

  8. The ameliorative effects of exercise on cognitive impairment and white matter injury from blood-brain barrier disruption induced by chronic cerebral hypoperfusion in adolescent rats.


    Lee, Jae-Min; Park, Jong-Min; Song, Min Kyung; Oh, Yoo Joung; Kim, Chang-Ju; Kim, Youn-Jung


    Vascular dementia is the progressive change in blood vessels that leads to neuronal injuries in vulnerable areas induced by chronic cerebral hypoperfusion (CCH). CCH induces disruption of blood-brain barrier (BBB), and this BBB disruption can initiate the cognitive impairment and white matter injury. In the present study, we evaluated the effect of treadmill exercise on the cognitive impairment, white matter injury, and BBB disruption induced by CCH. Vascular dementia was induced by permanent bilateral common carotid arteries occlusion (BCCAO) in rats. The rats in the exercise group were made to run on a treadmill for 30min once a day for 14 weeks, starting 4 weeks after birth. Our results revealed that treadmill exercise group was alleviated the cognitive impairment and myelin degradation induced by CCH. The disruption of BBB after CCH indicates degradation of occludin, zonula occluden-1 (ZO-1), and up-regulation of matrix metalloproteinases (MMPs). Treadmill exercise may provide protective effects on BBB disruption from degradation of occludin, ZO-1, and overexpression of MMP-9 after CCH. These findings suggest that treadmill exercise ameliorates cognitive impairment and white matter injury from BBB disruption induced by CCH in rats. The present study will be valuable for means of prophylactic and therapeutic intervention for patients with CCH.

  9. Toxic-Waste Disposal by Drain-in-Furnace Technique

    NASA Technical Reports Server (NTRS)

    Compton, L. E.; Stephens, J. B.; Moynihan, P. I.; Houseman, J.; Kalvinskas, J. J.


    Compact furnace moved from site to site. Toxic industrial waste destroyed using furnace concept developed for disposal of toxic munitions. Toxic waste drained into furnace where incinerated immediately. In furnace toxic agent rapidly drained and destroyed in small combustion chamber between upper and lower layers of hot ceramic balls

  10. Rethinking "Brain Drain" in the Era of Globalisation

    ERIC Educational Resources Information Center

    Rizvi, Fazal


    This paper discusses a range of issues concerning the idea of "brain drain" within the context of recent thinking on transnational mobility. It argues that the traditional analyses of brain drain are not sufficient, and that we can usefully approach the topic from a postcolonial perspective concerned with issues of identity, national…

  11. 14 CFR 121.241 - Oil system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Oil system drains. 121.241 Section 121.241..., FLAG, AND SUPPLEMENTAL OPERATIONS Special Airworthiness Requirements § 121.241 Oil system drains... position, must be provided to allow safe drainage of the entire oil system....

  12. 14 CFR 121.241 - Oil system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Oil system drains. 121.241 Section 121.241..., FLAG, AND SUPPLEMENTAL OPERATIONS Special Airworthiness Requirements § 121.241 Oil system drains... position, must be provided to allow safe drainage of the entire oil system....

  13. 14 CFR 121.241 - Oil system drains.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Oil system drains. 121.241 Section 121.241..., FLAG, AND SUPPLEMENTAL OPERATIONS Special Airworthiness Requirements § 121.241 Oil system drains... position, must be provided to allow safe drainage of the entire oil system....

  14. 14 CFR 121.241 - Oil system drains.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Oil system drains. 121.241 Section 121.241..., FLAG, AND SUPPLEMENTAL OPERATIONS Special Airworthiness Requirements § 121.241 Oil system drains... position, must be provided to allow safe drainage of the entire oil system....

  15. 14 CFR 121.241 - Oil system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Oil system drains. 121.241 Section 121.241..., FLAG, AND SUPPLEMENTAL OPERATIONS Special Airworthiness Requirements § 121.241 Oil system drains... position, must be provided to allow safe drainage of the entire oil system....

  16. 241-AY-102 Leak Detection Pit Drain Line Inspection Report

    SciTech Connect

    Boomer, Kayle D.; Engeman, Jason K.; Gunter, Jason R.; Joslyn, Cameron C.; Vazquez, Brandon J.; Venetz, Theodore J.; Garfield, John S.


    This document provides a description of the design components, operational approach, and results from the Tank AY-102 leak detection pit drain piping visual inspection. To perform this inspection a custom robotic crawler with a deployment device was designed, built, and operated by IHI Southwest Technologies, Inc. for WRPS to inspect the 6-inch leak detection pit drain line.

  17. 14 CFR 29.999 - Fuel system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Fuel system drains. 29.999 Section 29.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Fuel System Components § 29.999 Fuel system drains....

  18. 14 CFR 29.999 - Fuel system drains.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Fuel system drains. 29.999 Section 29.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Fuel System Components § 29.999 Fuel system drains....

  19. 14 CFR 29.999 - Fuel system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Fuel system drains. 29.999 Section 29.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Fuel System Components § 29.999 Fuel system drains....

  20. 14 CFR 29.999 - Fuel system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Fuel system drains. 29.999 Section 29.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Fuel System Components § 29.999 Fuel system drains....

  1. 14 CFR 25.999 - Fuel system drains.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Fuel system drains. 25.999 Section 25.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Fuel System Components § 25.999 Fuel system drains....

  2. 14 CFR 25.999 - Fuel system drains.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Fuel system drains. 25.999 Section 25.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Fuel System Components § 25.999 Fuel system drains....

  3. 14 CFR 25.999 - Fuel system drains.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Fuel system drains. 25.999 Section 25.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Fuel System Components § 25.999 Fuel system drains....

  4. 14 CFR 25.999 - Fuel system drains.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Fuel system drains. 25.999 Section 25.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Fuel System Components § 25.999 Fuel system drains....

  5. 14 CFR 29.999 - Fuel system drains.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Fuel system drains. 29.999 Section 29.999 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Fuel System Components § 29.999 Fuel system drains....

  6. Alloreactivity and anti-tumor activity segregate within two distinct subsets of cytokine-induced killer (CIK) cells: implications for their infusion across major HLA barriers.


    Sangiolo, Dario; Martinuzzi, Emanuela; Todorovic, Maja; Vitaggio, Katiuscia; Vallario, Antonella; Jordaney, Noela; Carnevale-Schianca, Fabrizio; Capaldi, Antonio; Geuna, Massimo; Casorzo, Laura; Nash, Richard A; Aglietta, Massimo; Cignetti, Alessandro


    Donor-derived cytokine-induced killer (CIK) can be infused as adoptive immunotherapy after hematopoietic cell transplant (HCT). Promising results were recently reported in HLA-identical HCT, where mild grafts versus host (GVH) events were observed. To extend this strategy across major HLA barriers (e.g. HLA-haploidentical HCT), further studies on CIK cells' alloreactivity are needed. We hypothesized that alloreactivity and anti-tumor activity of CIK cells segregate within two different cell subsets and could consequently be separated according to CD56 and CD3 expression. We tested CIK cells expanded from seven patients who underwent HCT as treatment of metastatic colorectal cancer. We found that CIK cells maintained their alloreactivity across major HLA barriers when tested as bulk population; after CD56-positive selection, anti-tumor activity was restricted to the CD3+/CD56+ cell fraction and alloreactivity versus HLA-mismatched PBMC was restricted to the CD3+/CD56- cell fraction. Bulk CIK cells from engrafted patients did not exhibit alloreactivity in response to host- or donor-derived PBMC, confirming their low potential for GVH across minor HLA barriers. Moreover, we tested if CIK cells expanded from engrafted patients after HCT were as effective as donor-derived ones and could be considered as an alternative option. The expansion rate and tumor cell killing was comparable to that observed in sibling donors. In conclusion, depletion of CD3+/CD56- cells might reduce the risk of GVH without affecting the tumor-killing capacity and could help extending CIK infusions across major HLA barriers. Engrafted patients after HCT could also be considered as an effective alternative option to donor-derived CIK cells.

  7. Methane oxidation in freely and poorly drained grassland soils and effects of cattle urine application.


    Li, Zheng; Kelliher, Francis M


    A sink for atmospheric methane (CH4) is microbial oxidation in soils. We report CH4 oxidation rates in freely and poorly drained soils on an intensively managed dairy farm. Following cattle urine application to half the plots (650 kg of nitrogen [N] ha(-1)) 31 chamber measurements were made over 100 d during autumn and winter. In the control plots, the freely and poorly drained soils' integrated CH4 oxidation rates averaged 1.8+/-0.2 and 0.6+/-0.1 kg CH4 ha(-1) yr(-1), respectively. In the poorly drained soil, the highest CH4 oxidation rates occurred when water-filled pore space (WFPS)<56% and CH4 oxidation rate declined by ninefold to near zero as WFPS increased from 56 to 68%. Urine application induced the freely and poorly drained soils' CH4 oxidation rates to decline for up to 2 mo by 0.7+/-0.2 and 0.4+/-0.1 kg CH4 ha(-1) yr(-1), respectively. The two soils' responses were thus not significantly different. After urine application, soil pore space CH4 concentration profiles suggested a simultaneous inhibition of bacteria that were CH4 oxidizers and stimulation of CH4 producers.

  8. Design criteria Drain Rerouting Project 93-OR-EW-2

    SciTech Connect

    Not Available


    This document contains the design criteria to be used by the architect-engineer (A--E) in the performance of Title I and II design for the Drain Rerouting Project. The Drain Rerouting project at the US Department of Energy`s (DOE) Oak Ridge Reservation in Oak Ridge, Tennessee will provide the Y-12 Plant with the capability to reroute particular drains within buildings 9202, 9203 and 9995. Process drains that are presently connected to the storm sewer shall be routed to the sanitary sewer to ensure that any objectionable material inadvertently discharged into process drains will not discharge to East Fork Popular Creek (EFPC) without treatment. The project will also facilitate compliance with the Y-12 Plant`s National Pollutant Discharge Elimination System (NPDES) discharge permit and allow for future pretreatment of once-through coolant.

  9. The potential for sea-level-rise-induced barrier island loss: Insights from the Chandeleur Islands, Louisiana, USA

    USGS Publications Warehouse

    Moore, Laura J.; Patsch, Kiki; List, Jeffrey H.; Williams, S. Jeffress


    As sea level rises and hurricanes become more intense, barrier islands around the world become increasingly vulnerable to conversion from self-sustaining migrating landforms to submerging or subaqueous sand bodies. To explore the mechanism by which such state changes occur and to assess the factors leading to island disintegration, we develop a suite of numerical simulations for the Chandeleur Islands in Louisiana, U.S.A., which appear to be on the verge of this transition. Our results suggest that the Chandeleurs are likely poised to change state, leading to their demise, within decades depending on future storm history. Contributing factors include high rates of relative sea level rise, limited sediment supply, muddy substrate, current island position relative to former Mississippi River distributary channels, and the effects of changes in island morphology on sediment transport pathways. Although deltaic barrier islands are most sensitive to disintegration because of their muddy substrate, the importance of relative sea level rise rate in determining the timing of threshold crossing suggests that the conceptual models for deltaic barrier island formation and disintegration may apply more broadly in the future.

  10. VE-Cadherin Disassembly and Cell Contractility in the Endothelium are Necessary for Barrier Disruption Induced by Tumor Cells

    PubMed Central

    Aragon-Sanabria, Virginia; Pohler, Steven E.; Eswar, Vikram J.; Bierowski, Matthew; Gomez, Esther W.; Dong, Cheng


    During metastasis, breakdown of the endothelial barrier is critical for tumor cell extravasation through blood vessel walls and is mediated by a combination of tumor secreted soluble factors and receptor-ligand interactions. However, a complete mechanism governing tumor cell transendothelial migration remains unclear. Here, we investigate the roles of tumor-associated signals in regulating endothelial cell contractility and adherens junction disassembly leading to endothelial barrier breakdown. We show that Src mediates VE-cadherin disassembly in response to metastatic melanoma cells. Through the use of pharmacological inhibitors of cytoskeletal contractility we find that endothelial cell contractility is responsive to interactions with metastatic cancer cells and that reducing endothelial cell contractility abrogates migration of melanoma cells across endothelial monolayers. Furthermore, we find that a combination of tumor secreted soluble factors and receptor-ligand interactions mediate activation of Src within endothelial cells that is necessary for phosphorylation of VE-cadherin and for breakdown of the endothelial barrier. Together, these results provide insight into how tumor cell signals act in concert to modulate cytoskeletal contractility and adherens junctions disassembly during extravasation and may aid in identification of therapeutic targets to block metastasis. PMID:28393886

  11. App-assisted external ventricular drain insertion.


    Eftekhar, Behzad


    The freehand technique for insertion of an external ventricular drain (EVD) is based on fixed anatomical landmarks and does not take individual variations into consideration. A patient-tailored approach based on augmented-reality techniques using devices such as smartphones can address this shortcoming. The Sina neurosurgical assist (Sina) is an Android mobile device application (app) that was designed and developed to be used as a simple intraoperative neurosurgical planning aid. It overlaps the patient's images from previously performed CT or MRI studies on the image seen through the device camera. The device is held by an assistant who aligns the images and provides information about the relative position of the target and EVD to the surgeon who is performing EVD insertion. This app can be used to provide guidance and continuous monitoring during EVD placement. The author describes the technique of Sina-assisted EVD insertion into the frontal horn of the lateral ventricle and reports on its clinical application in 5 cases as well as the results of ex vivo studies of ease of use and precision. The technique has potential for further development and use with other augmented-reality devices.

  12. Slowing the brain drain: FAIMER education programs.


    Burdick, William P; Morahan, Page S; Norcini, John J


    Migration of physicians has produced serious shortages in many developing countries. The Foundation for Advancement of International Medical Education and Research (FAIMER) is attempting to show this international brain drain through creation of faculty development programs for medical school faculty from developing countries in order to strengthen medical education and help build a sustainable discipline of medical education. The goals of these programs are to allow Fellows to acquire basic skills in medical education, skills in leadership and management, and build a strong community of practice. Acquisition of these skills will improve medical education in their home country, stimulate growth of the field of medical education, and improve opportunities for professional advancement. Three programs currently exist: the FAIMER Institute, a two year fellowship with residential and distance learning components; International Fellowships in Medical Education, which funds selected Institute alumni to obtain masters degrees in medical education; and FAIMER regional institutes, which use the principles and structure embedded in the FAIMER Institute to build faculty development programs overseas. Evaluation of FAIMER programs indicates approximately one-third of Fellows have been promoted, and that a community of medical educators is being created in many developing countries which may promote retention of these physicians.

  13. Thermophoresis of polymers: nondraining vs draining coil.


    Morozov, Konstantin I; Köhler, Werner


    Present theories for the thermophoretic mobility of polymers in dilute solution without long-ranged electrostatic interaction are based on a draining coil model with short-ranged segment-solvent interaction. We show that the characteristic thermophoretic interaction decays as r(-2) with the distance from the chain segment, which is of much longer range than the underlying rapidly decaying binary van der Waals interaction (∝ r(-6)). As a consequence, thermophoresis on the monomer level is governed by volume forces, resulting in hydrodynamic coupling between the chain segments. The inner parts of the nondraining coil do not actively participate in thermophoresis. The flow lines penetrate only into a thin surface layer of the coil and cause tangential stresses along the surface of the entire coil, not the individual segments. This model is motivated by recent experimental findings for thermoresponsive polymers and core-shell particles, and it explains the well-known molar mass independent thermophoretic mobility of polymers in dilute solution.

  14. Dual diaphragm tank with telltale drain

    NASA Technical Reports Server (NTRS)

    Tuthill, Wallace C., Jr. (Inventor)


    A fluid storage and expulsion system comprising a tank with an internal flexible diaphragm assembly of dual diaphragms in back-to-back relationship, at least one of which is provided with a patterned surface having fine edges such that the diaphragms are in contact along said edges without mating contact of surface areas to thereby form fluid channels which extend outwardly to the peripheral edges of the diaphragms is described. The interior wall of the tank at the juncture of tank sections is formed with a circumferential annular recess comprising an outer annular recess portion which forms a fluid collection chamber and an inner annular recess portion which accommodates the peripheral edge portions of the diaphragms and a sealing ring in clamped sealing relation therebetween. The sealing ring is perforated with radially extending passages which allow any fluid leaking or diffusing past a diaphragm to flow through the fluid channels between the diaphragms to the fluid collection chamber. Ports connectable to pressure fittings are provided in the tank sections for admission of fluids to opposite sides of the diaphragm assembly. A drain passage through the tank wall to the fluid collection chamber permits detection, analysis and removal of fluids in the collection chamber.

  15. Using Drained Spacecraft Propellant Tanks for Habitation

    NASA Technical Reports Server (NTRS)

    Thomas, Andrew S. W.


    A document proposes that future spacecraft for planetary and space exploration be designed to enable reuse of drained propellant tanks for occupancy by humans. This proposal would enable utilization of volume and mass that would otherwise be unavailable and, in some cases, discarded. Such utilization could enable reductions in cost, initial launch mass, and number of launches needed to build up a habitable outpost in orbit about, or on the surface of, a planet or moon. According to the proposal, the large propellant tanks of a spacecraft would be configured to enable crews to gain access to their interiors. The spacecraft would incorporate hatchways, between a tank and the crew volume, that would remain sealed while the tank contained propellant and could be opened after the tank was purged by venting to outer space and then refilled with air. The interior of the tank would be pre-fitted with some habitation fixtures that were compatible with the propellant environment. Electrical feed-throughs, used originally for gauging propellants, could be reused to supply electric power to equipment installed in the newly occupied space. After a small amount of work, the tank would be ready for long-term use as a habitation module.

  16. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  17. Observation of "wired" cell communication over 10-μm and 20-μm poly(dimethylsiloxane) barriers in tetracycline inducible expression systems

    NASA Astrophysics Data System (ADS)

    Kuo, Ching-Te; Chi, Cheng-Yu; Wu, Pei-Yi; Chuang, Fang-Tzu; Lin, Yueh-Chien; Liu, Hao-Kai; Huang, Guan-Syuan; Tsai, Tzu-Ching; Wo, Andrew M.; Lee, Hsinyu; Lee, Si-Chen


    Communication between cells and extracellular environments is of interest because of its critical roles in cell development and differentiation. Particularly, this signal transduction is commonly believed to rely on the contact and binding of the participating molecules/proteins, suggesting that the binding distance needed is less than a few nanometers. However, it is difficult to precisely match the rapidly binding interaction which depends on the probability of molecular collision in living systems, raising a hypothesis that another mechanism exists, could promote this signal communication, and remains unknown. Here we report that a long-range signal delivery over 10-μm and 20-μm polydimethylsiloxane (PDMS) barriers can be observed in microfluidically tetracycline (Tet) inducible expression systems. Results show that a significant increment of the long-range induced green fluorescent protein in human embryonic kidney 293T (HEK 293T) cells by the stimulation of Tet is demonstrated, and that such a signal induction is not dominated by Tet diffusion and displays a specific bindingless property. In addition, our experimental results, combined with theoretical modeling, suggest that this communication exhibits a bump-shaped characteristic depending on barrier thickness, materially structural property, surface roughness, and agonist concentration. It strongly relies on the PDMS barrier to delivery signal; therefore, we call such a mechanism as "wired" cell communication instead of wireless. These results could ignite interests in the novel and "wired" cell communication, which we call it X-signal, and in the use of such systems for the study of cellular biology and development of new drug.

  18. Modeling and extraction of gate bias-dependent parasitic source and drain resistances in MOSFETs

    NASA Astrophysics Data System (ADS)

    Kim, D. M.; Kim, H. C.; Kim, H. T.


    Gate voltage-dependent parasitic source and drain resistances in MOSFETs have been modeled and extracted with a symmetric additional resistance method (sARM) for better description of asymmetric parasitic resistances which are induced by intentional and/or accidental variations in the layout and fabrication process. A good agreement of nonlinear models with the sARM has been verified with experimental data obtained from n-channel LDD MOSFETs.

  19. Beneficial role of the probiotic mixture Ultrabiotique on maintaining the integrity of intestinal mucosal barrier in DSS-induced experimental colitis.


    Toumi, Ryma; Abdelouhab, Katia; Rafa, Hayet; Soufli, Imene; Raissi-Kerboua, Djamila; Djeraba, Zineb; Touil-Boukoffa, Chafia


    The etiology of inflammatory bowel diseases which include ulcerative colitis (UC) and Crohn disease has not yet been clarified. Several hypotheses suggest a change in composition of gut microflora along with an impaired mucosal barrier that lead to excessive mucosal immunologic responses. Increased production of nitric oxide (NO) contributes greatly to the tissue injury caused by chronic inflammation. Evidence indicates that the mucus layer covering the epithelium is altered during UC and experimental colitis. Our aim in this study was to investigate the potential therapeutic effect of probiotic during DSS-induced colitis by modulating the immune system and colonic mucus production. For that purpose, the probiotic formulation Ultrabiotique(®) (Lactobacillus acidophilus, Bifidobacterium lactis, Lactobacillus plantarum and Bifidobacterium breve) was administered daily for 7 d to mice with colitis. Probiotic supplementation improved clinical symptoms and histological alterations observed during DSS induced colitis. Ultrabiotique(®) treatment down regulated the NO production by peritoneal macrophages of DSS-treated mice and enhanced mucus production in both DSS-treated and healthy mice. In conclusion, the modification of microflora by the Ultrabiotique(®) played a beneficial role in maintaining the integrity of the intestinal mucosal barrier and promoted tissue repair.

  20. Barrier Island Morphology and Sediment Characteristics Affect the Recovery of Dune Building Grasses following Storm-Induced Overwash

    PubMed Central

    Brantley, Steven T.; Bissett, Spencer N.; Young, Donald R.; Wolner, Catherine W. V.; Moore, Laura J.


    Barrier islands are complex and dynamic systems that provide critical ecosystem services to coastal populations. Stability of these systems is threatened by rising sea level and the potential for coastal storms to increase in frequency and intensity. Recovery of dune-building grasses following storms is an important process that promotes topographic heterogeneity and long-term stability of barrier islands, yet factors that drive dune recovery are poorly understood. We examined vegetation recovery in overwash zones on two geomorphically distinct (undisturbed vs. frequently overwashed) barrier islands on the Virginia coast, USA. We hypothesized that vegetation recovery in overwash zones would be driven primarily by environmental characteristics, especially elevation and beach width. We sampled species composition and environmental characteristics along a continuum of disturbance from active overwash zones to relict overwash zones and in adjacent undisturbed environments. We compared species assemblages along the disturbance chronosequence and between islands and we analyzed species composition data and environmental measurements with Canonical Correspondence Analysis to link community composition with environmental characteristics. Recovering and geomorphically stable dunes were dominated by Ammophila breviligulata Fernaud (Poaceae) on both islands while active overwash zones were dominated by Spartina patens (Aiton) Muhl. (Poaceae) on the frequently disturbed island and bare sand on the less disturbed island. Species composition was associated with environmental characteristics only on the frequently disturbed island (p = 0.005) where A. breviligulata was associated with higher elevation and greater beach width. Spartina patens, the second most abundant species, was associated with larger sediment grain size and greater sediment size distribution. On the less frequently disturbed island, time since disturbance was the only factor that affected community

  1. Barrier island morphology and sediment characteristics affect the recovery of dune building grasses following storm-induced overwash.


    Brantley, Steven T; Bissett, Spencer N; Young, Donald R; Wolner, Catherine W V; Moore, Laura J


    Barrier islands are complex and dynamic systems that provide critical ecosystem services to coastal populations. Stability of these systems is threatened by rising sea level and the potential for coastal storms to increase in frequency and intensity. Recovery of dune-building grasses following storms is an important process that promotes topographic heterogeneity and long-term stability of barrier islands, yet factors that drive dune recovery are poorly understood. We examined vegetation recovery in overwash zones on two geomorphically distinct (undisturbed vs. frequently overwashed) barrier islands on the Virginia coast, USA. We hypothesized that vegetation recovery in overwash zones would be driven primarily by environmental characteristics, especially elevation and beach width. We sampled species composition and environmental characteristics along a continuum of disturbance from active overwash zones to relict overwash zones and in adjacent undisturbed environments. We compared species assemblages along the disturbance chronosequence and between islands and we analyzed species composition data and environmental measurements with Canonical Correspondence Analysis to link community composition with environmental characteristics. Recovering and geomorphically stable dunes were dominated by Ammophila breviligulata Fernaud (Poaceae) on both islands while active overwash zones were dominated by Spartina patens (Aiton) Muhl. (Poaceae) on the frequently disturbed island and bare sand on the less disturbed island. Species composition was associated with environmental characteristics only on the frequently disturbed island (p = 0.005) where A. breviligulata was associated with higher elevation and greater beach width. Spartina patens, the second most abundant species, was associated with larger sediment grain size and greater sediment size distribution. On the less frequently disturbed island, time since disturbance was the only factor that affected community


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  3. Advances in chest drain management in thoracic disease

    PubMed Central

    George, Robert S.


    An adequate chest drainage system aims to drain fluid and air and restore the negative pleural pressure facilitating lung expansion. In thoracic surgery the post-operative use of the conventional underwater seal chest drainage system fulfills these requirements, however they allow great variability amongst practices. In addition they do not offer accurate data and they are often inconvenient to both patients and hospital staff. This article aims to simplify the myths surrounding the management of chest drains following chest surgery, review current experience and explore the advantages of modern digital chest drain systems and address their disease-specific use. PMID:26941971

  4. Hyaluronan and layilin mediate loss of airway epithelial barrier function induced by cigarette smoke by decreasing E-cadherin.


    Forteza, Rosanna Malbran; Casalino-Matsuda, S Marina; Falcon, Nieves S; Valencia Gattas, Monica; Monzon, Maria E


    Cigarette smoke (CigS) exposure is associated with increased bronchial epithelial permeability and impaired barrier function. Primary cultures of normal human bronchial epithelial cells exposed to CigS exhibit decreased E-cadherin expression and reduced transepithelial electrical resistance. These effects were mediated by hyaluronan (HA) because inhibition of its synthesis with 4-methylumbelliferone prevented these effects, and exposure to HA fragments of <70 kDa mimicked these effects. We show that the HA receptor layilin is expressed apically in human airway epithelium and that cells infected with lentivirus expressing layilin siRNAs were protected against increased permeability triggered by both CigS and HA. We identified RhoA/Rho-associated protein kinase (ROCK) as the signaling effectors downstream layilin. We conclude that HA fragments generated by CigS bind to layilin and signal through Rho/ROCK to inhibit the E-cadherin gene and protein expression, leading to a loss of epithelial cell-cell contact. These studies suggest that HA functions as a master switch protecting or disrupting the epithelial barrier in its high versus low molecular weight form and that its depolymerization is a first and necessary step triggering the inflammatory response to CigS.

  5. Hyaluronan and Layilin Mediate Loss of Airway Epithelial Barrier Function Induced by Cigarette Smoke by Decreasing E-cadherin*

    PubMed Central

    Forteza, Rosanna Malbran; Casalino-Matsuda, S. Marina; Falcon, Nieves S.; Valencia Gattas, Monica; Monzon, Maria E.


    Cigarette smoke (CigS) exposure is associated with increased bronchial epithelial permeability and impaired barrier function. Primary cultures of normal human bronchial epithelial cells exposed to CigS exhibit decreased E-cadherin expression and reduced transepithelial electrical resistance. These effects were mediated by hyaluronan (HA) because inhibition of its synthesis with 4-methylumbelliferone prevented these effects, and exposure to HA fragments of <70 kDa mimicked these effects. We show that the HA receptor layilin is expressed apically in human airway epithelium and that cells infected with lentivirus expressing layilin siRNAs were protected against increased permeability triggered by both CigS and HA. We identified RhoA/Rho-associated protein kinase (ROCK) as the signaling effectors downstream layilin. We conclude that HA fragments generated by CigS bind to layilin and signal through Rho/ROCK to inhibit the E-cadherin gene and protein expression, leading to a loss of epithelial cell-cell contact. These studies suggest that HA functions as a master switch protecting or disrupting the epithelial barrier in its high versus low molecular weight form and that its depolymerization is a first and necessary step triggering the inflammatory response to CigS. PMID:23048036

  6. Focused Ultrasound-Induced Blood-Brain Barrier Opening: Association with Mechanical Index and Cavitation Index Analyzed by Dynamic Contrast-Enhanced Magnetic-Resonance Imaging

    PubMed Central

    Chu, Po-Chun; Chai, Wen-Yen; Tsai, Chih-Hung; Kang, Shih-Tsung; Yeh, Chih-Kuang; Liu, Hao-Li


    Focused ultrasound (FUS) with microbubbles can temporally open the blood-brain barrier (BBB), and the cavitation activities of microbubbles play a key role in the BBB-opening process. Previous attempts used contrast-enhanced magnetic resonance imaging (CE-MRI) to correlate the mechanical index (MI) with the scale of BBB-opening, but MI only partially gauged acoustic activities, and CE-MRI did not fully explore correlations of pharmacodynamic/pharmacokinetic behaviors. Recently, the cavitation index (CI) has been derived to serve as an indicator of microbubble-ultrasound stable cavitation, and may also serve as a valid indicator to gauge the level of FUS-induced BBB opening. This study investigates the feasibility of gauging FUS-induced BBB opened level via the two indexes, MI and CI, through dynamic contrast-enhanced (DCE)-MRI analysis as well as passive cavitation detection (PCD) analysis. Pharmacodynamic/pharmacokinetic parameters derived from DCE-MRI were characterized to identify the scale of FUS-induced BBB opening. Our results demonstrated that DCE-MRI can successfully access pharmacodynamic/pharmacokinetic BBB-opened behavior, and was highly correlated both with MI and CI, implying the feasibility in using these two indices to gauge the scale of FUS-induced BBB opening. The proposed finding may facilitate the design toward using focused ultrasound as a safe and reliable noninvasive CNS drug delivery. PMID:27630037

  7. Focused Ultrasound-Induced Blood-Brain Barrier Opening: Association with Mechanical Index and Cavitation Index Analyzed by Dynamic Contrast-Enhanced Magnetic-Resonance Imaging

    NASA Astrophysics Data System (ADS)

    Chu, Po-Chun; Chai, Wen-Yen; Tsai, Chih-Hung; Kang, Shih-Tsung; Yeh, Chih-Kuang; Liu, Hao-Li


    Focused ultrasound (FUS) with microbubbles can temporally open the blood-brain barrier (BBB), and the cavitation activities of microbubbles play a key role in the BBB-opening process. Previous attempts used contrast-enhanced magnetic resonance imaging (CE-MRI) to correlate the mechanical index (MI) with the scale of BBB-opening, but MI only partially gauged acoustic activities, and CE-MRI did not fully explore correlations of pharmacodynamic/pharmacokinetic behaviors. Recently, the cavitation index (CI) has been derived to serve as an indicator of microbubble-ultrasound stable cavitation, and may also serve as a valid indicator to gauge the level of FUS-induced BBB opening. This study investigates the feasibility of gauging FUS-induced BBB opened level via the two indexes, MI and CI, through dynamic contrast-enhanced (DCE)-MRI analysis as well as passive cavitation detection (PCD) analysis. Pharmacodynamic/pharmacokinetic parameters derived from DCE-MRI were characterized to identify the scale of FUS-induced BBB opening. Our results demonstrated that DCE-MRI can successfully access pharmacodynamic/pharmacokinetic BBB-opened behavior, and was highly correlated both with MI and CI, implying the feasibility in using these two indices to gauge the scale of FUS-induced BBB opening. The proposed finding may facilitate the design toward using focused ultrasound as a safe and reliable noninvasive CNS drug delivery.

  8. Focused Ultrasound-Induced Blood-Brain Barrier Opening: Association with Mechanical Index and Cavitation Index Analyzed by Dynamic Contrast-Enhanced Magnetic-Resonance Imaging.


    Chu, Po-Chun; Chai, Wen-Yen; Tsai, Chih-Hung; Kang, Shih-Tsung; Yeh, Chih-Kuang; Liu, Hao-Li


    Focused ultrasound (FUS) with microbubbles can temporally open the blood-brain barrier (BBB), and the cavitation activities of microbubbles play a key role in the BBB-opening process. Previous attempts used contrast-enhanced magnetic resonance imaging (CE-MRI) to correlate the mechanical index (MI) with the scale of BBB-opening, but MI only partially gauged acoustic activities, and CE-MRI did not fully explore correlations of pharmacodynamic/pharmacokinetic behaviors. Recently, the cavitation index (CI) has been derived to serve as an indicator of microbubble-ultrasound stable cavitation, and may also serve as a valid indicator to gauge the level of FUS-induced BBB opening. This study investigates the feasibility of gauging FUS-induced BBB opened level via the two indexes, MI and CI, through dynamic contrast-enhanced (DCE)-MRI analysis as well as passive cavitation detection (PCD) analysis. Pharmacodynamic/pharmacokinetic parameters derived from DCE-MRI were characterized to identify the scale of FUS-induced BBB opening. Our results demonstrated that DCE-MRI can successfully access pharmacodynamic/pharmacokinetic BBB-opened behavior, and was highly correlated both with MI and CI, implying the feasibility in using these two indices to gauge the scale of FUS-induced BBB opening. The proposed finding may facilitate the design toward using focused ultrasound as a safe and reliable noninvasive CNS drug delivery.

  9. Observations of magnetite dissolution in poorly drained soils

    USGS Publications Warehouse

    Grimley, D.A.; Arruda, N.K.


    Dissolution of strongly magnetic minerals is a common and relatively rapid phenomenon in poorly drained soils of the central United States, resulting in low magnetic susceptibility (MS). Low Eh reducing conditions are primarily responsible for magnetic mineral dissolution; a process likely mediated by iron-reducing bacteria in the presence of soil organic matter. Based on transects across drainage sequences from nine sites, natural magnetic minerals (>5 ??m) extracted from surface soil consist of 54% ?? 18% magnetite, 21% ?? 11% titanomagnetite, and 17% ?? 14% ilmenite. Magnetite and titanomagnetite dissolution, assessed by scanning electron microscopy on a 0-to-3 scale, inversely correlates with surface soil MS (r = 0.53), a proxy for soil drainage at studied transects. Altered magnetite typically displays etch pits 5 ??m) include 26% ?? 18% anthropogenic fly ash that also exhibits greater dissolution in low MS soils (r = 0.38), indicating detectable alteration can occur within 150 years in low Eh soils. Laboratory induced reduction of magnetite, titanomagnetite, and magnetic fly ash, with a citrate-bicarbonate- dithionite solution, resulted in dissolution textures similar to those of in situ soil particles. Although experiments indicate that reductive dissolution of magnetite can occur abiotically under extreme conditions, bacteria likely play an important role in the natural environment. ?? 2007 Lippincott Williams & Wilkins, Inc.

  10. Role of thrombin-PAR1-PKCθ/δ axis in brain pericytes in thrombin-induced MMP-9 production and blood-brain barrier dysfunction in vitro.


    Machida, Takashi; Dohgu, Shinya; Takata, Fuyuko; Matsumoto, Junichi; Kimura, Ikuya; Koga, Mariko; Nakamoto, Keiko; Yamauchi, Atsushi; Kataoka, Yasufumi


    Thrombin, an essential component in the coagulation cascade, participates in the pathogenesis of brain diseases, such as ischemic stroke, intracerebral hemorrhage, Alzheimer's disease and Parkinson's disease through blood-brain barrier (BBB) dysfunction. It is thought that the thrombin-matrix metalloproteinase (MMP)-9 axis is an important process in the pathogenesis of neurovascular disease, such as BBB dysfunction. We recently reported that brain pericytes are the most MMP-9-releasing cells in response to thrombin stimulation among the BBB-constituting cells. This thrombin-induced MMP-9 release is partially due to protease-activated receptor (PAR1), one of the specific thrombin receptors. Then, we evaluated the intracellular signaling pathways involved in MMP-9 release and the contribution of thrombin-reactive brain pericytes to BBB dysfunction. PKC activator evoked MMP-9 release from brain pericytes. The thrombin-induced MMP-9 release was inhibited by U0126, LY294002, Go6976, and Go6983. However, Go6976 decreased phosphorylation levels of PKCθ and Akt, and Go6983 decreased phosphorylation levels of PKCδ and extracellular signal-regulated kinase (ERK). Additionally, treatment of pericytes with thrombin or PAR1-activating peptide stimulated PKCδ/θ signaling. These substances impaired brain endothelial barrier function in the presence of brain pericytes. Brain pericytes function through two independent downstream signaling pathways via PAR1 activation to release MMP-9 in response to thrombin - the PKCθ-Akt pathway and the PKCδ-ERK1/2 pathway. These pathways participate in PAR1-mediated MMP-9 release from pericytes, which leads to BBB dysfunction. Brain pericytes and their specific signaling pathways could provide novel therapeutic targets for thrombin-induced neurovascular diseases.

  11. Effects of early enteral nutrition on the gastrointestinal motility and intestinal mucosal barrier of patients with burn-induced invasive fungal infection

    PubMed Central

    Zhang, Yu; Gu, Fang; Wang, Fengxian; Zhang, Yuanda


    Objective: To evaluate the effects of early enteral nutrition on the gastrointestinal motility and intestinal mucosal barrier of patients with burn-induced invasive fungal infection. Methods: A total of 120 patients with burn-induced invasive fungal infection were randomly divided into an early enteral nutrition (EN) group and a parenteral nutrition (PN) group (n=60). The patients were given nutritional support intervention for 14 days, and the expression levels of serum transferrin, albumin, total protein, endotoxin, D-lactic acid and inflammatory cytokines were detected on the 1st, 7th and 14th days respectively. Results: As the treatment progressed, the levels of serum transferrin, albumin and total protein of the EN group were significantly higher than those of the PN group (P<0.05), while the levels of serum endotoxin and D-lactic acid of the form group were significantly lower (P<0.05). After treatment, the expression levels of IL-6 and TNF-α were decreased in the EN group, which were significantly different from those of the PN group (P<0.05). During treatment, the incidence rates of complications such as abdominal distension, diarrhea, sepsis, nausea, vomiting and gastric retention were similar. The mean healing time of wound surface was 9.34±0.78 days in the EN group and 12.46±2.19 days in the PN group, i.e. such time of the former was significantly shorter than that of the latter (P<0.05). Conclusion: Treating patients having burn-induced invasive fungal infection by early enteral nutrition support with arginine can safely alleviate malnutrition and stress reaction, strengthen cellular immune function and promote wound healing, thereby facilitating the recovery of gastrointestinal motility and the function of intestinal mucosal barrier. PMID:27375697

  12. Time Course and Size of Blood-Brain Barrier Opening in a Mouse Model of Blast-Induced Traumatic Brain Injury.


    Hue, Christopher D; Cho, Frances S; Cao, Siqi; Nicholls, Russell E; Vogel Iii, Edward W; Sibindi, Cosmas; Arancio, Ottavio; Dale Bass, Cameron R; Meaney, David F; Morrison Iii, Barclay


    An increasing number of studies have reported blood-brain barrier (BBB) dysfunction after blast-induced traumatic brain injury (bTBI). Despite this evidence, there is limited quantitative understanding of the extent of BBB opening and the time course of damage after blast injury. In addition, many studies do not report kinematic parameters of head motion, making it difficult to separate contributions of primary and tertiary blast-loading. Detailed characterization of blast-induced BBB damage may hold important implications for serum constituents that may potentially cross the compromised barrier and contribute to neurotoxicity, neuroinflammation, and persistent neurologic deficits. Using an in vivo bTBI model, systemic administration of sodium fluorescein (NaFl; 376 Da), Evans blue (EB; 69 kDa when bound to serum albumin), and dextrans (3-500 kDa) was used to estimate the pore size of BBB opening and the time required for recovery. Exposure to blast with 272 ± 6 kPa peak overpressure, 0.69 ± 0.01 ms duration, and 65 ± 1 kPa*ms impulse resulted in significant acute extravasation of NaFl, 3 kDa dextran, and EB. However, there was no significant acute extravasation of 70 kDa or 500 kDa dextrans, and minimal to no extravasation of NaFl, dextrans, or EB 1 day after exposure. This study presents a detailed analysis of the time course and pore size of BBB opening after bTBI, supported by a characterization of kinematic parameters associated with blast-induced head motion.

  13. Filling, storing and draining. Three key aspects of landslide hydrology

    NASA Astrophysics Data System (ADS)

    Bogaard, Thom; Greco, Roberto


    Rainfall-triggered landslides are among the most widespread hazards in the world. The hydrology in and around a landslide area is key to pore pressure build-up in the soil skeleton which reduces shear strength due to the buoyancy force exerted by water in a saturated soil and to soil suction in an unsaturated soil. Extraordinary precipitation events trigger most of the landslides, but, at the same time, the vast majority of slopes do not fail. The intriguing question is: 'When and where exactly can a slope become triggered to slide and flow downwards?' The objective of this article is to present and discuss landslide hydrology at three scales - pore, hillslope, and catchment - which, taken together, give an overview of this interdisciplinary science. In fact, for rainfall-triggered landslides to occur, an unfavourable hydrological interplay should exist between fast and/or prolonged infiltration, and a relatively 'slow' drainage. The competition of water storage, pressure build-up and the subsequently induced drainage contains the importance of the timing, which is indisputably one of the more delicate but relevant aspects of landslide modelling, the overlay of hydrological processes with different time scales. As slopes generally remain stable, we can argue that effective drainage mechanisms spontaneously develop, as the best for a slope to stay stable is getting rid of the overload of water (above field capacity), either vertically or laterally. So, landslide hydrology could be framed as 'Filling-Storing-Draining'. Obviously, 'Storing' is added to stress the importance of dynamic pressure build-up for slope stability. 'Draining' includes all removal of water from the system (vertical and lateral flow, evaporation and transpiration) and thus pore water pressure release. Furthermore, by addressing landslide hydrology from both earth sciences and soil mechanics perspectives, we aim to manifest the hydrological processes in hillslopes and their influence on behaviour

  14. Intestinal barrier dysfunction develops at the onset of experimental autoimmune encephalomyelitis, and can be induced by adoptive transfer of auto-reactive T cells.


    Nouri, Mehrnaz; Bredberg, Anders; Weström, Björn; Lavasani, Shahram


    Multiple sclerosis (MS) is a chronic inflammatory demyelinating disease of the central nervous system with a pathogenesis involving a dysfunctional blood-brain barrier and myelin-specific, autoreactive T cells. Although the commensal microbiota seems to affect its pathogenesis, regulation of the interactions between luminal antigens and mucosal immune elements remains unclear. Herein, we investigated whether the intestinal mucosal barrier is also targeted in this disease. Experimental autoimmune encephalomyelitis (EAE), the prototypic animal model of MS, was induced either by active immunization or by adoptive transfer of autoreactive T cells isolated from these mice. We show increased intestinal permeability, overexpression of the tight junction protein zonulin and alterations in intestinal morphology (increased crypt depth and thickness of the submucosa and muscularis layers). These intestinal manifestations were seen at 7 days (i.e., preceding the onset of neurological symptoms) and at 14 days (i.e., at the stage of paralysis) after immunization. We also demonstrate an increased infiltration of proinflammatory Th1/Th17 cells and a reduced regulatory T cell number in the gut lamina propria, Peyer's patches and mesenteric lymph nodes. Adoptive transfer to healthy mice of encephalitogenic T cells, isolated from EAE-diseased animals, led to intestinal changes similar to those resulting from the immunization procedure. Our findings show that disruption of intestinal homeostasis is an early and immune-mediated event in EAE. We propose that this intestinal dysfunction may act to support disease progression, and thus represent a potential therapeutic target in MS. In particular, an increased understanding of the regulation of tight junctions at the blood-brain barrier and in the intestinal wall may be crucial for design of future innovative therapies.

  15. Source/Drain Engineering for High Performance Vertical MOSFET

    NASA Astrophysics Data System (ADS)

    Imamoto, Takuya; Endoh, Tetsuo

    In this paper, Source/Drain (S/i>/D) engineering for high performance (HP) Vertical MOSFET (V-MOSFET) in 3Xnm generation and its beyond is investigated, by using gradual S/i>/D profile while degradation of driving current (ION) due to the parasitic series resistance (Rpara) is minimized through two-dimensional device simulation taking into account for gate-induced-drain-leakage (GIDL). In general, it is significant to reduce spreading resistance in the case of conventional Planar MOSFET. Therefore, in this study, we focused and analyzed the abruptness of diffusion layer that is still importance parameter in V-MOSFET. First, for improving the basic device performance such as subthreshold swing (SS), ION, and Rpara, S/D engineering is investigated. The dependency of device performance on S/D abruptness (σS/D) for various Lightly Doped Drain Extension (LDD) abruptness (σLDD) is analyzed. In this study, Spacer Length (LSP) is defined as a function of σS/D. As σS/D becomes smaller and S/D becomes more abrupt, LSP becomes shorter. SS depends on the σS/D rather than the σLDD. ION has the peak value of 1750µA/µm at σS/D =2nm/dec. and σLDD=3nm/dec. when the silicon pillar diameter (D) is 30nm and the gate length (Lg) is 60nm. As σS/D becomes small, higher ION is obtained due to reduction of Rpara while SS is degraded. However, when σS/D becomes too small in the short channel devices (Lg =60nm and Lg =45nm), ION is degraded because the leakage current due to GIDL is increased and reaches IOFF limit of 100nA/µm. In addition, as σLDD becomes larger, larger ION is obtained in the case of Lg =100nm and Lg =60nm because channel length becomes shorter. On the other hand, in the case of Lg =45nm, as σLDD becomes larger, ION is degraded because short channel effect (SCE) becomes significant. Next, the dependency of the basic device performance on D is investigated. By slimming D from 30nm to 10nm, while SS is improved and approaches the ideal value of 60mV/Decade, ION

  16. Liquefaction under drained condition, from the lab to reality ?

    NASA Astrophysics Data System (ADS)

    Clément, Cécile; Aharonov, Einat; Stojanova, Menka; Toussaint, Renaud


    horizontal shaking our model predicts that the soil remains rigid. Under stronger accelerations, some of the particles, which constitute the medium, slide past each other, and the medium slowly rearranges. Yet, in this regime of shaking, the shaking is insufficient to cause the building to slide. The building sinks simply due to hydrostatic considerations, and since it is a static object in a dynamically rearranging medium. This is the case we call liquefaction. Eventually, for even stronger accelerations, both the particles and the building can slide and we predict convective movement. To test this model we run numerical simulations (granular dynamics DEM algorithm) and laboratory experiments. The numerical experiments do not include pore pressure, and only simulate buoyancy effects of water. The controlling parameters are the amplitude and frequency of the shaking, and the water level. With a saturated medium, experiments and simulations display three different behaviors: rigid, liquefaction, and convection, in agreement with our theoretical model. The peak ground acceleration (PGA) is the decisive parameter. It is important to note that for dry media and for a case when the building is fully submerged underwater, both in experiments and in simulations, the liquefaction effect disappears. Based on our work we suggest that elevated pore pressure conditions are not necessary for inducing liquefaction, and that liquefaction can occur under well drained and highly compacted soils, in situations previously considered to be safe from liquefaction. Références [1] Chi-Yuen Wang and Michael Manga. Earthquakes and Water, volume 114. Springer Verlag, 2010. [2] L. Goren, E. Aharonov, D. Sparks, and R. Toussaint. Pore pressure evolution in deforming granu- lar material : A general formulation and the infinitely stiff approximation. Journal of Geophysical Research, 115(B9), Sep 2010. [3] Liran Goren, Einat Aharonov, David Sparks, and Renaud Toussaint. The mechanical coupling of fluid

  17. Alternating Magnetic Field-Induced Hyperthermia Increases Iron Oxide Nanoparticle Cell Association/Uptake and Flux in Blood– Brain Barrier Models

    PubMed Central

    Dan, Mo; Bae, Younsoo; Pittman, Thomas A.


    Purpose Superparamagnetic iron oxide nanoparticles (IONPs) are being investigated for brain cancer therapy because alternating magnetic field (AMF) activates them to produce hyperthermia. For central nervous system applications, brain entry of diagnostic and therapeutic agents is usually essential. We hypothesized that AMF-induced hyperthermia significantly increases IONP blood–brain barrier (BBB) association/uptake and flux. Methods Cross-linked nanoassemblies loaded with IONPs (CNA-IONPs) and conventional citrate-coated IONPs (citrate-IONPs) were synthesized and characterized in house. CNA-IONP and citrate-IONP BBB cell association/uptake and flux were studied using two BBB Transwell® models (bEnd.3 and MDCKII cells) after conventional and AMF-induced hyperthermia exposure. Results AMF-induced hyperthermia for 0.5 h did not alter CNA-IONP size but accelerated citrate-IONP agglomeration. AMF-induced hyperthermia for 0.5 h enhanced CNA-IONP and citrate-IONP BBB cell association/uptake. It also enhanced the flux of CNA-IONPs across the two in vitro BBB models compared to conventional hyperthermia and normothermia, in the absence of cell death. Citrate-IONP flux was not observed under these conditions. AMF-induced hyperthermia also significantly enhanced paracellular pathway flux. The mechanism appears to involve more than the increased temperature surrounding the CNA-IONPs. Conclusions Hyperthermia induced by AMF activation of CNA-IONPs has potential to increase the BBB permeability of therapeutics for the diagnosis and therapy of various brain diseases. PMID:25377069

  18. Tiny biomedical amplifier combines high performance, low power drain

    NASA Technical Reports Server (NTRS)

    Deboo, G. J.


    Transistorized, portable, high performance amplifier with low power drain facilitates biomedical studies on mobile subjects. This device, which utilizes a differential input to obtain a common-mode rejection, is used for amplifying electrocardiogram and electromyogram signals.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. GENERAL VIEW OF COMPLEX LOOKING SOUTH, SAND DRAINING & DRYING BUILDING (right) AND SAND-SORTING BUILDING (left) - Mill "C" Complex, South of Dee Bennet Road, near Illinois River, Ottawa, La Salle County, IL

  20. Ethics and policy of medical brain drain: a review.


    Kollar, Eszter; Buyx, Alena


    Health-worker migration, commonly called "medical brain drain", refers to the mass migration of trained and skilled health professionals (doctors, nurses, midwives) from low-income to high-income countries. This is currently leaving a significant number of poor countries, particularly in sub-Saharan Africa, with critical staff shortages in the healthcare sector. A broad consensus exists that, where medical brain drain exacerbates such shortages, it is unethical, and this review presents the main arguments underpinning this view. Notwithstanding the general agreement, which policies are justifiable on ethical grounds to tackle brain drain and how best to go about implementing them remains controversial. The review offers a discussion of the specific ethical issues that have to be taken into account when deciding which policy measures to prioritise and suggests a strategy of policy implementation to address medical brain drain as a matter of urgency.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. VIEW EAST OF HEADGATES AT SPOOL DAM; DRAIN GATE MECHANISM AND DAM EDGE AT RIGHT - Willimantic Linen Company, Mill No. 1, Immediately West of South Main Street, North Bank of Willimantic River, Windham, Windham County, CT


    EPA Science Inventory

    Pathogen and toxic chemical concentrations above the chemical and toxicity water quality standards in creeks and rivers pose risks to human health and aquatic ecosystems. Storm drains discharging into these watercourses often contribute significantly to elevating pollutant concen...

  3. Focused ultrasound-induced blood-brain barrier disruption enhances the delivery of cytarabine to the rat brain.


    Zeng, Han-Qing; Lü, Lin; Wang, Feng; Luo, Yun; Lou, Shi-Feng


    To investigate the feasibility of using focused ultrasound (FUS) with microbubbles for targeted delivery of cytarabine to the brain. Sprague-Dawly rats (weighing 200-250 g) received focused ultrasound with intravenous injection microbubbles. At 0, 2, 4, 8, and 24 hours (n=5 for each time point) after sonication, animals received intravenous administration of cytarabine at a normal dose of 4 mg/kg body weight. Additional five rats were given with a high dose (50 mg/kg body weight) of cytarabine alone. Blood-brain barrier (BBB) permeability and cerebral cytarabine were determined. FUS in conjunction with microbubbles caused a transient BBB opening. Sonication exposure promoted cytarabine accumulation at the sonicated site. Animals injected with a normal dose of cytarabine 2 hours after sonication had similar concentrations of cerebral cytarabine compared to those with higher cytarabine without sonication. FUS can temporarily open the BBB and thus facilitate the penetration of systemic cytarabine into the brain.

  4. Impromidine-induced changes in the permeability of the blood-brain barrier of normotensive and spontaneously hypertensive rats

    SciTech Connect

    Boertje, S.B.; Le Beau, D.; Ward, S. )


    Previous studies suggested histamine receptors mediate changes in the cerebrovascular permeability of rats. To test this, we investigated the effects of impromidine, a specific agonist at the histamine H2-receptor, on blood pressure and permeability of the blood-brain barrier (BBB). Impromidine produced dose-dependent hypotension in Wistar-Kyoto (WKY) and spontaneously hypertensive (SHR) rats. Two higher doses of impromidine increased BBB permeability to 99mTc-sodium pertechnetate in WKY rats; however, two lower doses decreased permeability in SHR rats. All doses of impromidine increased cerebrovascular permeability to 131I-labeled serum albumin in both species. Doses of the drug were 100 times greater than those required to produce similar alterations using histamine.

  5. Absolute nitrogen atom density measurements by two-photon laser-induced fluorescence spectroscopy in atmospheric pressure dielectric barrier discharges of pure nitrogen

    SciTech Connect

    Es-Sebbar, Et-Touhami; Sarra-Bournet, Christian; Naude, Nicolas; Gherardi, Nicolas; Massines, Francoise


    In this paper, two-photon absorption laser induced fluorescence spectroscopy is used to follow the nitrogen atom density in flowing dielectric barrier discharges fed with pure nitrogen and operating at atmospheric pressure. Two different dielectric barrier discharge regimes are investigated: the Townsend regime, which is homogeneous although operating at atmospheric pressure, and the more common filamentary regime. In both regimes, densities as high as 3x10{sup 14}/cm{sup 3} are detected. However, the N atoms kinetic formation depends on the discharge regime. The saturation level is reached more rapidly with a filamentary discharge. For a given discharge regime, the N atom density depends strongly on the energy dissipated in the plasma between the gas inlet and the measurement position, whether the energy is varied by varying the position of the measurements, the gas flow, or the dissipated power. Experiments performed in the postdischarge show that the N atom decay cannot be simply attributed to three-body recombination of atomic nitrogen with nitrogen molecules, meaning that other mechanisms such as surface recombination or gas impurities play a role.

  6. Fermented Pueraria Lobata extract ameliorates dextran sulfate sodium-induced colitis by reducing pro-inflammatory cytokines and recovering intestinal barrier function

    PubMed Central

    Choi, Seungho; Woo, Jong-Kyu; Jang, Yeong-Su; Kang, Ju-Hee; Jang, Jung-Eun; Yi, Tae-Hoo; Park, Sang-Yong; Kim, Sun-Yeou; Yoon, Yeo-Sung


    Inflammatory bowel disease is a chronic inflammatory disorder occurring in the gastrointestinal track. However, the efficacy of current therapeutic strategies has been limited and accompanied by side effects. In order to eliminate the limitations, herbal medicines have recently been developed for treatment of IBD. Peuraria Lobata (Peuraria L.) is one of the traditional herbal medicines that have anti-inflammatory effects. Bioavailability of Peuraria L., which is rich in isoflavones, is lower than that of their fermented forms. In this study, we generated fermented Peuraria L. extracts (fPue) and investigated the role of fPue in inflammation and intestinal barrier function in vitro and in vivo. As the mice or intestinal epithelial cells were treated with DSS/fPue, mRNA expression of pro-inflammatory cytokines was reduced and the architecture and expression of tight junction proteins were recovered, compared to the DSS-treated group. In summary, fPue treatment resulted in amelioration of DSS-induced inflammation in the colon, and the disrupted intestinal barrier was recovered as the expression and architecture of tight junction proteins were retrieved. These results suggest that use of fPue could be a new therapeutic strategy for treatment of IBD. PMID:27729931

  7. Pilocarpine-induced convulsive activity is limited by multidrug transporters at the rodent blood-brain barrier.


    Römermann, K; Bankstahl, J P; Löscher, W; Bankstahl, M


    As a result of the growing availability of genetically engineered mouse lines, the pilocarpine post-status epilepticus (SE) model of temporal lobe epilepsy is increasingly used in mice. A discrepancy in pilocarpine sensitivity in FVB/N wild-type versus P-glycoprotein (PGP)-deficient mice precipitated the investigation of the interaction between pilocarpine and two major multidrug transporters at the blood-brain barrier. Doses of pilocarpine necessary for SE induction were determined in male and female wild-type and PGP-deficient mice. Brain and plasma concentrations were measured following low (30-50 mg⋅kg(-1) i.p.) and/or high (200 mg⋅kg(-1) i.p.) doses of pilocarpine in wild-type mice, and mice lacking PGP, breast cancer resistance protein (BCRP), or both transporters, as well as in rats with or without pretreatment with lithium chloride or tariquidar. Concentration equilibrium transport assays (CETA) were performed using cells overexpressing murine PGP or BCRP. Lower pilocarpine doses were necessary for SE induction in PGP-deficient mice. Brain-plasma ratios were higher in mice lacking PGP or PGP and BCRP, which was also observed after pretreatment with tariquidar in mice and in rats. Lithium chloride did not change brain penetration of pilocarpine. CETA confirmed transport of pilocarpine by PGP and BCRP. Pilocarpine is a substrate of PGP and BCRP at the rodent blood-brain barrier, which restricts its convulsive action. Future studies to reveal whether strain differences in pilocarpine sensitivity derive from differences in multidrug transporter expression levels are warranted.

  8. Blood-brain barrier flux of aluminum, manganese, iron and other metals suspected to contribute to metal-induced neurodegeneration.


    Yokel, Robert A


    The etiology of many neurodegenerative diseases has been only partly attributed to acquired traits, suggesting environmental factors may also contribute. Metal dyshomeostasis causes or has been implicated in many neurodegenerative diseases. Metal flux across the blood-brain barrier (the primary route of brain metal uptake) and the choroid plexuses as well as sensory nerve metal uptake from the nasal cavity are reviewed. Transporters that have been described at the blood-brain barrier are listed to illustrate the extensive possibilities for moving substances into and out of the brain. The controversial role of aluminum in Alzheimer's disease, evidence suggesting brain aluminum uptake by transferrin-receptor mediated endocytosis and of aluminum citrate by system Xc;{-} and an organic anion transporter, and results suggesting transporter-mediated aluminum brain efflux are reviewed. The ability of manganese to produce a parkinsonism-like syndrome, evidence suggesting manganese uptake by transferrin- and non-transferrin-dependent mechanisms which may include store-operated calcium channels, and the lack of transporter-mediated manganese brain efflux, are discussed. The evidence for transferrin-dependent and independent mechanisms of brain iron uptake is presented. The copper transporters, ATP7A and ATP7B, and their roles in Menkes and Wilson's diseases, are summarized. Brain zinc uptake is facilitated by L- and D-histidine, but a transporter, if involved, has not been identified. Brain lead uptake may involve a non-energy-dependent process, store-operated calcium channels, and/or an ATP-dependent calcium pump. Methyl mercury can form a complex with L-cysteine that mimics methionine, enabling its transport by the L system. The putative roles of zinc transporters, ZnT and Zip, in regulating brain zinc are discussed. Although brain uptake mechanisms for some metals have been identified, metal efflux from the brain has received little attention, preventing integration of

  9. Comparison of multispectral remote-sensing techniques for monitoring subsurface drain conditions. [Imperial Valley, California

    NASA Technical Reports Server (NTRS)

    Goettelman, R. C.; Grass, L. B.; Millard, J. P.; Nixon, P. R.


    The following multispectral remote-sensing techniques were compared to determine the most suitable method for routinely monitoring agricultural subsurface drain conditions: airborne scanning, covering the visible through thermal-infrared (IR) portions of the spectrum; color-IR photography; and natural-color photography. Color-IR photography was determined to be the best approach, from the standpoint of both cost and information content. Aerial monitoring of drain conditions for early warning of tile malfunction appears practical. With careful selection of season and rain-induced soil-moisture conditions, extensive regional surveys are possible. Certain locations, such as the Imperial Valley, Calif., are precluded from regional monitoring because of year-round crop rotations and soil stratification conditions. Here, farms with similar crops could time local coverage for bare-field and saturated-soil conditions.

  10. Enteric bacterial translocation after intraperitoneal implantation of rubber drain pieces.


    Guo, W; Andersson, R; Ljungh, A; Wang, X D; Bengmark, S


    To study the kinetics and mechanisms of bacterial translocation from the gut after intraperitoneal (IP) implantation of prosthetic materials, different sizes of rubber drain pieces were intraperitoneally implanted in the rat, followed by evaluation of ileal mucosal permeability after 2 days and of the occurrence of bacterial translocation and gut oxygen extraction at various time points. Enteric bacteria translocated to mesenteric lymph nodes and disseminated to systemic organs (liver, spleen, lungs, and kidneys), the portal vein, and inferior vena cava 2, 4, and 6 h after IP implantation of rubber drain pieces with 10-, 7-, and 3-cm2 areas, respectively, and subsequently to the IP rubber drain piece and the peritoneal cavity on the 2nd postoperative day. The incidence of translocation correlated with the size of the implanted material and time after implantation. The gut oxygen extraction increased significantly after IP implantation of 7- and 10-cm2 rubber drain pieces. The ileal mucosal permeability was enhanced in the groups implanted with 7- and 10-cm2 drain pieces. Thus, bacterial translocation occurs already in the early period after IP implantation of rubber drain and increased with time. The increased gut oxygen extraction implies that the gut is susceptible to IP inflammatory stimulation, and the enhanced ileal permeability suggests that the integrity of the gastrointestinal tract is compromised, which might facilitate bacterial translocation.

  11. High glucose-induced barrier impairment of human retinal pigment epithelium is ameliorated by treatment with Goji berry extracts through modulation of cAMP levels.


    Pavan, Barbara; Capuzzo, Antonio; Forlani, Giuseppe


    Human retinal pigment epithelium cells were used to investigate the mechanisms underlying blood-retinal barrier disruption under conditions of chronic hyperglycemia. The treatment with 25 mM glucose caused a rapid drop in the transepithelial electrical resistance (TEER), which was reversed by the addition of either a methanolic extract from Goji (Lycium barbarum L.) berries or its main component, taurine. Intracellular cAMP levels increased concurrently with the high glucose-induced TEER decrease, and were correlated to an increased activity of the cytosolic isoform of the enzyme adenylyl cyclase. The treatment with plant extract or taurine restored control levels. Data are discussed in view of a possible prevention approach for diabetic retinopathy.

  12. A Cannabinoid Receptor 2 Agonist Prevents Thrombin-Induced Blood-Brain Barrier Damage via the Inhibition of Microglial Activation and Matrix Metalloproteinase Expression in Rats.


    Li, Lin; Tao, Yihao; Tang, Jun; Chen, Qianwei; Yang, Yang; Feng, Zhou; Chen, Yujie; Yang, Liming; Yang, Yunfeng; Zhu, Gang; Feng, Hua; Chen, Zhi


    Thrombin mediates the life-threatening cerebral edema and blood-brain barrier (BBB) damage that occurs after intracerebral hemorrhage (ICH). We previously found that the selective cannabinoid receptor 2 (CB2R) agonist JWH-133 reduced brain edema and neurological deficits following germinal matrix hemorrhage (GMH). We explored whether CB2R stimulation ameliorated thrombin-induced brain edema and BBB permeability as well as the possible molecular mechanism involved. A total of 144 Sprague-Dawley (S-D) rats received a thrombin (20 U) injection in the right basal ganglia. JWH-133 (1.5 mg/kg) or SR-144528 (3.0 mg/kg) and vehicle were intraperitoneally (i.p.) injected 1 h after surgery. Brain water content measurement, Evans blue (EB) extravasation, Western blot, and immunofluorescence were used to study the effects of a CB2R agonist 24 h after surgery. The results demonstrated that JWH-133 administration significantly decreased thrombin-induced brain edema and reduced the number of Iba-1-positive microglia. JWH-133 also decreased the number of P44/P42(+)/Iba-1(+) microglia, lowered Evans blue extravasation, and inhibited the elevated matrix metallopeptidase (MMP)-9 and matrix metallopeptidase (MMP)-12 activities. However, a selective CB2R antagonist (SR-144528) reversed these effects. We demonstrated that CB2R stimulation reduced thrombin-induced brain edema and alleviated BBB damage. We also found that matrix metalloproteinase suppression may be partially involved in these processes.

  13. Early Activation of MAPK p44/42 Is Partially Involved in DON-Induced Disruption of the Intestinal Barrier Function and Tight Junction Network

    PubMed Central

    Springler, Alexandra; Hessenberger, Sabine; Schatzmayr, Gerd; Mayer, Elisabeth


    Deoxynivalenol (DON), produced by the plant pathogens Fusarium graminearum and Fusarium culmorum, is one of the most common mycotoxins, contaminating cereal and cereal-derived products. Although worldwide contamination of food and feed poses health threats to humans and animals, pigs are particularly susceptible to this mycotoxin. DON derivatives, such as deepoxy-deoxynivalenol (DOM-1), are produced by bacterial transformation of certain intestinal bacteria, which are naturally occurring or applied as feed additives. Intestinal epithelial cells are the initial barrier against these food- and feed-borne toxins. The present study confirms DON-induced activation of MAPK p44/42 and inhibition of p44/42 by MAPK-inhibitor U0126 monoethanolate. Influence of DON and DOM-1 on transepithelial electrical resistance (TEER), viability and expression of seven tight junction proteins (TJ), as well as the potential of U0126 to counteract DON-induced effects, was assessed. While DOM-1 showed no effect, DON significantly reduced TEER of differentiated IPEC-J2 and decreased expression of claudin-1 and -3, while leaving claudin-4; ZO-1, -2, and -3 and occludin unaffected. Inhibition of p44/42 counteracted DON-induced TEER decrease and restored claudin-3, but not claudin-1 expression. Therefore, effects of DON on TEER and claudin-3 are at least partially p44/42 mediated, while effects on viability and claudin-1 are likely mediated via alternative pathways. PMID:27618100

  14. The relation between doses or post-plasma time points and apoptosis of leukemia cells induced by dielectric barrier discharge plasma

    NASA Astrophysics Data System (ADS)

    Wang, Chao; Zhang, Haixia; Xue, Zhixiao; Yin, Huijuan; Niu, Qing; Chen, Hongli


    The dielectric barrier discharge (DBD) plasma was applied to induce apoptosis of LT-12 leukemia cells. Plasma effects on cell death was evaluated by MTT assay and FCM apoptosis assay with Annexin V/PI double staining, suggesting that plasma killing cells rate and inducing cell apoptosis rate both positively were related to the plasma doses or the post-plasma time points. The cell death rates increased from 15.2% to 33.1% and the apoptosis rate raise from 23.8% to 28% when the dose raise from 60s to 120 s at 8 h post-plasma, while they increased from 15.4% to 34.9% and from 48% to 55.3% respectively at the same doses at 12 h post-plasma. Furthermore, the production of reactive oxygen species (ROS), gene and protein expression for Caspases and Bcl-2 family members were measured for exploring the related apoptotic mechanisms phenomenon. We found ROS immediately increased to 1.24 times of the original amount, then increasing to 5.39-fold at 20 h after treatment. The gene and protein expression for Caspases and Bcl-2 family members are very active at 8-12 h post-plasma. Our results demonstrate that DBD plasma can effectively induce tumor cell death through primarily related apoptotic mechanisms.

  15. Critical role of TRPP2 and TRPC1 channels in stretch-induced injury of blood-brain barrier endothelial cells.


    Berrout, Jonathan; Jin, Min; O'Neil, Roger G


    The microvessels of the brain are very sensitive to mechanical stresses such as observed in traumatic brain injury (TBI). Such stresses can quickly lead to dysfunction of the microvessel endothelial cells, including disruption of blood-brain barrier (BBB). It is now evident that elevation of cytosolic calcium levels ([Ca2+]i) can compromise the BBB integrity, however the mechanism by which mechanical injury can produce a [Ca2+]i increase in brain endothelial cells is unclear. To assess the effects of mechanical/stretch injury on [Ca2+]i signaling, mouse brain microvessel endothelial cells (bEnd3) were grown to confluency on elasticized membranes and [Ca2+]i monitored using fura 2 fluorescence imaging. Application of an injury, using a pressure/stretch pulse of 50 ms, induced a rapid transient increase in [Ca2+]i. In the absence of extracellular Ca2+, the injury-induced [Ca2+]i transient was greatly reduced, but not fully eliminated, while unloading of Ca2+ stores by thapsigargin treatment in the absence of extracellular Ca2+ abolished the injury transient. Application of LOE-908 and amiloride, TRPC and TRPP2 channel blockers, respectively, both reduced the transient [Ca2+]i increase. Further, siRNA knockdown assays directed at TRPC1 and TRPP2 expression also resulted in a reduction of the injury-induced [Ca2+]i response. In addition, stretch injury induced increases of NO production and actin stress fiber formation, both of which were markedly reduced upon treatment with LOE908 and/or amiloride. We conclude that mechanical injury of brain endothelial cells induces a rapid influx of calcium, mediated by TRPC1 and TRPP2 channels, which leads to NO synthesis and actin cytoskeletal rearrangement.

  16. Evaluation of permeability, doxorubicin delivery, and drug retention in a rat brain tumor model after ultrasound-induced blood-tumor barrier disruption.


    Park, Juyoung; Aryal, Muna; Vykhodtseva, Natalia; Zhang, Yong-Zhi; McDannold, Nathan


    Drug delivery in brain tumors is challenging because of the presence of blood-brain barrier (BBB) and the blood-tumor barrier (BTB). Focused ultrasound (FUS) combined with microbubbles can enhance the permeability of the BTB in brain tumors, as well as disrupting the BBB in the surrounding tissue. In this study, dynamic contrast-enhanced Magnetic Resonance Imaging (DCE-MRI) was used to characterize FUS-induced permeability changes in a rat glioma model and in the normal brain and to investigate the relationship between these changes and the resulting concentration of the chemotherapy agent doxorubicin (DOX). 9L gliosarcoma cells were implanted in both hemispheres in male rats. At day 10-12 after implantation, FUS-induced BTB disruption using 690kHz ultrasound and Definity microbubbles was performed in one of the tumors and in a normal brain region in each animal. After FUS, DOX was administered at a dose of 5.67mg/kg. The resulting DOX concentration was measured via fluorometry at 1 or 24h after FUS. The transfer coefficient Ktrans describing extravasation of the MRI contrast agent Gd-DTPA was significantly increased in both the sonicated tumors and in the normal brain tissue (P<0.001) between the two DCE-MRI acquisitions obtained before and after FUS, while no significant difference was found in the controls (non-sonicated tumor/normal brain tissue). DOX concentrations were also significantly larger than controls in both the sonicated tumors and in the normal tissue volumes at 1 and 24h after sonication. The DOX concentrations were significantly larger (P<0.01) in the control tumors harvested 1h after FUS than in those harvested at 24h, when the tumor concentrations were not significantly different than in the non-sonicated normal brain. In contrast, there was no significant difference in the DOX concentrations between the tumors harvested at 1 and 24h after FUS or in the concentrations measured in the brain at these time points. The transfer coefficient Ktrans

  17. Transient Migration of Large Numbers of CD14++ CD16+ Monocytes to the Draining Lymph Node after Onset of Inflammation

    PubMed Central

    Lund, Hege; Boysen, Preben; Åkesson, Caroline Piercey; Lewandowska-Sabat, Anna Monika; Storset, Anne K.


    The dynamics of skin-draining cells following infection or vaccination provide important insight into the initiation of immune responses. In this study, the local recruitment and activation of immune cells in draining lymph nodes (LNs) was studied in calves in an adjuvant-induced inflammation. A transient but remarkably strong recruitment of monocytes was demonstrated after onset of inflammation, constituting up to 41% of live cells in the draining LNs after 24 h. Numerous CD14+ cells were visualized in subcutaneous tissues and draining LNs, and the majority of these cells did not express dendritic cell-associated markers CD205 and CD11c. In the LNs, recruited cells were predominately of a CD14++ and CD16+ phenotype, consistent with an intermediate monocyte subset characterized to possess a high inflammatory potential. Moreover, monocytes from the draining LN showed a high expression of genes coding for pro-inflammatory cytokines, including IL-1β, IL-6, TNFa, and TGFβ. Shortly after their appearance in the LN cortical areas, the monocytes had moved into the medulla followed by an increase in peripheral blood. In conclusion, this study provides novel information on in vivo monocyte recruitment and migration after onset of inflammation. PMID:27621730

  18. Reversible Demyelination, Blood-Brain Barrier Breakdown, and Pronounced Neutrophil Recruitment Induced by Chronic IL-1 Expression in the Brain

    PubMed Central

    Ferrari, Carina C.; Depino, Amaicha M.; Prada, Federico; Muraro, Nara; Campbell, Sandra; Podhajcer, Osvaldo; Perry, V. Hugh; Anthony, Daniel C.; Pitossi, Fernando J.


    Interleukin-1β (IL-1) expression is associated with a spectrum of neuroinflammatory processes related to chronic neurodegenerative diseases. The single-bolus microinjection of IL-1 into the central nervous system (CNS) parenchyma gives rise to delayed and localized neutrophil recruitment, transient blood-brain barrier (BBB) breakdown, but no overt damage to CNS integrity. However, acute microinjections of IL-1 do not mimic the chronic IL-1 expression, which is a feature of many CNS diseases. To investigate the response of the CNS to chronic IL-1 expression, we injected a recombinant adenovirus expressing IL-1 into the striatum. At the peak of IL-1 expression (days 8 and 14 post-injection), there was a marked recruitment of neutrophils, vasodilatation, and breakdown of the BBB. Microglia and astrocyte activation was evident during the first 14 days post-injection. At days 8 and 14, extensive demyelination was observed but the number of neurons was not affected by any treatment. Finally, at 30 days, signs of inflammation were no longer present, there was evidence of tissue reorganization, the BBB was intact, and the process of remyelination was noticeable. In summary, our data show that chronic expression of IL-1, in contrast to its acute delivery, can reversibly damage CNS integrity and implicates this cytokine or downstream components as major mediators of demyelination in chronic inflammatory and demyelinating diseases. PMID:15509551

  19. Smoothened Agonist Reduces Human Immunodeficiency Virus Type-1-Induced Blood-Brain Barrier Breakdown in Humanized Mice

    PubMed Central

    Singh, Vir B.; Singh, Meera V.; Gorantla, Santhi; Poluektova, Larisa Y.; Maggirwar, Sanjay B.


    Human Immunodeficiency Virus type-1 (HIV)-associated neurocognitive disorder is characterized by recruitment of activated/infected leukocytes into the CNS via disrupted Blood Brain Barrier (BBB) that contributes to persistent neuro-inflammation. In this report, humanized NOD/scid-IL2Rγcnull mice were used to establish that impaired Sonic hedgehog (Shh) signaling is associated with loss of BBB function and neurological damage, and that modulating Shh signaling can rescue these detrimental effects. Plasma viral load, p24 levels and CD4+ T cells were measured as markers of productive HIV infection. These mice also showed impaired exclusion of Evans blue dye from the brain, increased plasma levels of S100B, an astrocytic protein, and down-regulation of tight junction proteins Occludin and Claudin5, collectively indicating BBB dysfunction. Further, brain tissue from HIV+ mice indicated reduced synaptic density, neuronal atrophy, microglial activation, and astrocytosis. Importantly, reduced expression of Shh and Gli1 was also observed in these mice, demonstrating diminished Shh signaling. Administration of Shh mimetic, smoothened agonist (SAG) restored BBB integrity and also abated the neuropathology in infected mice. Together, our results suggest a neuroprotective role for Shh signaling in the context of HIV infection, underscoring the therapeutic potential of SAG in controlling HAND pathogenesis. PMID:27241024

  20. Radiofrequency-radiation exposure does not induce detectable leakage of albumin across the blood-brain barrier.


    McQuade, Jill M S; Merritt, James H; Miller, Stephanie A; Scholin, Terri; Cook, Michael C; Salazar, Alexander; Rahimi, Omid B; Murphy, Michael R; Mason, Patrick A


    The blood-brain barrier (BBB) consists of tight junctions between the endothelial cells that line the capillaries in the central nervous system. This structure protects the brain, and neurological damage could occur if it is compromised. Several publications by researchers at Lund University have reported alterations in the BBB after exposure to low-power 915 MHz energy. These publications increased the level of concern regarding the safety of wireless communication devices such as mobile phones. We performed a confirmation study designed to determine whether the BBB is altered in rats exposed in a transverse electromagnetic (TEM) transmission line cell to 915 MHz energy at parameters similar to those in the Lund University studies. Unanesthetized rats were exposed for 30 min to either continuous-wave or modulated (16 or 217 Hz) 915 MHz energy at power levels resulting in whole-body specific absorption rates (SARs) of 0.0018-20 W/kg. Albumin immunohistochemistry was performed on perfused brain tissue sections to determine the integrity of the BBB. Chi-square analysis revealed no significant increase in albumin extravasation in any of the exposed animals compared to the sham-exposed or home cage control animals.

  1. Treatment of Candida albicans biofilms with low-temperature plasma induced by dielectric barrier discharge and atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Koban, Ina; Matthes, Rutger; Hübner, Nils-Olaf; Welk, Alexander; Meisel, Peter; Holtfreter, Birte; Sietmann, Rabea; Kindel, Eckhard; Weltmann, Klaus-Dieter; Kramer, Axel; Kocher, Thomas


    Because of some disadvantages of chemical disinfection in dental practice (especially denture cleaning), we investigated the effects of physical methods on Candida albicans biofilms. For this purpose, the antifungal efficacy of three different low-temperature plasma devices (an atmospheric pressure plasma jet and two different dielectric barrier discharges (DBDs)) on Candida albicans biofilms grown on titanium discs in vitro was investigated. As positive treatment controls, we used 0.1% chlorhexidine digluconate (CHX) and 0.6% sodium hypochlorite (NaOCl). The corresponding gas streams without plasma ignition served as negative treatment controls. The efficacy of the plasma treatment was determined evaluating the number of colony-forming units (CFU) recovered from titanium discs. The plasma treatment reduced the CFU significantly compared to chemical disinfectants. While 10 min CHX or NaOCl exposure led to a CFU log10 reduction factor of 1.5, the log10 reduction factor of DBD plasma was up to 5. In conclusion, the use of low-temperature plasma is a promising physical alternative to chemical antiseptics for dental practice.

  2. Histamine Induces Alzheimer's Disease-Like Blood Brain Barrier Breach and Local Cellular Responses in Mouse Brain Organotypic Cultures

    PubMed Central

    Sedeyn, Jonathan C.; Wu, Hao; Hobbs, Reilly D.; Levin, Eli C.; Nagele, Robert G.; Venkataraman, Venkat


    Among the top ten causes of death in the United States, Alzheimer's disease (AD) is the only one that cannot be cured, prevented, or even slowed down at present. Significant efforts have been exerted in generating model systems to delineate the mechanism as well as establishing platforms for drug screening. In this study, a promising candidate model utilizing primary mouse brain organotypic (MBO) cultures is reported. For the first time, we have demonstrated that the MBO cultures exhibit increased blood brain barrier (BBB) permeability as shown by IgG leakage into the brain parenchyma, astrocyte activation as evidenced by increased expression of glial fibrillary acidic protein (GFAP), and neuronal damage-response as suggested by increased vimentin-positive neurons occur upon histamine treatment. Identical responses—a breakdown of the BBB, astrocyte activation, and neuronal expression of vimentin—were then demonstrated in brains from AD patients compared to age-matched controls, consistent with other reports. Thus, the histamine-treated MBO culture system may provide a valuable tool in combating AD. PMID:26697497

  3. Fermented Herbal Formulas KIOM-MA128 Ameliorate IL-6-Induced Intestinal Barrier Dysfunction in Colon Cancer Cell Line

    PubMed Central

    Park, Kwang Il; Kim, Dong Gun; Lee, Bo Hyoung


    Inflammatory bowel disease (IBD) comprises Crohn's disease (CD) and ulcerative colitis (UC). IBD increases the risk of colorectal cancer (CRC), depending on the extent and duration of intestinal inflammation. Increased IL-6 expression has been reported in IBD patients, which may be associated with intestinal barrier function through discontinuous tight junction (TJ). KIOM-MA is a specific agent for allergic diseases and cancer, and it is composed of several plants; these herbs have been used in traditional oriental medicine. We fermented KIOM-MA, the product of KIOM-MA128, using probiotics to improve the therapeutic efficacy via the absorption and bioavailability of the active ingredients. In this study, we demonstrated that KIOM-MA/MA128 exhibited anticolitis effects via the modulation of TJ protein. Interleukin-6 resulted in a dose-dependent decrease in the TER and an increase in the FITC-dextran permeability; however, pretreatment with 400 µg/ml KIOM-MA/MA128 resulted in a significant increase in the TER and a decrease in the FITC-dextran permeability via IL-6 induction. Furthermore, protein and mRNA TJ levels remained stable after pretreatment with 400 µg/ml KIOM-MA/MA128. Moreover, KIOM-MA/MA128 suppressed the expression of PLCγ1 and PKC. Taken together, these findings suggest novel information and clue of the anticolitis effects of KIOM-MA128 via regulation of tight junction. PMID:27980357

  4. On ultrasound-induced microbubble oscillation in a capillary blood vessel and its implications for the blood-brain barrier

    NASA Astrophysics Data System (ADS)

    Wiedemair, W.; Tuković, Ž.; Jasak, H.; Poulikakos, D.; Kurtcuoglu, V.


    The complex interaction between an ultrasound-driven microbubble and an enclosing capillary microvessel is investigated by means of a coupled, multi-domain numerical model using the finite volume formulation. This system is of interest in the study of transient blood-brain barrier disruption (BBBD) for drug delivery applications. The compliant vessel structure is incorporated explicitly as a distinct domain described by a dedicated physical model. Red blood cells (RBCs) are taken into account as elastic solids in the blood plasma. We report the temporal and spatial development of transmural pressure (Ptm) and wall shear stress (WSS) at the luminal endothelial interface, both of which are candidates for the yet unknown mediator of BBBD. The explicit introduction of RBCs shapes the Ptm and WSS distributions and their derivatives markedly. While the peak values of these mechanical wall parameters are not affected considerably by the presence of RBCs, a pronounced increase in their spatial gradients is observed compared to a configuration with blood plasma alone. The novelty of our work lies in the explicit treatment of the vessel wall, and in the modelling of blood as a composite fluid, which we show to be relevant for the mechanical processes at the endothelium.

  5. Photodynamic-therapy-induced alterations of the blood-brain barrier transfer constant of a tracer molecule in normal brain

    NASA Astrophysics Data System (ADS)

    Yeung, Ivan; Lilge, Lothar D.; Wilson, Brian C.; Lee, Ting-Yim; Stevens, Laura; Cenic, Aleksa


    Photofrin uptake studies in brain tissues using bulk sampling techniques have demonstrated up to a 10-fold higher concentration in intracranial tumors compared to normal brain structures. This selective uptake is in part attributed to the leaky blood-brain barrier (BBB) in brain tumors while intact BBB in normal brain excludes Photofrin from the extravascular space. However, in vivo preclinical studies have shown a very high sensitivity in normal brain to photodynamic therapy (PDT) despite this selective uptake. In vivo computed tomography (CT) measurement of the blood- brain transfer constant (K) and cerebral plasma volume using an x-ray dye as a tracer was used to monitor the degradation process of the BBB in normal brain during and post PDT. In these experiments, it was observed that K increased as early as 15 minutes after the onset of PDT, peaking at approximately 3 hr post PDT treatment followed by a drop close to baseline values for 3 out of 4 animals. On the other hand, the cerebral plasma volume showed a decrease also as early as 15 min post PDT onset, but its decrease continued up to 6 hrs with no apparent vascular stasis at the end of the time period. The results suggested a continuous process of BBB breakdown and vascular shutdown shortly after start of PDT.

  6. Focused ultrasound induced blood-brain barrier disruption to enhance chemotherapeutic drugs (BCNU) delivery for glioblastoma treatment

    NASA Astrophysics Data System (ADS)

    Liu, Hao-Li; Hua, Mu-Yi; Chen, Pin-Yuan; Huang, Chiung-Yin; Wang, Jiun-Jie; Wei, Kuo-Chen


    Focused ultrasound has been recently found to capable of temporally and reversibly disrupt local blood-brain barrier (BBB) and opens new frontier in delivering varies type of drugs into brain for central nerve system (CNS) disorder treatment. In this study, we aim to investigate the feasibility of delivering 1, 3-bits (2-chloroethyl) -1-nitrosourea (BCNU) to treat glioblastoma in animal models and evaluate whether this approach would gain treatment efficacy. Under the presence of microbubbles administration, a 400-kHz focused ultrasound was employed to deliver burst-tone ultrasonic energy stimulation to disrupt BBB in animal brains transcranially, and in-vivo monitored by magnetic-resonance imaging (MRI). C6-glioma cells were cultured and implanted into Sprague-Dawley rats as the brain-tumor model. BCNU deposited in brain was quantified by using high-performance liquid chromatography (HPLC), and brain tissues were examined histologically. MRI was employed to longitudinal evaluate the brain tumor treatment including the analysis of tumor progression and animal survival. We confirmed that the focused ultrasound, under the secure ultrasonic energy level, can significantly enhance the BCNU penetration through BBB over 300% than control without cause hemorrhage. Apparent improvement of treatment efficacy achieved by combining focused ultrasound with BCNU delivery, including significant suppression of tumor growth and a prolonged animal survival. This study highly support that this treatment strategy could be clinically-relevant and may help to provide another potential strategy in increasing local chemotherapeutic drugs for brain-tumor treatment.

  7. Methane fluxes on pristine, drained and restored boreal spruce swamps

    NASA Astrophysics Data System (ADS)

    Koskinen, Markku; Minkkinen, Kari; Nieminen, Mika; Maanavilja, Liisa; Tuittila, Eeva-Stiina


    Successful restoration of peatlands drained for forestry means that all the processes of pristine mires are present in the restored peatlands. Methanogen communities are usually disturbed by the lowering of water table by drainage and previous studies have found only slow recovery of methane emissions on restored peatlands. We made methane flux measurements on pristine, drained and restored conditions boreal spruce swamps. Restoration measures had taken place approximately 10 years before our measurement campaign. The measurement plots on the drained and restored sites included drainage ditches and the disturbed soil beside the ditch as well as the undisturbed mid-strip area. Water table was measured from wells near the flux measurement plots. Seven sites were sampled twice per month for one growing season with eight sampling plots grouped in four locations per site in total. The locations were placed on a line perpendicular to the mire edge on the pristine sites and a drainage ditch on the drained and restored sites. The highest mean water level was recorded on the restored sites, and the lowest on the drained sites. The restored sites showed high fluxes from all measurement plots. The fluxes from the pristine and drained sites were much smaller and did not differ significantly from each other. The highest fluxes were measured from the drainage ditches on both the drained and restored sites. The pristine sites showed high relative spatio-temporal variation in the flux, partly explained by changes in the water table level. No effect of measurement plot distance from the mire edge was discernible on the pristine sites.

  8. Annexin A1 restores Aβ1-42 -induced blood-brain barrier disruption through the inhibition of RhoA-ROCK signaling pathway.


    Park, Jong-Chan; Baik, Sung Hoon; Han, Sun-Ho; Cho, Hyun Jin; Choi, Hyunjung; Kim, Haeng Jun; Choi, Heesun; Lee, Wonik; Kim, Dong Kyu; Mook-Jung, Inhee


    The blood-brain barrier (BBB) is composed of brain capillary endothelial cells and has an important role in maintaining homeostasis of the brain separating the blood from the parenchyma of the central nervous system (CNS). It is widely known that disruption of the BBB occurs in various neurodegenerative diseases, including Alzheimer's disease (AD). Annexin A1 (ANXA1), an anti-inflammatory messenger, is expressed in brain endothelial cells and regulates the BBB integrity. However, its role and mechanism for protecting BBB in AD have not been identified. We found that β-Amyloid 1-42 (Aβ42)-induced BBB disruption was rescued by human recombinant ANXA1 (hrANXA1) in the murine brain endothelial cell line bEnd.3. Also, ANXA1 was decreased in the bEnd.3 cells, the capillaries of 5XFAD mice, and the human serum of patients with AD. To find out the mechanism by which ANXA1 recovers the BBB integrity in AD, the RhoA-ROCK signaling pathway was examined in both Aβ42-treated bEnd.3 cells and the capillaries of 5XFAD mice as RhoA was activated in both cases. RhoA inhibitors alleviated Aβ42-induced BBB disruption and constitutively overexpressed RhoA-GTP (active form of RhoA) attenuated the protective effect of ANXA1. When pericytes were cocultured with bEnd.3 cells, Aβ42-induced RhoA activation of bEnd.3 cells was inhibited by the secretion of ANXA1 from pericytes. Taken together, our results suggest that ANXA1 restores Aβ42-induced BBB disruption through inhibition of RhoA-ROCK signaling pathway and we propose ANXA1 as a therapeutic reagent, protecting against the breakdown of the BBB in AD.

  9. Language barriers

    PubMed Central

    Ngwakongnwi, Emmanuel; Hemmelgarn, Brenda R.; Musto, Richard; King-Shier, Kathryn M.; Quan, Hude


    Abstract Objective To assess use of regular medical doctors (RMDs), as well as awareness and use of telephone health lines or telehealth services, by official language minorities (OLMs) in Canada. Design Analysis of data from the 2006 postcensal survey on the vitality of OLMs. Setting Canada. Participants In total, 7691 English speakers in Quebec and 12 376 French speakers outside Quebec, grouped into those who experienced language barriers and those with no language barriers. Main outcome measures Health services utilization (HSU) by the presence of language barriers; HSU measures included having an RMD, use of an RMD’s services, and awareness of and use of telephone health lines or telehealth services. Multivariable models examined the associations between HSU and language barriers. Results After adjusting for age and sex, English speakers residing in Quebec with limited proficiency in French were less likely to have RMDs (adjusted odds ratio [AOR] 0.66, 95% CI 0.50 to 0.87) and to use the services of their RMDs (AOR 0.65, 95% CI 0.50 to 0.86), but were more likely to be aware of the existence of (AOR 1.50, 95% CI 1.16 to 1.93) and to use (AOR 1.43, 95% CI 0.97 to 2.11) telephone health lines or telehealth services. This pattern of having and using RMDs and telehealth services was not observed for French speakers residing outside of Quebec. Conclusion Overall we found variation in HSU among the language barrier populations, with lower use observed in Quebec. Age older than 45 years, male sex, being married or in common-law relationships, and higher income were associated with having RMDs for OLMs. PMID:23242902

  10. Relation of thermal conductivity with process induced anisotropic void system in EB-PVD PYSZ thermal barrier coatings.

    SciTech Connect

    Renteria, A. F.; Saruhan, B.; Ilavsky, J.; German Aerospace Center


    Thermal barrier coatings (TBCs) deposited by Electron-beam physical deposition (EB-PVD) protect the turbine blades situated at the high pressure sector of the aircraft and stationary turbines. It is an important task to uphold low thermal conductivity in TBCs during long-term service at elevated temperatures. One of the most promising methods to fulfil this task is to optimize the properties of PYSZ-based ,TBC by tailoring its microstructure. Thermal conductivity of the EB-PVD produced PYSZ TBCs is influenced mainly by the size, shape, orientation and volume of the various types of porosity present in the coatings. These pores can be classified as open (inter-columnar and between feather arms gaps) and closed (intra-columnar pores). Since such pores are located within the three-dimensionally deposited columns and enclose large differences in their sizes, shapes, distribution and anisotropy, the accessibility for their characterization is very complex and requires the use of sophisticated methods. In this work, three different EB-PVD TBC microstructures were manufactured by varying the process parameters, yielding various characteristics of their pores. The corresponding thermal conductivities in as-coated state and after ageing at 1100C/1h and 100h were measured via Laser Flash Analysis Method (LFA). The pore characteristics and their individual effect on the thermal conductivity are analysed by USAXS which is supported by subsequent modelling and LFA methods, respectively. Evident differences in the thermal conductivity values of each microstructure were found in as-coated and aged conditions. In summary, broader columns introduce higher values in thermal conductivity. In general, thermal conductivity increases after ageing for all three investigated microstructures, although those with initial smaller pore surface area show smaller changes.

  11. Relation of Thermal Conductivity with Process Induced Anisotropic Void Systems in EB-PVD PYSZ Thermal Barrier Coatings

    SciTech Connect

    Renteria, A. Flores; Saruhan-Brings, B.; Ilavsky, J.


    Thermal barrier coatings (TBCs) deposited by Electron-beam physical deposition (EB-PVD) protect the turbine blades situated at the high pressure sector of the aircraft and stationary turbines. It is an important task to uphold low thermal conductivity in TBCs during long-term service at elevated temperatures. One of the most promising methods to fulfil this task is to optimize the properties of PYSZ-based TBC by tailoring its microstructure. Thermal conductivity of the EB-PVD produced PYSZ TBCs is influenced mainly by the size, shape, orientation and volume of the various types of porosity present in the coatings. These pores can be classified as open (inter-columnar and between feather arms gaps) and closed (intra-columnar pores). Since such pores are located within the three-dimensionally deposited columns and enclose large differences in their sizes, shapes, distribution and anisotropy, the accessibility for their characterization is very complex and requires the use of sophisticated methods. In this work, three different EB-PVD TBC microstructures were manufactured by varying the process parameters, yielding various characteristics of their pores. The corresponding thermal conductivities in as-coated state and after ageing at 11000C/1h and 100h were measured via Laser Flash Analysis Method (LFA). The pore characteristics and their individual effect on the thermal conductivity are analysed by USAXS which is supported by subsequent modelling and LFA methods, respectively. Evident differences in the thermal conductivity values of each microstructure were found in as-coated and aged conditions. In summary, broader columns introduce higher values in thermal conductivity. In general, thermal conductivity increases after ageing for all three investigated microstructures, although those with initial smaller pore surface area show smaller changes.

  12. Carbonylation and disassembly of the F-actin cytoskeleton in oxidant induced barrier dysfunction and its prevention by epidermal growth factor and transforming growth factor α in a human colonic cell line

    PubMed Central

    Banan, A; Zhang, Y; Losurdo, J; Keshavarzian, A


    BACKGROUND—Intestinal barrier dysfunction concomitant with high levels of reactive oxygen metabolites (ROM) in the inflamed mucosa have been observed in inflammatory bowel disease (IBD). The cytoskeletal network has been suggested to be involved in the regulation of barrier function. Growth factors (epidermal growth factor (EGF) and transforming growth factor α (TGF-α)) protect gastrointestinal barrier integrity against a variety of noxious agents. However, the underlying mechanisms of oxidant induced disruption and growth factor mediated protection remain elusive.
AIMS—To determine: (1) if oxidation and disassembly of actin (a key cytoskeletal component) plays a major role in ROM induced epithelial monolayer barrier dysfunction; and (2) if growth factor mediated protection involves prevention of theses alterations.
METHODS—Caco-2 monolayers were preincubated with EGF, TGF-α, or vehicle before incubation with ROM (H2O2 or HOCl). Effects on cell integrity, barrier function, and G- and F-actin (oxidation, disassembly, and assembly) were determined.
RESULTS—ROM dose dependently and significantly increased F- and G-actin oxidation (carbonylation), decreased the stable F-actin fraction (index of stability), and increased the monomeric G-actin fraction (index of disassembly). Concomitant with these changes were disruption of the actin cytoskeleton and loss of the monolayer barrier function. In contrast, growth factor pretreatment decreased actin oxidation and enhanced the stable F-actin, while in concert prevented actin disruption and restored normal barrier function of monolayers exposed to ROM. Cytochalasin-D, an inhibitor of actin assembly, not only caused actin disassembly and barrier dysfunction but also abolished the protective action of growth factors. Moreover, an actin stabilising agent, phalloidin, mimicked the protective actions of the growth factors.
CONCLUSIONS—Oxidation, disassembly, and instability of the actin cytoskeleton appears to

  13. Stable carbon and nitrogen isotopes in vertical peat profiles of natural and drained boreal peatlands

    NASA Astrophysics Data System (ADS)

    Nykänen, Hannu; Mpamah, Promise; Rissanen, Antti; Pitkänen, Aki; Turunen, Jukka; Simola, Heikki


    Peatlands form a significant carbon pool in the global carbon cycle. Change in peat hydrology, due to global warming is projected to change microbiological processes and peat carbon pool. We tested if bulk stable carbon and nitrogen isotopes serve as indicators of severe long term drying in peatlands drained for forestry. Depth profile analysis of peat, for their carbon and nitrogen content as well as their carbon and nitrogen stable isotopic signatures, were conducted for peatlands in southern and eastern Finland, having ombrotrophic and minerotrophic natural and corresponding drained pairs or separate drained sites. The selection of sites allowed us to compare changes due to different fertility and changes due to long term artificial drying. Drainage lasting over 40 years has led to changes in hydrology, vegetation, nutrient mineralization and respiration. Furthermore, increased nutrient uptake and possible recycling of peat nitrogen and carbon trough vegetation back to the peat surface, also possibly has an effect on the stable isotopic composition of peat carbon and nitrogen. We think that drainage induced changes somehow correspond to those caused by changed hydrology due to climate change. We will present data from these measurements and discuss their implications for carbon and nitrogen flows in peatlands.

  14. Slosh wave and geyser excitations due to liquid hydrogen shut-off during draining in microgravity

    NASA Technical Reports Server (NTRS)

    Hung, R. J.; Shyu, K. L.


    The dynamical behavior of liquid hydrogen shut-off during draining, and shut-off at the moment of the incipience of a suction dip have been investigated. It shows that a large amplitude surge is observed for liquid in the container at the moment of liquid hydrogen shut-off in reduced gravity. It also shows that slosh waves accompanied by a strong geyser are developed for surge-related flow fields induced by liquid hydrogen shut-off at the incipience of a suction dip. In the slosh wave excitation, both a lower gravity environment and higher flow rate before the shut-off of liquid draining are resonsible for the initiation of greater amplitude slosh waves. Slosh wave excitation, due to shut-off during liquid hydrogen draining, shift the fluid mass distribution in the container which imposes time-dependent variation in the spacecraft moment of inertia. This provides important information necessary for on-orbit guidance and attitude control of spacecraft.

  15. Emissions of Greenhouse Gases from Wet Drained Forest Soils

    NASA Astrophysics Data System (ADS)

    von Arnold, K.; Weslien, P.; Nilsson, M.; Hånell, B.; Klemedtsson, L.


    Ditching has commonly been used in order to improve forest productivity on wet soils. When wet soils are drained the methane emissions, which are usually substantial from wetlands, decrease and the uptake of carbon dioxide by the vegetation increases. However, there is also an increase in the emissions of carbon dioxide and nitrous oxide from the soil. The sizes of the fluxes depend on drainage depth and soil fertility. We have performed a study with the objective to examine the effect of tree species composition and site fertility on greenhouse gas emissions from drained temperate forest ecosystems. The fluxes of methane, carbon dioxide and nitrous oxide were measured during two years in seven temperate forest sites, one open mire, one undrained alder swamp, both to be used for comparison, and five drained forest sites of different fertilities covered with different tree species. The drained sites, chosen to represent the most common tree species in Sweden, were two spruce sites of different fertility, three sites dominated by pine, alder and birch respectively. All drained sites had a mean groundwater depth between 14 and 26 cm. Fluxes were measured with dark static chambers, ten chambers at each site. Gas samples were collected every week during summer and every month during the wintertime. The annual methane emissions (presented as means of all chambers +/- standard error) were much larger from the undrained sites, between 50 +/- 19.2 and 126 +/- 34.7 kg/ha compared to 0 +/- 1.5 to 17 +/- 8.3 kg/ha from the drained sites. The fluxes of carbon dioxide from the soil were higher at the drained sites but as most twice as large as from the undrained sites (8 +/- 1.6 ton/ha from the mire and 16 +/- 1.9 ton/ha from the drained alder during the first year of sampling). The emissions of nitrous oxide were highest from the drained alder site, 11 +/- 3.8 kg/ha the first sampling year and 7 +/- 2.9 the second. At all other sites the emissions were approximately 10 times

  16. Development of a novel self micro-emulsifying drug delivery system (SMEDDS) for reducing HIV protease inhibitor-induced intestinal epithelial barrier dysfunction

    PubMed Central

    Lei, Bokai; Zha, Weibin; Wang, Yun; Wen, Cong; Stude, Elaine J; Wang, Xuan; Jin, Fang; Wang, Guangji; Zhang, Luyong; Zhou, Huiping


    The development of HIV protease inhibitors (PIs) has been one of the most significant advances of the past decade in controlling HIV infection. Unfortunately, the benefits of HIV PIs are compromised by serious side effects. One of the most frequent and deleterious side effects of HIV PIs is severe gastrointestinal (GI) disorders including mucosal erosions, epithelial barrier dysfunction, and leak-flux diarrhea, which occurs in 16–62% of patients on HIV PIs. Although the underlying mechanisms behind HIV PI-associated serious adverse side effects remain to be identified, our recent studies have shown that activation of endoplasmic reticulum (ER) stress response plays a critical role in HIV PI-induced GI complications. The objective of this study was to develop a novel self micro-emulsifying drug delivery system (SMEDDS) using various antioxidants as surfactants and co-surfactants to reduce the GI side effects of the most commonly used HIV PI, ritonavir. The biological activities of this SMSDDS of ritonavir were compared with that of Norvir®, which is currently used in the clinic. Rat normal intestinal epithelial cells (IEC-6) and mouse Raw 264.7 macrophages were used to examine the effect of new SMEDDS of ritonavir on activation of ER stress and oxidative stress. The Sprague-Dawley rats and C57/BL6 mice were used for pharmacokinetic studies and in vivo studies. The intracellular and plasma drug concentrations were determined by HPLC analysis. Activation of ER stress was detected by western blot analysis and secreted alkaline phosphatase (SEAP) reporter assay. Reactive oxygen species (ROS) was measured using dichlorodihydrofluorescein diacetate as a probe. Cell viability was determined by Roche’s cell proliferation reagent WST-1. Protein levels of inflammatory cytokines (TNF-α and IL-6) were determined by Enzyme-linked immunosorbent assays (ELISA). The intestinal permeability was assessed by luminal enteral administration of fluorescein isothiocyanate conjugated

  17. Development of a novel self-microemulsifying drug delivery system for reducing HIV protease inhibitor-induced intestinal epithelial barrier dysfunction.


    Lei, Bokai; Zha, Weibin; Wang, Yun; Wen, Cong; Studer, Elaine J; Wang, Xuan; Jin, Fang; Wang, Guangji; Zhang, Luyong; Zhou, Huiping


    The development of HIV protease inhibitors (PIs) has been one of the most significant advances of the past decade in controlling HIV infection. Unfortunately, the benefits of HIV PIs are compromised by serious side effects. One of the most frequent and deleterious side effects of HIV PIs is severe gastrointestinal (GI) disorders including mucosal erosions, epithelial barrier dysfunction, and leak-flux diarrhea, which occurs in 16-62% of patients on HIV PIs. Although the underlying mechanisms behind HIV PI-associated serious adverse side effects remain to be identified, our recent studies have shown that activation of endoplasmic reticulum (ER) stress response plays a critical role in HIV PI-induced GI complications. The objective of this study was to develop a novel self-microemulsifying drug delivery system (SMEDDS) using various antioxidants as surfactants and cosurfactants to reduce the GI side effects of the most commonly used HIV PI, ritonavir. The biological activities of this SMSDDS of ritonavir were compared with that of Norvir, which is currently used in the clinic. Rat normal intestinal epithelial cells (IEC-6) and mouse Raw 264.7 macrophages were used to examine the effect of new SMEDDS of ritonavir on activation of ER stress and oxidative stress. Sprague-Dawley rats and C57/BL6 mice were used for pharmacokinetic studies and in vivo studies. The intracellular and plasma drug concentrations were determined by HPLC analysis. Activation of ER stress was detected by Western blot analysis and secreted a