NASA Technical Reports Server (NTRS)
Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.
1992-01-01
Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.
NASA Technical Reports Server (NTRS)
Casay, G. A.; Wilson, W. W.
1992-01-01
One type of hardware used to grow protein crystals in the microgravity environment aboard the U.S. Space Shuttle is a hanging drop vapor diffusion apparatus (HDVDA). In order to optimize crystal growth conditions, dynamic control of the HDVDA is desirable. A critical component in the dynamically controlled system is a detector for protein nucleation. We have constructed a laser scattering detector for the HDVDA capable of detecting the nucleation stage. The detector was successfully tested for several scatterers differing in size using dynamic light scattering techniques. In addition, the ability to detect protein nucleation using the HDVDA was demonstrated for lysozyme.
Leach, R. N.; Stevens, F.; Langford, S. C.; Dickinson, J. T.
2008-01-01
Dropwise condensation of water vapor from a naturally cooling, hot water reservoir onto a hydrophobic polymer film and a silanized glass slide was studied by direct observation and simulations. The observed drop growth kinetics suggest that smallest drops grow principally by the diffusion of water adsorbed on the substrate to the drop perimeter, while drops larger than 50 μm in diameter grow principally by direct deposition from the vapor onto the drop surface. Drop coalescence plays a critical role in determining the drop size distribution, and stimulates the nucleation of new, small drops on the substrates. Simulations of drop growth incorporating these growth mechanisms provide a good description of the observed drop size distribution. Because of the large role played by coalescence, details of individual drop growth make little difference to the final drop size distribution. The rate of condensation per unit substrate area is especially high for the smallest drops, and may help account for the high heat transfer rates associated with dropwise condensation relative to filmwise condensation in heat exchange applications. PMID:17014129
Hanging drop crystal growth apparatus and method
NASA Technical Reports Server (NTRS)
Carter, Daniel C. (Inventor); Smith, Robbie E. (Inventor)
1989-01-01
An apparatus (10) is constructed having a cylindrical enclosure (16) within which a disc-shaped wicking element (18) is positioned. A well or recess (22) is cut into an upper side (24) of this wicking element, and a glass cover plate or slip (28) having a protein drop disposed thereon is sealably positioned on the wicking element (18), with drop (12) being positioned over well or recess (22). A flow of control fluid is generated by a programmable gradient former (16), with this control fluid having a vapor pressure that is selectively variable. This flow of control fluid is coupled to the wicking element (18) where control fluid vapor diffusing from walls (26) of the recess (22) is exposed to the drop (12), forming a vapor pressure gradient between the drop (12) and the control fluid vapor. Initially, this gradient is adjusted to draw solvent from the drop (12) at a relatively high rate, and as the critical supersaturation point is approached (the point at which crystal nucleation occurs), the gradient is reduced to more slowly draw solvent from the drop (12). This allows discrete protein molecules more time to orient themselves into an ordered crystalline lattice, producing protein crystals which, when processed by X-ray crystallography, possess a high degree of resolution.
Atomistic modeling of dropwise condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sikarwar, B. S., E-mail: bssikarwar@amity.edu; Singh, P. L.; Muralidhar, K.
The basic aim of the atomistic modeling of condensation of water is to determine the size of the stable cluster and connect phenomena occurring at atomic scale to the macroscale. In this paper, a population balance model is described in terms of the rate equations to obtain the number density distribution of the resulting clusters. The residence time is taken to be large enough so that sufficient time is available for all the adatoms existing in vapor-phase to loose their latent heat and get condensed. The simulation assumes clusters of a given size to be formed from clusters of smallermore » sizes, but not by the disintegration of the larger clusters. The largest stable cluster size in the number density distribution is taken to be representative of the minimum drop radius formed in a dropwise condensation process. A numerical confirmation of this result against predictions based on a thermodynamic model has been obtained. Results show that the number density distribution is sensitive to the surface diffusion coefficient and the rate of vapor flux impinging on the substrate. The minimum drop radius increases with the diffusion coefficient and the impinging vapor flux; however, the dependence is weak. The minimum drop radius predicted from thermodynamic considerations matches the prediction of the cluster model, though the former does not take into account the effect of the surface properties on the nucleation phenomena. For a chemically passive surface, the diffusion coefficient and the residence time are dependent on the surface texture via the coefficient of friction. Thus, physical texturing provides a means of changing, within limits, the minimum drop radius. The study reveals that surface texturing at the scale of the minimum drop radius does not provide controllability of the macro-scale dropwise condensation at large timescales when a dynamic steady-state is reached.« less
Film boiling of mercury droplets
NASA Technical Reports Server (NTRS)
Baumeister, K. J.; Schoessow, G. J.; Chmielewski, C. E.
1975-01-01
Vaporization times of mercury droplets in Leidenfrost film boiling on a flat horizontal plate are measured in an air atmosphere. Extreme care was used to prevent large amplitude droplet vibrations and surface wetting; therefore, these data can be compared to film boiling theory. Diffusion from the upper surface of the drop appears as a dominant mode of mass transfer from the drop. A closed-form analytical film boiling theory is developed to account for the diffusive evaporation. Reasonable agreement between data and theory is seen.
Evaporation of a sessile water drop and a drop of aqueous salt solution.
Misyura, S Y
2017-11-07
The influence of various factors on the evaporation of drops of water and aqueous salt solution has been experimentally studied. Typically, in the studies of drop evaporation, only the diffusive vapor transfer, radiation and the molecular heat conduction are taken into account. However, vapor-gas convection plays an important role at droplet evaporation. In the absence of droplet boiling, the influence of gas convection turns out to be the prevailing factor. At nucleate boiling, a prevailing role is played by bubbles generation and vapor jet discharge at a bubble collapse. The gas convection behavior for water and aqueous salt solution is substantially different. With a growth of salt concentration over time, the influence of the convective component first increases, reaches an extremum and then significantly decreases. At nucleate boiling in a salt solution it is incorrect to simulate the droplet evaporation and the heat transfer in quasi-stationary approximation. The evaporation at nucleate boiling in a liquid drop is divided into several characteristic time intervals. Each of these intervals is characterized by a noticeable change in both the evaporation rate and the convection role.
NASA Technical Reports Server (NTRS)
Fowlis, William W.; Delucas, Lawrence J.; Twigg, Pamela J.; Howard, Sandra B.; Meehan, Edward J.
1988-01-01
The principles of the hanging-drop method of crystal growth are discussed, and the rate of water evaporation in a water droplet (containing protein, buffer, and a precipitating agent) suspended above a well containing a double concentration of precipitating agent is investigated theoretically. It is shown that, on earth, the rate of evaporation may be determined from diffusion theory and the colligative properties of solutions. The parameters affecting the rate of evaporation include the temperature, the vapor pressure of water, the ionization constant of the salt, the volume of the drop, the contact angle between the droplet and the coverslip, the number of moles of salt in the droplet, the number of moles of water and salt in the well, the molar volumes of water and salt, the distance from the droplet to the well, and the coefficient of diffusion of water vapor through air. To test the theoretical equations, hanging-drop experiments were conducted using various reagent concentrations in 25-microliter droplets and measuring the evaporation times at 4 C and 25 C. The results showed good agreement with the theory.
Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J
2013-12-01
Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.
Drop deployment system for crystal growth apparatus
NASA Technical Reports Server (NTRS)
Rhodes, Percy (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)
1990-01-01
A crystal growth apparatus is presented. It utilizes a vapor diffusion method for growing protein crystals, and particularly such an apparatus wherein a ball mixer is used to mix the fluids that form a drop within which crystals are grown. Particular novelty of this invention lies in utilizing a ball mixer to completely mix the precipitate and protein solutions prior to forming the drop. Additional novelty lies in details of construction of the vials, the fluid deployment system, and the fluid storage system of the preferred embodiment.
Sigalotti, Leonardo Di G; Troconis, Jorge; Sira, Eloy; Peña-Polo, Franklin; Klapp, Jaime
2015-07-01
The rapid evaporation and explosive boiling of a van der Waals (vdW) liquid drop in microgravity is simulated numerically in two-space dimensions using the method of smoothed particle hydrodynamics. The numerical approach is fully adaptive and incorporates the effects of surface tension, latent heat, mass transfer across the interface, and liquid-vapor interface dynamics. Thermocapillary forces are modeled by coupling the hydrodynamics to a diffuse-interface description of the liquid-vapor interface. The models start from a nonequilibrium square-shaped liquid of varying density and temperature. For a fixed density, the drop temperature is increased gradually to predict the point separating normal boiling at subcritical heating from explosive boiling at the superheat limit for this vdW fluid. At subcritical heating, spontaneous evaporation produces stable drops floating in a vapor atmosphere, while at near-critical heating, a bubble is nucleated inside the drop, which then collapses upon itself, leaving a smaller equilibrated drop embedded in its own vapor. At the superheat limit, unstable bubble growth leads to either fragmentation or violent disruption of the liquid layer into small secondary drops, depending on the liquid density. At higher superheats, explosive boiling occurs for all densities. The experimentally observed wrinkling of the bubble surface driven by rapid evaporation followed by a Rayleigh-Taylor instability of the thin liquid layer and the linear growth of the bubble radius with time are reproduced by the simulations. The predicted superheat limit (T(s)≈0.96) is close to the theoretically derived value of T(s)=1 at zero ambient pressure for this vdW fluid.
NASA Technical Reports Server (NTRS)
Todd, Paul; Sportiello, Michael G.; Gregory, Derek; Cassanto, John M.; Alvarado, Ulises A.; Ostroff, Robert; Korszun, Z. R.
1993-01-01
Two methods of protein crystallization, osmotic dewatering and liquid-liquid diffusion, like the vapor diffusion (hanging-drop and sessile-drop) methods allow a gradual approach to supersaturation conditions. The crystallization of hen egg-white lysozyme, an extensively characterized protein crystal, in the presence of sodium chloride was used as an experimental model with which to compare these two methods in low gravity and in the laboratory. Comparisons of crystal growth rates by the two methods under the two conditions have, to date, indicated that the rate of crystal growth by osmotic dewatering is nearly the same in low gravity and on the ground, while much faster crystal growth rates can be achieved by the liquid-liquid diffusion method in low gravity.
Tanaka, Hiroaki; Inaka, Koji; Sugiyama, Shigeru; Takahashi, Sachiko; Sano, Satoshi; Sato, Masaru; Yoshitomi, Susumu
2004-01-01
We developed a new protein crystallization method has been developed using a simplified counter-diffusion method for optimizing crystallization condition. It is composed of only a single capillary, the gel in the silicon tube and the screw-top test tube, which are readily available in the laboratory. The one capillary can continuously scan a wide range of crystallization conditions (combination of the concentrations of the precipitant and the protein) unless crystallization occurs, which means that it corresponds to many drops in the vapor-diffusion method. The amount of the precipitant and the protein solutions can be much less than in conventional methods. In this study, lysozyme and alpha-amylase were used as model proteins for demonstrating the efficiency of this method. In addition, one-dimensional (1-D) simulations of the crystal growth were performed based on the 1-D diffusion model. The optimized conditions can be applied to the initial crystallization conditions for both other counter-diffusion methods with the Granada Crystallization Box (GCB) and for the vapor-diffusion method after some modification.
An evaporation model of multicomponent solution drops
NASA Astrophysics Data System (ADS)
Sartori, Silvana; Liñán, Amable; Lasheras, Juan C.
2010-11-01
Solutions of polymers are widely used in the pharmaceutical industry as tablets coatings. These allow controlling the rate at which the drug is delivered, taste or appearance. The coating is performed by spraying and drying the tablets at moderate temperatures. The wetting of the coating solution on the pill's surface depends on the droplet Webber and Re numbers, angle of impact and on the rheological properties of the droplet. We present a model for the evaporation of multicomponent solutions droplets in a hot air environment with temperatures substantially lower than the boiling temperature of the solvent. As the liquid vaporizes from the surface the fluid in the drop increases in concentration, until reaching its saturation point. After saturation, precipitation occurs uniformly within the drop. As the surface regresses, a compacting front formed by the precipitate at its maximum packing density advances into the drop, while the solute continues precipitating uniformly. This porous shell grows fast due to the double effect of surface regression and precipitation. The evaporation rate is determined by the rates at which heat is transported to the droplet surface and at which liquid vapor diffuses away from it. When the drop is fully compacted, the evaporation is drastically reduced.
Protein crystal growth results from shuttle flight 51-F
NASA Technical Reports Server (NTRS)
Bugg, C. E.
1985-01-01
The protein crystal growth (PCG) experiments run on 51-F were analyzed. It was found that: (1) sample stability is increased over that observed during the experiments on flight 51-D; (2) the dialysis experiments produced lysozyme crystals that were significantly larger than those obtained in our identical ground-based studies; (3) temperature fluctuations apparently caused problems during the crystallization experiments on 51-F; (4) it is indicated that teflon tape stabilizes droplets on the syringe tips; (5) samples survived during the reentry and landing in glass tips that were not stoppered with plungers; (6) from the ground-based studies, it was expected that equilibration should be complete within 2 to 4 days for all of these vapor-diffusion experiments, thus it appears that the vapor diffusion rates are somewhat slower under microgravity conditions; (7) drop tethering was highly successful, all four of the tethered drops were stable, even though they contained MPD solutions; (8) the PCG experiments on 51-F were done to assess the hardware and experimental procedures that are developed for future flights, when temperature control will be available. Lysozyme crystals obtained by microdialysis are considerably larger than those obtained on the ground, using the identical apparatus and procedures.
Crystallization and X-ray analysis of the salmon-egg lectin SEL24K
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu
2007-05-01
The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less
Assessment of water droplet evaporation mechanisms on hydrophobic and superhydrophobic substrates.
Pan, Zhenhai; Dash, Susmita; Weibel, Justin A; Garimella, Suresh V
2013-12-23
Evaporation rates are predicted and important transport mechanisms identified for evaporation of water droplets on hydrophobic (contact angle ~110°) and superhydrophobic (contact angle ~160°) substrates. Analytical models for droplet evaporation in the literature are usually simplified to include only vapor diffusion in the gas domain, and the system is assumed to be isothermal. In the comprehensive model developed in this study, evaporative cooling of the interface is accounted for, and vapor concentration is coupled to local temperature at the interface. Conjugate heat and mass transfer are solved in the solid substrate, liquid droplet, and surrounding gas. Buoyancy-driven convective flows in the droplet and vapor domains are also simulated. The influences of evaporative cooling and convection on the evaporation characteristics are determined quantitatively. The liquid-vapor interface temperature drop induced by evaporative cooling suppresses evaporation, while gas-phase natural convection acts to enhance evaporation. While the effects of these competing transport mechanisms are observed to counterbalance for evaporation on a hydrophobic surface, the stronger influence of evaporative cooling on a superhydrophobic surface accounts for an overprediction of experimental evaporation rates by ~20% with vapor diffusion-based models. The local evaporation fluxes along the liquid-vapor interface for both hydrophobic and superhydrophobic substrates are investigated. The highest local evaporation flux occurs at the three-phase contact line region due to proximity to the higher temperature substrate, rather than at the relatively colder droplet top; vapor diffusion-based models predict the opposite. The numerically calculated evaporation rates agree with experimental results to within 2% for superhydrophobic substrates and 3% for hydrophobic substrates. The large deviations between past analytical models and the experimental data are therefore reconciled with the comprehensive model developed here.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago
2006-02-01
D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less
Molecular dynamics study of the vaporization of an ionic drop.
Galamba, N
2010-09-28
The melting of a microcrystal in vacuum and subsequent vaporization of a drop of NaCl were studied through molecular dynamics simulations with the Born-Mayer-Huggins-Tosi-Fumi rigid-ion effective potential. The vaporization was studied for a single isochor at increasing temperatures until the drop completely vaporized, and gaseous NaCl formed. Examination of the vapor composition shows that the vapor of the ionic drop and gaseous NaCl are composed of neutral species, the most abundant of which, ranging from simple NaCl monomers (ion pairs) to nonlinear polymers, (Na(n)Cl(n))(n=2-4). The enthalpies of sublimation, vaporization, and dissociation of the different vapor species are found to be in reasonable agreement with available experimental data. The decrease of the enthalpy of vaporization of the vapor species, with the radius of the drop decrease, accounts for a larger fraction of trimers and tetramers than that inferred from experiments. Further, the rhombic dimer is significantly more abundant than its linear isomer although the latter increases with the temperature. The present results suggest that both trimers and linear dimers may be important to explain the vapor pressure of molten NaCl at temperatures above 1500 K.
A Fiber Optic Probe for Monitoring Protein Aggregation, Nucleation, and Crystallization
NASA Technical Reports Server (NTRS)
Ansari, Rafat R.; Suh, Kwang I.; Arabshahi, Alireza; Wilson, William W.; Bray, Terry L.; DeLucas, Lawrence J.
1996-01-01
Protein crystals are experimentally grown in hanging drops in microgravity experiments on-board the Space Shuttle orbiter. The technique of dynamic light scattering (DLS) can be used to monitor crystal growth process in hanging droplets (approx. 30 (L)) in microgravity experiments, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. In this paper we demonstrate that such experiments are now feasible. We apply a newly developed fiber optic probe to various earth and space (micro- gravity) bound protein crystallization system configurations to test its capability. These include conventional batch (cuvette or capillary) systems, hanging drop method in a six-pack hanging drop vapor diffusion apparatus (HDVDA), a modified HDVDA for temperature- induced nucleation and aggregation studies, and a newly envisioned dynamically controlled vapor diffusion system (DCVDS) configuration. Our compact system exploits the principles of DLS and offers a fast (within a few seconds) means of quantitatively and non-invasively monitoring the various growth stages of protein crystallization. In addition to DLS capability, the probe can also be used for performing single-angle static light scattering measurements. It utilizes extremely low levels of laser power (approx. few (W)) without a need of having any optical alignment and vibration isolation. The compact probe is also equipped with a miniaturized microscope for visualization of macroscopic protein crystals. This new optical diagnostic system opens up enormous opportunity for exploring new ways to grow good quality crystals suitable for x-ray crystallographic analysis and may help develop a concrete scientific basis for understanding the process of crystallization.
Behavior of fluids in a weightless environment
NASA Technical Reports Server (NTRS)
Fester, D. A.; Eberhardt, R. N.; Tegart, J. R.
1977-01-01
Fluid behavior in a low-g environment is controlled primarily by surface tension forces. Certain fluid and system characteristics determine the magnitude of these forces for both a free liquid surface and liquid in contact with a solid. These characteristics, including surface tension, wettability or contact angle, system geometry, and the relationships governing their interaction, are discussed. Various aspects of fluid behavior in a low-g environment are then presented. This includes the formation of static interface shapes, oscillation and rotation of drops, coalescence, the formation of foams, tendency for cavitation, and diffusion in liquids which were observed during the Skylab fluid mechanics science demonstrations. Liquid reorientation and capillary pumping to establish equilibrium configurations for various system geometries, observed during various free-fall (drop-tower) low-g tests, are also presented. Several passive low-g fluid storage and transfer systems are discussed. These systems use surface tension forces to control the liquid/vapor interface and provide gas-free liquid transfer and liquid-free vapor venting.
Combustion Characteristics of Sprays
1989-08-01
Lin. T. H.. and Sohrab. S. H. (1987). On the transition oi’diffusion to premixed I’lames in consers.ed ssstem Cornhusio. Flume 68. 73. Mlizutani. Y ...and Nakauima. A. (1973a). Combustion of fuel vapor-drop-air systems: Part 1-Open burner flames. Combust. F/ante 21.14. Mizutani. Y .. and Nakajima. A...AFOSR LES Final Report. AFRPL. Sohrab. S. H.. Ye. Z. Y .. and Law~k C. K. (1984). An experimenial investication on ilame interaction ano the
Looking Under a Leidenfrost Drop
NASA Astrophysics Data System (ADS)
Burton, Justin; Sharpe, Aaron; van der Veen, Roeland; Franco, Andres; Nagel, Sidney
2011-11-01
The Leidenfrost effect can be observed when small water drops move around effortlessly without sticking on a hot pan. The transition to a levitated state, where the drops rest on an insulating layer of vapor, occurs at the Leidenfrost temperature. Experiment and theory have examined the lifetime and maximum size of Leidenfrost drops. However, the liquid-vapor interface beneath the drop has not been fully charcterized. We report experiments using laser-light interference to measure the geometry of the liquid-vapor interface. By imaging the interference fringes produced between the bottom surface of the liquid and the hot substrate, we can measure the curvature of the vapor pocket beneath the drop as well as the azimuthal undulations along the neck that sits closest to the surface. From these measurements, we can extrapolate the shape of the bottom of the drop, which fluctuates in time with a period of a few milliseconds for millimeter-sized water drops. Our measurements of the azimuthal neck radius agree with predictions: the difference between the drop and neck radii, (Rd -Rn) ~0.53 λ in the limit of large drops where λ is the capillary length of the fluid. For small drops we recover the result found in that Rn ~Rd2 / λ .
Dynamics of gas bubble growth in a supersaturated solution with Sievert's solubility law.
Gor, G Yu; Kuchma, A E
2009-07-21
This paper presents a theoretical description of diffusion growth of a gas bubble after its nucleation in supersaturated liquid solution. We study systems where gas molecules completely dissociate in the solvent into two parts, thus making Sievert's solubility law valid. We show that the difference between Henry's and Sievert's laws for chemical equilibrium conditions causes the difference in bubble growth dynamics. Assuming that diffusion flux is steady we obtain a differential equation on bubble radius. Bubble dynamics equation is solved analytically for the case of homogeneous nucleation of a bubble, which takes place at a significant pressure drop. We also obtain conditions of diffusion flux steadiness. The fulfillment of these conditions is studied for the case of nucleation of water vapor bubbles in magmatic melts.
Saridakis, Emmanuel; Chayen, Naomi E.
2003-01-01
A systematic approach for improving protein crystals by growing them in the metastable zone using the vapor diffusion technique is described. This is a simple technique for optimization of crystallization conditions. Screening around known conditions is performed to establish a working phase diagram for the crystallization of the protein. Dilutions of the crystallization drops across the supersolubility curve into the metastable zone are then carried out as follows: the coverslips holding the hanging drops are transferred, after being incubated for some time at conditions normally giving many small crystals, over reservoirs at concentrations which normally yield clear drops. Fewer, much larger crystals are obtained when the incubation times are optimized, compared with conventional crystallization at similar conditions. This systematic approach has led to the structure determination of the light-harvesting protein C-phycocyanin to the highest-ever resolution of 1.45 Å. PMID:12547801
Three dimensional modeling of cirrus during the 1991 FIRE IFO 2: Detailed process study
NASA Technical Reports Server (NTRS)
Jensen, Eric J.; Toon, Owen B.; Westphal, Douglas L.
1993-01-01
A three-dimensional model of cirrus cloud formation and evolution, including microphysical, dynamical, and radiative processes, was used to simulate cirrus observed in the FIRE Phase 2 Cirrus field program (13 Nov. - 7 Dec. 1991). Sulfate aerosols, solution drops, ice crystals, and water vapor are all treated as interactive elements in the model. Ice crystal size distributions are fully resolved based on calculations of homogeneous freezing of solution drops, growth by water vapor deposition, evaporation, aggregation, and vertical transport. Visible and infrared radiative fluxes, and radiative heating rates are calculated using the two-stream algorithm described by Toon et al. Wind velocities, diffusion coefficients, and temperatures were taken from the MAPS analyses and the MM4 mesoscale model simulations. Within the model, moisture is transported and converted to liquid or vapor by the microphysical processes. The simulated cloud bulk and microphysical properties are shown in detail for the Nov. 26 and Dec. 5 case studies. Comparisons with lidar, radar, and in situ data are used to determine how well the simulations reproduced the observed cirrus. The roles played by various processes in the model are described in detail. The potential modes of nucleation are evaluated, and the importance of small-scale variations in temperature and humidity are discussed. The importance of competing ice crystal growth mechanisms (water vapor deposition and aggregation) are evaluated based on model simulations. Finally, the importance of ice crystal shape for crystal growth and vertical transport of ice are discussed.
Propelling a water drop with the vapor-mediated Marangoni effect
NASA Astrophysics Data System (ADS)
Kim, Seungho; Kim, Ho-Young
2013-11-01
We show that a water drop on solid surfaces can be propelled just by placing a volatile alcohol drop nearby. It is found to be because the water-air interface near the alcohol drop mixes with alcohol vapor, thereby locally lowering the surface tension. The surface-tension-gradient induces the motion of the water drop, enabling the trajectory control of water drops through the motion of remote alcohol drops. This vapor-mediated Marangoni effect also gives rise to other interesting interfacial flow phenomena, such as nucleation of holes on a water film and ballooning of a water drop hanging from a syringe needle with the approach of an alcohol drop. We visualize such interfacial dynamics with a high-speed camera and rationalize their salient features by scaling analysis. This work was supported by the National Research Foundation of Korea (grant no. 2012-008023).
Star-shaped oscillations of Leidenfrost drops
NASA Astrophysics Data System (ADS)
Ma, Xiaolei; Liétor-Santos, Juan-José; Burton, Justin C.
2017-03-01
We experimentally investigate the self-sustained, star-shaped oscillations of Leidenfrost drops. The drops levitate on a cushion of evaporated vapor over a heated, curved surface. We observe modes with n =2 -13 lobes around the drop periphery. We find that the wavelength of the oscillations depends only on the capillary length of the liquid and is independent of the drop radius and substrate temperature. However, the number of observed modes depends sensitively on the liquid viscosity. The dominant frequency of pressure variations in the vapor layer is approximately twice the drop oscillation frequency, consistent with a parametric forcing mechanism. Our results show that the star-shaped oscillations are driven by capillary waves of a characteristic wavelength beneath the drop and that the waves are generated by a large shear stress at the liquid-vapor interface.
Controlling Vapor Pressure In Hanging-Drop Crystallization
NASA Technical Reports Server (NTRS)
Carter, Daniel C.; Smith, Robbie
1988-01-01
Rate of evaporation adjusted to produce larger crystals. Device helps to control vapor pressure of water and other solvents in vicinity of hanging drop of solution containing dissolved enzyme protein. Well of porous frit (sintered glass) holds solution in proximity to drop of solution containing protein or enzyme. Vapor from solution in frit controls evaporation of solvent from drop to control precipitation of protein or enzyme. With device, rate of nucleation limited to decrease number and increase size (and perhaps quality) of crystals - large crystals of higher quality needed for x-ray diffraction studies of macromolecules.
Drop deployment system for crystal growth apparatus
NASA Technical Reports Server (NTRS)
Rhodes, Percy H. (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)
1992-01-01
This invention relates to a crystal growth apparatus (10) generally used for growing protein crystals wherein a vapor diffusion method is used for growing the crystals. In this apparatus, a precipitating solution and a solution containing dissolved crystalline material are stored in separate vials (12, 14), each having a resilient diaphragm (28) across one end and an opening (24) with a puncturable septum (26) thereacross at an opposite end. The vials are placed in receptacles (30) having a manifold (41) with a manifold diaphragm (42) in contact with the vial diaphragm at one end of the receptacle and a hollow needle (36) for puncturing the septum at the other end of the manifold. The needles of each vial communicate with a ball mixer (40) that mixes the precipitate and protein solutions and directs the mixed solution to a drop support (64) disposed in a crystal growth chamber (16), the drop support being a tube with an inner bevelled surface (66) that provides more support for the drop (68) than the tubes of the prior art. A sealable storage region (70) intermediate the drop support and mixer provides storage of the drop (68) and the grown crystals.
Effects of Evaporation/Condensation on Spreading and Contact Angle of a Volatile Liquid Drop
NASA Technical Reports Server (NTRS)
Zhang, Nengli; Chao, David F.; Singh, Bhim S. (Technical Monitor)
2000-01-01
Effects of evaporation/condensation on spreading and contact angle were experimentally studied. A sessile drop of R-113 was tested at different vapor environments to determine the effects of evaporation/condensation on the evolution of contact diameter and contact angle of the drop. Condensation on the drop surface occurs at both the saturated and a nonsaturated vapor environments and promotes the spreading. When the drop is placed in the saturated vapor environment it tends to completely wetting and spreads rapidly. In a nonsaturated vapor environment, the evolution of the sessile drop is divided three stages: condensation-spreading stage, evaporation-retracting stage and rapid contracting stage. In the first stage the drop behaves as in the saturated environment. In the evaporation -retracting stage, the competition between spreading and evaporation of the drop determines the evolution characteristics of the contact diameter and the contact angle. A lower evaporation rate struggles against the spreading power to turn the drop from spreading to retracting with a continuous increase of the contact angle. The drop placed in open air has a much higher evaporation rate. The strong evaporation suppresses the spreading and accelerates the retraction of the drop with a linear decrease of the contact diameter. The contraction of the evaporating drops is gradually accelerated when the contact diameter decreases to 3 min and less till drying up, though the evaporation rate is gradually slowing down.
Computer simulations of nematic drops: Coupling between drop shape and nematic order
NASA Astrophysics Data System (ADS)
Rull, L. F.; Romero-Enrique, J. M.; Fernandez-Nieves, A.
2012-07-01
We perform Monte Carlo computer simulations of nematic drops in equilibrium with their vapor using a Gay-Berne interaction between the rod-like molecules. To generate the drops, we initially perform NPT simulations close to the nematic-vapor coexistence region, allow the system to equilibrate and subsequently induce a sudden volume expansion, followed with NVT simulations. The resultant drops coexist with their vapor and are generally not spherical but elongated, have the rod-like particles tangentially aligned at the surface and an overall nematic orientation along the main axis of the drop. We find that the drop eccentricity increases with increasing molecular elongation, κ. For small κ the nematic texture in the drop is bipolar with two surface defects, or boojums, maximizing their distance along this same axis. For sufficiently high κ, the shape of the drop becomes singular in the vicinity of the defects, and there is a crossover to an almost homogeneous texture; this reflects a transition from a spheroidal to a spindle-like drop.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Chunmao; Yu, You; Yang, Maojun, E-mail: maojunyang@tsinghua.edu.cn
2015-10-23
Fhb is a surface virulence protein from Streptococcus suis, which could aid bacterial evasion of host innate immune defense by recruiting complement regulator factor H to inactivate C3b deposited on bacterial surface in blood. Here we successfully expressed and purified the N terminal domain of Fhb (N-Fhb) and obtained crystals of the N-Fhb by sitting-drop vapor diffusion method with a resolution of 1.50 Å. The crystals belong to space group C2 with unit cell parameters a = 127.1 Å, b = 77.3 Å, c = 131.6 Å, α = 90°, β = 115.9°, γ = 90°. The structure of N-Fhb was determined by SAD method and the core structure of N-Fhb is a β sandwich. Wemore » speculated that binding of Fhb to human factor H may be mainly mediated by surface amino acids with negative charges. - Highlights: • We expressed N-Fhb as the soluble protein in Escherichia coli. • Crystals of N-Fhb were grown by sitting drop vapor diffusion method. • Crystals of N-Fhb could diffracted to 1.5 Å. • The core structure of N-Fhb was a β sandwich. • A part of the surface of N-Fhb was rich with negative charges.« less
Gas Suppression via Copper Interlayers in Magnetron Sputtered Al-Cu2O Multilayers.
Kinsey, Alex H; Slusarski, Kyle; Sosa, Steven; Weihs, Timothy P
2017-07-05
The use of thin-foil, self-propagating thermite reactions to bond components successfully depends on the ability to suppress gas generation and avoid pore formation during the exothermic production of brazes. To study the mechanisms of vapor production in diluted thermites, thin film multilayer Al-Cu-Cu 2 O-Cu foils are produced via magnetron sputtering, where the Cu layer thickness is systematically increased from 0 to 100 nm in 25 nm increments. The excess Cu layers act as diffusion barriers, limiting the transport of oxygen from the oxide to the Al fuel, as determined by slow heating differential scanning calorimetry experiments. Furthermore, by adding excess Cu to the system, the temperature of the self-propagating thermite reactions drops below the boiling point of Cu, eliminating the metal vapor production. It is determined that Cu vapor production can be eliminated by increasing the Cu interlayer thickness above 50 nm. However, the porous nature of the final products suggests that only metal vapor production is suppressed via dilution. Gas generation via oxygen release is still capable of producing a porous reaction product.
Some mechanisms for the formation of octopus-shaped iron micro-particles
NASA Astrophysics Data System (ADS)
Bica, Ioan
2004-08-01
Fluid spheres (micro-spheres or/and drops) are formed out of the metallic solid (the carbon steel semi-finished product) in the argon plasma of the transferred electric arc. For short intervals of time, the spheres are at rest with relation to vapors. The movement of the vapors around the spheres is in the same plane. It consists of a movement around a circle combined with the movement produced by a definitely located whirl. The molar concentration of the vapors is small in comparison with the molar density of the mixture formed of vapors and gas. At the intersection of the sphere and the plane of movement of the vapors, distinct stagnation point is formed. They constitute points of the beginning/and end of the current lines. Each current line is a carrier of a vapor cylinder. In time, the cylinder-gas interface reaches points of temperature equal to that of the "dew point" for iron. On this occasion a liquid membrane is formed. It delimits the vapor-gas mixture from the rest of the gas. Subsequent to the process of diffusion in non-stationary condition, the membrane becomes thicker and no vapors exist inside the tube. Needle-shaped micro-tubes are formed, in liquid phase, around the fluid sphere. By solidification, micro-particles occur, consisting of a central nucleus around which ligaments branch out.
Performance of some nucleation theories with a nonsharp droplet-vapor interface.
Napari, Ismo; Julin, Jan; Vehkamäki, Hanna
2010-10-21
Nucleation theories involving the concept of nonsharp boundary between the droplet and vapor are compared to recent molecular dynamics (MD) simulation data of Lennard-Jones vapors at temperatures above the triple point. The theories are diffuse interface theory (DIT), extended modified liquid drop-dynamical nucleation theory (EMLD-DNT), square gradient theory (SGT), and density functional theory (DFT). Particular attention is paid to thermodynamic consistency in the comparison: the applied theories either use or, with a proper parameter adjustment, result in the same values of equilibrium vapor pressure, bulk liquid density, and surface tension as the MD simulations. Realistic pressure-density correlations are also used. The best agreement between the simulated nucleation rates and calculations is obtained from DFT, SGT, and EMLD-DNT, all of which, in the studied temperature range, show deviations of less than one order of magnitude in the nucleation rate. DIT underestimates the nucleation rate by up to two orders of magnitude. DFT and SGT give the best estimate of the molecular content of the critical nuclei. Overall, at the vapor conditions of this study, all the investigated theories perform better than classical nucleation theory in predicting nucleation rates.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harris, Paul T.; Raghunathan, Kannan; Spurbeck, Rachel R.
2010-09-02
Recombinant Lactobacillus jensenii enolase fused to a C-terminal noncleavable His tag was expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 3.25 {angstrom} resolution. The crystals belonged to space group I4, with unit-cell parameters a = b = 145.31, c = 99.79 {angstrom}. There were two protein subunits in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.8 {angstrom}{sup 3} Da{sup -1}, corresponding to 55.2% solvent content.
Protein crystal growth in space
NASA Technical Reports Server (NTRS)
Bugg, C. E.; Clifford, D. W.
1987-01-01
The advantages of protein crystallization in space, and the applications of protein crystallography to drug design, protein engineering, and the design of synthetic vaccines are examined. The steps involved in using protein crystallography to determine the three-dimensional structure of a protein are discussed. The growth chamber design and the hand-held apparatus developed for protein crystal growth by vapor diffusion techniques (hanging-drop method) are described; the experimental data from the four Shuttle missions are utilized to develop hardware for protein crystal growth in space and to evaluate the effects of gravity on protein crystal growth.
Microfabricated diffusion source
Oborny, Michael C [Albuquerque, NM; Frye-Mason, Gregory C [Cedar Crest, NM; Manginell, Ronald P [Albuquerque, NM
2008-07-15
A microfabricated diffusion source to provide for a controlled diffusion rate of a vapor comprises a porous reservoir formed in a substrate that can be filled with a liquid, a headspace cavity for evaporation of the vapor therein, a diffusion channel to provide a controlled diffusion of the vapor, and an outlet to release the vapor into a gas stream. The microfabricated diffusion source can provide a calibration standard for a microanalytical system. The microanalytical system with an integral diffusion source can be fabricated with microelectromechanical systems technologies.
Thermal activation of superheated lipid-coated perfluorocarbon drops.
Mountford, Paul A; Thomas, Alec N; Borden, Mark A
2015-04-28
This study explored the thermal conditions necessary for the vaporization of superheated perfluorocarbon nanodrops. Droplets C3F8 and C4F10 coated with a homologous series of saturated diacylphosphatidylcholines were formed by condensation of 4 μm diameter microbubbles. These drops were stable at room temperature and atmospheric pressure, but they vaporized back into microbubbles at higher temperatures. The vaporization transition was measured as a function of temperature by laser light extinction. We found that C3F8 and C4F10 drops experienced 90% vaporization at 40 and 75 °C, respectively, near the theoretical superheat limits (80-90% of the critical temperature). We therefore conclude that the metastabilty of these phase-change agents arises not from the droplet Laplace pressure altering the boiling point, as previously reported, but from the metastability of the pure superheated fluid to homogeneous nucleation. The rate of C4F10 drop vaporization was quantified at temperatures ranging from 55 to 75 °C, and an apparent activation energy barrier was calculated from an Arrhenius plot. Interestingly, the activation energy increased linearly with acyl chain length from C14 to C20, indicating that lipid interchain cohesion plays an important role in suppressing the vaporization rate. The vaporized drops (microbubbles) were found to be unstable to dissolution at high temperatures, particularly for C14 and C16. However, proper choice of the fluorocarbon and lipid species provided a nanoemulsion that could undergo at least ten reversible condensation/vaporization cycles. The vaporization properties presented in this study may facilitate the engineering of tunable phase-shift particles for diagnostic imaging, targeted drug delivery, tissue ablation, and other applications.
The origin of star-shaped oscillations of Leidenfrost drops
NASA Astrophysics Data System (ADS)
Ma, Xiaolei; Burton, Justin C.
We experimentally investigate the oscillations of Leidenfrost drops of water, liquid nitrogen, ethanol, methanol, acetone and isopropyl alcohol. The drops levitate on a cushion of evaporated vapor over a hot, curved surface which keeps the drops stationary. We observe star-shaped modes along the periphery of the drop, with mode numbers n = 2 to 13. The number of observed modes is sensitive to the properties of the liquid. The pressure oscillation frequency in the vapor layer under the drop is approximately twice that of the drop frequency, which is consistent with a parametric forcing mechanism. However, the Rayleigh and thermal Marangoni numbers are of order 10,000, indicating that convection should play a dominating role as well. Surprisingly, we find that the wavelength and frequency of the oscillations only depend on the thickness of the liquid, which is twice the capillary length, and do not depend on the mode number, substrate temperature, or the substrate curvature. This robust behavior suggests that the wavelength for the oscillations is set by thermal convection inside the drop, and is less dependent on the flow in the vapor layer under the drop
Automation of Vapor-Diffusion Growth of Protein Crystals
NASA Technical Reports Server (NTRS)
Hamrick, David T.; Bray, Terry L.
2005-01-01
Some improvements have been made in a system of laboratory equipment developed previously for studying the crystallization of proteins from solution by use of dynamically controlled flows of dry gas. The improvements involve mainly (1) automation of dispensing of liquids for starting experiments, (2) automatic control of drying of protein solutions during the experiments, and (3) provision for automated acquisition of video images for monitoring experiments in progress and for post-experiment analysis. The automation of dispensing of liquids was effected by adding an automated liquid-handling robot that can aspirate source solutions and dispense them in either a hanging-drop or a sitting-drop configuration, whichever is specified, in each of 48 experiment chambers. A video camera of approximately the size and shape of a lipstick dispenser was added to a mobile stage that is part of the robot, in order to enable automated acquisition of images in each experiment chamber. The experiment chambers were redesigned to enable the use of sitting drops, enable backlighting of each specimen, and facilitate automation.
46 CFR 39.30-1 - Operational requirements-TB/ALL.
Code of Federal Regulations, 2010 CFR
2010-10-01
... oxygen content of each area of that tank formed by each partial bulkhead must be measured at a point one... the requirements of this part. (b) The pressure drop through the vapor collection system from the most... rate versus the pressure drop. (c) If a vessel carries vapor hoses, the pressure drop through the hoses...
Self-Diffusion of Drops in a Dilute Sheared Emulsion
NASA Technical Reports Server (NTRS)
Loewenberg, Michael; Hinch, E. J.
1996-01-01
Self-diffusion coefficients that describe cross-flow migration of non-Brownian drops in a dilute sheared emulsion were obtained by trajectory calculations. A boundary integral formulation was used to describe pairwise interactions between deformable drops; interactions between undeformed drops were described with mobility functions for spherical drops. The results indicate that drops have large anisotropic self-diffusivities which depend strongly on the drop viscosity and modestly on the shear-rate. Pairwise interactions between drops in shear-flow do not appreciably promote drop breakup.
Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.
2010-11-12
Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.
Preliminary investigations of protein crystal growth using the Space Shuttle
NASA Technical Reports Server (NTRS)
Delucas, L. J.; Suddath, F. L.; Snyder, R.; Naumann, R.; Broom, M. B.; Pusey, M.; Yost, V.; Herren, B .; Carter, D.
1986-01-01
Four preliminary Shuttle experiments are described which have been used to develop prototype hardware for a more advanced system that will evaluate effects of gravity on protein crystal growth. The first phase of these experiments has centered on the development of micromethods for protein crystal growth by vapor-diffusion techniques (using a space version of the hanging-drop method) and on dialysis using microdialysis cells. Results suggest that the elimination of density-driven sedimentation can effect crystal morphology. In the dialysis experiment, space-grown crystals of concanavalin B were three times longer and 1/3 the thickness of earth-grown crystals.
Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina
2012-05-08
Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.
Micro-explosion of compound drops
NASA Astrophysics Data System (ADS)
Chen, Chun-Kuei; Lin, Ta-Hui
2014-08-01
Introducing water into spray combustion systems, by either water-in-oil emulsification or supplementary water injection, is one of the major techniques for combustion improvement and NOx reduction. Plentiful researches are available on combustion of water-in-oil emulsion fuel drops. The emulsified liquid is a heterogeneous mixture of immiscible liquids. One component forms the continuous phase and the other component forms the discrete phase. The discrete phase consists of globules of the one fluid that are suspended in the continuous phase fluid. Water-in-oil emulsions are commonly considered for combustion applications because emulsions can result in micro-explosion, thereby reducing the average drop diameter to enhance liquid vaporization, and suppressing the formation of soot and NOx. However, the water addition generally does not exceed about 20% for smooth engine operations[!, 21. The combustion characteristics and micro-explosion of emulsion drop were studied by many researchers. The micro-explosion of water in fuel emulsion drops was caused by very fast growth of superheated water vapor bubbles, its superheat limits must be lower than the boiling point temperature of the fuel. These bubbles were primarily governed by the pressure difference between the superheated vapor and the liquid, and by the inertia imparted to the liquid by the motion of the bubble surface[3 6 In this study, we used a coaxial nozzle to generation the multi-component drop. The different type of water-in-oil fuel drops called the compound drops. Unlike an emulsion drop, a compound drop consists of a water core and a fuel shell, which can originate from the phase separation of emulsion[7, 81 or a water drop colliding with a fuel drop[9, 101 Burning and micro-explosion of compound drops have been found to be distinct from those of emulsion drops[9-111 Wang et al.[9 , 101 studied the combustion characteristics of collision merged alkane-water drops. The merged drops appeared in adhesive and inserted manners. The drop ignition delay time increased with increasing water content. The average burning rate of alkane-water drops decreased with increasing water content. In the burning process, hexadecane-water drops exhibited flash vaporization or flame extinction. Heterogeneous explosion was occasionally observed in drops with trapped air bubbles. The air bubbles were assumed to be the nucleation points of the heterogeneous explosions. Chen and Lin[11 studied the characteristics of water-in-dodecane compound drop with different water content, diameter of drop and environmental oxygen concentration. The vaporization rate increased with increasing environmental oxygen concentration. The compound drops micro-exploded during the burning process in a random way. The number of micro-explosions was majorly influenced by drop diameter, followed by environmental oxygen concentration. Water content had a weaker effect on micro-explosion. As available literature and research results of compound drop burning are scarce, their combustion and micro-explosion behaviors are still poorly understood. In this regard, we changed the drop nature as compound drops to study their combustion characteristics and micro-explosion phenomena.
Portable vapor diffusion coefficient meter
Ho, Clifford K [Albuquerque, NM
2007-06-12
An apparatus for measuring the effective vapor diffusion coefficient of a test vapor diffusing through a sample of porous media contained within a test chamber. A chemical sensor measures the time-varying concentration of vapor that has diffused a known distance through the porous media. A data processor contained within the apparatus compares the measured sensor data with analytical predictions of the response curve based on the transient diffusion equation using Fick's Law, iterating on the choice of an effective vapor diffusion coefficient until the difference between the predicted and measured curves is minimized. Optionally, a purge fluid can forced through the porous media, permitting the apparatus to also measure a gas-phase permeability. The apparatus can be made lightweight, self-powered, and portable for use in the field.
Vélez-Cordero, J Rodrigo; Yáñez Soto, Bernardo; Arauz-Lara, José L
2016-08-16
Nonhomogeneous evaporation fluxes have been shown to promote the formation of internal currents in sessile droplets, explaining the patterns that suspended particles leave after the droplet has dried out. Although most evaporation experiments have been conducted using spherical-cap-shaped drops, which are essentially in an axisymmetric geometry, here we show an example of nonhomogeneous evaporation in asymmetric geometries, which is visualized by following the motion of colloidal particles along liquid fingers forming a meniscus at square corners. It is found that the particle's velocity increases with the diffusive evaporation factor [Formula: see text] for the three tested fluids: water, isopropyl alcohol (IPA), and ethanol (EtOH). Here, [Formula: see text] is the vapor diffusivity in air, RH is the relative amount of vapor in the atmosphere, and cs is the saturated vapor concentration. We observed that in IPA and EtOH the internal currents promote a 3D spiral motion, whereas in water the particle's trajectory is basically unidirectional. By adding 0.25 critical micelle concentration (CMC) of sodium dodecyl sulfate (SDS) surfactant in water, a velocity blast was observed in the whole circulation flow pattern, going from [Formula: see text] to nearly [Formula: see text] in the longitudinal velocity component. To assess the effect of breaking the axisymmetric condition on the evaporation flux profile, we numerically solved the diffusive equation in model geometries that preserve the value of the contact angle θ but introduce an additional angle ϕ that characterizes the solid substrate. By testing different combinations of θ and ϕ, we corroborated that the evaporation flux increases when the substrate and the gas-liquid curves meet at corners with increasing sharpness.
Dynamics and mass transport of solutal convection in a closed porous media system
NASA Astrophysics Data System (ADS)
Wen, Baole; Akhbari, Daria; Hesse, Marc
2016-11-01
Most of the recent studies of CO2 sequestration are performed in open systems where the constant partial pressure of CO2 in the vapor phase results in a time-invariant saturated concentration of CO2 in the brine (Cs). However, in some closed natural CO2 reservoirs, e.g., Bravo Dome in New Mexico, the continuous dissolution of CO2 leads to a pressure drop in the gas that is accompanied by a reduction of Cs and thereby affects the dynamics and mass transport of convection in the brine. In this talk, I discuss the characteristics of convective CO2 dissolution in a closed system. The gas is assumed to be ideal and its solubility given by Henry's law. An analytical solution shows that the diffusive base state is no longer self-similar and that diffusive mass transfer declines rapidly. Scaling analysis reveals that the volume ratio of brine and gas η determines the behavior of the system. DNS show that no constant flux regime exists for η > 0 nevertheless, the quantity F /Cs2 remains constant, where F is the dissolution flux. The onset time is only affected by η when the Rayleigh number Ra is small. In this case, the drop in Cs during the initial diffusive regime significantly reduces the effective Ra and therefore delays the onset.
Surface temperature measurements of a levitated water drop during laser irradiation
NASA Astrophysics Data System (ADS)
Brownell, Cody; Tracey, Timothy
2016-11-01
Simulation of high energy laser propagation and scattering in the maritime environment is problematic, due to the high liklihood of turbulence, fog, and rain or sea spray within the beam path. Laser interactions with large water drops (diameters of approximately 1-mm), such as those found in a light rain, have received relatively less attention. In this regime a high energy laser will rapidly heat and vaporize a water drop as it traverses the beam path, but the exact heating / vaporization rate, its dependence on impurities, and ancillary effects on the drop or surroundings are unclear. In this work we present surface temperature measurements of a water drop obtained using a FLIR IR camera. The drop is acoustically levitated, and subject to a continuous wave laser with a wavelength of 1070-nm and a mean irradiance of approximately 500 W/cm2. These measurements show that the steady-state surface temperature of the drop is well below the saturation temperature, yet based on the time history of the drop volume vaporization begins almost immediately upon laser strike. Inferences on the turbulence characteristics within the drop are also made from measurements of the fluctuations in the surface temperature. Supported by ONR, HEL-JTO, and USNA Trident Scholar Program.
Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA
2012-01-31
An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.
Flame Structure and Scalar Properties in Microgravity Laminar Fires
NASA Technical Reports Server (NTRS)
Feikema, D. A.; Lim, J.; Sivathanu, Y.
2006-01-01
Recent results from microgravity combustion experiments conducted in the Zero Gravity Facility (ZGF) 5.18 second drop tower are reported. Emission mid-infrared spectroscopy measurements have been completed to quantitatively determine the flame temperature, water and carbon dioxide vapor concentrations, radiative emissive power, and soot concentrations in a microgravity laminar ethylene/air flame. The ethylene/air laminar flame conditions are similar to previously reported experiments including the Flight Project, Laminar Soot Processes (LSP). Soot concentrations and gas temperatures are in reasonable agreement with similar results available in the literature. However, soot concentrations and flame structure dramatically change in long duration microgravity laminar diffusion flames as demonstrated in this paper.
NASA Astrophysics Data System (ADS)
Novianto, S.; Pamitran, A. S.; Nasruddin, Alhamid, M. I.
2016-06-01
Due to its friendly effect on the environment, natural refrigerants could be the best alternative refrigerant to replace conventional refrigerants. The present study was devoted to the effect of superficial velocity on vaporization pressure drop with propane in a horizontal circular tube with an inner diameter of 7.6 mm. The experiments were conditioned with 4 to 10 °C for saturation temperature, 9 to 20 kW/m2 for heat flux, and 250 to 380 kg/m2s for mass flux. It is shown here that increased heat flux may result in increasing vapor superficial velocity, and then increasing pressure drop. The present experimental results were evaluated with some existing correlations of pressure drop. The best prediction was evaluated by Lockhart-Martinelli (1949) with MARD 25.7%. In order to observe the experimental flow pattern, the present results were also mapped on the Wang flow pattern map.
Temperature gradient effects on vapor diffusion in partially-saturated porous media
DOE Office of Scientific and Technical Information (OSTI.GOV)
Webb, S.W.
1999-07-01
Vapor diffusion in porous media in the presence of its own liquid may be enhanced due to pore-scale processes, such as condensation and evaporation across isolated liquid islands. Webb and Ho (1997) developed one-and two-dimensional mechanistic pore-scale models of these processes in an ideal porous medium. For isothermal and isobaric boundary conditions with a concentration gradient, the vapor diffusion rate was significantly enhanced by these liquid island processes compared to a dry porous media. The influence of a temperature gradient on the enhanced vapor diffusion rate is considered in this paper. The two-dimensional pore network model which is used inmore » the present study is shown. For partially-saturated conditions, a liquid island is introduced into the top center pore. Boundary conditions on the left and right sides of the model are specified to give the desired concentration and temperature gradients. Vapor condenses on one side of the liquid island and evaporates off the other side due to local vapor pressure lowering caused by the interface curvature, even without a temperature gradient. Rather than acting as an impediment to vapor diffusion, the liquid island actually enhances the vapor diffusion rate. The enhancement of the vapor diffusion rate can be significant depending on the liquid saturation. Vapor diffusion is enhanced by up to 40% for this single liquid island compared to a dry porous medium; enhancement factors of up to an order of magnitude have been calculated for other conditions by Webb and Ho (1997). The dominant effect on the enhancement factor is the concentration gradient; the influence of the temperature gradient is smaller. The significance of these results, which need to be confirmed by experiments, is that the dominant model of enhanced vapor diffusion (EVD) by Philip and deVries (1957) predicts that temperature gradients must exist for EVD to occur. If there is no temperature gradient, there is no enhancement. The present results indicate that EVD is predominantly driven by concentration gradients; temperature gradients are less important. Therefore, the EVD model of Philip and deVries may need to be modified to reflect these results.« less
Preliminary endurance tests of water vaporizers for resistojet applications
NASA Technical Reports Server (NTRS)
Morren, W. Earl; Macrae, Gregory S.
1993-01-01
Three water vaporizers designed for resistojet applications were built and tested for periods up to 500 h and 250 thermal cycles. Two of the vaporizers were not sensitive to orientation with respect to gravity, an indication of likely compatibility with low-gravity environments. Some temperatures and pressures in the third were impacted by orientation, although operation was always stable. The pressure drop across the sand-filled version increased by 147 percent in 38 h and 19 thermal cycles. Bonding of the sand granules in the downstream end of the heat exchanger was the suspected cause of failure of this vaporizer. Pressure drops across the two sintered stainless steel-filled versions were more gradual. One, with a pore size of 60 microns, showed an 80 percent increase in 500 h and 250 thermal cycles and another, with a 10 microns poresize, showed a 29 percent increase in 350 h and 175 thermal cycles. Testing of the latter metal-filled vaporizer was ongoing as of this writing. Oxidation of the porous metal packing materials in these vaporizers, with subsequent deposition of oxide particles within the pores, was believed to have caused the observed increases in pressure drops.
Impact of Moisture Content and Grain Size on Hydrocarbon Diffusion in Porous Media
NASA Astrophysics Data System (ADS)
McLain, A. A.; Ho, C. K.
2001-12-01
Diffusion of hydrocarbon vapors in porous media can play an important role in our ability to characterize subsurface contaminants such as trichloroethylene (TCE). For example, traditional monitoring methods often rely on direct sampling of contaminated soils or vapor. These samples may be influenced by the diffusion of vapors away from the contaminant source term, such as non-aqueous-phase TCE liquid. In addition, diffusion of hydrocarbon vapors can also impact the migration and dispersion of the contaminant in the subsurface. Therefore, understanding the diffusion rates and vapor transport processes of hydrocarbons in variably-saturated, heterogeneous porous media will assist in the characterization and detection of these subsurface contaminants. The purpose of this study was to investigate the impact of soil heterogeneity and water-moisture content on the diffusion processes for TCE. A one-dimensional column experiment was used to monitor the rates of vapor diffusion through sand. Experiments were performed with different average water-moisture contents and different grain sizes. On one end of the column, a reservoir cap is used to encase the TCE, providing a constant vapor boundary condition while sealing the end. The other end of the column contains a novel microchemical sensor. The sensor employs a polymer-absorption resistor (chemiresistor) that reversibly swells and increases in resistance when exposed to hydrocarbons. Once calibrated, the chemiresistors can be used to passively monitor vapor concentrations. This unique method allows the detection of in-situ vapor concentrations without disturbing the local environment. Results are presented in the form of vapor-concentration breakthrough curves as detected by the sensor. The shape of the breakthrough curve is dependent on several key parameters, including the length of the column and parameters (e.g., water-moisture content and grain-size) that affect the effective diffusion coefficient of TCE in air. Comparisons are made between theoretical and observed breakthrough curves to evaluate the diffusion of TCE and other relevant physical processes (e.g., air-water partitioning of TCE). The relative impact of water-moisture content and grain size on the diffusion of TCE vapor in porous media is also addressed. The authors thank Bob Hughes, who developed the chemiresistor sensors, and Chad Davis, who assisted with the calibrations. Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy under Contract DE-AC04-94AL85000.
Bauer, Brad A.; Patel, Sandeep
2009-01-01
We present an extension of the TIP4P-QDP model, TIP4P-QDP-LJ, that is designed to couple changes in repulsive and dispersive nonbond interactions to changes in polarizability. Polarizability is intimately related to the dispersion component of classical force field models of interactions, and we explore the effect of incorporating this connection explicitly on properties along the liquid-vapor coexistence curve of pure water. Parametrized to reproduce condensed-phase liquid water properties at 298 K, the TIP4P-QDP-LJ model predicts density, enthalpy of vaporization, self-diffusion constant, and the dielectric constant at ambient conditions to about the same accuracy as TIP4P-QDP but shows remarkable improvement in reproducing the liquid-vapor coexistence curve. TIP4P-QDP-LJ predicts critical constants of Tc=623 K, ρc=0.351 g∕cm3, and Pc=250.9 atm, which are in good agreement with experimental values of Tc=647.1 K, ρc=0.322 g∕cm3, and Pc=218 atm, respectively. Applying a scaling factor correction (obtained by fitting the experimental vapor-liquid equilibrium data to the law of rectilinear diameters using a three-term Wegner expansion) the model predicts critical constants (Tc=631 K and ρc=0.308 g∕cm3). Dependence of enthalpy of vaporization, self-diffusion constant, surface tension, and dielectric constant on temperature are shown to reproduce experimental trends. We also explore the interfacial potential drop across the liquid-vapor interface for the temperatures studied. The interfacial potential demonstrates little temperature dependence at lower temperatures (300–450 K) and significantly enhanced (exponential) dependence at elevated temperatures. Terms arising from the decomposition of the interfacial potential into dipole and quadrupole contributions are shown to monotonically approach zero as the temperature approaches the critical temperature. Results of this study suggest that self-consistently treating the coupling of phase-dependent polarizability with dispersion interactions in classical water force fields may be an important effect for the extension of polarizable water force fields to reproduce properties along the liquid-vapor coexistence envelope as well as near critical conditions. More importantly, the present study demonstrates the rather remarkable transferability of a water model parametrized to a single state point to other thermodynamic states. Further studies are recommended. PMID:19725623
Bauer, Brad A; Patel, Sandeep
2009-08-28
We present an extension of the TIP4P-QDP model, TIP4P-QDP-LJ, that is designed to couple changes in repulsive and dispersive nonbond interactions to changes in polarizability. Polarizability is intimately related to the dispersion component of classical force field models of interactions, and we explore the effect of incorporating this connection explicitly on properties along the liquid-vapor coexistence curve of pure water. Parametrized to reproduce condensed-phase liquid water properties at 298 K, the TIP4P-QDP-LJ model predicts density, enthalpy of vaporization, self-diffusion constant, and the dielectric constant at ambient conditions to about the same accuracy as TIP4P-QDP but shows remarkable improvement in reproducing the liquid-vapor coexistence curve. TIP4P-QDP-LJ predicts critical constants of T(c)=623 K, rho(c)=0.351 g/cm(3), and P(c)=250.9 atm, which are in good agreement with experimental values of T(c)=647.1 K, rho(c)=0.322 g/cm(3), and P(c)=218 atm, respectively. Applying a scaling factor correction (obtained by fitting the experimental vapor-liquid equilibrium data to the law of rectilinear diameters using a three-term Wegner expansion) the model predicts critical constants (T(c)=631 K and rho(c)=0.308 g/cm(3)). Dependence of enthalpy of vaporization, self-diffusion constant, surface tension, and dielectric constant on temperature are shown to reproduce experimental trends. We also explore the interfacial potential drop across the liquid-vapor interface for the temperatures studied. The interfacial potential demonstrates little temperature dependence at lower temperatures (300-450 K) and significantly enhanced (exponential) dependence at elevated temperatures. Terms arising from the decomposition of the interfacial potential into dipole and quadrupole contributions are shown to monotonically approach zero as the temperature approaches the critical temperature. Results of this study suggest that self-consistently treating the coupling of phase-dependent polarizability with dispersion interactions in classical water force fields may be an important effect for the extension of polarizable water force fields to reproduce properties along the liquid-vapor coexistence envelope as well as near critical conditions. More importantly, the present study demonstrates the rather remarkable transferability of a water model parametrized to a single state point to other thermodynamic states. Further studies are recommended.
Computation of shear-induced collective-diffusivity in emulsions
NASA Astrophysics Data System (ADS)
Malipeddi, Abhilash Reddy; Sarkar, Kausik
2017-11-01
The shear-induced collective-diffusivity of drops in an emulsion is calculated through simulation. A front-tracking finite difference method is used to integrate the Navier-Stokes equations. When a cloud of drops is subjected to shear flow, after a certain time, the width of the cloud increases with the 1/3 power of time. This scaling of drop-cloud-width with time is characteristic of (sub-)diffusion that arises from irreversible two-drop interactions. The collective diffusivity is calculated from this relationship. A feature of the procedure adopted here is the modest computational requirement, wherein, a few drops ( 70) in shear for short time ( 70 strain) is found to be sufficient to get a good estimate. As far as we know, collective-diffusivity has not been calculated for drops through simulation till now. The computed values match with experimental measurements reported in the literature. The diffusivity in emulsions is calculated for a range of Capillary (Ca) and Reynolds (Re) numbers. It is found to be a unimodal function of Ca , similar to self-diffusivity. A sub-linear increase of the diffusivity with Re is seen for Re < 5 . This work has been limited to a viscosity matched case.
Fate of sulfur mustard on soil: Evaporation, degradation, and vapor emission.
Jung, Hyunsook; Kah, Dongha; Chan Lim, Kyoung; Lee, Jin Young
2017-01-01
After application of sulfur mustard to the soil surface, its possible fate via evaporation, degradation following absorption, and vapor emission after decontamination was studied. We used a laboratory-sized wind tunnel, thermal desorber, gas chromatograph-mass spectrometry (GC-MS), and 13 C nuclear magnetic resonance ( 13 C NMR) for systematic analysis. When a drop of neat HD was deposited on the soil surface, it evaporated slowly while being absorbed immediately into the matrix. The initial evaporation or drying rates of the HD drop were found to be power-dependent on temperature and initial drop volume. Moreover, drops of neat HD, ranging in size from 1 to 6 μL, applied to soil, evaporated at different rates, with the smaller drops evaporating relatively quicker. HD absorbed into soil remained for a month, degrading eventually to nontoxic thiodiglycol via hydrolysis through the formation of sulfonium ions. Finally, a vapor emission test was performed for HD contaminant after a decontamination process, the results of which suggest potential risk from the release of trace chemical quantities of HD into the environment. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Jinlan; Li, Xiaolu; Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People's Republic of China
2012-06-22
Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGEmore » after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .« less
Inverse Leidenfrost effect: self-propelling drops on a bath
NASA Astrophysics Data System (ADS)
Gauthier, Anais; van der Meer, Devaraj; Lohse, Detlef; Physics of Fluids Team
2017-11-01
When deposited on very hot solid, volatile drops can levitate over a cushion of vapor, in the so-called Leidenfrost state. This phenomenon can also be observed on a hot bath and similarly to the solid case, drops are very mobile due to the absence of contact with the substrate that sustains them. We discuss here a situation of ``inverse Leidenfrost effect'' where room-temperature drops levitate on a liquid nitrogen pool - the vapor is generated here by the bath sustaining the relatively hot drop. We show that the drop's movement is not random: the liquid goes across the bath in straight lines, a pattern only disrupted by elastic bouncing on the edges. In addition, the drops are initially self-propelled; first at rest, they accelerate for a few seconds and reach velocities of the order of a few cm/s, before slowing down. We investigate experimentally the parameters that affect their successive acceleration and deceleration, such as the size and nature of the drops and we discuss the origin of this pattern.
Ignition process in Diesel engines
NASA Technical Reports Server (NTRS)
Wentzel, W
1936-01-01
This report analyzes the heating and vaporization process of fuel droplets in a compression-ignition engine on the basis of the theory of similitude - according to which, the period for heating and complete vaporization of the average size fuel drop is only a fraction of the actually observed ignition lag. The result is that ignition takes place in the fuel vapor air mixture rather than on the surface of the drop. The theoretical result is in accord with the experimental observations by Rothrock and Waldron. The combustion shock occurring at lower terminal compression temperature, especially in the combustion of coal-tar oil, is attributable to a simultaneous igniting of a larger fuel-vapor volume formed prior to ignition.
METHOD OF MAKING TUNGSTEN FILAMENTS
Frazer, J.W.
1962-12-18
A method of making tungsten filaments is described in which the tungsten is completely free of isotope impurities in the range of masses 234 to 245 for use in mass spectrometers. The filament comprises a tantalum core generally less than 1 mil in diameter having a coating of potassium-free tantalum-diffused tungsten molecularly bonded thereto. In the preferred process of manufacture a short, thin tantalum filament is first mounted between terminal posts mounted in insulated relation through a backing plate. The tungsten is most conveniently vapor plated onto the tantalum by a tungsten carbonyl vapor decomposition method having a critical step because of the tendency of the tantalum to volatilize at the temperature of operntion of the filament. The preferred recipe comprises volatilizing tantalum by resistance henting until the current drops by about 40%, cutting the voltage back to build up the tungsten, and then gradually building the temperature back up to balance the rate of tungsten deposition with the rate of tantalum volatilization. (AEC)
Flame Radiation, Structure, and Scalar Properties in Microgravity Laminar Fires
NASA Technical Reports Server (NTRS)
Feikema, Douglas; Lim, Jongmook; Sivathanu, Yudaya
2007-01-01
Results from microgravity combustion experiments conducted in the Zero Gravity Research Facility (ZGF) 5.18 second drop facility are reported. The results quantify flame radiation, structure, and scalar properties during the early phase of a microgravity fire. Emission mid-infrared spectroscopy measurements have been completed to quantitatively determine the flame temperature, water and carbon dioxide vapor concentrations, radiative emissive power, and soot concentrations in microgravity laminar methane/air, ethylene/nitrogen/air and ethylene/air jet flames. The measured peak mole fractions for water vapor and carbon dioxide are found to be in agreement with state relationship predictions for hydrocarbon/air combustion. The ethylene/air laminar flame conditions are similar to previously reported results including those from the flight project, Laminar Soot Processes (LSP). Soot concentrations and gas temperatures are in reasonable agreement with similar results available in the literature. However, soot concentrations and flame structure dramatically change in long-duration microgravity laminar diffusion flames as demonstrated in this report.
Characteristics of Evaporator with a Lipuid-Vapor Separator
NASA Astrophysics Data System (ADS)
Ikeguchi, Masaki; Tanaka, Naoki; Yumikura, Tsuneo
Flow pattern of refrigerant in a heat exchanger tube changes depending on vapor quality, tube diameter, refrigerant flow rate and refrigerant properties. High flow rate causes mist flow where the quality is from 0.8 to 1.0. 1n this flow pattern, the liquid film detaches from the tube wall so that the heat flow is intervened. The heat transfer coefficient generally increases with the flow rate. But the pressure drop of refrigerant flow simultaneously increases and the region of the mist flow enlarges. In order to reduce the pressure drop and suppress the mist flow, we have developped a small liquid-vapor separator that removes the vapor from the evaporating refrigerant flow. This separator is equipped in the middle of the evaporator where the flow pattern is annular. The experiments to evaluate the effect of this separator were carried out and the following conclutions were obtained. (1) Average heat transfer coefficient increases by 30-60 %. (2) Pressure drop reduces by 20-30 %. (3) Cooling Capacity increases by 2-9 %.
Corner wetting during the vapor-liquid-solid growth of faceted nanowires
NASA Astrophysics Data System (ADS)
Spencer, Brian; Davis, Stephen
2016-11-01
We consider the corner wetting of liquid drops in the context of vapor-liquid-solid growth of nanowires. Specifically, we construct numerical solutions for the equilibrium shape of a liquid drop on top of a faceted nanowire by solving the Laplace-Young equation with a free boundary determined by mixed boundary conditions. A key result for nanowire growth is that for a range of contact angles there is no equilibrium drop shape that completely wets the corner of the faceted nanowire. Based on our numerical solutions we determine the scaling behavior for the singular surface behavior near corners of the nanowire in terms of the Young contact angle and drop volume.
Water vapor diffusion membranes, 2
NASA Technical Reports Server (NTRS)
Holland, F. F.; Klein, E.; Smith, J. K.; Eyer, C.
1976-01-01
Transport mechanisms were investigated for the three different types of water vapor diffusion membranes. Membranes representing porous wetting and porous nonwetting structures as well as dense diffusive membrane structures were investigated for water permeation rate as a function of: (1) temperature, (2) solids composition in solution, and (3) such hydrodynamic parameters as sweep gas flow rate, solution flow rate and cell geometry. These properties were measured using nitrogen sweep gas to collect the effluent. In addition, the chemical stability to chromic acid-stabilized urine was measured for several of each type of membrane. A technology based on the mechanism of vapor transport was developed, whereby the vapor diffusion rates and relative susceptibility of membranes to fouling and failure could be projected for long-term vapor recovery trials using natural chromic acid-stabilized urine.
Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude
2010-12-01
This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.
Ha, Yeonjeong; Kwon, Jung-Hwan
2010-04-15
Exact determination of the partition coefficient between 1-octanol and air (K(OA)) is very important because it is a key descriptor for describing the thermodynamic partitioning between the air and organic phases. In spite of its importance, the number and quality of experimental K(OA) values for hydrophobic organic chemicals are limited because of experimental difficulties. Thus, to measure K(OA) values, a high-throughput method was developed that used liquid-phase extraction with 1-octanol drop at the tip of a microsyringe needle. The concentration in the headspace surrounding the 1 muL octanol drop was equilibrated with liquid octanol containing polycyclic aromatic hydrocarbons (PAHs). The change in concentrations of PAHs in the octanol drop was measured to obtain mass transfer rate constants, and these rate constants were then converted into K(OA) values using a film diffusion model. Thirteen polycyclic aromatic hydrocarbons with log K(OA) between 5 and 12 were chosen for the proof of the principle. Experimental determination of log K(OA) was accomplished in 30 h for PAHs with their log K(OA) less than 11. The measured log K(OA) values were very close to those obtained by various experimental and estimation methods in the literature, suggesting that this new method can provide a fast and easy determination of log K(OA) values for many chemicals of environmental interests. In addition, the applicability of the method can be extended to determine Henry's law constant for compounds with low vapor pressure and to estimate gaseous transfer rate of semivolatile compounds for environmental fate modeling.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jens, Jason; Raghunathan, Kannan; Vago, Frank
2010-01-12
EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.
Preparation for microgravity - The role of the Microgravity Material Science Laboratory
NASA Technical Reports Server (NTRS)
Johnston, J. Christopher; Rosenthal, Bruce N.; Meyer, Maryjo B.; Glasgow, Thomas K.
1988-01-01
Experiments at the NASA Lewis Research Center's Microgravity Material Science Laboratory using physical and mathematical models to delineate the effects of gravity on processes of scientific and commercial interest are discussed. Where possible, transparent model systems are used to visually track convection, settling, crystal growth, phase separation, agglomeration, vapor transport, diffusive flow, and polymer reactions. Materials studied include metals, alloys, salts, glasses, ceramics, and polymers. Specific technologies discussed include the General Purpose furnace used in the study of metals and crystal growth, the isothermal dendrite growth apparatus, the electromagnetic levitator/instrumented drop tube, the high temperature directional solidification furnace, the ceramics and polymer laboratories and the center's computing facilities.
Xie, Chiyu; Liu, Guangzhi; Wang, Moran
2016-08-16
The evaporation flux distribution of sessile drops is investigated by molecular dynamic simulations. Three evaporating modes are classified, including the diffusion dominant mode, the substrate heating mode, and the environment heating mode. Both hydrophilic and hydrophobic drop-substrate interactions are considered. To count the evaporation flux distribution, which is position dependent, we proposed an azimuthal-angle-based division method under the assumption of spherical crown shape of drops. The modeling results show that the edge evaporation, i.e., near the contact line, is enhanced for hydrophilic drops in all the three modes. The surface diffusion of liquid molecular absorbed on solid substrate for hydrophilic cases plays an important role as well as the space diffusion on the enhanced evaporation rate at the edge. For hydrophobic drops, the edge evaporation flux is higher for the substrate heating mode, but lower than elsewhere of the drop for the diffusion dominant mode; however, a nearly uniform distribution is found for the environment heating mode. The evidence shows that the temperature distribution inside drops plays a key role in the position-dependent evaporation flux.
NASA Astrophysics Data System (ADS)
Kaushik, A.; Berkelhammer, M. B.; O'Neill, M.; Noone, D.
2017-12-01
The partitioning of land surface latent heat flux into evaporation and transpiration remains a challenging problem despite a basic understanding of the underlying mechanisms. Water isotopes are useful tracers for separating evaporation and transpiration contributions because E and T have distinct isotopic ratios. Here we use the isotope-based partitioning method at a semi-arid grassland tall-tower site in Colorado. Our results suggest that under certain conditions evaporation cannot be isotopically distinguished from transpiration without modification of existing partitioning techniques. Over a 4-year period, we measured profiles of stable oxygen and hydrogen isotope ratios of water vapor from the surface to 300 m and soil water down to 1 m along with standard meteorological fluxes. Using these data, we evaluated the contributions of rainfall, equilibration, surface water vapor exchange and sub-surface vapor diffusion to the isotopic composition of evapotranspiration (ET). Applying the standard isotopic approach to find the transpiration portion of ET (i.e., T/ET), we see a significant discrepancy compared with a method to constrain T/ET based on gross primary productivity (GPP). By evaluating the kinetic fractionation associated with soil evaporation and vapor diffusion we find that a significant proportion (58-84%) of evaporation following precipitation is non-fractionating. This is possible when water from isolated soil layers is being nearly completely evaporated. Non-fractionating evaporation looks isotopically like transpiration and therefore leads to an overestimation of T/ET. Including non-fractionating evaporation reconciles the isotope-based partitioning estimates of T/ET with the GPP method, and may explain the overestimation of T/ET from isotopes compared to other methods. Finally, we examine the application of non-fractionating evaporation to other boundary layer moisture flux processes such as rain evaporation, where complete evaporation of smaller drop pools may produce a similarly weaker kinetic effect.
Effect of External Pressure Drop on Loop Heat Pipe Operating Temperature
NASA Technical Reports Server (NTRS)
Jentung, Ku; Ottenstein, Laura; Rogers, Paul; Cheung, Kwok; Obenschain, Arthur F. (Technical Monitor)
2002-01-01
This paper discusses the effect of the pressure drop on the operating temperature in a loop heat pipe (LHP). Because the evaporator and the compensation chamber (CC) both contain two-phase fluid, a thermodynamic constraint exists between the temperature difference and the pressure drop for these two components. As the pressure drop increases, so will the temperature difference. The temperature difference in turn causes an increase of the heat leak from the evaporator to the CC, resulting in a higher CC temperature. Furthermore, the heat leak strongly depends on the vapor void fraction inside the evaporator core. Tests were conducted by installing a valve on the vapor line so as to vary the pressure drop, and by charging the LHP with various amounts of fluid. Test results verify that the LHP operating temperature increases with an increasing differential pressure, and the temperature increase is a strong function of the fluid inventory in the loop.
Bubble formation during drop impact on a heated pool
NASA Astrophysics Data System (ADS)
Tian, Yuansi; Alhazmi, Muath; Kouraytem, Nadia; Thoroddsen, Sigurdur
2017-11-01
Ultra high-speed video imaging, at up to 200 kfps, is used to investigate a drop impinging onto a high temperature pool. The room-temperature perfluorohexane drop, which has a boiling temperature as low as 56 °C impacts on the soybean oil pool heated up to around 200 °C, which is overwhelmingly higher than the boiling temperature of the drop. The bottom of the drop is therefore covered by a layer of vapor which prevents contact between the two immiscible liquid surfaces, akin to the Leidenfrost effect However, as the pool temperature is reduced, one starts seeing contact and the dynamics transition into the vapor explosion regime. At the boundary of this regime we observe some entrapment of scattered or a toroidal ring of small bubbles. Experimental video data will be presented to show this novel phenomenon and explain how these bubbles are formed and evolve.
Physics-based agent to simulant correlations for vapor phase mass transport.
Willis, Matthew P; Varady, Mark J; Pearl, Thomas P; Fouse, Janet C; Riley, Patrick C; Mantooth, Brent A; Lalain, Teri A
2013-12-15
Chemical warfare agent simulants are often used as an agent surrogate to perform environmental testing, mitigating exposure hazards. This work specifically addresses the assessment of downwind agent vapor concentration resulting from an evaporating simulant droplet. A previously developed methodology was used to estimate the mass diffusivities of the chemical warfare agent simulants methyl salicylate, 2-chloroethyl ethyl sulfide, di-ethyl malonate, and chloroethyl phenyl sulfide. Along with the diffusivity of the chemical warfare agent bis(2-chloroethyl) sulfide, the simulant diffusivities were used in an advection-diffusion model to predict the vapor concentrations downwind from an evaporating droplet of each chemical at various wind velocities and temperatures. The results demonstrate that the simulant-to-agent concentration ratio and the corresponding vapor pressure ratio are equivalent under certain conditions. Specifically, the relationship is valid within ranges of measurement locations relative to the evaporating droplet and observation times. The valid ranges depend on the relative transport properties of the agent and simulant, and whether vapor transport is diffusion or advection dominant. Published by Elsevier B.V.
Smoothed particle hydrodynamics method for evaporating multiphase flows.
Yang, Xiufeng; Kong, Song-Charng
2017-09-01
The smoothed particle hydrodynamics (SPH) method has been increasingly used for simulating fluid flows; however, its ability to simulate evaporating flow requires significant improvements. This paper proposes an SPH method for evaporating multiphase flows. The present SPH method can simulate the heat and mass transfers across the liquid-gas interfaces. The conservation equations of mass, momentum, and energy were reformulated based on SPH, then were used to govern the fluid flow and heat transfer in both the liquid and gas phases. The continuity equation of the vapor species was employed to simulate the vapor mass fraction in the gas phase. The vapor mass fraction at the interface was predicted by the Clausius-Clapeyron correlation. An evaporation rate was derived to predict the mass transfer from the liquid phase to the gas phase at the interface. Because of the mass transfer across the liquid-gas interface, the mass of an SPH particle was allowed to change. Alternative particle splitting and merging techniques were developed to avoid large mass difference between SPH particles of the same phase. The proposed method was tested by simulating three problems, including the Stefan problem, evaporation of a static drop, and evaporation of a drop impacting a hot surface. For the Stefan problem, the SPH results of the evaporation rate at the interface agreed well with the analytical solution. For drop evaporation, the SPH result was compared with the result predicted by a level-set method from the literature. In the case of drop impact on a hot surface, the evolution of the shape of the drop, temperature, and vapor mass fraction were predicted.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kish, Kevin; McDonnell, Patricia A.; Goldfarb, Valentina
Protein tyrosine phosphatase {gamma} is a membrane-bound receptor and is designated RPTP{gamma}. RPTP{gamma} and two mutants, RPTP{gamma}(V948I, S970T) and RPTP{gamma}(C858S, S970T), were recombinantly expressed and purified for X-ray crystallographic studies. The purified enzymes were crystallized using the hanging-drop vapor-diffusion method. Crystallographic data were obtained from several different crystal forms in the absence and the presence of inhibitor. In this paper, a description is given of how three different crystal forms were obtained that were used with various ligands. An orthorhombic crystal form and a trigonal crystal form were obtained both with and without ligand, and a monoclinic crystal form wasmore » only obtained in the presence of a particularly elaborated inhibitor.« less
Expression and X-Ray Structural Determination of the Nucleoprotein of Lassa Fever Virus.
Qi, Xiaoxuan; Wang, Wenjian; Dong, Haohao; Liang, Yuying; Dong, Changjiang; Ly, Hinh
2018-01-01
We describe methods to express the nucleoprotein (NP) of Lassa fever virus (LASV) in E. coli, to purify and crystallize it using the sitting-drop vapor diffusion method. The crystals were screened using Rigaku micro-007 X-ray generator and a dataset was collected at a resolution of 2.36 Å. The crystals belong to space group P3, with the unit cell parameters a = b = 176.35 Å, c = 56.40 Å, α = β = 90°, and γ = 120°. Using the X-ray diffraction method, we constructed a three-dimensional structure of the LASV NP that should aid in the development of novel therapeutic strategies against this virus, for which vaccine and effective treatment modalities are currently unavailable.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Raghunathan, Kannan; Vago, Frank S.; Ball, Terry
2010-01-12
EpsH is a minor pseudopilin protein of the Vibrio cholerae type II secretion system. A truncated form of EpsH with a C-terminal noncleavable His tag was constructed and expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 1.71 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.39, b = 71.11, c = 84.64 {angstrom}. There were two protein molecules in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.1 {angstrom}{sup 3} Da{sup -1}, corresponding to 41.5% solvent content.
Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG
Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis
2009-01-01
EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P21, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å. PMID:19478449
Macroscopic modeling for heat and water vapor transfer in dry snow by homogenization.
Calonne, Neige; Geindreau, Christian; Flin, Frédéric
2014-11-26
Dry snow metamorphism, involved in several topics related to cryospheric sciences, is mainly linked to heat and water vapor transfers through snow including sublimation and deposition at the ice-pore interface. In this paper, the macroscopic equivalent modeling of heat and water vapor transfers through a snow layer was derived from the physics at the pore scale using the homogenization of multiple scale expansions. The microscopic phenomena under consideration are heat conduction, vapor diffusion, sublimation, and deposition. The obtained macroscopic equivalent model is described by two coupled transient diffusion equations including a source term arising from phase change at the pore scale. By dimensional analysis, it was shown that the influence of such source terms on the overall transfers can generally not be neglected, except typically under small temperature gradients. The precision and the robustness of the proposed macroscopic modeling were illustrated through 2D numerical simulations. Finally, the effective vapor diffusion tensor arising in the macroscopic modeling was computed on 3D images of snow. The self-consistent formula offers a good estimate of the effective diffusion coefficient with respect to the snow density, within an average relative error of 10%. Our results confirm recent work that the effective vapor diffusion is not enhanced in snow.
Exposure assessment of ETBE in gas station workers and gasoline tanker truck drivers.
Eitaki, Yoko; Kawai, Toshio; Omae, Kazuyuki
2011-01-01
In order to measure occupational exposure concentrations of ethyl tertiary-butyl ether (ETBE), we developed a diffusive sampling method for monitoring ETBE and performed an ETBE exposure assessment. The applicability of diffusive samplers was examined by exposing the samplers to ETBE vapor in test chambers. The personal exposure levels of workers and airborne concentrations were measured at 4 gas stations. The ETBE sampling rate for the diffusive samplers (VOC-SD, Sigma-Aldrich Japan) was 25.04 ml/min (25°C). Compared with the active sampling method, the diffusive samplers could be used for short-term measurements and in environments containing a mixture of organic solvents. The geometric mean (GM) of TWA-8h ETBE was 0.08 ppm (0.02-0.28 ppm) in 28 gas station workers and 0.04 ppm (0.01-0.21 ppm) in 2 gasoline tanker truck drivers. With regard to ETBE airborne concentrations, the GM was 4.12 ppm (0.93-8.71 ppm) at the handles of hanging pumps but dropped to less than 0.01 ppm (less than 0.01-0.01 ppm) at the side of a public road. The diffusive sampling method can be used for the measurement of occupational ETBE exposure. The threshold limit of TLV-TWA 5 ppm recommended by the ACGIH was not exceeded in any of the workers in this study.
The rate of collisions due to Brownian or gravitational motion of small drops
NASA Technical Reports Server (NTRS)
Zhang, Xiaoguang; Davis, Robert H.
1991-01-01
Quantitative predictions of the collision rate of two spherical drops undergoing Brownian diffusion or gravitational sedimentation are presented. The diffusion equation for relative Brownian motion of two drops is derived, and the relative motion of pairs of drops in gravitational sedimentation is traced via a trajectory analysis in order to develop theoretical models to determine the collision efficiencies, both with and without interparticle forces applied between the drops. It is concluded that finite collision rates between nondeforming fluid drops are possible for Brownian diffusion or gravitational sedimentation in the absence of attractive forces, in stark contrast to the prediction that lubrication forces prevent rigid spheres from contacting each other unless an attractive force that becomes infinite as the separation approaches zero is applied. Collision rates are shown to increase as the viscosity of the drop-phase decreases. In general, hydrodynamic interactions reduce the collision rates more for gravitational collisions than for Brownian collisions.
24 CFR 3280.704 - Fuel supply systems.
Code of Federal Regulations, 2012 CFR
2012-04-01
... be ventilated at top and bottom to facilitate diffusion of vapors. The compartment shall be... to permit diffusion of vapors and shall be insulated from the structural members of the body. Tanks...
24 CFR 3280.704 - Fuel supply systems.
Code of Federal Regulations, 2014 CFR
2014-04-01
... be ventilated at top and bottom to facilitate diffusion of vapors. The compartment shall be... to permit diffusion of vapors and shall be insulated from the structural members of the body. Tanks...
24 CFR 3280.704 - Fuel supply systems.
Code of Federal Regulations, 2013 CFR
2013-04-01
... be ventilated at top and bottom to facilitate diffusion of vapors. The compartment shall be... to permit diffusion of vapors and shall be insulated from the structural members of the body. Tanks...
Formation of microbeads during vapor explosions of Field's metal in water
NASA Astrophysics Data System (ADS)
Kouraytem, N.; Li, E. Q.; Thoroddsen, S. T.
2016-06-01
We use high-speed video imaging to investigate vapor explosions during the impact of a molten Field's metal drop onto a pool of water. These explosions occur for temperatures above the Leidenfrost temperature and are observed to occur in up to three stages as the metal temperature is increased, with each explosion being more powerful that the preceding one. The Field's metal drop breaks up into numerous microbeads with an exponential size distribution, in contrast to tin droplets where the vapor explosion deforms the metal to form porous solid structures. We compare the characteristic bead size to the wavelength of the fastest growing mode of the Rayleigh-Taylor instability.
Vapor-phase interactions and diffusion of organic solvents in the unsaturated zone
Roy, W.R.; Griffin, R.A.
1990-01-01
This article presents an analysis of the interactions and static movement of 37 organic solvents as vapors through the unsaturated soil zone. The physicochemical interactions of the organic vapors with unsaturated soil materials were emphasized with focus on diffusive, and adsorptive interactions. Fick's Law and porous media diffusion coefficients for most of the solvent vapors were either compiled or estimated; coefficients were not available for some of the fluorinated solvents. The adsorption of some of the solvent vapors by silica was concluded to be due to hydrogen bond formation with surface silanol groups. Heats of adsorption data for different adsorbents were also compiled. There were very few data on the adsorption of these solvent vapors by soils, but it appears that the magnitude of adsorption of nonpolar solvents is reduced as the relative humidity of the vapor-solid system is increased. Consequently, the interaction of the vapors may then separated into two processes; (1) gas-water partitioning described by Henry's Law constants, and (2) solid-water adsorption coefficients which may be estimated from liquid-solid partition coefficients (Kd values). ?? 1990 Springer-Verlag New York Inc.
NASA Astrophysics Data System (ADS)
Nikonov, Eduard G.; Pavluš, Miron; Popovičová, Mária
2018-02-01
One of the varieties of pores, often found in natural or artificial building materials, are the so-called blind pores of dead-end or saccate type. Three-dimensional model of such kind of pore has been developed in this work. This model has been used for simulation of water vapor interaction with individual pore by molecular dynamics in combination with the diffusion equation method. Special investigations have been done to find dependencies between thermostats implementations and conservation of thermodynamic and statistical values of water vapor - pore system. The two types of evolution of water - pore system have been investigated: drying and wetting of the pore. Full research of diffusion coefficient, diffusion velocity and other diffusion parameters has been made.
Structure of High-Speed Sprays.
1985-02-01
red (Appendix B and Ref. 9) and computed (Appendix C and Ref. 10) the drop veloci lies in the farfield of non vaporizing Diesel-type sprays; measured...and Ref. 9) and computed (Appendix C and Ref. 10) the drop velocities in the farfield of non vaporizing Diesel-type sprays; measured (11) (and are...r) e and 41 - ,(r) e Solutions free from singularities on the axis r- O are found to be f, = C , Io(kr) and #I = C , rI,(.r), where C , and Ca are
Condensation of nano-refrigerant inside a horizontal tube
NASA Astrophysics Data System (ADS)
Darzi, Milad; Sadoughi, M. K.; Sheikholeslami, M.
2018-05-01
In this paper, condensing pressure drop of refrigerant-based nanofluid inside a tube is studied. Isobutene was selected as the base fluid while CuO nanoparticles were utilized to prepare nano-refrigerant. However, for the feasibility of nanoparticle dispersion into the refrigerant, Polyester oil (POE) was utilized as lubricant oil and added to the pure refrigerant by 1% mass fraction. Various values of mass flux, vapor quality, concentration of nanoparticle are investigated. Results indicate that adding nanoparticles leads to enhance frictional pressure drop. Nanoparticles caused larger pressure drop penalty at relatively lower vapor qualities which may be attributed to the existing condensation flow pattern such that annular flow is less influenced by nanoparticles compared to intermittent flow regime.
Spreading of a liquid film on a substrate by the evaporation-adsorption process
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wayner, P.C. Jr.; Schonberg, J.
1992-09-01
The importance of evaporation followed by multilayer adsorption in comparison to liquid flow at the leading edge of a volatile spreading film is analyzed. Presuming that both flows are functions of the same chemical potential gradient, a dimensionless group (N) which delineates the relative importance of vapor diffusion flow to viscous flow on the surface is obtained: N = [rho][sub i]D[nu]x/([minus][bar A][pi]). The relative importance of vapor flow increases with the vapor-pressure dependent partial density, [rho][sub i], and diffusivity, D, of the diffusing vapor, the kinematic viscosity of the liquid, [nu], and the distance downstream from the bulk liquid region,more » x, and decreases with the Hamaker constant, 6[pi][bar A]. Using physical properties the modifiers volatile'' and nonvolatile'' can thereby be put in perspective. Changes in the interfacial force field are a function of [bar A]. The spreading velocity due to the vapor diffusion process is obtained and is found to decrease with a decrease in the interfacial force field and the bulk vapor pressure. The infinite stress at the contact line can be easily relieved by evaporation-adsorption in many systems.« less
Diffusive-convective physical vapor transport of PbTe from a Te-rich solid source
NASA Technical Reports Server (NTRS)
Zoutendyk, J.; Akutagawa, W.
1982-01-01
Crystal growth of PbTe by physical vapor transport (sublimation) in a closed ampoule is governed by the vapor species in thermal equilibrium with the solid compound. Deviations from stoichiometry in the source material cause diffusion limitation of the transport rate, which can be modified by natural (gravity-driven) convection. Mass-transport experiments have been performed using Te-rich material wherein sublimation rates have been measured in order to study the effects of natural convection in diffusion-limited vapor transport. Linear velocities for both crystal growth and evaporation (back sublimation) have been measured for transport in the direction of gravity, horizontally, and opposite to gravity. The experimental results are discussed in terms of both the one-dimensional diffusive-advective model and current, more sophisticated theory which includes natural convection. There is some evidence that convection effects from radial temperature gradients and solutal density gradients have been observed.
Methods for characterizing subsurface volatile contaminants using in-situ sensors
Ho, Clifford K [Albuquerque, NM
2006-02-21
An inverse analysis method for characterizing diffusion of vapor from an underground source of volatile contaminant using data taken by an in-situ sensor. The method uses one-dimensional solutions to the diffusion equation in Cartesian, cylindrical, or spherical coordinates for isotropic and homogenous media. If the effective vapor diffusion coefficient is known, then the distance from the source to the in-situ sensor can be estimated by comparing the shape of the predicted time-dependent vapor concentration response curve to the measured response curve. Alternatively, if the source distance is known, then the effective vapor diffusion coefficient can be estimated using the same inverse analysis method. A triangulation technique can be used with multiple sensors to locate the source in two or three dimensions. The in-situ sensor can contain one or more chemiresistor elements housed in a waterproof enclosure with a gas permeable membrane.
Church, Peter E.; Lyford, Forest P.; Clifford, Scott
2000-01-01
Volatile organic compounds are present in soils and ground water at the Centredale Manor Superfund Site in North Providence, Rhode Island. In September 1999, water-to-vapor diffusion samplers were placed in the bottom sediments of waterways adjacent to the site to identify possible contaminated ground-water discharge areas. The approximate12-acre site is a narrow stretch of land between the eastern bank of the Woonasquatucket River, downstream from the U.S. Route 44 bridge and a former mill raceway. The samplers were placed along a 2,250-foot reach of the Woonasquatucket River, in the former mill raceway several hundred feet to the east and parallel to the river, and in a cross channel between the river and former mill raceway. Volatile organic compounds were detected in 84 of the 104 water-to-vapor diffusion samplers retrieved. Trichloroethylene and tetrachloro-ethylene were the principal volatile organic compounds detected. The highest vapor concentrations measured for these two chemicals were from diffusion samplers located along an approximate 100-foot reach of the Woonasquatucket River about 500 feet downstream of the bridge; here trichloroethylene and tetrachloroethylene vapor concentrations ranged from about 2,000 to 180,000 and 1,600 to 1,400,000 parts per billion by volume, respectively. Upstream and downstream from this reach and along the former mill raceway, trichloroethylene and tetrachloroethylene vapor concentrations from the diffusion samples were generally less than 100 parts per billion by volume. Along the lower reaches of the river and mill raceway, however, and in the cross channel, vapor concentrations of trichloroethylene exceeded 100 parts per billion by volume and tetrachloroethylene exceeded 1,000 parts per billion by volume in several diffusion samples. Although diffusion sample vapor concentrations are higher than water concentrations in surface waters and in ground water, and they should only be interpreted qualitatively as relative values, these values provide important information as to potential discharge areas of contaminants.
Cryogenic spray vaporization in high-velocity helium, argon and nitrogen gasflows
NASA Technical Reports Server (NTRS)
Ingebo, Robert D.
1993-01-01
Effects of gas properties on cryogenic liquid-jet atomization in high-velocity helium, nitrogen, and argon gas flows were investigated. Volume median diameter, D(sub v.5e), data were obtained with a scattered-light scanning instrument. By calculating the change in spray drop size, -Delta D(sub v.5)(exp 2), due to droplet vaporization, it was possible to calculate D(sub v.5C). D(sub v.5C) is the unvaporized characteristic drop size formed at the fuel-nozzle orifice. This drop size was normalized with respect to liquid-jet diameter, D(sub O). It was then correlated with several dimensionless groups to give an expression for the volume median diameter of cryogenic LN2 sprays. This expression correlates drop size D(sub v.5c) with aerodynamic and liquid-surface forces so that it can be readily determined in the design of multiphase-flow propellant injectors for rocket combustors.
Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N
1993-12-20
gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.
NASA Technical Reports Server (NTRS)
Ingebo, Robert D.
1961-01-01
Single jets of ethanol were studied photomicrographically inside a rocket chamber as they broke up into sprays of drops which underwent simultaneous acceleration and vaporization with chemical reaction occurring in the surrounding combustion gas stream. In each rocket test-firing, liquid oxygen was used as the oxidant. Both drop velocity and drop size distribution data were obtained from photomicrographs of the ethanol drops taken with an ultra-high speed tracking camera developed at NASA, Lewis Research Center.
Smith, James A.; Tisdale, Amy K.; Cho, H. Jean
1996-01-01
The upward flux of trichloroethene (TCE) vapor through the unsaturated zone above a contaminated, water-table aquifer at Picatinny Arsenal, New Jersey, has been studied under natural conditions over a 12-month period. Vertical gas-phase diffusion fluxes were estimated indirectly by measuring the TCE vapor concentration gradient in the unsaturated zone and using Fick's law to calculate the flux. The total gas-phase flux (e.g., the sum of diffusion and advection fluxes) was measured directly with a vertical flux chamber (VFC). In many cases, the upward TCE vapor flux was several orders of magnitude greater than the upward TCE diffusion flux, suggesting that mechanisms other than steady-state vapor diffusion are contributing to the vertical transport of TCE vapors through the unsaturated zone. The measured total flux of TCE vapor from the subsurface to the atmosphere is approximately 50 kg/yr and is comparable in magnitude to the removal rate of TCE from the aquifer by an existing pump-and-treat system and by discharge into a nearby stream. The net upward flux of TCE is reduced significantly during a storm event, presumably due to the mass transfer of TCE from the soil gas to the infiltrating rainwater and its subsequent downward advection. Several potential problems associated with the measurement of total gas-phase fluxes are discussed.
The evaporation of a drop of mercury
NASA Astrophysics Data System (ADS)
Winter, Thomas G.
2003-08-01
The evaporative rates of two drops of mercury at room temperature are determined experimentally and theoretically. The resulting mercury vapor levels are estimated and measured, compared with the OSHA permissible exposure limit, and found to be small by comparison.
Experiments on Nitrogen Oxide Production of Droplet Arrays Burning under Microgravity Conditions
NASA Astrophysics Data System (ADS)
Moesl, Klaus; Sattelmayer, Thomas; Kikuchi, Masao; Yamamoto, Shin; Yoda, Shinichi
The optimization of the combustion process is top priority in current aero-engine and aircraft development, particularly from the perspectives of high efficiency, minimized fuel consumption, and a sustainable exhaust gas production. Aero-engines are exclusively liquid-fueled with a strong correlation between the combustion temperature and the emissions of nitric oxide (NOX ). Due to safety concerns, the progress in NOX reduction has been much slower than in stationary gas turbines. In the past, the mixing intensity in the primary zone of aero-engine combustors was improved and air staging implemented. An important question for future aero-engine combustors, consequently, is how partial vaporization influences the NOX emissions of spray flames? In order to address this question, the combustion of partially vaporized, linear droplet arrays was studied experimentally under microgravity conditions. The influence of fuel pre-vaporization on the NOX emissions was assessed in a wide range. The experiments were performed in a drop tower and a sounding rocket campaign. The microgravity environment provided ideal experiment conditions without the disturbing ef-fect of natural convection. This allowed the study of the interacting phenomena of multi-phase flow, thermodynamics, and chemical kinetics. This way the understanding of the physical and chemical processes related to droplet and spray combustion could be improved. The Bremen drop tower (ZARM) was utilized for the precursor campaign in July 2008, which was com-prised of 30 drops. The sounding rocket experiments, which totaled a microgravity duration of 6 minutes, were finally performed on the flight of TEXUS-46 in November 2009. On both campaigns the "Japanese Combustion Module" (JCM) was used. It is a cooperative experi-ment on droplet array combustion between the Japan Aerospace Exploration Agency (JAXA) and ESA's (European Space Agency) research team, working on the combustion properties of partially premixed sprays. One droplet array consisted of five droplets (for sounding rocket) and 9 -17 droplets (for drop tower) of the hydrocarbon n-decane (C10 H22 ). While keeping the pressure at 1.0 bar (+/-20 mbar), the combustion chamber temperature and the fuel vaporization time were varied in the range of 300 -500 K and 0.5 -18 s, respectively. Consequently, the total amount of fuel, the local equivalence ratio Φ along the droplet array, and the dimensionless droplet spacing S/d0 , with d0 being the initial droplet diameter, were adapted. Ignition was initiated by a hot-wire igniter from one end of the droplet array. Representative gas samples were collected from every single combustion sequence after flame extinction and stored in specially treated gas sampling cylinders for their succeeding analysis on ground. Visual observation of the combustion process, as well as temperature and pressure logging, supported the scientific interpretation of the gas analysis. With an increase of the preheating temperature, NOX emissions increase due to a higher effec-tive flame temperatures. However, with an increasing pre-vaporization, NOX emissions become lower due to the dropping number and the dropping size of burning droplets, acting as hot spots. A correction for the effect of the preheating temperature was developed. It reveals the effect of pre-vaporization and shows that the NOX emissions are almost independent of it for near-stoichiometric operation. At overall lean conditions the NOX emissions drop non-linearly with the degree of vaporization. Up to now, this leads to the conclusion that a high degree of vaporization is required in order to achieve substantial NOX abatement.
The Commercial Vapor Diffusion Apparatus (CVDA) STS-95
NASA Technical Reports Server (NTRS)
2004-01-01
The Commercial Vapor Diffusion Apparatus will be used to perform 128 individual crystal growth investigations for commercial and science research. These experiments will grow crystals of several different proteins, including HIV-1 Protease Inhibitor, Glycogen Phosphorylase A, and NAD Synthetase. The Commercial Vapor Diffusion Apparatus supports multiple commercial investigations within a controlled environment. The goal of the Commercial Protein Crystal Growth payload on STS-95 is to grow large, high-quality crystals of several different proteins of interest to industry, and to continue to refine the technology and procedures used in microgravity for this important commercial research.
Microfabricated valveless devices for thermal bioreactions based on diffusion-limited evaporation.
Wang, Fang; Yang, Ming; Burns, Mark A
2008-01-01
Microfluidic devices that reduce evaporative loss during thermal bioreactions such as PCR without microvalves have been developed by relying on the principle of diffusion-limited evaporation. Both theoretical and experimental results demonstrate that the sample evaporative loss can be reduced by more than 20 times using long narrow diffusion channels on both sides of the reaction region. In order to further suppress the evaporation, the driving force for liquid evaporation is reduced by two additional techniques: decreasing the interfacial temperature using thermal isolation and reducing the vapor concentration gradient by replenishing water vapor in the diffusion channels. Both thermal isolation and vapor replenishment techniques can limit the sample evaporative loss to approximately 1% of the reaction content.
NASA Astrophysics Data System (ADS)
Abdel-Hameed, H.; Bellan, J.
2002-10-01
Direct numerical simulations are performed of spatial, three-dimensional, laminar jets of different inlet geometric configurations for the purpose of quantifying the characteristics of the flows; both single-phase (SP) and two-phase (TP) free jets are considered. The TP jets consist of gas laden with liquid drops randomly injected at the inlet. Drop evaporation ensues both due to the gaseous flow being initially unvitiated by the vapor species corresponding to the liquid drops, and to drop heating as the initial drop temperature is lower than that of the carrier gas. The conservation equations for the TP flow include complete couplings of mass, momentum, and energy based on thermodynamically self-consistent specification of the vapor enthalpy, internal energy, and latent heat of vaporization. Inlet geometries investigated are circular, elliptic, rectangular, square, and triangular. The results focus both on the different spreading achieved according to the inlet geometry, as well as on the considerable change in the flow field due to the presence of the drops. The most important consequence of the drop interaction with the flow is the production of streamwise vorticity that alters entrainment and species mixing according to the inlet geometry. Similar to their SP equivalent, TP jets are shown to reach steady-state entrainment; examination of the flows at this time station shows that the potential cores of TP jets are shorter by an order of magnitude than their SP counterpart. Moreover, whereas the TP circular jet exhibits a symmetric entrainment pattern well past the streamwise location of the potential core, noncircular jets display at the same location strong departures from symmetry. Furthermore, the SP-jet phenomenon of axis switching is no longer present in TP jets. The distributions of drop-number density, liquid mass, and evaporated species are compared for different inlet cross sections and recommendations are made regarding the optimal choice for different applications.
Noncircular Cross Sections Could Enhance Mixing in Sprays
NASA Technical Reports Server (NTRS)
Bellan, Josette; Abdel-Hameed, Hesham
2003-01-01
A computational study has shown that by injecting drops in jets of gas having square, elliptical, triangular, or other noncircular injection cross sections, it should be possible to increase (relative to comparable situations having circular cross section) the entrainment and dispersion of liquid drops. This finding has practical significance for a variety of applications in which it is desirable to increase dispersion of drops. For example, in chemical-process sprays, increased dispersion leads to increases in chemical- reaction rates; in diesel engines, increasing the dispersion of drops of sprayed fuel reduces the production of soot; and in household and paint sprays, increasing the dispersion of drops makes it possible to cover larger surfaces. It has been known for some years that single-phase fluid jets that enter flow fields through noncircular inlets entrain more fluid than do comparable jets entering through circular inlets. The computational study reported here was directed in part toward determining whether and how this superior mixing characteristic of noncircular single phase jets translates to a similar benefit in cases of two-phase jets (that is, sprays). The study involved direct numerical simulations of single- and two-phase free jets with circular, elliptical, rectangular, square, and triangular inlet cross sections. The two-phase jets consisted of gas laden with liquid drops randomly injected at the inlets. To address the more interesting case of evaporating drops, the carrier gas in the jets was specified to be initially unvitiated by the vapor of the liquid chemical species and the initial temperature of the drops was chosen to be smaller than that of the gas. The mathematical model used in the study was constructed from the conservation equations for the two-phase flow and included complete couplings of mass, momentum, and energy based on thermodynamically self-consistent specification of the enthalpy, internal energy, and latent heat of vaporization of the vapor.
Can Hail and Rain Nucleate Cloud Droplets?
NASA Astrophysics Data System (ADS)
Weiss, S.; Prabhakaran, P.; Krekhov, A.; Pumir, A.; Bodenschatz, E.
2017-12-01
We present results from a laboratory scale moist convection experiment composed of a mixture of pressurized sulphur hexafluoride (SF6 - liquid and vapor phase) and helium (He - gas phase) to mimic the wet (saturated water vapor) and dry components (nitrogen, oxygen etc.) of the earth's atmosphere. We operate the experiments close to critical conditions to allow for homogeneous nucleation of sulphur hexafluoride droplets. The liquid SF6 pool is heated from below and the warm SF6 vapor from the liquid-vapor interface rise and condense underneath the cold top plate. We observe the nucleation of microdroplets in the wake of cold drops falling through the SF6-He atmosphere. Using classical nucleation theory, we show that the nucleation is caused by isobaric cooling of SF6 vapor in the wake of the cold drop. Furthermore, we argue that in an atmospheric cloud, falling hail and large cold raindrops may induce heterogeneous nucleation of microdroplets in their wake. We also observe that under appropriate conditions these microdroplets form a stable horizontal layer, thus separating regions of super and sub-critical saturation.
Can hail and rain nucleate cloud droplets?
NASA Astrophysics Data System (ADS)
Prabhakaran, Prasanth; Weiss, Stephan; Krekhov, Alexei; Pumir, Alain; Bodenschatz, Eberhard
2017-11-01
We present results from a laboratory scale moist convection experiment composed of a mixture of pressurized sulphur hexafluoride (SF6 - liquid and vapor phase) and helium (He - gas phase) to mimic the wet (saturated water vapor) and dry components (nitrogen, oxygen etc.) of the earth's atmosphere. We operate the experiments close to critical conditions to allow for homogeneous nucleation of sulphur hexafluoride droplets. The liquid SF6 pool is heated from below and the warm SF6 vapor from the liquid-vapor interface rise and condense underneath the cold top plate. We observe the nucleation of microdroplets in the wake of cold drops falling through the SF6-He atmosphere. Using classical nucleation theory, we show that the nucleation is caused by isobaric cooling of SF6 vapor in the wake of the cold drop. Furthermore, we argue that in an atmospheric cloud, falling hail and large cold raindrops may induce heterogeneous nucleation of microdroplets in their wake. We also observe that under appropriate conditions these microdroplets form a stable horizontal layer, thus separating regions of super and sub-critical saturation.
Influence of surface wettability on transport mechanisms governing water droplet evaporation.
Pan, Zhenhai; Weibel, Justin A; Garimella, Suresh V
2014-08-19
Prediction and manipulation of the evaporation of small droplets is a fundamental problem with importance in a variety of microfluidic, microfabrication, and biomedical applications. A vapor-diffusion-based model has been widely employed to predict the interfacial evaporation rate; however, its scope of applicability is limited due to incorporation of a number of simplifying assumptions of the physical behavior. Two key transport mechanisms besides vapor diffusion-evaporative cooling and natural convection in the surrounding gas-are investigated here as a function of the substrate wettability using an augmented droplet evaporation model. Three regimes are distinguished by the instantaneous contact angle (CA). In Regime I (CA ≲ 60°), the flat droplet shape results in a small thermal resistance between the liquid-vapor interface and substrate, which mitigates the effect of evaporative cooling; upward gas-phase natural convection enhances evaporation. In Regime II (60 ≲ CA ≲ 90°), evaporative cooling at the interface suppresses evaporation with increasing contact angle and counterbalances the gas-phase convection enhancement. Because effects of the evaporative cooling and gas-phase convection mechanisms largely neutralize each other, the vapor-diffusion-based model can predict the overall evaporation rates in this regime. In Regime III (CA ≳ 90°), evaporative cooling suppresses the evaporation rate significantly and reverses entirely the direction of natural convection induced by vapor concentration gradients in the gas phase. Delineation of these counteracting mechanisms reconciles previous debate (founded on single-surface experiments or models that consider only a subset of the governing transport mechanisms) regarding the applicability of the classic vapor-diffusion model. The vapor diffusion-based model cannot predict the local evaporation flux along the interface for high contact angle (CA ≥ 90°) when evaporative cooling is strong and the temperature gradient along the interface determines the peak local evaporation flux.
NASA Astrophysics Data System (ADS)
Šetina, Janez; Sefa, Makfir; Erjavec, Bojan; Hudoklin, Domen
2013-03-01
The dynamics of water-vapor dissolution in Viton O-rings is measured with a gravimetric method using a precise mass comparator. A sample gasket was degassed in high vacuum for a sufficiently long period to remove more than 99 % of the dissolved water vapor. After that, it was exposed to the ambient atmosphere with a controlled temperature, and relative humidity and water-vapor uptake curves were measured gravimetrically with a precise balance. The dynamics of a water-vapor release into vacuum from another sample that was previously saturated with water vapor at room temperature was determined. The sample was placed in a vacuum outgassing rate measurement apparatus. The time dependence of the evolved water vapor was calculated by integrating the measured outgassing rate. The physical process of water absorption can be described by the diffusion equation. The geometry of the samples required solving the diffusion equation in cylindrical coordinates. This was done numerically using a finite-difference method. As a result of the modeling, room temperature values of the diffusion constant D, the solubility s, and the permeability K = D× s of water vapor in the sample material (Viton A-401C) were obtained. For sample 1, we obtained D = 8.0 × 10 ^{-8} cm2 {\\cdot } s^{-1} and s = 6.5 × 10^{-7} g {\\cdot } cm^-3 Pa^{-1}, while for sample 2, D = 3.0 × 10^{-7} cm2 s^{-1} and s = 3.5 × 10^{-7} g {\\cdot } cm^{-3} {\\cdot } Pa^{-1}.
HYDROCARBON VAPOR DIFFUSION IN INTACT CORE SLEEVES
The diffusion of 2,2,4-trimethylpentane (TMP) and 2,2,5-trimethylhexane (TMH) vapors put of residually contaminated sandy soil from the U.S. Environmental Protection Agency (EPA) field research site at Traverse City, Michigan, was measured and modeled. The headspace of an intact ...
Self-diffusion Coefficient and Structure of Binary n-Alkane Mixtures at the Liquid-Vapor Interfaces.
Chilukoti, Hari Krishna; Kikugawa, Gota; Ohara, Taku
2015-10-15
The self-diffusion coefficient and molecular-scale structure of several binary n-alkane liquid mixtures in the liquid-vapor interface regions have been examined using molecular dynamics simulations. It was observed that in hexane-tetracosane mixture hexane molecules are accumulated in the liquid-vapor interface region and the accumulation intensity decreases with increase in a molar fraction of hexane in the examined range. Molecular alignment and configuration in the interface region of the liquid mixture change with a molar fraction of hexane. The self-diffusion coefficient in the direction parallel to the interface of both tetracosane and hexane in their binary mixture increases in the interface region. It was found that the self-diffusion coefficient of both tetracosane and hexane in their binary mixture is considerably higher in the vapor side of the interface region as the molar fraction of hexane goes lower, which is mostly due to the increase in local free volume caused by the local structure of the liquid in the interface region.
Jung, Hyunsook; Choi, Seungki
2017-10-15
The evaporation, degradation, and decontamination of sulfur mustard on environmental matrices including sand, concrete, and asphalt are described. A specially designed wind tunnel and thermal desorber in combination with gas chromatograph (GC) produced profiles of vapor concentration obtained from samples of the chemical agent deposited as a drop on the surfaces of the matrices. The matrices were exposed to the chemical agent at room temperature, and the degradation reactions were monitored and characterized. A vapor emission test was also performed after a decontamination process. The results showed that on sand, the drop of agent spread laterally while evaporating. On concrete, the drop of the agent was absorbed immediately into the matrix while spreading and evaporating. However, the asphalt surface conserved the agent and slowly released parts of the agent over an extended period of time. The degradation reactions of the agent followed pseudo first order behavior on the matrices. Trace amounts of the residual agent present at the surface were also released as vapor after decontamination, posing a threat to the exposed individual and environment.
Gas-evaporation in low-gravity field (cogelation mechanism of metal vapors) (M-14)
NASA Technical Reports Server (NTRS)
Wada, N.
1993-01-01
When metal and alloy compounds are heated and vaporized in a rare gas such as helium, argon, or xenon, the vaporized substances diffused in the rare gas are supersaturated resulting in a smoke of fine particles of the material congealing as snow or fog. The gas vaporizing method is a fine particle generation method. Though the method has a variety of applications, the material vapor flow is disturbed by gravitational convection on Earth. The inability to elucidate the fine particle generation mechanism results in an obstruction to improving the method to mass production levels. As no convection occurs in microgravity in space, the fine particle generation mechanism influenced only by diffusion can be investigated. Investigators expect that excellent particles with homogeneous diameter distribution can be obtained. Experiment data and facts will assist in improving efficiency, quality, and scale or production processes including element processes such as vaporization, diffusion, and condensation. The objective of this experiment is to obtain important information related to the mechanism of particle formation in the gas atmosphere (smoke particles) and the production of submicron powders of extremely uniform size.
Diffusion mechanisms in chemical vapor-deposited iridium coated on chemical vapor-deposited rhenium
NASA Technical Reports Server (NTRS)
Hamilton, J. C.; Yang, N. Y. C.; Clift, W. M.; Boehme, D. R.; Mccarty, K. F.; Franklin, J. E.
1992-01-01
Radiation-cooled rocket thruster chambers have been developed which use CVD Re coated with CVD Ir on the interior surface that is exposed to hot combustion gases. The Ir serves as an oxidation barrier which protects the structural integrity-maintaining Re at elevated temperatures. The diffusion kinetics of CVD materials at elevated temperatures is presently studied with a view to the prediction and extension of these thrusters' performance limits. Line scans for Ir and Re were fit on the basis of a diffusion model, in order to extract relevant diffusion constants; the fastest diffusion process is grain-boundary diffusion, where Re diffuses down grain boundaries in the Ir overlayer.
NASA Astrophysics Data System (ADS)
Kostarev, K.; Denisova, M.; Shmyrov, A.
2018-03-01
The paper presents the results of comparative investigation of the interaction between the capillary and buoyant mechanisms of motion in a problem of surfactant mass transfer between an insoluble drop and surrounding fluid under different gravity conditions. The research was performed for the drop that is coupled with the reservoir filled with a source mixture through a long thin tube (needle). Visualization of the flow patterns and concentration fields has shown that surfactant diffusion from the needle at normal gravity leads to the onset of the oscillatory mode of the capillary convection in the drop. It has been found that the frequency of the Marangoni convection outbursts, the lifetime of the oscillatory flow modes and the amount of the source mixture involved in the process of mass transfer depend on the drop size and initial concentration of the surfactant. The obtained results are compared with the cases of surfactant diffusion from the isolated drop under terrestrial conditions and from the drop coupled with reservoir in microgravity. Additionally, a series of experiments were performed to investigate diffusion of a surfactant from the surrounding solution into a drop.
NASA Astrophysics Data System (ADS)
Prosperetti, Andrea
2017-01-01
This article reviews the fundamental physics of vapor bubbles in liquids. Work on bubble growth and condensation for stationary and translating bubbles is summarized and the differences with bubbles containing a permanent gas stressed. In particular, it is shown that the natural frequency of a vapor bubble is proportional not to the inverse radius, as for a gas bubble, but to the inverse radius raised to the power 2/3. Permanent gas dissolved in the liquid diffuses into the bubble with strong effects on its dynamics. The effects of the diffusion of heat and mass on the propagation of pressure waves in a vaporous bubbly liquid are discussed. Other topics briefly touched on include thermocapillary flow, plasmonic nanobubbles, and vapor bubbles in an immiscible liquid.
Water vapor diffusion membranes
NASA Technical Reports Server (NTRS)
Holland, F. F., Jr.; Smith, J. K.
1974-01-01
The program is reported, which was designed to define the membrane technology of the vapor diffusion water recovery process and to test this technology using commercially available or experimental membranes. One membrane was selected, on the basis of the defined technology, and was subjected to a 30-day demonstration trial.
Model for determining vapor equilibrium rates in the hanging drop method for protein crystal growth
NASA Technical Reports Server (NTRS)
Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.
1987-01-01
An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented. Results are applied to 18 drop and well arrangements commonly encountered in the laboratory. The chemical nature of the salt, drop size and shape, drop concentration, well size, well concentration, and temperature are taken into account. The rate of evaporation increases with temperature, drop size, and the salt concentration difference between the drop and the well. The evaporation in this model possesses no unique half-life. Once the salt in the drop achieves 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.
Combustion of liquid-fuel droplets in supercritical conditions
NASA Technical Reports Server (NTRS)
Shuen, J. S.; Yang, Vigor; Hsaio, C. C.
1992-01-01
A comprehensive analysis of liquid-fuel droplet combustion in both subcritical and supercritical environments has been conducted. The formulation is based on the complete conservation equations for both gas and liquid phases, and accommodates variable thermophysical properties, finite-rate chemical kinetics, and a full treatment of liquid-vapor phase equilibrium at the drop surface. The governing equations and associated interfacial boundary conditions are solved numerically using a fully coupled, implicit scheme with the dual time-stepping integration technique. The model is capable of treating the entire droplet history, including the transition from the subcritical to supercritical state. As a specific example, the combustion of n-pentane fuel droplets in air is studied for pressures in the range of 5-140 atm. Results indicate that the ambient gas pressure exerts significant control of droplet gasification and burning processes through its influence on fluid transport, gas-liquid interfacial thermodynamics, and chemical reactions. The droplet gasification rate increases progressively with pressure. However, the data for the overall burnout time exhibit a considerable change in the combustion mechanism at the critical pressure, mainly as a result of reduced mass diffusivity and latent heat of vaporization with increased pressure.
An evaporation model of colloidal suspension droplets
NASA Astrophysics Data System (ADS)
Sartori, Silvana; Li\\ Nán, Amable; Lasheras, Juan C.
2009-11-01
Colloidal suspensions of polymers in water or other solvents are widely used in the pharmaceutical industry to coat tablets with different agents. These allow controlling the rate at which the drug is delivered, taste or physical appearance. The coating is performed by simultaneously spraying and drying the tablets with the colloidal suspension at moderately high temperatures. The spreading of the coating on the pills surface depends on the droplet Webber and Reynolds numbers, angle of impact, but more importantly on the rheological properties of the drop. We present a model for the evaporation of a colloidal suspension droplet in a hot air environment with temperatures substantially lower than the boiling temperature of the carrier fluid. As the liquid vaporizes from the surface, a compacting front advances into the droplet faster than the liquid surface regresses, forming a shell of a porous medium where the particles reach their maximum packing density. While the surface regresses, the evaporation rate is determined by both the rate at which heat is transported to the droplet surface and the rate at which liquid vapor is diffused away from it. This regime continues until the compacting front reaches the center of the droplet, at which point the evaporation rate is drastically reduced.
Droplet Vaporization In A Levitating Acoustic Field
NASA Technical Reports Server (NTRS)
Ruff, G. A.; Liu, S.; Ciobanescu, I.
2003-01-01
Combustion experiments using arrays of droplets seek to provide a link between single droplet combustion phenomena and the behavior of complex spray combustion systems. Both single droplet and droplet array studies have been conducted in microgravity to better isolate the droplet interaction phenomena and eliminate or reduce the effects of buoyancy-induced convection. In most experiments involving droplet arrays, the droplets are supported on fibers to keep them stationary and close together before the combustion event. The presence of the fiber, however, disturbs the combustion process by introducing a source of heat transfer and asymmetry into the configuration. As the number of drops in a droplet array increases, supporting the drops on fibers becomes less practical because of the cumulative effect of the fibers on the combustion process. To eliminate the effect of the fiber, several researchers have conducted microgravity experiments using unsupported droplets. Jackson and Avedisian investigated single, unsupported drops while Nomura et al. studied droplet clouds formed by a condensation technique. The overall objective of this research is to extend the study of unsupported drops by investigating the combustion of well-characterized drop clusters in a microgravity environment. Direct experimental observations and measurements of the combustion of droplet clusters would provide unique experimental data for the verification and improvement of spray combustion models. In this work, the formation of drop clusters is precisely controlled using an acoustic levitation system so that dilute, as well as dense clusters can be created and stabilized before combustion in microgravity is begun. While the low-gravity test facility is being completed, tests have been conducted in 1-g to characterize the effect of the acoustic field on the vaporization of single and multiple droplets. This is important because in the combustion experiment, the droplets will be formed and levitated prior to ignition. Therefore, the droplets will begin to vaporize in the acoustic field thus forming the "initial conditions" for the combustion process. Understanding droplet vaporization in the acoustic field of this levitator is a necessary step that will help to interpret the experimental results obtained in low-gravity.
Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S
2003-10-01
Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.
Terraced spreading of simple liquids on solid surfaces
NASA Technical Reports Server (NTRS)
Yang, Ju-Xing; Koplik, Joel; Banavar, Jayanth R.
1992-01-01
We have studied the spreading of liquid drops on a solid surface by molecular-dynamics simulations of coexisting three-phase Lennard-Jones systems of liquid, vapor, and solid. We consider both spherically symmetric atoms and diatomic molecules, and a range of interaction strengths. As the attraction between liquid and solid increases we observe a smooth transition in spreading regimes, from partial to complete to terraced wetting. In the terraced case, where distinct monomolecular layers spread with different velocities, the layers are ordered but not solid, with substantial molecular diffusion both within and between layers. The quantitative behavior resembles recent experimental findings, but the detailed dynamics differ. In particular, the layers exhibit an unusual spreading law, where their radii vary in time as R-squared approximately equal to log10t, which disagrees with experiments on polymeric liquids as well as recent calculations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee,Y.; Kumar, S.; Jobichen, C.
2007-01-01
Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less
Numerical Simulation of Hydrodynamics of a Heavy Liquid Drop Covered by Vapor Film in a Water Pool
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, W.M.; Yang, Z.L.; Giri, A.
2002-07-01
A numerical study on the hydrodynamics of a droplet covered by vapor film in water pool is carried out. Two level set functions are used as to implicitly capture the interfaces among three immiscible fluids (melt-drop, vapor and coolant). This approach leaves only one set of conservation equations for the three phases. A high-order Navier-Stokes solver, called Cubic-Interpolated Pseudo-Particle (CIP) algorithm, is employed in combination with level set approach, which allows large density ratios (up to 1000), surface tension and jump in viscosity. By this calculation, the hydrodynamic behavior of a melt droplet falling into a volatile coolant is simulated,more » which is of great significance to reveal the mechanism of steam explosion during a hypothetical severe reactor accident. (authors)« less
Pressure Profiles in a Loop Heat Pipe Under Gravity Influence
NASA Technical Reports Server (NTRS)
Ku, Jentung
2015-01-01
During the operation of a loop heat pipe (LHP), the viscous flow induces pressure drops in various elements of the loop. The total pressure drop is equal to the sum of pressure drops in vapor grooves, vapor line, condenser, liquid line and primary wick, and is sustained by menisci at liquid and vapor interfaces on the outer surface of the primary wick in the evaporator. The menisci will curve naturally so that the resulting capillary pressure matches the total pressure drop. In ground testing, an additional gravitational pressure head may be present and must be included in the total pressure drop when LHP components are placed in a non-planar configuration. Under gravity-neutral and anti-gravity conditions, the fluid circulation in the LHP is driven solely by the capillary force. With gravity assist, however, the flow circulation can be driven by the combination of capillary and gravitational forces, or by the gravitational force alone. For a gravity-assist LHP at a given elevation between the horizontal condenser and evaporator, there exists a threshold heat load below which the LHP operation is gravity driven and above which the LHP operation is capillary force and gravity co-driven. The gravitational pressure head can have profound effects on the LHP operation, and such effects depend on the elevation, evaporator heat load, and condenser sink temperature. This paper presents a theoretical study on LHP operations under gravity neutral, anti-gravity, and gravity-assist modes using pressure diagrams to help understand the underlying physical processes. Effects of the condenser configuration on the gravitational pressure head and LHP operation are also discussed.
Pressure Profiles in a Loop Heat Pipe under Gravity Influence
NASA Technical Reports Server (NTRS)
Ku, Jentung
2015-01-01
During the operation of a loop heat pipe (LHP), the viscous flow induces pressure drops in various elements of the loop. The total pressure drop is equal to the sum of pressure drops in vapor grooves, vapor line, condenser, liquid line and primary wick, and is sustained by menisci at liquid and vapor interfaces on the outer surface of the primary wick in the evaporator. The menisci will curve naturally so that the resulting capillary pressure matches the total pressure drop. In ground testing, an additional gravitational pressure head may be present and must be included in the total pressure drop when LHP components are placed in a non-planar configuration. Under gravity-neutral and anti-gravity conditions, the fluid circulation in the LHP is driven solely by the capillary force. With gravity assist, however, the flow circulation can be driven by the combination of capillary and gravitational forces, or by the gravitational force alone. For a gravity-assist LHP at a given elevation between the horizontal condenser and evaporator, there exists a threshold heat load below which the LHP operation is gravity driven and above which the LHP operation is capillary force and gravity co-driven. The gravitational pressure head can have profound effects on the LHP operation, and such effects depend on the elevation, evaporator heat load, and condenser sink temperature. This paper presents a theoretical study on LHP operations under gravity-neutral, anti-gravity, and gravity-assist modes using pressure diagrams to help understand the underlying physical processes. Effects of the condenser configuration on the gravitational pressure head and LHP operation are also discussed.
Heat Pipe Vapor Dynamics. Ph.D. Thesis
NASA Technical Reports Server (NTRS)
Issacci, Farrokh
1990-01-01
The dynamic behavior of the vapor flow in heat pipes is investigated at startup and during operational transients. The vapor is modeled as two-dimensional, compressible viscous flow in an enclosure with inflow and outflow boundary conditions. For steady-state and operating transients, the SIMPLER method is used. In this method a control volume approach is employed on a staggered grid which makes the scheme very stable. It is shown that for relatively low input heat fluxes the compressibility of the vapor flow is low and the SIMPLER scheme is suitable for the study of transient vapor dynamics. When the input heat flux is high or the process under a startup operation starts at very low pressures and temperatures, the vapor is highly compressible and a shock wave is created in the evaporator. It is shown that for a wide range of input heat fluxes, the standard methods, including the SIMPLER scheme, are not suitable. A nonlinear filtering technique, along with the centered difference scheme, are then used for shock capturing as well as for the solution of the cell Reynolds-number problem. For high heat flux, the startup transient phase involves multiple shock reflections in the evaporator region. Each shock reflection causes a significant increase in the local pressure and a large pressure drop along the heat pipe. Furthermore, shock reflections cause flow reversal in the evaporation region and flow circulations in the adiabatic region. The maximum and maximum-averaged pressure drops in different sections of the heat pipe oscillate periodically with time because of multiple shock reflections. The pressure drop converges to a constant value at steady state. However, it is significantly higher than its steady-state value at the initiation of the startup transient. The time for the vapor core to reach steady-state condition depends on the input heat flux, the heat pipe geometry, the working fluid, and the condenser conditions. However, the vapor transient time, for an Na-filled heat pipe is on the order of seconds. Depending on the time constant for the overall system, the vapor transient time may be very short. Therefore, the vapor core may be assumed to be quasi-steady in the transient analysis of a heat pipe operation.
NASA Technical Reports Server (NTRS)
Cao, Y.; Faghri, A.
1993-01-01
The heat pipe startup process is described physically and is divided into five periods for convenience of analysis. The literature survey revealed that none of the previous attempts to simulate the heat pipe startup process numerically were successful, since the rarefied vapor flow in the heat pipe was not considered. Therefore, a rarefied vapor self-diffusion model is proposed, and the early startup periods, in which the rarefied vapor flow is dominant within the heat pipe, are first simulated numerically. The numerical results show that large vapor density gradients existed along the heat pipe length, and the vapor flow reaches supersonic velocities when the density is extremely low. The numerical results are compared with the experimental data of the early startup period with good agreement.
Water vapor diffusion membrane development
NASA Technical Reports Server (NTRS)
Tan, M. K.
1977-01-01
An application of the water vapor diffusion technique is examined whereby the permeated water vapor is vented to space vacuum to alleviate on-board waste storage and provide supplemental cooling. The work reported herein deals primarily with the vapor diffusion-heat rejection (VD-HR) as it applies to the Space Shuttle. A stack configuration was selected, designed and fabricated. An asymmetric cellulose acetate membrane, used in reverse osmosis application was selected and a special spacer was designed to enhance mixing and promote mass transfer. A skid-mount unit was assembled from components used in the bench unit although no attempt was made to render it flight-suitable. The operating conditions of the VD-HR were examined and defined and a 60-day continuous test was carried out. The membranes performed very well throughout the test; no membrane rupture and no unusual flux decay was observed. In addition, a tentative design for a flight-suitable VD-HR unit was made.
Condensation of wet vapors in turbines
NASA Technical Reports Server (NTRS)
Kothman, R. E.
1970-01-01
Computer program predicts condensation point in wet vapor turbines and analyzes subsequent nucleation and growth processes to determine both moisture content and drop size and number distribution as a function of position. Program includes effects of molecular association on condensation and flow processes and handles both subsonic and supersonic flows.
Energy, volatile production, and climatic effects of the Chicxulub Cretaceous/Tertiary impact
NASA Technical Reports Server (NTRS)
Pope, K. O.; Baines, K. H.; Ocampo, A. C.; Ivanov, B. A.
1997-01-01
A comprehensive analysis of volatiles in the Chicxulub impact strongly supports the hypothesis that impact-generated sulfate aerosols caused over a decade of global cooling, acid rain, and disruption of ocean circulation, which contributed to the mass extinction at the Cretaceous/Tertiary (K/T) boundary. The crater size, meteoritic content of the K/T boundary clay, and impact models indicate that the Chicxulub crater was formed by a short period comet or an asteroid impact that released 0.7-3.4 x 10(31) ergs of energy. Impact models and experiments combined with estimates of volatiles in the projectile and target rocks predict that over 200 gigatons (Gt) each of SO2 and water vapor, and over 500 Gt of CO2, were globally distributed in the stratosphere by the impact. Additional volatiles may have been produced on a global or regional scale that formed sulfate aerosols rapidly in cooler parts of the vapor plume, causing an early, intense pulse of sulfuric acid rain. Estimates of the conversion rate of stratospheric SO2 and water vapor to sulfate aerosol, based on volcanic production of sulfate aerosols, coupled with calculations of diffusion, coagulation, and sedimentation, demonstrate that the 200 Gt stratospheric SO2 and water vapor reservoir would produce sulfate aerosols for 12 years. These sulfate aerosols caused a second pulse of acid rain that was global. Radiative transfer modeling of the aerosol clouds demonstrates (1) that if the initial rapid pulse of sulfate aerosols was global, photosynthesis may have been shut down for 6 months and (2) that for the second prolonged aerosol cloud, solar transmission dropped 80% by the end of first year and remained 50% below normal for 9 years. As a result, global average surface temperatures probably dropped between 5 degrees and 31 degrees K, suggesting that global near-freezing conditions may have been reached. Impact-generated CO2 caused less than 1 degree K greenhouse warming and therefore was insignificant compare to the sulfate cooling. The magnitude of sulfate cooling depends largely upon the rate of ocean mixing as surface waters cool, sink, and are replaced by upwelling of deep ocean water. This upwelling apparently drastically altered ocean stratification and circulation, which may explain the global collapse of the delta 13C gradient between surface and deep ocean waters at the K/T boundary.
Thermal-hydraulic behaviors of vapor-liquid interface due to arrival of a pressure wave
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inoue, Akira; Fujii, Yoshifumi; Matsuzaki, Mitsuo
In the vapor explosion, a pressure wave (shock wave) plays a fundamental role for triggering, propagation and enhancement of the explosion. Energy of the explosion is related to the magnitude of heat transfer rate from hot liquid to cold volatile one. This is related to an increasing rate of interface area and to an amount of transient heat flux between the liquids. In this study, the characteristics of transient heat transfer and behaviors of vapor film both on the platinum tube and on the hot melt tin drop, under same boundary conditions have been investigated. It is considered that theremore » exists a fundamental mechanism of the explosion in the initial expansion process of the hot liquid drop immediately after arrival of pressure wave. The growth rate of the vapor film is much faster on the hot liquid than that on the solid surface. Two kinds of roughness were observed, one due to the Taylor instability, by rapid growth of the explosion bubble, and another, nucleation sites were observed at the vapor-liquid interface. Based on detailed observation of early stage interface behaviors after arrival of a pressure wave, the thermal fragmentation mechanism is proposed.« less
Laser diagnostics for microgravity droplet studies
NASA Technical Reports Server (NTRS)
Winter, Michael
1993-01-01
Rapid advances have recently been made in numerical simulation of droplet combustion under microgravity conditions, while experimental capabilities remain relatively primitive. Calculations can now provide detailed information on mass and energy transport, complex gas-phase chemistry, multi-component molecular diffusion, surface evaporation and heterogeneous reaction, which provides a clearer picture of both quasi-steady as well as dynamic behavior of droplet combustion. Experiments concerning these phenomena typically result in pictures of the burning droplets, and the data therefrom describe droplet surface regression along with flame and soot shell position. With much more precise, detailed, experimental diagnostics, significant gains could be made on the dynamics and flame structural changes which occur during droplet combustion. Since microgravity experiments become increasingly more expensive as they progress from drop towers and flights to spaceborne experiments, there is a great need to maximize the information content from these experiments. Sophisticated measurements using laser diagnostics on individual droplets and combustion phenomena are now possible. These include measuring flow patterns and temperature fields within droplets, vaporization rates and vaporization enhancement, radical species profiling in flames and gas-phase flow-tagging velocimetry. Although these measurements are sophisticated, they have undergone maturation to the degree where with some development, they are applicable to studies of microgravity droplet combustion. This program beginning in September of 1992, will include a series of measurements in the NASA Learjet, KC-135 and Drop Tower facilities for investigating the range of applicability of these diagnostics while generating and providing fundamental data to ongoing NASA research programs in this area. This program is being conducted in collaboration with other microgravity investigators and is aimed toward supplementing their experimental efforts.
Modeling studies of gas movement and moisture migration at Yucca Mountain, Nevada
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsang, Y.W.; Pruess, K.
1991-06-01
Modeling studies on moisture redistribution processes that are mediated by gas phase flow and diffusion have been carried out. The problem addressed is the effect of a lowered humidity of the soil gas at the land surface on moisture removal from Yucca Mountain, the potential site for a high-level nuclear waste repository. At the land surface, humid formation gas contacts much drier atmospheric air. Near this contact, the humidity of the soil gas may be considerably lower than at greater depth, where the authors expect equilibrium with the liquid phase and close to 100% humidity. The lower relative humidity ofmore » the soil gas may be modeled by imposing, at the land surface, an additional negative capillary suction corresponding to vapor pressure lowering according to Kelvin`s Equation, thus providing a driving force for the upward movement of moisture in both the vapor and liquid phases. Sensitivity studies show that moisture removal from Yucca Mountain arising from the lowered-relative-humidity boundary condition is controlled by vapor diffusion. There is much experimental evidence in the soil literature that diffusion of vapor is enhanced due to pore-level phase change effects by a few orders of magnitude. Modeling results presented here will account for this enhancement in vapor diffusion.« less
Direct molecular diffusion and micro-mixing for rapid dewatering of LiBr solution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bigham, S; Isfahani, RN; Moghaddam, S
2014-03-01
A slow molecular diffusion rate often limits the desorption process of an absorbate molecule from a liquid absorbent. To enhance the desorption rate, the absorbent is often boiled to increase the liquid vapor interfacial area. However, the growth of bubbles generated during the nucleate boiling process still remains mass-diffusion limited. Here, it is shown that a desorption rate higher than that of boiling can be achieved, if the vapor absorbent interface is continuously replenished with the absorbate-rich solution to limit the concentration boundary layer growth. The study is conducted in a LiBr-water-solution, in which the water molecules' diffusion rate ismore » quite slow. The manipulation of the vapor solution interface concentration distribution is enabled by the mechanical confinement of the solution flow within microchannels, using a hydrophobic vapor-venting membrane and the implementation of microstructures on the flow channel's bottom wall. The microstructures stretch and fold the laminar streamlines within the solution film and produce vortices. The vortices continuously replace the concentrated solution at the vapor solution interface with the water-rich solution brought from the bottom and middle of the flow channel. The physics of the process is described using a combination of experimental and numerical studies. Published by Elsevier Ltd.« less
Calculation of nanodrop profile from fluid density distribution.
Berim, Gersh O; Ruckenstein, Eli
2016-05-01
Two approaches are examined, which can be used to determine the drop profile from the fluid density distributions (FDDs) obtained on the basis of microscopic theories. For simplicity, only two-dimensional (cylindrical, or axisymmetrical) distributions are examined and it is assumed that the fluid is either in contact with a smooth solid or separated from the smooth solid by a lubricating liquid film. The first approach is based on the sharp-kink interface approximation in which the density of the liquid inside and the density of the vapor outside the drop are constant with the exception of the surface layer of the drop where the density is different from the above ones. In this case, the drop profile was calculated by minimizing the total potential energy of the system. The second approach is based on a nonuniform FDD obtained either by the density functional theory or molecular dynamics simulations. To determine the drop profile from such an FDD, which does not contain sharp interfaces, three procedures can be used. In the first two procedures, P1 and P2, the one-dimensional FDDs along straight lines which are parallel to the surface of the solid are extracted from the two-dimensional FDD. Each of those one-dimensional FDDs has a vapor-liquid interface at which the fluid density changes from vapor-like to liquid-like values. Procedure P1 uses the locations of the equimolar dividing surfaces for the one-dimensional FDDs as points of the drop profile. Procedure P2 is based on the assumption that the fluid density is constant on the surface of the drop, that density being selected either arbitrarily or as a fluid density at the location of the equimolar dividing surface for one of the one-dimensional FDDs employed in procedure P1. In the third procedure, P3, which is suggested for the first time in this paper, the one-dimensional FDDs are taken along the straight lines passing through a selected point inside the drop (radial line). Then, the drop profile is calculated like in procedure P1. It is shown, that procedure P3 provides a drop profile which is more reasonable than the other ones. Relationship of the discussed procedures to those used in image analysis is briefly discussed. Copyright © 2016 Elsevier B.V. All rights reserved.
Vapor condensation onto a non-volatile liquid drop
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inci, Levent; Bowles, Richard K., E-mail: richard.bowles@usask.ca
2013-12-07
Molecular dynamics simulations of miscible and partially miscible binary Lennard–Jones mixtures are used to study the dynamics and thermodynamics of vapor condensation onto a non-volatile liquid drop in the canonical ensemble. When the system volume is large, the driving force for condensation is low and only a submonolayer of the solvent is adsorbed onto the liquid drop. A small degree of mixing of the solvent phase into the core of the particles occurs for the miscible system. At smaller volumes, complete film formation is observed and the dynamics of film growth are dominated by cluster-cluster coalescence. Mixing into the coremore » of the droplet is also observed for partially miscible systems below an onset volume suggesting the presence of a solubility transition. We also develop a non-volatile liquid drop model, based on the capillarity approximations, that exhibits a solubility transition between small and large drops for partially miscible mixtures and has a hysteresis loop similar to the one observed in the deliquescence of small soluble salt particles. The properties of the model are compared to our simulation results and the model is used to study the formulation of classical nucleation theory for systems with low free energy barriers.« less
Sutter, Eli; Sutter, Peter
2008-02-01
We use transmission electron microscopy observations to establish the parts of the phase diagram of nanometer sized Au-Ge alloy drops at the tips of Ge nanowires (NWs) that determine their temperature-dependent equilibrium composition and, hence, their exchange of semiconductor material with the NWs. We find that the phase diagram of the nanoscale drop deviates significantly from that of the bulk alloy, which explains discrepancies between actual growth results and predictions on the basis of the bulk-phase equilibria. Our findings provide the basis for tailoring vapor-liquid-solid growth to achieve complex one-dimensional materials geometries.
A fault constitutive relation accounting for thermal pressurization of pore fluid
Andrews, D.J.
2002-01-01
The heat generated in a slip zone during an earthquake can raise fluid pressure and thereby reduce frictional resistance to slip. The amount of fluid pressure rise depends on the associated fluid flow. The heat generated at a given time produces fluid pressure that decreases inversely with the square root of hydraulic diffusivity times the elapsed time. If the slip velocity function is crack-like, there is a prompt fluid pressure rise at the onset of slip, followed by a slower increase. The stress drop associated with the prompt fluid pressure rise increases with rupture propagation distance. The threshold propagation distance at which thermally induced stress drop starts to dominate over frictionally induced stress drop is proportional to hydraulic diffusivity. If hydraulic diffusivity is 0.02 m2/s, estimated from borehole samples of fault zone material, the threshold propagation distance is 300 m. The stress wave in an earthquake will induce an unknown amount of dilatancy and will increase hydraulic diffusivity, both of which will lessen the fluid pressure effect. Nevertheless, if hydraulic diffusivity is no more than two orders of magnitude larger than the laboratory value, then stress drop is complete in large earthquakes.
The role of thermal vapor diffusion in the subsurface hydrologic evolution of Mars
NASA Technical Reports Server (NTRS)
Clifford, Stephen M.
1991-01-01
The hydrologic response of groundwater to the thermal evolution of the early martian crust is considered. When a temperature gradient is present in a moist porous medium, it gives rise to a vapor-pressure gradient that drives the diffusion of water vapor from regions of high to low temperature. By this process, a geothermal gradient as small as 15 K/km could drive the vertical transport of 1 km of water to the freezing front at the base of the martian crysophere every 10 exp 6-10 exp 7 years, or the equivalent of about 100-1000 km of water over the course of martian geologic history. Models of the thermal history of Mars suggest that this thermally-driven vapor flux may have been as much as 3-5 times greater in the past. The magnitude of this transport suggests that the process of geothermally-induced vapor diffusion may have played a critical role in the initial emplacement of ground ice and the subsequent geomorphic and geochemical evolution of the martian crust.
Field Testing of an Unvented Roof with Fibrous Insulation, Tiles, and Vapor Diffusion Venting
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ueno, K.; Lstiburek, J. W.
This research is a test implementation of an unvented tile roof assembly in a hot-humid climate (Orlando, FL; Zone 2A), insulated with air permeable insulation (netted and blown fiberglass). Given the localized moisture accumulation and failures seen in previous unvented roof field work, it was theorized that a 'diffusion vent' (water vapor open, but air barrier 'closed') at the highest points in the roof assembly might allow for the wintertime release of moisture, to safe levels. The 'diffusion vent' is an open slot at the ridge and hips, covered with a water-resistant but vapor open (500+ perm) air barrier membrane.more » As a control comparison, one portion of the roof was constructed as a typical unvented roof (self-adhered membrane at ridge). The data collected to date indicate that the diffusion vent roof shows greater moisture safety than the conventional, unvented roof design.« less
Borodin, Oleg
2009-09-10
A number of correlations between heat of vaporization (H(vap)), cation-anion binding energy (E(+/-)), molar volume (V(m)), self-diffusion coefficient (D), and ionic conductivity for 29 ionic liquids have been investigated using molecular dynamics (MD) simulations that employed accurate and validated many-body polarizable force fields. A significant correlation between D and H(vap) has been found, while the best correlation was found for -log(DV(m)) vs H(vap) + 0.28E(+/-). A combination of enthalpy of vaporization and a fraction of the cation-anion binding energy was suggested as a measure of the effective cohesive energy for ionic liquids. A deviation of some ILs from the reported master curve is explained based upon ion packing and proposed diffusion pathways. No general correlations were found between the ion diffusion coefficient and molecular volume or the diffusion coefficient and cation/anion binding energy.
NASA Technical Reports Server (NTRS)
Kundrot, Craig E.; Barnes, Cindy L.; Snell, Eddie H.; Achari, Aniruddha; Whitaker, Ann F. (Technical Monitor)
2001-01-01
We determined the room temperature 1.2 A structure of thaumatin using a crystal grown in the first protein crystallization experiment conducted aboard the International Space Station (ISS). The crystals were grown in the Enhanced Gaseous Nitrogen Dewar (EGN) developed by Alexander McPherson and co-workers. EGN transports frozen solutions contained in tygon tubing in a liquid nitrogen Dewar to ISS where the tubes then thaw. Batch, free interface diffusion (FID), or vapor diffusion crystallization occurs after thawing. EGN was flown to the ISS on STS-106 on September 8, 2000. This was a "risk mitigation" flight that tested EGN performance and the process of conducting experiments on ISS. We focused on how to map a hanging drop crystallization recipe to the EGN FID method. Thaumatin was chosen as the test system. Three series of crystallization recipes were set-up. Each series tested different volume ratios of protein-rich solution to precipitant-rich solution. The series differed from each other by fixing either the protein concentration or the amount of protein in the solutions. Upon return of the samples to Earth on October 24 by STS-92, bubbles that spanned the diameter of the tubing were observed in all tubes. Such bubbles interrupt liquid-liquid diffusion and force vapor diffusion equilibration to occur instead. Nonetheless, crystals grew in 9 of 30 tubes. Many large crystals were grown, the largest being 2.0 x 1.1 x 1.0 cubic mm. The largest crystal was used to collect data at room temperature on beamline 7-1 of the Stanford Synchrotron Radiation Source to a maximum resolution of 1.2 A. The structure was refined anisotropically using SHELX with a data to parameter ratio of 4.5 to give an R(sub factor) of 15.8% (R(sub free) = 18.2%) for ail reflections without generated hydrogens. This refinement is proceeding. Comparisons of this 1.2 A microgravity structure to previous reports of the thaumatin structure at 1.75 A and to ground control crystals will be presented.
Effects of thermal vapor diffusion on seasonal dynamics of water in the unsaturated zone
Milly, Paul C.D.
1996-01-01
The response of water in the unsaturated zone to seasonal changes of temperature (T) is determined analytically using the theory of nonisothermal water transport in porous media, and the solutions are tested against field observations of moisture potential and bomb fallout isotopic (36Cl and 3H) concentrations. Seasonally varying land surface temperatures and the resulting subsurface temperature gradients induce thermal vapor diffusion. The annual mean vertical temperature gradient is close to zero; however, the annual mean thermal vapor flux is downward, because the temperature‐dependent vapor diffusion coefficient is larger, on average, during downward diffusion (occurring at high T) than during upward diffusion (low T). The annual mean thermal vapor flux is shown to decay exponentially with depth; the depth (about 1 m) at which it decays to e−1of its surface value is one half of the corresponding decay depth for the amplitude of seasonal temperature changes. This depth‐dependent annual mean flux is effectively a source of water, which must be balanced by a flux divergence associated with other transport processes. In a relatively humid environment the liquid fluxes greatly exceed the thermal vapor fluxes, so such a balance is readily achieved without measurable effect on the dynamics of water in the unsaturated zone. However, if the mean vertical water flux through the unsaturated zone is very small (<1 mm y−1), as it may be at many locations in a desert landscape, the thermal vapor flux must be balanced mostly by a matric‐potential‐induced upward flux of water. This return flux may include both vapor and liquid components. Below any near‐surface zone of weather‐related fluctuations of matric potential, maintenance of this upward flux requires an increase with depth in the annual mean matric potential; this theoretical prediction is supported by long‐term field measurements in the Chihuahuan Desert. The analysis also makes predictions, confirmed by the field observations, regarding the seasonal variations of matric potential at a given depth. The conceptual model of unsaturated zone water transport developed here implies the possibility of near‐surface trapping of any aqueous constituent introduced at the surface.
Equatorial ground ice on Mars: Steady-state stability
NASA Technical Reports Server (NTRS)
Mellon, Michael T.; Jakosky, Bruce M.; Postawko, Susan E.
1993-01-01
Current Martian equatorial surface temperatures are too warm for water ice to exist at the surface for any appreciable length of time before subliming into the atmosphere. Subsurface temperatures are generally warmer still and, despite the presence of a diffusive barrier of porous regolith material, it has been shown by Smoluchowski, Clifford and Hillel, and Fanale et al. that buried ground ice will also sublime and be lost to the atmosphere in a relatively short time. We investigate the behavior of this subliming subsurface ice and show that it is possible for ice to maintain at a steady-state depth, where sublimation and diffusive loss to the atmosphere is balanced by resupply from beneath by diffusion and recondensation of either a deeper buried ice deposits or ground water. We examine the behavior of equatorial ground ice with a numercial time-marching molecular diffusion model. In our model we allow for diffusion of water vapor through a porous regolith, variations in diffusivity and porosity with ice content, and recondensation of sublimed water vapor. A regolith containing considerable amounts of ice can still be very porous, allowing water vapor to diffuse up from deeper within the ice layer where temperatures are warmer due to the geothermal gradient. This vapor can then recondense nearer to the surface where ice had previously sublimed and been lost to the atmosphere. As a result we find that ice deposits migrate to find a steady-state depth, which represents a balance between diffusive loss to the atmosphere through the overlying porous regolith and diffusive resupply through a porous icy regolith below. This depth depends primarily on the long-term mean surface temperature and the nature of the geothermal gradient, and is independent of the ice-free porosity and the regolith diffusivity. Only the rate of loss of ground ice depends on diffusive properties.
Svensson, Tomas; Lewander, Märta; Svanberg, Sune
2010-08-02
We demonstrate high-resolution tunable diode laser absorption spectroscopy (TDLAS) of water vapor confined in nanoporous alumina. Strong multiple light scattering results in long photon pathlengths (1 m through a 6 mm sample). We report on strong line broadening due to frequent wall collisions (gas-surface interactions). For the water vapor line at 935.685 nm, the HWHM of confined molecules are about 4.3 GHz as compared to 2.9 GHz for free molecules (atmospheric pressure). Gas diffusion is also investigated, and in contrast to molecular oxygen (that moves rapidly in and out of the alumina), the exchange of water vapor is found very slow.
Savoie, Jennifer G.; LeBlanc, D.R.; Blackwood, D.S.; McCobb, T.D.; Rendigs, R. R.; Clifford, Scott
2000-01-01
Diffusion samplers were installed in the bottom of Johns Pond, Cape Cod, Massachusetts, to confirm that volatile organic compounds from the Storm Drain-5 (SD-5) plume emanating from the Massachusetts Military Reservation (MMR) were discharging into the pond. An array of 134 vapor-diffusion samplers was buried by divers about 0.5 feet below the pond bottom in the presumed discharge area of the SD-5 plume and left in place for about 2 weeks to equilibrate. Two areas of high concentrations of volatile organic compounds (VOCs) were identified. Samples from the first area contained trichloroethene (TCE) and tetrachloroethene with concentrations in vapor as high as 890 and 667 parts per billion by volume, respectively. This discharge area is about 1,000 feet wide, extends from 100 to 350 feet offshore, and is interpreted to be the discharge area of the SD-5 plume. Samples from the second area were located closer to shore than the discharge area of the SD-5 plume and contained unexpectedly high vapor concentrations of TCE (more than 40,000 parts per billion by volume). Ground-water samples collected with a drive-point sampler near the second area had aqueous TCE concentrations as high as 1,100 micrograms per liter. Subsequently, a more closely spaced array of 110 vapor-diffusion samplers was installed to map the area of elevated TCE concentrations . The discharge area detected with the samplers is about 75 feet wide and extends from about 25 to 200 feet offshore . TCE vapor concentrations in this area were as high as 42,800 parts per billion by volume. TCE concentrations in micrograms per liter in water-diffusion samples from 15 selected sites in the two discharge areas were about 35 times lower than the TCE concentrations in parts per billion by volume in corresponding vapor-diffusion samples. The difference in values is due to the volatile nature of TCE and the different units of measure. TCE was detected in diffusion samplers set in the pond water column above the plume discharge areas, but the TCE concentrations were 20 to 30 times lower than the corresponding levels in diffusion samplers buried in the pond bottom.
DNS of moderate-temperature gaseous mixing layers laden with multicomponent-fuel drops
NASA Technical Reports Server (NTRS)
Clercq, P. C. Le; Bellan, J.
2004-01-01
A formulation representing multicomponent-fuel (MC-fuel) composition as a Probability Distribution Function (PDF) depending on the molar weight is used to construct a model of a large number of MC-fuel drops evaporating in a gas flow, so as to assess the extent of fuel specificity on the vapor composition.
Method and means for producing solid evacuated microspheres of hydrogen
Turnbull, Robert J.; Foster, Christopher A.; Hendricks, Charles D.
1976-01-01
A method is provided for producing solid, evacuated microspheres comprised of hydrogen. The spheres are produced by forming a jet of liquid hydrogen and exciting mechanical waves on the jet of appropriate frequency so that the jet breaks up into drops with a bubble formed in each drop by cavitation. The drops are exposed to a pressure less than the vapor pressure of the liquid hydrogen so that the bubble which is formed within each drop expands. The drops which contain bubbles are exposed to an environment having a pressure just below the triple point of liquid hydrogen and they thereby freeze giving solid, evacuated spheres of hydrogen.
Solid evacuated microspheres of hydrogen
Turnbull, Robert J.; Foster, Christopher A.; Hendricks, Charles D.
1982-01-01
A method is provided for producing solid, evacuated microspheres comprised of hydrogen. The spheres are produced by forming a jet of liquid hydrogen and exciting mechanical waves on the jet of appropriate frequency so that the jet breaks up into drops with a bubble formed in each drop by cavitation. The drops are exposed to a pressure less than the vapor pressure of the liquid hydrogen so that the bubble which is formed within each drop expands. The drops which contain bubbles are exposed to an environment having a pressure just below the triple point of liquid hydrogen and they thereby freeze giving solid, evacuated spheres of hydrogen.
Studies of the Terrestrial Molecular Oxygen and Carbon Cycles in Sand Dune Gases and in Biosphere 2.
NASA Astrophysics Data System (ADS)
Severinghaus, Jeffrey Peck
Molecular oxygen in the atmosphere is coupled tightly to the terrestrial carbon cycle by the processes of photosynthesis, respiration, and burning. This dissertation examines different aspects of this coupling in four chapters. Chapter 1 explores the feasibility of using air from sand dunes to reconstruct atmospheric O_2 composition centuries ago. Such a record would reveal changes in the mass of the terrestrial biosphere, after correction for known fossil fuel combustion, and constrain the fate of anthropogenic CO_2. Test drilling in sand dunes shows that sand dunes do contain old air, as shown by the concentrations of chlorofluorocarbons and ^{85}Kr. Diffusion is shown to dominate mixing rather than advection. However, biological respiration in dunes corrupts the signal, and isotopic analysis of O_2 and N _2 shows that fractionation of the gases precludes use of sand dunes as archives. Chapter 2 further explores this fractionation, revealing a previously unknown "water vapor flux fractionation" process. A flux of water vapor out of the moist dune into the dry desert air sweeps out the other gases, forcing them to diffuse back into the dune. The heavy isotopes of N_2 and O_2 diffuse more slowly, creating a steady state depletion of heavy isotopes in the dune interior. Molecular diffusion theory and a laboratory simulation of the effect agree well with the observations. Additional fractionation of the dune air occurs via thermal diffusion and gravitational settling, and it is predicted that soil gases in general will enjoy all three effects. Chapter 3 examines the cause of a mysterious drop in O _2 concentrations in the closed ecosystem of Biosphere 2, located near Tucson, Arizona. The organic -rich soil manufactured for the experiment is shown to be the culprit, with CO_2 produced by bacterial respiration of the organic matter reacting with the extensive concrete surfaces inside. Chapter 4 examines the O_2:C stoichiometry of terrestrial soil respiration and photosynthesis, in the context of using atmospheric O_2 measurements to constrain the size of the "missing sink" of CO_2. Direct measurements of soil respiration and biomatter elemental abundance suggest a value of 1.1 +/- 0.05 oxygen molecules per CO_2 molecule.
Deep-level transient spectroscopy studies of Ni- and Zn-diffused vapor-phase-epitaxy n-GaAs
NASA Technical Reports Server (NTRS)
Partin, D. L.; Chen, J. W.; Milnes, A. G.; Vassamillet, L. F.
1979-01-01
The paper presents deep-level transient spectroscopy studies of Ni- and Zn-diffused vapor-phase epitaxy n-GaAs. Nickel diffused into VPE n-GaAs reduces the hole diffusion length L sub p from 4.3 to 1.1 microns. Deep-level transient spectroscopy was used to identify energy levels in Ni-diffused GaAs; the as-grown VPE GaAs contains traces of these levels and an electron trap. Ni diffusion reduces the concentration of this level by an amount that matches the increase in concentration of each of the two Ni-related levels. A technique for measuring minority-carrier capture cross sections was developed, which indicates that L sub p in Ni-diffused VPE n-GaAs is controlled by the E sub c - 0.39 eV defect level.
Protein crystal growth in a microgravity environment
NASA Technical Reports Server (NTRS)
Bugg, Charles E.
1988-01-01
Protein crystal growth is a major experimental problem and is the bottleneck in widespread applications of protein crystallography. Research efforts now being pursued and sponsored by NASA are making fundamental contributions to the understanding of the science of protein crystal growth. Microgravity environments offer the possibility of performing new types of experiments that may produce a better understanding of protein crystal growth processes and may permit growth environments that are more favorable for obtaining high quality protein crystals. A series of protein crystal growth experiments using the space shuttle was initiated. The first phase of these experiments was focused on the development of micro-methods for protein crystal growth by vapor diffusion techniques, using a space version of the hanging drop method. The preliminary space experiments were used to evolve prototype hardware that will form the basis for a more advanced system that can be used to evaluate effects of gravity on protein crystal growth.
Three-dimensional structure of Erwinia carotovora L-asparaginase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kislitsyn, Yu. A.; Kravchenko, O. V.; Nikonov, S. V.
2006-10-15
Three-dimensional structure of Erwinia carotovora L-asparaginase, which has antitumor activity and is used for the treatment of acute lymphoblastic leukemia, was solved at 3 A resolution and refined to R{sub cryst} = 20% and R{sub free} = 28%. Crystals of recombinant Erwinia carotovora L-asparaginase were grown by the hanging-drop vapor-diffusion method from protein solutions in a HEPES buffer (pH 6.5) and PEG MME 5000 solutions in a cacodylate buffer (pH 6.5) as the precipitant. Three-dimensional X-ray diffraction data were collected up to 3 A resolution from one crystal at room temperature. The structure was solved by the molecular replacement methodmore » using the coordinates of Erwinia chrysanthemi L-asparaginase as the starting model. The coordinates refined with the use of the CNS program package were deposited in the Protein Data Bank (PDB code 1ZCF)« less
Crystallization and X-ray analysis of the salmon-egg lectin SEL24K.
Murata, Kenji; Fisher, Andrew J; Hedrick, Jerry L
2007-05-01
The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 A resolution. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 A, alpha = 90, beta = 92.82, gamma = 90 degrees. The crystal is likely to contain eight molecules in the asymmetric unit (V(M) = 2.3 A3 Da(-1)), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelersa, Claudiu M.; Schmier, Brad J.; Malhotra, Arun
2012-05-08
The final step in RNA degradation is the hydrolysis of RNA fragments five nucleotides or less in length (nanoRNA) to mononucleotides. In Escherichia coli this step is carried out by oligoribonuclease (Orn), a DEDD-family exoribonuclease that is conserved throughout eukaryotes. However, many bacteria lack Orn homologs, and an unrelated DHH-family phosphoesterase, NrnA, has recently been identified as one of the enzymes responsible for nanoRNA degradation in Bacillus subtilis. To understand its mechanism of action, B. subtilis NrnA was purified and crystallized at room temperature using the hanging-drop vapor-diffusion method with PEG 4000, PEG 3350 or PEG MME 2000 as precipitant.more » The crystals belonged to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 50.62, b = 121.3, c = 123.4 {angstrom}, {alpha} = 90, {beta} = 91.31, {gamma} = 90{sup o}.« less
Mechanism of anisotropic surface self-diffusivity at the prismatic ice-vapor interface.
Gladich, Ivan; Oswald, Amrei; Bowens, Natalie; Naatz, Sam; Rowe, Penny; Roeselova, Martina; Neshyba, Steven
2015-09-21
Predictive theoretical models for mesoscopic roughening of ice require improved understanding of attachment kinetics occurring at the ice-vapor interface. Here, we use classical molecular dynamics to explore the generality and mechanics of a transition from anisotropic to isotropic self-diffusivity on exposed prismatic surfaces. We find that self-diffusion parallel to the crystallographic a-axis is favored over the c-axis at sub-melt temperatures below about -35 °C, for three different representations of the water-water intermolecular potential. In the low-temperature anisotropic regime, diffusion results from interstitial admolecules encountering entropically distinct barriers to diffusion in the two in-plane directions. At higher temperatures, isotropic self-diffusion occurring deeper within the quasi-liquid layer becomes the dominant mechanism, owing to its larger energy of activation.
NASA Astrophysics Data System (ADS)
Calonne, N.; Geindreau, C.; Flin, F.
2015-12-01
At the microscopic scale, i.e., pore scale, dry snow metamorphism is mainly driven by the heat and water vapor transfer and the sublimation-deposition process at the ice-air interface. Up to now, the description of these phenomena at the macroscopic scale, i.e., snow layer scale, in the snowpack models has been proposed in a phenomenological way. Here we used an upscaling method, namely, the homogenization of multiple-scale expansions, to derive theoretically the macroscopic equivalent modeling of heat and vapor transfer through a snow layer from the physics at the pore scale. The physical phenomena under consideration are steady state air flow, heat transfer by conduction and convection, water vapor transfer by diffusion and convection, and phase change (sublimation and deposition). We derived three different macroscopic models depending on the intensity of the air flow considered at the pore scale, i.e., on the order of magnitude of the pore Reynolds number and the Péclet numbers: (A) pure diffusion, (B) diffusion and moderate convection (Darcy's law), and (C) strong convection (nonlinear flow). The formulation of the models includes the exact expression of the macroscopic properties (effective thermal conductivity, effective vapor diffusion coefficient, and intrinsic permeability) and of the macroscopic source terms of heat and vapor arising from the phase change at the pore scale. Such definitions can be used to compute macroscopic snow properties from 3-D descriptions of snow microstructures. Finally, we illustrated the precision and the robustness of the proposed macroscopic models through 2-D numerical simulations.
NASA Technical Reports Server (NTRS)
Chung, Gui-Yung; Mccoy, Benjamin J.
1991-01-01
A homogeneous model is developed for the chemical vapor infiltration by one-dimensional diffusion into a system of layered plies consisting of woven tows containing bundles of filaments. The model predictions of the amount of deposition and the porosity of the sample as a function of time are compared with the predictions of a recent nonhomogeneous model with aligned holes formed by the weave. The nonhomogeneous model allows for diffusion through the aligned holes, into the spaces between plies, and into the gaps around filaments; i.e., three diffusion equations apply. Relative to the nonhomogeneous results, the homogeneous model underestimates the amount of deposition, since the absence of holes and spaces allows earlier occlusion of gaps around filaments and restricts the vapor infiltration.
NASA Technical Reports Server (NTRS)
Bellan, Josette; Harstad, Kenneth; Ohsaka, Kenichi
2003-01-01
Although the high pressure multicomponent fluid conservation equations have already been derived and approximately validated for binary mixtures by this PI, the validation of the multicomponent theory is hampered by the lack of existing mixing rules for property calculations. Classical gas dynamics theory can provide property mixing-rules at low pressures exclusively. While thermal conductivity and viscosity high-pressure mixing rules have been documented in the literature, there is no such equivalent for the diffusion coefficients and the thermal diffusion factors. The primary goal of this investigation is to extend the low pressure mixing rule theory to high pressures and validate the new theory with experimental data from levitated single drops. The two properties that will be addressed are the diffusion coefficients and the thermal diffusion factors. To validate/determine the property calculations, ground-based experiments from levitated drops are being conducted.
Chen, Hai-Bin; Ding, Xi-Hong; Pan, Xu; Hayat, Tasawar; Alsaedi, Ahmed; Ding, Yong; Dai, Song-Yuan
2018-01-24
To achieve high-quality perovskite solar cells (PSCs), the morphology and carrier transportation of perovskite films need to be optimized. Herein, C 60 is employed as nucleation sites in PbI 2 precursor solution to optimize the morphology of perovskite films via vapor-assisted deposition process. Accompanying the homogeneous nucleation of PbI 2 , the incorporation of C 60 as heterogeneous nucleation sites can lower the nucleation free energy of PbI 2 , which facilitates the diffusion and reaction between PbI 2 and organic source. Meanwhile, C 60 could enhance carrier transportation and reduce charge recombination in the perovskite layer due to its high electron mobility and conductivity. In addition, the grain sizes of perovskite get larger with C 60 optimizing, which can reduce the grain boundaries and voids in perovskite and prevent the corrosion because of moisture. As a result, we obtain PSCs with a power conversion efficiency (PCE) of 18.33% and excellent stability. The PCEs of unsealed devices drop less than 10% in a dehumidification cabinet after 100 days and remain at 75% of the initial PCE during exposure to ambient air (humidity > 60% RH, temperature > 30 °C) for 30 days.
Analysis of models for two solution crystal growth problems
NASA Technical Reports Server (NTRS)
Fehribach, Joseph D.; Rosenberger, Franz
1989-01-01
Two diffusive solution crystal growth models are considered which are characterized by two phases separated by an interface, a lack of convective mixing in either phase, and the presence of diffusion components differing widely in diffusivity. The first model describes precipitant-driven solution crystal growth and the second model describes a hanging drop evaporation problem. It is shown that for certain proteins sharp concentration gradients may develop in the drop during evaporation, while under the same conditions the concentrations of other proteins remain uniform.
Development of PIV for Microgravity Diffusion Flames
NASA Technical Reports Server (NTRS)
Greenberg, Paul S.; Wernet, Mark P.; Yanis, William; Urban, David L.; Sunderland, Peter B.
2003-01-01
Results are presented from the application of Particle Image Velocimetry(PIV) to the overfire region of a laminar gas jet diffusion flame in normal gravity. A methane flame burning in air at 0.98 bar was considered. The apparatus demonstrated here is packaged in a drop rig designed for use in the 2.2 second drop tower.
Condensation on Slippery Asymmetric Bumps
NASA Astrophysics Data System (ADS)
Park, Kyoo-Chul; Kim, Philseok; Aizenberg, Joanna
Controlling dropwise condensation by designing surfaces that enable droplets to grow rapidly and be shed as quickly as possible is fundamental to water harvesting systems, thermal power generation, distillation towers, etc. However, cutting-edge approaches based on micro/nanoscale textures suffer from intrinsic trade-offs that make it difficult to optimize both growth and transport at once. Here we present a conceptually different design approach based on principles derived from Namib desert beetles, cacti, and pitcher plants that synergistically couples both aspects of condensation and outperforms other synthetic surfaces. Inspired by an unconventional interpretation of the role of the beetle's bump geometry in promoting condensation, we show how to maximize vapor diffusion flux at the apex of convex millimetric bumps by optimizing curvature and shape. Integrating this apex geometry with a widening slope analogous to cactus spines couples rapid drop growth with fast directional transport, by creating a free energy profile that drives the drop down the slope. This coupling is further enhanced by a slippery, pitcher plant-inspired coating that facilitates feedback between coalescence-driven growth and capillary-driven motion. We further observe an unprecedented six-fold higher exponent in growth rate and much faster shedding time compared to other surfaces. We envision that our fundamental understanding and rational design strategy can be applied to a wide range of phase change applications.
Condensation on Slippery Asymmetric Bumps
NASA Astrophysics Data System (ADS)
Park, Kyoo-Chul; Kim, Philseok; Aizenberg, Joanna
2016-11-01
Controlling dropwise condensation by designing surfaces that enable droplets to grow rapidly and be shed as quickly as possible is fundamental to water harvesting systems, thermal power generation, distillation towers, etc. However, cutting-edge approaches based on micro/nanoscale textures suffer from intrinsic trade-offs that make it difficult to optimize both growth and transport at once. Here we present a conceptually different design approach based on principles derived from Namib desert beetles, cacti, and pitcher plants that synergistically couples both aspects of condensation and outperforms other synthetic surfaces. Inspired by an unconventional interpretation of the role of the beetle's bump geometry in promoting condensation, we show how to maximize vapor diffusion flux at the apex of convex millimetric bumps by optimizing curvature and shape. Integrating this apex geometry with a widening slope analogous to cactus spines couples rapid drop growth with fast directional transport, by creating a free energy profile that drives the drop down the slope. This coupling is further enhanced by a slippery, pitcher plant-inspired coating that facilitates feedback between coalescence-driven growth and capillary-driven motion. We further observe an unprecedented six-fold higher exponent in growth rate and much faster shedding time compared to other surfaces. We envision that our fundamental understanding and rational design strategy can be applied to a wide range of phase change applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less
Development of a Scale-up Tool for Pervaporation Processes
Thiess, Holger; Strube, Jochen
2018-01-01
In this study, an engineering tool for the design and optimization of pervaporation processes is developed based on physico-chemical modelling coupled with laboratory/mini-plant experiments. The model incorporates the solution-diffusion-mechanism, polarization effects (concentration and temperature), axial dispersion, pressure drop and the temperature drop in the feed channel due to vaporization of the permeating components. The permeance, being the key model parameter, was determined via dehydration experiments on a mini-plant scale for the binary mixtures ethanol/water and ethyl acetate/water. A second set of experimental data was utilized for the validation of the model for two chemical systems. The industrially relevant ternary mixture, ethanol/ethyl acetate/water, was investigated close to its azeotropic point and compared to a simulation conducted with the determined binary permeance data. Experimental and simulation data proved to agree very well for the investigated process conditions. In order to test the scalability of the developed engineering tool, large-scale data from an industrial pervaporation plant used for the dehydration of ethanol was compared to a process simulation conducted with the validated physico-chemical model. Since the membranes employed in both mini-plant and industrial scale were of the same type, the permeance data could be transferred. The comparison of the measured and simulated data proved the scalability of the derived model. PMID:29342956
Zipper, Lauren E; Aristide, Xavier; Bishop, Dylan P; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B; Santiago, Brianna M; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M; Soares, Alexei S
2014-12-01
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63-82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbante, Paolo; Frezzotti, Aldo; Gibelli, Livio
The unsteady evaporation of a thin planar liquid film is studied by molecular dynamics simulations of Lennard-Jones fluid. The obtained results are compared with the predictions of a diffuse interface model in which capillary Korteweg contributions are added to hydrodynamic equations, in order to obtain a unified description of the liquid bulk, liquid-vapor interface and vapor region. Particular care has been taken in constructing a diffuse interface model matching the thermodynamic and transport properties of the Lennard-Jones fluid. The comparison of diffuse interface model and molecular dynamics results shows that, although good agreement is obtained in equilibrium conditions, remarkable deviationsmore » of diffuse interface model predictions from the reference molecular dynamics results are observed in the simulation of liquid film evaporation. It is also observed that molecular dynamics results are in good agreement with preliminary results obtained from a composite model which describes the liquid film by a standard hydrodynamic model and the vapor by the Boltzmann equation. The two mathematical model models are connected by kinetic boundary conditions assuming unit evaporation coefficient.« less
Detection of Explosive Vapors: The Roles of Exciton and Molecular Diffusion in Real-Time Sensing.
Ali, Mohammad A; Shoaee, Safa; Fan, Shengqiang; Burn, Paul L; Gentle, Ian R; Meredith, Paul; Shaw, Paul E
2016-11-04
Time-resolved quartz crystal microbalance with in situ fluorescence measurements are used to monitor the sorption of the nitroaromatic (explosive) vapor, 2,4-dinitrotoluene (DNT) into a porous pentiptycene-containing poly(phenyleneethynylene) sensing film. Correlation of the nitroaromatic mass uptake with fluorescence quenching shows that the analyte diffusion follows the Case-II transport model, a film-swelling-limited process, in which a sharp diffusional front propagates at a constant velocity through the film. At a low vapor pressure of DNT of ≈16 ppb, the analyte concentration in the front is sufficiently high to give an average fluorophore-analyte separation of ≈1.5 nm. Hence, a long exciton diffusion length is not required for real-time sensing in the solid state. Rather the diffusion behavior of the analyte and the strength of the binding interaction between the analyte and the polymer play first-order roles in the fluorescence quenching process. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Control of flow through a vapor generator
Radcliff, Thomas D.
2005-11-08
In a Rankine cycle system wherein a vapor generator receives heat from exhaust gases, provision is made to avoid overheating of the refrigerant during ORC system shut down while at the same time preventing condensation of those gases within the vapor generator when its temperature drops below a threshold temperature by diverting the flow of hot gases to ambient and to thereby draw ambient air through the vapor generator in the process. In one embodiment, a bistable ejector is adjustable between one position, in which the hot gases flow through the vapor generator, to another position wherein the gases are diverted away from the vapor generator. Another embodiment provides for a fixed valve ejector with a bias towards discharging to ambient, but with a fan on the downstream side of said vapor generator for overcoming this bias.
Spill-Resistant Alkali-Metal-Vapor Dispenser
NASA Technical Reports Server (NTRS)
Klipstein, William
2005-01-01
A spill-resistant vessel has been developed for dispensing an alkali-metal vapor. Vapors of alkali metals (most commonly, cesium or rubidium, both of which melt at temperatures slightly above room temperature) are needed for atomic frequency standards, experiments in spectroscopy, and experiments in laser cooling. Although the present spill-resistant alkali-metal dispenser was originally intended for use in the low-gravity environment of outer space, it can also be used in normal Earth gravitation: indeed, its utility as a vapor source was confirmed by use of cesium in a ground apparatus. The vessel is made of copper. It consists of an assembly of cylinders and flanges, shown in the figure. The uppermost cylinder is a fill tube. Initially, the vessel is evacuated, the alkali metal charge is distilled into the bottom of the vessel, and then the fill tube is pinched closed to form a vacuum seal. The innermost cylinder serves as the outlet for the vapor, yet prevents spilling by protruding above the surface of the alkali metal, no matter which way or how far the vessel is tilted. In the event (unlikely in normal Earth gravitation) that any drops of molten alkali metal have been shaken loose by vibration and are floating freely, a mesh cap on top of the inner cylinder prevents the drops from drifting out with the vapor. Liquid containment of the equivalent of 1.2 grams of cesium was confirmed for all orientations with rubbing alcohol in one of the prototypes later used with cesium.
Lyford, F.P.; Kliever, J.D.; Scott, Clifford
1999-01-01
Volatile organic compounds are present in ground water at the Allen Harbor Landfill and the Calf Pasture Point sites on the former Naval Construction Battalion Center in Davisville, R.I. Vapor-diffusion samplers were used at the two sites during March-April 1998 to identify possible discharge points for contaminants along the shore of Allen Harbor and in two wetland areas near the shore. Results from vapor-diffusion samplers will be used in conjunction with other site information to evaluate proposed ground-water monitoring programs. Volatile organic compounds were detected in 41 of 115 samplers placed along the shoreline at the Allen Harbor Landfill. Trichloroethylene was the principal volatile organic compound detected of eight target compounds. The highest vapor concentration measured exceeded 300,000 parts per billion by volume in an area where TCE was detected in groundwater from nearby monitoring wells. Other chemicals detected in vapor-diffusion samplers included tetrachloroethylene, toluene, and benzene. Concentrations of individual volatile organic compounds were less than 100 parts per billion by volume in most samplers. Volatile organic compounds, principally trichloroethylene, were detected in 7 of 30 samplers placed along the shoreline at Calf Pasture Point; the highest trichloroethylene concentration was 1,900 parts per billion by volume. A trace concentration of tetrachloroethylene was detected in one of the samplers. One of 24 samplers placed in two wetland areas near the shore (suspected discharge areas for ground-water containing volatile organic compounds) detected trichloroethylene at a vapor concentration of 14 parts per billion by volume.
NASA Technical Reports Server (NTRS)
Castillo, J. L.; Garcia-Ybarra, P. L.; Rosner, D. E.
1991-01-01
The stability of solid planar growth from a binary vapor phase with a condensing species dilute in a carrier gas is examined when the ratio of depositing to carrier species molecular mass is large and the main diffusive transport mechanism is thermal diffusion. It is shown that a deformation of the solid-gas interface induces a deformation of the gas phase isotherms that increases the thermal gradients and thereby the local mass deposition rate at the crests and reduces them at the valleys. The initial surface deformation is enhanced by the modified deposition rates in the absence of appreciable Fick/Brownian diffusion and interfacial energy effects.
Li, Chun; Huang, Liang; Snigdha, Gayatri Pongur; Yu, Yifei; Cao, Linyou
2012-10-23
We report a synthesis of single-crystalline two-dimensional GeS nanosheets using vapor deposition processes and show that the growth behavior of the nanosheet is substantially different from those of other nanomaterials and thin films grown by vapor depositions. The nanosheet growth is subject to strong influences of the diffusion of source materials through the boundary layer of gas flows. This boundary layer diffusion is found to be the rate-determining step of the growth under typical experimental conditions, evidenced by a substantial dependence of the nanosheet's size on diffusion fluxes. We also find that high-quality GeS nanosheets can grow only in the diffusion-limited regime, as the crystalline quality substantially deteriorates when the rate-determining step is changed away from the boundary layer diffusion. We establish a simple model to analyze the diffusion dynamics in experiments. Our analysis uncovers an intuitive correlation of diffusion flux with the partial pressure of source materials, the flow rate of carrier gas, and the total pressure in the synthetic setup. The observed significant role of boundary layer diffusions in the growth is unique for nanosheets. It may be correlated with the high growth rate of GeS nanosheets, ~3-5 μm/min, which is 1 order of magnitude higher than other nanomaterials (such as nanowires) and thin films. This fundamental understanding of the effect of boundary layer diffusions may generally apply to other chalcogenide nanosheets that can grow rapidly. It can provide useful guidance for the development of general paradigms to control the synthesis of nanosheets.
Quantitative Measurement of Oxygen in Microgravity Combustion
NASA Technical Reports Server (NTRS)
Silver, Joel A.
1997-01-01
A low-gravity environment, in space or in ground-based facilities such as drop towers, provides a unique setting for studying combustion mechanisms. Understanding the physical phenomena controlling the ignition and spread of flames in microgravity has importance for space safety as well as for better characterization of dynamical and chemical combustion processes which are normally masked by buoyancy and other gravity-related effects. Due to restrictions associated with performing measurements in reduced gravity, diagnostic methods which have been applied to microgravity combustion studies have generally been limited to capture of flame emissions on film or video, laser Schlieren imaging and (intrusive) temperature measurements using thermocouples. Given the development of detailed theoretical models, more sophisticated diagnostic methods are needed to provide the kind of quantitative data necessary to characterize the properties of microgravity combustion processes as well as provide accurate feedback to improve the predictive capabilities of the models. When the demands of space flight are considered, the need for improved diagnostic systems which are rugged, compact, reliable, and operate at low power becomes apparent. The objective of this research is twofold. First, we want to develop a better understanding of the relative roles of diffusion and reaction of oxygen in microgravity combustion. As the primary oxidizer species, oxygen plays a major role in controlling the observed properties of flames, including flame front speed (in solid or liquid flames), extinguishment characteristics, flame size and flame temperature. The second objective is to develop better diagnostics based on diode laser absorption which can be of real value in both microgravity combustion research and as a sensor on-board Spacelab as either an air quality monitor or as part of a fire detection system. In our prior microgravity work, an eight line-of-sight fiber optic system measured water vapor mole fractions in the NASA Lewis 2.2-sec Drop Tower. In that system, the laser and all electronics resided at the top of the drop tower and was connected via a fiber optic cable to the rig, on which a 'pitch and catch' set of fiber collimating lenses were used to transmit the laser beam across a jet diffusion flame. This system required eight independent detection/demodulation units and had poor spatial resolution. This research builds on this earlier work, resulting in an improved capability for quantitative, nonintrusive measurement of major combustion species. A vertical cavity surface-emitting diode laser (VCSEL) and a continuous spatial scanning method permit the measurement of temporal and spatial profiles of the concentrations and temperatures of molecular oxygen. High detection sensitivity is achieved with wavelength modulation spectroscopy (WMS). One-g experiments are performed using a slot diffusion flame. Microgravity measurements on a solid fuel (cellulose sheet) system are planned for the NASA Lewis 2.2-second Drop Tower Facility.
Permeability of cork for water and ethanol.
Fonseca, Ana Luisa; Brazinha, Carla; Pereira, Helena; Crespo, Joao G; Teodoro, Orlando M N D
2013-10-09
Transport properties of natural (noncompressed) cork were evaluated for water and ethanol in both vapor and liquid phases. The permeability for these permeants has been measured, as well as the sorption and diffusion coefficients. This paper focuses on the differences between the transport of gases' relevant vapors and their liquids (water and ethanol) through cork. A transport mechanism of vapors and liquids is proposed. Experimental evidence shows that both vapors and liquids permeate not only through the small channels across the cells (plasmodesmata), as in the permeation of gases, but also through the walls of cork cells by sorption and diffusion as in dense membranes. The present study also shows that cork permeability for gases was irreversibly and drastically decreased after cork samples were exposed to ethanol or water in liquid phase.
NASA Astrophysics Data System (ADS)
Gao, Chao; Zhou, Jian; Liu, Guizhen; Wang, Lin
2018-03-01
Olivine structure LiFePO4/carbon nanoparticles are synthesized successfully using a microwave plasma chemical vapor deposition (MPCVD) method. Microwave is an effective method to synthesize nanomaterials, the LiFePO4/carbon nanoparticles with high crystallinity can shorten diffusion routes for ionic transfer and electron tunneling. Meanwhile, a high quality, complete and homogenous carbon layer with appropriate thickness coating on the surface of LiFePO4 particles during in situ chemical vapor deposition process, which can ensure that electrons are able to transfer fast enough from all sides. Electrochemical impedance spectroscopy (EIS) is carried out to collect information about the kinetic behavior of lithium diffusion in LiFePO4/carbon nanoparticles during the charging and discharging processes. The chemical diffusion coefficients of lithium ions, DLi, are calculated in the range of 10-15-10-9 cm2s-1. Nanoscale LiFePO4/carbon particles show the longer regions of the faster solid-solution diffusion, and corresponding to the narrower region of the slower two-phase diffusion during the insertion/exaction of lithium ions. The CV and galvanostatic charge-discharge measurements show that the LiFePO4/carbon nanoparticles perform an excellent electrochemical performance, especially the high rate capacity and cycle life.
NASA Technical Reports Server (NTRS)
Heinlein, Fritz
1926-01-01
The test equipment for studying the vaporization of heavy and medium oils is described as well as some of the experimental properties explored such as vaporization speed and diffusion coefficient. The experiemtal arrangement is also discussed.
Quantitative organic vapor-particle sampler
Gundel, Lara; Daisey, Joan M.; Stevens, Robert K.
1998-01-01
A quantitative organic vapor-particle sampler for sampling semi-volatile organic gases and particulate components. A semi-volatile organic reversible gas sorbent macroreticular resin agglomerates of randomly packed microspheres with the continuous porous structure of particles ranging in size between 0.05-10 .mu.m for use in an integrated diffusion vapor-particle sampler.
NASA Technical Reports Server (NTRS)
Snow, W. L.
1974-01-01
The mutual diffusion of two reacting gases is examined which takes place in a bath of inert gas atoms. Solutions are obtained between concentric spheres, each sphere acting as a source for one of the reactants. The calculational model is used to illustrate severe number density gradients observed in absorption experiments with alkali vapor. Severe gradients result when sq root k/D R is approximately 5 where k, D, and R are respectively the second order rate constant, the multicomponent diffusion constant, and the geometrical dimension of the experiment.
NASA Technical Reports Server (NTRS)
Mackowski, Daniel W.; Knight, Roy W.
1993-01-01
One of the most promising applications of microgravity (micro-g) environments is the manufacture of exotic and high-quality crystals in closed cylindrical ampoules using physical vapor transport (PVT) processes. The quality enhancements are believed to be due to the absence of buoyant convection in the weightless environment - resulting in diffusion-limited transport of the vapor. In a typical experiment, solid-phase sample material is initially contained at one end of the ampoule. The sample is made to sublime into the vapor phase and deposit onto the opposite end by maintaining the source at an elevated temperature with respect to the deposit. Identification of the physical factors governing both the rates and uniformity of crystal growth, and the optimization of the micro-g technology, will require an accurate modeling of the vapor transport within the ampoule. Previous micro-g modeling efforts have approached the problem from a 'classical' convective/diffusion formulation, in which convection is driven by the action of buoyancy on thermal and solutal density differences. The general conclusion of these works have been that in low gravity environments the effect of buoyancy on vapor transport is negligible, and vapor transport occurs in a diffusion-limited mode. However, it has been recently recognized than in the non-isothermal (and often low total pressure) conditions encountered in ampoules, the commonly-assumed no-slip boundary condition to the differential equations governing fluid motion can be grossly unrepresentative of the actual situation. Specifically, the temperature gradients can give rise to thermal creep flows at the ampoule side walls. In addition, temperature gradients in the vapor itself can, through the action of thermal stress, lead to bulk fluid convection.
Thoury-Monbrun, Valentin; Gaucel, Sébastien; Rouessac, Vincent; Guillard, Valérie; Angellier-Coussy, Hélène
2018-06-15
This study aims at assessing the use of a quartz crystal microbalance (QCM) coupled with an adsorption system to measure water vapor transfer properties in micrometric size cellulose particles. This apparatus allows measuring successfully water vapor sorption kinetics at successive relative humidity (RH) steps on a dispersion of individual micrometric size cellulose particles (1 μg) with a total acquisition duration of the order of one hour. Apparent diffusivity and water uptake at equilibrium were estimated at each step of RH by considering two different particle geometries in mass transfer modeling, i.e. sphere or finite cylinder, based on the results obtained from image analysis. Water vapor diffusivity values varied from 2.4 × 10 -14 m 2 s -1 to 4.2 × 10 -12 m 2 s -1 over the tested RH range (0-80%) whatever the model used. A finite cylinder or spherical geometry could be used equally for diffusivity identification for a particle size aspect ratio lower than 2. Copyright © 2018 Elsevier Ltd. All rights reserved.
Bulk Growth of Wide Band Gap II-VI Compound Semiconductors by Physical Vapor Transport
NASA Technical Reports Server (NTRS)
Su, Ching-Hua
1997-01-01
The mechanism of physical vapor transport of II-VI semiconducting compounds was studied both theoretically, using a one-dimensional diffusion model, as well as experimentally. It was found that the vapor phase stoichiometry is critical in determining the vapor transport rate. The experimental heat treatment methods to control the vapor composition over the starting materials were investigated and the effectiveness of the heat treatments was confirmed by partial pressure measurements using an optical absorption technique. The effect of residual (foreign) gas on the transport rate was also studies theoretically by the diffusion model and confirmed experimentally by the measurements of total pressure and compositions of the residual gas. An in-situ dynamic technique for the transport rate measurements and a further extension of the technique that simultaneously measured the partial pressures and transport rates were performed and, for the first time, the experimentally determined mass fluxes were compared with those calculated, without any adjustable parameters, from the diffusion model. Using the information obtained from the experimental transport rate measurements as guideline high quality bulk crystal of wide band gap II-VI semiconductor were grown from the source materials which undergone the same heat treatment methods. The grown crystals were then extensively characterized with emphasis on the analysis of the crystalline structural defects.
An approximate analysis of the diffusing flow in a self-controlled heat pipe.
NASA Technical Reports Server (NTRS)
Somogyi, D.; Yen, H. H.
1973-01-01
Constant-density two-dimensional axisymmetric equations are presented for the diffusing flow of a class of self-controlled heat pipes. The analysis is restricted to the vapor space. Condensation of the vapor is related to its mass fraction at the wall by the gas kinetic formula. The Karman-Pohlhausen integral method is applied to obtain approximate solutions. Solutions are presented for a water heat pipe with neon control gas.
Lattice Boltzmann Simulation of Kinetic Isotope Effect During Snow Crystal Formation
NASA Astrophysics Data System (ADS)
Lu, G.; Depaolo, D. J.; Kang, Q.; Zhang, D.
2007-12-01
The isotopic composition of precipitation, especially that of snow, plays a special role in the global hydrological cycle and in reconstruction of past climates using polar ice cores. The fractionation of the major water isotope species (HHO, HDO, HHO-18) during ice crystal formation is critical to understanding the global distribution of isotopes in precipitation. Ice crystal growth in clouds is traditionally treated with a spherically-symmetric steady state diffusion model, with semi-empirical modifications added to account for ventilation and for complex crystal morphology. Although it is known that crystal growth rate, which depends largely on the degree of vapor over- saturation, determines crystal morphology, there are no quantitative models that relate morphology to the vapor saturation factor. Since kinetic (vapor phase diffusion-controlled) isotopic fractionation also depends on growth rate, there should be direct relationships between vapor saturation, crystal morphology, and crystal isotopic composition. We use a 2D lattice Boltzmann model to simulate diffusion-controlled ice crystal growth from vapor- oversaturated air. In the model, crystals grow solely according to the diffusive fluxes just above the crystal surfaces, and hence crystal morphology arises from the initial and boundary conditions in the model and does not need to be specified a priori. Crystal growth patterns can be varied between random growth and deterministic growth (along the maximum concentration gradient for example). The input parameters needed are the isotope- dependent vapor deposition rate constant (k) and the water vapor diffusivity in air (D). The values of both k and D can be computed from kinetic theory, and there are also experimentally determined values of D. The deduced values of k are uncertain to the extent that the condensation coefficient for ice is uncertain. The ratio D/k is a length (order 1 micron) that determines the minimum scale of dendritic growth features and allows us to scale the numerical calculations to atmospheric conditions. Our calculations confirm that the crystal/vapor isotopic fractionation approaches the equilibrium value, and the crystals are compact (circular in 2D) as the saturation factor approaches unity (S= 1.0). However, few natural crystals form under such conditions. At higher oversaturation (e.g. S = 1.2), dendritic crystals of millimeter size develop on timescales appropriate to cloud processes, and kinetic effects control isotopic fractionation. Fractionation factors for dendritic crystals are similar to those predicted by the spherical diffusion model, but the model also gives estimates of crystal heterogeneity. Dendritic crystals are constrained to be relatively large, with dimension much greater than about 20D/k. The most difficult aspect of the modeling is to account for the large density difference between air and ice, which requires us to use a fictitious higher density for the vapor-oversaturated air and scale the crystal growth time accordingly. An approach using a larger scale simulation and the domain decomposition method can provide a vapor flux for a nested smaller scale calculation. The results clarify the controls on crystal growth, and the relationships between saturation state, growth rate, crystal morphology and isotopic fractionation.
NASA Astrophysics Data System (ADS)
Song, Peng; He, Xuan; Xiong, Xiping; Ma, Hongqing; Song, Qunling; Lü, Jianguo; Lu, Jiansheng
2018-03-01
To investigate the effect of water vapor on the novel Pt-containing oxide growth behavior, Pt-addition within the oxide layer on the surface of NiCoCrAl coating and furnace cycle tests were carried out at 1050 °C in air and air plus water vapor. The thick Pt-containing oxide layer on NiCoCrAl exhibits a different oxidation growth behavior compared to the conventional Pt-diffusion metallic coatings. The Pt-containing oxide after oxidation in air plus water vapor showed a much thicker oxide layer compare to the ones without Pt addition, and also presented a much better coating adhesion. During the oxidation process in air, Pt promotes the spinel (NiCr2O4) formation. However, the Cr2O3 formed in air with water vapor and fixed Pt within the complex oxide layer. The water vapor promoted the Ni and Co outer-diffusion, and combined with Pt to form CoPt compounds on the surface of the NiCoCrAl coating system.
Electrochemistry in an acoustically levitated drop.
Chainani, Edward T; Ngo, Khanh T; Scheeline, Alexander
2013-02-19
Levitated drops show potential as microreactors, especially when radicals are present as reactants or products. Solid/liquid interfaces are absent or minimized, avoiding adsorption and interfacial reaction of conventional microfluidics. We report amperometric detection in an acoustically levitated drop with simultaneous ballistic addition of reactant. A gold microelectrode sensor was fabricated with a lithographic process; active electrode area was defined by a photosensitive polyimide mask. The microdisk gold working electrode of radius 19 μm was characterized using ferrocenemethanol in aqueous buffer. Using cyclic voltammetry, the electrochemically active surface area was estimated by combining a recessed microdisk electrode model with the Randles-Sevcik equation. Computer-controlled ballistic introduction of reactant droplets into the levitated drop was developed. Chronoamperometric measurements of ferrocyanide added ballistically demonstrate electrochemical monitoring using the microfabricated electrode in a levitated drop. Although concentration increases with time due to drop evaporation, the extent of concentration is predictable with a linear evaporation model. Comparison of diffusion-limited currents in pendant and levitated drops show that convection arising from acoustic levitation causes an enhancement of diffusion-limited current on the order of 16%.
Diffuse sunlight based calibration of the water vapor channel in the upc raman lidar
NASA Astrophysics Data System (ADS)
Muñoz-Porcar, Constantino; Comeron, Adolfo; Sicard, Michaël; Barragan, Ruben; Garcia-Vizcaino, David; Rodríguez-Gómez, Alejandro; Rocadenbosch, Francesc
2018-04-01
A method for determining the calibration factor of the water vapor channel of a Raman lidar, based on zenith measurements of diffuse sunlight and on assumptions regarding some system parameters and Raman scattering models, has been applied to the lidar system of Universitat Politècnica de Catalunya (UPC; Technical University of Catalonia, Spain). Results will be analyzed in terms of stability and comparison with typical methods relying on simultaneous radiosonde measurements.
Culver, Sean P.; Brutchey, Richard L.
2016-10-25
A series of Eu 3+-, Tb 3+-, and Tm 3+-doped CaWO 4 phosphor nanocrystals have been synthesized under benign conditions using the vapor diffusion sol–gel method. Here the high degree of synthetic flexibility inherent to this approach has enabled the synthesis of a CaWO 4:(Eu,Tb) dual-sensitized white light emitting nanocrystal phosphor upon commercial UV excitation at 366 nm with a long lifetime exceeding 1 ms.
Finite Element Analysis Modeling of Chemical Vapor Deposition of Silicon Carbide
2014-06-19
thesis primarily focuses on mass transport by gas -phase flow and diffusion , chemical reaction in gas phase and on solid surfaces, and thin film...chemical vapor deposition (CVD). This thesis primarily focuses on mass transport by gas -phase flow and diffusion , chemical reaction in gas phase and...9 Fluid Flow…………………………………………..…………………..…………….9 Thermodynamics………………………………………..………………….….…….11 Chemical Reaction and Diffusion
NASA Technical Reports Server (NTRS)
Srivastava, R. C.; Coen, J. L.
1992-01-01
The traditional explicit growth equation has been widely used to calculate the growth and evaporation of hydrometeors by the diffusion of water vapor. This paper reexamines the assumptions underlying the traditional equation and shows that large errors (10-30 percent in some cases) result if it is used carelessly. More accurate explicit equations are derived by approximating the saturation vapor-density difference as a quadratic rather than a linear function of the temperature difference between the particle and ambient air. These new equations, which reduce the error to less than a few percent, merit inclusion in a broad range of atmospheric models.
NASA Technical Reports Server (NTRS)
Marchese, Anthony J.; Dryer, Fredrick L.; Choi, Mun Y.
1994-01-01
In order to develop an extensive envelope of test conditions for NASA's space-based Droplet Combustion Experiment (DCE) as well those droplet experiments which can be performed using a drop tower, the transient vaporization and combustion of methanol and n-heptane droplets were simulated using a recently developed fully time-dependent, spherically symmetric droplet combustion model. The transient vaporization of methanol and n-heptane was modeled to characterize the instantaneous gas phase composition surrounding the droplet prior to the introduction of an ignition source. The results for methanol/air showed that the entire gas phase surrounding a 2 mm methanol droplet deployed in zero-g .quickly falls outside the lean flammability limit. The gas phase surrounding an identically-sized n-heptane droplet, on the other hand, remains flammable. The combustion of methanol was then modeled considering a detailed gas phase chemical kinetic mechanism (168 steps, 26 species) and the effect of the dissolution of flame-generated water into the liquid droplet. These results were used to determine the critical ignition diameter required to achieve quasi-steady droplet combustion in a given oxidizing environment. For droplet diameters greater than the critical ignition diameter, the model predicted a finite diameter at which the flame would extinguish. These extinction diameters were found to vary significantly with initial droplet diameter. This phenomenon appears to be unique to the transient heat transfer, mass transfer and chemical kinetics of the system and thus has not been reported elsewhere to date. The extinction diameter was also shown to vary significantly with the liquid phase Lewis number since the amount of water present in the droplet at extinction is largely governed by the rate at which water is transported into the droplet via mass diffusion. Finally, the numerical results for n-heptane combustion were obtained using both 2 step and 96 step semi-emperical chemical kinetic mechanisms. Neither mechanism exhibited the variation of extinction diameter with initial diameter.
Cooling by conversion of para to ortho-hydrogen
NASA Technical Reports Server (NTRS)
Sherman, A. (Inventor)
1983-01-01
The cooling capacity of a solid hydrogen cooling system is significantly increased by exposing vapor created during evaporation of a solid hydrogen mass to a catalyst and thereby accelerating the endothermic para-to-ortho transition of the vapor to equilibrium hydrogen. Catalyst such as nickel, copper, iron or metal hydride gels of films in a low pressure drop catalytic reactor are suitable for accelerating the endothermic para-to-ortho conversion.
Factors affecting the morphology of isocitrate lyase crystals
NASA Technical Reports Server (NTRS)
Demattei, Robert C.; Feigelson, Robert S.; Weber, Patricia C.
1992-01-01
Isocitrate lyase crystals have been grown by the hanging drop vapor equilibration method in both 1-g and microgravity and by vapor equilibrium in small capillaries. The crystal morphologies obtained have ranged from dendritic to 'octagonal' prisms. Theoretical evaporation models have been applied to these growth regimes. The results of these analyses along with other experimental results, indicate the factors which must be controlled to produce good growth morphologies.
Laboratory Evaluation of Drop-in Solvent Alternatives to n-Propyl Bromide for Vapor Degreasing
NASA Technical Reports Server (NTRS)
Mitchell, Mark A.; Lowrey, Nikki M.
2012-01-01
Based on this limited laboratory study, solvent blends of trans-1,2 dichloroethylene with HFEs, HFCs, or PFCs appear to be viable alternatives to n-propyl bromide for vapor degreasing. The lower boiling points of these blends may lead to greater solvent loss during use. Additional factors must be considered when selecting a solvent substitute, including stability over time, VOC, GWP, toxicity, and business considerations.
Method and apparatus for determining minority carrier diffusion length in semiconductors
Moore, Arnold R.
1984-01-01
Method and apparatus are provided for determining the diffusion length of minority carriers in semiconductor material, particularly amorphous silicon which has a significantly small minority carrier diffusion length using the constant magnitude surface-photovoltage (SPV) method. Steady or modulated illumination at several wavelengths provides the light excitation on the surface of the material to generate the SPV. A manually controlled or automatic servo system maintains a constant predetermined value of the SPV for each wavelength. A drop of a transparent electrolyte solution containing redox couples (preferably quinhydrone) having an oxidation-reduction potential (E) in the order of +0.6 to -1.65 volts couples the SPV to a measurement system. The drop of redox couple solution functions to create a liquid Schottky barrier at the surface of the material. Illumination light is passed through a transparent rod supported over the surface and through the drop of transparent electrolyte. The drop is held in the gap between the rod and the surface. Steady red light is also used as an optical bias to reduce deleterious space-charge effects that occur in amorphous silicon.
Metallic diffusion measured by a modified Knudsen technique
NASA Technical Reports Server (NTRS)
Fray, D. J.
1969-01-01
Diffusion coefficient of a metal in high temperature system is determined. From the measurement of the weight loss from a Knudsen cell, the vapor pressure of the escaping species can be calculated. If the only way this species can enter the Knudsen cell is by diffusion through a foil, the weight loss is diffusion flux.
Patterson, Bradley M; Davis, Greg B
2009-02-01
Potential hydrocarbon-vapor intrusion pathways into a building through a concrete slab-on-ground were investigated and quantified under a variety of environmental conditions to elucidate the potential mechanisms for indoor air contamination. Vapor discharge from the uncovered open ground soil adjacent to the building and subsequent advection into the building was unlikely due to the low soil-gas concentrations at the edge of the building as a result of aerobic biodegradation of hydrocarbon vapors. When the building's interior was under ambient pressure, a flux of vapors into the building due to molecular diffusion of vapors through the building's concrete slab (cyclohexane 11 and methylcyclohexane 31 mg m(-2) concrete slab day(-1)) and short-term (up to 8 h) cyclical pressure-driven advection of vapors through an artificial crack (cyclohexane 4.2 x 10(3) and methylcyclohexane 1.2 x 10(4) mg m(-2) cracks day(-1)) was observed. The average subslab vapor concentration under the center of the building was 25,000 microg L(-1). Based on the measured building's interiorvapor concentrations and the building's air exchange rate of 0.66 h(-1), diffusion of vapors through the concrete slab was the dominantvapor intrusion pathway and cyclical pressure exchanges resulted in a near zero advective flux. When the building's interior was under a reduced pressure (-12 Pa), advective transport through cracks or gaps in the concrete slab (cyclohexane 340 and methylcyclohexane 1100 mg m(-2) cracks day(-1)) was the dominant vapor intrusion pathway.
Improvements to water vapor transmission and capillary absorption measurements in porous materials
Samuel L. Zelinka; Samuel V. Glass; Charles R. Boardman
2016-01-01
The vapor permeability (or equivalently the vapor diffusion resistance factor) and the capillary absorption coefficient are frequently used as inputs to hygrothermal or heat, air, and moisture (HAM) models. However, it has been well documented that the methods used to determine these properties are sensitive to the operator, and wide variations in the properties have...
NASA Technical Reports Server (NTRS)
Ingebo, Robert D.
1987-01-01
Two-phase flows were investigated by using high velocity nitrogen gas streams to atomize small-diameter liquid jets. Tests were conducted primarily in the acceleration-wave regime for liquid jet atomization, where it was found that the loss of droplets due to vaporization had a marked effect on drop size measurements. In addition, four identically designed two-fluid atomizers were fabricated and tested for similarity of spray profiles. A scattered-light scanner was used to measure a characteristic drop diameter, which was correlated with nitrogen gas flowrate. The exponent of 1.33 for nitrogen gas flowrate is identical to that predicted by atomization theory for liquid jet breakup in the acceleration-wave regime. This is higher than the value of 1.2 which was previously obtained at a sampling distance of 4.4 cm downstream of the atomizer. The difference is attributed to the fact that drop-size measurements obtained at a 2.2 cm sampling distance are less effected by vaporization and dispersion of small droplets and therefore should give better agreement with atomization theory. Profiles of characteristic drop diameters were also obtained by making at least five line-of-sight measurements across the spray at several horizontal positions above and below the center line of the spray.
NASA Technical Reports Server (NTRS)
Ingebo, Robert D.
1987-01-01
Two-phase flows were investigated by using high velocity nitrogen gas streams to atomize small-diameter liquid jets. Tests were conducted primarily in the acceleration-wave regime for liquid jet atomization, where it was found that the loss of droplets due to vaporization had a marked effect on drop-size measurements. In addition, four identically designed two-fluid atomizers were fabricated and tested for similarity of spray profiles. A scattered-light scanner was used to measure a characteristic drop diameter, which was correlated with nitrogen gas flowrate. The exponent of 1.33 for nitrogen gas flowrate is identical to that predicted by atomization theory for liquid jet breakup in the acceleration-wave regime. This is higher than the value of 1.2 which was previously obtained at a smapling distance of 4.4 cm downstream of the atomizer. The difference is attributed to the fact that drop-size measurements obtained at a 2.2 cm sampling distance are less affected by vaporization and dispersion of small droplets and therefore should give better agreement with atomization theory. Profiles of characteristic drop diameters were also obtained by making at least five line-of-sight measurements across the spray at several horizontal positions above and below the center line of the spray.
Investigation of Capillary Limit in a Loop Heat Pipe
NASA Technical Reports Server (NTRS)
Ku, Jentung; Ottenstein, Laura; Rogers, Paul; Cheung, Kwok; Obenschain, Arthur F. (Technical Monitor)
2001-01-01
This paper presets an experimental study on the capillary limit of a loop heat pipe (LHP) at low powers. The slow thermal response of the loop at low powers made it possible to observe interactions among various components after the capillary limit was exceeded. The capillary limit at low powers was achieved by imposing additional pressure drops on the vapor line through the use of a metering valve. A differential pressure transducer was also used to measure the pressure drop across the evaporator and the compensation chamber (CC). Test results show that when the capillary limit is exceeded, vapor will penetrate the primary wick, resulting in a partial dry-out of the evaporator and a rapid increase of the CC temperature. Because the evaporator can tolerate vapor bubbles, the LHP will continue to function and may reach a new steady state at the higher temperature. Thus, the LHP will exhibit a graceful degradation in performance rather than a complete failure. Moreover, the loop can recover from a partial dry-out by reducing the heat load without a re-start.
Diffusion Of Mass In Evaporating Multicomponent Drops
NASA Technical Reports Server (NTRS)
Bellan, Josette; Harstad, Kenneth G.
1992-01-01
Report summarizes study of diffusion of mass and related phenomena occurring in evaporation of dense and dilute clusters of drops of multicomponent liquids intended to represent fuels as oil, kerosene, and gasoline. Cluster represented by simplified mathematical model, including global conservation equations for entire cluster and conditions on boundary between cluster and ambient gas. Differential equations of model integrated numerically. One of series of reports by same authors discussing evaporation and combustion of sprayed liquid fuels.
Startup analysis for a high temperature gas loaded heat pipe
NASA Technical Reports Server (NTRS)
Sockol, P. M.
1973-01-01
A model for the rapid startup of a high-temperature gas-loaded heat pipe is presented. A two-dimensional diffusion analysis is used to determine the rate of energy transport by the vapor between the hot and cold zones of the pipe. The vapor transport rate is then incorporated in a simple thermal model of the startup of a radiation-cooled heat pipe. Numerical results for an argon-lithium system show that radial diffusion to the cold wall can produce large vapor flow rates during a rapid startup. The results also show that startup is not initiated until the vapor pressure p sub v in the hot zone reaches a precise value proportional to the initial gas pressure p sub i. Through proper choice of p sub i, startup can be delayed until p sub v is large enough to support a heat-transfer rate sufficient to overcome a thermal load on the heat pipe.
2017-01-01
The drying of dichloromethane with a molecular sieve 3A packed bed process is modeled and experimentally verified. In the process, the dichloromethane is dried in the liquid phase and the adsorbent is regenerated by water desorption with dried dichloromethane product in the vapor phase. Adsorption equilibrium experiments show that dichloromethane does not compete with water adsorption, because of size exclusion; the pure water vapor isotherm from literature provides an accurate representation of the experiments. The breakthrough curves are adequately described by a mathematical model that includes external mass transfer, pore diffusion, and surface diffusion. During the desorption step, the main heat transfer mechanism is the condensation of the superheated dichloromethane vapor. The regeneration time is shortened significantly by external bed heating. Cyclic steady-state experiments demonstrate the feasibility of this novel, zero-emission drying process. PMID:28539701
Water vapor diffusion membrane development
NASA Technical Reports Server (NTRS)
Tan, M. K.
1976-01-01
A total of 18 different membranes were procured, characterized, and tested in a modified bench-scale vapor diffusion water reclamation unit. Four membranes were selected for further studies involving membrane fouling. Emphasis was placed on the problem of flux decline due to membrane fouling. This is discussed in greater details under "Summary and Discussion on Membrane Fouling Studies" presented in pages 47-51. The system was also investigated for low temperature application on wash-water where the permeated water is not recovered but vented into space vacuum.
Electrical breakdown and nanogap formation of indium oxide core/shell heterostructure nanowires.
Jung, Minkyung; Song, Woon; Sung Lee, Joon; Kim, Nam; Kim, Jinhee; Park, Jeunghee; Lee, Hyoyoung; Hirakawa, Kazuhiko
2008-12-10
We report the electrical breakdown behavior and subsequent nanogap formation of In(2)O(3)/InO(x) core/shell heterostructure nanowires with substrate-supported and suspended structures. The radial heterostructure nanowires, composed of crystalline In(2)O(3) cores and amorphous In-rich shells, are grown by chemical vapor deposition. As the nanowires broke down, they exhibited two distinct current drops in the current-voltage characteristics. The tips of the broken nanowires were found to have a cone or a volcano shape depending on the width of the nanowire. The shape, the size, and the position of the nanogap depend strongly on the device structure and the nanowire dimensions. The substrate-supported and the suspended devices exhibit distinct breakdown behavior which can be explained by the diffusive thermal transport model. The breakdown temperature of the nanowire is estimated to be about 450 K, close to the melting temperature of indium. We demonstrated the usefulness of this technique by successful fabrication of working pentacene field-effect transistors.
Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix.
Inoguchi, Noriko; Oshlo, Jake R; Natarajan, Chandrasekhar; Weber, Roy E; Fago, Angela; Storz, Jay F; Moriyama, Hideaki
2013-04-01
The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128.
Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix
Inoguchi, Noriko; Oshlo, Jake R.; Natarajan, Chandrasekhar; Weber, Roy E.; Fago, Angela; Storz, Jay F.; Moriyama, Hideaki
2013-01-01
The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128. PMID:23545644
Barison; Barreca; Daolio; Fabrizio; Piccirillo
2000-01-01
The influence of different RuO(2) crystallite sizes was investigated by secondary ion mass spectrometry (SIMS) on the oxide deposited on various support materials (Ni, Ti, Al(2)O(3), oxidized Si(100)). In order to examine the effect of an oxidic environment on the film structure, RuO(2) 20%-TiO(2) 80% at. mixed oxide was deposited on Ti. The polycrystalline coatings were prepared by heating the Ru (and Ti)-containing solution dropped on the supports.1 RuO(2) nanocrystalline coatings were grown by chemical vapor deposition (CVD) from Ru(COD)(eta(3)-allyl)(2).2 The identification of mixed oxide clusters showed the higher reactivity of Ni and Al(2)O(3) over the other substrates. Diffusion and migration characteristics were observed to be influenced by the nature of the support. The results are complementary to those of a previous SIMS investigation.3 Copyright 2000 John Wiley & Sons, Ltd.
Ferguson, A D; Breed, J; Diederichs, K; Welte, W; Coulton, J W
1998-07-01
FhuA (Mr 78,992, 714 amino acids), siderophore receptor for ferrichrome-iron in the outer membrane of Escherichia coli, was affinity tagged, rapidly purified, and crystallized. To obtain FhuA in quantities sufficient for crystallization, a hexahistidine tag was genetically inserted into the fhuA gene after amino acid 405, which resides in a known surface-exposed loop. Recombinant FhuA405.H6 was overexpressed in an E. coli strain that is devoid of several major porins and using metal-chelate chromatography was purified in large amounts to homogeneity. FhuA crystals were grown using the hanging drop vapor diffusion technique and were suitable for X-ray diffraction analysis. On a rotating anode X-ray source, diffraction was observed to 3.0 A resolution. The crystals belong to space group P6(1) or P6(5) with unit cell dimensions of a=b=174 A, c=88 A (alpha=beta=90 degrees, gamma=120 degrees).
Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B.; Santiago, Brianna M.; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M.; Soares, Alexei S.
2014-01-01
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations. PMID:25484231
Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; ...
2014-11-28
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less
Scavenging dissolved oxygen via acoustic droplet vaporization.
Radhakrishnan, Kirthi; Holland, Christy K; Haworth, Kevin J
2016-07-01
Acoustic droplet vaporization (ADV) of perfluorocarbon emulsions has been explored for diagnostic and therapeutic applications. Previous studies have demonstrated that vaporization of a liquid droplet results in a gas microbubble with a diameter 5-6 times larger than the initial droplet diameter. The expansion factor can increase to a factor of 10 in gassy fluids as a result of air diffusing from the surrounding fluid into the microbubble. This study investigates the potential of this process to serve as an ultrasound-mediated gas scavenging technology. Perfluoropentane droplets diluted in phosphate-buffered saline (PBS) were insonified by a 2 MHz transducer at peak rarefactional pressures lower than and greater than the ADV pressure amplitude threshold in an in vitro flow phantom. The change in dissolved oxygen (DO) of the PBS before and after ADV was measured. A numerical model of gas scavenging, based on conservation of mass and equal partial pressures of gases at equilibrium, was developed. At insonation pressures exceeding the ADV threshold, the DO of air-saturated PBS decreased with increasing insonation pressures, dropping as low as 25% of air saturation within 20s. The decrease in DO of the PBS during ADV was dependent on the volumetric size distribution of the droplets and the fraction of droplets transitioned during ultrasound exposure. Numerically predicted changes in DO from the model agreed with the experimentally measured DO, indicating that concentration gradients can explain this phenomenon. Using computationally modified droplet size distributions that would be suitable for in vivo applications, the DO of the PBS was found to decrease with increasing concentrations. This study demonstrates that ADV can significantly decrease the DO in an aqueous fluid, which may have direct therapeutic applications and should be considered for ADV-based diagnostic or therapeutic applications. Copyright © 2016 Elsevier B.V. All rights reserved.
Scavenging dissolved oxygen via acoustic droplet vaporization
Radhakrishnan, Kirthi; Holland, Christy K.; Haworth, Kevin J.
2016-01-01
Acoustic droplet vaporization (ADV) of perfluorocarbon emulsions has been explored for diagnostic and therapeutic applications. Previous studies have demonstrated that vaporization of a liquid droplet results in a gas microbubble with a diameter 5 to 6 times larger than the initial droplet diameter. The expansion factor can increase to a factor of 10 in gassy fluids as a result of air diffusing from the surrounding fluid into the microbubble. This study investigates the potential of this process to serve as an ultrasound-mediated gas scavenging technology. Perfluoropentane droplets diluted in phosphate-buffered saline (PBS) were insonified by a 2 MHz transducer at peak rarefactional pressures lower than and greater than the ADV pressure amplitude threshold in an in vitro flow phantom. The change in dissolved oxygen (DO) of the PBS before and after ADV was measured. A numerical model of gas scavenging, based on conservation of mass and equal partial pressures of gases at equilibrium, was developed. At insonation pressures exceeding the ADV threshold, the DO of air-saturated PBS decreased with increasing insonation pressures, dropping as low as 25% of air saturation within 20 s. The decrease in DO of the PBS during ADV was dependent on the volumetric size distribution of the droplets and the fraction of droplets transitioned during ultrasound exposure. Numerically predicted changes in DO from the model agreed with the experimentally measured DO, indicating that concentration gradients can explain this phenomenon. Using computationally modified droplet size distributions that would be suitable for in vivo applications, the DO of the PBS was found to decrease with increasing concentrations. This study demonstrates that ADV can significantly decrease the DO in an aqueous fluid, which may have direct therapeutic applications and should be considered for ADV-based diagnostic or therapeutic applications. PMID:26964964
Lattice Boltzmann Simulation of Water Isotope Fractionation During Growth of Ice Crystals in Clouds
NASA Astrophysics Data System (ADS)
Lu, G.; Depaolo, D.; Kang, Q.; Zhang, D.
2006-12-01
The isotopic composition of precipitation, especially that of snow, plays a special role in the global hydrological cycle and in reconstruction of past climates using polar ice cores. The fractionation of the major water isotope species (HHO, HDO, HHO-18) during ice crystal formation is critical to understanding the global distribution of isotopes in precipitation. Ice crystal growth in clouds is traditionally treated with a spherically- symmetric steady state diffusion model, with semi-empirical modifications added to account for ventilation and for complex crystal morphology. Although it is known that crystal growth rate, which depends largely on the degree of vapor over-saturation, determines crystal morphology, there are no existing quantitative models that directly relate morphology to the vapor saturation factor. Since kinetic (vapor phase diffusion-controlled) isotopic fractionation also depends on growth rate, there should be a direct relationship between vapor saturation, crystal morphology, and crystal isotopic composition. We use a 2D Lattice-Boltzmann model to simulate diffusion-controlled ice crystal growth from vapor- oversaturated air. In the model, crystals grow solely according to the diffusive fluxes just above the crystal surfaces, and hence crystal morphology arises from the initial and boundary conditions in the model and does not need to be specified a priori. The input parameters needed are the isotope-dependent vapor deposition rate constant (k) and the water vapor diffusivity in air (D). The values of both k and D can be computed from kinetic theory, and there are also experimentally determined values of D. The deduced values of k are uncertain to the extent that the sticking coefficient (or accommodation coefficient) for ice is uncertain. The ratio D/k is a length that determines the minimum scale of dendritic growth features and allows us to scale the numerical calculations to atmospheric conditions using a dimensionless Damkohler number: Da = kh/D, where h is the width of the 2D calculation domain. Varying the nondimensional Da in the model is equivalent to varying the scale (h) in the model. Our calculations confirm that the crystal/vapor isotopic fractionation approaches the equilibrium value, and the crystals are compact (circular in 2D) as the saturation factor approaches unity (S= 1.0). At higher oversaturation (e.g. S = 1.2), dendritic crystals of millimeter size develop on timescales appropriate to cloud processes, the isotopic fractionations are dominated by kinetic effects, and similar to those predicted by the spherical diffusion model. Dendritic crystals are constrained to be relatively large, with dimension much greater than D/k. The most difficult aspect of the modeling is to account for the large density difference between air and ice, which requires us to use a fictitious higher density for the vapor-oversaturated air and scale the crystal growth time accordingly. A different approach, using a larger scale simulation to derive boundary conditions for a nested smaller scale calculation is in progress. The results to date clarify the controls on dendritic crystal growth, the relationships between saturation state, growth rate, crystal morphology and isotopic fractionation, and provide limits on the value of the accommodation coefficient.
Structure and Dynamics of Interfaces: Drops and Films
NASA Technical Reports Server (NTRS)
Mann, J. Adin, Jr.; Mann, Elizabeth K.; Meyer, William V.; Neumann, A. Wilhelm; Tavana, Hossein
2015-01-01
We aim to acquire measurements of the structure and dynamics of certain liquid-fluid interfaces using an ensemble of techniques in collaboration: (1) Total internal reflection (TIR) Surface light scattering spectroscopy (SLSS), (2) Brewster angle microscopy (BAM), and (3) Drop-shape analysis. SLSS and BAM can be done on a shared interfacial footprint. Results using a 50-50 mixture of pentane-isohexane, which extends the range of NASA's Confined Vapor Bubble (CVB) experiment, yield surface tension results that differ from the expected Langmuir Fit. These results were confirmed using both the SLSS and drop-shape analysis approaches.
PASSIVE/DIFFUSIVE SAMPLERS FOR PESTICIDES IN RESIDENTIAL INDOOR AIR
Pesticides applied indoors vaporize from treated surfaces (e.g., carpets and baseboards) resulting in elevated air concentrations that may persist for long periods after applications. Estimating long-term respiratory exposures to pesticide vapors in residential indoor environme...
Atomization and vaporization characteristics of airblast fuel injection inside a venturi tube
NASA Technical Reports Server (NTRS)
Sun, H.; Chue, T.-H.; Lai, M.-C.; Tacina, R. R.
1993-01-01
This paper describes the experimental and numerical characterization of the capillary fuel injection, atomization, dispersion, and vaporization of liquid fuel in a coflowing air stream inside a single venturi tube. The experimental techniques used are all laser-based. Phase Doppler analyzer was used to characterize the atomization and vaporization process. Planar laser-induced fluorescence visualizations give good qualitative picture of the fuel droplet and vapor distribution. Limited quantitative capabilities of the technique are also demonstrated. A modified version of the KIVA-II was used to simulate the entire spray process, including breakup and vaporization. The advantage of venturi nozzle is demonstrated in terms of better atomization, more uniform F/A distribution, and less pressure drop. Multidimensional spray calculations can be used as a design tool only if care is taken for the proper breakup model, and wall impingement process.
Transmitting and reflecting diffuser. [for ultraviolet light
NASA Technical Reports Server (NTRS)
Keafer, L. S., Jr.; Burcher, E. E.; Kopia, L. P. (Inventor)
1973-01-01
A near-Lambertian diffuser is described which transmits and reflects ultraviolet light. An ultraviolet grade fused silica substrate is coated with vaporized fuse silica. The coating thickness is controlled, one thickness causing ultraviolet light to diffuse and another thickness causing ultraviolet light to reflect a near Lambertian pattern.
Fluid transport in partially filled porous sol-gel silica glass
NASA Astrophysics Data System (ADS)
D'orazio, Franco; Bhattacharja, Sankar; Halperin, William P.; Gerhardt, Rosario
1990-10-01
Measurements of low-frequency ac electrical conductivity of a porous glass filled with different amounts of a saline solution are compared with the self-diffusion coefficient of water measured in the same sample, reported previously [F. D'Orazio et al., Phys. Rev. Lett. 63, 43 (1989)]. The two transport parameters are consistently related through the Einstein relation under saturation conditions. A more complex picture is revealed for the unsaturated sample, since the presence of a vapor phase enhances the self-diffusion coefficient. Conductivity experiments allow an independent assessment of the contribution to self-diffusion from the liquid phase. However, a comparison between the two experiments indicates that the role of the vapor phase is not well understood.
Development of Nb{sub 3}Sn Cavity Vapor Diffusion Deposition System
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eremeev, Grigory V.; Macha, Kurt M.; Clemens, William A.
2014-02-01
Nb{sub 3}Sn is a BCS superconductors with the superconducting critical temperature higher than that of niobium, so theoretically it surpasses the limitations of niobium in RF fields. The feasibility of technology has been demonstrated at 1.5 GHz with Nb{sub 3}Sn vapor deposition technique at Wuppertal University. The benefit at these frequencies is more pronounced at 4.2 K, where Nb{sub 3}Sn coated cavities show RF resistances an order of magnitude lower than that of niobium. At Jefferson Lab we started the development of Nb{sub 3}Sn vapor diffusion deposition system within an R\\&D development program towards compact light sources. Here we presentmore » the current progress of the system development.« less
A Mass Diffusion Model for Dry Snow Utilizing a Fabric Tensor to Characterize Anisotropy
NASA Astrophysics Data System (ADS)
Shertzer, Richard H.; Adams, Edward E.
2018-03-01
A homogenization algorithm for randomly distributed microstructures is applied to develop a mass diffusion model for dry snow. Homogenization is a multiscale approach linking constituent behavior at the microscopic level—among ice and air—to the macroscopic material—snow. Principles of continuum mechanics at the microscopic scale describe water vapor diffusion across an ice grain's surface to the air-filled pore space. Volume averaging and a localization assumption scale up and down, respectively, between microscopic and macroscopic scales. The model yields a mass diffusivity expression at the macroscopic scale that is, in general, a second-order tensor parameterized by both bulk and microstructural variables. The model predicts a mass diffusivity of water vapor through snow that is less than that through air. Mass diffusivity is expected to decrease linearly with ice volume fraction. Potential anisotropy in snow's mass diffusivity is captured due to the tensor representation. The tensor is built from directional data assigned to specific, idealized microstructural features. Such anisotropy has been observed in the field and laboratories in snow morphologies of interest such as weak layers of depth hoar and near-surface facets.
Investigation of aluminosilicate refractory for solid oxide fuel cell applications
NASA Astrophysics Data System (ADS)
Gentile, Paul Steven
Stationary solid oxide fuel cells (SOFCs) have been demonstrated to provide clean and reliable electricity through electro-chemical conversion of various fuel sources (CH4 and other light hydrocarbons). To become a competitive conversion technology the costs of SOFCs must be reduced to less than $400/kW. Aluminosilicate represents a potential low cost alternative to high purity alumina for SOFC refractory applications. The objectives of this investigation are to: (1) study changes of aluminosilicate chemistry and morphology under SOFC conditions, (2) identify volatile silicon species released by aluminosilicates, (3) identify the mechanisms of aluminosilicate vapor deposition on SOFC materials, and (4) determine the effects of aluminosilicate vapors on SOFC electrochemical performance. It is shown thermodynamically and empirically that low cost aluminosilicate refractory remains chemically and thermally unstable under SOFC operating conditions between 800°C and 1000°C. Energy dispersive spectroscopy (EDS) and X-ray photoelectron spectroscopy (XPS) of the aluminosilicate bulk and surface identified increased concentrations of silicon at the surface after exposure to SOFC gases at 1000°C for 100 hours. The presence of water vapor accelerated surface diffusion of silicon, creating a more uniform distribution. Thermodynamic equilibrium modeling showed aluminosilicate remains stable in dry air, but the introduction of water vapor indicative of actual SOFC gas streams creates low temperature (<1000°C) silicon instability due to the release of Si(OH)4 and SiO(OH) 2. Thermal gravimetric analysis and transpiration studies identified a discrete drop in the rate of silicon volatility before reaching steady state conditions after 100-200 hours. Electron microscopy observed the preferential deposition of vapors released from aluminosilicate on yttria stabilized zirconia (YSZ) over nickel. The adsorbent consisted of alumina rich clusters enclosed in an amorphous siliceous layer. Silicon penetrated the YSZ along grain boundaries, isolating grains in an insulating glassy phase. XPS did not detect spectra shifts or peak broadening associated with formation of new Si-Zr-Y-O phases. SOFC electrochemical performance testing at 800-1000°C attributed rapid degradation (0.1% per hour) of cells exposed to aluminosilicate vapors in the fuel stream predominately to ohmic polarization. EDS identified silicon concentrations above impurity levels at the electrolyte/active anode interface.
Hanging drop crystal growth apparatus
NASA Technical Reports Server (NTRS)
Naumann, Robert J. (Inventor); Witherow, William K. (Inventor); Carter, Daniel C. (Inventor); Bugg, Charles E. (Inventor); Suddath, Fred L. (Inventor)
1990-01-01
This invention relates generally to control systems for controlling crystal growth, and more particularly to such a system which uses a beam of light refracted by the fluid in which crystals are growing to detect concentration of solutes in the liquid. In a hanging drop apparatus, a laser beam is directed onto drop which refracts the laser light into primary and secondary bows, respectively, which in turn fall upon linear diode detector arrays. As concentration of solutes in drop increases due to solvent removal, these bows move farther apart on the arrays, with the relative separation being detected by arrays and used by a computer to adjust solvent vapor transport from the drop. A forward scattering detector is used to detect crystal nucleation in drop, and a humidity detector is used, in one embodiment, to detect relative humidity in the enclosure wherein drop is suspended. The novelty of this invention lies in utilizing angular variance of light refracted from drop to infer, by a computer algorithm, concentration of solutes therein. Additional novelty is believed to lie in using a forward scattering detector to detect nucleating crystallites in drop.
Flow field investigation in a bulb turbine diffuser
NASA Astrophysics Data System (ADS)
Pereira, M.; Duquesne, P.; Aeschlimann, V.; Deschênes, C.
2017-04-01
An important drop in turbine performances has been measured in a bulb turbine model operated at overload. Previous investigations have correlated the performance drop with diffuser losses, and particularly to the flow separation zone at the diffuser wall. The flow has been investigated in the transition part of the diffuser using two LDV measurement sections. The transition part is a diffuser section that transforms from a circular to a rectangular section. The two measurement sections are at the inlet and outlet of the diffuser transition part. The turbine has been operated at three operating points, which are representative of different flow patterns at the diffuser exit at overload. In addition to the average velocity field, the analysis is conducted based on a backflow occurrence function and on the swirl level. Results reveal a counter-rotating zone in the diffuser, which intensifies with the guide vanes opening. The guide vanes opening induces a modification of the flow phenomena: from a central backflow recirculation zone at the lowest flowrate to a backflow zone induced by flow separation at the wall at the highest flowrate.
Modeling and Uncertainty Quantification of Vapor Sorption and Diffusion in Heterogeneous Polymers
Sun, Yunwei; Harley, Stephen J.; Glascoe, Elizabeth A.
2015-08-13
A high-fidelity model of kinetic and equilibrium sorption and diffusion is developed and exercised. The gas-diffusion model is coupled with a triple-sorption mechanism: Henry’s law absorption, Langmuir adsorption, and pooling or clustering of molecules at higher partial pressures. Sorption experiments are conducted and span a range of relative humidities (0-95%) and temperatures (30-60°C). Kinetic and equilibrium sorption properties and effective diffusivity are determined by minimizing the absolute difference between measured and modeled uptakes. Uncertainty quantification and sensitivity analysis methods are described and exercised herein to demonstrate the capability of this modeling approach. Water uptake in silica-filled and unfilled poly(dimethylsiloxane) networksmore » is investigated; however, the model is versatile enough to be used with a wide range of materials and vapors.« less
Influence of Computational Drop Representation in LES of a Droplet-Laden Mixing Layer
NASA Technical Reports Server (NTRS)
Bellan, Josette; Radhakrishnan, Senthilkumaran
2013-01-01
Multiphase turbulent flows are encountered in many practical applications including turbine engines or natural phenomena involving particle dispersion. Numerical computations of multiphase turbulent flows are important because they provide a cheaper alternative to performing experiments during an engine design process or because they can provide predictions of pollutant dispersion, etc. Two-phase flows contain millions and sometimes billions of particles. For flows with volumetrically dilute particle loading, the most accurate method of numerically simulating the flow is based on direct numerical simulation (DNS) of the governing equations in which all scales of the flow including the small scales that are responsible for the overwhelming amount of dissipation are resolved. DNS, however, requires high computational cost and cannot be used in engineering design applications where iterations among several design conditions are necessary. Because of high computational cost, numerical simulations of such flows cannot track all these drops. The objective of this work is to quantify the influence of the number of computational drops and grid spacing on the accuracy of predicted flow statistics, and to possibly identify the minimum number, or, if not possible, the optimal number of computational drops that provide minimal error in flow prediction. For this purpose, several Large Eddy Simulation (LES) of a mixing layer with evaporating drops have been performed by using coarse, medium, and fine grid spacings and computational drops, rather than physical drops. To define computational drops, an integer NR is introduced that represents the ratio of the number of existing physical drops to the desired number of computational drops; for example, if NR=8, this means that a computational drop represents 8 physical drops in the flow field. The desired number of computational drops is determined by the available computational resources; the larger NR is, the less computationally intensive is the simulation. A set of first order and second order flow statistics, and of drop statistics are extracted from LES predictions and are compared to results obtained by filtering a DNS database. First order statistics such as Favre averaged stream-wise velocity, Favre averaged vapor mass fraction, and the drop stream-wise velocity, are predicted accurately independent of the number of computational drops and grid spacing. Second order flow statistics depend both on the number of computational drops and on grid spacing. The scalar variance and turbulent vapor flux are predicted accurately by the fine mesh LES only when NR is less than 32, and by the coarse mesh LES reasonably accurately for all NR values. This is attributed to the fact that when the grid spacing is coarsened, the number of drops in a computational cell must not be significantly lower than that in the DNS.
Vapor Flow Patterns During a Start-Up Transient in Heat Pipes
NASA Technical Reports Server (NTRS)
Issacci, F.; Ghoniem, N, M.; Catton, I.
1996-01-01
The vapor flow patterns in heat pipes are examined during the start-up transient phase. The vapor core is modelled as a channel flow using a two dimensional compressible flow model. A nonlinear filtering technique is used as a post process to eliminate the non-physical oscillations of the flow variables. For high-input heat flux, multiple shock reflections are observed in the evaporation region. The reflections cause a reverse flow in the evaporation and circulations in the adiabatic region. Furthermore, each shock reflection causes a significant increase in the local pressure and a large pressure drop along the heat pipe.
2004-04-15
The Commercial Vapor Diffusion Apparatus will be used to perform 128 individual crystal growth investigations for commercial and science research. These experiments will grow crystals of several different proteins, including HIV-1 Protease Inhibitor, Glycogen Phosphorylase A, and NAD Synthetase. The Commercial Vapor Diffusion Apparatus supports multiple commercial investigations within a controlled environment. The goal of the Commercial Protein Crystal Growth payload on STS-95 is to grow large, high-quality crystals of several different proteins of interest to industry, and to continue to refine the technology and procedures used in microgravity for this important commercial research.
The role of mass transport in protein crystallization.
García-Ruiz, Juan Manuel; Otálora, Fermín; García-Caballero, Alfonso
2016-02-01
Mass transport takes place within the mesoscopic to macroscopic scale range and plays a key role in crystal growth that may affect the result of the crystallization experiment. The influence of mass transport is different depending on the crystallization technique employed, essentially because each technique reaches supersaturation in its own unique way. In the case of batch experiments, there are some complex phenomena that take place at the interface between solutions upon mixing. These transport instabilities may drastically affect the reproducibility of crystallization experiments, and different outcomes may be obtained depending on whether or not the drop is homogenized. In diffusion experiments with aqueous solutions, evaporation leads to fascinating transport phenomena. When a drop starts to evaporate, there is an increase in concentration near the interface between the drop and the air until a nucleation event eventually takes place. Upon growth, the weight of the floating crystal overcomes the surface tension and the crystal falls to the bottom of the drop. The very growth of the crystal then triggers convective flow and inhomogeneities in supersaturation values in the drop owing to buoyancy of the lighter concentration-depleted solution surrounding the crystal. Finally, the counter-diffusion technique works if, and only if, diffusive mass transport is assured. The technique relies on the propagation of a supersaturation wave that moves across the elongated protein chamber and is the result of the coupling of reaction (crystallization) and diffusion. The goal of this review is to convince protein crystal growers that in spite of the small volume of the typical protein crystallization setup, transport plays a key role in the crystal quality, size and phase in both screening and optimization experiments.
Investigation Of Vapor Explosion Mechanisms Using High Speed Photography
NASA Astrophysics Data System (ADS)
Armstrong, Donn R.; Anderson, Richard P.
1983-03-01
The vapor explosion, a physical interaction between hot and cold liquids that causes the explosive vaporization of the cold liquid, is a hazard of concern in such diverse industries as metal smelting and casting, paper manufacture, and nuclear power generation. Intensive work on this problem worldwide, for the past 25 years has generated a number of theories and mechanisms proposed to explain vapor explosions. High speed photography has been the major instrument used to test the validity of the theories and to provide the observations that have lead to new theories. Examples are given of experimental techniques that have been used to investigate vapor explosions. Detailed studies of specific mechanisms have included microsecond flash photograph of contact boiling and high speed cinematography of shock driven breakup of liquid drops. Other studies looked at the explosivity of various liquid pairs using cinematography inside a pulsed nuclear reactor and x-ray cinematography of a thermite-sodium interaction.
NASA Astrophysics Data System (ADS)
McCray, J. E.; Downs, W.; Falta, R. W.; Housley, T.
2005-12-01
DNAPL sources of carbon tetrachloride (CT) vapors are of interest at the Radioactive Waste Management Complex (RWMC) at the Idaho National Engineering and Environmental Laboratory (INEEL). The site is underlain by thick fractured basalt that includes sedimentary interbeds, each are a few meters thick. Daily atmospheric pressure fluctuations serve as driving forces for CT vapor transport in the subsurface. Other important transport processes for vapor movement include gas-phase diffusion and density-driven transport. The objective of this research is to investigate the influence and relative importance of these processes on gaseous transport of CT. Gas pressure and vapor concentration measurements were conducted at various depths in two wells. A numerical multiphase flow model (TOUGH2), calibrated to field pressure data, is used to conduct sensitivity analyses to elucidate the importance of the different transport mechanisms. Results show that the basalt is highly permeable to vertical air flow. The pressure dampening occurs mainly in the sedimentary interbeds. Model-calibrated permeability values for the interbeds are similar to those obtained in a study by the U.S. Geological Survey for shallow sediments, and an order of magnitude higher than column-scale values obtained by previous studies conducted by INEEL scientists. The transport simulations indicate that considering the effect of barometric pressure changes is critical to simulating transport of pollutants in the vadose zone above the DNAPL source. Predicted concentrations can be orders of magnitude smaller than actual concentrations if the effect is not considered. Below the DNAPL vapor source, accounting for density and diffusion alone would yield acceptable results provided that a 20% error in concentrations are acceptable, and that simulating concentrations trends (and not actual concentrations) is the primary goal.
Nguyen, Tuan A H; Biggs, Simon R; Nguyen, Anh V
2018-05-30
Current analytical models for sessile droplet evaporation do not consider the nonuniform temperature field within the droplet and can overpredict the evaporation by 20%. This deviation can be attributed to a significant temperature drop due to the release of the latent heat of evaporation along the air-liquid interface. We report, for the first time, an analytical solution of the sessile droplet evaporation coupled with this interfacial cooling effect. The two-way coupling model of the quasi-steady thermal diffusion within the droplet and the quasi-steady diffusion-controlled droplet evaporation is conveniently solved in the toroidal coordinate system by applying the method of separation of variables. Our new analytical model for the coupled vapor concentration and temperature fields is in the closed form and is applicable for a full range of spherical-cap shape droplets of different contact angles and types of fluids. Our analytical results are uniquely quantified by a dimensionless evaporative cooling number E o whose magnitude is determined only by the thermophysical properties of the liquid and the atmosphere. Accordingly, the larger the magnitude of E o , the more significant the effect of the evaporative cooling, which results in stronger suppression on the evaporation rate. The classical isothermal model is recovered if the temperature gradient along the air-liquid interface is negligible ( E o = 0). For substrates with very high thermal conductivities (isothermal substrates), our analytical model predicts a reversal of temperature gradient along the droplet-free surface at a contact angle of 119°. Our findings pose interesting challenges but also guidance for experimental investigations.
Three-dimensional modeling of diesel engine intake flow, combustion and emissions
NASA Technical Reports Server (NTRS)
Reitz, R. D.; Rutland, C. J.
1992-01-01
A three-dimensional computer code (KIVA) is being modified to include state-of-the-art submodels for diesel engine flow and combustion: spray atomization, drop breakup/coalescence, multi-component fuel vaporization, spray/wall interaction, ignition and combustion, wall heat transfer, unburned HC and NOx formation, soot and radiation, and the intake flow process. Improved and/or new submodels which were completed are: wall heat transfer with unsteadiness and compressibility, laminar-turbulent characteristic time combustion with unburned HC and Zeldo'vich NOx, and spray/wall impingement with rebounding and sliding drops. Results to date show that adding the effects of unsteadiness and compressibility improves the accuracy of heat transfer predictions; spray drop rebound can occur from walls at low impingement velocities (e.g., in cold-starting); larger spray drops are formed at the nozzle due to the influence of vaporization on the atomization process; a laminar-and-turbulent characteristic time combustion model has the flexibility to match measured engine combustion data over a wide range of operating conditions; and finally, the characteristic time combustion model can also be extended to allow predictions of ignition. The accuracy of the predictions is being assessed by comparisons with available measurements. Additional supporting experiments are also described briefly. To date, comparisons with measured engine cylinder pressure and heat flux data were made for homogeneous charge, spark-ignited and compression-ignited engines. The model results are in good agreement with the experiments.
Apparatus for diffusion-gap thermal desalination
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lowenstein, Andrew
A thermal distillation apparatus including evaporation surfaces that are wetted with a solution, and from which at least some of the volatile solvent contained in the solution evaporates, condensers having an external surface in close proximity to, but not touching, a corresponding one of the one or more evaporation surfaces, and on which vapors of the solvent condense, releasing thermal energy that heats a flow of the solution moving upward within the condensers, spacers that prevent contact between the evaporating surfaces and the condensers, wherein spaces between the evaporating surfaces and the condensers are filled with a gaseous mixture composedmore » of solvent vapor and one or more non-condensable gases, and except for diffusion of the solvent vapor relative to the non-condensable gases, the gaseous mixture is stationary.« less
Kinetic Monte Carlo Simulations of Oxygen Diffusion in Environmental Barrier Coating Materials
NASA Technical Reports Server (NTRS)
Good, Brian S.
2017-01-01
Ceramic Matrix Composite (CMC) materials are of interest for use in next-generation turbine engine components, offering a number of significant advantages, including reduced weight and high operating temperatures. However, in the hot environment in which such components operate, the presence of water vapor can lead to corrosion and recession, limiting the useful life of the components. Such degradation can be reduced through the use of Environmental Barrier Coatings (EBCs) that limit the amount of oxygen and water vapor reaching the component. Candidate EBC materials include Yttrium and Ytterbium silicates. In this work we present results of kinetic Monte Carlo (kMC) simulations of oxygen diffusion, via the vacancy mechanism, in Yttrium and Ytterbium disilicates, along with a brief discussion of interstitial diffusion.
Direct methanol fuel cell and system
Wilson, Mahlon S.
2004-10-26
A fuel cell having an anode and a cathode and a polymer electrolyte membrane located between anode and cathode gas diffusion backings uses a methanol vapor fuel supply. A permeable polymer electrolyte membrane having a permeability effective to sustain a carbon dioxide flux equivalent to at least 10 mA/cm.sup.2 provides for removal of carbon dioxide produced at the anode by reaction of methanol with water. Another aspect of the present invention includes a superabsorpent polymer material placed in proximity to the anode gas diffusion backing to hold liquid methanol or liquid methanol solution without wetting the anode gas diffusion backing so that methanol vapor from the liquid methanol or liquid methanol-water solution is supplied to the membrane.
Lordgooei, M.; Sagen, J.; Rood, M.J.; Rostam-Abadi, M.
1998-01-01
A new activated-carbon fiber-cloth (ACFC) adsorber coupled with an electrothermal regenerator and a cryogenic condenser was designed and developed to efficiently capture and recover toxic chemical vapors (TCVs) from simulated industrial gas streams. The system was characterized for adsorption by ACFC, electrothermal desorption, and cryogenic condensation to separate acetone and methyl ethyl ketone from gas streams. Adsorption dynamics are numerically modeled to predict system characteristics during scale-up and optimization of the process in the future. The model requires diffusivities of TCVs into an activated-carbon fiber (ACF) as an input. Effective diffusivities of TCVs into ACFs were modeled as a function of temperature, concentration, and pore size distribution. Effective diffusivities for acetone at 65 ??C and 30-60 ppmv were measured using a chromatography method. The energy factor for surface diffusion was determined from comparison between the experimental and modeled effective diffusivities. The modeled effective diffusivities were used in a dispersive computational model to predict mass transfer zones of TCVs in fixed beds of ACFC under realistic conditions for industrial applications.
Ultra-fast vapor generation by a graphene nano-ratchet: a theoretical and simulation study.
Ding, Hongru; Peng, Guilong; Mo, Shenqiu; Ma, Dengke; Sharshir, Swellam Wafa; Yang, Nuo
2017-12-14
Vapor generation is of prime importance for a broad range of applications: domestic water heating, desalination and wastewater treatment, etc. However, slow and inefficient evaporation limits its development. In this study, a nano-ratchet, a multilayer graphene with cone-shaped nanopores (MGCN), to accelerate vapor generation has been proposed. By performing molecular dynamics simulation, we found that air molecules were spontaneously transported across MGCN and resulted in a remarkable pressure difference, 21 kPa, between the two sides of MGCN. We studied the dependence of the pressure difference on the ambient temperature and geometry of MGCN in detail. Through further analysis of the diffusive transport, we found that pressure difference depended on the competition between ratchet transport and Knudsen diffusion and it was further found that ratchet transport is dominant. The significant pressure difference could lead to a 15-fold or greater enhancement of vapor generation, which shows the wide applications of this nano-ratchet.
Liu, Hongyu; Liu, Cuiyun; Peng, Shuge; Pan, Bingli; Lu, Chang
2018-02-15
A series of novel methyl cellulose (MC) composite films were prepared using polyethyleneimine reduced graphene oxide (PEI-RGO) as an effective filler for water vapor barrier application. The as-prepared PEI-RGO/MC composites were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, thermogravimetric analysis, tensile test and scanning electron microscopy. The experimental and theoretical results exhibited that PEI-RGO was uniformly dispersed in the MC matrix without aggregation and formed an aligned dispersion. The addition of PEI-RGO resulted in an enhanced surface hydrophobicity and a tortuous diffusion pathway for water molecules. Water vapor permeability of PEI-RGO/MC with loading of 3.0% of surface modified graphene was as low as 5.98×10 -11 gmm -2 s -1 Pa -1 . The synergistic effects of enhanced surface hydrophobicity and tortuous diffusion pathway were accounted for the improved water vapor barrier performance of the PEI-RGO/MC composite films. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mooney, Damian A; MacElroy, J M Don
2007-11-06
Water vapor sorption experiments have been conducted on Kevlar 49 at 30 degrees C over a range of water vapor pressures in 0-90% of saturation and on the as-polymerized form of the material at 30, 45, and 60 degrees C over a series of water vapor pressures of 0-60%, 0-25%, and 0-15%, respectively. For each of the differential steps in water vapor pressure, dynamic uptake curves were generated and analyzed according to a number of different mathematical models, including Fickian, Coaxial cylindrical, and intercalation models. The intercalation model was demonstrated to be the most successful model and considered two time-scales involved in the diffusion process, i.e., a penetrant-diffusive time-scale and a polymer-local-matrix-relaxation time-scale. The success of this model reinforces previously reported adsorption and desorption isotherms which suggested that water may penetrate into the surface layers of the polymer crystallite through a process known as intercalation.
ERIC Educational Resources Information Center
Abrikosov, A. A.
1992-01-01
Looks at one phase of the water cycle; the formation of drops in cooling water vapor. Examines the influence of surface shape on the equilibrium of the liquid and gas phases. Discusses the mathematical formulas that model the phenomenon. (MDH)
A Validated All-Pressure Fluid Drop Model and Lewis Number Effects for a Binary Mixture
NASA Technical Reports Server (NTRS)
Harstad, K.; Bellan, J.
1999-01-01
The differences between subcritical liquid drop and supercritical fluid drop behavior are discussed. Under subcritical, evaporative high emission rate conditions, a film layer is present in the inner part of the drop surface which contributes to the unique determination of the boundary conditions; it is this film layer which contributes to the solution's convective-diffusive character. In contrast, under supercritical condition as the boundary conditions contain a degree of arbitrariness due to the absence of a surface, and the solution has then a purely diffusive character. Results from simulations of a free fluid drop under no-gravity conditions are compared to microgravity experimental data from suspended, large drop experiments at high, low and intermediary temperatures and in a range of pressures encompassing the sub-and supercritical regime. Despite the difference between the conditions of the simulations and experiments (suspension vs. free floating), the time rate of variation of the drop diameter square is remarkably well predicted in the linear curve regime. The drop diameter is determined in the simulations from the location of the maximum density gradient, and agrees well with the data. It is also shown that the classical calculation of the Lewis number gives qualitatively erroneous results at supercritical conditions, but that an effective Lewis number previously defined gives qualitatively correct estimates of the length scales for heat and mass transfer at all pressures.
On the autonomous motion of active drops or bubbles.
Ryazantsev, Yuri S; Velarde, Manuel G; Guzman, Eduardo; Rubio, Ramón G; Ortega, Francisco; Montoya, Juan-Jose
2018-05-19
Thermo-capillary stresses on the surface of a drop can be the result of a non-isothermal surface chemical conversion of a reactant dissolved in the host fluid. The strength of heat production (with e.g. absorption) on the surface is ruled by the diffusion of the reactant and depends on the state of motion of the drop. Such thermo-capillary stresses can provoke the motion of the drop or its motionless state in the presence of an external body force. If in the balance of forces, including indeed viscous drag, the net resultant force vanishes there is the possibility of autonomous motion with constant velocity of the drop. Focusing on drops with radii in the millimeter range provided here is a quantitative study of the possibility of such autonomous motion when the drop, considered as active unit, is seat of endo- or exo-thermic reactive processes that dominate its motion. The framework is restricted to Stokes flows in the hydrodynamics, negligible heat Peclet number while the solute Peclet number is considered very high. A boundary layer approximation is used in the description of reactant diffusion. Those processes eventually end up in the action being expressed by surface tension gradients and the Marangoni effect. Explicit expressions of the force acting on the drop and the velocity fields inside and outside the drop are provided. Some significant particular cases are discussed to illustrate the usefulness of the theory. Copyright © 2018. Published by Elsevier Inc.
Studies on Aspirin Crystals Generated by a Modified Vapor Diffusion Method.
Mittal, Amit; Malhotra, Deepak; Jain, Preeti; Kalia, Anupama; Shunmugaperumal, Tamilvanan
2016-08-01
The objectives of the current investigation were (1) to study the influence of selected two different non-solvents (diethylether and dichloromethane) on the drug crystal formation of a model drug, aspirin (ASP-I) by the modified vapor diffusion method and (2) to characterize and compare the generated crystals (ASP-II and ASP-III) using different analytical techniques with that of unprocessed ASP-I. When compared to the classical vapor diffusion method which consumes about 15 days to generate drug crystals, the modified method needs only 12 h to get the same. Fourier transform-infrared spectroscopy (FT-IR) reveals that the internal structures of ASP-II and ASP-III crystals were identical when compared with ASP-I. Although the drug crystals showed a close similarity in X-ray diffraction patterns, the difference in the relative intensities of some of the diffraction peaks (especially at 2θ values of around 7.7 and 15.5) could be attributed to the crystal habit or crystal size modification. Similarly, the differential scanning calorimetry (DSC) study speculates that only the crystal habit modifications might occur but without involving any change in internal structure of the generated drug polymorphic form I. This is further substantiated from the scanning electron microscopy (SEM) pictures that indicated the formation of platy shape for the ASP-II crystals and needle shape for the ASP-III crystals. In addition, the observed slow dissolution of ASP crystals should indicate polymorph form I formation. Thus, the modified vapor diffusion method could routinely be used to screen and legally secure all possible forms of other drug entities too.
Ferdowsi, Milad; Ramirez, Antonio Avalos; Jones, Joseph Peter; Heitz, Michèle
2017-09-01
Methane (CH 4 ) removal in the presence of ethanol vapors was performed by a stone-based bed and a hybrid packing biofilter in parallel. In the absence of ethanol, a methane removal efficiency of 55 ± 1% was obtained for both biofilters under similar CH 4 inlet load (IL) of 13 ± 0.5 g CH4 m -3 h -1 and an empty bed residence time (EBRT) of 6 min. The results proved the key role of the bottom section in both biofilters for simultaneous removal of CH 4 and ethanol. Ethanol vapor was completely eliminated in the bottom sections for an ethanol IL variation between 1 and 11 g ethanol m -3 h -1 . Ethanol absorption and accumulation in the biofilm phase as well as ethanol conversion to CO 2 contributed to ethanol removal efficiency of 100%. In the presence of ethanol vapor, CO 2 productions in the bottom section increased almost fourfold in both biofilters. The ethanol concentration in the leachate of the biofilter exceeding 2200 g ethanol m -3 leachate in both biofilters demonstrated the excess accumulation of ethanol in the biofilm phase. The biofilters responded quickly to an ethanol shock load followed by a starvation with 20% decrease of their performance. The return to normal operations in both biofilters after the transient conditions took less than 5 days. Unlike the hybrid packing biofilter, excess pressure drop (up to 1.9 cmH 2 O m -1 ) was an important concern for the stone bed biofilter. The biomass accumulation in the bottom section of the stone bed biofilter contributed to 80% of the total pressure drop. However, the 14-day starvation reduced the pressure drop to 0.25 cmH 2 O m -1 .
Structure and characteristics of heterogeneous detonation
NASA Astrophysics Data System (ADS)
Nicholls, J. A.; Sichel, M.; Kauffman, C. W.
1983-09-01
The emphasis of this research program centered around the structure of heterogeneous detonation waves, inasmuch as this had been found to be very important to the detonation characteristics of heterogeneous mixtures. On the experimental side, a vertical detonation tube was used wherein liquid fuel drops, all of one size, were generated at the top of the tube and allowed to fall vertically into the desired gaseous mixture. A strong blast wave was transmitted into the mixture through use of an auxiliary shock tube. The propagation of the resultant wave was monitored by pressure switches, pressure transducers, and photography. The low vapor pressure liquid fuel, decane (400 micrometer drop size) was used for most of the experiments. Attention was given to wave structure, wave velocity, and initiation energy. Three atmospheres (100% O2; 40% O2/60% N2; and air) and a number of equivalence ratios were investigated. Holographic pictures and streak photography were employed to study the drop shattering process and the structure of the front. Other experiments investigated the addition of the sensitizer, normal propyl nitrate (NPN), to the decane. The important aspect of vapor pressure was studied by heating the entire tube to various elevated temperatures and then noting the effect on detonability.
Tritium plume dynamics in the shallow unsaturated zone in an arid environment
Maples, S.R.; Andraski, Brian J.; Stonestrom, David A.; Cooper, C.A.; Pohll, G.; Michel, R.L.
2014-01-01
The spatiotemporal variability of a tritium plume in the shallow unsaturated zone and the mechanisms controlling its transport were evaluated during a 10-yr study. Plume movement was minimal and its mass declined by 68%. Upward-directed diffusive-vapor tritium fluxes and radioactive decay accounted for most of the observed plume-mass declines.Effective isolation of tritium (3H) and other contaminants at waste-burial facilities requires improved understanding of transport processes and pathways. Previous studies documented an anomalously widespread (i.e., theoretically unexpected) distribution of 3H (>400 m from burial trenches) in a dry, sub-root-zone gravelly layer (1–2-m depth) adjacent to a low-level radioactive waste (LLRW) burial facility in the Amargosa Desert, Nevada, that closed in 1992. The objectives of this study were to: (i) characterize long-term, spatiotemporal variability of 3H plumes; and (ii) quantify the processes controlling 3H behavior in the sub-root-zone gravelly layer beneath native vegetation adjacent to the facility. Geostatistical methods, spatial moment analyses, and mass flux calculations were applied to a spatiotemporally comprehensive, 10-yr data set (2001–2011). Results showed minimal bulk-plume advancement during the study period and limited Fickian spreading of mass. Observed spreading rates were generally consistent with theoretical vapor-phase dispersion. The plume mass diminished more rapidly than would be expected from radioactive decay alone, indicating net efflux from the plume. Estimates of upward 3H efflux via diffusive-vapor movement were >10× greater than by dispersive-vapor or total-liquid movement. Total vertical fluxes were >20× greater than lateral diffusive-vapor fluxes, highlighting the importance of upward migration toward the land surface. Mass-balance calculations showed that radioactive decay and upward diffusive-vapor fluxes contributed the majority of plume loss. Results indicate that plume losses substantially exceeded any continuing 3H contribution to the plume from the LLRW facility during 2001 to 2011 and suggest that the widespread 3H distribution resulted from transport before 2001.
"Pressure Blocking" Effect in the Growing Vapor Bubble in a Highly Superheated Liquid
NASA Astrophysics Data System (ADS)
Zudin, Yu. B.; Zenin, V. V.
2016-09-01
The problem on the growth of a vapor bubble in a liquid whose superheating enthalpy exceeds the phase transition heat has been considered. A physical model of the "pressure blocking" in the bubble is presented. The problem for the conditions of the experiment on the effervescence of a butane drop has been solved numerically. An algorithm for constructing an analytical solution of the problem on the bubble growth in a highly superheated liquid is proposed.
The prototype computer program SPARC has been under development for several years to estimate physical properties and chemical reactivity parameters of organic compounds strictly from molecular structure. SPARC solute-solute physical process models have been developed and tested...
Substrate-mediated diffusion-induced growth of single-crystal nanowires.
Mohammad, S Noor
2009-11-28
Theoretical investigations of the growth and growth rates of single-crystal nanowires (NWs) by vapor phase mechanisms have been carried out. Substrate-induced processes are assumed to dominate this growth. The modeling for growth takes adsorption, desorption, surface scattering, and diffusion into account. It takes into consideration also the retarding electric field arising from the scattering of the NW vapor species by both the substrate and the NW sidewalls. Growth characteristics under the influence of the retarding electric field have been studied. Competitive roles of adatom diffusivity and the electric field in the NW growth are elucidated. Influence of the growing NW length and the adatom impingement rate on the NW growth rate has been described. The effect of adatom collection area around each NW has been examined. The NW tapering and kinking have been explained. The fundamentals of the substrate induction and details of the growth parameters have been analyzed. The influence of foreign element catalytic agents in the vapor-liquid-solid mechanism has been presented. All these have led to the understanding and resolution of problems, controversies, and contradictions involving substrate-induced NW growths.
Microgravity nucleation and particle coagulation experiments support
NASA Technical Reports Server (NTRS)
Lilleleht, L. U.; Lass, T. J.
1987-01-01
A hollow sphere model is developed to predict the range of supersaturation ratio values for refractory metal vapors in a proposed experimental nucleation apparatus. Since the experiments are to be carried out in a microgravity environment, the model neglects the effects of convection and assumes that the only transfer of vapors through an inert gas atmosphere is by conduction and molecular diffusion. A consistent set of physical properties data is assembled for the various candidate metals and inert ambient gases expected to be used in the nucleation experiments. Transient partial pressure profiles are computed for the diffusing refractory species for two possible temperature distributions. The supersaturation ratio values from both candidate temperature profiles are compared with previously obtained experimetnal data on a silver-hydrogen system. The model is used to simulate the diffusion of magnesium vapor through argon and other inert gas atmospheres over ranges of initial and boundary conditions. These results identify different combinations of design and operating parameters which are liekly to produce supersaturation ratio values high enough to induce homogeneous nucleation in the apparatus being designed for the microgravity nucleation experiments.
NASA Technical Reports Server (NTRS)
Anderson, O. L.; Chiappetta, L. M.; Edwards, D. E.; Mcvey, J. B.
1982-01-01
A model for predicting the distribution of liquid fuel droplets and fuel vapor in premixing-prevaporizing fuel-air mixing passages of the direct injection type is reported. This model consists of three computer programs; a calculation of the two dimensional or axisymmetric air flow field neglecting the effects of fuel; a calculation of the three dimensional fuel droplet trajectories and evaporation rates in a known, moving air flow; a calculation of fuel vapor diffusing into a moving three dimensional air flow with source terms dependent on the droplet evaporation rates. The fuel droplets are treated as individual particle classes each satisfying Newton's law, a heat transfer, and a mass transfer equation. This fuel droplet model treats multicomponent fuels and incorporates the physics required for the treatment of elastic droplet collisions, droplet shattering, droplet coalescence and droplet wall interactions. The vapor diffusion calculation treats three dimensional, gas phase, turbulent diffusion processes. The analysis includes a model for the autoignition of the fuel air mixture based upon the rate of formation of an important intermediate chemical species during the preignition period.
NASA Astrophysics Data System (ADS)
Weike, Pang; Wenju, Lin; Qilin, Pan; Wenye, Lin; Qunte, Dai; Luwei, Yang; Zhentao, Zhang
2014-01-01
In this paper, a set of heat pump (called as Mechanical Vapor Recompression, MVR) propelled by a centrifugal fan is tested and it shows some special characteristic when it works together with a falling film evaporator. Firstly, an analysis of the fan's suction and discharge parameters at stable state, such as its pressure and temperature, indicates that a phenomenon of wet compression is probably to appear during vapor compression. As a result, superheat after saturated vapor is compressed is eliminated, which reduces discharge temperature of the system. It is because drops boil away and absorb the super heat into their latent heat during vapor compression. Meanwhile, drops in the suction vapor add to the compressed vapor, which increase the given heat of the MVR heat pump. Next, assistant electric heat could adjust and keep steady of the operating pressure and temperature of an MVR heat pump. With the evaporation temperature up to be high, heat balance is broken and supplement heat needs to increase. Thirdly, the performance of an MVR heat pump is affect by the balance of falling film and evaporation that has an effect on heat transfer. Then, two parameters standing for the performance are measured as it runs in practical condition. The two important parameters are consumptive electricity power and productive water capacity. According to theoretical work in ideal condition by calculation and fan's input power by measure as running, adiabatic efficiency (ηad) of a centrifugal fan is calculated when it is applied in a heat pump of MVR. Following, based on ηad, practical SMER and COP of an MVR heat pump are discovered to be correlative with it. Finally, in dependence on productive water in theory and in practice, displacement efficiency (ηv) of centrifugal fans is obtained when compressing vapor, and so provide some references of matching a fan for an MVR heat pump. On the other hand, it is helpful to research and develop MVR heat pumps, and also to check electricity power consumption while operating practically in light of electric motor efficiency (ηe) and ηad.
A numerical analysis of high-temperature heat pipe startup from the frozen state
NASA Technical Reports Server (NTRS)
Cao, Y.; Faghri, A.
1993-01-01
Continuum and rarefied vapor flows co-exist along the heat pipe length for most of the startup period. A two-region model is proposed in which the vapor flow in the continuum region is modeled by the compressible Navier-Stokes equations, and the vapor flow in the rarefied region is simulated by a self-diffusion model. The two vapor regions are linked with appropriate boundary conditions, and heat pipe wail, wick, and vapor flow are solved as a conjugate problem. The numerical solutions for the entire heat pipe startup process from the frozen state are compared with the corresponding experimental data with good agreement.
Tritium Plume Dynamics in the Shallow Unsaturated Zone Adjacent to an Arid Waste Disposal Facility
NASA Astrophysics Data System (ADS)
Maples, S.; Andraski, B. J.; Stonestrom, D. A.; Cooper, C. A.; Michel, R. L.; Pohll, G. M.
2012-12-01
Previous studies at the U.S. Geological Survey's Amargosa Desert Research Site (ADRS) in southern Nevada have documented two plumes of tritiated water-vapor (3HHOg) adjacent to a closed, commercial low-level radioactive waste disposal facility. Wastes were disposed on-site from 1962-92. Tritium has moved long distances (> 400 m) through a shallow (1-2-m depth) dry gravelly layer—orders of magnitude further than anticipated by standard transport models. Geostatistical methods, spatial moment analyses and tritium flux calculations were applied to assess shallow plume dynamics. A grid-based plant-water sampling method was utilized to infer detailed, field-scale 3HHOg concentrations at 5-yr intervals during 2001-11. Results indicate that gravel-layer 3HHOg mass diminished faster than would be expected from radioactive decay (~70% in 10 yr). Both plumes exhibited center-of-mass stability, suggesting that bulk-plume movement is minimal during the period of study. Nonetheless, evidence of localized lateral advancement along some margins, combined with increases in the spatial covariance of concentration distribution, indicates intra-plume mass redistribution is ongoing. Previous studies have recognized that vertical movement of tritiated water from sub-root-zone gravel into the root-zone contributes to atmospheric release via evapotranspiration. Estimates of lateral and vertical tritium fluxes during the study period indicate (1) vertical tritiated water fluxes were dominated by diffusive-vapor fluxes (> 90%), and (2) vertical diffusive-vapor fluxes were roughly an order of magnitude greater than lateral diffusive-vapor fluxes. This behavior highlights the importance of the atmosphere as a tritium sink. Estimates of cumulative vertical diffusive-vapor flux and radioactive decay with time were comparable to observed declines in total shallow plume mass with time. This suggests observed changes in plume mass may (1) be attributed, in considerable part, to these removal mechanisms, and (2) appreciable input from the adjacent disposal facility is not occurring at this time.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mombrú, Dominique; Romero, Mariano, E-mail: mromero@fq.edu.uy; Faccio, Ricardo, E-mail: rfaccio@fq.edu.uy
In situ preparation of polyaniline-ceramic nanocomposites has recently demonstrated that the electrical properties are highly improved with respect to the typical ex situ preparations. In this report, we present for the first time, to the best of our knowledge, the in situ growth of titanium oxide quantum dots in polyaniline host via water vapor flow diffusion as an easily adaptable route to prepare other ceramic-polymer nanocomposites. The main relevance of this method is the possibility to prepare ceramic quantum dots from alkoxide precursors using water vapor flow into any hydrophobic polymer host and to achieve good homogeneity and size-control. Inmore » addition, we perform full characterization by means of high-resolution transmission electron microscopy, X-ray powder diffraction, small angle X-ray scattering, thermogravimetric and calorimetric analyses, confocal Raman microscopy and impedance spectroscopy analyses. The presence of the polymer host and interparticle Coulomb repulsive interactions was evaluated as an influence for the formation of ~3–8 nm equally-sized quantum dots independently of the concentration. The polyaniline polaron population showed an increase for the quantum dots diluted regime and the suppression at the concentrated regime, ascribed to the formation of chemical bonds at the interface, which was confirmed by theoretical simulations. In agreement with the previous observation, the in situ growth of ceramic quantum dots in polyaniline host via water vapor flow diffusion could be very useful as a novel approach to prepare electrode materials for energy conversion and storage applications. - Highlights: • In situ growth of titanium oxide quantum dots in polyaniline host via water vapor flow diffusion. • Polyaniline charge carriers at the interface and charge interactions between quantum dots. • Easy extrapolation to sol-gel derived quantum dots into polymer host as potential electrode materials.« less
Diffusion of biomass pyrolysis products in H-ZSM-5 by molecular dynamics simulations
Bu, Lintao; Nimlos, Mark R.; Robichaud, David J.; ...
2016-12-13
Diffusion of biomass pyrolysis vapors and their upgraded products is an essential catalytic property of zeolites during catalytic fast pyrolysis and likely plays a critical role in the selectivity of these catalysts. Characterizing the diffusivities of representative biofuel molecules is critical to understand shape selectivity and interpret product distribution. Yet, experimental measurements on the diffusivities of oxygenated biofuel molecules at pyrolysis temperatures are very limited in the literature. As an alternative approach, we conducted MD simulations to measure the diffusion coefficients of several selected molecules that are representative of biomass pyrolysis vapors, namely water, methanol, glycolaldehyde, and toluene in H-ZSM-5more » zeolite. The results show the diffusion coefficients calculated via MD simulations are consistent with available NMR measurements at room temperature. The effect of molecular weight and molecular critical diameter on the diffusivity among the chosen model compounds is also examined. Furthermore, we have characterized the diffusivities of representative biofuel molecules, namely xylene isomers, in H-ZSM-5. Our calculations determined that the ratio of the diffusion coefficients for xylene isomers is p-xylene: o-xylene: m-xylene ≈ 83:3:1 at 700 K. Furthermore, our results also demonstrate the different diffusivity between p-xylene and toluene is due to the molecular orientations when the molecules diffuse along the channels in H-ZSM-5 and provide deep insight into the effect of molecular orientation on its diffusivity.« less
Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires.
Hou, Wen Chi; Hong, Franklin Chau-Nan
2009-02-04
This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 degrees C.
NASA Astrophysics Data System (ADS)
Kouraytem, Nadia; Li, Er Qiang; Vakarelski, Ivan Uriev; Thoroddsen, Sigurdur
2015-11-01
High-speed video imaging is used in order to look at the impact of a molten metal drop falling into a liquid pool. The interaction regimes are three: film boiling, nucleate boiling or vapor explosion. Following the vapor explosion, the metal fragments and different textures are observed. It was seen that, using a tin alloy, a porous structure results whereas using a distinctive eutectic metal, Field's metal, micro beads are formed. Different parameters such as the metal type, molten metal temperature, pool surface tension and pool boiling temperature have been altered in order to assess the role they play on the explosion dynamics and the molten metal's by product.
Reconditioning perovskite films in vapor environments through repeated cation doping
NASA Astrophysics Data System (ADS)
Boonthum, Chirapa; Pinsuwan, Kusuma; Ponchai, Jitprabhat; Srikhirin, Toemsak; Kanjanaboos, Pongsakorn
2018-06-01
Perovskites have attracted considerable attention for application as high-efficiency photovoltaic devices owing to their low-cost and low-temperature fabrication. A good surface and high crystallinity are necessary for high-performance devices. We examine the negative effects of chemical ambiences on the perovskite crystal formation and morphology. The repeated cation doping (RCD) technique was developed to remedy these issues by gradually dropping methylammonium ions on top of about-to-form perovskite surfaces to cause recrystallization. RCD promotes pinhole-free, compact, and polygonal-like surfaces under various vapor conditions. Furthermore, it enhances the electronic properties and crystallization. The benefits of RCD extend beyond perovskites under vapor ambiences, as it can improve regular and wasted perovskites.
Recent results and new hardware developments for protein crystal growth in microactivity
NASA Technical Reports Server (NTRS)
Delucas, L. J.; Long, M. M.; Moore, K. M.; Smith, C.; Carson, M.; Narayana, S. V. L.; Carter, D.; Clark, A. D., Jr.; Nanni, R. G.; Ding, J.
1993-01-01
Protein crystal growth experiments have been performed on 16 space shuttle missions since April, 1985. The initial experiments utilized vapor diffusion crystallization techniques similar to those used in laboratories for earth-based experiments. More recent experiments have utilized temperature induced crystallization as an alternative method for growing high quality protein crystals in microgravity. Results from both vapor diffusion and temperature induced crystallization experiments indicate that proteins grown in microgravity may be larger, display more uniform morphologies, and yield diffraction data to significantly higher resolutions than the best crystals of these proteins grown on earth.
Full scale evaluation of diffuser ageing with clean water oxygen transfer tests.
Krampe, J
2011-01-01
Aeration is a crucial part of the biological wastewater treatment in activated sludge systems and the main energy user of WWTPs. Approximately 50 to 60% of the total energy consumption of a WWTP can be attributed to the aeration system. The performance of the aeration system, and in the case of fine bubble diffused aeration the diffuser performance, has a significant impact on the overall plant efficiency. This paper seeks to isolate the changes of the diffuser performance over time by eliminating all other influencing parameters like sludge retention time, surfactants and reactor layout. To achieve this, different diffusers have been installed and tested in parallel treatment trains in two WWTPs. The diffusers have been performance tested in clean water tests under new conditions and after one year of operation. A set of material property tests describing the diffuser membrane quality was also performed. The results showed a significant drop in the performance of the EPDM diffuser in the first year which resulted in similar oxygen transfer efficiency around 16 g/m3/m for all tested systems. Even though the tested silicone diffusers did not show a drop in performance they had a low efficiency in the initial tests. The material properties indicate that the EPDM performance loss is partly due to the washout of additives.
Dynamics of an Unsteady Diffusion Flame: Effects of Heat Release and Gravity
1990-09-27
UNSTEADY DIFFUSION FLAME: EFFECTS OF HEAT RELEASE AND GRAVITY INTRODUCTION Experiments on laminar diffusion flames have shown that gravity affects the flame ... length and width as well as its extinction characteristics (1-4). These studies have been conducted in drop towers and have focused on fuel jets with
Surface Piercing Propeller Performance
2005-09-01
solid body ( hydrodynamic cavitation ) or by high-intensity sound waves (acoustic cavitation). A Research study done by Yin Lu Young at UT studied and...discusses the effect of hydrodynamic cavitation , which occurs when pressure drops below the saturated vapor pressure, consequently resulting in the
ERIC Educational Resources Information Center
Curzon, F. L.
1978-01-01
Describes four demonstrations of the Leidenfrost phenomenon; floating of liquid drops on their own vapor above a hot surface, delayed quenching of red-hot brass by water, explosion of vessels containing suspended liquid droplets, and momentary incombustibility of living tissue immersed in boiling oil. (Author/GA)
Predictions and Verification of an Isotope Marine Boundary Layer Model
NASA Astrophysics Data System (ADS)
Feng, X.; Posmentier, E. S.; Sonder, L. J.; Fan, N.
2017-12-01
A one-dimensional (1D), steady state isotope marine boundary layer (IMBL) model is constructed. The model includes meteorologically important features absent in Craig and Gordon type models, namely height-dependent diffusion/mixing and convergence of subsiding external air. Kinetic isotopic fractionation results from this height-dependent diffusion which starts as pure molecular diffusion at the air-water interface and increases linearly with height due to turbulent mixing. The convergence permits dry, isotopically depleted air subsiding adjacent to the model column to mix into ambient air. In δD-δ18O space, the model results fill a quadrilateral, of which three sides represent 1) vapor in equilibrium with various sea surface temperatures (SSTs) (high d18O boundary of quadrilateral); 2) mixture of vapor in equilibrium with seawater and vapor in the subsiding air (lower boundary depleted in both D and 18O); and 3) vapor that has experienced the maximum possible kinetic fractionation (high δD upper boundary). The results can be plotted in d-excess vs. δ18O space, indicating that these processes all cause variations in d-excess of MBL vapor. In particular, due to relatively high d-excess in the descending air, mixing of this air into the MBL causes an increase in d-excess, even without kinetic isotope fractionation. The model is tested by comparison with seven datasets of marine vapor isotopic ratios, with excellent correspondence; >95% of observational data fall within the quadrilateral area predicted by the model. The distribution of observations also highlights the significant influence of vapor from the nearby converging descending air on isotopic variations in the MBL. At least three factors may explain the <5% of observations that fall slightly outside of the predicted region in both δD-δ18O and d-excess - δ18O space: 1) variations in seawater isotopic ratios, 2) variations in isotopic composition of subsiding air, and 3) influence of sea spray. The model can be used for understanding the effects of boundary layer processes and meteorological conditions on isotopic composition of vapor within, and vapor fluxes through the MBL, and how changes in moisture source regions affect the isotopic composition of precipitation. The model can be applied to modern as well as paleo- climate conditions.
Simulation of drop movement over an inclined surface using smoothed particle hydrodynamics.
Das, Arup K; Das, Prasanta K
2009-10-06
Smoothed particle hydrodynamics (SPH) is used to numerically simulate the movement of drops down an inclined plane. Diffuse interfaces have been assumed for tracking the motion of the contact line. The asymmetric shape of the three-dimensional drop and the variation of contact angle along its periphery can be calculated using the simulation. During the motion of a liquid drop down an inclined plane, an internal circulation of liquid particles is observed due to gravitational pull which causes periodic change in the drop shape. The critical angle of inclination required for the inception of drop motion is also evaluated for different fluids as a function of drop volume. The numerical predictions exhibit a good agreement with the published experimental results.
Moradian, Hamid; Bazargani, Abdollah; Rafiee, Azade; Nazarialam, Ali
2013-09-01
Dental caries is still remained as a major health problem. This problem has created a new interest to search for new antimicrobial agents from various sources including medicinal plants. Since limited data is available so far regarding the antibacterial effect of Coriandrum sativum seed and Dentol Drop against Streptococcus mutans, this study aims to assess this activity. This experimental study was conducted in Shiraz University of Medical Sciences. In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum seed and Dentol drop with chlorhexidine against Streptococcus mutans was evaluated using disk diffusion and broth microdilution assays. Positive and negative controls were considered. The data was statistically analyzed by applying Kruskal-Wallis and Tukey post-hoc test to compare the groups using SPSS software (version 17). Dentol drop showed a remarkable antibacterial activity, in comparison with chlorhexidine, against S. mutans in the disk diffusion (p value = 0.005), and broth microdilution assays (p value = 0.0001). Based on the results of this study, Coriandrum sativum seed did not posses any antibacterial property. Coriandrum sativum seed showed no anti-Streptococcus mutans activity. Dentol drop exhibited a remarkable antibacterial activity against S. mutans when tested in vitro. Dentol drop can be further studied as a preventive measure for dental caries.
Water-vapor pressure control in a volume
NASA Technical Reports Server (NTRS)
Scialdone, J. J.
1978-01-01
The variation with time of the partial pressure of water in a volume that has openings to the outside environment and includes vapor sources was evaluated as a function of the purging flow and its vapor content. Experimental tests to estimate the diffusion of ambient humidity through openings and to validate calculated results were included. The purging flows required to produce and maintain a certain humidity in shipping containers, storage rooms, and clean rooms can be estimated with the relationship developed here. These purging flows are necessary to prevent the contamination, degradation, and other effects of water vapor on the systems inside these volumes.
The numerical methods for the development of the mixture region in the vapor explosion simulations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Y.; Ohashi, H.; Akiyama, M.
An attempt to numerically simulate the process of the vapor explosion with a general multi-component and multi-dimension code is being challenged. Because of the rapid change of the flow field and extremely nonuniform distribution of the components in the system of the vapor explosion, the numerical divergence and diffusion are subject to occur easily. A dispersed component model and a multiregion scheme, by which these difficulties can be effectively overcome, were proposed. The simulations have been performed for the processes of the premixing and the fragmentation propagation in the vapor explosion.
Effect of flow velocity on the process of air-steam condensation in a vertical tube condenser
NASA Astrophysics Data System (ADS)
Havlík, Jan; Dlouhý, Tomáš
2018-06-01
This article describes the influence of flow velocity on the condensation process in a vertical tube. For the case of condensation in a vertical tube condenser, both the pure steam condensation process and the air-steam mixture condensation process were theoretically and experimentally analyzed. The influence of steam flow velocity on the value of the heat transfer coefficient during the condensation process was evaluated. For the condensation of pure steam, the influence of flow velocity on the value of the heat transfer coefficient begins to be seen at higher speeds, conversely, this effect is negligible at low values of steam velocity. On the other hand, for the air-steam mixture condensation, the influence of flow velocity must always be taken into account. The flow velocity affects the water vapor diffusion process through non-condensing air. The presence of air significantly reduces the value of the heat transfer coefficient. This drop in the heat transfer coefficient is significant at low velocities; on the contrary, the decrease is relatively small at high values of the velocity.
Balasubramanian, Moovarkumudalvan; Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Ponnuswamy, Mondikalipudur Nanjappa Gounder
2009-01-01
Hemoglobin is a tetrameric, iron-containing metalloprotein, which plays a vital role in the transportation of oxygen from lungs to tissues and carbon dioxide back to lungs. Though good amount of work has already been done on hemoglobins, the scarcity of data on three dimensional structures pertaining to low oxygen affinity hemoglobins from mammalian species, motivated our group to work on this problem specifically. Herein, we report the preliminary crystallographic analysis of buffalo hemoglobin, which belongs to low oxygen affinity species. The buffalo blood was collected, purified by anion exchange chromatography and crystallized with PEG 3350 using 50mM phosphate buffer at pH 6.7 as a precipitant by hanging drop vapor diffusion method. Data collection was carried out using mar345dtb image plate detector system. Buffalo hemoglobin crystallizes in orthorhombic space group P2(1)2(1)2(1) with one whole biological molecule (alpha2beta2) in the asymmetric unit with cell dimensions a=63.064A, b=74.677A, c=110.224A.
Direct visualization of nanoparticle dynamics at liquid interfaces
NASA Astrophysics Data System (ADS)
Gao, Yige; Kim, Paul; Hoagland, David; Russell, Tom
Ionic liquids, because of their negligible vapor pressures and moderate viscosities, are suitable media to investigate the dynamics of different types of dispersed nanoparticles by scanning electron microscopy. No liquid cell is necessary. Here, Brownian motions of nanoparticles partially wetted at the vacuum-liquid interface are visualized by low voltage SEM under conditions that allow single particle tracking for tens-of-minutes or longer. Conductive, nonconductive, semiconductive, and core-shell conductive-nonconductive nanoparticles have all been studied, and their interactions with each other in one- and two-component layers, as manifested in particle trajectories, differ significantly. For example, Au-coated silica nanoparticles aggregate above a threshold current, whereas aggregated silica-coated Au nanoparticles disaggregate at the same conditions. The impacts of surface concentration of nanoparticle dynamics were observed for one-component and two-component layers, with both global and localized motions visualized for single particles even in dense environments. As the surface concentration increases, the diffusion coefficient drops, and when the concentration reaches a critical threshold, the nanoparticles are essentially frozen. Financial support from NSF DMR-1619651 is acknowledged.
NASA Astrophysics Data System (ADS)
Chandrashekar, Anand; Chen, Feng; Lin, Jasmine; Humayun, Raashina; Wongsenakhum, Panya; Chang, Sean; Danek, Michal; Itou, Takamasa; Nakayama, Tomoo; Kariya, Atsushi; Kawaguchi, Masazumi; Hizume, Shunichi
2010-09-01
This paper describes electrical testing results of new tungsten chemical vapor deposition (CVD-W) process concepts that were developed to address the W contact and bitline scaling issues on 55 nm node devices. Contact resistance (Rc) measurements in complementary metal oxide semiconductor (CMOS) devices indicate that the new CVD-W process for sub-32 nm and beyond - consisting of an advanced pulsed nucleation layer (PNL) combined with low resistivity tungsten (LRW) initiation - produces a 20-30% drop in Rc for diffused NiSi contacts. From cross-sectional bright field and dark field transmission electron microscopy (TEM) analysis, such Rc improvement can be attributed to improved plugfill and larger in-feature W grain size with the advanced PNL+LRW process. More experiments that measured contact resistance for different feature sizes point to favorable Rc scaling with the advanced PNL+LRW process. Finally, 40% improvement in line resistance was observed with this process as tested on 55 nm embedded dynamic random access memory (DRAM) devices, confirming that the advanced PNL+LRW process can be an effective metallization solution for sub-32 nm devices.
Chemical vapor deposition of W-Si-N and W-B-N
Fleming, James G.; Roherty-Osmun, Elizabeth Lynn; Smith, Paul M.; Custer, Jonathan S.; Jones, Ronald V.; Nicolet, Marc-A.; Madar, Roland; Bernard, Claude
1999-01-01
A method of depositing a ternary, refractory based thin film on a substrate by chemical vapor deposition employing precursor sources of tungsten comprising WF.sub.6, either silicon or boron, and nitrogen. The result is a W--Si--N or W--B--N thin film useful for diffusion barrier and micromachining applications.
This material will be interesting to regulators and contractors who collect samples of soil gas to estimate the potential for vapor intrusion of buildings. In the absence of biodegradation, transport of vapors through the unsaturated zone is expected to be by diffusion, and t...
Historically, conventional practice to estimate intrusion of fuel vapors from soil and ground water to buildings measures the concentration of BTEX beneath the building using vapor probes or monitoring wells screened across the water table. Standard practice assumes that the co...
Reducing cyclone pressure drop with evasés
USDA-ARS?s Scientific Manuscript database
Cyclones are widely used to separate particles from gas flows and as air emissions control devices. Their cost of operation is proportional to the fan energy required to overcome their pressure drop. Evasés or exit diffusers potentially could reduce exit pressure losses without affecting collection...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Padbury, Richard P.; Jur, Jesse S., E-mail: jsjur@ncsu.edu
Previous research exploring inorganic materials nucleation behavior on polymers via atomic layer deposition indicates the formation of hybrid organic–inorganic materials that form within the subsurface of the polymer. This has inspired adaptations to the process, such as sequential vapor infiltration, which enhances the diffusion of organometallic precursors into the subsurface of the polymer to promote the formation of a hybrid organic–inorganic coating. This work highlights the fundamental difference in mass uptake behavior between atomic layer deposition and sequential vapor infiltration using in-situ methods. In particular, in-situ quartz crystal microgravimetry is used to compare the mass uptake behavior of trimethyl aluminummore » in poly(butylene terephthalate) and polyamide-6 polymer thin films. The importance of trimethyl aluminum diffusion into the polymer subsurface and the subsequent chemical reactions with polymer functional groups are discussed.« less
Insights into gold-catalyzed plasma-assisted CVD growth of silicon nanowires
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Wanghua, E-mail: wanghua.chen@polytechnique.edu; Roca i Cabarrocas, Pere
2016-07-25
Understanding and controlling effectively the behavior of metal catalyst droplets during the Vapor-Liquid-Solid growth of nanowires are crucial for their applications. In this work, silicon nanowires are produced by plasma-assisted Chemical Vapor Deposition using gold as a catalyst. The influence of hydrogen plasma on nanowire growth is investigated experimentally and theoretically. Interestingly, in contrast to conventional chemical vapor deposition, the growth rate of silicon nanowires shows a decrease as a function of their diameters, which is consistent with the incorporation of silicon via sidewall diffusion. We show that Ostwald ripening of catalyst droplets during nanowire growth is inhibited in themore » presence of a hydrogen plasma. However, when the plasma is off, the diffusion of Au atoms on the nanowire sidewall can take place. Based on this observation, we have developed a convenient method to grow silicon nanotrees.« less
Yu, Jie; Sun, Lushi; Xiang, Jun; Hu, Song; Su, Sheng
2013-02-01
Heavy metals volatilization during thermal treatment of model solid waste was theoretically and experimentally investigated in a fluidized bed reactor. Lead, cadmium, zinc and copper, the most four conventional heavy metals were investigated. Particle temperature model and metal diffusion model were established to simulate the volatilization of CdCl(2) evaporation and investigate the possible influencing factors. The diffusion coefficient, porosity and particle size had significant effects on metal volatilization. The higher diffusion coefficient and porosity resulted in the higher metal evaporation. The influence of redox conditions, HCl, water and mineral matrice were also investigated experimentally. The metal volatilization can be promoted by the injection of HCl, while oxygen played a negative role. The diffusion process of heavy metals within particles also had a significant influence on kinetics of their vaporization. The interaction between heavy metals and mineral matter can decrease metal evaporation amount by forming stable metallic species. Copyright © 2012 Elsevier Ltd. All rights reserved.
Leidenfrost drops on a heated liquid pool
NASA Astrophysics Data System (ADS)
Maquet, L.; Sobac, B.; Darbois-Texier, B.; Duchesne, A.; Brandenbourger, M.; Rednikov, A.; Colinet, P.; Dorbolo, S.
2016-09-01
We show that a volatile liquid drop placed at the surface of a nonvolatile liquid pool warmer than the boiling point of the drop can be held in a Leidenfrost state even for vanishingly small superheats. Such an observation points to the importance of the substrate roughness, negligible in the case considered here, in determining the threshold Leidenfrost temperature. A theoretical model based on the one proposed by Sobac et al. [Phys. Rev. E 90, 053011 (2014), 10.1103/PhysRevE.90.053011] is developed in order to rationalize the experimental data. The shapes of the drop and of the liquid substrate are analyzed. The model notably provides scalings for the vapor film thickness profile. For small drops, these scalings appear to be identical to the case of a Leidenfrost drop on a solid substrate. For large drops, in contrast, they are different, and no evidence of chimney formation has been observed either experimentally or theoretically in the range of drop sizes considered in this study. Concerning the evaporation dynamics, the radius is shown to decrease linearly with time whatever the drop size, which differs from the case of a Leidenfrost drop on a solid substrate. For high superheats, the characteristic lifetime of the drops versus the superheat follows a scaling law that is derived from the model, but, at low superheats, it deviates from this scaling by rather saturating.
Irreversible Entropy Production in Two-Phase Mixing Layers
NASA Technical Reports Server (NTRS)
Okongo, Nora
2003-01-01
This report presents a study of dissipation (irreversible production of entropy) in three-dimensional, temporal mixing layers laden with evaporating liquid drops. The purpose of the study is to examine the effects of evaporating drops on the development of turbulent features in flows. Direct numerical simulations were performed to analyze transitional states of three mixing layers: one without drops, and two that included drops at different initial mass loadings. Without drops, the dissipation is essentially due to viscous effects. It was found that in the presence of drops, the largest contribution to dissipation was made by heating and evaporation of the drops, and that at large length scales, this contribution is positive (signifying that the drops reduce turbulence), while at small scales, this contribution is negative (the drops increase turbulence). The second largest contribution to dissipation was found to be associated with the chemical potential, which leads to an increase in turbulence at large scales and a decrease in turbulence at small scales. The next smaller contribution was found to be that of viscosity. The fact that viscosity effects are only third in order of magnitude in the dissipation is in sharp contrast to the situation for the mixing layer without the drops. The next smaller contribution - that of the drag and momentum of the vapor from the drops - was found to be negative at lower mass loading but to become positive at higher mass loading.
Performance of a multiple venturi fuel-air preparation system. [fuel injection for gas turbines
NASA Technical Reports Server (NTRS)
Tacina, R. R.
1979-01-01
Spatial fuel-air distributions, degree of vaporization, and pressure drop were measured 16.5 cm downstream of the fuel injection plane of a multiple Venturi tube fuel injector. Tests were performed in a 12 cm tubular duct. Test conditions were: a pressure of 0.3 MPa, inlet air temperature from 400 to 800K, air velocities of 10 and 20 m/s, and fuel-air ratios of 0.010 and 0.020. The fuel was Diesel #2. Spatial fuel-air distributions were within + or - 20 percent of the mean at inlet air temperatures above 450K. At an inlet air temperature of 400K, the fuel-air distribution was measured when a 50 percent blockage plate was placed 9.2 cm upstream of the fuel injection plane to distort the inlet air velocity fuel injection plane to distort the inlet air velocity profile. Vaporization of the fuel was 50 percent complete at an inlet air temperature of 400K and the percentage increased linearly with temperature to complete vaporization at 600K. The pressure drop was 3 percent at the design point which was three times greater than the designed value and the single tube experiment value. No autoignition or flashback was observed at the conditions tested.
Convective mass transfer around a dissolving bubble
NASA Astrophysics Data System (ADS)
Duplat, Jerome; Grandemange, Mathieu; Poulain, Cedric
2017-11-01
Heat or mass transfer around an evaporating drop or condensing vapor bubble is a complex issue due to the interplay between the substrate properties, diffusion- and convection-driven mass transfer, and Marangoni effects, to mention but a few. In order to disentangle these mechanisms, we focus here mainly on the convective mass transfer contribution in an isothermal mass transfer problem. For this, we study the case of a millimetric carbon dioxide bubble which is suspended under a substrate and dissolved into pure liquid water. The high solubility of CO2 in water makes the liquid denser and promotes a buoyant-driven flow at a high (solutal) Rayleigh number (Ra˜104 ). The alteration of p H allows the concentration field in the liquid to be imaged by laser fluorescence enabling us to measure both the global mass flux (bubble volume, contact angle) and local mass flux around the bubble along time. After a short period of mass diffusion, where the boundary layer thickens like the square root of time, convection starts and the CO2 is carried by a plume falling at constant velocity. The boundary layer thickness then reaches a plateau which depends on the bubble cross section. Meanwhile the plume velocity scales like (dV /d t )1 /2 with V being the volume of the bubble. As for the rate of volume loss, we recover a constant mass flux in the diffusion-driven regime followed by a decrease in the volume V like V2 /3 after convection has started. We present a model which agrees well with the bubble dynamics and discuss our results in the context of droplet evaporation, as well as high Rayleigh convection.
Evaporation enhancement in soils: a critical review
NASA Astrophysics Data System (ADS)
Rutten, Martine; van de Giesen, Nick
2015-04-01
Temperature gradients in the top layer of the soil are, especially during the daytime, steeper than would be expected if thermal conduction was the primary heat transfer mechanism. Evaporation seems to have significant influence on the soil heat budget. Only part of the surface soil heat flux is conducted downwards, increasing the soil temperatures, and part is used for evaporation, acting as a sink to the soil heat budget. For moist soils, the evaporation is limited by the transport of water molecules to the surface. The classical view is that water vapor is transported from the evaporation front to the surface by diffusion. Diffusion is mixing due to the random movement of molecules resulting in flattening concentration gradients. In soil, the diffusive vapor flux and the resulting latent heat flux are generally small. We found that transport enhancement is necessary in order to sustain vapor fluxes that are large enough to sustain latent heat fluxes, as well as being large enough to explain the observed temperature gradients. Enhancement of vapor diffusion is a known phenomenon, subject to debate on the explanations of underlying mechanism. In an extensive literature review on vapor enhancement in soils, the plausibility of various mechanisms was assessed. We reviewed mechanisms based on (combinations of) diffusive, viscous, buoyant, capillary and external pressure forces including: thermodiffusion, dispersion, Stefan's flow, Knudsen diffusion, liquid island effect, hydraulic lift, free convection, double diffusive convection and forced convection. The analysis of the order of magnitude of the mechanisms based on first principles clearly distinguished between plausible and implausible mechanisms. Thermodiffusion, Stefan's flow, Knudsen effects, liquid islands do not significantly contribute to enhanced evaporation. Double diffusive convection seemed unlikely due to lack of experimental evidence, but could not be completely excluded from the list of potential mechanisms. Hydraulic lift, the mechanism that small capillaries lift liquid water to the surface where it evaporates, does significantly contribute to enhanced evaporation from soils, also from dryer soils. The experimental evidence for and the theoretical underpinnings of this mechanism are convincing. However, we sought mechanisms that both explain enhanced evaporation and steep temperature gradients in the soil during the daytime. These often observed gradients consist of a sharp decrease of temperature with a depth up to the depth of the evaporation front. Hydraulic lift cannot explain this because the evaporation front is located at the surface. One remaining mechanism is forced convection due to atmospheric pressure fluctuations, also referred to as wind pumping. Wind pumping causes displacement and flow velocities too small for significant convective and too small for significant dispersive transport, when steady state dispersion formulations are used. However, experiments do indicate significant dispersive transport that can be explained by dispersion under unsteady flow conditions. Forced convection due to pressure fluctuations seems to be the only mechanism that can explain both enhanced evaporation and the steep temperature gradients.
Rotating diffuser for pressure recovery in a steam cooling circuit of a gas turbine
Eldrid, Sacheverel Q.; Salamah, Samir A.; DeStefano, Thomas Daniel
2002-01-01
The buckets of a gas turbine are steam-cooled via a bore tube assembly having concentric supply and spent cooling steam return passages rotating with the rotor. A diffuser is provided in the return passage to reduce the pressure drop. In a combined cycle system, the spent return cooling steam with reduced pressure drop is combined with reheat steam from a heat recovery steam generator for flow to the intermediate pressure turbine. The exhaust steam from the high pressure turbine of the combined cycle unit supplies cooling steam to the supply conduit of the gas turbine.
Modeling and control of diffusion and low-pressure chemical vapor deposition furnaces
NASA Astrophysics Data System (ADS)
De Waard, H.; De Koning, W. L.
1990-03-01
In this paper a study is made of the heat transfer inside cylindrical resistance diffusion and low-pressure chemical vapor deposition furnaces, aimed at developing an improved temperature controller. A model of the thermal behavior is derived which also covers the important class of furnaces equipped with semitransparent quartz process tubes. The model takes into account the thermal behavior of the thermocouples. It is shown that currently used temperature controllers are highly inefficient for very large scale integration applications. Based on the model an alternative temperature controller of the linear-quadratic-Gaussian type is proposed which features direct wafer temperature control. Some simulation results are given.
Wang, Hui; Lan, Yucheng; Zhang, Jiaming; Crimp, Martin A; Ren, Zhifeng
2012-04-01
Long beta-Ga2O3 crystalline nanowires are synthesized on patterned silicon substrates using chemical vapor deposition technique. Advanced electron microscopy indicates that the as-grown beta-Ga2O3 nanowires are consisted of poly-crystalline (Co, Ga)O tips and straight crystalline beta-Ga2O3 stems. The catalytic cobalt not only locates at the nanowire tips but diffuses into beta-Ga2O3 nanowire stems several ten nanometers. A solid diffusion growth mechanism is proposed based on the spatial elemental distribution along the beta-Ga2O3 nanowires at nanoscale.
Onischuk, A A; Purtov, P A; Baklanov, A M; Karasev, V V; Vosel, S V
2006-01-07
Zinc and silver vapor homogeneous nucleations are studied experimentally at the temperature from 600 to 725 and 870 K, respectively, in a laminar flow diffusion chamber with Ar as a carrier gas at atmospheric pressure. The size, shape, and concentration of aerosol particles outcoming the diffusion chamber are analyzed by a transmission electron microscope and an automatic diffusion battery. The wall deposit is studied by a scanning electron microscope (SEM). Using SEM data the nucleation rate for both Zn and Ag is estimated as 10(10) cm(-3) s(-1). The dependence of critical supersaturation on temperature for Zn and Ag measured in this paper as well as Li, Na, Cs, Ag, Mg, and Hg measured elsewhere is analyzed. To this aim the classical nucleation theory is extended by the dependence of surface tension on the nucleus radius. The preexponent in the formula for the vapor nucleation rate is derived using the formula for the work of formation of noncritical embryo [obtained by Nishioka and Kusaka [J. Chem. Phys. 96, 5370 (1992)] and later by Debenedetti and Reiss [J. Chem. Phys. 108, 5498 (1998)
NASA Technical Reports Server (NTRS)
Singh, N. B.; Duval, W. M.
1991-01-01
Physical vapor transport processes were studied for the purpose of identifying the magnitude of convective effects on the crystal growth process. The effects of convection on crystal quality were were studied by varying the aspect ratio and those thermal conditions which ultimately affect thermal convection during physical vapor transport. An important outcome of the present study was the observation that the convection growth rate increased up to a certain value and then dropped to a constant value for high aspect ratios. This indicated that a very complex transport had occurred which could not be explained by linear stability theory. Better quality crystals grown at a low Rayleigh number confirmed that improved properties are possible in convectionless environments.
A kinetic model for heterogeneous condensation of vapor on an insoluble spherical particle.
Luo, Xisheng; Fan, Yu; Qin, Fenghua; Gui, Huaqiao; Liu, Jianguo
2014-01-14
A kinetic model is developed to describe the heterogeneous condensation of vapor on an insoluble spherical particle. This new model considers two mechanisms of cluster growth: direct addition of water molecules from the vapor and surface diffusion of adsorbed water molecules on the particle. The effect of line tension is also included in the model. For the first time, the exact expression of evaporation coefficient is derived for heterogeneous condensation of vapor on an insoluble spherical particle by using the detailed balance. The obtained expression of evaporation coefficient is proved to be also correct in the homogeneous condensation and the heterogeneous condensation on a planar solid surface. The contributions of the two mechanisms to heterogeneous condensation including the effect of line tension are evaluated and analysed. It is found that the cluster growth via surface diffusion of adsorbed water molecules on the particle is more important than the direct addition from the vapor. As an example of our model applications, the growth rate of the cap shaped droplet on the insoluble spherical particle is derived. Our evaluation shows that the growth rate of droplet in heterogeneous condensation is larger than that in homogeneous condensation. These results indicate that an explicit kinetic model is benefit to the study of heterogeneous condensation on an insoluble spherical particle.
Physics of lithium bromide (LiBr) solution dewatering through vapor venting membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Isfahani, RN; Fazeli, A; Bigham, S
2014-01-01
The physics of water desorption from a lithium bromide (LiBr) solution flow through an array of microchannels capped by a porous membrane is studied. The membrane allows the vapor to exit the flow and retains the liquid. Effects of different parameters such as wall temperature, solution and vapor pressures, and solution mass flux on the desorption rate were studied. Two different mechanisms of desorption are analyzed. These mechanisms consisted of: (1) direct diffusion of water molecules out of the solution and their subsequent flow through the membrane and (2) formation of water vapor bubbles within the solution and their ventingmore » through the membrane. Direct diffusion was the dominant desorption mode at low surface temperatures and its magnitude was directly related to the vapor pressure, the solution concentration, and the heated wall temperature. Desorption at the boiling regime was predominantly controlled by the solution flow pressure and mass flux. Microscale visualization studies suggested that at a critical mass flux, some bubbles are carried out of the desorber through the solution microchannels rather than being vented through the membrane. Overall, an order of magnitude higher desorption rate compare to a previous study on a membrane-based desorber was achieved. Published by Elsevier Ltd.« less
Field Testing of an Unvented Roof with Fibrous Insulation, Tiles and Vapor Diffusion Venting
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ueno, K.; Lstiburek, J. W.
This research is a test implementation of an unvented tile roof assembly in a hot-humid climate (Orlando, FL; Zone 2A), insulated with air permeable insulation (netted and blown fiberglass). Given the localized moisture accumulation and failures seen in previous unvented roof field work, it was theorized that a 'diffusion vent' (water vapor open, but air barrier 'closed') at the highest points in the roof assembly might allow for the wintertime release of moisture, to safe levels. The 'diffusion vent' is an open slot at the ridge and hips, covered with a water-resistant but vapor open (500+ perm) air barrier membrane.more » As a control comparison, one portion of the roof was constructed as a typical unvented roof (self-adhered membrane at ridge). The data collected to date indicate that the diffusion vent roof shows greater moisture safety than the conventional, unvented roof design. The unvented roof had extended winter periods of 95-100% RH, and wafer (wood surrogate RH sensor) measurements indicating possible condensation; high moisture levels were concentrated at the roof ridge. In contrast, the diffusion vent roofs had drier conditions, with most peak MCs (sheathing) below 20%. In the spring, as outdoor temperatures warmed, all roofs dried well into the safe range (10% MC or less). Some roof-wall interfaces showed moderately high MCs; this might be due to moisture accumulation at the highest point in the lower attic, and/or shading of the roof by the adjacent second story. Monitoring will be continued at least through spring 2016 (another winter and spring).« less
The structure of evaporating and combusting sprays: Measurements and predictions
NASA Technical Reports Server (NTRS)
Shuen, J. S.; Solomon, A. S. P.; Faeth, G. M.
1984-01-01
An apparatus developed, to allow observations of monodisperse sprays, consists of a methane-fueled turbulent jet diffusion flame with monodisperse methanol drops injected at the burner exit. Mean and fluctuating-phase velocities, drop sizes, drop-mass fluxes and mean-gas temperatures were measured. Initial drop diameters of 100 and 180 microns are being considered in order to vary drop penetration in the flow and effects of turbulent dispersion. Baseline tests of the burner flame with no drops present were also conducted. Calibration tests, needed to establish methods for predicting drop transport, involve drops supported in the post-flame region of a flat-flame burner operated at various mixture ratios. Spray models which are being evaluated include: (1) locally homogeneous flow (LFH) analysis, (2) deterministic separated flow (DSF) analysis and (3) stochastic separated flow (SSF) analysis.
Contribution for Iron Vapor and Radiation Distribution Affected by Current Frequency of Pulsed Arc
NASA Astrophysics Data System (ADS)
Shimokura, Takuya; Mori, Yusuke; Iwao, Toru; Yumoto, Motoshige
Pulsed GTA welding has been used for improvement of stability, weld speed, and heat input control. However, the temperature and radiation power of the pulsed arc have not been elucidated. Furthermore, arc contamination by metal vapor changes the arc characteristics, e.g. by increasing radiation power. In this case, the metal vapor in pulsed GTA welding changes the distribution of temperature and radiation power as a function of time. This paper presents the relation between metal vapor and radiation power at different pulse frequencies. We calculate the Fe vapor distribution of the pulsed current. Results show that the Fe vapor is transported at fast arc velocity during the peak current period. During the base current period, the Fe vapor concentration is low and distribution is diffuse. The transition of Fe vapor distribution does not follow the pulsed current; the radiation power density distribution differs for high frequencies and low frequencies. In addition, the Fe vapor and radiation distribution are affected by the pulsed arc current frequency.
DSMC simulations of vapor transport toward development of the lithium vapor box divertor concept
NASA Astrophysics Data System (ADS)
Jagoe, Christopher; Schwartz, Jacob; Goldston, Robert
2016-10-01
The lithium vapor divertor box concept attempts to achieve volumetric dissipation of the high heat efflux from a fusion power system. The vapor extracts the heat of the incoming plasma by ionization and radiation, while remaining localized in the vapor box due to differential pumping based on rapid condensation. Preliminary calculations with lithium vapor at densities appropriate for an NSTX-U-scale machine give Knudsen numbers between 0.01 and 1, outside both the range of continuum fluid dynamics and of collisionless Monte Carlo. The direct-simulation Monte Carlo (DSMC) method, however, can simulate rarefied gas flows in this regime. Using the solver contained in the OpenFOAM package, pressure-driven flows of water vapor will be analyzed. The use of water vapor in the relevant range of Knudsen number allows for a flexible similarity experiment to verify the reliability of the code before moving to tests with lithium. The simulation geometry consists of chains of boxes on a temperature gradient, connected by slots with widths that are a representative fraction of the dimensions of the box. We expect choked flow, sonic shocks, and order-of-magnitude pressure and density drops from box to box, but this expectation will be tested in the simulation and then experiment. This work is supported by the Princeton Environmental Institute.
Fundamental study of FC-72 pool boiling surface temperature fluctuations and bubble behavior
NASA Astrophysics Data System (ADS)
Griffin, Alison R.
A heater designed to monitor surface temperature fluctuations during pool boiling experiments while the bubbles were simultaneously being observed has been fabricated and tested. The heat source was a transparent indium tin oxide (ITO) layer commercially deposited on a fused quartz substrate. Four copper-nickel thin film thermocouples (TFTCs) on the heater surface measured the surface temperature, while a thin layer of sapphire or fused silica provided electrical insulation between the TFTCs and the ITO. The TFTCs were micro-fabricated using the liftoff process to deposit the nickel and copper metal films. The TFTC elements were 50 mum wide and overlapped to form a 25 mum by 25 mum junction. TFTC voltages were recorded by a DAQ at a sampling rate of 50 kHz. A high-speed CCD camera recorded bubble images from below the heater at 2000 frames/second. A trigger sent to the camera by the DAQ synchronized the bubble images and the surface temperature data. As the bubbles and their contact rings grew over the TFTC junction, correlations between bubble behavior and surface temperature changes were demonstrated. On the heaters with fused silica insulation layers, 1--2°C temperature drops on the order of 1 ms occurred as the contact ring moved over the TFTC junction during bubble growth and as the contact ring moved back over the TFTC junction during bubble departure. These temperature drops during bubble growth and departure were due to microlayer evaporation and liquid rewetting the heated surface, respectively. Microlayer evaporation was not distinguished as the primary method of heat removal from the surface. Heaters with sapphire insulation layers did not display the measurable temperature drops observed with the fused silica heaters. The large thermal diffusivity of the sapphire compared to the fused silica was determined as the reason for the absence of these temperature drops. These findings were confirmed by a comparison of temperature drops in a 2-D simulation of a bubble growing over the TFTC junction on both the sapphire and fused silica heater surfaces. When the fused silica heater produced a temperature drop of 1.4°C, the sapphire heater produced a drop of only 0.04°C under the same conditions. These results verified that the lack of temperature drops present in the sapphire data was due to the thermal properties of the sapphire layer. By observing the bubble departure frequency and site density on the heater, as well as the bubble departure diameter, the contribution of nucleate boiling to the overall heat removal from the surface could be calculated. These results showed that bubble vapor generation contributed to approximately 10% at 1 W/cm2, 23% at 1.75 W/cm2, and 35% at 2.9 W/cm 2 of the heat removed from a fused silica heater. Bubble growth and contact ring growth were observed and measured from images obtained with the high-speed camera. Bubble data recorded on a fused silica heater at 3 W/cm2, 4 W/cm2, and 5 W/cm 2 showed that bubble departure diameter and lifetime were negligibly affected by the increase in heat flux. Bubble and contact ring growth rates demonstrated significant differences when compared on the fused silica and sapphire heaters at 3 W/cm2. The bubble departure diameters were smaller, the bubble lifetimes were longer, and the bubble departure frequency was larger on the sapphire heater, while microlayer evaporation was faster on the fused silica heater. Additional considerations revealed that these differences may be due to surface conditions as well as differing thermal properties. Nucleate boiling curves were recorded on the fused silica and sapphire heaters by adjusting the heat flux input and monitoring the local surface temperature with the TFTCs. The resulting curves showed a temperature drop at the onset of nucleate boiling due to the increase in heat transfer coefficient associated with bubble nucleation. One of the TFTC locations on the sapphire heater frequently experienced a second temperature drop at a higher heat flux. When the heat flux was started from 1 W/cm2 instead of zero or returned to zero only momentarily, the temperature overshoot did not occur. In these cases sufficient vapor remained in the cavities to initiate boiling at a lower superheat.
Spontaneous jumping, bouncing and trampolining of hydrogel drops on a heated plate.
Pham, Jonathan T; Paven, Maxime; Wooh, Sanghyuk; Kajiya, Tadashi; Butt, Hans-Jürgen; Vollmer, Doris
2017-10-13
The contact between liquid drops and hot solid surfaces is of practical importance for industrial processes, such as thermal spraying and spray cooling. The contact and bouncing of solid spheres is also an important event encountered in ball milling, powder processing, and everyday activities, such as ball sports. Using high speed video microscopy, we demonstrate that hydrogel drops, initially at rest on a surface, spontaneously jump upon rapid heating and continue to bounce with increasing amplitudes. Jumping is governed by the surface wettability, surface temperature, hydrogel elasticity, and adhesion. A combination of low-adhesion impact behavior and fast water vapor formation supports continuous bouncing and trampolining. Our results illustrate how the interplay between solid and liquid characteristics of hydrogels results in intriguing dynamics, as reflected by spontaneous jumping, bouncing, trampolining, and extremely short contact times.Drops of liquid on a hot surface can exhibit fascinating behaviour such as the Leidenfrost effect in which drops hover on a vapour layer. Here Pham et al. show that when hydrogel drops are placed on a rapidly heated plate they bounce to increasing heights even if they were initially at rest.
Enhanced Vapor-Phase Diffusion in Porous Media - LDRD Final Report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, C.K.; Webb, S.W.
1999-01-01
As part of the Laboratory-Directed Research and Development (LDRD) Program at Sandia National Laboratories, an investigation into the existence of enhanced vapor-phase diffusion (EVD) in porous media has been conducted. A thorough literature review was initially performed across multiple disciplines (soil science and engineering), and based on this review, the existence of EVD was found to be questionable. As a result, modeling and experiments were initiated to investigate the existence of EVD. In this LDRD, the first mechanistic model of EVD was developed which demonstrated the mechanisms responsible for EVD. The first direct measurements of EVD have also been conductedmore » at multiple scales. Measurements have been made at the pore scale, in a two- dimensional network as represented by a fracture aperture, and in a porous medium. Significant enhancement of vapor-phase transport relative to Fickian diffusion was measured in all cases. The modeling and experimental results provide additional mechanisms for EVD beyond those presented by the generally accepted model of Philip and deVries (1957), which required a thermal gradient for EVD to exist. Modeling and experimental results show significant enhancement under isothermal conditions. Application of EVD to vapor transport in the near-surface vadose zone show a significant variation between no enhancement, the model of Philip and deVries, and the present results. Based on this information, the model of Philip and deVries may need to be modified, and additional studies are recommended.« less
Reactive codoping of GaAlInP compound semiconductors
Hanna, Mark Cooper [Boulder, CO; Reedy, Robert [Golden, CO
2008-02-12
A GaAlInP compound semiconductor and a method of producing a GaAlInP compound semiconductor are provided. The apparatus and method comprises a GaAs crystal substrate in a metal organic vapor deposition reactor. Al, Ga, In vapors are prepared by thermally decomposing organometallic compounds. P vapors are prepared by thermally decomposing phospine gas, group II vapors are prepared by thermally decomposing an organometallic group IIA or IIB compound. Group VIB vapors are prepared by thermally decomposing a gaseous compound of group VIB. The Al, Ga, In, P, group II, and group VIB vapors grow a GaAlInP crystal doped with group IIA or IIB and group VIB elements on the substrate wherein the group IIA or IIB and a group VIB vapors produced a codoped GaAlInP compound semiconductor with a group IIA or IIB element serving as a p-type dopant having low group II atomic diffusion.
Chemical vapor deposition of W-Si-N and W-B-N
Fleming, J.G.; Roherty-Osmun, E.L.; Smith, P.M.; Custer, J.S.; Jones, R.V.; Nicolet, M.; Madar, R.; Bernard, C.
1999-06-29
A method of depositing a ternary, refractory based thin film on a substrate by chemical vapor deposition employing precursor sources of tungsten comprising WF[sub 6], either silicon or boron, and nitrogen. The result is a W-Si-N or W-B-N thin film useful for diffusion barrier and micromachining applications. 10 figs.
Experiments on the Motion of Drops on a Horizontal Solid Surface due to a Wettability Gradient
NASA Technical Reports Server (NTRS)
Moumen, Nadjoua; Subramanian, R, Shankar; MLaughlin, john B.
2006-01-01
Results from experiments performed on the motion of drops of tetraethylene glycol in a wettability gradient present on a silicon surface are reported and compared with predictions from a recently developed theoretical model. The gradient in wettability was formed by exposing strips cut from a silicon wafer to decyltrichlorosiland vapors. Video images of the drops captured during the experiments were subsequently analyzed for drop size and velocity as functions of position along the gradient. In separate experiments on the same strips, the static contact angle formed by small drops was measured and used to obtain the local wettability gradient to which a drop is subjected. The velocity of the drops was found to be a strong function of position along the gradient. A quasi-steady theoretical model that balances the local hydrodynamic resistance with the local driving force generally describes the observations; possible reasons for the remaining discrepancies are discussed. It is shown that a model in which the driving force is reduced to accomodate the hysteresis effect inferred from the data is able to remove most of the discrepancy between the observed and predicted velocities.
NASA Astrophysics Data System (ADS)
Huerta L., Mario E.; Mejía G., M. Esther; Castillejos E., A. Humberto
2016-04-01
Air-mists are key elements in the secondary cooling of modern thin steel slab continuous casters. The selection of water, W, and air, A, flow rates, and pressures in pneumatic nozzles open up a wide spectrum of cooling possibilities by their influence on droplet diameter, d, droplet velocity, v, and water impact flux, w. Nonetheless, due to the harsh environment resulting from the high temperatures and dense mists involved, there is very little information about the correlation between heat flux extracted, - q, and mist characteristics, and none about the dynamics of drop-wall interactions. For obtaining both kinds of information, this work combines a steady-state heat flux measuring method with a visualization technique based on a high-speed camera and a laser illumination system. For wall temperatures, T w, between ~723 K and ~1453 K (~450 °C and ~1180 °C), which correspond to film boiling regime, it was confirmed that - q increases with increase in v, w, and T w and with decrease in d. It should be noticed, however, that the increase in w generally decreases the spray cooling effectiveness because striking drops do not evaporate efficiently due to the interference by liquid remains from previous drops. Visualization of the events happening close to the surface also reveals that the contact time of the liquid with the surface is very brief and that rebounding, splashing, sliding, and levitation of drops lead to ineffective contact with the surface. At the center of the mist footprint, where drops impinge nearly normal to the surface those with enough momentum establish intimate contact with it before forming a vapor layer that pushes away the remaining liquid. Also, some drops are observed sliding upon the surface or levitating close to it; these are drops with low momentum which are influenced by the deflecting air stream. At footprint positions where oblique impingement occurs, frequently drops are spotted sliding or levitating and liquid films flowing in from inner positions are seen generating vapor cushions after having stayed in contact with the surface. Visualization of events taking place under high, ~500 kPa, and low, ~200 kPa, air nozzle pressure, p a, conditions suggests that the considerably larger heat extraction obtained under high p a is related to more frequent impingement of finer and faster drops that result in the formation of a dense fog of tiny secondary drops that moves tangentially close to the surface.
1979-03-01
and Diffusion Laboratory Department of Civil Engineering, , / """..,--. Colorado State University DOT-CG-75279-A) )V Fnrt Cnl lin. Colorado 80523 ype...Film Aspirating Probe ......... .. 20 3.5.2 Errors in Concentration Measurement . . 21 4.0 TEST PROGRAM RESULTS ..... ............... .. 23 4.1...Coriolis Force Viscous Diffusivity Prandtl number Pr = v/(k/P C ViThrma Diffusivity0 0 p Thermal Diffusivity Eckert number Ec = /Cpo (AT)o 5 For exact
NASA Astrophysics Data System (ADS)
Reynolds, Dylan; Wood, Stephen E.; Bapst, Jonathan; Mehlhaff, Joshua; Griffiths, Stephen G.
2014-11-01
We have applied a self-consistent 1-D model for heat diffusion, vapor diffusion, and ice condensation/sublimation, and surface energy balance to investigate our hypothesis for the source of the recently observed water vapor around Ceres [1]. As described in a companion presentation [2], we find that the estimated global flux of 6 kg/s can be produced by steady-state sublimation of subsurface ice driven by the “geothermal” temperature gradient for a heat flux of 1 mW/m2 - the value estimated for a chondritic abundance of heat-producing elements [3,4]. We will present a detailed description of our Ceres cryothermal diffusion model and comparisons with previous models. One key difference is the use of a new physics-based analytic model (‘MaxRTCM’) for calculating the thermal conductivity (Kth) of planetary regolith [5] that has been validated by comparisons to a wide range of laboratory data [6]. MaxRTCM predicts much lower Kth values in the upper regolith than those in previous work [3]. It also accounts for a process first modeled in a study of unstable equatorial ground ice on Mars [7,8], where vapor diffusing up from a receding ice table toward the surface can recondense at shallower depths - eventually forming a steady-state profile of pore ice volume fraction that increases with depth and maintains a constant flux of vapor at all depths [7]. Using MaxRTCM we calculate the corresponding Kth(z) profiles and will present predictions and implications of the resulting temperature profile in the upper few kilometers of Ceres’ megaregolith.References: [1] Küppers et al. (2014), Nature, 505(7484), 525-527. [2] Wood et al., 2014, this meeting. [3] Fanale & Salvail (1989) Icarus 82, 97-110. [4] McCord and Sotin (2005) JGR 110, E05009. [5] Wood (2013) LPSC Abs. 44, 3077. [6] Wood (2014), Icarus, in revision. [7] Mellon et al. (1997), JGR, 102, 19357-69. [8] Clifford (1993), JGR, 98, 10973-11016.
Moradian, Hamid; Bazargani, Abdollah; Rafiee, Azade; Nazarialam, Ali
2013-01-01
Background and objectives Dental caries is still remained as a major health problem. This problem has created a new interest to search for new antimicrobial agents from various sources including medicinal plants. Since limited data is available so far regarding the antibacterial effect of Coriandrum sativum seed and Dentol Drop against Streptococcus mutans, this study aims to assess this activity. Materials and Methods This experimental study was conducted in Shiraz University of Medical Sciences. In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum seed and Dentol drop with chlorhexidine against Streptococcus mutans was evaluated using disk diffusion and broth microdilution assays. Positive and negative controls were considered. The data was statistically analyzed by applying Kruskal-Wallis and Tukey post-hoc test to compare the groups using SPSS software (version 17). Results Dentol drop showed a remarkable antibacterial activity, in comparison with chlorhexidine, against S. mutans in the disk diffusion (p value = 0.005), and broth microdilution assays (p value = 0.0001). Based on the results of this study, Coriandrum sativum seed did not posses any antibacterial property. Conclusion Coriandrum sativum seed showed no anti-Streptococcus mutans activity. Dentol drop exhibited a remarkable antibacterial activity against S. mutans when tested in vitro. Dentol drop can be further studied as a preventive measure for dental caries. PMID:24475330
FLUID MECHANICS AND TANKAGE DESIGN FOR LOW GRAVITY ENVIRONMENT
tankage delivers only single-phase propellants. The requirements for feed systems of electric engines are described briefly. Also, the 1.85-second drop...direction of mass transfer in tapered tubes and liquid-vapor interface shapes in an annular space between concentric cylinders. Possible feed systems
A fundamental study of chromium deposition on solid oxide fuel cell cathode materials
NASA Astrophysics Data System (ADS)
Tucker, Michael C.; Kurokawa, Hideto; Jacobson, Craig P.; De Jonghe, Lutgard C.; Visco, Steven J.
Chromium contamination of metal oxides and SOFC cathode catalysts is studied in the range 700-1000 °C. Samples are exposed to a moist air atmosphere saturated with volatile Cr species in the presence and absence of direct contact between the sample and ferritic stainless steel powder. Chromium contamination of the samples is observed to occur via two separate pathways: surface diffusion from the stainless steel surface and vapor deposition from the atmosphere. Surface diffusion dominates in all cases. Surface diffusion is found to be a significant source of Cr contamination for LSM and LSCF at 700, 800, and 1000 °C. Vapor deposition of Cr onto LSCF was observed at each of these temperatures, but was not observed for LSM at 700 or 800 °C. Comparison of the behavior for LSM, LSCF, and single metal oxides suggests that Mn and Co, respectively, are responsible for the Cr contamination of these catalysts.
Kinetic Monte Carlo Simulations of Oxygen Diffusion in Environmental Barrier Coating Materials
NASA Technical Reports Server (NTRS)
Good, Brian S.
2017-01-01
Ceramic Matrix Composite (CMC) materials are of interest for use in next-generation turbine engine components, offering a number of significant advantages, including reduced weight and high operating temperatures. However, in the hot environment in which such components operate, the presence of water vapor can lead to corrosion and recession, limiting the useful life of the components. Such degradation can be reduced through the use of Environmental Barrier Coatings (EBCs) that limit the amount of oxygen and water vapor reaching the component. Candidate EBC materials include Yttrium and Ytterbium silicates. In this work we present results of kinetic Monte Carlo (kMC) simulations of oxygen diffusion, via the vacancy mechanism, in Yttrium and Ytterbium disilicates, along with a brief discussion of interstitial diffusion. An EBC system typically includes a bond coat located between the EBC and the component surface. Bond coat materials are generally chosen for properties other than low oxygen diffusivity, but low oxygen diffusivity is nevertheless a desirable characteristic, as the bond coat could provide some additional component protection, particularly in the case where cracks in the coating system provide a direct path from the environment to the bond coat interface. We have therefore performed similar kMC simulations of oxygen diffusion in this material.
Drop evaporation in a single-axis acoustic levitator
NASA Technical Reports Server (NTRS)
Lierke, E. G.; Croonquist, A. P.
1990-01-01
A 20 kHz single-axis acoustic positioner is used to levitate aqueous-solution drops (volumes less than or approximately equal to 100 micro-liters). Drop evaporation rates are measured under ambient, isothermal conditions for different relative humidities. Acoustic convection around the levitated sample enhances the mass loss over that due to natural convection and diffusion. A theoretical treatment of the mass flow is developed in analogy to previous studies of the heat transfer from a sphere in an acoustic field. Predictions of the enhanced mass loss, in the form of Nusselt (Sherwood) numbers, are compared with observed rages of drop shrinking. The work is part of an ESA crystal growth from levitated solution drops.
NASA Astrophysics Data System (ADS)
Huang, Junqi; Goltz, Mark N.
2017-06-01
To greatly simplify their solution, the equations describing radial advective/dispersive transport to an extraction well in a porous medium typically neglect molecular diffusion. While this simplification is appropriate to simulate transport in the saturated zone, it can result in significant errors when modeling gas phase transport in the vadose zone, as might be applied when simulating a soil vapor extraction (SVE) system to remediate vadose zone contamination. A new analytical solution for the equations describing radial gas phase transport of a sorbing contaminant to an extraction well is presented. The equations model advection, dispersion (including both mechanical dispersion and molecular diffusion), and rate-limited mass transfer of dissolved, separate phase, and sorbed contaminants into the gas phase. The model equations are analytically solved by using the Laplace transform with respect to time. The solutions are represented by confluent hypergeometric functions in the Laplace domain. The Laplace domain solutions are then evaluated using a numerical Laplace inversion algorithm. The solutions can be used to simulate the spatial distribution and the temporal evolution of contaminant concentrations during operation of a soil vapor extraction well. Results of model simulations show that the effect of gas phase molecular diffusion upon concentrations at the extraction well is relatively small, although the effect upon the distribution of concentrations in space is significant. This study provides a tool that can be useful in designing SVE remediation strategies, as well as verifying numerical models used to simulate SVE system performance.
NASA Astrophysics Data System (ADS)
Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.
2015-11-01
HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.
Investigation of aluminosilicate as a solid oxide fuel cell refractory
NASA Astrophysics Data System (ADS)
Gentile, Paul S.; Sofie, Stephen W.
2011-05-01
Aluminosilicate represents a potential low cost alternative to alumina for solid oxide fuel cell (SOFC) refractory applications. The objectives of this investigation are to study: (1) changes of aluminosilicate chemistry and morphology under SOFC conditions, (2) deposition of aluminosilicate vapors on yttria stabilized zirconia (YSZ) and nickel, and (3) effects of aluminosilicate vapors on SOFC electrochemical performance. Thermal treatment of aluminosilicate under high temperature SOFC conditions is shown to result in increased mullite concentrations at the surface due to diffusion of silicon from the bulk. Water vapor accelerates the rate of surface diffusion resulting in a more uniform distribution of silicon. The high temperature condensation of volatile gases released from aluminosilicate preferentially deposit on YSZ rather than nickel. Silicon vapor deposited on YSZ consists primarily of aluminum rich clusters enclosed in an amorphous siliceous layer. Increased concentrations of silicon are observed in enlarged grain boundaries indicating separation of YSZ grains by insulating glassy phase. The presence of aluminosilicate powder in the hot zone of a fuel line supplying humidified hydrogen to an SOFC anode impeded peak performance and accelerated degradation. Energy dispersive X-ray spectroscopy detected concentrations of silicon at the interface between the electrolyte and anode interlayer above impurity levels.
Vaporization of a solid surface in an ambient gas
NASA Astrophysics Data System (ADS)
Benilov, M. S.; Jacobsson, S.; Kaddani, A.; Zahrai, S.
2001-07-01
The net flux of vapour from a solid surface in an ambient gas is analysed with the aim to estimate the effect of vaporization cooling on the energy balance of an arc cathode under conditions typical for a high-power current breaker. If the ratio of the equilibrium vapour pressure pv to the ambient pressure p∞ is smaller than unity, the removal of vapour from the surface is due to diffusion into the bulk of the gas. As a consequence, the net flux of the vapour from the surface is much smaller than the emitted flux. An estimate of the diffusion rate under conditions typical for a high-power current breaker indicates that vaporization cooling plays a minor role in the energy balance of the cathode in this case. If ratio pv/p∞ is above unity, the flow of the vapour from the surface appears and the net flux is comparable to the emitted flux. A simple analytical solution has been obtained for this case, which is in a good agreement with results of the Monte Carlo modelling of preceding authors. If pv/p∞ exceeds approximately 4.5, vaporization occurs as into vacuum and the net flux is about 0.82 of the emitted flux.
Inter-diffusion analysis of joint interface of tungsten-rhenium couple
NASA Astrophysics Data System (ADS)
Hua, Y. F.; Li, Z. X.; Zhang, X.; Du, J. H.; Huang, C. L.; Du, M. H.
2011-09-01
The tungsten-rhenium couple was prepared by using glow plasma physical vapor deposition (PVD) on the isotropic fine grained graphite (IG) substrates. Diffusion anneals of the tungsten-rhenium couple were conducted at the temperature from 1100 °C to 1400 °C to investigate the inter-diffusion behaviors. The results showed that the thickness of the inter-diffusion zone increased with increasing annealing temperature. The relationship between the inter-diffusion coefficient and the annealing temperature accorded with the Arrhenius manner. The value of inter-diffusion activation energies was 189 kJ/mole (1.96 eV). The service time of tungsten-rhenium multilayer diffusion barrier was limited by the inter-diffusion for rhenium and tungsten rather than the diffusion of carbon in rhenium.
46 CFR 32.50-15 - Cargo piping on tank vessels constructed on or after July 1, 1951-TB/ALL.
Code of Federal Regulations, 2010 CFR
2010-10-01
...) Except for the carriage of animal fats and vegetable oils, the system has a closure which forms a vapor... vegetable oils, the system has a metallic drop line which complies with 46 CFR 153.282. (3) Cargo piping...
46 CFR 32.50-15 - Cargo piping on tank vessels constructed on or after July 1, 1951-TB/ALL.
Code of Federal Regulations, 2011 CFR
2011-10-01
...) Except for the carriage of animal fats and vegetable oils, the system has a closure which forms a vapor... vegetable oils, the system has a metallic drop line which complies with 46 CFR 153.282. (3) Cargo piping...
Segregating gas from melt: an experimental study of the Ostwald ripening of vapor bubbles in magmas
Lautze, Nicole C.; Sisson, Thomas W.; Mangan, Margaret T.; Grove, Timothy L.
2011-01-01
Diffusive coarsening (Ostwald ripening) of H2O and H2O-CO2 bubbles in rhyolite and basaltic andesite melts was studied with elevated temperature–pressure experiments to investigate the rates and time spans over which vapor bubbles may enlarge and attain sufficient buoyancy to segregate in magmatic systems. Bubble growth and segregation are also considered in terms of classical steady-state and transient (non-steady-state) ripening theory. Experimental results are consistent with diffusive coarsening as the dominant mechanism of bubble growth. Ripening is faster in experiments saturated with pure H2O than in those with a CO2-rich mixed vapor probably due to faster diffusion of H2O than CO2 through the melt. None of the experimental series followed the time1/3 increase in mean bubble radius and time-1 decrease in bubble number density predicted by classical steady-state ripening theory. Instead, products are interpreted as resulting from transient regime ripening. Application of transient regime theory suggests that bubbly magmas may require from days to 100 years to reach steady-state ripening conditions. Experimental results, as well as theory for steady-state ripening of bubbles that are immobile or undergoing buoyant ascent, indicate that diffusive coarsening efficiently eliminates micron-sized bubbles and would produce mm-sized bubbles in 102–104 years in crustal magma bodies. Once bubbles attain mm-sizes, their calculated ascent rates are sufficient that they could transit multiple kilometers over hundreds to thousands of years through mafic and silicic melt, respectively. These results show that diffusive coarsening can facilitate transfer of volatiles through, and from, magmatic systems by creating bubbles sufficiently large for rapid ascent.
Macroscopic traveling packet and soliton states of quasi-one-dimensional flocks.
Guttenberg, Nicholas; Toner, John; Tu, Yuhai
2014-05-01
Using a continuum model for inhomogeneous flocks, we show that a finite but arbitrarily large moving "packet" of active particles (e.g., moving creatures) can form in a background of a lower density disordered phase of these particles, like a liquid drop surrounded by vapor. The "vapor density" of the disordered background can be made arbitrarily low. We find three basic types of quasi-one-dimensional states: "longitudinal", "transverse", and "oblique" states, with their internal velocity fields, respectively, parallel, perpendicular, and oblique to the interface. The transitions between these states are also studied.
NASA Astrophysics Data System (ADS)
Ghazalli, N. F.; Yuliati, L.; Lintang, H. O.
2018-01-01
We highlight the systematic study on vapochromic sensing of aromatic vapors such as benzene using phosphorescent trinuclear pyrazolate complexes (2) with supramolecular assembly of a weak intermolecular metal-metal interaction consisting of 4-(3,5-dimethoxybenzyl)-3,5-dimethyl pyrazole ligand (1) and group 11 metal ions (Cu(I), Ag(I), Au(I)). The resulting chemosensor 2(Cu) revealed positive response to benzene vapors in 5 mins by blue-shifting its emission band in 44 nm (from 616 to 572 nm) and emitted bright orange to green, where this change cannot be recovered even with external stimuli. Comparing to 2(Ag) with longer metal-metal distance (473 nm) with same sensing time and quenching in 37%, 2(Au) gave quenching in 81% from its original intensity at 612 nm with reusability in 82% without external stimuli and emitted less emissive of red-orange from its original color. The shifting phenomenon in 2(Cu) suggests diffusion of benzene vapors to inside molecules for formation of intermolecular interaction with Cu(I)-Cu(I) interaction while quenching phenomenon in 2(Au) suggests diffusion of benzene vapors to between the Au(I)-Au(I) interaction. These results indicate that suitable molecular structure of ligand and metal ion in pyrazolate complex is important for designing chemosensor in the detection of benzene vapors.
Schmid, Markus; Prinz, Tobias K.; Stäbler, Andreas; Sängerlaub, Sven
2017-01-01
Whey protein coatings and cast films are promising for use as food packaging materials. Ongoing research is endeavoring to reduce their permeability. The intention of this study was to evaluate the effect of the reactive additives sodium sulfite, sodium dodecyl sulfate (SDS), and urea on the oxygen barrier, water vapor barrier, and protein solubility of whey protein cast films. The concentration of the reactive additives was 1 to 20 wt.-%. Dried whey protein cast films were used as substrate materials. The water vapor transmission rate, the oxygen permeability, and the protein solubility were measured. Effective diffusion coefficients and effective sorption coefficients were calculated from the results of the water vapor sorption experiments. The presence of sodium sulfite resulted in an increased number of hydrophobic interactions and hydrogen bonds and a slightly decreased number of disulfide bonds. The oxygen permeability decreased from 68 to 46 cm3 (STP/standard temperature and pressure) 100 μm (m2 d bar)−1 for 1 wt.-% SDS in the whey protein cast film. The water vapor transmission rate decreased from 165 to 44 g 100 μm (m2 d)−1 measured at 50 to 0% r. h. for 20 wt.-% SDS in the whey protein cast film. The reduction in the water vapor transmission rate correlated with the lower effective diffusion coefficient. PMID:28149835
NASA Astrophysics Data System (ADS)
Schmid, Markus; Prinz, Tobias K.; Stäbler, Andreas; Sängerlaub, Sven
2016-12-01
Whey protein coatings and cast films are promising for use as food packaging materials. Ongoing research is endeavoring to reduce their permeability. The intention of this study was to evaluate the effect of the reactive additives sodium sulfite, sodium dodecyl sulfate (SDS), and urea on the oxygen barrier, water vapor barrier, and protein solubility of whey protein cast films. The concentration of the reactive additives was 1 to 20 wt.-%. Dried whey protein cast films were used as substrate materials. The water vapor transmission rate, the oxygen permeability, and the protein solubility were measured. Effective diffusion coefficients and effective sorption coefficients were calculated from the results of the water vapor sorption experiments. The presence of sodium sulfite resulted in an increased number of hydrophobic interactions and hydrogen bonds and a slightly decreased number of disulfide bonds. The oxygen permeability decreased from 68 to 46 cm³ (STP / standard temperature and pressure) 100 µm (m² d bar)-1 for 1 wt.-% SDS in the whey protein cast film. The water vapor transmission rate decreased from 165 to 44 g 100 µm (m² d)-1 measured at 50 to 0 % r. h. for 20 wt.-% SDS in the whey protein cast film. The reduction in the water vapor transmission rate correlated with the lower effective diffusion coefficient.
Direct determination of minority carrier diffusion lengths at axial GaAs nanowire p-n junctions.
Gutsche, Christoph; Niepelt, Raphael; Gnauck, Martin; Lysov, Andrey; Prost, Werner; Ronning, Carsten; Tegude, Franz-Josef
2012-03-14
Axial GaAs nanowire p-n diodes, possibly one of the core elements of future nanowire solar cells and light emitters, were grown via the Au-assisted vapor-liquid-solid mode, contacted by electron beam lithography, and investigated using electron beam induced current measurements. The minority carrier diffusion lengths and dynamics of both, electrons and holes, were determined directly at the vicinity of the p-n junction. The generated photocurrent shows an exponential decay on both sides of the junction and the extracted diffusion lengths are about 1 order of magnitude lower compared to bulk material due to surface recombination. Moreover, the observed strong diameter-dependence is well in line with the surface-to-volume ratio of semiconductor nanowires. Estimating the surface recombination velocities clearly indicates a nonabrupt p-n junction, which is in essential agreement with the model of delayed dopant incorporation in the Au-assisted vapor-liquid-solid mechanism. Surface passivation using ammonium sulfide effectively reduces the surface recombination and thus leads to higher minority carrier diffusion lengths. © 2012 American Chemical Society
The structure of dilute combusting sprays
NASA Technical Reports Server (NTRS)
Shuen, J. S.; Solomon, A. S. P.; Faeth, F. M.
1985-01-01
An experimental and theoretical study of drop processes in a turbulent flame is described. The experiments involved a monodisperse (105 and 180 micro m initial diameter) stream of methanol drops injected at the base of a turbulent methane-fueled diffusion flame burning in still air. The following measurements were made: mean and fluctuating phase velocities, mean drop number flux, drop-size distributions and mean gas-phase temperatures. Measurements were compared with predictions of two separated flow models: (1) deterministic separated flow, where drop-turbulence interactions are ignored; and (2) stochastic separated flow, where drop-turbulence interactions are considered using random-walk computations. The stochastic separated flow analysis yielded best agreement with measurements, since it provides for turbulent dispersion of drops which was important for present test conditions (and probably for most combusting sprays as well). Distinguishing the presence or absence of envelope flames around the drops, however, was relatively unimportant for present test conditions, since the drops spent most of their lifetime in fuel-rich regions of the flow where this distinction is irrelevant.
Dehaeck, Sam; Rednikov, Alexey; Colinet, Pierre
2014-03-04
The local evaporation rate and interfacial temperature are two quintessential characteristics for the study of evaporating droplets. Here, it is shown how one can extract these quantities by measuring the vapor concentration field around the droplet with digital holographic interferometry. As a concrete example, an evaporating freely receding pending droplet of 3M Novec HFE-7000 is analyzed at ambient conditions. The measured vapor cloud is shown to deviate significantly from a pure-diffusion regime calculation, but it compares favorably to a new boundary-layer theory accounting for a buoyancy-induced convection in the gas and the influence upon it of a thermal Marangoni flow. By integration of the measured local evaporation rate over the interface, the global evaporation rate is obtained and validated by a side-view measurement of the droplet shape. Advective effects are found to boost the global evaporation rate by a factor of 4 as compared to the diffusion-limited theory.
Ben-David, Avishai; Embury, Janon F; Davidson, Charles E
2006-09-10
A comprehensive analytical radiative transfer model for isothermal aerosols and vapors for passive infrared remote sensing applications (ground-based and airborne sensors) has been developed. The theoretical model illustrates the qualitative difference between an aerosol cloud and a chemical vapor cloud. The model is based on two and two/four stream approximations and includes thermal emission-absorption by the aerosols; scattering of diffused sky radiances incident from all sides on the aerosols (downwelling, upwelling, left, and right); and scattering of aerosol thermal emission. The model uses moderate resolution transmittance ambient atmospheric radiances as boundary conditions and provides analytical expressions for the information on the aerosol cloud that is contained in remote sensing measurements by using thermal contrasts between the aerosols and diffused sky radiances. Simulated measurements of a ground-based sensor viewing Bacillus subtilis var. niger bioaerosols and kaolin aerosols are given and discussed to illustrate the differences between a vapor-only model (i.e., only emission-absorption effects) and a complete model that adds aerosol scattering effects.
Elemental Mercury Diffusion Processes and Concentration at the Lunar Poles
NASA Technical Reports Server (NTRS)
Moxley, Frederick; Killen, Rosemary M.; Hurley, Dana M.
2011-01-01
In 2009, the Lyman Alpha Mapping Project (LAMP) spectrograph onboard the Lunar Reconnaissance Orbiter (LRO) spacecraft made the first detection of element mercury (Hg) vapor in the lunar exosphere after the Lunar Crater Observing and Sensing Satellite (LCROSS) Centaur rocket impacted into the Cabeus crater in the southern polar region of the Moon. The lunar regolith core samples from the Apollo missions determined that Hg had a devolatilized pattern with a concentration gradient increasing with depth, in addition to a layered pattern suggesting multiple episodes of burial and volatile loss. Hg migration on the lunar surface resulted in cold trapping at the poles. We have modeled the rate at which indigenous Hg is lost from the regolith through diffusion out of lunar grains. We secondly modeled the migration of Hg vapor in the exosphere and estimated the rate of cold-trapping at the poles using a Monte Carlo technique. The Hg vapor may be lost from the exosphere via ionization, Jeans escape, or re-impact into the surface causing reabsorption.
Segmented nanowires displaying locally controllable properties
Sutter, Eli Anguelova; Sutter, Peter Werner
2013-03-05
Vapor-liquid-solid growth of nanowires is tailored to achieve complex one-dimensional material geometries using phase diagrams determined for nanoscale materials. Segmented one-dimensional nanowires having constant composition display locally variable electronic band structures that are determined by the diameter of the nanowires. The unique electrical and optical properties of the segmented nanowires are exploited to form electronic and optoelectronic devices. Using gold-germanium as a model system, in situ transmission electron microscopy establishes, for nanometer-sized Au--Ge alloy drops at the tips of Ge nanowires (NWs), the parts of the phase diagram that determine their temperature-dependent equilibrium composition. The nanoscale phase diagram is then used to determine the exchange of material between the NW and the drop. The phase diagram for the nanoscale drop deviates significantly from that of the bulk alloy.
The effect of environment on thermal barrier coating lifetime
Pint, Bruce A.; Unocic, Kinga A.; Haynes, James Allen
2016-03-15
While the water vapor content of the combustion gas in natural gas-fired land-based turbines is ~10%, it can be 20–85% with coal-derived (syngas or H 2) fuels or innovative turbine concepts for more efficient carbon capture. Additional concepts envisage working fluids with high CO 2 contents to facilitate carbon capture and sequestration. To investigate the effects of changes in the gas composition on thermal barrier coating (TBC) lifetime, furnace cycling tests (1-h and 100-h cycles) were performed in air with 10, 50, and 90 vol. % water vapor and CO 2-10% H 2O and compared to prior results in drymore » air or O 2. Two types of TBCs were investigated: (1) diffusion bond coatings (Pt-diffusion or Pt-modified aluminide) with commercial electron-beam physical vapor-deposited yttria-stabilized zirconia (YSZ) top coatings on second-generation superalloy N5 and N515 substrates and (2) high-velocity oxygen fuel (HVOF) sprayed MCrAlYHfSi bond coatings with air plasma-sprayed YSZ top coatings on superalloys X4, 1483, or 247 substrates. For both types of coatings exposed in 1-h cycles, the addition of water vapor resulted in a decrease in coating lifetime, except for Pt-diffusion coatings which were unaffected by the environment. In 100-h cycles, environment was less critical, perhaps because coating failure was chemical (i.e., due to interdiffusion) rather than mechanical. As a result, in both 1-h and 100-h cycles, CO 2 did not appear to have any negative effect on coating lifetime.« less
NASA Astrophysics Data System (ADS)
Mombrú, Dominique; Romero, Mariano; Faccio, Ricardo; Castiglioni, Jorge; Mombrú, Alvaro W.
2017-06-01
In situ preparation of polyaniline-ceramic nanocomposites has recently demonstrated that the electrical properties are highly improved with respect to the typical ex situ preparations. In this report, we present for the first time, to the best of our knowledge, the in situ growth of titanium oxide quantum dots in polyaniline host via water vapor flow diffusion as an easily adaptable route to prepare other ceramic-polymer nanocomposites. The main relevance of this method is the possibility to prepare ceramic quantum dots from alkoxide precursors using water vapor flow into any hydrophobic polymer host and to achieve good homogeneity and size-control. In addition, we perform full characterization by means of high-resolution transmission electron microscopy, X-ray powder diffraction, small angle X-ray scattering, thermogravimetric and calorimetric analyses, confocal Raman microscopy and impedance spectroscopy analyses. The presence of the polymer host and interparticle Coulomb repulsive interactions was evaluated as an influence for the formation of 3-8 nm equally-sized quantum dots independently of the concentration. The polyaniline polaron population showed an increase for the quantum dots diluted regime and the suppression at the concentrated regime, ascribed to the formation of chemical bonds at the interface, which was confirmed by theoretical simulations. In agreement with the previous observation, the in situ growth of ceramic quantum dots in polyaniline host via water vapor flow diffusion could be very useful as a novel approach to prepare electrode materials for energy conversion and storage applications.
ERIC Educational Resources Information Center
Dou, Remy; Hogan, DaNel; Kossover, Mark; Spuck, Timothy; Young, Sarah
2013-01-01
Diffusion has often been taught in science courses as one of the primary ways by which molecules travel, particularly within organisms. For years, classroom teachers have used the same common demonstrations to illustrate this concept (e.g., placing drops of food coloring in a beaker of water). Most of the time, the main contributor to the motion…
Liquid phase stabilization versus bubble formation at a nanoscale curved interface
NASA Astrophysics Data System (ADS)
Schiffbauer, Jarrod; Luo, Tengfei
2018-03-01
We investigate the nature of vapor bubble formation near a nanoscale-curved convex liquid-solid interface using two models: an equilibrium Gibbs model for homogenous nucleation, and a nonequilibrium dynamic van der Waals-diffuse-interface model for phase change in an initially cool liquid. Vapor bubble formation is shown to occur for sufficiently large radius of curvature and is suppressed for smaller radii. Solid-fluid interactions are accounted for and it is shown that liquid-vapor interfacial energy, and hence Laplace pressure, has limited influence over bubble formation. The dominant factor is the energetic cost of creating the solid-vapor interface from the existing solid-liquid interface, as demonstrated via both equilibrium and nonequilibrium arguments.
Fracture Development within the Karaha-Telaga Bodas Geothermal Field, Indonesia
Nemcok, M.; Moore, J.N.; Allis, R.; McCulloch, J.
2002-01-01
Karaha-Telaga Bodas is a partially vapor-dominated geothermal system located in an active volcano in western Java. More than 2 dozen geothermal wells have been drilled to depths of 3 km. Detailed paragenetic and fluid-inclusion studies have defined liquid-dominated, transitional and vapor-dominated stages in the evolution of this system. The liquid-dominated stage was initiated by shallow magma intrusion into the base of the volcanic cone. Lava and pyroclastic flows capped a geothermal system. The uppermost andesite flows were only weakly fractured due to the insulating effect of the intervening altered pyroclastics, which absorbed the deformation. Shear and tensile fractures were filled with carbonates at shallow depths and by quartz, epidote and actinolite at depths and temperatures over 1km and 300??C. The system underwent numerous local cycles of overpressuring, which are marked by subhorizontal tensile fractures, anastomosing tensile fractures and implosion breccias. The development of the liquid system was interrupted by a catastrophic drop in fluid pressures. As the fluids boiled in response to this pressure drop, chalcedony and quartz were deposited in fractures having the largest apertures and steep dips. The orientations of these fractures indicate that the escaping overpressured fluids used the shortest possible paths to the surface. Vapor-dominated conditions were initiated within a vertical chimney over the still hot intrusion. As pressures declined these conditions spread outward. Downward migration of the chimney occurred as the intrusion cooled and the brittle-ductile transition migrated to greater depths. Condensate that formed at the top of the vapor-dominated zone percolated downward and lowsalinity meteoric water entered the marginal parts of the system. Calcite, anhydrite, and fluorite precipitated in fractures upon heating. A progressive sealing of the fractures occurred, resulting in the downward migration of the cap rock. In response to decreasing pore pressures in the expanding vapor zone, the fracture system within the vapor-dominated reservoir progressively collapsed, leaving only residual permeability, with apertures supported by asperities or propping breccia. In places, the fractures have completely collapsed where normal stresses acting on the fracture walls exceeded the compressive strength of the wall rock.
Reaction layer formation at the graphite/copper-chromium alloy interface
NASA Technical Reports Server (NTRS)
Devincent, Sandra M.; Michal, Gary M.
1992-01-01
Sessile drop tests were used to obtain information about copper chromium alloys that suitably wet graphite. Characterization of graphite/copper-chromium alloy interfaces subjected to elevated temperatures were conducted using scanning electron micrography, energy dispersive spectroscopy, auger electron spectroscopy, and x ray diffraction analyses. These analyses indicate that during sessile drop tests conducted at 1130 C for one hour, copper alloys containing greater than 0.98 percent chromium form continuous reaction layers of approximately 10 micron thickness. The reaction layers adhere to the graphite surface. The copper wets the reaction layer to form a contact angle of 60 degrees or less. X ray diffraction results indicate that the reaction layer is chromium carbide. The kinetics of reaction layer formation were modelled in terms of bulk diffusion mechanisms. Reaction layer thickness is controlled initially by the diffusion of Cr out of Cu alloy and later by the diffusion of C through chromium carbide.
Reaction layer formation at the graphite/copper-chromium alloy interface
NASA Technical Reports Server (NTRS)
Devincent, Sandra M.; Michal, Gary M.
1993-01-01
Sessile drop tests were used to obtain information about copper chromium alloys that suitably wet graphite. Characterization of graphite/copper-chromium alloy interfaces subjected to elevated temperatures were conducted using scanning electron micrography, energy dispersive spectroscopy, Auger electron spectroscopy, and X-ray diffraction analyses. These analyses indicate that during sessile drop tests conducted at 1130 C for one hour, copper alloys containing greater than 0.98 percent chromium form continuous reaction layers of approximately 10 micron thickness. The reaction layers adhere to the graphite surface. The copper wets the reaction layer to form a contact angle of 60 degrees or less. X-ray diffraction results indicate that the reaction layer is chromium carbide. The kinetics of reaction layer formation were modelled in terms of bulk diffusion mechanisms. Reaction layer thickness is controlled initially by the diffusion of Cr out of Cu alloy and later by the diffusion of C through chromium carbide.
NASA Astrophysics Data System (ADS)
Shen, Binglin; Xu, Xingqi; Xia, Chunsheng; Pan, Bailiang
2017-11-01
Combining the kinetic and fluid dynamic processes in static and flowing-gas diode-pumped alkali vapor lasers, a comprehensive physical model with three cyclically iterative algorithms for simulating the three-dimensional pump and laser intensities as well as temperature distribution in the vapor cell of side-pumped alkali vapor lasers is established. Comparison with measurement of a static side-pumped cesium vapor laser with a diffuse type hollow cylinder cavity, and with classical and modified models is made. Influences of flowed velocity and pump power on laser power are calculated and analyzed. The results have demonstrated that for high-power side-pumped alkali vapor lasers, it is necessary to take into account the three-dimensional distributions of pump energy, laser energy and temperature in the cell to simultaneously obtain the thermal features and output characteristics. Therefore, the model can deepen the understanding of the complete kinetic and fluid dynamic mechanisms of a side-pumped alkali vapor laser, and help with its further experimental design.
NASA Technical Reports Server (NTRS)
King, E. A.
1983-01-01
The major chemical differences between fluid drop chondrules and their probable parent materials may have resulted from the loss of volatiles such as S, H2O, Fe, and volatile siderophile elements by partial evaporation during the chondrule-forming process. Vertical access solar furnace experiments in vacuum and hydrogen have demonstrated such chemical fractionation trends using standard rock samples. The formation of immiscible iron droplets and spherules by in situ reduction of iron from silicate melt and the subsequent evaporation of the iron have been observed directly. During the time that the main sample bead is molten, many small spatter spherules are thrown off the main bead, thereby producing many additional chondrule-like melt spherules that cool rapidly and generate a population of spherules with size frequency distribution characteristics that closely approximate some populations of fluid drop chondrules in chondrites. It is possible that spatter-produced fluid drop chondrules dominate the meteoritic fluid drop chondrule populations. Such meteoritic chondrule populations should be chemically related by various relative amounts of iron and other volatile loss by vapor fractionation.
Development of vapor phase hydrogen peroxide sterilization process for spacecraft applications
NASA Technical Reports Server (NTRS)
Rohatgi, N.; Schubert, W.; Knight, J.; Quigley, M.; Forsberg, G.; Ganapathi, G.; Yarbrough, C.; Koukol, R.
2001-01-01
This paper will present test data and discussion on the work we are conducting at JPL to address the following issues: 1) efficacy of sterilization process; 2) diffusion of hydrogen peroxide under sterilization process conditions into hard to reach places; 3) materials and components compatibility with the sterilization process and 4) development of methodology to protect sensitive components from hydrogen peroxide vapor.
MODELING COMPARATIVE THERMAL PERFORMANCE OF LIGHTWEIGHT FABRICS USING A COMPUTATIONAL DESIGN TOOL
2017-04-14
lost through clothing = ( T / Rc ) + ( pv / Ret ) (5) T = temperature difference between skin and environment (°C) Rc...thermal resistance (m²-°C/Watt) pv = vapor pressure difference between skin and environment (Pa) Ret = water vapor diffusion resistance (m²-Pa/Watt...clothing, and the external environment (wind, temperature, humidity, solar radiation). Activity: Stationary Anatomic Build: Newton, Fine
The role of moisture on combustion of pyrolysis gases in wildland fires
Selina C. Ferguson; Ambarish Dahale; Babak Shotorban; S. Mahalingam; David R. Weise
2013-01-01
The role of water vapor, originated from the moisture content in vegetation, on the combustion process was investigated via simulating an opposed diffusion flame and a laminar premixed flame with pyrolysis gases as the fuel and air as the oxidizer. The fuel was mixed with water vapor, and the simulation was repeated for various water mole fractions. In both of the...
Decontamination of chemical tracers in droplets by a submerging thin film flow
NASA Astrophysics Data System (ADS)
Landel, Julien R.; McEvoy, Harry; Dalziel, Stuart B.
2016-11-01
We investigate the decontamination of chemical tracers contained in small viscous drops by a submerging falling film. This problem has applications in the decontamination of hazardous chemicals, following accidental releases or terrorist attacks. Toxic droplets lying on surfaces are cleaned by spraying a liquid decontaminant over the surface. The decontaminant film submerges the droplets, without detaching them, in order to neutralize toxic chemicals in the droplets. The decontamination process is controlled by advection, diffusion and reaction processes near the drop-film interface. Chemical tracers dissolve into the film flow forming a thin diffusive boundary layer at the interface. The chemical tracers are then neutralized through a reaction with a chemical decontaminant transported in the film. We assume in this work that the decontamination process occurs mainly in the film phase owing to low solubility of the decontaminant in the drop phase. We analyze the impact of the reaction time scale, assuming first-order reaction, in relation with the characteristic advection and diffusion time scales in the case of a single droplet. Using theoretical, numerical and experimental means, we find that the reaction time scale need to be significantly smaller than the characteristic time scale in the diffusive boundary layer in order to enhance noticeably the decontamination of a single toxic droplet. We discuss these results in the more general case of the decontamination of a large number of droplets. This material is based upon work supported by the Defense Threat Reduction Agency under Contract No. HDTRA1-12-D-0003-0001.
Nonlinear Chemical Dynamics and Synchronization
NASA Astrophysics Data System (ADS)
Li, Ning
Alan Turing's work on morphogenesis, more than half a century ago, continues to motivate and inspire theoretical and experimental biologists even today. That said, there are very few experimental systems for which Turing's theory is applicable. In this thesis we present an experimental reaction-diffusion system ideally suited for testing Turing's ideas in synthetic "cells" consisting of microfluidically produced surfactant-stabilized emulsions in which droplets containing the Belousov-Zhabotinsky (BZ) oscillatory chemical reactants are dispersed in oil. The BZ reaction has become the prototype of nonlinear dynamics in chemistry and a preferred system for exploring the behavior of coupled nonlinear oscillators. Our system consists of a surfactant stabilized monodisperse emulsion of drops of aqueous BZ solution dispersed in a continuous phase of oil. In contrast to biology, here the chemistry is understood, rate constants are measured and interdrop coupling is purely diffusive. We explore a large set of parameters through control of rate constants, drop size, spacing, and spatial arrangement of the drops in lines and rings in one-dimension (1D) and hexagonal arrays in two-dimensions (2D). The Turing model is regarded as a metaphor for morphogenesis in biology but not for prediction. Here, we develop a quantitative and falsifiable reaction-diffusion model that we experimentally test with synthetic cells. We quantitatively establish the extent to which the Turing model in 1D describes both stationary pattern formation and temporal synchronization of chemical oscillators via reaction-diffusion and in 2D demonstrate that chemical morphogenesis drives physical differentiation in synthetic cells.
Simpson, Andrew T
2003-11-01
The measurement of oil mist derived from metalworking fluids formulated with light mineral oils can be highly inaccurate when using traditional filter sampling. This is due to evaporation of oil from the filter. In this work the practicability of an alternative approach measuring total oil mist and vapor was investigated. Combinations of inhalable particle samplers with backup sorbent vapor traps and standard vapor sampling on pumped and diffusive sorbent tubes were evaluated with gravimetric, infrared spectroscopic, and gas chromatographic analytical methods against the performance requirements of European Standard EN 482. An artificial aerosol was used to compare the methods against a reference method of filter sampler in series with three impingers. Multi-orifice samplers were used with standard 8-mm diameter charcoal tubes at 2 L/min without any signs of channelling or significant breakthrough, as were conical inhalable samplers with XAD-2 tubes at 1 L/min. Most combinations of samplers had a bias of less than 3 percent, but solitary pumped charcoal tubes underestimated total oil by 13 percent. Diffusive sampling was affected by impaction of mist particles and condensation of oil vapor. Gravimetric analysis of filters revealed significant potential sample loss during storage, with 4 percent being lost after one day when stored at room temperature and 2 percent when refrigerated. Samples left overnight in the balance room to equilibrate lost 24 percent. Infrared spectroscopy gave more precise results for vapor than gas chromatography (p = 0.002). Gas chromatography was less susceptible to bias from contaminating solvent vapors than infrared spectroscopy, but was still vulnerable to petroleum distillates. Under the specific test conditions (one oil type and mist particle size), all combinations of methods examined complied with the requirements of European Standard EN 484. Total airborne oil can be measured accurately; however, care must be taken to avoid contamination by hydrocarbon solvent vapors during sampling.
Chen, Yinshan; Zhu, Men; Laventure, Audrey; ...
2017-06-26
Surface grating decay measurements have been performed on three closely related molecular glasses to study the effect of intermolecular hydrogen bonds on surface diffusion. The three molecules are derivatives of bis(3,5-dimethyl-phenylamino)-1,3,5-triazine and differ only in the functional group R at the 2-position, with R being C 2H 5, OCH 3, and NHCH 3, and referred to as “Et”, “OMe”, and “NHMe”, respectively. Of the three molecules, NHMe forms more extensive intermolecular hydrogen bonds than Et and OMe and was found to have slower surface diffusion. For Et and OMe, surface diffusion is so fast that it replaces viscous flow asmore » the mechanism of surface grating decay as temperature is lowered. In contrast, no such transition was observed for NHMe under the same conditions, indicating significantly slower surface diffusion. This result is consistent with the previous finding that extensive intermolecular hydrogen bonds slow down surface diffusion in molecular glasses and is attributed to the persistence of hydrogen bonds even in the surface environment. Here, this result is also consistent with the lower stability of the vapor-deposited glass of NHMe relative to those of Et and OMe and supports the view that surface mobility controls the stability of vapor-deposited glasses.« less
Crystallization of Membrane Proteins by Vapor Diffusion
Delmar, Jared A.; Bolla, Jani Reddy; Su, Chih-Chia; Yu, Edward W.
2016-01-01
X-ray crystallography remains the most robust method to determine protein structure at the atomic level. However, the bottlenecks of protein expression and purification often discourage further study. In this chapter, we address the most common problems encountered at these stages. Based on our experiences in expressing and purifying antimicrobial efflux proteins, we explain how a pure and homogenous protein sample can be successfully crystallized by the vapor diffusion method. We present our current protocols and methodologies for this technique. Case studies show step-by-step how we have overcome problems related to expression and diffraction, eventually producing high quality membrane protein crystals for structural determinations. It is our hope that a rational approach can be made of the often anecdotal process of membrane protein crystallization. PMID:25950974
1994-02-16
These Vapor Diffusion Apparatus (VDA) trays were first flown in the Thermal Enclosure System (TES) during the USMP-2 (STS-62) mission. Each tray can hold 20 protein crystal growth chambers. Each chamber contains a double-barrel syringe; one barrel holds protein crystal solution and the other holds precipitant agent solution. During the microgravity mission, a torque device is used to simultaneously retract the plugs in all 20 syringes. The two solutions in each chamber are then mixed. After mixing, droplets of the combined solutions are moved onto the syringe tips so vapor diffusion can begin. During the length of the mission, protein crystals are grown in the droplets. Shortly before the Shuttle's return to Earth, the experiment is deactivated by retracting the droplets containing protein crystals, back into the syringes.
Simultaneous infrared and UV-visible absorption spectra of matrix-isolated carbon vapor
NASA Technical Reports Server (NTRS)
Kurtz, Joe; Huffman, Donald R.
1989-01-01
Carbon molecules were suggested as possible carriers of the diffuse interstellar bands. In particular, it was proposed that the 443 nm diffuse interstellar band is due to the same molecule which gives rise to the 447 nm absorption feature in argon matrix-isolated carbon vapor. If so, then an associated C-C stretching mode should be seen in the IR. By doing spectroscopy in both the IR and UV-visible regions on the same sample, the present work provides evidence for correlating UV-visible absorption features with those found in the IR. Early data indicates no correlation between the strongest IR feature (1997/cm) and the 447 nm band. Correlation with weaker IR features is being investigated.
NASA Technical Reports Server (NTRS)
Brock, T. W.; Field, M. B.
1979-01-01
Low-melting phosphate and borate glasses were screen printed on silicon wafers and heated to form n and p junctions. Data on surface appearance, sheet resistance and junction depth are presented. Similar data are reported for vapor phase transport from sintered aluminum metaphosphate and boron-containing glass-ceramic solid sources. Simultaneous diffusion of an N(+) layer with screen-printed glass and a p(+) layer with screen-printed Al alloy paste was attempted. No p(+) back surface field formation was achieved. Some good cells were produced but the heating in an endless-belt furnace caused a large scatter in sheet resistance and junction depth for three separate lots of wafers.
Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin, Lei; Zhu, De-Yu; Yang, Na
2005-04-01
The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.
Taming Self-Organization Dynamics to Dramatically Control Porous Architectures.
Daly, Ronan; Sader, John E; Boland, John J
2016-03-22
We demonstrate templating of functional materials with unexpected and intricate micro- and nanostructures by controlling the condensation, packing, and evaporation of water droplets on a polymer solution. Spontaneous evaporation of a polymer solution induces cooling of the liquid surface and water microdroplet condensation from the ambient vapor. These droplets pack together and act as a template to imprint an entangled polymer film. This breath figure (BF) phenomenon is an example of self-organization that involves the long-range ordering of droplets. Equilibrium-based analysis provides many insights into contact angles and drop stability of individual drops, but the BF phenomenon remains poorly understood thus far, preventing translation to real applications. Here we investigate the dynamics of this phenomenon to separate out the competing influences and then introduce a modulation scheme to ultimately manipulate the water vapor-liquid equilibrium independently from the solvent evaporation. This approach to BF control provides insights into the mechanism, a rationale for microstructure design, and evidence for the benefits of dynamical control of self-organization systems. We finally present dramatically different porous architectures from this approach reminiscent of microscale Petri dishes, conical flasks, and test tubes.
Water-assisted growth of graphene-carbon nanotube hybrids in plasma
NASA Astrophysics Data System (ADS)
Tewari, Aarti; Ghosh, Santanu; Srivastava, Pankaj
2018-04-01
The enhanced growth of graphene-carbon nanotube (CNT) hybrids in a hydrocarbon and hydrogen plasma assisted by water is numerically formulated. The catalyst activity and agglomeration of catalyst particles are the rate determining factors in the growth of hybrids and their constituents, i.e., the CNT and graphene. The water vapor concentration is varied to investigate its effect on the growth process. The enhanced catalyst activity on account of oxidation by hydroxyl ions of water to impede the agglomeration of catalyst particles and the removal of amorphous carbon through etching by hydrogen ions of water are seen to be the main driving forces behind the many fold increase in the dimensions of constituent nanostructures and the hybrids with water vapor concentration. Importantly, beyond a certain specific water vapor concentration, the growth rates dropped due to active oxidation of the catalyst particle.
Soft beams: When capillarity induces axial compression
NASA Astrophysics Data System (ADS)
Neukirch, S.; Antkowiak, A.; Marigo, J.-J.
2014-01-01
We study the interaction of an elastic beam with a liquid drop in the case where bending and extensional effects are both present. We use a variational approach to derive equilibrium equations and constitutive relation for the beam. This relation is shown to include a term due to surface energy in addition to the classical Young's modulus term, leading to a modification of Hooke's law. At the triple point where solid, liquid, and vapor phases meet, we find that the external force applied on the beam is parallel to the liquid-vapor interface. Moreover, in the case where solid-vapor and solid-liquid interface energies do not depend on the extension state of the beam, we show that the extension in the beam is continuous at the triple point and that the wetting angle satisfies the classical Young-Dupré relation.
Soft beams: when capillarity induces axial compression.
Neukirch, S; Antkowiak, A; Marigo, J-J
2014-01-01
We study the interaction of an elastic beam with a liquid drop in the case where bending and extensional effects are both present. We use a variational approach to derive equilibrium equations and constitutive relation for the beam. This relation is shown to include a term due to surface energy in addition to the classical Young's modulus term, leading to a modification of Hooke's law. At the triple point where solid, liquid, and vapor phases meet, we find that the external force applied on the beam is parallel to the liquid-vapor interface. Moreover, in the case where solid-vapor and solid-liquid interface energies do not depend on the extension state of the beam, we show that the extension in the beam is continuous at the triple point and that the wetting angle satisfies the classical Young-Dupré relation.
Assessment of Mitigation Systems on Vapor Intrusion ...
Vapor intrusion is the migration of subsurface vapors, including radon and volatile organic compounds (VOCs), in soil gas from the subsurface to indoor air. Vapor intrusion happens because there are pressure and concentration differentials between indoor air and soil gas. Indoor environments are often negatively pressurized with respect to outdoor air and soil gas (for example, from exhaust fans or the stack effect), and this pressure difference allows soil gas containing subsurface vapors to flow into indoor air through advection. In addition, concentration differentials cause VOCs and radon to migrate from areas of higher to lower concentrations through diffusion, which is another cause of vapor intrusion. Current practice for evaluating the vapor intrusion pathway involves a multiple line of evidence approach based on direct measurements in groundwater, external soil gas, subslab soil gas, and/or indoor air. No single line of evidence is considered definitive, and direct measurements of vapor intrusion can be costly, especially where significant spatial and temporal variability require repeated measurements at multiple locations to accurately assess the chronic risks of long-term exposure to volatile organic compounds (VOCs) like chloroform, perchloroethylene (PCE), and trichloroethylene (TCE).
Are there sex differences in the capillary blood volume and diffusing capacity response to exercise?
Bouwsema, Melissa M; Tedjasaputra, Vincent; Stickland, Michael K
2017-03-01
Previous work suggests that women may exhibit a greater respiratory limitation in exercise compared with height-matched men. Diffusion capacity (Dl CO ) increases with incremental exercise, and the smaller lungs of women may limit membrane diffusing capacity (Dm) and pulmonary capillary blood volume (Vc) in response to the increased oxygen demand. We hypothesized that women would have lower Dl CO , Dl CO relative to cardiac output (Dl CO /Q̇), Dm, Vc, and pulmonary transit time, secondary to lower Vc at peak exercise. Sixteen women (112 ± 12% predicted relative V̇o 2peak ) and sixteen men (118 ± 22% predicted relative V̇o 2peak ) were matched for height and weight. Hemoglobin-corrected diffusing capacity (Dl CO ), Vc, and Dm were determined via the multiple-[Formula: see text] Dl CO technique at rest and during incremental exercise up to 90% of V̇o 2peak Both groups increased Dl CO , Vc, and Dm with exercise intensity, but women had 20% lower Dl CO ( P < 0.001), 18% lower Vc ( P = 0.002), and 22% lower Dm ( P < 0.001) compared with men across all workloads, and neither group exhibited a plateau in Vc. When expressed relative to alveolar volume (Va), the between-sex difference was eliminated. The drop in Dl CO /Q̇ was proportionally less in women than men, and mean pulmonary transit time did not drop below 0.3 s in either group. Women demonstrate consistently lower Dl CO , Vc, and Dm compared with height-matched men during exercise; however, these differences disappear with correction for lung size. These results suggest that after differences in lung volume are accounted for there is no intrinsic sex difference in the Dl CO , Vc, or Dm response to exercise. NEW & NOTEWORTHY Women demonstrate lower diffusing capacity-to-cardiac output ratio (Dl CO /Q̇), pulmonary capillary blood volume (Vc), and membrane diffusing capacity (Dm) compared with height-matched men during exercise. However, these differences disappear after correction for lung size. The drop in Dl CO /Q̇ was proportionally less in women, and pulmonary transit time did not drop below 0.3 s in either group. After differences in lung volume are accounted for, there is no intrinsic sex difference in Dl CO , Vc, or Dm response to exercise. Copyright © 2017 the American Physiological Society.
Savoie, Jennifer G.; Lyford, Forest P.; Clifford, Scott
1999-01-01
In March and April 1998, a network of water-to-vapor diffusion samplers was installed along the Cochato River at the Baird & McGuire Superfund Site in Holbrook, Massachusetts, where a plume of volatile organic compounds (VOCs) is present in ground water. The purpose of installing the sampler network was to determine if VOCs were present in river-bottom sediments while a ground-water extraction system was operating and after the system had been shut down for two weeks. Water-to-water diffusion samplers placed at selected locations provided supplemental information about concentrations of VOCs in pore water in the river-bottom sediments. Water levels in piezometers and river stage were measured concurrently to determine if ground water was discharging to the river. Benzene, toluene, ethylbenzene and xylenes (BTEX compounds) were detected in water-tovapor and water-to-water diffusion samplers located in the area where the plume is known to pass beneath the river for both pumping and nonpumping conditions. Concentrations of total BTEX compounds in water-to-vapor diffusion samplers ranged from non-detect upriver and downriver from the plume area to greater than 200 parts per million by volume in the plume area. Concentrations of total BTEX compounds were not significantly different for pumping than for non-pumping conditions. Concentrations of total BTEX compounds in water-to-water diffusion samplers ranged from non-detect to 680 micrograms per liter. The limited number of water-to-water diffusion samplers did not indicate that concentrations were higher for pumping or non-pumping conditions. Trichloroethylene and tetrachloroethylene also were detected in water-to-vapor diffusion samplers downriver from the area where the BTEX compounds were detected. Water levels in four piezometers were consistently higher than the river stage, indicating an upward hydraulic gradient and ground-water discharge to the river. The concentrations of VOCs in riverbottom sediments and the upward hydraulic gradients observed indicate that contaminants from the Baird & McGuire ground-water plume were discharging to the Cochato River during the study period for both pumping and non-pumping conditions.
A three-dimensional phase field model for nanowire growth by the vapor-liquid-solid mechanism
NASA Astrophysics Data System (ADS)
Wang, Yanming; Ryu, Seunghwa; McIntyre, Paul C.; Cai, Wei
2014-07-01
We present a three-dimensional multi-phase field model for catalyzed nanowire (NW) growth by the vapor-liquid-solid (VLS) mechanism. The equation of motion contains both a Ginzburg-Landau term for deposition and a diffusion (Cahn-Hilliard) term for interface relaxation without deposition. Direct deposition from vapor to solid, which competes with NW crystal growth through the molten catalyst droplet, is suppressed by assigning a very small kinetic coefficient at the solid-vapor interface. The thermodynamic self-consistency of the model is demonstrated by its ability to reproduce the equilibrium contact angles at the VLS junction. The incorporation of orientation dependent gradient energy leads to faceting of the solid-liquid and solid-vapor interfaces. The model successfully captures the curved shape of the NW base and the Gibbs-Thomson effect on growth velocity.
NASA Astrophysics Data System (ADS)
Wang, Min; Fang, Xin; Hu, Shunxing; Hu, Huanling; Li, Tao; Dou, Xiankang
2015-10-01
Observations of monthly and seasonal nightly water vapor variations over Hefei utilizing L625 lidar water vapor data observed from 2000 to 2008 is the focus of this study. The experimental setup and main parameters of the L625 lidar for water vapor measurement are first presented, then the measurement principle of water vapor and data processing methods are introduced. The water vapor measurement precision of the lidar system was analyzed by comparison with radiosonde. Monthly and seasonal water vapor profiles were built by analyzing 2000-2008 lidar data. In the vertical direction, results show that water vapor content decreases gradually with height. The more the water vapor content in the low atmosphere, the faster the decay rate with altitude. As far as monthly variation, the water vapor content first increases and then decreases with month. The maximum content of water vapor appears in July, at mixing ratio of 15.6 g/kg at 1 km. The seasonal variability of water vapor content is rather obvious. In summer the water vapor mixing ratio reaches up to 15.0 g/kg at 1 km, and in winter it is only 3.9 g/kg at the same altitude. Interannual variation of water vapor content differs between seasons (as revealed in the standard deviation of data) where summer is least stable and autumn is the most stable. Precipitable water vapor is calculated from water vapor mean profiles at 1-4 km and the relationship between precipitable water vapor and precipitation is also investigated. A clear positive correlation is found with Pearson correlation coefficients (R) 0.933 between monthly precipitation and mean precipitable water vapor, as well a clear positive correlation between seasonal precipitation and seasonal mean precipitable water vapor (R = 0.988). Precipitation conversion efficiency (PCE) is calculated from precipitation and precipitable water vapor. The monthly PCE reaches its maximum in October at 25.8%, and drops to its minimum in January at 11.5%. Seasonal PCE's minimum is 15.2% in autumn and 23.7% in winter, at maximum.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Yinshan; Zhu, Men; Laventure, Audrey
Surface grating decay measurements have been performed on three closely related molecular glasses to study the effect of intermolecular hydrogen bonds on surface diffusion. The three molecules are derivatives of bis(3,5-dimethyl-phenylamino)-1,3,5-triazine and differ only in the functional group R at the 2-position, with R being C 2H 5, OCH 3, and NHCH 3, and referred to as “Et”, “OMe”, and “NHMe”, respectively. Of the three molecules, NHMe forms more extensive intermolecular hydrogen bonds than Et and OMe and was found to have slower surface diffusion. For Et and OMe, surface diffusion is so fast that it replaces viscous flow asmore » the mechanism of surface grating decay as temperature is lowered. In contrast, no such transition was observed for NHMe under the same conditions, indicating significantly slower surface diffusion. This result is consistent with the previous finding that extensive intermolecular hydrogen bonds slow down surface diffusion in molecular glasses and is attributed to the persistence of hydrogen bonds even in the surface environment. Here, this result is also consistent with the lower stability of the vapor-deposited glass of NHMe relative to those of Et and OMe and supports the view that surface mobility controls the stability of vapor-deposited glasses.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ranjan, Devesh
Diffusion bonded heat exchangers are the leading candidates for the sCO 2 Brayton cycles in next generation nuclear power plants. Commercially available diffusion bonded heat exchangers utilize set of continuous semi-circular zigzag micro channels to increase the heat transfer area and enhance heat transfer through increased turbulence production. Such heat exchangers can lead to excessive pressure drop as well as flow maldistribution in the case of poorly designed flow distribution headers. The goal of the current project is to fabricate and test potential discontinuous fin patterns for diffusion bonded heat exchangers; which can achieve desired thermal performance at lower pressuremore » drops. Prototypic discontinuous offset rectangular and Airfoil fin surface geometries were chemically etched on to 316 stainless steel plate and sealed against an un-etched flat pate using O-ring seal emulating diffusion bonded heat exchangers. Thermal-hydraulic performance of these prototypic discontinuous fin geometries was experimentally evaluated and compared to the existing data for the continuous zigzag channels. The data generated from this project will serve as the database for future testing and validation of numerical models.« less
The Observed Properties of Liquid Helium at the Saturated Vapor Pressure
NASA Astrophysics Data System (ADS)
Donnelly, Russell J.; Barenghi, Carlo F.
1998-11-01
The equilibrium and transport properties of liquid 4He are deduced from experimental observations at the saturated vapor pressure. In each case, the bibliography lists all known measurements. Quantities reported here include density, thermal expansion coefficient, dielectric constant, superfluid and normal fluid densities, first, second, third, and fourth sound velocities, specific heat, enthalpy, entropy, surface tension, ion mobilities, mutual friction, viscosity and kinematic viscosity, dispersion curve, structure factor, thermal conductivity, latent heat, saturated vapor pressure, thermal diffusivity and Prandtl number of helium I, and displacement length and vortex core parameter in helium II.
Phase transformations during the growth of paracetamol crystals from the vapor phase
NASA Astrophysics Data System (ADS)
Belyaev, A. P.; Rubets, V. P.; Antipov, V. V.; Bordei, N. S.
2014-07-01
Phase transformations during the growth of paracetamol crystals from the vapor phase are studied by differential scanning calorimetry. It is found that the vapor-crystal phase transition is actually a superposition of two phase transitions: a first-order phase transition with variable density and a second-order phase transition with variable ordering. The latter, being a diffuse phase transition, results in the formation of a new, "pretransition," phase irreversibly spent in the course of the transition, which ends in the appearance of orthorhombic crystals. X-ray diffraction data and micrograph are presented.
LOX/Hydrogen Coaxial Injector Atomization Test Program
NASA Technical Reports Server (NTRS)
Zaller, M.
1990-01-01
Quantitative information about the atomization of injector sprays is needed to improve the accuracy of computational models that predict the performance and stability margin of liquid propellant rocket engines. To obtain this data, a facility for the study of spray atomization is being established at NASA-Lewis to determine the drop size and velocity distributions occurring in vaporizing liquid sprays at supercritical pressures. Hardware configuration and test conditions are selected to make the cold flow simulant testing correspond as closely as possible to conditions in liquid oxygen (LOX)/gaseous H2 rocket engines. Drop size correlations from the literature, developed for liquid/gas coaxial injector geometries, are used to make drop size predictions for LOX/H2 coaxial injectors. The mean drop size predictions for a single element coaxial injector range from 0.1 to 2000 microns, emphasizing the need for additional studies of the atomization process in LOX/H2 engines. Selection of cold flow simulants, measured techniques, and hardware for LOX/H2 atomization simulations are discussed.
Properties of liquid Ti alloys from electrostatic levitation experiments and simulation
NASA Astrophysics Data System (ADS)
Novak, Brian; Raush, Jonathan; Zhang, Xiaoman; Moldovan, Dorel; Meng, Wenjin; Guo, Shengmin
Accurate thermophysical property data for liquid metals and alloys are important for the development of realistic simulations of laser-based 3D printing processes. We are using the container-less electrostatic levitation (ESL) method, molecular simulation, and CALPHAD calculations to obtain such data for Ti alloys. We performed vacuum ESL measurements of viscosity and surface tension with an oscillating drop technique at NASA MSFC on molten elemental Ti, Ti-xAl binaries (x = 0-10 wt%), Ti-6Al-4V, and Ti-6Al-4V-10Mo which showed improved mechanical properties compared with traditional β Ti alloys. We also used classical molecular simulations to obtain viscosities and surface tensions for Ti-xAl. Pair distribution functions, diffusivities, and vapor pressures were also obtained from simulations. The simulated viscosities and surface tensions for pure Ti agree well with the ESL data while the Ti-xAl viscosities have the same trends as the ESL data, but not quantitative agreement. Chemical activity and Gibbs free energy of Ti-10Al were generated using the CALPHAD technique and compared to experimental values. Supported by the National Science Foundation through cooperative agreement OIA-1541079 and the Louisiana Board of Regents.
Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Balasubramanian, Moovarkumudalvan; Ponnuswamy, Mondikalipudur Nanjappa Gounder
2009-01-01
Hemoglobin is a vital protein present in almost all higher species. It is a transport protein involved in carrying oxygen from lungs to tissues and carbon dioxide back to lungs by an intrinsically coordinated manner. Even though a good amount of work has been carried out in this direction there exists scarcity of structural insight on low oxygen affinity species. Attempts are being made to unravel the structural insight of this low oxygen affinity species. Goat blood plasma was collected, treated with EDTA to avoid blood clotting and purification was accomplished using DEAE-anion chromatographic column. The goat hemoglobin was crystallized using 50mM of phosphate buffer at pH 6.7 with 1M NaCl and PEG 3350 as precipitant by hanging drop vapor diffusion method. Crystals obtained are screened and suitable crystals are taken for data collection using mar345dtb as image plate detector system. Goat hemoglobin crystal diffracted up to 2.61 A resolution. Goat hemoglobin crystallizes in orthorhombic space group P212(1)2(1) as a whole biological molecule in the asymmetric unit with cell dimensions a=53.568A, b=67.365A, c=154.183A.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baig, M.; Brown, A.; Eswaramoorthy, S.
Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) atmore » Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.« less
Intergranular diffusion and embrittlement of a Ni-16Mo-7Cr alloy in Te vapor environment
NASA Astrophysics Data System (ADS)
Cheng, Hongwei; Li, Zhijun; Leng, Bin; Zhang, Wenzhu; Han, Fenfen; Jia, Yanyan; Zhou, Xingtai
2015-12-01
Nickel and some nickel-base alloys are extremely sensitive to intergranular embrittlement and tellurium (Te) enhanced cracking, which should be concerned during their serving in molten salt reactors. Here, a systematic study about the effects of its temperature on the reaction products at its surface, the intergranular diffusion of Te in its body and its embrittlement for a Ni-16Mo-7Cr alloy contacting Te is reported. For exposed to Te vapor at high temperature (823-1073 K), the reaction products formed on the surface of the alloy were Ni3Te2, CrTe, and MoTe2, and the most serious embrittlement was observed at 1073 K. The kinetic measurement in terms of Te penetration depth in the alloy samples gives an activation energy of 204 kJ/mol. Electron probe microanalysis confirmed the local enrichment of Te at grain boundaries. And clearly, the embrittlement was results from the intergranular diffusion and segregation of element Te.
NASA Astrophysics Data System (ADS)
Jacobs, K.; Bugge, F.; Butzke, G.; Lehmann, L.; Schimko, R.
1988-11-01
Metal-organic vapor phase epitaxy was used to grow stripe heterolaser diodes that were hitherto fabricated by liquid phase epitaxy. The main relationships between the growth parameters (partial input pressures, temperatures) and the properties of materials (thicknesses, solid-solution compositions, carrier densities) were investigated. The results were in full agreement with the mechanism of growth controlled by a vapor-phase diffusion. The results achieved routinely in the growth of GaAs are reported. It is shown that double heterostructure laser diodes fabricated by metal-organic vapor phase epitaxy compete favorably with those grown so far by liquid phase epitaxy, including their degradation and reliability.
Bacterial chemotaxis along vapor-phase gradients of naphthalene.
Hanzel, Joanna; Harms, Hauke; Wick, Lukas Y
2010-12-15
The role of bacterial growth and translocation for the bioremediation of organic contaminants in the vadose zone is poorly understood. Whereas air-filled pores restrict the mobility of bacteria, diffusion of volatile organic compounds in air is more efficient than in water. Past research, however, has focused on chemotactic swimming of bacteria along gradients of water-dissolved chemicals. In this study we tested if and to what extent Pseudomonas putida PpG7 (NAH7) chemotactically reacts to vapor-phase gradients forming above their swimming medium by the volatilization from a spot source of solid naphthalene. The development of an aqueous naphthalene gradient by air-water partitioning was largely suppressed by means of activated carbon in the agar. Surprisingly, strain PpG7 was repelled by vapor-phase naphthalene although the steady state gaseous concentrations were 50-100 times lower than the aqueous concentrations that result in positive chemotaxis of the same strain. It is thus assumed that the efficient gas-phase diffusion resulting in a steady, and possibly toxic, naphthalene flux to the cells controlled the chemotactic reaction rather than the concentration to which the cells were exposed. To our knowledge this is the first demonstration of apparent chemotactic behavior of bacteria in response to vapor-phase effector gradients.
Two-phase heat transfer and pressure drop of LNG during saturated flow boiling in a horizontal tube
NASA Astrophysics Data System (ADS)
Chen, Dongsheng; Shi, Yumei
2013-12-01
Two-phase heat transfer and pressure drop of LNG (liquefied natural gas) have been measured in a horizontal smooth tube with an inner diameter of 8 mm. The experiments were conducted at inlet pressures from 0.3 to 0.7 MPa with a heat flux of 8-36 kW m-2, and mass flux of 49.2-201.8 kg m-2 s-1. The effect of vapor quality, inlet pressure, heat flux and mass flux on the heat transfer characteristic are discussed. The comparisons of the experimental data with the predicted value by existing correlations are analyzed. Zou et al. (2010) correlation shows the best accuracy with 24.1% RMS deviation among them. Moreover four frictional pressure drop methods are also chosen to compare with the experimental database.
Stable and metastable nanowires displaying locally controllable properties
Sutter, Eli Anguelova; Sutter, Peter Werner
2014-11-18
Vapor-liquid-solid growth of nanowires is tailored to achieve complex one-dimensional material geometries using phase diagrams determined for nanoscale materials. Segmented one-dimensional nanowires having constant composition display locally variable electronic band structures that are determined by the diameter of the nanowires. The unique electrical and optical properties of the segmented nanowires are exploited to form electronic and optoelectronic devices. Using gold-germanium as a model system, in situ transmission electron microscopy establishes, for nanometer-sized Au--Ge alloy drops at the tips of Ge nanowires (NWs), the parts of the phase diagram that determine their temperature-dependent equilibrium composition. The nanoscale phase diagram is then used to determine the exchange of material between the NW and the drop. The phase diagram for the nanoscale drop deviates significantly from that of the bulk alloy.
Flow condensation on copper-based nanotextured superhydrophobic surfaces.
Torresin, Daniele; Tiwari, Manish K; Del Col, Davide; Poulikakos, Dimos
2013-01-15
Superhydrophobic surfaces have shown excellent ability to promote dropwise condensation with high droplet mobility, leading to enhanced surface thermal transport. To date, however, it is unclear how superhydrophobic surfaces would perform under the stringent flow condensation conditions of saturated vapor at high temperature, which can affect superhydrophobicity. Here, we investigate this issue employing "all-copper" superhydrophobic surfaces with controlled nanostructuring for minimal thermal resistance. Flow condensation tests performed with saturated vapor at a high temperature (110 °C) showed the condensing drops penetrate the surface texture (i.e., attain the Wenzel state with lower droplet mobility). At the same time, the vapor shear helped ameliorate the mobility and enhanced the thermal transport. At the high end of the examined vapor velocity range, a heat flux of ~600 kW m(-2) was measured at 10 K subcooling and 18 m s(-1) vapor velocity. This clearly highlights the excellent potential of a nanostructured superhydrophobic surface in flow condensation applications. The surfaces sustained dropwise condensation and vapor shear for five days, following which mechanical degradation caused a transition to filmwise condensation. Overall, our results underscore the need to investigate superhydrophobic surfaces under stringent and realistic flow condensation conditions before drawing conclusions regarding their performance in practically relevant condensation applications.
NASA Astrophysics Data System (ADS)
Antonov, N. N.; Samokhin, A. A.; Zhabin, S. N.; Gavrikov, A. V.; Smirnov, V. P.
2016-11-01
Spent nuclear fuel plasma separation method approbation implies the use of model substances. Thus it is necessary to solve the problem of material conversion into a cold plasma flow, as well as the problem of deposition on collectors. For this purpose, we carried out a kinetic and hydrodynamic simulation of the discharge with hot cathode in the lead vapor (lead vapor was injected into the interelectrode gap). Dependencies of the ionization efficiency, electrostatic potential distribution, density distribution of ions and electrons in the discharge gap on the discharge current density and the model substance vapor concentration were obtained. The simulation results show that at discharge current density of about 3.5 A/cm2 and the lead vapor concentration of 2 × 1012 cm-3, the ionization efficiency is close to 60%. Experimental research of the discharge with a hot cathode in the lead vapor was carried out. We also carried out the research of the Pb condensation coefficients on various substrates. For experimental data analysis the numerical model based on Monte Carlo method was used. The research results show that deposition coefficients at medium temperatures of substrates near 70 °C do not drop lower than 75%.
Heat and mass transfer in flames
NASA Technical Reports Server (NTRS)
Faeth, G. M.
1986-01-01
Heat- and mass-transfer processes in turbulent diffusion flames are discussed, considering turbulent mixing and the structure of single-phase flames, drop processes in spray flames, and nonluminous and luminous flame radiation. Interactions between turbulence and other phenomena are emphasized, concentrating on past work of the author and his associates. The conserved-scalar formalism, along with the laminar-flamelet approximation, is shown to provide reasonable estimates of the structure of gas flames, with modest levels of empiricism. Extending this approach to spray flames has highlighted the importance of drop/turbulence interactions; e.g., turbulent dispersion of drops, modification of turbulence by drops, etc. Stochastic methods being developed to treat these phenomena are yielding encouraging results.
Heat transfer within a flat micro heat pipe with extra liquid
NASA Astrophysics Data System (ADS)
Sprinceana, Silviu; Mihai, Ioan
2016-12-01
In the real functioning of flat micro heat pipe (FMHP), there can appear cases when the temperature from the vaporization zone can exceed a critical value caused by a sudden increase of the thermal flow. The heat transfer which is completed conductively through the copper wall of a FMHP vaporizer causes the vaporization of the work fluid. On the condenser, the condensation of the fluid vapors and the transfer of the condenser to the vaporizer can no longer be achieved. The solution proposed for enhancing heat transfer in the event of blockage phenomenon FMHP, it is the injection of a certain amount of working fluid in the vaporization zone. By this process the working fluid injected into the evaporator passes suddenly in the vapor, producing a cooling zone. The new product additional mass of vapor will leave the vaporization zone and will condense in condensation zone, thereby supplementing the amount of condensation. Thus resumes normal operating cycle of FMHP. For the experimental measurements made for the transfer of heat through the FMHP working fluid demineralized water, they were made two micro-capillary tubes of sintered copper layer. The first was filled with 1ml of demineralized water was dropped under vacuum until the internal pressure has reached a level of 1•104Pa. The second FMHP was filled with the same amount of working fluid was used and the same capillary inner layer over which was laid a polysynthetic material that will accrue an additional amount of fluid. In this case, the internal pressure was reduced to 1•104Pa.
Compact Water Vapor Exchanger for Regenerative Life Support Systems
NASA Technical Reports Server (NTRS)
Izenson, Michael G.; Chen, Weibo; Anderson, Molly; Hodgson, Edward
2012-01-01
Thermal and environmental control systems for future exploration spacecraft must meet challenging requirements for efficient operation and conservation of resources. Regenerative CO2 removal systems are attractive for these missions because they do not use consumable CO2 absorbers. However, these systems also absorb and vent water to space along with carbon dioxide. This paper describes an innovative device designed to minimize water lost from regenerative CO2 control systems. Design studies and proof-of-concept testing have shown the feasibility of a compact, efficient membrane water vapor exchanger (WVX) that will conserve water while meeting challenging requirements for operation on future spacecraft. Compared to conventional WVX designs, the innovative membrane WVX described here has the potential for high water recovery efficiency, compact size, and very low pressure losses. The key innovation is a method for maintaining highly uniform flow channels in a WVX core built from water-permeable membranes. The proof-of-concept WVX incorporates all the key design features of a prototypical unit, except that it is relatively small scale (1/23 relative to a unit sized for a crew of six) and some components were fabricated using non-prototypical methods. The proof-of-concept WVX achieved over 90% water recovery efficiency in a compact core in good agreement with analysis models. Furthermore the overall pressure drop is very small (less than 0.5 in. H2O, total for both flow streams) and meets requirements for service in environmental control and life support systems on future spacecraft. These results show that the WVX provides very uniform flow through flow channels for both the humid and dry streams. Measurements also show that CO2 diffusion through the water-permeable membranes will have negligible effect on the CO2 partial pressure in the spacecraft atmosphere.
Greenaway, Ann L.; Bachman, Benjamin F.; Boucher, Jason W.; ...
2018-01-12
Ga 1–xIn xP is a technologically important III–V ternary semiconductor widely utilized in commercial and record-efficiency solar cells. We report the growth of Ga 1–xIn xP by water-vapor-mediated close-spaced vapor transport. Because growth of III–V semiconductors in this system is controlled by diffusion of metal oxide species, we find that congruent transport from the mixed powder source requires complete annealing to form a single alloy phase. Growth from a fully alloyed source at water vapor concentrations of ~7000 ppm in H 2 at 850 °C affords smooth films with electron mobility of 1070 cm 2 V –1 s –1 andmore » peak internal quantum efficiency of ~90% for carrier collection in a nonaqueous photoelectrochemical test cell.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Greenaway, Ann L.; Bachman, Benjamin F.; Boucher, Jason W.
Ga 1–xIn xP is a technologically important III–V ternary semiconductor widely utilized in commercial and record-efficiency solar cells. We report the growth of Ga 1–xIn xP by water-vapor-mediated close-spaced vapor transport. Because growth of III–V semiconductors in this system is controlled by diffusion of metal oxide species, we find that congruent transport from the mixed powder source requires complete annealing to form a single alloy phase. Growth from a fully alloyed source at water vapor concentrations of ~7000 ppm in H 2 at 850 °C affords smooth films with electron mobility of 1070 cm 2 V –1 s –1 andmore » peak internal quantum efficiency of ~90% for carrier collection in a nonaqueous photoelectrochemical test cell.« less
Yeates, K O; Mortensen, M E
1994-04-01
Mercury is an extremely toxic heavy metal that can devastate the central nervous system. The neuropsychological consequences of mercury vapor intoxication have been studied primarily in adults. We present two adolescent half-siblings, ages 13 and 15, who were unintentionally exposed to concentrated mercury vapor for 3 months. Both children participated in neuropsychological evaluations shortly after being diagnosed with mercury toxicity, and again 1 year later. Results from the initial assessments documented functional deficits consistent with diffuse encephalopathy. Upon follow-up, neuropsychological functioning had improved, but deficits remained in visuoperceptual and constructional skills, nonverbal memory, and conceptual abstraction. The deficits persisted despite removal from exposure, return of urinary and blood mercury to acceptable levels, and resolution of neuropsychiatric symptoms. The deficits were similar to, but more severe than, those found in adults suffering from mercury vapor intoxication. The results suggest that the developing brain may be especially vulnerable to mercury vapor toxicity.
NASA Astrophysics Data System (ADS)
Tang, Liangliang; Xu, Chang; Liu, Zhuming
2017-01-01
Zn diffusion in III-V compound semiconductorsare commonly processed under group V-atoms rich conditions because the vapor pressure of group V-atoms is relatively high. In this paper, we found that group V-atoms in the diffusion sources would not change the shaped of Zn profiles, while the Zn diffusion would change dramatically undergroup III-atoms rich conditions. The Zn diffusions were investigated in typical III-V semiconductors: GaAs, GaSb and InAs. We found that under group V-atoms rich or pure Zn conditions, the double-hump Zn profiles would be formed in all materials except InAs. While under group III-atoms rich conditions, single-hump Zn profiles would be formed in all materials. Detailed diffusion models were established to explain the Zn diffusion process; the surface self-diffusion of matrix atoms is the origin of the abnormal Zn diffusion phenomenon.
Volatile transport on Venus and implications for surface geochemistry and geology
NASA Technical Reports Server (NTRS)
Brackett, Robert A.; Fegley, Bruce; Arvidson, Raymond E.
1995-01-01
The high vapor pressure of volatile metal halides and chalcogenides (e.g., of Cu, Zn, Sn, Pb, As, Sb, Bi) at typical Venus surface temperatures, coupled with the altitude-dependent temperature gradient of approximately 8.5 K/km, is calculated to transport volatile metal vapors to the highlands of Venus, where condensation and accumulation will occur. The predicted geochemistry of volatile metals on Venus is supported by observations of CuCl in volcanic gases at Kilauea and Nyiragongo, and large enrichments of these and other volatile elements in terrestrial volcanic aerosols. A one-dimensional finite difference vapor transport model shows the diffusive migration of a thickness of 0.01 to greater than 10 microns/yr of moderately to highly volatile phases (e.g., metal halides and chalcogenides) from the hot lowlands (740 K) to the cold highlands (660 K) on Venus. The diffusive transport of volatile phases on Venus may explain the observed low emissivity of the Venusian highlands, hazes at 6-km altitude observed by two Pioneer Venus entry probes, and the Pioneer Venus entry probe anomalies at 12.5 km.
Sound, infrasound, and sonic boom absorption by atmospheric clouds.
Baudoin, Michaël; Coulouvrat, François; Thomas, Jean-Louis
2011-09-01
This study quantifies the influence of atmospheric clouds on propagation of sound and infrasound, based on an existing model [Gubaidulin and Nigmatulin, Int. J. Multiphase Flow 26, 207-228 (2000)]. Clouds are considered as a dilute and polydisperse suspension of liquid water droplets within a mixture of dry air and water vapor, both considered as perfect gases. The model is limited to low and medium altitude clouds, with a small ice content. Four physical mechanisms are taken into account: viscoinertial effects, heat transfer, water phase changes (evaporation and condensation), and vapor diffusion. Physical properties of atmospheric clouds (altitude, thickness, water content and droplet size distribution) are collected, along with values of the thermodynamical coefficients. Different types of clouds have been selected. Quantitative evaluation shows that, for low audible and infrasound frequencies, absorption within clouds is several orders of magnitude larger than classical absorption. The importance of phase changes and vapor diffusion is outlined. Finally, numerical simulations for nonlinear propagation of sonic booms indicate that, for thick clouds, attenuation can lead to a very large decay of the boom at the ground level. © 2011 Acoustical Society of America
NASA Astrophysics Data System (ADS)
Wang, Xue; Hartmann, Jana; Mandl, Martin; Sadat Mohajerani, Matin; Wehmann, Hergo-H.; Strassburg, Martin; Waag, Andreas
2014-04-01
Three-dimensional GaN columns recently have attracted a lot of attention as the potential basis for core-shell light emitting diodes for future solid state lighting. In this study, the fundamental insights into growth kinetics and mass transport mechanisms of N-polar GaN columns during selective area metal organic vapor phase epitaxy on patterned SiOx/sapphire templates are systematically investigated using various pitch of apertures, growth time, and silane flow. Species impingement fluxes on the top surface of columns Jtop and on their sidewall Jsw, as well as, the diffusion flux from the substrate Jsub contribute to the growth of the GaN columns. The vertical and lateral growth rates devoted by Jtop, Jsw and Jsub are estimated quantitatively. The diffusion length of species on the SiOx mask surface λsub as well as on the sidewall surfaces of the 3D columns λsw are determined. The influences of silane on the growth kinetics are discussed. A growth model is developed for this selective area metal organic vapor phase epitaxy processing.
Microgravity nucleation and particle coagulation experiments support
NASA Technical Reports Server (NTRS)
Lilleleht, L. U.; Ferguson, F. T.
1987-01-01
A preliminary model for diffusion between concentric hemispheres was adapted to the cylindrical geometry of a microgravity nucleation apparatus, and extended to include the effects of radiation and conduction through the containment walls. Computer programs were developed to calculate first the temperature distribution and then the evolving concentration field using a finite difference formulation of the transient diffusion and radiation processes. The following estimations are made: (1) it takes approximately 35 minutes to establish a steady temperature field; (2) magnesium vapors released into the argon environment at the steady temperature distribution will reach a maximum supersaturation ratio of approximately 10,000 in the 20-second period at a distance of 15 cm from the source of vapors; and (3) approximately 750W electrical power will be required to maintain steady operating temperatures within the chamber.
The importance of Soret transport in the production of high purity silicon for solar cells
NASA Technical Reports Server (NTRS)
Srivastava, R.
1985-01-01
Temperature-gradient-driven diffusion, or Soret transport, of silicon vapor and liquid droplets is analyzed under conditions typical of current production reactors for obtaining high purity silicon for solar cells. Contrary to the common belief that Soret transport is negligible, it is concluded that some 15-20 percent of the silicon vapor mass flux to the reactor walls is caused by the high temperature gradients that prevail inside such reactors. Moreover, since collection of silicon is also achieved via deposition of silicon droplets onto the walls, the Soret transport mechanism becomes even more crucial due to size differences between diffusing species. It is shown that for droplets in the 0.01 to 1 micron diameter range, collection by Soret transport dominates both Brownian and turbulent mechanisms.
NASA Technical Reports Server (NTRS)
Gokoglu, Suleyman A.
1988-01-01
This paper investigates the role played by vapor-phase chemical reactions on CVD rates by comparing the results of two extreme theories developed to predict CVD mass transport rates in the absence of interfacial kinetic barrier: one based on chemically frozen boundary layer and the other based on local thermochemical equilibrium. Both theories consider laminar convective-diffusion boundary layers at high Reynolds numbers and include thermal (Soret) diffusion and variable property effects. As an example, Na2SO4 deposition was studied. It was found that gas phase reactions have no important role on Na2SO4 deposition rates and on the predictions of the theories. The implications of the predictions of the two theories to other CVD systems are discussed.
Two reference time scales for studying the dynamic cavitation of liquid films
NASA Technical Reports Server (NTRS)
Sun, D. C.; Brewe, D. E.
1992-01-01
Two formulas, one for the characteristic time of filling a void with the vapor of the surrounding liquid, and one of filling the void by diffusion of the dissolved gas in the liquid, are derived. By comparing these time scales with that of the dynamic operation of oil film bearings, it is concluded that the evaporation process is usually fast enough to fill the cavitation bubble with oil vapor; whereas the diffusion process is much too slow for the dissolved air to liberate itself and enter the cavitation bubble. These results imply that the formation of a two phase fluid in dynamically loaded bearings, as often reported in the literature, is caused by air entrainment. They further indicate a way to simplify the treatment of the dynamic problem of bubble evolution.
NASA Technical Reports Server (NTRS)
Karpova, E. A.; Rose, M. Franklin (Technical Monitor)
2000-01-01
Three different types of ribosome crystals were grown by the vapor diffusion technique in hanging drops as described in (1,2). The ribosome is a large asymmetric RNA-protein complex (2.3 million Da), which is protein syntheses machinery of the cell. In this poster we would like to discuss the features of ribosome crystallization. Ribosomes were purified from the thermophilic bacteria Thermus thermophilus by centrifugation (3). Three types of crystals (needle, flat tetragonal and tetragonal-like pyramid) can be grown from the same solution; furthermore, in the same drop using 10-15% 2-methyl-2,4- pentanediol as a precipitant. The crystals appeared in 5-48 hours. The crystals were stable and can co-exist in solution over long period of time. The kinetics of appearance of different crystal forms was different: first the needle crystals were grown, then the tetragonal, and finally the tetragonal pyramids. Later studies of the process of ribosome crystal growth depending on supersaturation showed that low supersaturation results in the appearance of tetragonal plates or tetragonal-like pyramids. An electron microscopy study, together with computer modeling, has shown that crystals of different forms have a high probability of having the same unit cell parameters. According to these experiments the following conclusion can be dranvn: the level of supersaturation of the macromolecule in a crystallizing solution is one of the major factors for forming three-dimensional crystals convenient for X-rays diffraction analysis. From the same macromolecule solution, crystals of different forms can be grown at approximately the same conditions by varying the concentration of macromolecule in the solution. Ion-macromolecule and water-macromolecule interactions, apparently, play the main role in the formation of the unit cell of the crystals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zipper, Lauren E.; Binghamton University, 4400 Vestal Parkway East, Vestal, NY 13902; Aristide, Xavier
This article describes the use of evaporation control lids that are fitted to crystallization plates to improve the reproducibility of trials using as little as 5 nl. The plate lids contain apertures which are large enough for the transfer of protein containing droplets, but small enough to greatly reduce the rate of evaporation during the time needed to prepare the plate. A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fittingmore » the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less
Structural and evaporative evolutions in desiccating sessile drops of blood
NASA Astrophysics Data System (ADS)
Sobac, B.; Brutin, D.
2011-07-01
We report an experimental investigation of the drying of a deposited drop of whole blood. Flow motion, adhesion, gelation, and fracturation all occur during the evaporation of this complex matter, leading to a final typical pattern. Two distinct regimes of evaporation are highlighted: the first is driven by convection, diffusion, and gelation in a liquid phase, whereas the second, with a much slower rate of evaporation, is characterized by the mass transport of the liquid left over in the gellified biocomponent matter. A diffusion model of the drying process allows a prediction of the transition between these two regimes of evaporation. Moreover, the formation of cracks and other events occurring during the drying are examined and shown to be driven by critical solid mass concentrations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, H.X.; Anh, B.V.; Dinh, T.N.
1999-07-01
This paper presents results of a numerical investigation on the behavior of melt drops falling in a gas (vapor) space and then penetrating into a liquid volume through the gas-liquid interface. The phenomenon studied here is, usually, observed when a liquid drop falls through air into a water pool and is, specially, of interest when a hypothetical severe reactor core meltdown accident is considered. The objective of this work is to study the effect of the gas-liquid interface on the dynamic evolution of the interaction area between the fragmenting melt drop and water. In the present study, the Navier-Stokes equationsmore » are solved for three phases (gas, liquid and melt-drop) using a higher-order, explicit, numerical method, called Cubic-Interpolated Pseudo-Particle (CIP) method, which is employed in combination with an advanced front-capturing scheme, named the Level Set Algorithm (LSA). By using this method, reasonable physical pictures of droplet deformation and fragmentation during movement in a stationary uniform water pool, and in a gas-liquid two-layer volume, is simulated. Effect of the gas-liquid interface on the drop deformation and fragmentation is analyzed by comparing the simulation results obtained for the two cases. Effects of the drop geometry, and of the flow conditions, on the behavior of the melt drop are also analyzed.« less
NASA Technical Reports Server (NTRS)
Mckay, C. P.
1985-01-01
To investigate the occurrence of low temperatures and the formation of noctilucent clouds in the summer mesosphere, a one-dimensional time-dependent photochemical-thermal numerical model of the atmosphere between 50 and 120 km has been constructed. The model self-consistently solves the coupled photochemical and thermal equations as perturbation equations from a reference state assumed to be in equilibrium and is used to consider the effect of variability in water vapor in the lower mesosphere on the temperature in the region of noctilucent cloud formation. It is found that change in water vapor from an equilibrium value of 5 ppm at 50 km to a value of 10 ppm, a variation consistent with observations, can produce a roughly 15 K drop in temperature at 82 km. It is suggested that this process may produce weeks of cold temperatures and influence noctilucent cloud formation.
Effects of Buoyancy in Hydrogen Jet Diffusion Flames
NASA Technical Reports Server (NTRS)
Agrawal, A. K.; Al-Ammar, K.; Gollahalli, S. R.; Griffin, D. W.
1999-01-01
This project was carried out to understand the effects of heat release and buoyancy on the flame structure of diffusion flames. Experiments were conducted at atmospheric pressure in both normal gravity and microgravity conditions in the NASA LeRC 2.2 s drop tower. Experiments were also conducted in a variable pressure combustion facility in normal gravity to scale buoyancy and thus, to supplement the drop tower experiments. Pure H2 or H2 mixed with He was used as the jet fluid to avoid the complexities associated with soot formation. Fuel jet burning in quiescent air was visualized and quantified by the Rainbow Schlieren Deflectometry (RSD) to obtain scalar profiles (temperature, oxygen concentration) within the flame. Burner tube diameter (d) was varied from 0.3 to 1.19 mm producing jet exit Reynolds numbers ranging from 40 to 1900, and generating flames encompassing laminar and transitional (laminar to turbulent) flow structure. Some experiments were also complemented with the CFD analysis. In a previous paper, we have presented details of the RSD technique, comparison of computed and measured scalar distributions, and effects of buoyancy on laminar and transitional H2 gas-jet diffusion flames. Results obtained from the RSD technique, variable pressure combustion chamber, and theoretical models have been published. Subsequently, we have developed a new drop rig with improved optical and image acquisition. In this set up, the schlieren images are acquired in real time and stored digitally in RAM of an onboard computer. This paper deals with laminar diffusion flames of pure H2 in normal and microgravity.
Diffusion of Mg dopant in metal-organic vapor-phase epitaxy grown GaN and AlxGa1-xN
NASA Astrophysics Data System (ADS)
Köhler, K.; Gutt, R.; Wiegert, J.; Kirste, L.
2013-02-01
Diffusion of the p-type dopant Mg in GaN and AlxGa1-xN which is accompanied by segregation and affected by transient effects in metal-organic vapor-phase epitaxy reactors is investigated. We have grown 110 nm thick Mg doped GaN and Al0.1Ga0.9N layers on top of undoped GaN and Al0.1Ga0.9N layers, respectively, in a temperature range between 925 °C and 1050 °C where we placed special emphasis on the lower temperature limit without diffusion to allow separation of Mg transients, diffusion, and segregation. Hereby, AlxGa1-xN layers enable monitoring of the resolution limit by secondary ion mass spectrometry analyses for the respective samples; therefore, thin AlxGa1-xN marker layers are incorporated in the thick GaN layers. We found an upper limit of 1.25 × 1019 cm-3 for diffusing Mg atoms in both sample types. Owing to the marked influence of Mg segregation in Al0.1Ga0.9N, diffusion is only seen by using a GaN cap on top of the Al0.1Ga0.9N layer sequence. Diffusion in Al0.1Ga0.9N is shown to be increased by about 25%-30% compared to GaN. Post growth annealing experiments under conditions equivalent to those used for growth of the Mg doped samples showed negligible diffusion. Comparing the results to well established findings on other doped III-V compounds, diffusion is explained by an interstitial-substitutional mechanism with a diffusion coefficient, which is concentration dependent. Analysis of the temperature dependent diffusivity revealed an activation energy of 5.0 eV for GaN:Mg and 5.2 eV for Al0.1Ga0.9N:Mg.
Oxygen diffusion: an enzyme-controlled variable parameter.
Erdmann, Wilhelm; Kunke, Stefan
2014-01-01
Previous oxygen microelectrode studies have shown that the oxygen diffusion coefficient (DO₂) increases during extracellular PO₂ decreases, while intracellular PO₂ remained unchanged and thus cell function (spike activity of neurons). Oxygen dependency of complex multicellular organisms requires a stable and adequate oxygen supply to the cells, while toxic concentrations have to be avoided. Oxygen brought to the tissue by convection diffuses through the intercellular and cell membranes, which are potential barriers to diffusion. In gerbil brain cortex, PO₂ and DO₂ were measured by membrane-covered and by bare gold microelectrodes, as were also spike potentials. Moderate respiratory hypoxia was followed by a primary sharp drop of tissue PO₂ that recovered to higher values concomitant with an increase of DO₂. A drop in intracellular PO₂ recovered immediately. Studies on the abdominal ganglion of aplysia californica showed similar results.Heterogeneity is a feature of both normal oxygen supply to tissue and supply due to a wide range of disturbances in oxygen supply. Oxygen diffusion through membranes is variable thereby ensuring adequate intracellular PO₂. Cell-derived glucosamine oxidase seems to regulate the polymerization/depolymerisation ratio of membrane mucopolysaccharides and thus oxygen diffusion.Variability of oxygen diffusion is a decisive parameter for regulating the supply/demand ratio of oxygen supply to the cell; this occurs in highly developed animals as well as in species of a less sophisticated nature. Autoregulation of oxygen diffusion is as important as the distribution/perfusion ratio of the capillary meshwork and as the oxygen extraction ratio in relation to oxygen consumption of the cell. Oxygen diffusion resistance is the cellular protection against luxury oxygen supply (which can result in toxic oxidative species leading to mutagenesis).
Wagner, Jr., Edward P.
1999-01-01
A water cooled steam jet for transferring fluid and preventing vapor lock, or vaporization of the fluid being transferred, has a venturi nozzle and a cooling jacket. The venturi nozzle produces a high velocity flow which creates a vacuum to draw fluid from a source of fluid. The venturi nozzle has a converging section connected to a source of steam, a diffuser section attached to an outlet and a throat portion disposed therebetween. The cooling jacket surrounds the venturi nozzle and a suction tube through which the fluid is being drawn into the venturi nozzle. Coolant flows through the cooling jacket. The cooling jacket dissipates heat generated by the venturi nozzle to prevent vapor lock.
A Preliminary Study on the Vapor/Mist Phase Lubrication of a Spur Gearbox
NASA Technical Reports Server (NTRS)
Morales, Wilfredo; Handschuh, Robert F.
1999-01-01
Organophosphates have been the primary compounds used in vapor/mist phase lubrication studies involving ferrous bearing material. Experimental results have indicated that the initial formation of an iron phosphate film on a rubbing ferrous surface, followed by the growth (by cationic diffusion) of a lubricious pyrophosphate-type coating over the iron phosphate, is the reason organophosphates work well as vapor/mist phase lubricants. Recent work, however, has shown that this mechanism leads to the depletion of surface iron atoms and to eventual lubrication failure. A new organophosphate formulation was developed which circumvents surface iron depletion. This formulation was tested by generating an iron phosphate coating on an aluminum surface. The new formulation was then used to vapor/mist phase lubricate a spur gearbox in a preliminary study.
NASA Technical Reports Server (NTRS)
Johnson, R. L.; Young, Donald L. (Technical Monitor)
1967-01-01
This report contains the results of a fifteen month analytical and experimental study of the leakage rate of the pressurant gases (N2, He) and the propellant vapors (N2O4,N2H4) through bladder structures consisting of two layers of Teflon separated by a metallic foil diffusion barrier containing microscopic or larger holes. Results were obtained for the steady state leakage rate through circular holes and long rectangular openings in the barrier for arbitrary thicknesses of the two Teflon layers. The effect of hole shape and relative hole position on the leakage rate were studied. The transient problem was analyzed and it was shown that steady state calculations are adequate for estimating the leakage rate. A computer program entitled "Diffusion Analyzer Program" was developed to calculate the leakage rate, both transient and steady state. Finally, the analytical results were compared to experimentally determined values of the leakage rate through a model laminated bladder structure. The results of the analysis are in good agreement with experiment. The experimental effort (Part II of the Bladder Permeation Program) measured the solubility, diffusion coefficient and permeability of helium, nitrogen and nitrogen tetroxide vapor through Teflon TFE and FEP membranes. Data were obtained in the temperature range of 25 to 100 C at pressures ranging from near vacuum to about 20 atmospheres. Results of the experimental effort were compared with the limited data previously reported. As a verification to the applicability of results to actual bladder systems, counter diffusion tests were performed with a laminated sample containing aluminum foil with a selected group of holes.
Development and fabrication of a high current, fast recovery power diode
NASA Technical Reports Server (NTRS)
Berman, A. H.; Balodis, V.; Devance, D. C.; Gaugh, C. E.; Karlsson, E. A.
1983-01-01
A high voltage (VR = 1200 V), high current (IF = 150 A), fast recovery ( 700 ns) and low forward voltage drop ( 1.5 V) silicon rectifier was designed and the process developed for its fabrication. For maximum purity, uniformity and material characteristic stability, neutron transmutation n-type doped float zone silicon is used. The design features a hexagonal chip for maximum area utilization of space available in the DO-8 diode package, PIN diffused junction structure with deep diffused D(+) anode and a shallow high concentration n(+) cathode. With the high temperature glass passivated positive bevel mesa junction termination, the achieved blocking voltage is close to the theoretical limit of the starting material. Gold diffusion is used to control the lifetime and the resulting effect on switching speed and forward voltage tradeoff. For solder reflow assembly, trimetal (Al-Ti-Ni) contacts are used. The required major device electrical characteristics were achieved. Due to the tradeoff nature of forward voltage drop and reverse recovery time, a compromise was reached for these values.
A highly accurate boundary integral equation method for surfactant-laden drops in 3D
NASA Astrophysics Data System (ADS)
Sorgentone, Chiara; Tornberg, Anna-Karin
2018-05-01
The presence of surfactants alters the dynamics of viscous drops immersed in an ambient viscous fluid. This is specifically true at small scales, such as in applications of droplet based microfluidics, where the interface dynamics become of increased importance. At such small scales, viscous forces dominate and inertial effects are often negligible. Considering Stokes flow, a numerical method based on a boundary integral formulation is presented for simulating 3D drops covered by an insoluble surfactant. The method is able to simulate drops with different viscosities and close interactions, automatically controlling the time step size and maintaining high accuracy also when substantial drop deformation appears. To achieve this, the drop surfaces as well as the surfactant concentration on each surface are represented by spherical harmonics expansions. A novel reparameterization method is introduced to ensure a high-quality representation of the drops also under deformation, specialized quadrature methods for singular and nearly singular integrals that appear in the formulation are evoked and the adaptive time stepping scheme for the coupled drop and surfactant evolution is designed with a preconditioned implicit treatment of the surfactant diffusion.
Koo, Won Hoe; Jeong, Soon Moon; Choi, Sang Hun; Kim, Woo Jin; Baik, Hong Koo; Lee, Sung Man; Lee, Se Jong
2005-06-09
The tin oxide and silicon oxide films have been deposited on polycarbonate substrates as gas barrier films, using a thermal evaporation and ion beam assisted deposition process. The oxide films deposited by ion beam assisted deposition show a much lower water vapor transmission rate than those by thermal evaporation. The tin oxide films show a similar water vapor transmission rate to the silicon oxide films in thermal evaporation but a lower water vapor transmission rate in IBAD. These results are related to the fact that the permeation of water vapor with a large dipole moment is affected by the chemistry of oxides and the packing density of the oxide films. The permeation mechanism of water vapor through the oxide films is discussed in terms of the chemical interaction with water vapor and the microstructure of the oxide films. The chemical interaction of water vapor with oxide films has been investigated by the refractive index from ellipsometry and the OH group peak from X-ray photoelectron spectroscopy, and the microstructure of the composite oxide films was characterized using atomic force microscopy and a transmission electron microscope. The activation energy for water vapor permeation through the oxide films has also been measured in relation to the permeation mechanism of water vapor. The diffusivity of water vapor for the tin oxide films has been calculated from the time lag plot, and its implications are discussed.
NASA Technical Reports Server (NTRS)
Selle, Laurent C.; Bellan, Josette
2006-01-01
A model of multicomponent-liquid (MC-liquid) drop evaporation in a three-dimensional mixing layer is here exercised at larger Reynolds numbers than in a previous study, and transitional states are obtained. The gas phase is followed in an Eulerian frame and the multitude of drops is described in a Lagrangian frame. Complete coupling between phases is included with source terms in the gas conservation equations accounting for the drop/flow interaction in terms of drop drag, drop heating and species evaporation. The liquid composition, initially specified as a single-Gamma (SG) probability distribution function (PDF) depending on the molar mass is allowed to evolve into a linear combination of two SGPDFs, called the double-Gamma PDF (DGPDF). The compositions of liquid and vapor emanating from the drops are calculated through four moments of the DGPDFs, which are drop-specific and location-specific, respectively. The mixing layer is initially excited to promote the double pairing of its four initial spanwise vortices into an ultimate vortex in which small scales proliferate. Simulations are performed for four liquids of different compositions and the effect of the initial mass loading and initial free-stream gas temperature are explored. For reference, Simulations are also performed for gaseous multicomponent mixing layers for which the effect of Reynolds number is investigated. The results encompass examination of the global layer characteristics, flow visualizations and homogeneous-plane statistics at transition. Comparisons are performed with previous pre-transitional MC-liquid simulations and with transitional single-component (SC) liquid studies. It is found that MCC flows at transition, the classical energy cascade is of similar strength, but that the smallest scales contain orders of magnitude less energy than SC flows, which is confirmed by the larger viscous dissipation in the former case. Contrasting to pre-transitional MC flows, the vorticity and drop organization depend on the initial gas temperature, this being due to the drop/turbulence coupling. The vapor-composition mean molar mass and standard deviation distributions strongly correlate with the initial liquid-composition PDF; such a correlation only exists for the magnitude of the mean but not for that of the standard deviation. Unlike in pre-transitional situations, regions of large composition standard deviation no longer necessarily coincide with regions of large mean molar mass. The kinetic energy, rotational and composition characteristics, and dissipation are liquid specific and the variation among liquids is amplified with increasing free-stream gas temperature. Eulerian and Lagrangian statistics of gas-phase quantities show that the different. Observation framework may affect the perception of the flow characteristics. The gas composition, of which the first four moments are calculated, is shown to be close to, but distinct from a SGPDF. The PDF of the scalar dissipation rate is calculated for drop-laden layers and is shown to depart more significantly from the typically assumed Gaussian in gaseous flows than experimentally measured gaseous scalar dissipation rates, this being attributed to the increased heterogeneity due to drop/flow interactions.
Köcher, Paul; Horna, Viviana; Leuschner, Christoph
2013-08-01
The functional role of internal water storage is increasingly well understood in tropical trees and conifers, while temperate broad-leaved trees have only rarely been studied. We examined the magnitude and dynamics of the use of stem water reserves for transpiration in five coexisting temperate broad-leaved trees with largely different morphology and physiology (genera Fagus, Fraxinus, Tilia, Carpinus and Acer). We expected that differences in water storage patterns would mostly reflect species differences in wood anatomy (ring vs. diffuse-porous) and wood density. Sap flux density was recorded synchronously at five positions along the root-to-branch flow path of mature trees (roots, three stem positions and branches) with high temporal resolution (2 min) and related to stem radius changes recorded with electronic point dendrometers. The daily amount of stored stem water withdrawn for transpiration was estimated by comparing the integrated flow at stem base and stem top. The temporal coincidence of flows at different positions and apparent time lags were examined by cross-correlation analysis. Our results confirm that internal water stores play an important role in the four diffuse-porous species with estimated 5-12 kg day(-1) being withdrawn on average in 25-28 m tall trees representing 10-22% of daily transpiration; in contrast, only 0.5-2.0 kg day(-1) was withdrawn in ring-porous Fraxinus. Wood density had a large influence on storage; sapwood area (diffuse- vs. ring-porous) may be another influential factor but its effect was not significant. Across the five species, the length of the time lag in flow at stem top and stem base was positively related to the size of stem storage. The stem stores were mostly exhausted when the soil matrix potential dropped below -0.1 MPa and daily mean vapor pressure deficit exceeded 3-5 hPa. We conclude that stem storage is an important factor improving the water balance of diffuse-porous temperate broad-leaved trees in moist periods, while it may be of low relevance in dry periods and in ring-porous species.
The Superheat Phenomenon in the Combustion of Magnesium Particles
NASA Technical Reports Server (NTRS)
Shafirovich, E. IA.; Goldshleger, U. I.
1992-01-01
Magnesium is known to be a likely fuel for engines that could work in the CO2 atmospheres of Mars and Venus. The present paper reports temperature measurements of magnesium samples during combustion in CO2. The burning sample temperature increases with the decrease in the initial size. The temperature of the 1-mm samples is 300-400 K higher than the boiling point of magnesium. The stability of the superheated drop is explained by the presence of a porous shell on the surface. An attempt has been made to describe vaporization on the superheated drop by the Knudsen-Langmuir equation. During combustion at high-pressure fragment ejection of the flame is observed in high-speed motion pictures. This phenomenon is shown to be connected with the drop superheat. The repeated fracture of the outer shell formed in the flame ensures the complete burnout of metal particles at high pressure.
NASA Technical Reports Server (NTRS)
Gooderum, P. B.; Bushnell, D. M.
1972-01-01
Atomization, drop size, and penetration data are presented for cross stream water injection at conditions simulating high altitude reentry (low Weber number, high static temperature, high Knudsen number, and low static pressure). These results are applied to the RAM C-1 and C-3 flights. Two primary breakup modes are considered, vapor pressure or flashing and aerodynamic atomization. Results are given for breakup boundaries and mean drop size for each of these atomization mechanisms. Both standard and flight orifice geometries are investigated. The data were obtained in both a static environment and in conventional aerodynamic facilities at Mach numbers of 4.5 and 8. The high temperature aspects of reentry were simulated in a Mach 5.5 cyanogen-oxygen tunnel with total temperature of 4500 K.
The cesiator - A device for cesium vapor control and impurity purge
NASA Astrophysics Data System (ADS)
Rasor, N. S.; Desplat, J.-L.
A new type of liquid cesium reservoir that maintains a temperature-independent cesium pressure, continuously recirculates cesium vapor through the TFE (thermionic fuel element), and purges it of impurities is discussed. This device, the cesiator, is based on well-established gas-buffered heat pipe principles. The cesiator offers new TFE design options for fission product/impurity handling that eliminate the need for an intercell insulator seal and associated failure modes. Cesiator performance requirements are estimated based on data for expected release of fission products and their effect on TFE performance. The effect of design parameters on cesiator performance is described. Experimentation with an ethanol-metal mock-up revealed an unexpected but desirable mode of operation that autoregulates the pressure drop and flow of vapor in the external circuit and that has been incorporated in the reference design for phase II development. Experimental techniques for measuring the local temperature, pressure, and composition in a condensing vapor were successfully developed. A reference design for a TFE cesiator was defined for prototype design, development, and test.
Use of the quartz crystal microbalance to determine the monomeric friction coefficient of polyimides
NASA Technical Reports Server (NTRS)
Bechtold, Mary M.
1995-01-01
When a thin film of polymer is coated on to a quartz crystal microbalance (QCM), the QCM can be used to detect the rate of increase in weight of the polymer film as the volatile penetrant diffuses into the polymer. From this rate information the diffusion coefficient of the penetrant into the polymer can be computed. Calculations requiring this diffusion coefficient lead to values which approximate the monomeric friction coefficient of the polymer. This project has been concerned with the trial of crystal oscillating circuits suitable for driving polymer coated crystals in an atmosphere of penetrant. For these studies done at room temperature, natural rubber was used as an easily applied polymer that is readily penetrated by toluene vapors, qualities anticipated with polyimides when they are tested at T(g) in the presence of toluene. Three quartz crystal oscillator circuits were tested. The simplest circuit used +/- 5 volt dc and had a transistor to transistor logic (TTL) inverter chip that provides a 180 deg phase shift via a feed back loop. This oscillator circuit was stable but would not drive the crystal when the crystal was coated with polymer and subjected to toluene vapors. Removal of a variable resistor from this circuit increased stability but did not otherwise increase performance. Another driver circuit tested contained a two stage differential input, differential output, wide band video amplifier and also contain a feed back loop. The circuit voltage could not be varied and operated at +/- 5 volts dc; this circuit was also stable but failed to oscillate the polymer coated crystal in an atmosphere saturated with toluene vapors. The third oscillator circuit was of similar construction and relied on the same video amplifier but allowed operation with variable voltage. This circuit would drive the crystal when the crystal was submerged in liquid toluene and when the crystal was coated with polymer and immersed in toluene vapors. The frequency readings obtained when using this oscillating circuit are highly variable. This circuit requires further modification to stabilize frequency readings before its use in studies to determine the diffusion coefficient of penetrant molecules into a polymer film coated on a QCM.
NASA Astrophysics Data System (ADS)
Santini, M.; Guilizzoni, M.; Fest-Santini, S.; Lorenzi, M.
2017-11-01
Highly hydrophobic surfaces have been intensively investigated in the last years because their properties may lead to very promising technological spillovers encompassing both everyday use and high-tech fields. Focusing on textiles, hydrophobic fabrics are of major interest for applications ranging from clothes to architecture to environment protection and energy conversion. Gas diffusion media - made by a gas diffusion layer (GDL) and a microporous layer (MPL) - for fuel cells are a good benchmark to develop techniques aimed at characterizing the wetting performances of engineered textiles. An experimental investigation was carried out about carbon-based, PTFE-treated GDLs with and without MPLs. Two samples (woven and woven-non-woven) were analysed before and after coating with a MPL. Their three-dimensional structure was reconstructed and analysed by computer-aided X-ray microtomography (µCT). Static and dynamic wettability analyses were then carried out using a modified axisymmetric drop shape analysis technique. All the surfaces exhibited very high hydrophobicity, three of them near to a super-hydrophobic behavior. Water drop impacts were performed, evidencing different bouncing, sticking and fragmentation outcomes for which critical values of the Weber number were identified. Finally, a µCT scan of a drop on a GDL was performed, confirming the Cassie-Baxter wetting state on such surface.
Method and apparatus for the production of metal oxide powder
Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.
1993-01-01
The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.
Method and apparatus for the production of metal oxide powder
Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.
1992-01-01
The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.
Method and apparatus for the production of metal oxide powder
Harris, M.T.; Scott, T.C.; Byers, C.H.
1992-06-16
The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed. 2 figs.
A study of pressure losses in residential air distribution systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abushakra, Bass; Walker, Iain S.; Sherman, Max H.
2002-07-01
An experimental study was conducted to evaluate the pressure drop characteristics of residential duct system components that are either not available or not thoroughly (sometimes incorrectly) described in existing duct design literature. The tests were designed to imitate cases normally found in typical residential and light commercial installations. The study included three different sizes of flexible ducts, under different compression configurations, splitter boxes, supply boots, and a fresh air intake hood. The experimental tests conformed to ASHRAE Standard 120P--''Methods of Testing to Determine Flow Resistance of HVAC Air Ducts and Fittings''. The flexible duct study covered compressibility and bending effectsmore » on the total pressure drop, and the results showed that the available published references tend to underestimate the effects of compression in flexible ducts that can increase pressure drops by up to a factor of nine. The supply boots were tested under different configurations including a setup where a flexible duct elbow connection was considered as an integral part of the supply boot. The supply boots results showed that diffusers can increase the pressure drop by up to a factor of two in exit fittings, and the installation configuration can increase the pressure drop by up to a factor of five. The results showed that it is crucial for designers and contractors to be aware of the compressibility effects of the flexible duct, and the installation of supply boots and diffusers.« less
High Temperature Corrosion of Silicon Carbide and Silicon Nitride in Water Vapor
NASA Technical Reports Server (NTRS)
Opila, E. J.; Robinson, Raymond C.; Cuy, Michael D.; Gray, Hugh R. (Technical Monitor)
2002-01-01
Silicon carbide (SiC) and silicon nitride (Si3N4) are proposed for applications in high temperature combustion environments containing water vapor. Both SiC and Si3N4 react with water vapor to form a silica (SiO2) scale. It is therefore important to understand the durability of SiC, Si3N4 and SiO2 in water vapor. Thermogravimetric analyses, furnace exposures and burner rig results were obtained for these materials in water vapor at temperatures between 1100 and 1450 C and water vapor partial pressures ranging from 0.1 to 3.1 atm. First, the oxidation of SiC and Si3N4 in water vapor is considered. The parabolic kinetic rate law, rate dependence on water vapor partial pressure, and oxidation mechanism are discussed. Second, the volatilization of silica to form Si(OH)4(g) is examined. Mass spectrometric results, the linear kinetic rate law and a volatilization model based on diffusion through a gas boundary layer are discussed. Finally, the combined oxidation and volatilization reactions, which occur when SiC or Si3N4 are exposed in a water vapor-containing environment, are presented. Both experimental evidence and a model for the paralinear kinetic rate law are shown for these simultaneous oxidation and volatilization reactions.
A warming tropical central Pacific dries the lower stratosphere
NASA Astrophysics Data System (ADS)
Ding, Qinghua; Fu, Qiang
2018-04-01
The amount of water vapor in the tropical lower stratosphere (TLS), which has an important influence on the radiative energy budget of the climate system, is modulated by the temperature variability of the tropical tropopause layer (TTL). The TTL temperature variability is caused by a complex combination of the stratospheric quasi-biennial oscillation (QBO), tropospheric convective processes in the tropics, and the Brewer-Dobson circulation (BDC) driven by mid-latitude and subtropical atmospheric waves. In 2000, the TLS water vapor amount exhibited a stepwise transition to a dry phase, apparently caused by a change in the BDC. In this study, we present observational and modeling evidence that the epochal change of water vapor between the periods of 1992-2000 and 2001-2005 was also partly caused by a concurrent sea surface temperature (SST) warming in the tropical central Pacific. This SST warming cools the TTL above by enhancing the equatorial wave-induced upward motion near the tropopause, which consequently reduces the amount of water vapor entering the stratosphere. The QBO affects the TLS water vapor primarily on inter-annual timescales, whereas a classical El Niño southern oscillation (ENSO) event has small effect on tropical mean TLS water vapor because its responses are longitudinally out of phase. This study suggests that the tropical central Pacific SST is another driver of TLS water vapor variability on inter-decadal timescales and the tropical SST changes could contribute to about 30% of the step-wise drop of the lower stratospheric water vapor from 1992-2000 to 2001-2005.
Global lower mesospheric water vapor revealed by LIMS observations
NASA Technical Reports Server (NTRS)
Gordley, L. L.; Russell, J. M., III; Remsberg, E. E.
1985-01-01
The Limb Infrared Monitor of the Stratospheric water vapor channel data analysis has been extended from the 1. mb level (about 48 km) to the .3 mb level (about 60 km) through a radiance averaging procedure and better understanding of systematic errors. The data show H2O mixing ratio peaks near the .5 mb level varying from 4 to 7 ppmv with latitude and season. Above this level the mixing ratio drops off quickly with altitude, but, due to experimental uncertainties, at an uncertain rate. The stratospheric results are virtually the same as determined from the archived LIMS results with a tropical hygropause and enhanced H2O concentration in the lower levels at high winter latitudes.
NASA Astrophysics Data System (ADS)
Faghri, Amir; Chen, Ming-Ming
1989-10-01
The effects of conjugate heat transfer, vapor compressibility, and viscous dissipation in heat pipes are discussed. The accuracy of the partially parabolic versus the elliptic presentation of the governing equations is also examined. The results show that the axial wall conduction has a tendency to make the temperature distribution more uniform for heat pipes with large ratios of pipe wall to effective liquid-wick thermal conductivity. The compressible and incompressible models show very close agreement for the total pressure drop, while the local pressure variations along the heat pipe are quite different for these two models when the radial Reynolds number at the interface is high.
Wide Band-Gap Semiconductors. 1991 Materials Research Society Symposium Proceedings
1992-09-01
attention of many research groups bccause the instrumental simplicity and high growth rate (1,2). One of the basic problems with this technique, other than...solution with group 1a element as a dopant under controlled Zn vapor pressure. p-n junction diodes are also prepared by the Ga diffusion from Zn solution...stoichiometric composition catl be controlled by the application of the vapor pressure. Mat. Res. Soc. Symp. Proc. Vol. 242. 1992 Materials Research Society 180
Two reference time scales for studying the dynamic cavitation of liquid films
NASA Technical Reports Server (NTRS)
Sun, D. C.; Brewe, David E.
1991-01-01
Two formulas, one for characteristic time of filling a void with a vapor of the surrounding liquid, and one of filling the void by diffusion of the dissolved gas in the liquid, are derived. Based on this analysis, it is seen that in an oil film bearing operating under dynamic loads, the content of cavitation region should be oil vapor rather than the air liberated from solution, if the oil is free of entrained air.
Improved Assessment Strategies for Vapor Intrusion Passive Samplers and Building Pressure Control
2013-09-01
pressure control. Matrix Analyte Method Container Holding Time (Days) Vapor Radon McHugh , Hammond, Nickels , and Hartman, 2008 Tedlar ® bag 14...2: Diffusive Sampling,” ISO 16017-2:2003. McHugh T. E., D. E. Hammond, T. Nickels , and B. Hartman. 2008. “Use of Radon Measurements for Evaluation...Control I. D. Rivera-Duarte D. B. Chadwick SSC Pacific T. McAlary H. Groenevelt T. Creamer D. Bertrand Geosyntec Consultants, Inc. T. McHugh
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marmer, G.J.; Dunn, C.P.; Moeller, K.L.
Uranium enrichment in the United States has utilized a diffusion process to preferentially enrich the U-235 isotope in the uranium product. The U-AVLIS process is based on electrostatic extraction of photoionized U-235 atoms from an atomic vapor stream created by electron-beam vaporization of uranium metal alloy. The U-235 atoms are ionized when precisely tuned laser light -- of appropriate power, spectral, and temporal characteristics -- illuminates the uranium vapor and selectively photoionizes the U-235 isotope. A programmatic document for use in screening DOE site to locate a U-AVLIS production plant was developed and implemented in two parts. The first partmore » consisted of a series of screening analyses, based on exclusionary and other criteria, that identified a reasonable number of candidate sites. These sites were subjected to a more rigorous and detailed comparative analysis for the purpose of developing a short list of reasonable alternative sites for later environmental examination. This environmental site description (ESD) provides a detailed description of the PGDP site and vicinity suitable for use in an environmental impact statement (EIS). The report is based on existing literature, data collected at the site, and information collected by Argonne National Laboratory (ANL) staff during a site visit. 65 refs., 15 tabs.« less
NASA Astrophysics Data System (ADS)
Jackisch, D.; He, S.; Ong, M. R.; Goodkin, N.
2017-12-01
Water isotopes are important tracers of climate dynamics and their measurement can provide valuable insights into the relationship between isotopes and atmospheric parameters and overall convective activities. While most studies provide data on daily or even monthly time scales, high-temporal in-situ stable isotope measurements are scarce, especially in the tropics. In this study, we presented δ18O and δ2H values in precipitation and vapor continuously and simultaneously measured using laser spectroscopy in Singapore during the 2016/2017 Northeast (NE) Asian monsoon and 2017 Southwest (SW) Asian monsoon. We found that δ-values of precipitation and vapor exhibit quite different patterns during individual events, although there is a significant correlation between the δ-values of precipitation and of vapor. δ-values in precipitation during individual precipitation events show a distinct V-shape pattern, with the lowest isotope values observed in the middle of the event. However, isotopes in water vapor mostly show an L-shape and are characterized by a gradual decrease with the onset of rainfall. The difference in δ-values of precipitation and vapor is generally constant during the early stage of the events but gradually increases near the end. It is likely that vapor and precipitation are closer to equilibrium at the early stage of a rain event, but diverge at the later stages. This divergence can be largely attributed to the evaporation of raindrops. We notice a frequent drop in d-excess of precipitation, whereas d-excess in vapor increases. In addition, a significant correlation exists between outgoing longwave radiation (OLR) and isotopes in both precipitation and vapor, suggesting an influence of regional convective activity.
Xie, Jiazhuo; Wang, Haijun; Wang, Zhou; Zhao, Qinghua; Yang, Yuechao; Waterhouse, Geoffrey I N; Hao, Lei; Xiao, Zihao; Xu, Jing
2018-01-08
Herein, we reported the successful development of novel nanocomposite films based on linear low density polyethylene (LLDPE) with enhanced anti-drop, optical, mechanical, thermal and water vapor barrier properties by introducing organophilic layered double hydroxides (OLDHs) nanosheets. OLDHs loadings were varied from 0-6 wt.%. Structural analyses using the Fourier transform infrared spectrum (FT-IR), X-ray diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) indicated that the OLDHs nanosheets were homogeneously dispersed with an ordered alignment in the LLDPE matrix. The LLDPE film containing 2 wt.% OLDHs (denoted as OLDHs-2) showed the optimal mechanical, thermal and water vapor barrier properties, whilst the anti-drop and optical performance of the films improved with increasing OLDHs content. The enhanced antidrop properties of the composite films relative to pristine LLDPE can be expected to effectively reduce agricultural losses to disease when the films are applied as agricultural films, whilst the superior light transmittance and water-retaining properties of the composite films will boost agricultural production. Results presented suggest that multifunctional LLDPE/OLDHs nanocomposites show great promise as low cost agricultural plastic films.
Effect of ice contamination on liquid-nitrogen drops in film boiling
NASA Technical Reports Server (NTRS)
Schoessow, G. J.; Chmielewski, C. E.; Baumeister, K. J.
1977-01-01
Previously reported vaporization time data of liquid nitrogen drops in film boiling on a flat plate are about 30 percent shorter than predicted from standard laminar film boiling theory. This theory, however, had been found to successfully correlate the data for conventional fluids such as water, ethanol, benzene, or carbon tetrachloride. This paper presents experimental evidence that some of the discrepancy for cryogenic fluids results from ice contamination due to condensation. The data indicate a fairly linear decrease in droplet evaporation time with the diameter of the ice crystal residue. After correcting the raw data for ice contamination along with convection, a comparison of theory with experiment shows good agreement.
Effect of ice contamination of liquid-nitrogen drops in film boiling
NASA Technical Reports Server (NTRS)
Schoessow, G. J.; Chmielewski, C. E.; Baumeister, K. J.
1977-01-01
Previously reported vaporization time data of liquid nitrogen drops in film boiling on a flat plate are about 30 percent shorter than predicted from standard laminar film boiling theory. This theory, however, had been found to successfully correlate the data for conventional fluids such as water, ethanol, benzene, or carbon tetrachloride. Experimental evidence that some of the discrepancy for cryogenic fluids results from ice contamination due to condensation is presented. The data indicate a fairly linear decrease in droplet evaporation time with the diameter of the ice crystal residue. After correcting the raw data for ice contamination along with convection, a comparison of theory with experiment shows good agreement.
Coffee-stain growth dynamics on dry and wet surfaces
NASA Astrophysics Data System (ADS)
Boulogne, François; Ingremeau, François; Stone, Howard A.
2017-02-01
The drying of a drop containing particles often results in the accumulation of the particles at the contact line. In this work, we investigate the drying of an aqueous colloidal drop surrounded by a hydrogel that is also evaporating. We combine theoretical and experimental studies to understand how the surrounding vapor concentration affects the particle deposit during the constant radius evaporation mode. In addition to the common case of evaporation on an otherwise dry surface, we show that in a configuration where liquid is evaporating from a flat surface around the drop, the singularity of the evaporative flux at the contact line is suppressed and the drop evaporation is homogeneous. For both conditions, we derive the velocity field and we establish the temporal evolution of the number of particles accumulated at the contact line. We predict the growth dynamics of the stain and the drying timescales. Thus, dry and wet conditions are compared with experimental results and we highlight that only the dynamics is modified by the evaporation conditions, not the final accumulation at the contact line.
Convection effects in protein crystal growth
NASA Technical Reports Server (NTRS)
Roberts, Glyn O.
1988-01-01
Protein crystals for X-ray diffraction study are usually grown resting on the bottom of a hanging drop of a saturated protein solution, with slow evaporation to the air in a small enclosed cell. The evaporation rate is controlled by hanging the drop above a reservoir of water, with its saturation vapor pressure decreased by a low concentration of a passive solute. The drop has a lower solute concentration, and its volume shrinks by evaporation until the molecular concentrations match. Protein crystals can also be grown from a seed crystal suspended or supported in the interior of a supersaturated solution. The main analysis of this report concerns this case because it is less complicated than hanging-drop growth. Convection effects have been suggested as the reason for the apparent cessation of growth at a certain rather small crystal size. It seeems that as the crystal grows, the number of dislocations increases to a point where further growth is hindered. Growth in the microgravity environment of an orbiting space vehicle has been proposed as a method for obtaining larger crystals. Experimental observations of convection effects during the growth of protein crystals have been reported.
NASA Technical Reports Server (NTRS)
Rich, T. R.; Mix, T. W.
1974-01-01
Recovery of potable water from urine on manned space missions of extended duration was the objective of work aimed at the improvement of membrane performance for the vapor diffusion process (VDR). Kynar, Teflon, PVC, and polysulfone candidate membranes were evaluated from chemical, thermal, mechanical, and fabricating standpoints to determine their suitability for operation in the VDR pervaporation module. Pervaporation rates and other performance characteristics were determined in a breadboard pervaporator test rig. Kynar and Teflon membranes were demonstrated to be chemically stable at pervaporation temperatures in urine pretreated with chromic acid bactericide. The separation of the pervaporator and condenser modules, the use of a recirculating sweep gas to conduct pervaporate to the condenser, and the selection of a hollow fiber membrane configuration for pervaporator module design is recommended as a result of the investigation.
Water vapor diffusion membrane development. [for water recovery purposes onboard manned spacecraft
NASA Technical Reports Server (NTRS)
Tan, M. K.
1974-01-01
The phase separator component used as a membrane in the vapor diffusion process (VRD) for the recovery of potable water from urine on manned space missions of extended duration was investigated, with particular emphasis on cation-selective membranes because of their noted mechanical strength, superior resistance to acids, oxidants, and germicides, and their potential resistance to organic foulants. Two of the membranes were tested for 700 hours continuously, and were selected on the basis of criteria deemed important to an effective water reclamation system onboard spacecraft. The samples of urine were successfully processed by removing 93 percent of their water content in 70 hours using the selected membranes. Pretreatment with an acid-oxidant formulation improved product quality. Cation exchange membranes were shown to possess superior mechanical strength and chemical resistance, as compared to cellulosic membranes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Minglian; Li, Zhenguo; Zheng, Wei
The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.
Island dynamics and anisotropy during vapor phase epitaxy of m-plane GaN
Perret, Edith; Xu, Dongwei; Highland, M. J.; ...
2017-12-04
Using in situ grazing-incidence x-ray scattering, we have measured the diffuse scattering from islands that form during layer-by-layer growth of GaN by metal-organic vapor phase epitaxy on the (10more » $$\\bar{1}$$0) m-plane surface. The diffuse scattering is extended in the (0001) in-plane direction in reciprocal space, indicating a strong anisotropy with islands elongated along [1$$\\bar{2}$$10] and closely spaced along [0001]. This is confirmed by atomic force microscopy of a quenched sample. Islands were characterized as a function of growth rate F and temperature. Furthermore, the island spacing along [0001] observed during the growth of the first monolayer obeys a power-law dependence on growth rate F -n, with an exponent n=0.25±0.02. Our results are in agreement with recent kinetic Monte Carlo simulations, indicating that elongated islands result from the dominant anisotropy in step edge energy and not from surface diffusion anisotropy. The observed power-law exponent can be explained using a simple steady-state model, which gives n = 1/4.« less
Island dynamics and anisotropy during vapor phase epitaxy of m-plane GaN
DOE Office of Scientific and Technical Information (OSTI.GOV)
Perret, Edith; Xu, Dongwei; Highland, M. J.
Using in situ grazing-incidence x-ray scattering, we have measured the diffuse scattering from islands that form during layer-by-layer growth of GaN by metal-organic vapor phase epitaxy on the (1010) m-plane surface. The diffuse scattering is extended in the (0001) in-plane direction in reciprocal space, indicating a strong anisotropy with islands elongated along [1210] and closely spaced along [0001]. This is confirmed by atomic force microscopy of a quenched sample. Islands were characterized as a function of growth rate F and temperature. The island spacing along [0001] observed during the growth of the first monolayer obeys a power-law dependence on growthmore » rate F-n, with an exponent n = 0:25 + 0.02. The results are in agreement with recent kinetic Monte Carlo simulations, indicating that elongated islands result from the dominant anisotropy in step edge energy and not from surface diffusion anisotropy. The observed power-law exponent can be explained using a simple steady-state model, which gives n = 1/4.« less
Island dynamics and anisotropy during vapor phase epitaxy of m-plane GaN
DOE Office of Scientific and Technical Information (OSTI.GOV)
Perret, Edith; Xu, Dongwei; Highland, M. J.
Using in situ grazing-incidence x-ray scattering, we have measured the diffuse scattering from islands that form during layer-by-layer growth of GaN by metal-organic vapor phase epitaxy on the (10more » $$\\bar{1}$$0) m-plane surface. The diffuse scattering is extended in the (0001) in-plane direction in reciprocal space, indicating a strong anisotropy with islands elongated along [1$$\\bar{2}$$10] and closely spaced along [0001]. This is confirmed by atomic force microscopy of a quenched sample. Islands were characterized as a function of growth rate F and temperature. Furthermore, the island spacing along [0001] observed during the growth of the first monolayer obeys a power-law dependence on growth rate F -n, with an exponent n=0.25±0.02. Our results are in agreement with recent kinetic Monte Carlo simulations, indicating that elongated islands result from the dominant anisotropy in step edge energy and not from surface diffusion anisotropy. The observed power-law exponent can be explained using a simple steady-state model, which gives n = 1/4.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ciovati, Gianluigi
Radio-frequency (RF) superconducting cavities made of high purity niobium are widely used to accelerate charged particle beams in particle accelerators. The major limitation to achieve RF field values approaching the theoretical limit for niobium is represented by ''anomalous'' losses which degrade the quality factor of the cavities starting at peak surface magnetic fields of about 100 mT, in absence of field emission. These high field losses are often referred to as ''Q-drop''. It has been observed that the Q-drop is drastically reduced by baking the cavities at 120 C for about 48 h under ultrahigh vacuum. An improved oxygen diffusionmore » model for the niobium-oxide system is proposed to explain the benefit of the low-temperature baking on the Q-drop in niobium superconducting rf cavities. The model shows that baking at 120 C for 48 h allows oxygen to diffuse away from the surface, and therefore increasing the lower critical field towards the value for pure niobium.« less
NASA Technical Reports Server (NTRS)
Sunderland, P. B.; Urban, D. L.; Stocker, D. P.; Chao, B.-H.; Axelbaum, Richard L.; Salzman, Jack (Technical Monitor)
2001-01-01
Limiting conditions for soot-particle inception were studied in microgravity spherical diffusion flames burning ethylene at atmospheric pressure. Nitrogen was supplied in the fuel and/or oxidizer to obtain the broadest range of stoichiometric mixture fraction. Both normal flames (oxygen in ambience) and inverted flames (fuel in ambience) were considered. Microgravity was obtained in the NASA Glenn 2.2-second drop tower. The flames were observed with a color video camera and sooting conditions were defined as conditions for which yellow emission was present throughout the duration of the drop. Sooting limit results were successfully correlated in terms of adiabatic flame temperature and stoichiometric mixture fraction. Soot free conditions were favored by increased stoichiometric mixture fractions. No statistically significant effect of convection direction on sooting limits was observed. The relationship between adiabatic flame temperature and stoichiometric mixture fraction at the sooting limits was found to be in qualitative agreement with a simple theory based on the assumption that soot inception can occur only where temperature and local C/O ratio exceed threshold values (circa 1250 K and 1, respectively).
An Examination of the Evolution of Radiation and Advection Fogs
1993-01-01
and fog diagnostic and prediction models have developed in sophistication so that they can reproduce fairly accurate one- or two-dimensional...occurred only by molecular diffusion near the interface created between the species during the mixing process. The rate of homogenization is minimal until...of excess vapor by molecular diffusion at the interfaces of nearly saturated air mixing in eddies is faster than the relaxation time of droplet
Chromium Vaporization Reduction by Nickel Coatings For SOEC Interconnect Materials
DOE Office of Scientific and Technical Information (OSTI.GOV)
Michael V. Glazoff; Sergey N. Rashkeev; J. Stephen Herring
2014-09-01
The vaporization of Cr-rich volatile species from interconnect materials is a major source of degradation that limits the lifetime of planar solid oxide devices systems with metallic interconnects, including Solid Oxide Electrolysis Cells, or SOECs. Some metallic coatings (Ni, Co, and Cu) significantly reduce the Cr release from interconnects and slow down the oxide scale growth on the steel substrate. To shed additional light upon the mechanisms of such protection and find a suitable coating material for ferritic stainless steel materials, we used a combination of first-principles calculations, thermodynamics, and diffusion modeling to investigate which factors determine the quality ofmore » the Ni metallic coating at stainless steel interconnector. We found that the Cr migration in Ni coating is determined by a delicate combination of the nickel oxidation, Cr diffusion, and phase transformation processes. Although the formation of Cr2O3 oxide is more exothermic than that of NiO, the kinetic rate of the chromia formation in the coating layer and its surface is significantly reduced by the low mobility of Cr in nickel oxide and in NiCr2O4 spinel. These results are in a good agreement with diffusion modeling for Cr diffusion through Ni coating layer on the ferritic 441 steel substrate.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luo, Langli; Su, Mao; Yan, Pengfei
The presence of water vapor, intentional or unavoidable, is crucial to many materials applications, such as steam generator, turbine engine, fuel cell, catalyst, and corrosion 1-6. Phenomenologically, water vapor has been noticed to accelerate oxidation of metals/alloys 7,8, however, the atomistic mechanisms remain elusive. Herein, through direct in situ atomic-scale transmission electron microscopy observation and density functional theory calculation, we reveal that water vapor enhanced oxidation of Ni-Cr alloy is associated with proton dissolution promoted vacancy formation, migration and clustering. Protons derived from water dissociation occupy interstitial position in the oxide lattice, which consequently leads to the lowering of bothmore » vacancy formation energy and the cation diffusion barrier. The atomic scale observations reveal a water vapor derived proton mediated oxide growth mechanism, which provides insights for reckoning many technological processes concerning materials in moist environment at elevated temperatures.« less
NASA Astrophysics Data System (ADS)
Nagai, Shingo
2013-11-01
We report estimation of the effective diffusion coefficient of moisture through a barrier coating to develop an encapsulation technology for the thin-film electronics industry. This investigation targeted a silicon oxide (SiOx) film that was deposited on a plastic substrate by a large-process-area web coater. Using the finite difference method based on diffusion theory, our estimation of the effective diffusion coefficient of a SiOx film corresponded to that of bulk glass that was previously reported. This result suggested that the low diffusivities of barrier films can be obtained on a mass-production level in the factory. In this investigation, experimental observations and mathematical confirmation revealed the limit of the water vapor transmission rate on the single barrier coating.
Minority carrier diffusion and defects in InGaAsN grown by molecular beam epitaxy
NASA Astrophysics Data System (ADS)
Kurtz, Steven R.; Klem, J. F.; Allerman, A. A.; Sieg, R. M.; Seager, C. H.; Jones, E. D.
2002-02-01
To gain insight into the nitrogen-related defects of InGaAsN, nitrogen vibrational mode spectra, Hall mobilities, and minority carrier diffusion lengths are examined for InGaAsN (1.1 eV band gap) grown by molecular beam epitaxy (MBE). Annealing promotes the formation of In-N bonding, and lateral carrier transport is limited by large scale (≫mean free path) material inhomogeneities. Comparing solar cell quantum efficiencies with our earlier results for devices grown by metalorganic chemical vapor deposition (MOCVD), we find significant electron diffusion in the MBE material (reversed from the hole diffusion in MOCVD material), and minority carrier diffusion in InGaAsN cannot be explained by a "universal," nitrogen-related defect.
Liquid- and Gas-Phase Diffusion of Ferrocene in Thin Films of Metal-Organic Frameworks
Zhou, Wencai; Wöll, Christof; Heinke, Lars
2015-01-01
The mass transfer of the guest molecules in nanoporous host materials, in particular in metal-organic frameworks (MOFs), is among the crucial features of their applications. By using thin surface-mounted MOF films in combination with a quartz crystal microbalance (QCM), the diffusion of ferrocene vapor and of ethanolic and hexanic ferrocene solution in HKUST-1 was investigated. For the first time, liquid- and gas-phase diffusion in MOFs was compared directly in the identical sample. The diffusion coefficients are in the same order of magnitude (~10−16 m2·s−1), whereas the diffusion coefficient of ferrocene in the empty framework is roughly 3-times smaller than in the MOF which is filled with ethanol or n-hexane.
Self-wrapping of an ouzo drop induced by evaporation on a superamphiphobic surface.
Tan, Huanshu; Diddens, Christian; Versluis, Michel; Butt, Hans-Jürgen; Lohse, Detlef; Zhang, Xuehua
2017-04-12
Evaporation of multi-component drops is crucial to various technologies and has numerous potential applications because of its ubiquity in nature. Superamphiphobic surfaces, which are both superhydrophobic and superoleophobic, can give a low wettability not only for water drops but also for oil drops. In this paper, we experimentally, numerically and theoretically investigate the evaporation process of millimetric sessile ouzo drops (a transparent mixture of water, ethanol, and trans-anethole) with low wettability on a superamphiphobic surface. The evaporation-triggered ouzo effect, i.e. the spontaneous emulsification of oil microdroplets below a specific ethanol concentration, preferentially occurs at the apex of the drop due to the evaporation flux distribution and volatility difference between water and ethanol. This observation is also reproduced by numerical simulations. The volume decrease of the ouzo drop is characterized by two distinct slopes. The initial steep slope is dominantly caused by the evaporation of ethanol, followed by the slower evaporation of water. At later stages, thanks to Marangoni forces the oil wraps around the drop and an oil shell forms. We propose an approximate diffusion model for the drying characteristics, which predicts the evaporation of the drops in agreement with experiment and numerical simulation results. This work provides an advanced understanding of the evaporation process of ouzo (multi-component) drops.
Evaporation of pure liquid sessile and spherical suspended drops: a review.
Erbil, H Yildirim
2012-01-15
A sessile drop is an isolated drop which has been deposited on a solid substrate where the wetted area is limited by a contact line and characterized by contact angle, contact radius and drop height. Diffusion-controlled evaporation of a sessile drop in an ambient gas is an important topic of interest because it plays a crucial role in many scientific applications such as controlling the deposition of particles on solid surfaces, in ink-jet printing, spraying of pesticides, micro/nano material fabrication, thin film coatings, biochemical assays, drop wise cooling, deposition of DNA/RNA micro-arrays, and manufacture of novel optical and electronic materials in the last decades. This paper presents a review of the published articles for a period of approximately 120 years related to the evaporation of both sessile drops and nearly spherical droplets suspended from thin fibers. After presenting a brief history of the subject, we discuss the basic theory comprising evaporation of micrometer and millimeter sized spherical drops, self cooling on the drop surface and evaporation rate of sessile drops on solids. The effects of drop cooling, resultant lateral evaporative flux and Marangoni flows on evaporation rate are also discussed. This review also has some special topics such as drop evaporation on superhydrophobic surfaces, determination of the receding contact angle from drop evaporation, substrate thermal conductivity effect on drop evaporation and the rate evaporation of water in liquid marbles. Copyright © 2011 Elsevier B.V. All rights reserved.
Wagner, E.P. Jr.
1999-01-12
A water cooled steam jet for transferring fluid and preventing vapor lock, or vaporization of the fluid being transferred, has a venturi nozzle and a cooling jacket. The venturi nozzle produces a high velocity flow which creates a vacuum to draw fluid from a source of fluid. The venturi nozzle has a converging section connected to a source of steam, a diffuser section attached to an outlet and a throat portion disposed there between. The cooling jacket surrounds the venturi nozzle and a suction tube through which the fluid is being drawn into the venturi nozzle. Coolant flows through the cooling jacket. The cooling jacket dissipates heat generated by the venturi nozzle to prevent vapor lock. 2 figs.
1992-01-09
Materials 22 Deply of Laminated Panels with Perforation due to Impact John Lair 23 Actuator Location and Optimal Control Design for Flexible Structures...procedure is the focusing and alignment of the UV souce. Though the output of a vapor lamp is nonuniform ., intensity peaks can be smoothed by expanding the...surface, localized surface heatig may occur. Secondly, the output of a mercury vapor lame is nonuniform , requiring diffusion tc obtain a more- uniform
Dosimeter for monitoring vapors and aerosols of organic compounds
Vo-Dinh, Tuan
1987-01-01
A dosimeter is provided for collecting and detecting vapors and aerosols of organic compounds. The dosimeter comprises a lightweight, passive device that can be conveniently worn by a person as a badge or placed at a stationary location. The dosimeter includes a sample collector comprising a porous web treated with a chemical for inducing molecular displacement and enhancing phosphorescence. Compounds are collected onto the web by molecular diffusion. The web also serves as the sample medium for detecting the compounds by a room temperature phosphorescence technique.
Electrically Conductive Porous Membrane
NASA Technical Reports Server (NTRS)
Burke, Kenneth Alan (Inventor)
2014-01-01
The present invention relates to an electrically conductive membrane that can be configured to be used in fuel cell systems to act as a hydrophilic water separator internal to the fuel cell, or as a water separator used with water vapor fed electrolysis cells, or as a water separator used with water vapor fed electrolysis cells, or as a capillary structure in a thin head pipe evaporator, or as a hydrophobic gas diffusion layer covering the fuel cell electrode surface in a fuel cell.
An experimental study of air-assist atomizer spray flames
NASA Technical Reports Server (NTRS)
Mao, Chien-Pei; Wang, Geng; Chigier, Norman
1988-01-01
It is noted that air-assisted atomizer spray flames encountered in furnaces, boilers, and gas turbine combustors possess a more complex structure than homogeneous turbulent diffusion flames, due to the swirling motion introduced into the fuel and air flows for the control of flame stability, length, combustion intensity, and efficiency. Detailed comparisons are presented between burning and nonburning condition measurements of these flames obtained by nonintrusive light scattering phase/Doppler detection. Spray structure is found to be drastically changed within the flame reaction zone, with changes in the magnitude and shape of drop number density, liquid flux, mean drop size diameter, and drop mean axial velocity radial distributions.
Illustrating Chemical Concepts through Food Systems: Introductory Chemistry Experiments.
ERIC Educational Resources Information Center
Chambers, E., IV; Setser, C. S.
1980-01-01
Demonstrations involving foods that illustrate chemical concepts are described, including vaporization of liquids and Graham's law of diffusion, chemical reaction rates, adsorption, properties of solutions, colloidal dispersions, suspensions, and hydrogen ion concentration. (CS)
Development of a primary diffusion source of organic vapors for gas analyzer calibration
NASA Astrophysics Data System (ADS)
Lecuna, M.; Demichelis, A.; Sassi, G.; Sassi, M. P.
2018-03-01
The generation of reference mixtures of volatile organic compounds (VOCs) at trace levels (10 ppt-10 ppb) is a challenge for both environmental and clinical measurements. The calibration of gas analyzers for trace VOC measurements requires a stable and accurate source of the compound of interest. The dynamic preparation of gas mixtures by diffusion is a suitable method for fulfilling these requirements. The estimation of the uncertainty of the molar fraction of the VOC in the mixture is a key step in the metrological characterization of a dynamic generator. The performance of a dynamic generator was monitored over a wide range of operating conditions. The generation system was simulated by a model developed with computational fluid dynamics and validated against experimental data. The vapor pressure of the VOC was found to be one of the main contributors to the uncertainty of the diffusion rate and its influence at 10-70 kPa was analyzed and discussed. The air buoyancy effect and perturbations due to the weighing duration were studied. The gas carrier flow rate and the amount of liquid in the vial were found to play a role in limiting the diffusion rate. The results of sensitivity analyses were reported through an uncertainty budget for the diffusion rate. The roles of each influence quantity were discussed. A set of criteria to minimize the uncertainty contribution to the primary diffusion source (25 µg min-1) were estimated: carrier gas flow rate higher than 37.7 sml min-1, a maximum VOC liquid mass decrease in the vial of 4.8 g, a minimum residual mass of 1 g and vial weighing times of 1-3 min. With this procedure a limit uncertainty of 0.5% in the diffusion rate can be obtained for VOC mixtures at trace levels (10 ppt-10 ppb), making the developed diffusion vials a primary diffusion source with potential to become a new reference material for trace VOC analysis.
Development and Application of a Three-Dimensional Finite Element Vapor Intrusion Model
Pennell, Kelly G.; Bozkurt, Ozgur; Suuberg, Eric M.
2010-01-01
Details of a three-dimensional finite element model of soil vapor intrusion, including the overall modeling process and the stepwise approach, are provided. The model is a quantitative modeling tool that can help guide vapor intrusion characterization efforts. It solves the soil gas continuity equation coupled with the chemical transport equation, allowing for both advective and diffusive transport. Three-dimensional pressure, velocity, and chemical concentration fields are produced from the model. Results from simulations involving common site features, such as impervious surfaces, porous foundation sub-base material, and adjacent structures are summarized herein. The results suggest that site-specific features are important to consider when characterizing vapor intrusion risks. More importantly, the results suggest that soil gas or subslab gas samples taken without proper regard for particular site features may not be suitable for evaluating vapor intrusion risks; rather, careful attention needs to be given to the many factors that affect chemical transport into and around buildings. PMID:19418819
The influence of magma degassing on entrapment pressures recorded in olivine-hosted melt inclusions
NASA Astrophysics Data System (ADS)
Gaetani, G. A.
2013-12-01
The concentrations of H2O and CO2 in olivine-hosted melt inclusions provide estimates for the pressures at which they were entrapped, and represent an important source of information on the depths at which basaltic magmas crystallize [1]. Results from recent dehydration experiments demonstrate that diffusive loss of H2O from melt inclusions, driven by degassing of the external magma, leads to significant decreases to pressure within the inclusion [2, 3]. This, in turn, lowers the solubility of CO2 in the included melt causing a vapor to exsolve and form a bubble. This process has the potential to significantly modify estimates of entrapment pressures derived from volatile concentrations in olivine hosted melt inclusions. I have developed a quantitative model that describes this process, allowing the influence of degassing on entrapment pressures to be rigorously evaluated. Diffusive loss of H2O from the inclusions was determined using the model of [3]. An equation of state (EOS) for the silicate melt was taken from the results of [4] and [5], while the EOS for H2O-CO2 vapor was taken from [6]. The solubilities of H2O and CO2 in the silicate melt were derived from VolatileCalc [7]. Modeling results demonstrate that degassing of H2O-rich magma produces significant pressure drops, so that entrapment pressures never exceed crustal values and always represent a minimum. Conversely, degassing of H2O-poor magma does not significantly perturb the H2O content of olivine-hosted melt inclusions. Therefore, these inclusions preserve reliable records of the pressures at which they were entrapped. These results are consistent with a global compilation of olivine-hosted melt inclusion entrapment pressures presented by [3]. References: [1] Wanless, VD, and Shaw, AM, Nature Geosci, 5, 651-655 (2012); [2] Gaetani, GA, et al., Geology, 40, 915-918 (2012); [3] Bucholz, CE, et al., Earth Planet Sci Lett, 374, 145-155 (2013); [4] Lange, R. A., and Carmichael, ISE, Geochim Cosmochim Acta, 51, 2931-2946, (1987); [5] Kress, VC, and Carmichael, ISE, Contrib Mineral Petrol, 108, 82-92 (1991); [6] Duan, Z, and Zhang, Z, Geochim Cosmochim Acta, 70, 2311-2324 (2006); [7] Newman, S, and Lowenstern, JB, Comput Geosci, 28, 597-604 (2002).
NASA Astrophysics Data System (ADS)
Mombrú, Dominique; Romero, Mariano; Faccio, Ricardo; Mombrú, Alvaro W.
2017-12-01
Here, we report a novel strategy for the preparation of TiO2 quantum dots fillers prepared from alkoxide precursor via in situ water vapor flow diffusion into poly(N-vinylcarbazole) host. A detailed characterization by means of infrared and Raman spectroscopy, X-ray powder diffraction, small angle X-ray scattering and differential scanning calorimetry is reported. The growth mechanism of both crystallites and particles was mostly governed by the classical coarsening reaction limited growth and the polymer host showed no detectable chemical modifications at the interface or active participation in the growing process. The main relevance of our strategy respect to the typical sol-gel growth in solution is the possibility of the interruption of the reaction by simple stopping the water vapor flow diffusion into the polymer host thus achieving good control in the nanoparticles size. The thermal stability and fractal behavior of our nanocomposites were also studied by differential scanning calorimetry and in situ small angle X-ray scattering versus temperature. Strong correlations between modifications in the fractal behavior and glass transition or fusion processes were observed for these nanocomposites.
Biodegradation of vapor-phase toluene in unsaturated porous media: Column experiments.
Khan, Ali M; Wick, Lukas Y; Harms, Hauke; Thullner, Martin
2016-04-01
Biodegradation of organic chemicals in the vapor phase of soils and vertical flow filters has gained attention as promising approach to clean up volatile organic compounds (VOC). The drivers of VOC biodegradation in unsaturated systems however still remain poorly understood. Here, we analyzed the processes controlling aerobic VOC biodegradation in a laboratory setup mimicking the unsaturated zone above a shallow aquifer. The setup allowed for diffusive vapor-phase transport and biodegradation of three VOC: non-deuterated and deuterated toluene as two compounds of highly differing biodegradability but (nearly) identical physical and chemical properties, and MTBE as (at the applied experimental conditions) non-biodegradable tracer and internal control. Our results showed for toluene an effective microbial degradation within centimeter VOC transport distances despite high gas-phase diffusivity. Degradation rates were controlled by the reactivity of the compounds while oxic conditions were found everywhere in the system. This confirms hypotheses that vadose zone biodegradation rates can be extremely high and are able to prevent the outgassing of VOC to the atmosphere within a centimeter range if compound properties and site conditions allow for sufficiently high degradation rates. Copyright © 2016 Elsevier Ltd. All rights reserved.
Laboratory Evaluation of Drop-in Solvent Alternatives to n-Propyl Bromide for Vapor Degreasing
2012-05-01
Center Nikki M. Lowrey Jacobs Technology, Inc. Environment, Energy Security, & Sustainability Symposium New Orleans, LA May 21-24, 2012 Report ...Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting burden for the collection of information is estimated to average 1 hour per...suggestions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports , 1215 Jefferson Davis
The interaction of evaporative and convective instabilities
NASA Astrophysics Data System (ADS)
Ozen, O.
Evaporative convection arises in a variety of natural and industrial processes, such as drying of lakebeds, heat pipe technology and dry-eye syndrome. The phenomenon of evaporative convection leads to an interfacial instability where an erstwhile flat surface becomes undulated as a control variable, such as temperature drop, exceeds a critical value. This instability has been investigated by others assuming that the vapor phase is infinitely deep and passive, i.e. vapor fluid dynamics has been ignored. However, when we look at some engineering processes, such as distillation columns, heat pipes and drying technologies where phase change takes place we might imagine that the assumption of an infinitely deep vapor layer or at least that of a passive vapor is inappropriate. Previous work on convection in bilayer systems with no phase-change suggests that active vapor layers play a major role in determining the stability of an interface. Hence, for the case of convection with phase-change, we will address this issue and try to answer the question whether the infinitely deep and passive vapor layer is a valid assumption. We have also investigated, theoretically, the gravity and surface tension gradient-driven instabilities occurring during the evaporation of a liquid into its own vapor taking into account the fluid dynamics of both phases and the finiteness of the domains of each phase, i.e. the liquid and its vapor are assumed to be confined between two horizontal plates, and different heating arrangements are applied. The effects of fluid layer depths, the evaporation rate and the temperature gradient applied across the fluids on the stability of the interface are studied. The modes of the flow pattern are determined for each scenario. The physics of the instability are explained and a comparison is made with the results of similar, yet physically different problems.
Water vapor distribution in protoplanetary disks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, Fujun; Bergin, Edwin A., E-mail: fdu@umich.edu
Water vapor has been detected in protoplanetary disks. In this work, we model the distribution of water vapor in protoplanetary disks with a thermo-chemical code. For a set of parameterized disk models, we calculate the distribution of dust temperature and radiation field of the disk with a Monte Carlo method, and then solve the gas temperature distribution and chemical composition. The radiative transfer includes detailed treatment of scattering by atomic hydrogen and absorption by water of Lyα photons, since the Lyα line dominates the UV spectrum of accreting young stars. In a fiducial model, we find that warm water vapormore » with temperature around 300 K is mainly distributed in a small and well-confined region in the inner disk. The inner boundary of the warm water region is where the shielding of UV field due to dust and water itself become significant. The outer boundary is where the dust temperature drops below the water condensation temperature. A more luminous central star leads to a more extended distribution of warm water vapor, while dust growth and settling tends to reduce the amount of warm water vapor. Based on typical assumptions regarding the elemental oxygen abundance and the water chemistry, the column density of warm water vapor can be as high as 10{sup 22} cm{sup –2}. A small amount of hot water vapor with temperature higher than ∼300 K exists in a more extended region in the upper atmosphere of the disk. Cold water vapor with temperature lower than 100 K is distributed over the entire disk, produced by photodesorption of the water ice.« less
Nucleation and growth of crystals under cirrus and polar stratospheric cloud conditions
NASA Technical Reports Server (NTRS)
Hallett, John; Queen, Brian; Teets, Edward; Fahey, James
1995-01-01
Laboratory studies examine phase changes of hygroscopic substances which occur as aerosol in stratosphere and troposphere (sodium chloride, ammonium sulfate, ammonium bisulfate, nitric acid, sulfuric acid), under controlled conditions, in samples volume 1 to 10(exp -4) ml. Crystallization of salts from supersaturated solutions is examined by slowly evaporating a solution drop on a substrate, under controlled relative humidity, until self nucleation occurs; controlled nucleation of ice in a mm capillary U-tube gives a measured ice crystallization velocity at known supercooling. Two states of crystallization occur for regions where hydrates exist. It is inferred that all of the materials readily exist as supersaturated/supercooled solutions; the degree of metastability appears to be slightly enhanced by inclusion of aircraft produced soot. The crystallization velocity is taken as a measure of viscosity. Results suggest an approach to a glass transition at high molality, supersaturation and/or supercooling within the range of atmospheric interest. It is hypothesized that surface reactions occur more readily on solidified particles - either crystalline or glass, whereas volume reactions are more important on droplets with sufficiently low viscosity and volume diffusivity. Implications are examined for optical properties of such particles in the atmosphere. In a separate experiment, crystal growth was examined in a modified thermal vapor diffusion chamber over the range of cirrus temperature (-30 to -70 C) and under controlled supersaturation and air pressure. The crystals grew at a velocity of 1-2 microns/s, thickness 60-70 micron, in the form of thin column crystals. Design criteria are given for a system to investigate particle growth down to -100 C, (PSC temperatures) where nitric acid particles can be grown under similar control and in the form of hydrate crystals.
Maximum drop radius and critical Weber number for splashing in the dynamical Leidenfrost regime
NASA Astrophysics Data System (ADS)
Riboux, Guillaume; Gordillo, Jose Manuel
2015-11-01
At room temperature, when a drop impacts against a smooth solid surface at a velocity above the so called critical velocity for splashing, the drop loses its integrity and fragments into tiny droplets violently ejected radially outwards. Below this critical velocity, the drop simply spreads over the substrate. Splashing is also reported to occur for solid substrate temperatures above the Leidenfrost temperature, T, for which a vapor layer prevents the drop from touching the substrate. In this case, the splashing morphology largely differs from the one reported at room temperature because, thanks to the presence of the gas layer, the shear stresses on the liquid do not decelerate the ejected lamella. Our purpose here is to predict, for wall temperatures above T, the dependence of the critical impact velocity on the temperature of the substrate as well as the maximum spreading radius for impacting velocities below the critical velocity for splashing. This is done making use of boundary integral simulations, where the velocity and the height of the liquid layer at the root of the ejected lamella are calculated numerically. This information constitutes the initial conditions for the one dimensional mass and momentum equations governing the dynamics of the toroidal rim limiting the edge of the lamella.
Rapid vertical trace gas transport by an isolated midlatitude thunderstorm
NASA Astrophysics Data System (ADS)
Hauf, Thomas; Schulte, Peter; Alheit, Reiner; Schlager, Hans
1995-11-01
During the cloud dynamics and chemistry field experiment CLEOPATRA in the summer of 1992 in southern Germany, the Deutsche Forschungsanstalt für Luft- und Raumfahrt (DLR) (German Aerospace Research Establishment) research aircraft Falcon traversed four times the anvil of a severe, isolated thunderstorm. The first two traverses were at 8 km altitude and close to the anvil cloud base, while the second two traverses were at 10 km. During the 8-km traverse, measured ozone mixing ratios dropped by 13 parts per billion by volume (ppbv) from the ambient cloud free environment to the anvil cloud, while water vapor increased by 0.3 g kg-1. At the 10-km traverses, ozone dropped by 25 ppbv, while water vapor increased by 0.18 g kg-1. Three-dimensional numerical thunderstorm simulations were performed to understand the cause of these changes. The simulations included the transport of two chemical inert tracers. Ozone was assumed to be one of them. The initial ozone profile was composed from an ozone routine sounding and the in situ Falcon measurements prior to the thunderstorm development. The second tracer is typical for a surface released pollutant with a nonzero, constant value in the boundary layer but zero above it. The redistribution of both tracers by the storm is calculated and compared with the observations. For the anvil penetration at 10 km, the calculated difference in ozone mixing ratios is 21 ppbv, while for water vapor an increase of 0.25 g kg-1 was found, in good agreement with the observations. To validate the model results, the radar reflectivity was calculated from simulated fields of cloud water, rain, graupel, hail, and snow and ice crystals and compared with observed values. With respect to maximum reflectivity values and spatial scales, again, excellent agreement was achieved. It is concluded that the rapid transport from the boundary layer directly into the anvil level is the most likely cause of the observed ozone decrease and water vapor increase. Entrainment of ozone-rich environmental air into the anvil cloud occurred but left a protected core with undiluted boundary layer air in the anvil cloud even at a distance of 120 km from the main updraft. Processes such as production of O3 by electrical discharges, chemical reactions of ozone with boundary layer-released or lightning-produced nitrogen compounds, scavenging by hydrometeors, and heterogeneous reactions at the surface of ice crystals may occur, but on the timescale of 0.5-1 hour seem to have a negligible influence on the observed ozone drop.
Yokota, Takehiro; Nara, Yukinori; Kashima, Akiko; Matsubara, Keiko; Misawa, Satoru; Kato, Ryohei; Sugio, Shigetoshi
2007-02-01
Human JNK stimulatory phosphatase-1 (JSP-1) is a novel member of dual specificity phosphatases. A C-terminus truncated JSP-1 was expressed in Escherichia coli and was crystallized using the sitting-drop vapor diffusion method. Thin-plate crystals obtained at 278 K belong to a monoclinic space group, C2, with unit-cell parameters a = 84.0 A, b = 49.3 A, c = 47.3 A, and beta = 119.5 degrees , and diffract up to 1.5 A resolution at 100 K. The structure of JSP-1 has a single compact (alpha/beta) domain, which consists of six alpha-helices and five beta-strands, and shows a conserved structural scaffold in regard to both DSPs and PTPs. A cleft formed by a PTP-loop at the active site is very shallow, and is occupied by one sulfonate compound, MES, at the bottom. In the binary complex structure of JSP-1 with MES, the conformations of three important segments in regard to the catalytic mechanism are not similar to those in PTP1B. JSP-1 has no loop corresponding to the Lys120-loop of PTP1B, and tryptophan residue corresponding to the substrate-stacking in PTP1B is substituted by alanine residue in JSP-1. Copyright 2006 Wiley-Liss, Inc.
Purification, characterization, and crystallization of Crocodylus siamensis hemoglobin.
Jandaruang, Jinda; Siritapetawee, Jaruwan; Songsiriritthigul, Chomphunuch; Preecharram, Sutthidech; Azuma, Taoka; Dhiravisit, Apisak; Fukumori, Yoshihiro; Thammasirirak, Sompong
2014-08-01
Crocodylus siamensis hemoglobin was purified by a size exclusion chromatography, Sephacryl S-100 with buffer containing dithiothreitol. The purified Hb was dissociated to be two forms (α chain and β chain) which observed by SDS-PAGE, indicated that the C. siamensis Hb was an unpolymerized form. The unpolymerized Hb (composed of two α chains and two β chains) showed high oxygen affinity at 3.13 mmHg (P(50)) and 1.96 (n value), and a small Bohr effect (δH(+) = -0.29) at a pH of 6.9-8.4. Adenosine triphosphate did not affect the oxygenation properties, whereas bicarbonate ions strongly depressed oxygen affinity. Crude C. siamensis Hb solutions were showed high O(2) affinity at P(50) of 2.5 mmHg which may assure efficient utilization of the lung O(2) reserve during breath holding and diving. The purified Hbs were changed to cyanmethemoglobin forms prior crystallization. Rod- and plate-shaped crystals were obtained by the sitting-drop vapor-diffusion method at 5 °C using equal volumes of protein solution (37 mg/ml) and reservoir [10-13 % (w/v) PEG 4000, with 0.1 M Tris buffer in present of 0.2 M MgCl(2)·6H(2)O] solution at a pH of 7.0-8.5.
Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen
2008-07-09
The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.
Lai, Yu-Hsuan; Yang, Jing-Tang; Shieh, Dar-Bin
2010-02-21
A wettability gradient to transport a droplet across superhydrophobic to hydrophilic surfaces is fabricated on combining a structure gradient and a self-assembled-monolayer (SAM) gradient. The combination of these two gradients is realized with a simple but versatile SAM technique, in which the textured silicon wafer strip is placed vertically in a bottle that contains a decyltrichlorosilane solution to form concurrently a saturated SAM below the liquid surface and a wettability gradient above. The platform fabricated in this way has a water-contact angle from 151.2 degrees to 39.7 degrees; the self-transport distance is hence increased significantly to about 9 mm. A theoretical model that approximates the shape of a moving drop to a spheroidal cap is developed to predict the self-transport behavior. Satisfactory agreement is shown for most regions except where the hysteresis effect is unmeasurable and an unsymmetrical deformation occurs. A double-directional gradient surface to alter the direction of movement of a droplet is also realized. The platforms we developed serve not only to transport a fluid over a long distance but also for a broad spectrum of biomedical applications such as protein adsorption, cell adhesion and DNA-based biosensors.
Shih, Po-Hsun; Wu, Sheng Yun
2017-07-21
Plenty of studies have been performed to probe the diverse properties of ZnO nanowires, but only a few have focused on the physical properties of a single nanowire since analyzing the growth mechanism along a single nanowire is difficult. In this study, a single ZnO nanowire was synthesized using a Ti-assisted chemical vapor deposition (CVD) method to avoid the appearance of catalytic contamination. Two-dimensional energy dispersive spectroscopy (EDS) mapping with a diffusion model was used to obtain the diffusion length and the activation energy ratio. The ratio value is close to 0.3, revealing that the growth of ZnO nanowires was attributed to the short-circuit diffusion.
Kinetic Monte Carlo Simulation of Oxygen Diffusion in Ytterbium Disilicate
NASA Astrophysics Data System (ADS)
Good, Brian
2015-03-01
Ytterbium disilicate is of interest as a potential environmental barrier coating for aerospace applications, notably for use in next generation jet turbine engines. In such applications, the diffusion of oxygen and water vapor through these coatings is undesirable if high temperature corrosion is to be avoided. In an effort to understand the diffusion process in these materials, we have performed kinetic Monte Carlo simulations of vacancy-mediated oxygen diffusion in Ytterbium Disilicate. Oxygen vacancy site energies and diffusion barrier energies are computed using Density Functional Theory. We find that many potential diffusion paths involve large barrier energies, but some paths have barrier energies smaller than one electron volt. However, computed vacancy formation energies suggest that the intrinsic vacancy concentration is small in the pure material, with the result that the material is unlikely to exhibit significant oxygen permeability.
NASA Astrophysics Data System (ADS)
Abani, Neerav; Reitz, Rolf D.
2010-09-01
An advanced mixing model was applied to study engine emissions and combustion with different injection strategies ranging from multiple injections, early injection and grouped-hole nozzle injection in light and heavy duty diesel engines. The model was implemented in the KIVA-CHEMKIN engine combustion code and simulations were conducted at different mesh resolutions. The model was compared with the standard KIVA spray model that uses the Lagrangian-Drop and Eulerian-Fluid (LDEF) approach, and a Gas Jet spray model that improves predictions of liquid sprays. A Vapor Particle Method (VPM) is introduced that accounts for sub-grid scale mixing of fuel vapor and more accurately and predicts the mixing of fuel-vapor over a range of mesh resolutions. The fuel vapor is transported as particles until a certain distance from nozzle is reached where the local jet half-width is adequately resolved by the local mesh scale. Within this distance the vapor particle is transported while releasing fuel vapor locally, as determined by a weighting factor. The VPM model more accurately predicts fuel-vapor penetrations for early cycle injections and flame lift-off lengths for late cycle injections. Engine combustion computations show that as compared to the standard KIVA and Gas Jet spray models, the VPM spray model improves predictions of in-cylinder pressure, heat released rate and engine emissions of NOx, CO and soot with coarse mesh resolutions. The VPM spray model is thus a good tool for efficiently investigating diesel engine combustion with practical mesh resolutions, thereby saving computer time.
Diffusion of vaporous guests into a seemingly non-porous organic crystal
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herbert, Simon A.; Janiak, Agnieszka; Thallapally, Praveen K.
2014-10-07
In this research, the tetragonal apohost phase of p-tert-butyltetramethoxythiacalix[4]arene absorbs hydrochloric acid and iodine. These guest molecules occupy different sites in the solid-state structure -- either within the small intrinsic voids of the macrocycle or within the interstitial spaces between the host molecules. This study illustrates the dynamic deformation of the host, providing strong mechanistic insight into the diffusion of guests into this seemingly non-porous material.
Self Regulating Fiber Fuel Cell
2010-08-16
12000 68.2 77.4 24/7 Extreme Rigid liquid hydrogen fuel cell Medis 68 X 97 X 57 20000 53.2 108.1 Fiber Fuel Cell Flexible Individual fiber Honeywell...which allows hydrogen and water vapor to permeate freely but prevents liquids from entering or fuel particles from escaping. The SPM permeability...S is the solubility and D is the diffusivity. Solubility and diffusivity data vs. pressure for hydrogen in Nafion is not available in the literature
ERIC Educational Resources Information Center
Shaw, G. W.; And Others
1989-01-01
Provides a reading list for A- and S-level biology. Contains several experiments and demonstrations with topics on: the intestine, bullock corneal cells, valences, the science of tea, automated hydrolysis, electronics characteristics, bromine diffusion, enthalpy of vaporization determination, thermometers, pendulums, hovercraft, Bernoulli fluid…
NASA Technical Reports Server (NTRS)
Tacina, R.
1976-01-01
A premixing-prevaporizing fuel system for a gas turbine catalytic combustor has been developed and evaluated. Spatial fuel distribution and degree of vaporization were measured at inlet temperatures up to 800 K and fuel-air ratios of 0.01 and 0.025. The test pressure was 0.5 MPa; velocity was 20 m/sec. Both a multiple-jet cross-stream injector and a splash-groove injector with a 30 deg air swirler exhibited a uniform fuel distribution and a high degree of vaporization with little total pressure drop. Fuel oxidation reactions were observed at the 800 K inlet air temperature, indicating that a different design concept is necessary for application with an automotive gas turbine.
NASA Astrophysics Data System (ADS)
Attari Moghaddam, Alireza; Prat, Marc; Tsotsas, Evangelos; Kharaghani, Abdolreza
2017-12-01
The classical continuum modeling of evaporation in capillary porous media is revisited from pore network simulations of the evaporation process. The computed moisture diffusivity is characterized by a minimum corresponding to the transition between liquid and vapor transport mechanisms confirming previous interpretations. Also the study suggests an explanation for the scattering generally observed in the moisture diffusivity obtained from experimental data. The pore network simulations indicate a noticeable nonlocal equilibrium effect leading to a new interpretation of the vapor pressure-saturation relationship classically introduced to obtain the one-equation continuum model of evaporation. The latter should not be understood as a desorption isotherm as classically considered but rather as a signature of a nonlocal equilibrium effect. The main outcome of this study is therefore that nonlocal equilibrium two-equation model must be considered for improving the continuum modeling of evaporation.
Kyoungjin An, Alicia; Lee, Eui-Jong; Guo, Jiaxin; Jeong, Sanghyun; Lee, Jung-Gil; Ghaffour, Noreddine
2017-01-01
To ascertain membrane distillation (MD) as an emerging desalination technology to meet the global water challenge, development of membranes with ideal material properties is crucial. Functionalized carbon nanotubes (CNTs) were anchored to nanofibres of electrospun membranes. Covalent modification and fluorination of CNTs improved their dispersibility and interfacial interaction with the polymer membrane, resulting in well-aligned CNTs inside crystalline fibres with superhydrophobicity. Consideration for the chemical/physical properties of the CNT composite membranes and calculation of their theoretical fluxes revealed the mechanism of MD: CNTs facilitated the repulsive force for Knudsen and molecular diffusions, reduced the boundary-layer effect in viscous flow, and assisted surface diffusion, allowing for fast vapor transport with anti-wetting. This study shows that the role of CNTs and an optimal composite ratio can be used to reduce the gap between theoretical and experimental approaches to desalination. PMID:28134288
NASA Astrophysics Data System (ADS)
Kyoungjin An, Alicia; Lee, Eui-Jong; Guo, Jiaxin; Jeong, Sanghyun; Lee, Jung-Gil; Ghaffour, Noreddine
2017-01-01
To ascertain membrane distillation (MD) as an emerging desalination technology to meet the global water challenge, development of membranes with ideal material properties is crucial. Functionalized carbon nanotubes (CNTs) were anchored to nanofibres of electrospun membranes. Covalent modification and fluorination of CNTs improved their dispersibility and interfacial interaction with the polymer membrane, resulting in well-aligned CNTs inside crystalline fibres with superhydrophobicity. Consideration for the chemical/physical properties of the CNT composite membranes and calculation of their theoretical fluxes revealed the mechanism of MD: CNTs facilitated the repulsive force for Knudsen and molecular diffusions, reduced the boundary-layer effect in viscous flow, and assisted surface diffusion, allowing for fast vapor transport with anti-wetting. This study shows that the role of CNTs and an optimal composite ratio can be used to reduce the gap between theoretical and experimental approaches to desalination.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saylor, David M.; Jawahery, Sudi; Silverstein, Joshua S.
2016-07-21
We investigate the link between dynamic localization, characterized by the Debye–Waller factor, 〈u{sup 2}〉, and solute self-diffusivity, D, in a polymer system using atomistic molecular dynamics simulations and vapor sorption experiments. We find a linear relationship between lnD and 1/〈u{sup 2}〉 over more than four decades of D, encompassing most of the glass formation regime. The observed linearity is consistent with the Langevin dynamics in a periodically varying potential field and may offer a means to rapidly assess diffusion based on the characterization of dynamic localization.
Update on Advection-Diffusion Purge Flow Model
NASA Technical Reports Server (NTRS)
Brieda, Lubos
2015-01-01
Gaseous purge is commonly used in sensitive spacecraft optical or electronic instruments to prevent infiltration of contaminants and/or water vapor. Typically, purge is sized using simplistic zero-dimensional models that do not take into account instrument geometry, surface effects, and the dependence of diffusive flux on the concentration gradient. For this reason, an axisymmetric computational fluid dynamics (CFD) simulation was recently developed to model contaminant infiltration and removal by purge. The solver uses a combined Navier-Stokes and Advection-Diffusion approach. In this talk, we report on updates in the model, namely inclusion of a particulate transport model.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schmidtbauer, Jan; Bansen, Roman; Heimburger, Robert
Germanium nanowires (NWs) were grown onto Ge(111) substrates by the vapor-liquid-solid process using gold droplets. The growth was carried out in a molecular beam epitaxy chamber at substrate temperatures between 370 Degree-Sign C and 510 Degree-Sign C. The resulting nanowire growth rate turns out to be highly dependent on the substrate temperature exhibiting the maximum at T = 430 Degree-Sign C. The temperature dependence of growth rate can be attributed to surface diffusion both along the substrate and nanowire sidewalls. Analyzing the diffusive material transport yields a diffusion length of 126 nm at a substrate temperature of 430 Degree-Sign C.
Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki
2007-09-01
Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qureshi, Insaf A.; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in
2006-09-01
A 24 kDa protein was purified from the seeds of L. sativus by ammonium sulfate fractionation and ion-exchange chromatography. Crystals were obtained by the hanging-drop vapour-diffusion method. A 24 kDa protein was purified from the seeds of Lathyrus sativus by ammonium sulfate fractionation and ion-exchange chromatography. The N-terminal amino-acid sequence showed significant homology with the 2S albumin class of seed storage proteins. The protein showed 85% sequence homology with the seed albumin of Pisum sativum within the 40 N-terminal residues. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cellmore » parameters a = 43.5, b = 82.7, c = 153.4 Å.« less
Comprehensive analysis of earthquake source spectra and swarms in the Salton Trough, California
NASA Astrophysics Data System (ADS)
Chen, X.; Shearer, P. M.
2011-09-01
We study earthquakes within California's Salton Trough from 1981 to 2009 from a precisely relocated catalog. We process the seismic waveforms to isolate source spectra, station spectra and travel-time dependent spectra. The results suggest an average P wave Q of 340, agreeing with previous results indicating relatively high attenuation in the Salton Trough. Stress drops estimated from the source spectra using an empirical Green's function (EGF) method reveal large scatter among individual events but a low median stress drop of 0.56 MPa for the region. The distribution of stress drop after applying a spatial-median filter indicates lower stress drops near geothermal sites. We explore the relationships between seismicity, stress drops and geothermal injection activities. Seismicity within the Salton Trough shows strong spatial clustering, with 20 distinct earthquake swarms with at least 50 events. They can be separated into early-Mmax and late-Mmax groups based on the normalized occurrence time of their largest event. These swarms generally have a low skew value of moment release history, ranging from -9 to 3.0. The major temporal difference between the two groups is the excess of seismicity and an inverse power law increase of seismicity before the largest event for the late-Mmax group. All swarms exhibit spatial migration of seismicity at a statistical significance greater than 85%. A weighted L1-norm inversion of linear migration parameters yields migration velocities from 0.008 to 0.8 km/hour. To explore the influence of fluid injection in geothermal sites, we also model the migration behavior with the diffusion equation, and obtain a hydraulic diffusion coefficient of approximately 0.25 m2/s for the Salton Sea geothermal site, which is within the range of expected values for a typical geothermal reservoir. The swarms with migration velocities over 0.1 km/hour cannot be explained by the diffusion curve, rather, their velocity is consistent with the propagation velocity of creep and slow slip events. These variations in migration behavior allow us to distinguish among different driving processes.
Verginelli, Iason; Yao, Yijun; Suuberg, Eric M.
2017-01-01
In this study we present a petroleum vapor intrusion tool implemented in Microsoft® Excel® using Visual Basic for Applications (VBA) and integrated within a graphical interface. The latter helps users easily visualize two-dimensional soil gas concentration profiles and indoor concentrations as a function of site-specific conditions such as source strength and depth, biodegradation reaction rate constant, soil characteristics and building features. This tool is based on a two-dimensional explicit analytical model that combines steady-state diffusion-dominated vapor transport in a homogeneous soil with a piecewise first-order aerobic biodegradation model, in which rate is limited by oxygen availability. As recommended in the recently released United States Environmental Protection Agency's final Petroleum Vapor Intrusion guidance, a sensitivity analysis and a simplified Monte Carlo uncertainty analysis are also included in the spreadsheet. PMID:28163564
Verginelli, Iason; Yao, Yijun; Suuberg, Eric M
2016-01-01
In this study we present a petroleum vapor intrusion tool implemented in Microsoft ® Excel ® using Visual Basic for Applications (VBA) and integrated within a graphical interface. The latter helps users easily visualize two-dimensional soil gas concentration profiles and indoor concentrations as a function of site-specific conditions such as source strength and depth, biodegradation reaction rate constant, soil characteristics and building features. This tool is based on a two-dimensional explicit analytical model that combines steady-state diffusion-dominated vapor transport in a homogeneous soil with a piecewise first-order aerobic biodegradation model, in which rate is limited by oxygen availability. As recommended in the recently released United States Environmental Protection Agency's final Petroleum Vapor Intrusion guidance, a sensitivity analysis and a simplified Monte Carlo uncertainty analysis are also included in the spreadsheet.
Atomic origins of water-vapour-promoted alloy oxidation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luo, Langli; Su, Mao; Yan, Pengfei
The presence of water vapor, intentional or unavoidable, is crucial to many materials applications, such as steam generator, turbine engine, fuel cell, catalyst, and corrosion 1-6. Phenomenologically, water vapor has been noticed to accelerate oxidation of metals/alloys 7,8, however, the atomistic mechanisms remain elusive. Herein, through direct in situ atomic-scale transmission electron microscopy observation and density functional theory calculation, we reveal that water vapor enhanced oxidation of Ni-Cr alloy is associated with proton dissolution promoted vacancy formation, migration and clustering. Protons derived from water dissociation occupy interstitial position in the oxide lattice, which consequently leads to the lowering of bothmore » vacancy formation energy and the cation diffusion barrier. The atomic scale observations reveal a water vapor derived proton mediated oxide growth mechanism, which provides insights for reckoning many technological processes concerning materials in moist environment at elevated temperatures.« less
NASA Technical Reports Server (NTRS)
Purdy, K. R.; Ventrice, M. B.; Fang, J.
1972-01-01
Analytical and experimental studies were initiated to determine if the response of a constant temperature hot wire anemometer to acoustic oscillations could serve as an analog to the response of the drop vaporization burning rate process to acoustic oscillations, and, perhaps, also as an analog to any Reynolds number dependent process. The motivation behind this study was a recent analytical study which showed that distorted acoustic oscillations could amplify the open-loop response of vaporization limited combustion. This type of amplification may be the cause of unstable combustion in liquid propellant rocket engines. The analytical results obtained for the constant temperature anemometer are similar in nature to those previously obtained for vaporization limited combustion and indicate that the response is dependent on the amount and type of distortion as well as other factors, such as sound pressure level, Mach number and hot wire temperature. Preliminary results indicate qualitative agreement between theory and experiment.
Ho, Thao T T; Zimmermann, Tanja; Ohr, Steffen; Caseri, Walter R
2012-09-26
Composites of trimethylammonium-modified nanofibrillated cellulose and layered silicates (TMA-NFC/LS) were prepared by high-shear homogenization followed by pressure filtration and vacuum hot-pressing, which gave rise to particularly homogeneous dispersion of the silicate particles. Thirteen different clays and micas were employed. Water vapor barrier and mechanical properties (tensile strength, E-modulus, strain at break) of the composite films were investigated, considering the effects of layered silicate types and their concentration (in the range of 0 to 85 wt %). Good interactions between TMA-NFC and LS were obtained due to electrostatic attraction between cationic fibrils and anionic silicate layers, and even favored by high-shear homogenization process. Furthermore, oriented TMA-NFC/LS composite structure was achieved. Layered silicates exerted a pronounced influence on the water vapor barrier and mechanical properties; however, there was no common trend reflecting their types. The transport of water molecules through TMA-NFC/LS composites was studied considering both diffusion and adsorption mechanisms. As a result, diffusion pathways were proposed based on two new and one well-known models: the "native network", "covered fiber composite", and "fiber-brick composite" models. Importantly, it was found that the insertion of layered silicate particles did not improve automatically the barrier properties as indicated by the commonly used "fiber-brick composite" model. Mica R120 at a 50 wt % loading in composites with TMA-NFC matrix showed 30-fold improved water vapor permeability and 5-fold higher E-modulus compared to commercially used base paper.
Drug Delivery for Peripheral Nerve Regeneration
2014-09-01
1. Introduction 4 2. Keywords 4 3. Accomplishments 4 4. Impact 15 5. Changes/Problems 16 6. Products 17 7. Participants & Other... enzymatically and under adverse pH levels • Diffusion dropped dramatically after 6 days Figure 8 shows that the diffusion rate is independent of loaded...efficacy of the device using in-vitro and DRG studies. This data will help researchers/ industry to further develop drug delivery efforts in other areas
Choi, Jae-Hwan; Park, Jin-Soo; Moon, Seung-Hyeon
2002-07-15
In this study the concentration distributions within the diffusion boundary layer were obtained by directly measuring the potential drops while the currents (under- and overlimiting) passed through the Neosepta CMX cation-exchange membrane (Tokuyama Corp., Japan). Potential drops according to the distance from the membrane surface on the depleted side were measured using a microelectrode to obtain the concentration profile. From the concentration profiles obtained, it was observed that the diffusion boundary layers existed in the range of 300-350 microm, which reasonably coincide with the theoretical diffusion boundary layer thickness calculated from the limiting current density. Although there were some deviations between the concentrations determined from the Nernst model and those from experiments, it was confirmed that the Nernst model effectively depicts the transport phenomena in the ion-exchange membrane system. In addition it was found that the salt concentration at the membrane surface increased when the currents applied exceeded the limiting current. It is thought that the concentration polarization formed in the diffusion boundary layer at currents near or lower than the limiting current was disturbed by a turbulent convection when the current was greater than the limiting current. As a consequence, the concentration at the membrane surface increased to a sufficient level for generation of the overlimiting current.
Ball feeder for replenishing evaporator feed
Felde, David K.; McKoon, Robert H.
1993-01-01
Vapor source material such as uranium, which is to be dropped into a melt in an evaporator, is made into many balls of identical diameters and placed inside a container. An elongated sloping pipe is connected to the container and leads to the evaporator such that these balls can travel sequentially therealong by gravity. A metering valve in this pipe for passing these balls one at a time is opened in response to a signal when it is ascertained by a detector that there is a ball ready to be passed. A gate in the pipe near the evaporator momentarily stops the motion of the traveling ball and is then opened to allow the ball drop into the melt at a reduced speed.
Ball feeder for replenishing evaporator feed
Felde, D.K.; McKoon, R.H.
1993-03-23
Vapor source material such as uranium, which is to be dropped into a melt in an evaporator, is made into many balls of identical diameters and placed inside a container. An elongated sloping pipe is connected to the container and leads to the evaporator such that these balls can travel sequentially therealong by gravity. A metering valve in this pipe for passing these balls one at a time is opened in response to a signal when it is ascertained by a detector that there is a ball ready to be passed. A gate in the pipe near the evaporator momentarily stops the motion of the traveling ball and is then opened to allow the ball drop into the melt at a reduced speed.
Study of cryogenic propellant systems for loading the space shuttle. Part 2: Hydrogen systems
NASA Technical Reports Server (NTRS)
Steward, W. G.
1975-01-01
Computer simulation studies of liquid hydrogen fill and vent systems for the space shuttle are studied. The computer programs calculate maximum and minimum permissible flow rates during cooldown as limited by thermal stress considerations, fill line cooldown time, pressure drop, flow rates, vapor content, vent line pressure drop and vent line discharge temperature. The input data for these programs are selected through graphic displays which schematically depict the part of the system being analyzed. The computed output is also displayed in the form of printed messages and graphs. Digital readouts of graph coordinates may also be obtained. Procedures are given for operation of the graphic display unit and the associated minicomputer and timesharing computer.
Horton, James A.; Hayden, Jr., Howard W.
1995-01-01
An uranium enrichment process capable of producing an enriched uranium, having a .sup.235 U content greater than about 4 wt. %, is disclosed which will consume less energy and produce metallic uranium tails having a lower .sup.235 U content than the tails normally produced in a gaseous diffusion separation process and, therefore, eliminate UF.sub.6 tails storage and sharply reduce fluorine use. The uranium enrichment process comprises feeding metallic uranium into an atomic vapor laser isotope separation process to produce an enriched metallic uranium isotopic mixture having a .sup.235 U content of at least about 2 wt. % and a metallic uranium residue containing from about 0.1 wt. % to about 0.2 wt. % .sup.235 U; fluorinating this enriched metallic uranium isotopic mixture to form UF.sub.6 ; processing the resultant isotopic mixture of UF.sub.6 in a gaseous diffusion process to produce a final enriched uranium product having a .sup.235 U content of at least 4 wt. %, and up to 93.5 wt. % or higher, of the total uranium content of the product, and a low .sup.235 U content UF.sub.6 having a .sup.235 U content of about 0.71 wt. % of the total uranium content of the low .sup.235 U content UF.sub.6 ; and converting this low .sup.235 U content UF.sub.6 to metallic uranium for recycle to the atomic vapor laser isotope separation process.