Base pairing and structural insights into the 5-formylcytosine in RNA duplex

PubMed Central

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Thermodynamic insights into 2-thiouridine-enhanced RNA hybridization

PubMed Central

Larsen, Aaron T.; Fahrenbach, Albert C.; Sheng, Jia; Pian, Julia; Szostak, Jack W.

2015-01-01

Nucleobase modifications dramatically alter nucleic acid structure and thermodynamics. 2-thiouridine (s2U) is a modified nucleobase found in tRNAs and known to stabilize U:A base pairs and destabilize U:G wobble pairs. The recently reported crystal structures of s2U-containing RNA duplexes do not entirely explain the mechanisms responsible for the stabilizing effect of s2U or whether this effect is entropic or enthalpic in origin. We present here thermodynamic evaluations of duplex formation using ITC and UV thermal denaturation with RNA duplexes containing internal s2U:A and s2U:U pairs and their native counterparts. These results indicate that s2U stabilizes both duplexes. The stabilizing effect is entropic in origin and likely results from the s2U-induced preorganization of the single-stranded RNA prior to hybridization. The same preorganizing effect is likely responsible for structurally resolving the s2U:U pair-containing duplex into a single conformation with a well-defined H-bond geometry. We also evaluate the effect of s2U on single strand conformation using UV- and CD-monitored thermal denaturation and on nucleoside conformation using 1H NMR spectroscopy, MD and umbrella sampling. These results provide insights into the effects that nucleobase modification has on RNA structure and thermodynamics and inform efforts toward improving both ribozyme-catalyzed and nonenzymatic RNA copying. PMID:26240387

The Dewar photoproduct of thymidylyl(3′→5′)- thymidine (Dewar product) exhibits mutagenic behavior in accordance with the “A rule”

PubMed Central

Lee, Joon-Hwa; Bae, Sung-Hun; Choi, Byong-Seok

2000-01-01

In contrast to the highly mutagenic pyrimidine(6–4)pyrimidone photoproduct, its Dewar valence isomer (Dewar product) has low mutagenic potential and produces a broad range of mutations [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the mutagenic property of the Dewar product, we used experimental NMR restraints and molecular dynamics to determine the solution structure of a Dewar-lesion DNA decamer duplex. This DNA decamer duplex (DW/GA duplex) contains a mismatched base pair between the 3′ T residue of the Dewar lesion (T6) and an opposed G residue (G15). The 3′ T (T6) of the Dewar lesion formed stable hydrogen bonds with the opposing G15 residue. However, the helical bending and unwinding angles of the DW/GA duplex were much larger than those of a second duplex that contains the Dewar lesion and opposing A15 and A16 residues (DW/AA duplex). The DW/GA duplex showed poorer stacking interactions at the two bases of the Dewar product and at the adjacent A7⋅T14 base pair than did the DW/AA duplex. These structural features imply that no thermal stability or conformational benefit is obtained by incorporating a G instead of an A opposite the 3′ T of the Dewar lesion. These properties may thus facilitate the preferential incorporation of an A in accordance with the A rule during translesion replication and lead to the low frequency of 3′ T→C mutations observed at this site. PMID:10758155

Effect of Phosphate-Buffered Solution Corrosion on the Ratcheting Fatigue Behavior of a Duplex Mg-Li-Al Alloy

NASA Astrophysics Data System (ADS)

Yuan, Xin; Yu, Dunji; Gao, Li-Lan; Gao, Hong

2016-05-01

This work reports the uniaxial ratcheting and fatigue behavior of a duplex Mg-Li-Al alloy under the influence of phosphate-buffered solution corrosion. Microstructural observations reveal pitting and filament corrosion defects, which impair the load-bearing capacity of the alloy and cause stress concentration, thus leading to an accelerated accumulation of ratcheting strain and shortened fatigue life under the same nominal loading conditions. Comparing Smith model, Smith-Watson-Topper model, and Paul-Sivaprasad-Dhar model, a ratcheting fatigue life prediction model based on the Broberg damage rule and the Paul-Sivaprasad-Dhar model was proposed, and the model yielded a superior prediction for the studied magnesium alloy.

Formation Mechanism of CaS-Bearing Inclusions and the Rolling Deformation in Al-Killed, Low-Alloy Steel with Ca Treatment

NASA Astrophysics Data System (ADS)

Xu, Guang; Jiang, Zhouhua; Li, Yang

2016-08-01

The existing form of CaS inclusion in Ca-treated, Al-killed steel during secondary refining process was investigated with scanning electron microscopy and an energy-dispersive spectrometer (EDS). The results of 12 heats industrial tests showed that CaS has two kinds of precipitation forms. One form takes place by the direct reaction of Ca and S, and the other takes place by the reaction of CaO in calcium aluminates with dissolved Al and S in liquid steel. Thermodynamic research for different precipitation modes of CaS under different temperature was carried out. In particular, CaO-Al2O3-CaS isothermal section diagrams and component activities of calcium aluminates were calculated by the thermodynamic software FactSage. By thermodynamic calculation, a precipitation-area diagram of oxide-sulfide duplex inclusion was established by fixing the sulfur content. The quantity of CaS, which was precipitated in a reaction between [Al], [S] and (CaO), can be calculated and predicted based on the precipitation-area diagram of oxide-sulfide duplex inclusion. Electron probe microanalysis and EDS were used for observing rolling deformation of different types of CaS-bearing inclusions during the rolling process. Low modification of calcium aluminates wrapped by CaS has different degrees of harm to steel in the rolling process. A thick CaS layer can prevent some fragile calcium aluminates from being crushed during the rolling process. Some oxide-sulfide duplex inclusion contains little CaS performed better deformation during the rolling process, but when CaS in oxide-sulfide duplex inclusion becomes more, it will cause the whole inclusion to lose plastic yielding ability. The plastic deformation region of CaS-bearing inclusion in a CaO-Al2O3-CaS isothermal section diagram is confirmed.

Synergistic effects between analogs of DNA and RNA improve the potency of siRNA-mediated gene silencing

PubMed Central

Deleavey, Glen F.; Watts, Jonathan K.; Alain, Tommy; Robert, Francis; Kalota, Anna; Aishwarya, Veenu; Pelletier, Jerry; Gewirtz, Alan M.; Sonenberg, Nahum; Damha, Masad J.

2010-01-01

We report that combining a DNA analog (2′F-ANA) with rigid RNA analogs [2′F-RNA and/or locked nucleic acid (LNA)] in siRNA duplexes can produce gene silencing agents with enhanced potency. The favored conformations of these two analogs are different, and combining them in a 1–1 pattern led to reduced affinity, whereas alternating short continuous regions of individual modifications increased affinity relative to an RNA:RNA duplex. Thus, the binding affinity at key regions of the siRNA duplex could be tuned by changing the pattern of incorporation of DNA-like and RNA-like nucleotides. These heavily or fully modified duplexes are active against a range of mRNA targets. Effective patterns of modification were chosen based on screens using two sequences targeting firefly luciferase. We then applied the most effective duplex designs to the knockdown of the eIF4E binding proteins 4E-BP1 and 4E-BP2. We identified modified duplexes with potency comparable to native siRNA. Modified duplexes showed dramatically enhanced stability to serum nucleases, and were characterized by circular dichroism and thermal denaturation studies. Chemical modification significantly reduced the immunostimulatory properties of these siRNAs in human peripheral blood mononuclear cells. PMID:20413581

Covering solid, film cooled surfaces with a duplex thermal barrier coating

NASA Technical Reports Server (NTRS)

Liebert, C. H. (Inventor)

1983-01-01

Thermal barrier coating systems were applied to hardware having passageways in the walls connecting apertures in the surface to a gas supply for film cooling. An inert gas, such as argon, is discharged through the apertures during the application of the thermal barrier coating system by plasma spraying. This flow of inert gas reduces both blocking of the holes and base metal oxidation during the coating operation.

Mechanical and Microstructural Effects of Thermal Aging on Cast Duplex Stainless Steels by Experiment and Finite Element Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarm, Samuel C.; Mburu, Sarah N.; Kolli, Ratna P.

Cast duplex stainless steel piping in light water nuclear reactors expe- rience thermal aging embrittlement during operational service. Interest in extending the operational life to 80 years requires an increased understanding of the microstructural evolution and corresponding changes in mechanical behavior. We analyze the evolution of the microstructure during thermal aging of cast CF-3 and CF-8 stainless steels using electron microscopy and atom probe tomography. The evolution of the mechanical properties is measured concurrently by mechanical methods such as tensile tests, Charpy V-notch tests, and instrumented nanoinden- tation. A microstructure-based finite element method model is developed and uti- lized inmore » conjunction with the characterization results in order to correlate the local stress-strain effects in the microstructure with the bulk measurements. This work is supported by the DOE Nuclear Energy University Programs (NEUP), contract number DE-NE0000724.« less

Influence of PNA containing 8-aza-7-deazaadenine on structure stability and binding affinity of PNA·DNA duplex: insights from thermodynamics, counter ion, hydration and molecular dynamics analysis.

PubMed

Gupta, Sharad K; Sur, Souvik; Prasad Ojha, Rajendra; Tandon, Vibha

2013-07-01

This paper describes the synthesis of a novel 8-aza-7-deazapurin-2,6-diamine (DPP)-containing peptide nucleic acid (PNA) monomer and Boc protecting group-based oligomerization of PNA, replacing adenine (A) with DPP monomers in the PNA strand. The PNA oligomers were synthesized against the biologically relevant SV40 promoter region (2494-AATTTTTTTTATTTA-2508) of pEGFP-N3 plasmid. The DPP-PNA·DNA duplex showed enhanced stability as compared to normal duplex (A-PNA·DNA). The electronic distribution of DPP monomer suggested that DPP had better electron donor properties over 2,6-diamino purine. UV melting and thermodynamic analysis revealed that the PNA oligomer containing a diaminopyrazolo(3,4-d)pyrimidine moiety (DPP) stabilized the PNA·DNA hybrids compared to A-PNA·DNA. DPP-PNA·DNA duplex showed higher water activity (Δnw = 38.5) in comparison to A-PNA·DNA duplex (Δnw = 14.5). The 50 ns molecular dynamics simulations of PNA·DNA duplex containing DPP or unmodified nucleobase-A showed average H-bond distances in the DPP-dT base pair of 2.90 Å (OH-N bond) and 2.91 Å (NH-N bond), which were comparably shorter than in the A-dT base pair, in which the average distances were 3.18 Å (OH-N bond) and 2.97 Å (NH-N bond), and there was one additional H-bond in the DPP-dT base pair of around 2.98 Å (O2H-N2 bond), supporting the higher stability of DPP-PNA·DNA. The analysis of molecular dynamics simulation data showed that the system binding free energy increased at a rate of approximately -4.5 kcal mol(-1) per DPP base of the PNA·DNA duplex. In summary, increased thermal stability, stronger hydrogen bonding and more stable conformation in the DPP-PNA·DNA duplex make it a better candidate as antisense/antigene therapeutic agents.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

PubMed Central

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Duplex Heterogeneous Nucleation Behavior of Precipitates in C-Mn Steel Containing Sn

NASA Astrophysics Data System (ADS)

Sun, Guilin; Tao, Sufen

2018-04-01

The two successive heterogeneous nucleation behaviors of FeSn2-MnS-Al2O3 complex precipitates in ultrahigh Sn-bearing steel were investigated. First, Al2O3 was the nucleation site of the MnS at the end of solidification. Then, FeSn2 nucleated heterogeneously on the MnS particles that nucleated on the Al2O3 particles. The formation sequence of the precipitated phase caused the duplex heterogeneous nucleation to occur consecutively at most twice.

Boronization and Carburization of Superplastic Stainless Steel and Titanium-Based Alloys

PubMed Central

Matsushita, Masafumi

2011-01-01

Bronization and carburization of fine-grain superplastic stainless steel is reviewed, and new experimental results for fine grain Ti88.5Al4.5V3Fe2Mo2 are reported. In superplastic duplex stainless steel, the diffusion of carbon and boron is faster than in non-superplastic duplex stainless steel. Further, diffusion is activated by uniaxial compressive stress. Moreover, non-superplastic duplex stainless steel shows typical grain boundary diffusion; however, inner grain diffusion is confirmed in superplastic stainless steel. The presence of Fe and Cr carbides or borides is confirmed by X-ray diffraction, which indicates that the diffused carbon and boron react with the Fe and Cr in superplastic stainless steel. The Vickers hardness of the carburized and boronized layers is similar to that achieved with other surface treatments such as electro-deposition. Diffusion of boron into the superplastic Ti88.5Al4.5V3Fe2Mo2 alloy was investigated. The hardness of the surface exposed to boron powder can be increased by annealing above the superplastic temperature. However, the Vickers hardness is lower than that of Ti boride. PMID:28824144

Characterization of the Alumina Scale formed on Coated and Uncoated Doped Superalloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Unocic, Kinga A; Parish, Chad M; Pint, Bruce A

2011-01-01

To investigate the mechanisms by which Y and La dopants affect the oxidation behavior of Ni base single crystal superalloys, the oxide scales formed on two variants of a commercial X4 alloy, each with and without a MCrAlYHfSi coating were characterized. The alloy systems were oxidized for 100h at 1100 C and then examined using analytical transmission electron microscopy. Without a coating, a duplex scale was formed on the superalloy surface comprised of an outer Ni rich spinel type layer and an inner columnar Al2O3 layer. In this case, Hf and Ti were found segregated to the alumina grain boundariesmore » in the outer part of the scale on both alloys but only Hf was detected near the metal alumina interface. There was no evidence of Ta, Y or La segregation to the scale grain boundaries after this exposure. The scale formed on the alloys with the thermally sprayed coating was primarily alumina, and Y and Hf segregated to the alumina grain boundaries for both alloys. There was evidence of Ti rich oxides in the outer part of the scale indicating that Ti had diffused through the coating into the thermally grown oxide but La was not found.« less

Superplastic Deformation Mechanisms of Superfine/Nanocrystalline Duplex PM-TiAl-Based Alloy

PubMed Central

Gong, Xuebo; Duan, Zhenxin; Pei, Wen; Chen, Hua

2017-01-01

In this paper, the equiaxed superfine/nanocrystalline duplex PM-TiAl-based alloy with (γ + α2) microstructure, Ti-45Al-5Nb (at %), has been synthesized by high-energy ball milling and vacuum hot pressing sintering. Superplastic deformation behavior has been investigated at 1000 °C and 1050 °C with strain rates from 5 × 10−5 s−1 to 1 × 10−3 s−1. The effects of deformation on the microstructure and mechanical behaviors of high Nb containing TiAl alloy have been characterized and analyzed. The results showed that, the ultimate tensile strength of the alloy was 58.7 MPa at 1000 °C and 10.5 MPa at 1050 °C with a strain rate of 5 × 10−5 s−1, while the elongation was 121% and 233%, respectively. The alloy exhibited superplastic elongation at 1000 and 1050 °C with an exponent (m) of 0.48 and 0.45. The main softening mechanism was dynamic recrystallization of γ grains; the dislocation slip and γ/γ interface twinning were responsible for superplastic deformation. The orientation relationship of γ/γ interface twinning obeyed the classical one: (001)γ//(110)γ. PMID:28925971

Superplastic Deformation Mechanisms of Superfine/Nanocrystalline Duplex PM-TiAl-Based Alloy.

PubMed

Gong, Xuebo; Duan, Zhenxin; Pei, Wen; Chen, Hua

2017-09-19

In this paper, the equiaxed superfine/nanocrystalline duplex PM-TiAl-based alloy with (γ + α₂) microstructure, Ti-45Al-5Nb (at %), has been synthesized by high-energy ball milling and vacuum hot pressing sintering. Superplastic deformation behavior has been investigated at 1000 °C and 1050 °C with strain rates from 5 × 10 -5 s -1 to 1 × 10 -3 s -1 . The effects of deformation on the microstructure and mechanical behaviors of high Nb containing TiAl alloy have been characterized and analyzed. The results showed that, the ultimate tensile strength of the alloy was 58.7 MPa at 1000 °C and 10.5 MPa at 1050 °C with a strain rate of 5 × 10 -5 s -1 , while the elongation was 121% and 233%, respectively. The alloy exhibited superplastic elongation at 1000 and 1050 °C with an exponent (m) of 0.48 and 0.45. The main softening mechanism was dynamic recrystallization of γ grains; the dislocation slip and γ/γ interface twinning were responsible for superplastic deformation. The orientation relationship of γ/γ interface twinning obeyed the classical one: (001) γ //(110) γ .

Recognition of DNA/RNA bulges by antimicrobial and antitumor metallohelices.

PubMed

Malina, Jaroslav; Scott, Peter; Brabec, Viktor

2015-09-07

Bulged structures have been identified in nucleic acids and have been shown to be linked to biomolecular processes involved in numerous diseases. Thus, chemical agents with affinity for bulged nucleic acids are of general biological significance. Herein, the mechanism of specific recognition and stabilization of bulged DNA and RNA by helical bimetallic species was established through detailed molecular biophysics and biochemistry assays. These agents, known as 'flexicates', are potential mimetics of α-helical peptides in cancer treatment, exhibiting antimicrobial and antitumor effects. The flexicates have positive impacts on the thermal stability of DNA duplexes containing bulges, which means that the flexicates interact with the duplexes containing bulges, and that these interactions stabilize the secondary structures of these duplexes. Notably, the stabilising effect of the flexicates increases with the size of the bulge, the maximal stabilization is observed for the duplexes containing a bulge composed of at least three bases. The flexicates bind most preferentially to the bulges composed of pyrimidines flanked on both sides also by pyrimidines. It is suggested that it is so because these bulges exhibit greatest conformational variability in comparison with other combinations of bases in the bulge loop and bases flanking the bulge. Finally, the results indicate that there is only one dominant binding site for the flexicates on the DNA and RNA bulges and that the flexicates bind directly to the bulge or in its close proximity. It is also shown that the flexicates effectively bind to RNA duplexes containing the bulged region of HIV-1 TAR RNA.

Evaluation of present thermal barrier coatings for potential service in electric utility gas turbines

NASA Technical Reports Server (NTRS)

Bratton, R. J.; Lau, S. K.; Lee, S. Y.

1982-01-01

The resistance of present-day thermal barrier coatings to combustion gases found in electric utility turbines was assessed. The plasma sprayed coatings, both duplex and graded types, were primarily zirconia-based, although a calcium silicate was also evaluated. Both atmospheric burner rig tests and high pressure tests (135 psig) showed that several present-day thermal barrier coatings have a high potential for service in gas turbines burning the relatively clean GT No. 2 fuel. However, coating improvements are needed for use in turbines burning lower grade fuel such as residual oil. The duplex ZrO2.8Y2O3/NiCrA1Y coating was ranked highest and selected for near-term field testing, with Ca2SiO4/NiCrA1Y ranked second. Graded coatings show potential for corrosive turbine operating conditions and warrant further development. The coating degradation mechanisms for each coating system subjected to the various environmental conditions are also described.

Duplex precipitates and their effects on the room-temperature fracture behaviour of a NiAl-strengthened ferritic alloy

DOE PAGES

Sun, Zhiqian; Song, Gian; Ilavsky, Jan; ...

2015-03-23

Duplex precipitates are presented in a NiAl-strengthened ferritic alloy. They were characterized by the ultra-small angle X-ray scattering and transmission electron microscope. Fine cooling precipitates with the size of several to tens of nanometres harden the matrix considerably at room temperature. The cracks will likely to initiate from precipitates, and coalesce and propagate quickly through the matrix due to the excessive hardening effect of cooling precipitates, which lead to the premature fracture of NiAl-strengthened ferritic alloys.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

PubMed

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

2015-12-02

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Improvement of mechanical behaviors of a superlight Mg-Li base alloy by duplex phases and fine precipitates

DOE PAGES

Zou, Yun; Zhang, Lehao; Li, Yang; ...

2017-12-06

Limitations of strength and formability are the major obstacles to the industrial application of magnesium alloys. Here, we demonstrate, by producing the duplex phases and fine intermetallic particles in composition-optimized superlight Mg-Li-Al alloys, a unique approach to simultaneously improve the comprehensive mechanical properties (a strength-ductility balance). In conclusion, the phase components and microstructures, including the size, morphology, and distribution of precipitated-intermetallic particles can be optimized by tuning the Li content, which strongly influences the work-hardening behavior and tension-compression yield asymmetry.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Gian; Sun, Zhiqian; Poplawsky, Jonathan D.

The microstructures of a hierarchical-precipitate-strengthened ferritic alloy are characterized, using transmission-electron microscopy (TEM) and atom-probe tomography (APT). The alloy shows duplex precipitates. The primary precipitate with an average edge length of 90 nm consists of NiAl- and Ni2TiAl-type phases, while the secondary precipitate with an average radius of 2 nm is a NiAl-type phase. Based on the APT results, the volume fractions of the primary and secondary precipitates were calculated, using the lever rule to be 17.3 and 2.3 %, respectively.

Assessment of thermal embrittlement in duplex stainless steels 2003 and 2205 for nuclear power applications

DOE PAGES

Tucker, J. D.; Miller, M. K.; Young, G. A.

2015-04-01

Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°Fmore » (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.« less

Microstructural characterization of Ti-6Al-4V alloy subjected to the duplex SMAT/plasma nitriding.

PubMed

Pi, Y; Faure, J; Agoda-Tandjawa, G; Andreazza, C; Potiron, S; Levesque, A; Demangel, C; Retraint, D; Benhayoune, H

2013-09-01

In this study, microstructural characterization of Ti-6Al-4V alloy, subjected to the duplex surface mechanical attrition treatment (SMAT)/nitriding treatment, leading to improve its mechanical properties, was carried out through novel and original samples preparation methods. Instead of acid etching which is limited for morphological characterization by scanning electron microscopy (SEM), an original ion polishing method was developed. Moreover, for structural characterization by transmission electron microscopy (TEM), an ion milling method based with the use of two ions guns was also carried out for cross-section preparation. To demonstrate the efficiency of the two developed methods, morphological investigations were done by traditional SEM and field emission gun SEM. This was followed by structural investigations through selected area electron diffraction (SAED) coupled with TEM and X-ray diffraction techniques. The results demonstrated that ionic polishing allowed to reveal a variation of the microstructure according to the surface treatment that could not be observed by acid etching preparation. TEM associated to SAED and X-ray diffraction provided information regarding the nanostructure compositional changes induced by the duplex SMAT/nitriding process. Copyright © 2013 Wiley Periodicals, Inc.

The formation of catalytically competent enzyme-substrate complex is not a bottleneck in lesion excision by human alkyladenine DNA glycosylase.

PubMed

Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S

2017-04-01

Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.

Theoretical analysis of SAW propagation characteristics in (100) oriented AlN/diamond structure.

PubMed

Ro, Ruyen; Chiang, Yuan-Feng; Sung, Chia-Chi; Lee, Ruyue; Wu, Sean

2010-01-01

In this study, the finite element method is employed to calculate SAW characteristics in (100) AlN/diamond based structures with different electrical interfaces; i.e., IDT/ AlN/diamond, AlN/IDT/diamond, IDT/AlN/thin metal film/ diamond, and thin metal film/AlN/IDT/diamond. The effects of Cu and Al electrodes as well as the thickness of electrode on phase velocity, coupling coefficient, and reflectivity of SAWs are illustrated. Propagation characteristics of SAWs in (002) AlN/diamond-based structures are also presented for comparison. Simulation results show that to retain a large reflectivity for the design of RF filters and duplexers, the Cu IDT/(100) AlN/diamond structure possesses the highest phase velocity and largest coupling coefficient at the smallest AlN film thickness- to-wavelength ratio.

The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes

PubMed Central

Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina

2011-01-01

Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethlyl-glycine backbone. The crystal structure of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATCGG)2 (pdb: 3MBS), and the other containing the same nucleobase pairs and a central pair of bipyridine ligands (pdb: 3MBU), has been solved with a resolution of 1.2 Å and 1.05 Å, respectively. The non-modified PNA duplex adopts a P-type helical structure s i m i l a r t o that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. These results support the notion that while PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines are bulged out of the duplex and are aligned parallel to the minor groove of the PNA. In the case of the bipyridine-containing PNA, two bipyridines from adjacent PNA duplexes form a π-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are π-stacking with adjacent nucleobase pairs and adopt an intrahelical geometry [Johar et al., Chem. Eur. J., 2008, 14, 2080]. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes. PMID:20859960

Recent Developments in Assessing Microstructure-Sensitive Early Stage Fatigue of Polycrystals (Postprint)

DTIC Science & Technology

2014-04-01

can strongly affect formation of fatigue cracks. El Bartali et al. [7] quantified plastic strain at the grain scale in a duplex stainless steel and mea... Fatigue Fract Eng Mater Struct 2013. [7] El Bartali A, Aubin V, Degallaix S. Fatigue damage analysis in a duplex stainless steel by digital image...S. Surface observation and measurement techniques to study the fatigue damage micromechanisms in a duplex stainless steel . Int J Fatigue 2009;31:2049

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2006-01-01

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

Corrosion resistance and in-vitro bioactivity of BaO containing Na2O-CaO-P2O5 phosphate glass-ceramic coating prepared on 316 L, duplex stainless steel 2205 and Ti6Al4V

NASA Astrophysics Data System (ADS)

Edathazhe, Akhila B.; Shashikala, H. D.

2018-03-01

The phosphate glass with composition 11Na2O-15BaO-29CaO-45P2O5 was coated on biomedical implant materials such as stainless steel 316 L, duplex stainless steel (DSS) 2205 and Ti6Al4V alloy by thermal enamelling method. The structural properties and composition of glass coated substrates were studied by x-ray diffraction (XRD), Scanning electron microscopy (SEM) and Energy dispersive x-ray spectroscopy (EDS) analysis. The coatings were partially crystalline in nature with porous structure and pore size varied from micro to nanometer range. The polarization curve was obtained for uncoated and coated substrates from electrochemical corrosion test which was conducted at 37 °C in Hank’s balanced salt solution (HBSS). The corrosion resistance of 316 L substrate increased after coating, whereas it decreased in case of DSS 2205 and Ti6Al4V. The XRD and SEM/EDS studies indicated the bioactive hydroxyapatite (HAp) layer formation on all the coated surfaces after electrochemical corrosion test, which improved the corrosion resistance. The observed electrochemical corrosion behavior can be explained based on protective HAp layer formation, composition and diffusion of ions on glass coated surfaces. The in-vitro bioactivity test was carried out at 37 °C in HBS solution for 14 days under static conditions for uncoated and coated substrates. pH and ion release rate measurements from the coated samples were conducted to substantiate the electrochemical corrosion test. The lower ion release rates of Na+ and Ca2+ from coated 316 L supported its higher electrochemical corrosion resistance among coated samples. Among the uncoated substrates, DSS showed higher electrochemical corrosion resistance. Amorphous calcium-phosphate (ACP) layer formation on all the coated substrates after in-vitro bioactivity test was confirmed by XRD, SEM/EDS and ion release measurements. The present work is a comparative study of corrosion resistance and bioactivity of glass coated and uncoated biomedical implants such as 316 L, DSS and Ti6Al4V.

Nominal vs Local Shot-Peening Effects on Fatigue Lifetime in Ti-6Al-2Sn-4Zr-6Mo at Elevated Temperature

DTIC Science & Technology

2009-11-01

PROCEDURE A. Material The materia l in this study was tbe IX + /1 titanium aUoy. Ti- 6 -2- 4 - 6 . in the duplex microstructural condition. Two y,;riants of the...ress level and temperature in the turbine engine alloy Ti-6AI-2Sn-4Zr- 6Mo (Ti- 6 -2- 4 - 6 ). The experimental conditions were chosen to target a regime...defects. which are produced during SP by thermally activated pro- cesses.II~.~1J A detailed discussion of these relaxation elTects in Ti- 6 -2- 4 - 6 is

Characterizing AISI 1045 steel surface duplex-treated by alternating current field enhanced pack aluminizing and nitriding

NASA Astrophysics Data System (ADS)

Xie, Fei; Zhang, Ge; Pan, Jianwei

2018-02-01

Thin cases and long treating time are shortcomings of conventional duplex treatment of aluminizing followed by nitriding (DTAN). Alternating current field (ACF) enhanced DTAN was carried out on AISI 1045 steel by applying an ACF to treated samples and treating agents with a pair of electrodes for overcoming those shortcomings. By investigating cases' structures, phases, composition and hardness distributions of differently treated samples, preliminary studies were made on characterizations of the ACF enhanced duplex treatment to AISI 1045 steel. The results show that, with the help of the ACF, the surface Al-rich phase Al5Fe2 formed in conventional pack aluminizing can be easily avoided and the aluminizing process is dramatically promoted. The aluminizing case can be nitrided either with conventional pack nitriding or ACF enhanced pack nitriding. By applying ACF to pack nitriding, the diffusion of nitrogen into the aluminizing case is promoted. AlN, Fe2∼3N and solid solution of N in iron are efficiently formed as a result of reactions of N with the aluminizing case. A duplex treated case with an effective thickness of more than 170 μm can be obtained by the alternating current field enhanced 4 h pack aluminizing plus 4 h pack nitriding.

The deformation behavior and microstructure evolution of duplex Mg-9Li-1Al alloy during superplasticity tensile testing

NASA Astrophysics Data System (ADS)

Liu, Meiduo; Zheng, Haipeng; Zhang, Tianlong; Wu, Ruizhi

2017-12-01

The superplastic mechanical properties and microstructure evolution of the duplex Mg-9Li-1Al alloy were investigated. The tensile testing results show that, the elongation of the as-extruded Mg-9Li-1Al alloy reaches 510% at 573 K with a strain rate of 2×10-4 s-1. During the deformation process, the strips of α phase break into equiaxed structure. This phenomenon can be attributed to a particular dynamic recrystallization, which suggests that the β phase can recrystallize in the α phase due to the small misfit degree between α phase and β phase.

Microstructure and Antiwear Property of Laser Cladding Ni–Co Duplex Coating on Copper

PubMed Central

Wang, Yiyong; Liang, Zhipeng; Zhang, Junwei; Ning, Zhe; Jin, Hui

2016-01-01

Ni–Co duplex coatings were cladded onto Cu to improve the antiwear properties of Cu products. Prior to laser cladding, n-Al2O3/Ni layers were introduced as interlayers between laser cladding coatings and Cu substrates to improve the laser absorptivity of these substrates and ensure defect-free laser cladding coatings. The structure and morphology of the coatings were characterized by scanning electron microscopy and optical microscopy, and the phases of the coatings were analyzed by X-ray diffraction. Their hardness was measured using a microhardness tester. Experimental results showed that defect-free composite coatings were obtained and that the coatings were metallurgically bonded to the substrates. The surface of the Ni–Co duplex coatings comprised a Co-based solid solution, Cr7C3, (Fe,Ni)23C6, and other strengthening phases. The microhardness and wear resistance of the duplex coatings were significantly improved compared with the Cu substrates. The average microhardness of the cladded coatings was 845.6 HV, which was approximately 8.2 times greater than that of the Cu substrates (102.6 HV). The volume loss of the Cu substrates was approximately 7.5 times greater than that of the Ni–Co duplex coatings after 60 min of sliding wear testing. The high hardness of and lack of defects in the Ni–Co duplex coatings reduced the plastic deformation and adhesive wear of the Cu substrates, resulting in improved wear properties. PMID:28773755

Thermal-barrier coatings for utility gas turbines

NASA Technical Reports Server (NTRS)

Levine, S. R.; Miller, R. A.

1982-01-01

The potential of thermal barrier coatings for use in utility gas turbines was assessed. Pressurized passage and ambient pressure doped fuel burner rig tests revealed that thermal barrier coatings are not resistant to dirty combustion environments. However, present thermal barrier coatings, such as duplex partially stabilized zirconia and duplex Ca2SiO4 have ample resistance to the thermo-mechanical stress and temperature levels anticipated for heavy duty gas turbines firing clean fuel as revealed by clean fuel pressurized passage and ambient pressure burner rig tests. Thus, it is appropriate to evaluate such coatings on blades, vanes and combustors in the field. However, such field tests should be backed up with adequate effort in the areas of coating application technology and design analysis so that the field tests yield unequivocal results.

The corrosion behavior of Fe-Mn-Al weld metals

NASA Astrophysics Data System (ADS)

Aidun, Daryush K.

2001-02-01

The corrosion resistance of a newly developed iron-base, Fe-Mn-Al austenitic, and duplex weld metal has been examined in the NACE solution consisting of 5 wt.% NaCl, 0.5 wt.% acetic acid, and the balance distilled water. The electrochemical techniques such as potentiodynamic polarization, Tafel plots, linear polarization, cyclic polarization, and open-circuit potential versus time were employed. The Fe-Mn-Al weld metals did not passivate and exhibited high corrosion rates. Fe-Cr-Ni (310 and 316) weld and base metals were also examined in the NACE solution at room temperature. The 310 and 316 base metals were more resistant to corrosion than the as-welded 310 and 316 weld metals. Postweld heat treatment (PWHT) improved the corrosion performance of the Fe-Mn-Al weld metals. The corrosion resistance of Fe-Mn-Al weld metals after PWHT was still inferior to that of the 310 and 316 weld and base metals.

Coatings for directional eutectics

NASA Technical Reports Server (NTRS)

Rairden, J. R.; Jackson, M. R.

1976-01-01

Significant advances have been made in the development of an environmentally stable coating for a very high strength, directionally solidified eutectic alloy designated NiTaC-13. Three duplex (two-layer) coatings survived 3,000 hours on a cyclic oxidation test (1,100 C to 90 C). These coatings were fabricated by first depositing a layer of NiCrAl(Y) by vacuum evaporation from an electron beam heated source, followed by depositing an aluminizing overlayer. The alloy after exposure with these coatings was denuded of carbide fibers at the substrate/coating interface. It was demonstrated that TaC fiber denudation can be greatly retarded by applying a carbon-bearing coating. The coating was applied by thermal spraying followed by aluminization. Specimens coated with NiCrAlCY+Al survived over 2,000 hours in the cyclic oxidation test with essentially no TaC denudation. Coating ductility was studied for coated and heat-treated bars, and stress rupture life at 871 C and 1,100 C was determined for coated and cycled bars.

Environmental Barrier Coatings Having a YSZ Top Coat

NASA Technical Reports Server (NTRS)

Lee, Kang N.; Gray, Hugh (Technical Monitor)

2002-01-01

Environmental barrier coatings (EBCs) with a Si bond coat, a yttria-stabilized zirconia (YSZ) top coat, and various intermediate coats were investigated. EBCs were processed by atmospheric pressure plasma spraying. The EBC durability was determined by thermal cycling tests in water vapor at 1300 C and 1400 C, and in air at 1400 C and 1500 C. EBCs with a mullite (3Al2O3 (dot) 2SiO2) + BSAS (1 - xBaO (dot) xSrO (dot) Al2O3 (dot) 2SiO2) intermediate coat were more durable than EBCs with a mullite intermediate coat, while EBCs with a mullite/BSAS duplex intermediate coat resulted in inferior durability. The improvement with a mullite + BSAS intermediate coat was attributed to enhanced compliance of the intermediate coat due to the addition of a low modulus BSAS second phase. Mullite + BSAS/YSZ and BSAS/YSZ interfaces produced a low melting (less than 1400 C) reaction product, which is expected to degrade the EBC performance by increasing the thermal conductivity. EBCs with a mullite + BSAS / graded mullite + YSZ intermediate coat showed the best durability among the EBCs investigated in this study. This improvement was attributed to diffused CTE (Coefficient of Thermal Expansion) mismatch stress and improved chemical stability due to the compositionally graded mullite+YSZ layer.

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

NASA Technical Reports Server (NTRS)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

Primary and secondary precipitates in a hierarchical-precipitate-strengthened ferritic alloy

DOE PAGES

Song, Gian; Sun, Zhiqian; Poplawsky, Jonathan D.; ...

2017-02-27

The microstructures of a hierarchical-precipitate-strengthened ferritic alloy are characterized, using transmission-electron microscopy (TEM) and atom-probe tomography (APT). The alloy shows duplex precipitates. The primary precipitate with an average edge length of 90 nm consists of NiAl- and Ni2TiAl-type phases, while the secondary precipitate with an average radius of 2 nm is a NiAl-type phase. Based on the APT results, the volume fractions of the primary and secondary precipitates were calculated, using the lever rule to be 17.3 and 2.3 %, respectively.

Preliminary Results from Duplex Procedure for Obtain of Fe Based Materials for Automotive Applications

NASA Astrophysics Data System (ADS)

Crăciun, R. C.; Stanciu, S.; Geantă, V.; Voiculescu, I.; Manole, V.; Gârneţ, I. A.; Alexandru, A.; Cimpoesu, N.; Săndulache, F.

2017-06-01

Abstract Iron based materials still represent a high percentage from metallic materials used in industry, in general, and in automotive industry, in particular. In this case we used a duplex process in order to obtain the FeMnSiAl experimental alloy for a more efficient use of various units. In the first stage iron, manganese, silicon and aluminum were melted and mixed together using arc melting technology and for the second stage the alloy was re-melt for homogeneity in an induction furnace. Chemical composition, after each melting step, was analyzed using EDS Bruker detector for various areas and microstructural characterization using SEM, VegaTescan LMH II with SE detector, equipment. This alloy is proposed as a metallic approach of mechanical dumpers used in automotive industry for low and medium impact contacts.

2'-modified nucleosides for site-specific labeling of oligonucleotides

NASA Technical Reports Server (NTRS)

Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

2002-01-01

We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

Ensuring an exit strategy: RTEL1 restricts rogue recombination.

PubMed

Villeneuve, Anne M

2008-10-17

Success of homologous recombination-based DNA repair depends not only on recombinases, which promote invasion of the homologous DNA duplex that serves as a template for repair, but also on antirecombinases, which dismantle recombination intermediates to allow completion of repair. In this issue, Barber et al. (2008) identify a previously elusive antirecombinase activity important for maintaining genome stability in animals.

Fluorous Peptide Nucleic Acids: PNA Analogues with Fluorine in Backbone (γ-CF2-apg-PNA) Enhance Cellular Uptake.

PubMed

Ellipilli, Satheesh; Ganesh, Krishna N

2015-09-18

Fluorous PNA analogues possessing fluorine as inherent part of aminopropylglycine (apg) backbone (γ-CF2-apg PNA) have been synthesized and evaluated for biophysical and cell penetrating properties. These form duplexes of higher thermal stability with cRNA than cDNA, although destabilized compared to duplexes of standard aeg-PNA. Cellular uptake of the fluorinated γ-CF2-apg PNAs in NIH 3T3 and HeLa cells was 2-3-fold higher compared to that of nonfluorinated apg PNA, with NIH 3T3 cells showing better permeability compared to HeLa cells. The backbone fluorinated PNAs, which are first in this class, when combined with other chemical modifications may have potential for future PNA-based antisense agents.

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

PubMed Central

Pilch, D S; Brousseau, R; Shafer, R H

1990-01-01

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

The use of thermomagnetic analysis for detection and quantification of 475°C embrittlement of duplex stainless steels

NASA Astrophysics Data System (ADS)

da Silva, M. R.; Tavares, S. S. M.; Fruchart, D.; Miraglia, S.; Neto, J. M.

2001-05-01

A duplex stainless steel was aged at 475°C for different times up to 500 h. The thermal embrittlement was investigated by thermomagnetic analysis using a vibrating sample magnetometer and a thermomagnetic balance. The results obtained with the two equipment were similar and show that the Curie temperature increases with the ageing time. Relationships between Tc and mechanical properties (hardness and toughness) were proposed.

Defined presentation of carbohydrates on a duplex DNA scaffold.

PubMed

Schlegel, Mark K; Hütter, Julia; Eriksson, Magdalena; Lepenies, Bernd; Seeberger, Peter H

2011-12-16

A new method for the spatially defined alignment of carbohydrates on a duplex DNA scaffold is presented. The use of an N-hydroxysuccinimide (NHS)-ester phosphoramidite along with carbohydrates containing an alkylamine linker allows for on-column labeling during solid-phase oligonucleotide synthesis. This modification method during solid-phase synthesis only requires the use of minimal amounts of complex carbohydrates. The covalently attached carbohydrates are presented in the major groove of the B-form duplex DNA as potential substrates for murine type II C-type lectin receptors mMGL1 and mMGL2. CD spectroscopy and thermal melting revealed only minimal disturbance of the overall helical structure. Surface plasmon resonance and cellular uptake studies with bone-marrow-derived dendritic cells were used to assess the capability of these carbohydrate-modified duplexes to bind to mMGL receptors. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Spermine moiety attached to the C-5 position of deoxyuridine enhances the duplex stability of the phosphorothioate DNA/complementary DNA and shows the susceptibility of the substrate to RNase H.

PubMed

Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo

2008-09-01

Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.

A process model for the heat-affected zone microstructure evolution in duplex stainless steel weldments: Part I. the model

NASA Astrophysics Data System (ADS)

Hemmer, H.; Grong, Ø.

1999-11-01

The present investigation is concerned with modeling of the microstructure evolution in duplex stainless steels under thermal conditions applicable to welding. The important reactions that have been modeled are the dissolution of austenite during heating, subsequent grain growth in the delta ferrite regime, and finally, the decomposition of the delta ferrite to austenite during cooling. As a starting point, a differential formulation of the underlying diffusion problem is presented, based on the internal-state variable approach. These solutions are later manipulated and expressed in terms of the Scheil integral in the cases where the evolution equation is separable or can be made separable by a simple change of variables. The models have then been applied to describe the heat-affected zone microstructure evolution during both thick-plate and thin-plate welding of three commercial duplex stainless steel grades: 2205, 2304, and 2507. The results may conveniently be presented in the form of novel process diagrams, which display contours of constant delta ferrite grain size along with information about dissolution and reprecipitation of austenite for different combinations of weld input energy and peak temperature. These diagrams are well suited for quantitative readings and illustrate, in a condensed manner, the competition between the different variables that lead to structural changes during welding of duplex stainless steels.

The influence of sequence context and length on the kinetics of DNA duplex formation from complementary hairpins possessing (CNG) repeats.

PubMed

Paiva, Anthony M; Sheardy, Richard D

2005-04-20

The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

PubMed Central

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

PubMed

Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

2017-12-14

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

Base opening in RNA and DNA duplexes: implication for RNA stability.

PubMed

Chen, Y Z; Mohan, V; Griffey, R H

2000-05-01

The energetics of a low-energy single base opening in several RNA duplex crystal structures has been calculated and compared to DNA duplexes. Base opening in RNA appears to have an overall preference towards the major groove, similar to results previously reported for B-DNA. Movement of each of the adenine, uracil, and cytosine bases into the minor groove is blocked by a high-energy barrier due to severe close contact with neighboring bases. Guanine bases are able to open towards both grooves because of the unique orientation of the base that avoids steric clash along the opening pathway. RNA bases are found to have a substantially smaller major groove opening extent than that of their B-DNA counterparts. A comparison with base opening behavior of A-DNA duplexes suggests that this difference results from helix constraint associated with A-form backbone conformation. The reduced opening extent correlates with the RNA duplex stability and is consistent with observed slower imino proton exchange rates in RNA duplexes.

Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

PubMed Central

Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

2018-01-01

Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed Central

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-01-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-02-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

Distant neighbor base sequence context effects in human nucleotide excision repair of a benzo[a]pyrene-derived DNA lesion

PubMed Central

Cai, Yuqin; Kropachev, Konstantin; Xu, Rong; Tang, Yijin; Kolbanovskii, Marina; Kolbanovskii, Alexander; Amin, Shantu; Patel, Dinshaw J.; Broyde, Suse; Geacintov, Nicholas E.

2010-01-01

Summary The effects of non-nearest base sequences, beyond the nucleotides flanking a DNA lesion on either side, on nucleotide excision repair (NER) in extracts from human cells were investigated. We constructed two duplexes containing the same minor groove-aligned 10S (+)-trans-anti-B[a]P-N2-dG (G*) DNA adduct, derived from the environmental carcinogen benzo[a]pyrene (B[a]P): 5′-C-C-A-T-C-G*-C-T-A-C-C-3′ (CG*C-I), and 5′-C-A-C3-A4-C5-G*-C-A-C-A-C-3′ (CG*C-II). We utilized gel electrophoresis to compare the extent of DNA bending, and molecular dynamics (MD) simulations to analyze the structural characteristics of these two DNA duplexes. The NER efficiencies are 1.6 ± 0.2 times greater in the case of the CG*C-II than the CG*C-I sequence context in 135-mer duplexes. Gel electrophoresis and self-ligation circularization experiments revealed that the CG*C-II duplex is more bent than the CG*C-I duplex, while MD simulations showed that the unique -C3-A4-C5- segment in the CG*C-II duplex plays a key role. The presence of a minor groove-positioned guanine amino group, namely, the Watson-Crick partner to C3, acts as a wedge; facilitated by a highly deformable local -C3-A4- base step, this amino group allows the B[a]P ring system to produce a more enlarged minor groove in CG*C-II than in CG*C-I, as well as a local untwisting and enlarged and flexible Roll only in the CG*C-II sequence. These structural properties fit well with our prior findings that in the case of the family of minor groove 10S (+)-trans-anti-B[a]P-N2-dG lesions, flexible bends and enlarged minor groove widths (Cai et al. (2009) J. Mol. Biol., 385: 30–44) constitute NER recognition signals, and extend our understanding of sequence context effects on NER to the neighbors that are distant to the lesion. PMID:20399214

Structures of exocyclic R,R- and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine adducts induced by 1,2,3,4-diepoxybutane.

PubMed

Kowal, Ewa A; Seneviratne, Uthpala; Wickramaratne, Susith; Doherty, Kathleen E; Cao, Xiangkun; Tretyakova, Natalia; Stone, Michael P

2014-05-19

1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N(6) position of adenine in DNA. Two enantiomers of bis-N(6)-dA adducts of DEB have been identified: R,R-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (R,R-DHB-dA), and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (S,S-DHB-dA) [ Seneviratne , U. , Antsypovich , S. , Dorr , D. Q. , Dissanayake , T. , Kotapati , S. , and Tretyakova , N. ( 2010 ) Chem. Res. Toxicol. 23 , 1556 -1567 ]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5'-d(C(1)G(2)G(3)A(4)C(5)X(6)A(7)G(8)A(9)A(10)G(11))-3':5'-d(C(12)T(13)T(14)C(15)T(16)T(17)G(18)T(19)C(20)C(21)G(22))-3' duplex [X(6) = R,R-DHB-dA (R(6)) or S,S-DHB-dA (S(6))]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N(6) bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N(6) bond, allows the complementary thymine, T(17), to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T(17) N3H imino proton. The loss of the second Watson-Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as compared to the corresponding unmodified duplex. The reduced base stacking at the adduct sites may also contribute to the thermal instability.

Structures of Exocyclic R,R- and S,S-N6,N6-(2,3-Dihydroxybutan-1,4-diyl)-2′-Deoxyadenosine Adducts Induced by 1,2,3,4-Diepoxybutane

PubMed Central

2015-01-01

1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N6 position of adenine in DNA. Two enantiomers of bis-N6-dA adducts of DEB have been identified: R,R-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (R,R-DHB-dA), and S,S-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (S,S-DHB-dA) [SeneviratneU., AntsypovichS., DorrD. Q., DissanayakeT., KotapatiS., and TretyakovaN. (2010) Chem. Res. Toxicol.23, 1556−156720873715]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5′-d(C1G2G3A4C5X6A7G8A9A10G11)-3′:5′-d(C12T13T14C15T16T17G18T19C20C21G22)-3′ duplex [X6 = R,R-DHB-dA (R6) or S,S-DHB-dA (S6)]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N6 bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N6 bond, allows the complementary thymine, T17, to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T17 N3H imino proton. The loss of the second Watson–Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as compared to the corresponding unmodified duplex. The reduced base stacking at the adduct sites may also contribute to the thermal instability. PMID:24741991

The Influence of Temperature on the Frictional Behavior of Duplex-Coated Die Steel Rubbing Against Forging Brass

NASA Astrophysics Data System (ADS)

Ebrahimzadeh, I.; Ashrafizadeh, F.

2015-01-01

Improvement of die life under hot forging of brass alloys is considered vital from both economical and technical points of view. One of the best methods for improving die life is duplex coatings. In this research, the influence of temperature on the tribological behavior of duplex-coated die steel rubbing against forging brass was investigated. The wear tests were performed on a pin-on-disk machine from room temperature to 700 °C; the pins were made in H13 hot work tool steel treated by plasma nitriding and by PVD coatings of TiN-TiAlN-CrAlN. The disks were machined from a two-phase brass alloy too. The results revealed that the friction coefficient of this tribosystem went through a maximum at 550 °C and decreased largely at 700 °C. Furthermore, the formation of Cr2O3 caused the reduction of friction coefficient at 700 °C. PVD coatings proved their wear resistance up to 550 °C, well above the working temperature of the brass forging dies.

Molecular dynamics correctly models the unusual major conformation of the GAGU RNA internal loop and with NMR reveals an unusual minor conformation.

PubMed

Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H

2018-05-01

The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

DNA-DNA interaction beyond the ground state

NASA Astrophysics Data System (ADS)

Lee, D. J.; Wynveen, A.; Kornyshev, A. A.

2004-11-01

The electrostatic interaction potential between DNA duplexes in solution is a basis for the statistical mechanics of columnar DNA assemblies. It may also play an important role in recombination of homologous genes. We develop a theory of this interaction that includes thermal torsional fluctuations of DNA using field-theoretical methods and Monte Carlo simulations. The theory extends and rationalizes the earlier suggested variational approach which was developed in the context of a ground state theory of interaction of nonhomologous duplexes. It shows that the heuristic variational theory is equivalent to the Hartree self-consistent field approximation. By comparison of the Hartree approximation with an exact solution based on the QM analogy of path integrals, as well as Monte Carlo simulations, we show that this easily analytically-tractable approximation works very well in most cases. Thermal fluctuations do not remove the ability of DNA molecules to attract each other at favorable azimuthal conformations, neither do they wash out the possibility of electrostatic “snap-shot” recognition of homologous sequences, considered earlier on the basis of ground state calculations. At short distances DNA molecules undergo a “torsional alignment transition,” which is first order for nonhomologous DNA and weaker order for homologous sequences.

Coatings for directional eutectics. [cyclic furnace oxidation tests

NASA Technical Reports Server (NTRS)

Jackson, M. R.; Rairden, J. R.; Hampton, L. V.

1974-01-01

Coating compositions were evaluated for oxidation protection of directionally solidified composite alloy NiTaC-13. These coatings included three NiCrAlY compositions (30-5-1, 25-10-1 and 20-15-1), two FeCrAlY compositions (30-5-1 and 25-10-1), a CoCrAlY composition (25-10-1), and one duplex coating, Ni-35Cr + Al. Duplicate pin samples of each composition were evaluated using two cyclic furnace oxidation tests of 100 hours at 871 C and 500 hours at 1093 C. The two best coatings were Ni-20Cr-15Al-lY and Ni-35Cr + Al. The two preferred coatings were deposited on pins and were evaluated in detail in .05 Mach cyclic burner rig oxidation to 1093 C. The NiCrAlY coating was protective after 830 hours of cycling, while the duplex coating withstood 630 hours. Test bars were coated and cycled for up to 500 hours. Tensile tests indicated no effect of coatings on strength. In 871 C air stress rupture, a degradation was observed for coated relative to bare material. The cycled NiCrAlY coating offered excellent protection with properties superior to the bare cycled NiTaC-13 in 1093 C air stress rupture.

Effects of Duplex Nitriding and TiN Coating Treatment on Wear Resistance, Corrosion Resistance and Biocompatibility of Ti6Al4V Alloy

NASA Astrophysics Data System (ADS)

Kao, W. H.; Su, Y. L.; Hsieh, Y. T.

2017-08-01

Ti6Al4V alloy substrates were nitrided at 900 °C. TiN coatings were then deposited on the nitrided substrates using a closed-field unbalanced magnetron sputtering system. The microstructure, hardness and adhesion properties of the TiN-N-Ti6Al4V substrates were evaluated and compared with those of an untreated Ti6Al4V sample, a nitrided Ti6Al4V sample and a TiN-coated Ti6Al4V sample, respectively. The tribological properties of the various samples were investigated by means of reciprocating sliding wear tests performed in 0.9 wt.% NaCl solution against 316L, Si3N4 and Ti6Al4V balls, respectively. In addition, the corrosion resistance was evaluated using potentiodynamic polarization tests. Finally, the biocompatibility of the samples was investigated by observing the attachment and growth of purified mouse leukemic monocyte/macrophage cells (Raw 264.7) on the sample surface after culturing periods of 24, 72 and 120 h, respectively. Overall, the results showed that the duplex nitriding/TiN coating treatment significantly improved the tribological, anti-corrosion and biocompatibility properties of the original Ti6Al4V alloy.

Evaluation of present-day thermal barrier coatings for industrial/utility applications

NASA Technical Reports Server (NTRS)

Bratton, R. J.; Lau, S. K.; Lee, S. Y.

1980-01-01

Atmospheric burner rig tests have been conducted to evaluate the corrosion resistance of present-day thermal barrier coatings. The coatings are primarily plasma-sprayed and zirconia-based. Both duplex and graded coating systems were tested at a gas temperature of 2100 F and metal temperatures that range from 1475 F to 1650 F. The fuels ranged from clean GT No. 2 to that doped with impurity levels which simulate water-washed residual fuels. Results to date suggest that liquid sulfate condensates play an important role in the coating degradation mechanisms, whereas the role of vanadium and its salts is less clear.

Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

PubMed

Shirasu, Naoto; Kuroki, Masahide

2014-01-01

We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

PubMed Central

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

A Coupled EBSD/EDS Method to Determine the Primary- and Secondary-Alpha Textures in Titanium Alloys With Duplex Microstructures (Preprint)

DTIC Science & Technology

2007-07-01

primary and secondary alpha in micrographs and thus to correlate microstructural features and texture data [3- 6 ]. For instance, Germain, et al. [3, 4 ...Following electropolishing , the sample was mounted 7/3/2007 6 on the tilting stage inside an XL30 field-emission-gun scanning-electron-microscope (FEG...AFRL-RX-WP-TP-2008-4338 A COUPLED EBSD/EDS METHOD TO DETERMINE THE PRIMARY–AND SECONDARY–ALPHA TEXTURES IN TITANIUM ALLOYS WITH DUPLEX

Tertiary structure-based analysis of microRNA–target interactions

PubMed Central

Gan, Hin Hark; Gunsalus, Kristin C.

2013-01-01

Current computational analysis of microRNA interactions is based largely on primary and secondary structure analysis. Computationally efficient tertiary structure-based methods are needed to enable more realistic modeling of the molecular interactions underlying miRNA-mediated translational repression. We incorporate algorithms for predicting duplex RNA structures, ionic strength effects, duplex entropy and free energy, and docking of duplex–Argonaute protein complexes into a pipeline to model and predict miRNA–target duplex binding energies. To ensure modeling accuracy and computational efficiency, we use an all-atom description of RNA and a continuum description of ionic interactions using the Poisson–Boltzmann equation. Our method predicts the conformations of two constructs of Caenorhabditis elegans let-7 miRNA–target duplexes to an accuracy of ∼3.8 Å root mean square distance of their NMR structures. We also show that the computed duplex formation enthalpies, entropies, and free energies for eight miRNA–target duplexes agree with titration calorimetry data. Analysis of duplex–Argonaute docking shows that structural distortions arising from single-base-pair mismatches in the seed region influence the activity of the complex by destabilizing both duplex hybridization and its association with Argonaute. Collectively, these results demonstrate that tertiary structure-based modeling of miRNA interactions can reveal structural mechanisms not accessible with current secondary structure-based methods. PMID:23417009

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

PubMed

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Influence of Annealing on the Depth Microstructure of the Shot Peened Duplex Stainless Steel at Elevated Temperature

NASA Astrophysics Data System (ADS)

Feng, Qiang; She, Jia; Xiang, Yong; Wu, Xianyun; Wang, Chengxi; Jiang, Chuanhai

The depth profiles of residual stresses and lattice parameters in the surface layers of shot peened duplex stainless steel at elevated temperature were investigated utilizing X-ray diffraction analysis. At each deformation depth, residual stress distributions in both ferrite and austenite were studied by X-ray diffraction stress analysis which is performed on the basis of the sin2ψ method and the lattice parameters were explored by Rietveld method. The results reveal that difference changes of depth residual compressive stress profiles between ferrite and austenite under the same annealing condition are resulted from the diverse coefficient of thermal expansion, dislocation density, etc. for different phases in duplex stainless steel. The relaxations of depth residual stresses in austenite are more obvious than those in ferrite. The lattice parameters decrease in the surface layer with the extending of annealing time, however, they increase along the depth after annealing for 16min. The change of the depth lattice parameters can be ascribed to both thermal expansion and the relaxation of residual stress. The different changes of microstructure at elevated temperature between ferrite and austenite are discussed.

Planck-Benzinger thermal work function: Monoclonal antibody-DNA duplex binding interactions

NASA Astrophysics Data System (ADS)

Chun, Paul W.

We have reexamined the van't Hoff plots and delineation of thermodynamic data of the monoclonal antibodies of Jel 274 and Jel 241 binding to DNA duplex at high ionic strength using fluorescein-labeled oligonucleotide titration with increasing concentrations of the antibody as reported by Tanha and Lee (Nucleic Acid Res, 1997, 25, 1442). To compare the thermodynamic parameters from data over the experimental temperature range of 277-312.5 K, the binding constant from van't Hoff plots is used to evaluate ΔGo(T) from 0 to 400 K using our general linear T3 model, ΔGo(T) = α +βT2+γT3. The limited information provided by the van't Hoff plots and their extensions is not sufficient to describe the variations in the Gibbs free energy change as a function of temperature and other thermodynamic functions observed in these and other biological interactions. Rather, it is necessary to determine a number of thermodynamic parameters, including the heat of reaction, (Th), (Tm), and (TCp), and the thermal set point, (TS), all of which can be precisely assessed using our general linear T3 model. To date, no experimental measurement offers this degree of accuracy. In evaluating the thermodynamic parameters in the binding interaction of monoclonal IgG Jel 241-d[AT]20DNA duplex, it is apparent that at a high NaCl concentration, the range of the compensatory temperatures, (Th) = 155 K and (Tm) = 450 K, is much broader than observed in any other sample, whereas the thermal set points, (TS) = 330 K, is 20-30 K higher. The inherent chemical bond energy ΔHo(T0) is much lower in this sample. The values of thermal agitation energy (heat capacity integrals) are of similar magnitude for all the samples tested. It appears that increasing the NaCl concentration to 130 mM will greatly enhance the binding interaction between the monoclonal antibody and DNA duplex. It is not clear, however, from the limited data available, whether the binding interaction is sequence specific, although logic would suggest it is.

ESI-MS Investigation of an Equilibrium between a Bimolecular Quadruplex DNA and a Duplex DNA/RNA Hybrid

NASA Astrophysics Data System (ADS)

Birrento, Monica L.; Bryan, Tracy M.; Samosorn, Siritron; Beck, Jennifer L.

2015-07-01

Electrospray ionization mass spectrometry (ESI-MS) conditions were optimized for simultaneous observation of a bimolecular qDNA and a Watson-Crick base-paired duplex DNA/RNA hybrid. The DNA sequence used was telomeric DNA, and the RNA contained the template for telomerase-mediated telomeric DNA synthesis. Addition of RNA to the quadruplex DNA (qDNA) resulted in formation of the duplex DNA/RNA hybrid. Melting profiles obtained using circular dichroism spectroscopy confirmed that the DNA/RNA hybrid exhibited greater thermal stability than the bimolecular qDNA in solution. Binding of a 13-substituted berberine ( 1) derivative to the bimolecular qDNA stabilized its structure as evidenced by an increase in its stability in the mass spectrometer, and an increase in its circular dichroism (CD) melting temperature of 10°C. The DNA/RNA hybrid did not bind the ligand extensively and its thermal stability was unchanged in the presence of ( 1). The qDNA-ligand complex resisted unfolding in the presence of excess RNA, limiting the formation of the DNA/RNA hybrid. Previously, it has been proposed that DNA secondary structures, such as qDNA, may be involved in the telomerase mechanism. DNA/RNA hybrid structures occur at the active site of telomerase. The results presented in the current work show that if telomeric DNA was folded into a qDNA structure, it is possible for a DNA/RNA hybrid to form as is required during template alignment. The discrimination of ligand ( 1) for binding to the bimolecular qDNA over the DNA/RNA hybrid positions it as a useful compound for probing the role(s), if any, of antiparallel qDNA in the telomerase mechanism.

Real-time testing of titanium sheet and extrusion coupon specimens subjected to Mach 2.7 supersonic cruise aircraft wing stresses and temperatures

NASA Technical Reports Server (NTRS)

Lunde, T.

1977-01-01

The accuracy of three accelerated flight-by-flight test methods for material selection, and fatigue substantiation of supersonic cruise aircraft structure was studied. The real time stresses and temperatures applied to the specimens were representative of the service conditions in the lower surface of a Mach 2.7 supersonic cruise aircraft wing root structure. Each real time flight lasted about 65 minutes, including about one hour at (500 F) in the cruise condition. Center notched coupon specimens from six titanium materials were tested: mill-annealed, duplex-annealed, and triplex-annealed Ti-8Al-1Mo-1V sheets; mill-annealed Ti-8Al-1Mo-1V extrusion; mill-annealed Ti-6Al-4V sheet; and solution-treated and aged Ti-6Al-4V extrusion. For duplex-annealed Ti-8Al-1Mo-1V sheet, specimens with single spotweld were also tested. The test results were studied in conjunction with other related data from the literature for: material selection, structural fabrication, fatigue resistance of supersonic cruise aircraft structure, and fatigue test acceleration procedures for supersonic cruise aircraft.

Local electrical properties of thermally grown oxide films formed on duplex stainless steel surfaces

NASA Astrophysics Data System (ADS)

Guo, L. Q.; Yang, B. J.; He, J. Y.; Qiao, L. J.

2018-06-01

The local electrical properties of thermally grown oxide films formed on ferrite and austenite surfaces of duplex stainless steel at different temperatures were investigated by Current sensing atomic force microscopy, X-ray Photoelectron Spectroscopy (XPS) and Auger Electron Spectroscopy (AES). The current maps and XPS/AES analyses show that the oxide films covering austenite and ferrite surfaces formed at different temperatures exhibit different local electrical characteristics, thickness and composition. The dependence of electrical conductivity of oxide films covering austenite and ferrite surface on the formation temperature is attributed to the film thickness and semiconducting structures, which is intrinsically related to thermodynamics and kinetics process of film grown at different temperature. This is well elucidated by corresponding semiconductor band structures of oxide films formed on austenite and ferrite phases at different temperature.

Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

PubMed

Moreira, Bernardo G; You, Yong; Owczarzy, Richard

2015-03-01

Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

Multi-shell model of ion-induced nucleic acid condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois

2016-04-21

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes in- duced by tri-valent cobalt hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. The duplex aggregation free energy is de- composed into attraction and repulsion components represented by simple analytic expressions. The source of the short-range attraction between NA duplexes in the aggregated phase is the in- teraction of CoHex ions in the overlapping regions of the “external” shells with the oppositely chargedmore » duplexes. The attraction depends on CoHex binding affinity to the “external” shell of nearly neutralized duplex and the number of ions in the shell overlapping volume. For a given NA duplex sequence and structure, these parameters are estimated from molecular dynamics simula- tion. The attraction is opposed by the residual repulsion of nearly neutralized duplexes as well as duplex configurational entropy loss upon aggregation. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA conden- sation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. The model also predicts that longer NA fragments will condense easier than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation, lends support to proposed NA condensation picture based on the multivalent “ion binding shells”.« less

Force-Induced Rupture of a DNA Duplex: From Fundamentals to Force Sensors.

PubMed

Mosayebi, Majid; Louis, Ard A; Doye, Jonathan P K; Ouldridge, Thomas E

2015-12-22

The rupture of double-stranded DNA under stress is a key process in biophysics and nanotechnology. In this article, we consider the shear-induced rupture of short DNA duplexes, a system that has been given new importance by recently designed force sensors and nanotechnological devices. We argue that rupture must be understood as an activated process, where the duplex state is metastable and the strands will separate in a finite time that depends on the duplex length and the force applied. Thus, the critical shearing force required to rupture a duplex depends strongly on the time scale of observation. We use simple models of DNA to show that this approach naturally captures the observed dependence of the force required to rupture a duplex within a given time on duplex length. In particular, this critical force is zero for the shortest duplexes, before rising sharply and then plateauing in the long length limit. The prevailing approach, based on identifying when the presence of each additional base pair within the duplex is thermodynamically unfavorable rather than allowing for metastability, does not predict a time-scale-dependent critical force and does not naturally incorporate a critical force of zero for the shortest duplexes. We demonstrate that our findings have important consequences for the behavior of a new force-sensing nanodevice, which operates in a mixed mode that interpolates between shearing and unzipping. At a fixed time scale and duplex length, the critical force exhibits a sigmoidal dependence on the fraction of the duplex that is subject to shearing.

A new diffusion-inhibited oxidation-resistant coating for superalloys

NASA Technical Reports Server (NTRS)

Gedwill, M. A.; Glasgow, T. K.; Levine, S. R.

1981-01-01

A concept for enhanced protection of superalloys consists of adding an oxidation- and diffusion-resistant cermet layer between the superalloy and the outer oxidation-resistant metallic alloy coating. Such a duplex coating was compared with a physical-vapor-deposited (PVD) NiCrAlY coating in cyclic oxidation at 1150 C. The substrate alloy was MA 754 - an oxide-dispersion-strengthened superalloy that is difficult to coat. The duplex coating, applied by plasma spraying, outperformed the PVD coating on the basis of weight change and both macroscopic and metallographic observations.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, J. D.; Miller, M. K.; Young, G. A.

Duplex stainless steels are desirable for use in power generation systems due to their attractive combination of strength, corrosion resistance, and cost. However, thermal embrittlement at intermediate homologous temperatures of ~887°F (475°C) and below, via spinodal decomposition, limits upper service temperatures for many applications. New lean grade duplex alloys have improved thermal stability over standard grades and potentially increase the upper service temperature or the lifetime at a given temperature for this class of material. The present work compares the thermal stability of lean grade, alloy 2003 to standard grade, alloy 2205, through a series of isothermal agings between 500°Fmore » (260°C) and 900°F (482°C) for times between 1 and 10,000 hours. Aged samples were characterized by changes in microhardness and impact toughness. Additionally, atom probe tomography was performed to illustrate the evolution of the α-α' phase separation in both alloys at select conditions. Atom probe tomography confirmed that phase separation occurs via spinodal decomposition for both alloys and identified the formation of Ni-Cu-Si-Mn-P clusters in alloy 2205 that may contribute to embrittlement of this alloy. The impact toughness model predictions for upper service temperature show that alloy 2003 can be considered for use in 550°F applications for 80 year service lifetimes based on a Charpy V-notch criteria of 35 ft-lbs at 70°F. Alloy 2205 should be limited to 500°F applications.« less

Advanced ordered intermetallic alloy deployment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, C.T.; Maziasz, P.J.; Easton, D.S.

1997-04-01

The need for high-strength, high-temperature, and light-weight materials for structural applications has generated a great deal of interest in ordered intermetallic alloys, particularly in {gamma}-based titanium aluminides {gamma}-based TiAl alloys offer an attractive mix of low density ({approximately}4g/cm{sup 3}), good creep resistance, and high-temperature strength and oxidation resistance. For rotating or high-speed components. TiAl also has a high damping coefficient which minimizes vibrations and noise. These alloys generally contain two phases. {alpha}{sub 2} (DO{sub 19} structure) and {gamma} (L 1{sub 0}), at temperatures below 1120{degrees}C, the euticoid temperature. The mechanical properties of TiAl-based alloys are sensitive to both alloy compositionsmore » and microstructure. Depending on heat-treatment and thermomechanical processing, microstructures with near equiaxed {gamma}, a duplex structure (a mix of the {gamma} and {alpha}{sub 2} phases) can be developed in TiAl alloys containing 45 to 50 at. % Al. The major concern for structural use of TiAl alloys is their low ductility and poor fracture resistance at ambient temperatures. The purpose of this project is to improve the fracture toughness of TiAl-based alloys by controlling alloy composition, microstructure and thermomechanical treatment. This work is expected to lead to the development of TiAl alloys with significantly improved fracture toughness and tensile ductility for structural use.« less

A most spectrum-efficient duplexing system: CDD

NASA Astrophysics Data System (ADS)

Lee, William C. Y.

2001-10-01

The game to play in wireless communications when it comes to increasing spectrum efficiency is to eliminate interference. Currently, all cellular systems use FDD (Frequency Division Duplexing) in an attempt to eliminate the interference from the adjacent cells. Through the use of many technologies only one type of interference remains and that is the adjacent base-tohome mobile interference. TDD (Time Division Duplexing) has not been used for mobile cellular systems, not only because of the adjacent base-to-home mobile interference, but also because of the additional adjacent base-to-home base interference, and adjacent mobile-to-home mobile interference. Therefore, TDD can only be used for small, confined area systems. CDD (Code Division Duplexing) can eliminate all three kinds of interference; the adjacent base-to-home mobile, the adjacent baseto-home base, and the adjacent mobile- to- home in cellular systems. Eliminating each of these interferences makes CDD the most spectrum efficient duplexing system. This talk will elaborate on a set of smart codes, which will make an efficient CDD system a reality.

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

PubMed

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

Thermal Stability of RNA Structures with Bulky Cations in Mixed Aqueous Solutions.

PubMed

Nakano, Shu-Ichi; Tanino, Yuichi; Hirayama, Hidenobu; Sugimoto, Naoki

2016-10-04

Bulky cations are used to develop nucleic-acid-based technologies for medical and technological applications in which nucleic acids function under nonaqueous conditions. In this study, the thermal stability of RNA structures was measured in the presence of various bulky cations in aqueous mixtures with organic solvents or polymer additives. The stability of oligonucleotide, transfer RNA, and polynucleotide structures was decreased in the presence of salts of tetrabutylammonium and tetrapentylammonium ions, and the stability and salt concentration dependences were dependent on cation sizes. The degree to which stability was dependent on salt concentration was correlated with reciprocals of the dielectric constants of mixed solutions, regardless of interactions between the cosolutes and RNA. Our results show that organic solvents affect the strength of electrostatic interactions between RNA and cations. Analysis of ion binding to RNA indicated greater enhancement of cation binding to RNA single strands than to duplexes in media with low dielectric constants. Furthermore, background bulky ions changed the dependence of RNA duplex stability on the concentration of metal ion salts. These unique properties of large tetraalkylammonium ions are useful for controlling the stability of RNA structures and its sensitivity to metal ion salts. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Photophysical Characterization of Enhanced 6-Methylisoxanthopterin Fluorescence in Duplex DNA.

PubMed

Moreno, Andrew; Knee, J L; Mukerji, Ishita

2016-12-08

The structure and dynamic motions of bases in DNA duplexes and other constructs are important for understanding mechanisms of selectivity and recognition of DNA-binding proteins. The fluorescent guanine analogue, 6-methylisoxanthopterin 6-MI, is well suited to this purpose as it exhibits an unexpected 3- to 4-fold increase in relative quantum yield upon duplex formation when incorporated into the following sequences: ATFAA, AAFTA, or ATFTA (where F represents 6-MI). To better understand some of the factors leading to the 6-MI fluorescence increase upon duplex formation, we characterized the effect of local sequence and structural perturbations on 6-MI photophysics through temperature melts, quantum yield measurements, fluorescence quenching assays, and fluorescence lifetime measurements. By examining 21 sequences we have determined that the duplex-enhanced fluorescence (DEF) depends on the composition of bases adjacent to 6-MI and the presence of adenines at locations n ± 2 from the probe. Investigation of duplex stability and local solvent accessibility measurements support a model in which the DEF arises from a constrained geometry of 6-MI in the duplex, which remains H-bonded to cytosine, stacked with adjacent bases and inaccessible to quenchers. Perturbation of DNA structure through the introduction of an unpaired base 3' to 6-MI or a mismatched basepair increases 6-MI dynamic motion leading to fluorescence quenching and a reduction in quantum yield. Molecular dynamics simulations suggest the enhanced fluorescence results from a greater degree of twist at the X-F step relative to the quenched duplexes examined. These results point to a model where adenine residues located at n ± 2 from 6-MI induce a structural geometry with greater twist in the duplex that hinders local motion reducing dynamic quenching and producing an increase in 6-MI fluorescence.

Process development for Ni-Cr-ThO2 and Ni-Cr-Al-ThO2 sheet

NASA Technical Reports Server (NTRS)

Cook, R. C.; Norris, L. F.

1973-01-01

A process was developed for the production of thin gauge Ni-Cr-ThO2 sheet. The process was based on the elevated temperature deposition of chromium onto a wrought Ni-2%ThO2 sheet and subsequent high temperature diffusion heat treatments to minimize chromium concentration gradients within the sheet. The mechanical properties of the alloy were found to be critically dependent on those of the Ni-2%ThO2 sheet. A similar process for the production of a Ni-Cr-Al-ThO2 alloy having improved oxidation resistance was investigated but the non-reproducible deposition of aluminum from duplex Cr/Al packs precluded successful scale-up. The mechanical properties of the Ni-Cr-Al-ThO2 alloys were generally equivalent to the best Ni-Cr-ThO2 alloy produced in the programme.

Single nucleotide polymorphism detection in aldehyde dehydrogenase 2 (ALDH2) gene using bacterial magnetic particles based on dissociation curve analysis.

PubMed

Maruyama, Kohei; Takeyama, Haruko; Nemoto, Etsuo; Tanaka, Tsuyoshi; Yoda, Kiyoshi; Matsunaga, Tadashi

2004-09-20

Single nucleotide polymorphism (SNP) detection for aldehyde dehydrogenase 2 (ALDH2) gene based on DNA thermal dissociation curve analysis was successfully demonstrated using an automated system with bacterial magnetic particles (BMPs) by developing a new method for avoiding light scattering caused by nanometer-size particles when using commercially available fluorescent dyes such as FITC, Cy3, and Cy5 as labeling chromophores. Biotin-labeled PCR products in ALDH2, two allele-specific probes (Cy3-labeled detection probe for ALDH2*1 and Cy5-labeled detection probe for ALDH2*2), streptavidin-immobilized BMPs (SA-BMPs) were simultaneously mixed. The mixture was denatured at 70 degrees C for 3 min, cooled slowly to 25 degrees C, and incubated for 10 min, allowing the DNA duplex to form between Cy3- or Cy5-labeled detection probes and biotin-labeled PCR products on SA-BMPs. Then duplex DNA-BMP complex was heated to 58 degrees C, a temperature determined by dissociation curve analysis and a dissociated single-base mismatched detection probe was removed at the same temperature under precise control. Furthermore, fluorescence signal from the detection probe was liberated into the supernatant from completely matched duplex DNA-BMP complex by heating to 80 degrees C and measured. In the homozygote target DNA (ALDH2*1/*1 and ALDH2*2/*2), the fluorescence signals from single-base mismatched were decreased to background level, indicating that mismatched hybridization was efficiently removed by the washing process. In the heterozygote target DNA (ALDH2*1/*2), each fluorescence signals was at a similar level. Therefore, three genotypes of SNP in ALDH2 gene were detected using the automated detection system with BMPs. Copyright 2004 Wiley Periodicals, Inc.

Multi-shell model of ion-induced nucleic acid condensation

NASA Astrophysics Data System (ADS)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Baker, Nathan A.; Onufriev, Alexey V.

2016-04-01

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into "external" and "internal" ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the "external" shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the "internal" shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent "ion binding shells."

Development of AlN/Epoxy Composites with Enhanced Thermal Conductivity.

PubMed

Xu, Yonggang; Yang, Chi; Li, Jun; Mao, Xiaojian; Zhang, Hailong; Hu, Song; Wang, Shiwei

2017-12-18

AlN/epoxy composites with high thermal conductivity were successfully prepared by infiltrating epoxy into AlN porous ceramics which were fabricated by gelcasting of foaming method. The microstructure, mechanical, and thermal properties of the resulting composites were investigated. The compressive strengths of the AlN/epoxy composites were enhanced compared with the pure epoxy. The AlN/epoxy composites demonstrate much higher thermal conductivity, up to 19.0 W/(m·K), compared with those by the traditional particles filling method, because of continuous thermal channels formed by the walls and struts of AlN porous ceramics. This study demonstrates a potential route to manufacture epoxy-based composites with extremely high thermal conductivity.

Development of AlN/Epoxy Composites with Enhanced Thermal Conductivity

PubMed Central

Xu, Yonggang; Yang, Chi; Li, Jun; Zhang, Hailong; Hu, Song; Wang, Shiwei

2017-01-01

AlN/epoxy composites with high thermal conductivity were successfully prepared by infiltrating epoxy into AlN porous ceramics which were fabricated by gelcasting of foaming method. The microstructure, mechanical, and thermal properties of the resulting composites were investigated. The compressive strengths of the AlN/epoxy composites were enhanced compared with the pure epoxy. The AlN/epoxy composites demonstrate much higher thermal conductivity, up to 19.0 W/(m·K), compared with those by the traditional particles filling method, because of continuous thermal channels formed by the walls and struts of AlN porous ceramics. This study demonstrates a potential route to manufacture epoxy-based composites with extremely high thermal conductivity. PMID:29258277

Deposition and thermal characterization of nano-structured aluminum nitride thin film on Cu-W substrate for high power light emitting diode package.

PubMed

Cho, Hyun Min; Kim, Min-Sun

2014-08-01

In this study, we developed AlN thick film on metal substrate for hybrid type LED package such as chip on board (COB) using metal printed circuit board (PCB). Conventional metal PCB uses ceramic-polymer composite as electrical insulating layer. Thermal conductivities of such type dielectric film are typically in the range of 1~4 W/m · K depending on the ceramic filler. Also, Al or Cu alloy are mainly used for metal base for high thermal conduction to dissipate heat from thermal source mounted on metal PCB. Here we used Cu-W alloy with low thermal expansion coefficient as metal substrate to reduce thermal stress between insulating layer and base metal. AlN with polyimide (PI) powder were used as starting materials for deposition. We could obtain very high thermal conductivity of 28.3 W/m · K from deposited AlN-PI thin film by AlN-3 wt% PI powder. We made hybrid type high power LED package using AlN-PI thin film. We tested thermal performance of this film by thermal transient measurement and compared with conventional metal PCB substrate.

Experience with duplex bearings in narrow angle oscillating applications

NASA Technical Reports Server (NTRS)

Phinney, D. D.; Pollard, C. L.; Hinricks, J. T.

1988-01-01

Duplex ball bearings are matched pairs on which the abutting faces of the rings have been accurately ground so that when the rings are clamped together, a controlled amount of interference (preload) exists across the balls. These bearings are vulnerable to radial temperature gradients, blocking in oscillation and increased sensitivity to contamination. These conditions decrease the service life of these bearings. It was decided that an accelerated thermal vacuum life test should be conducted. The test apparatus and results are described and the rationale is presented for reducing a multiyear life test on oil lubricated bearings to less than a year.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, T.; Shimizu, S.; Ogata, Y.

For the primary coolant piping of PWRs in Japan, cast duplex stainless steel which is excellent in terms of strength, corrosion resistance, and weldability has conventionally been used. The cast duplex stainless steel contains the ferrite phase in the austenite matrix and thermal aging after long term service is known to change its material characteristics. It is considered appropriate to apply the methodology of elastic plastic fracture mechanics for an evaluation of the integrity of the primary coolant piping after thermal aging. Therefore we evaluated the integrity of the primary coolant piping for an initial PWR plant in Japan bymore » means of elastic plastic fracture mechanics. The evaluation results show that the crack will not grow into an unstable fracture and the integrity of the piping will be secured, even when such through wall crack length is assumed to equal the fatigue crack growth length for a service period of up to 60 years.« less

Effect of heat treatment on corrosion behavior of duplex stainless steel in orthodontic applications

NASA Astrophysics Data System (ADS)

Sabea Hammood, Ali; Faraj Noor, Ahmed; Talib Alkhafagy, Mohammed

2017-12-01

Heat treatment is necessary for duplex stainless steel (DSS) to remove or dissolve intermetallic phases, to remove segregation and to relieve any residual thermal stress in DSS, which may be formed during production processes. In the present study, the corrosion resistance of a DSS in artificial saliva was studied by potentiodynamic measurements. The microstructure was investigated by scanning electron microscopy (SEM),x-ray diffraction (XRD) and Vickers hardness (HV). The properties were tested in as-received and in thermally treated conditions (800-900 °C, 2-8 min). The research aims to evaluate the capability of DSS for orthodontic applications, in order to substitute the austenitic grades. The results indicate that the corrosion resistance is mainly affected by the ferrite/austenite ratio. The best result was obtained with a treatment at 900 °C for 2 min.

Genotyping by alkaline dehybridization using graphically encoded particles.

PubMed

Zhang, Huaibin; DeConinck, Adam J; Slimmer, Scott C; Doyle, Patrick S; Lewis, Jennifer A; Nuzzo, Ralph G

2011-03-01

This work describes a nonenzymatic, isothermal genotyping method based on the kinetic differences exhibited in the dehybridization of perfectly matched (PM) and single-base mismatched (MM) DNA duplexes in an alkaline solution. Multifunctional encoded hydrogel particles incorporating allele-specific oligonucleotide (ASO) probes in two distinct regions were fabricated by using microfluidic-based stop-flow lithography. Each particle contained two distinct ASO probe sequences differing at a single base position, and thus each particle was capable of simultaneously probing two distinct target alleles. Fluorescently labeled target alleles were annealed to both probe regions of a particle, and the rate of duplex dehybridization was monitored by using fluorescence microscopy. Duplex dehybridization was achieved through an alkaline stimulus using either a pH step function or a temporal pH gradient. When a single target probe sequence was used, the rate of mismatch duplex dehybridization could be discriminated from the rate of perfect match duplex dehybridization. In a more demanding application in which two distinct probe sequences were used, we found that the rate profiles provided a means to discriminate probe dehybridizations from both of the two mismatched duplexes as well as to distinguish at high certainty the dehybridization of the two perfectly matched duplexes. These results demonstrate an ability of alkaline dehybridization to correctly discriminate the rank hierarchy of thermodynamic stability among four sets of perfect match and single-base mismatch duplexes. We further demonstrate that these rate profiles are strongly temperature dependent and illustrate how the sensitivity can be compensated beneficially by the use of an actuating gradient pH field. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Theoretical Development of a Multicarrier Wireless Relay System and a Practical Exploration of Full-Duplex Radio Communication

DTIC Science & Technology

2014-06-01

analyzed the performance of full-duplex MIMO OFDM transceivers under non-ideal ADCs. In [62], impact of thermal noise on full-duplex radio was...h12 ∗ h23 − h22 ∗ h13 h12 ∗ h24 − h22 ∗ h14 h21 ∗ h13 − h11 ∗ h23 h21 ∗ h14 − h11 ∗ h24 h22 ∗ h11 − h12 ∗ h21 0 0 h22 ∗ h11 − h12 ∗ h21...with complex model for fullduplex can be de- scribed as the following equation: xc =  xar xai xbr xbi  =  h13

A Commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century"

ERIC Educational Resources Information Center

Brandt, Steffen

2010-01-01

This article presents the author's commentary on "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century," in which Isaac I. Bejar and E. Aurora Graf propose the application of a test design--the duplex design (which was proposed in 1988 by Bock and Mislevy) for application in current accountability assessments.…

NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.

PubMed

Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L

2014-03-07

Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.

Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.

PubMed

Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J

2018-04-06

In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.

Validation of a novel duplex ultrasound objective structured assessment of technical skills (DUOSATS) for arterial stenosis detection.

PubMed

Jaffer, U; Singh, P; Pandey, V A; Aslam, M; Standfield, N J

2014-01-01

Duplex ultrasound facilitates bedside diagnosis and hence timely patient care. Its uptake has been hampered by training and accreditation issues. We have developed an assessment tool for Duplex arterial stenosis measurement for both simulator and patient based training. A novel assessment tool: duplex ultrasound assessment of technical skills was developed. A modified duplex ultrasound assessment of technical skills was used for simulator training. Novice, intermediate experience and expert users of duplex ultrasound were invited to participate. Participants viewed an instructional video and were allowed ample time to familiarize with the equipment. Participants' attempts were recorded and independently assessed by four experts using the modified duplex ultrasound assessment of technical skills. 'Global' assessment was also done on a four point Likert scale. Content, construct and concurrent validity as well as reliability were evaluated. Content and construct validity as well as reliability were demonstrated. The simulator had good satisfaction rating from participants: median 4; range 3-5. Receiver operator characteristic analysis has established a cut point of 22/ 34 and 25/ 40 were most appropriate for simulator and patient based assessment respectively. We have validated a novel assessment tool for duplex arterial stenosis detection. Further work is underway to establish transference validity of simulator training to improved skill in scanning patients. We have developed and validated duplex ultrasound assessment of technical skills for simulator training.

Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

PubMed

Pang, Jie; Zhang, Ziping; Jin, Haizhu

2016-03-15

Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Synthesis and conformational properties of oligonucleotides incorporating 2'-O-phosphorylated ribonucleotides as structural motifs of pre-tRNA splicing intermediates.

PubMed

Tsuruoka, H; Shohda, K; Wada, T; Sekine, M

2000-11-03

To synthesize oligonucleotides containing 2'-O-phosphate groups, four kinds of ribonucleoside 3'-phosphoramidite building blocks 6a-d having the bis(2-cyano-1,1-dimethylethoxy)thiophosphoryl (BCMETP) group were prepared according to our previous phosphorylation procedure. These phosphoramidite units 6a-d were not contaminated with 3'-regioisomers and were successfully applied to solid-phase synthesis to give oligodeoxyuridylates 15, 16 and oligouridylates 21, 22. Self-complementary Drew-Dickerson DNA 12mers 24-28 replaced by a 2'-O-phosphorylated ribonucleotide at various positions were similarly synthesized. In these syntheses, it turned out that KI(3) was the most effective reagent for oxidative desulfurization of the initially generated thiophosphate group to the phosphate group on polymer supports. Without using this conversion step, a tridecadeoxyuridylate 17 incorporating a 2'-O-thiophosphorylated uridine derivative was also synthesized. To investigate the effect of the 2'-phosphate group on the thermal stability and 3D-structure of DNA(RNA) duplexes, T(m) measurement of the self-complementary oligonucleotides obtained and MD simulation of heptamer duplexes 33-36 were carried out. According to these analyses, it was suggested that the nucleoside ribose moiety phosphorylated at the 2'-hydroxyl function predominantly preferred C2'-endo to C3'-endo conformation in DNA duplexes so that it did not significantly affect the stability of the DNA duplex. On the other hand, the 2'-modified ribose moiety was expelled to give a C3'-endo conformation in RNA duplexes so that the RNA duplexes were extremely destabilized.

Effect of initial hydrogen content of a titanium alloy on susceptibility to hot-salt stress-corrosion

NASA Technical Reports Server (NTRS)

Gray, H. R.

1971-01-01

The Ti-8Al-1Mo-1V alloy was tested in four conditions: mill annealed (70 ppM H), duplex annealed (70 ppM H), vacuum annealed to an intermediate (36 ppM) and a low (9 ppM H) hydrogen level. Material annealed at 650 C (duplex condition) exhibited resistance to hot-salt stress corrosion superior to that exhibited by material in the mill-annealed condition. Reduction of the alloy hydrogen content from 70 to as low as 9 ppM did not influence resistance to hot-salt stress corrosion embrittlement or cracking.

Thermodynamic and hydration effects for the incorporation of a cationic 3-aminopropyl chain into DNA

PubMed Central

Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.

2002-01-01

The introduction of cationic 5-(ω-aminoalkyl)-2′-deoxypyrimidines into duplex DNA has been shown to induce DNA bending. In order to understand the energetic and hydration contributions for the incorporation of a cationic side chain in DNA a combination of spectroscopy, calorimetry and density techniques were used. Specifically, the temperature unfolding and isothermal formation was studied for a pair of duplexes with sequence d(CGTAGUCG TGC)/d(GCACGACTACG), where U represents 2′-deoxyuridine (‘control’) or 5-(3-aminopropyl)-2′-deoxyuridine (‘modified’). Continuous variation experiments confirmed 1:1 stoichiometries for each duplex and the circular dichroism spectra show that both duplexes adopted the B conformation. UV and differential scanning calorimetry melting experiments reveal that each duplex unfolds in two-state transitions. In low salt buffer, the ‘modified’ duplex is more stable and unfolds with a lower endothermic heat and lower release of counterion and water. This electrostatic stabilization is entropy driven and disappears at higher salt concentrations. Complete thermodynamic profiles at 15°C show that the favorable formation of each duplex results from the compensation of a favorable exothermic heat with an unfavorable entropy contribution. However, the isothermal profiles yielded a differential enthalpy of 8.8 kcal/mol, which is 4.3 kcal/mol higher than the differential enthalpy observed in the unfolding profiles. This indicates that the presence of the aminopropyl chain induces an increase in base stacking interactions in the modified single strand and a decrease in base stacking interactions in the modified duplex. Furthermore, the formation of the ‘control’ duplex releases water while the ‘modified’ duplex takes up water. Relative to the control duplex, formation of the modified duplex at 15°C yielded a marginal differential ΔG° term, positive ΔΔHITC–Δ(TΔS) compensation, negative ΔΔV and a net release of counterions. The opposite signs of the differential enthalpy–entropy compensation and differential volume change terms show a net uptake of structural water around polar and non-polar groups. This indicates that incorporation of the aminopropyl chain induces a higher exposure of aromatic bases to the solvent, which may be consistent with a small and local bend in the ‘modified’ duplex. PMID:12136099

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

PubMed

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of Microstructure and Mechanical Properties in Dissimilar Austenitic/Super Duplex Stainless Steel Joint

NASA Astrophysics Data System (ADS)

Rahmani, Mehdi; Eghlimi, Abbas; Shamanian, Morteza

2014-10-01

To study the effect of chemical composition on microstructural features and mechanical properties of dissimilar joints between super duplex and austenitic stainless steels, welding was attempted by gas tungsten arc welding process with a super duplex (ER2594) and an austenitic (ER309LMo) stainless steel filler metal. While the austenitic weld metal had vermicular delta ferrite within austenitic matrix, super duplex stainless steel was mainly comprised of allotriomorphic grain boundary and Widmanstätten side plate austenite morphologies in the ferrite matrix. Also the heat-affected zone of austenitic base metal comprised of large austenite grains with little amounts of ferrite, whereas a coarse-grained ferritic region was observed in the heat-affected zone of super duplex base metal. Although both welded joints showed acceptable mechanical properties, the hardness and impact strength of the weld metal produced using super duplex filler metal were found to be better than that obtained by austenitic filler metal.

Structural and thermodynamic insight into E. coli UvrABC mediated incision of cluster di-acetylaminofluorene adducts on the NarI sequence

PubMed Central

Jain, Vipin; Hilton, Benjamin; Lin, Bin; Jain, Anshu; MacKerell, Alexander D.; Zou, Yue; Cho, Bongsup P.

2014-01-01

Cluster DNA damage refers to two or more lesions in a single turn of the DNA helix. Such clustering may occur with bulky DNA lesions, which may be responsible for their sequence dependent repair and mutational outcomes. Here we prepared three 16-mer cluster duplexes in which two fluoroacetylaminofluorene adducts (dG-FAAF) are separated by none, one and two nucleotides in the E. coli NarI mutational hot spot (5'-CTCTCG1G2CG3CCATCAC-3'): i.e. 5'-- CG1*G2*CG3CC--3', 5'--CG1G2*CG3*CC--3', and 5'--CG1*G2CG3*CC--3' [G*=dG-FAAF], respectively. We conducted spectroscopic, thermodynamic, and molecular dynamics studies of these di-FAAF duplexes and the results were compared with those of the corresponding mono- FAAF adducts in the same NarI sequence (Nucleic Acids Res. 2012, 3939–3951). Our nucleotide excision repair results showed greater reparability of the di-adducts in comparison to the corresponding mono-adducts. Moreover, we observed dramatic flanking base sequence effects on their repair efficiency in the order of NarI-G2G3 > -G1G3 > -G1G2. The NMR/CD/UV-melting and MD-simulation results revealed that in contrast to the mono-adducts, di-adducts produced synergistic effect on duplex destabilization. In addition, dG-FAAF at G2G3 and G1G3 destack the neighboring bases with greater destabilization occurring with the former. Overall, the results indicate the importance of base stacking and related thermal/thermodynamic destabilization in the repair of bulky cluster arylamine DNA adducts. PMID:23841451

Structure and conversion kinetics of a bi-stable DNA i-motif: broken symmetry in the [d(5mCCTCC)]4 tetramer.

PubMed

Nonin, S; Leroy, J L

1996-08-23

At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.

Creep deformation in near-γ TiAl: Part 1. the influence of microstructure on creep deformation in Ti-49Al-1V

NASA Astrophysics Data System (ADS)

Worth, Brian D.; Jones, J. Wayne; Allison, John E.

1995-11-01

The influence of microstructure on creep deformation was examined in the near-y TiAl alloy Ti-49A1-1V. Specifically, microstructures with varying volume fractions of lamellar constituent were produced through thermomechanical processing. Creep studies were conducted on these various microstructures under constant load in air at temperatures between 760 °C and 870 °C and at stresses ranging from 50 to 200 MPa. Microstructure significantly influences the creep behavior of this alloy, with a fully lamellar microstructure yielding the highest creep resistance of the microstructures examined. Creep resistance is dependent on the volume fraction of lamellar constituent, with the lowest creep resistance observed at intermediate lamellar volume fractions. Examination of the creep deformation structure revealed planar slip of dislocations in the equiaxed y microstructure, while subboundary formation was observed in the duplex microstructure. The decrease in creep resistance of the duplex microstructure, compared with the equiaxed y microstructure, is attributed to an increase in dislocation mobility within the equiaxed y constituent, that results from partitioning of oxygen from the γ phase to the α2 phase. Dislocation motion in the fully lamellar microstructure was confined to the individual lamellae, with no evidence of shearing of γ/γ or γ/α2 interfaces. This suggests that the high creep resistance of the fully lamellar microstructure is a result of the fine spacing of the lamellar structure, which results in a decreased effective slip length for dislocation motion over that found in the duplex and equiaxed y microstructures.

Multi-shell model of ion-induced nucleic acid condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(III) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derivedmore » from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.”.« less

Multi-shell model of ion-induced nucleic acid condensation

PubMed Central

Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Onufriev, Alexey V.

2016-01-01

We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.” PMID:27389241

A Dual-Specific Targeting Approach Based on the Simultaneous Recognition of Duplex and Quadruplex Motifs.

PubMed

Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân

2017-09-20

Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.

Triple helical DNA in a duplex context and base pair opening

PubMed Central

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

Influence of nucleotide modifications at the C2’ position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA

PubMed Central

Copp, William; Denisov, Alexey Y.; Xie, Jingwei; Noronha, Anne M.; Liczner, Christopher; Safaee, Nozhat

2017-01-01

Abstract Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2′-deoxyribose, 2′-O-methyl-ribose, 2′-deoxy-2′-fluoro-ribose, arabinose and 2′-deoxy-2′-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2’ modifications gave a variety of effects. Arabinose and 2′-deoxy-2′-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2′-O-methyl and 2′-deoxy-2′-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. PMID:28973475

Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

PubMed

Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

2017-09-29

Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Sensitivity of hydrogen bonds of DNA and RNA to hydration, as gauged by 1JNH measurements in ethanol-water mixtures.

PubMed

Manalo, Marlon N; Kong, Xiangming; LiWang, Andy

2007-04-01

Hydrogen-bond lengths of nucleic acids are (1) longer in DNA than in RNA, and (2) sequence dependent. The physicochemical basis for these variations in hydrogen-bond lengths is unknown, however. Here, the notion that hydration plays a significant role in nucleic acid hydrogen-bond lengths is tested. Watson-Crick N1...N3 hydrogen-bond lengths of several DNA and RNA duplexes are gauged using imino 1J(NH) measurements, and ethanol is used as a cosolvent to lower water activity. We find that 1J(NH) values of DNA and RNA become less negative with added ethanol, which suggests that mild dehydration reduces hydrogen-bond lengths even as the overall thermal stabilities of these duplexes decrease. The 1J(NH) of DNA are increased in 8 mol% ethanol to those of RNA in water, which suggests that the greater hydration of DNA plays a significant role in its longer hydrogen bonds. The data also suggest that ethanol-induced dehydration is greater for the more hydrated G:C base pairs and thereby results in greater hydrogen-bond shortening than for the less hydrated A:T/U base pairs of DNA and RNA.

Solution structure and stability of the DNA undecamer duplexes containing oxanine mismatch

PubMed Central

Pack, Seung Pil; Morimoto, Hirohisa; Makino, Keisuke; Tajima, Kunihiko; Kanaori, Kenji

2012-01-01

Solution structures of DNA duplexes containing oxanine (Oxa, O) opposite a cytosine (O:C duplex) and opposite a thymine (O:T duplex) have been solved by the combined use of 1H NMR and restrained molecular dynamics calculation. One mismatch pair was introduced into the center of the 11-mer duplex of [d(GTGACO6CACTG)/d(CAGTGX17GTCAC), X = C or T]. 1H NMR chemical shifts and nuclear Overhauser enhancement (NOE) intensities indicate that both the duplexes adopt an overall right-handed B-type conformation. Exchangeable resonances of C17 4-amino proton of the O:C duplex and of T17 imino proton of O:T duplex showed unusual chemical shifts, and disappeared with temperature increasing up to 30°C, although the melting temperatures were >50°C. The O:C mismatch takes a wobble geometry with positive shear parameter where the Oxa ring shifted toward the major groove and the paired C17 toward the minor groove, while, in the O:T mismatch pair with the negative shear, the Oxa ring slightly shifted toward the minor groove and the paired T17 toward the major groove. The Oxa mismatch pairs can be wobbled largely because of no hydrogen bond to the O1 position of the Oxa base, and may occupy positions in the strands that optimize the stacking with adjacent bases. PMID:22039100

Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

PubMed Central

Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

2015-01-01

Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

Thermal effects of diagnostic ultrasound in an anthropomorphic skull model.

PubMed

Vyskocil, E; Pfaffenberger, S; Kollmann, C; Gleiss, A; Nawratil, G; Kastl, S; Unger, E; Aumayr, K; Schuhfried, O; Huber, K; Wojta, J; Gottsauner-Wolf, M

2012-12-01

Exposure to diagnostic ultrasound (US) can significantly heat biological tissue although conventional routine examinations are regarded as safe. The risk of unwanted thermal effects increases with a high absorption coefficient and extended insonation time. Certain applications of transcranial diagnostic US (TC-US) require prolonged exposure. An anthropomorphic skull model (ASM) was developed to evaluate thermal effects induced by TC-US of different modalities. The objective was to determine whether prolonged continuous TC-US application results in potentially harmful temperature increases. The ASM consists of a human skull with tissue mimicking material and exhibits acoustic and anatomical characteristics of the human skull and brain. Experiments are performed with a diagnostic US device testing four different US modalities: Duplex PW (pulsed wave) Doppler, PW Doppler, color flow Doppler and B-mode. Temperature changes are recorded during 180 minutes of insonation. All measurements revealed significant temperature increases during insonation independent of the US modality. The maximum temperature elevation of + 5.25° C (p < 0.001) was observed on the surface of the skull exposed to duplex PW Doppler. At the bone-brain border a maximum temperature increae of + 2.01 °C (p < 0.001) was noted. Temperature increases within the brain were < 1.23 °C (p = 0.001). The highest values were registered using the duplex PW Doppler modality. TC-US induces significant local heating effects in an ASM. An application duration that extends routine clinical periods causes potentially harmful heating especially in tissue close to bone. TC-US elevates the temperature in the brain mimicking tissue but is not capable of producing harmful temperature increases during routine examinations. However, the risk of thermal injury in brain tissue increases significantly after an exposure time of > 2 hours. © Georg Thieme Verlag KG Stuttgart · New York.

Plasma sprayed ceramic thermal barrier coating for NiAl-based intermetallic alloys

NASA Technical Reports Server (NTRS)

Miller, Robert A. (Inventor); Doychak, Joseph (Inventor)

1994-01-01

A thermal barrier coating system consists of two layers of a zirconia-yttria ceramic. The first layer is applied by low pressure plasma spraying. The second layer is applied by conventional atmospheric pressure plasma spraying. This facilitates the attachment of a durable thermally insulating ceramic coating directly to the surface of a highly oxidation resistant NiAl-based intermetallic alloy after the alloy has been preoxidized to promote the formation of a desirable Al2O3 scale.

Response of Al-Based Micro- and Nanocomposites to Rapid Fluctuations in Thermal Environments

NASA Astrophysics Data System (ADS)

Dash, K.; Ray, B. C.

2018-05-01

The focus of this work is to highlight the relative response of Al-based micro- and nanocomposites in the form of enhancement in flexural strength via induced thermal stresses at high and cryogenic temperatures in ex situ and in situ atmospheres. In this investigation, we have tried to explore the reliability, matrix-reinforcement interaction and microstructural integrity of these materials in their service period by designing appropriate heat treatment regimes. Al-Al2O3 micro- and nanocomposites had been fabricated by powder processing method. The micro- and nanocomposites were subjected to down-thermal shock (from positive to negative temperature) and up-thermal shock (from negative to positive temperature) with varying thermal gradients. For isothermal conditioning, the composites were exposed to + 80 and - 80 °C for 1 h separately. High-temperature three-point flexural tests were performed at 100 and 250 °C on the composites. All the composites subjected to thermal shock and isothermal conditioning was tested in three-point flexural mode post-treatments. Al-1 vol.% Al2O3 nanocomposite's flexural strength improved to 118 MPa post-thermal shock treatment of gradient of 160 °C. The Al-5 and 10 vol.% Al2O3 microcomposites possessed flexural strength of 200 and 99.8 MPa after thermal shock treatment of gradient of 160 and 80 °C, respectively. The observed improvement in flexural strength of micro- and nanocomposites post-thermal excursions were compared and have been discussed with the support of fractography. The microcomposites showed a higher positive scale of response to the thermal excursions as compared to that of the nanocomposites.

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

PubMed Central

Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

PubMed

Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Thermal properties of spinel based solid solutions

NASA Astrophysics Data System (ADS)

O'Hara, Kelley Rae

Solid solution formation in spinel based systems proved to be a viable approach to decreasing thermal conductivity. Samples with systematically varied additions of MgGa2O4 to MgAl2O 4 were prepared and thermal diffusivity was measured using the laser flash technique. Additionally, heat capacity was measured using differential scanning calorimetry and modeled for the MgAl2O4-MgGa 2O4 system. At 200°C thermal conductivity decreased 24% with a 5 mol% addition of MgGa2O4 to the system. The solid solution continued to decrease the thermal conductivity by 13% up to 1000°C with 5 mol% addition. The decrease in thermal conductivity ultimately resulted in a decrease in heat flux when applied to a theoretical furnace lining, which could lead to energy savings in industrial settings. The MgAl2O4-Al2O3 phase equilibria was investigated to fully understand the system and the thermal properties at elevated temperatures. The solvus line between MgAl2O4 and Al2O3 has been defined at 79.6 wt% Al 2O3 at 1500°C, 83.0 wt% Al2O4 at 1600°C, and 86.5 wt% Al2O3 at 1700°C. A metastable region has been identified at temperatures up to 1700°C which could have significant implications for material processing and properties. The spinel solid solution region has been extended to form an infinite solid solution with Al2O3 at elevated temperatures. A minimum in melting at 1975°C and a chemistry of 96 wt% Al2O3 rather than a eutectic is present. Thermal properties in the MgAl2O4-Al2O 3 system were investigated in both the single phase solid solution region and the two phase region. The thermal diffusivity decreased through the MgAl 2O4 solid solution region and was at a minimum through the entire metastable (nucleation and growth) region. As Al2O 3 became present as a second phase the thermal diffusivity increased with Al2O3 content. There was an 11.7% increase in thermal diffusivity with a change in overall chemistry of 85.20 wt% Al2O 3 to 87.71 wt% Al2O3, due to the drastic change in final chemistry (38.3 wt% Al20 3) caused by the nucleation and growth region in the system.

Comparative NMR analysis of the decadeoxynucleotide d-(GCATTAATGC)2 and an analogue containing 2-aminoadenine.

PubMed Central

Chazin, W J; Rance, M; Chollet, A; Leupin, W

1991-01-01

The dodecadeoxynucleotide duplex d-(GCATTAATGC)2 has been prepared with all adenine bases replaced by 2-NH2-adenine. This modified duplex has been characterized by nuclear magnetic resonance (NMR) spectroscopy. Complete sequence-specific 1H resonance assignments have been obtained by using a variety of 2D NMR methods. Multiple quantum-filtered and multiple quantum experiments have been used to completely assign all sugar ring protons, including 5'H and 5'H resonances. The assignments form the basis for a detailed comparative analysis of the 1H NMR parameters of the modified and parent duplex. The structural features of both decamer duplexes in solution are characteristic of the B-DNA family. The spin-spin coupling constants in the sugar rings and the relative spatial proximities of protons in the bases and sugars (as determined from the comparison of corresponding nuclear Overhauser effects) are virtually identical in the parent and modified duplexes. Thus, substitution by this adenine analogue in oligonucleotides appears not to disturb the global or local conformation of the DNA duplex. PMID:1945828

Coatings for directional eutectics

NASA Technical Reports Server (NTRS)

Rairden, J. R.; Jackson, M. R.

1976-01-01

Coatings developed to provide oxidation protection for the directionally-solidified eutectic alloy NiTaC-B (4.4 weight percent Cr) were evaluated. Of seven Co-, Fe- and Ni-base coatings that were initially investigated, best resistance to cyclic oxidation was demonstrated by duplex coatings fabricated by depositing a layer of NiCrAl(Y) by vacuum evaporation from an electron beam source followed by deposition of an Al overlayer using the pack cementation process. It was found that addition of carbon to the coating alloy substantially eliminated the problem of fiber denudation in TaC-type eutectic alloys. Burner rig cycled NiTaC-B samples coated with Ni-20Cr-5Al-0.1C-0.1Y+Al and rupture-tested at 1100 deg C performed as well as or better than uncoated, vacuum cycled and air-tested NiTaC-13; however, a slight degradation with respect to uncoated material was noted in air-stress rupture tests at 870 deg C for both cycled and uncycled samples.

Methods And Devices For Characterizing Duplex Nucleic Acid Molecules

DOEpatents

Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen

2005-08-30

Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

Effect of electromagnetic interaction during fusion welding of AISI 2205 duplex stainless steel on the corrosion resistance

NASA Astrophysics Data System (ADS)

García-Rentería, M. A.; López-Morelos, V. H.; González-Sánchez, J.; García-Hernández, R.; Dzib-Pérez, L.; Curiel-López, F. F.

2017-02-01

The effect of electromagnetic interaction of low intensity (EMILI) applied during fusion welding of AISI 2205 duplex stainless steel on the resistance to localised corrosion in natural seawater was investigated. The heat affected zone (HAZ) of samples welded under EMILI showed a higher temperature for pitting initiation and lower dissolution under anodic polarisation in chloride containing solutions than samples welded without EMILI. The EMILI assisted welding process developed in the present work enhanced the resistance to localised corrosion due to a modification on the microstructural evolution in the HAZ and the fusion zone during the thermal cycle involved in fusion welding. The application of EMILI reduced the size of the HAZ, limited coarsening of the ferrite grains and promoted regeneration of austenite in this zone, inducing a homogeneous passive condition of the surface. EMILI can be applied during fusion welding of structural or functional components of diverse size manufactured with duplex stainless steel designed to withstand aggressive environments such as natural seawater or marine atmospheres.

Analysis of singular interface stresses in dissimilar material joints for plasma facing components

NASA Astrophysics Data System (ADS)

You, J. H.; Bolt, H.

2001-10-01

Duplex joint structures are typical material combinations for the actively cooled plasma facing components of fusion devices. The structural integrity under the incident heat loads from the plasma is one of the most crucial issues in the technology of these components. The most critical domain in a duplex joint component is the free surface edge of the bond interface between heterogeneous materials. This is due to the fact that the thermal stress usually shows a singular intensification in this region. If the plasma facing armour tile consists of a brittle material, the existence of the stress singularity can be a direct cause of failure. The present work introduces a comprehensive analytical tool to estimate the impact of the stress singularity for duplex PFC design and quantifies the relative stress intensification in various materials joints by use of a model formulated by Munz and Yang. Several candidate material combinations of plasma facing armour and metallic heat sink are analysed and the results are compared with each other.

Duplex and triplex formation of mixed pyrimidine oligonucleotides with stacking of phenyl-triazole moieties in the major groove.

PubMed

Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul

2011-08-05

5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.

Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

PubMed

Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

2017-07-19

RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

Thermal Properties of Oxides With Magnetoplumbite Structure for Advanced Thermal Barrier Coatings

NASA Technical Reports Server (NTRS)

Bansal, Narottam P.; Zhu, Dongming; Eslamloo-Grami, Maryam

2007-01-01

Oxides having magnetoplumbite structure are promising candidate materials for applications as high temperature thermal barrier coatings because of their high thermal stability, high thermal expansion, and low thermal conductivity. In this study, powders of LaMgAl11O19, GdMgAl11O19, SmMgAl11O19, and Gd0.7Yb0.3MgAl11O19 magnetoplumbite oxides were synthesized by citric acid sol-gel method and hot pressed into disk specimens. The thermal expansion coefficients (CTE) of these oxide materials were measured from room temperature to 1500 C. The average CTE value was found to be approx.9.6x10(exp -6)/C. Thermal conductivity of these magnetoplumbite-based oxide materials was also evaluated using steady-state laser heat flux test method. The effects of doping on thermal properties were also examined. Thermal conductivity of the doped Gd0.7Yb0.3MgAl11O19 composition was found to be lower than that of the undoped GdMgAl11O19. In contrast, thermal expansion coefficient was found to be independent of the oxide composition and appears to be controlled by the magnetoplumbite crystal structure. Thermal conductivity testing of LaMgAl11O19 and LaMnAl11O19 magnetoplumbite oxide coatings plasma sprayed on NiCrAlY/Rene N5 superalloy substrates indicated resistance of these coatings to sintering even at temperatures as high as 1600 C.

An Investigation on the Thermal Effusivity of Nanofluids Containing Al2O3 and CuO Nanoparticles

PubMed Central

Noroozi, Monir; Zakaria, Azmi; Moksin, Mohd Maarof; Wahab, Zaidan Abd

2012-01-01

The thermal effusivity of Al2O3 and CuO nanofluids in different base fluids, i.e., deionized water, ethylene glycol and olive oil were investigated. The nanofluids, nanoparticles dispersed in base fluids; were prepared by mixing Al2O3, CuO nanopowder and the base fluids using sonication with high-powered pulses to ensure a good uniform dispersion of nanoparticles in the base fluids. The morphology of the particles in the base fluids was investigated by transmission electron microscopy (TEM). In this study, a phase frequency scan of the front pyroelectric configuration technique, with a thermally thick PVDF pyroelectric sensor and sample, was used to measure the thermal effusivity of the prepared nanofluids. The experimental results of the thermal effusivity of the studied solvents (deionized water, ethylene glycol and olive oil) showed good agreement with literature values, and were reduced in the presence of nanoparticles. The thermal effusivity of the nanofluid was found to be particularly sensitive to its base fluid and the type of nanoparticles. PMID:22949865

An investigation on the thermal effusivity of nanofluids Containing Al(2)O(3) and CuO nanoparticles.

PubMed

Noroozi, Monir; Zakaria, Azmi; Moksin, Mohd Maarof; Wahab, Zaidan Abd

2012-01-01

The thermal effusivity of Al(2)O(3) and CuO nanofluids in different base fluids, i.e., deionized water, ethylene glycol and olive oil were investigated. The nanofluids, nanoparticles dispersed in base fluids; were prepared by mixing Al(2)O(3), CuO nanopowder and the base fluids using sonication with high-powered pulses to ensure a good uniform dispersion of nanoparticles in the base fluids. The morphology of the particles in the base fluids was investigated by transmission electron microscopy (TEM). In this study, a phase frequency scan of the front pyroelectric configuration technique, with a thermally thick PVDF pyroelectric sensor and sample, was used to measure the thermal effusivity of the prepared nanofluids. The experimental results of the thermal effusivity of the studied solvents (deionized water, ethylene glycol and olive oil) showed good agreement with literature values, and were reduced in the presence of nanoparticles. The thermal effusivity of the nanofluid was found to be particularly sensitive to its base fluid and the type of nanoparticles.

Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

PubMed Central

O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

2006-01-01

Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

PubMed Central

Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

2014-01-01

Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

Efficacy of duplex ultrasound surveillance after infrainguinal vein bypass may be enhanced by identification of characteristics predictive of graft stenosis development.

PubMed

Tinder, Chelsey N; Chavanpun, Joe P; Bandyk, Dennis F; Armstrong, Paul A; Back, Martin R; Johnson, Brad L; Shames, Murray L

2008-09-01

Controversy regarding the efficacy of duplex ultrasound surveillance after infrainguinal vein bypass led to an analysis of patient and bypass graft characteristics predictive for development of graft stenosis and a decision of secondary intervention. Retrospective analysis of a contemporary, consecutive series of 353 clinically successful infrainguinal vein bypasses performed in 329 patients for critical (n = 284; 80%) or noncritical (n = 69; 20%) limb ischemia enrolled in a surveillance program to identify and repair duplex-detected graft stenosis. Variables correlated with graft stenosis and bypass repair included: procedure indication, conduit type (saphenous vs nonsaphenous vein; reversed vs nonreversed orientation), prior bypass graft failure, postoperative ankle-brachial index (ABI) < 0.85, and interpretation of the first duplex surveillance study as "normal" or "abnormal" based on peak systolic velocity (PSV) and velocity ratio (Vr) criteria. Overall, 126 (36%) of the 353 infrainguinal bypasses had 174 secondary interventions (endovascular, 100; surgery, 74) based on duplex surveillance; resulting in 3-year Kaplan-Meier primary (46%), assisted-primary (80%), and secondary (81%) patency rates. Characteristics predictive of duplex-detected stenosis leading to intervention (PSV: 443 +/- 94 cm/s; Vr: 8.6 +/- 9) were: "abnormal" initial duplex testing indicating moderate (PSV: 180-300 cm/s, Vr: 2-3.5) stenosis (P < .0001), non-single segment saphenous vein conduit (P < .01), warfarin drug therapy (P < .01), and redo bypass grafting (P < .001). Procedure indication, postoperative ABI level, statin drug therapy, and vein conduit orientation were not predictive of graft revision. The natural history of 141 (40%) bypasses with an abnormal first duplex scan differed from "normal" grafts by more frequent (51% vs 24%, P < .001) and earlier (7 months vs 11 months) graft revision for severe stenosis and a lower 3-year assisted primary patency (68% vs 87%; P < .001). In 52 (15%) limbs, the bypass graft failed and 20 (6%) limbs required amputation. The efficacy of duplex surveillance after infrainguinal vein bypass may be enhanced by modifying testing protocols, eg, rigorous surveillance for "higher risk" bypasses, based on the initial duplex scan results and other characteristics (warfarin therapy, non- single segment saphenous vein conduit, redo bypass) predictive for stenosis development.

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

NASA Astrophysics Data System (ADS)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

Structural studies of the 5'-phenazinium-tethered matched and G-A-mismatched DNA duplexes by NMR spectroscopy.

PubMed

Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J

1993-05-01

The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry optimization using ab initio program (3-21G basis set). It has been shown that mismatched G-A bases are in the anti-anti conformation. The mismatched 7G-1A form stable base pairs through inter-strand hydrogen bonds (N7(A)...HN2(G) (1.92 A) with a subtended angle of 176 degrees and N3(G)...HN6(A) (2.01 A) with a subtended angle of 153 degrees (the 'amino-type' hydrogen bond)) and a propeller twist of 36 degrees for 7G-1A residues.(ABSTRACT TRUNCATED AT 400 WORDS)

Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses

USDA-ARS?s Scientific Manuscript database

Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...

A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

PubMed

Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

1987-09-15

We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.

Structure of a bimetallic strip produced by plasma spraying of a TiAl powder on a niobium sheet

NASA Astrophysics Data System (ADS)

Povarova, K. B.; Antonova, A. V.; Burmistrov, V. I.; Safronov, B. V.; Perfilov, L. S.; Chukanov, A. P.

2007-10-01

Ti-48 at % Al alloy granules produced by centrifugal spraying are milled into a powder with a particle size of 40 100 μm, and are applied onto a niobium foil using plasma spraying in an argon atmosphere. The fabricated TiAl/Nb bimetallic strip consists of a 100-μm-thick niobium layer and a porous 300-to 400-μm-thick TiAl layer formed by flattened particles. Directly after the preparation of the bimetallic strip, the surface of the TiAl porous layer is rough. Vacuum annealing at 1000, 1100, and 1200°C for 0.5 1.5 h leads to intense pore healing. After deposition and annealing, the interlayer adhesion is strong. The preparation of TiAl granules and spraying of the powder is accompanied by aluminum depletion of the Ti-48 at % Al alloy to 42 45 at % and an increase in the fraction of the α2-Ti3Al phase in the deposited layer. The prepared material has a duplex structure. An intermediate diffuse layer characterized by a variable composition and thickness is formed at the interface. This layer consists of two solid solutions; one of them, which is formed at the TiAl layer, is an α2-Ti3Al-based solid solution of niobium and the other, which is formed at the niobium foil, is a niobium-based solid solution of titanium and aluminum.

Microstructure, thermal shock resistance and thermal emissivity of plasma sprayed LaMAl11O19 (M = Mg, Fe) coatings for metallic thermal protection systems

NASA Astrophysics Data System (ADS)

Liu, Hong-Zhi; Ouyang, Jia-Hu; Liu, Zhan-Guo; Wang, Ya-Ming

2013-04-01

LaMAl11O19 (M = Mg, Fe) ceramic coatings were plasma-sprayed on nickel-based superalloy with NiCoCrAlYTa as the bond coat. The microstructure, thermal shock resistance and thermal emissivity of these two ceramic coatings were investigated. LaMAl11O19 coatings exhibit a characteristic of stacked lamellae, and consist mainly of a magnetoplumbite-type hexaaluminate phase and an amorphous phase. During thermal cycling, the amorphous phase disappears and a LaAlO3 phase is formed at temperatures of both 1000 and 1200 °C. The thermal cycling numbers of LaMgAl11O19 coating are 102 at 1000 °C and 42 at 1200 °C; LaFeAl11O19 has a thermal cycling lifetime of 87 at 1000 °C and 30 at 1200 °C, respectively. Normal spectral emissivity of nickel-based superalloy is about 0.2 over the whole wavelength range of 3-14 μm. However, the emissivity of LaFeAl11O19 coating is about 0.7 at short wavelengths and above 0.9 in the wavelength range of 7-14 μm.

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

PubMed

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

The structure-directed effect of Al-based metal–organic frameworks on fabrication of alumina by thermal treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Dandan, E-mail: liudandan_upc@126.com; Dai, Fangna, E-mail: fndai@upc.edu.cn; Collage of Science, China University of Petroleum

2015-05-15

Highlights: • We use Al-MOFs as precursor in the fabrication process of mesoporous alumina by thermal treatment. • The obtained mesoporous alumina has dual pore system and five-fold aluminum. • The aluminum building units in the precursor show structure-directed effect on the formation of alumina. - Abstract: In this work, the block-shaped Al-based metal–organic frameworks (Al-MOFs) MIL-53 have been synthesized by hydrothermal method. To detect the correlation between the structure of Al-MOFs and the formation of alumina, the ligands are eliminated by thermal treatment. MIL-53 and the calcination products were characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR),more » scanning electron microscope (SEM), transmission electron microscopy (TEM), nitrogen adsorption–desorption and solid-state {sup 27}Al nuclear magnetic resonance ({sup 27}Al NMR). It was found that after calcination, the block-shaped Al-MOFs precursor turns into high-crystallinity mesoporous alumina nanosheets, and the thermal treatment product γ-alumina possesses a dual pore system and a large surface area (146 m{sup 2}/g), with five-fold aluminum. During the thermal treatment process, the structure of MIL-53 and its secondary building units have structure-directed effect in the formation of alumina.« less

Crystal structure of a four-stranded intercalated DNA: d(C4)

NASA Technical Reports Server (NTRS)

Chen, L.; Cai, L.; Zhang, X.; Rich, A.

1994-01-01

The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

PubMed

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

PubMed Central

Xie, Ping

2015-01-01

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel. PMID:26473825

DOE Office of Scientific and Technical Information (OSTI.GOV)

Travis, Jonathan; Orendorff, Christopher J.

This work investigated the effects of Al 2O 3 ALD coatings on the performance and thermal abuse tolerance of graphite based anodes and Li(NixMnyCoz)O2 (NMC) based cathodes. It was found that 5 cycles of Al 2O 3 ALD on the graphite anode increased the onset temperature of thermal runaway by approximately 20 °C and drastically reduced the anode’s contribution to the overall amount of heat released during thermal runaway. Although Al 2O 3 ALD improves the cycling stability of NMC based cathodes, the thermal abuse tolerance was not greatly improved. A series of conductive aluminum oxide/carbon composites were created andmore » characterized as potential thicker protective coatings for use on NMC based cathode materials. A series of electrodes were coated with manganese monoxide ALD to test the efficacy of an oxygen scavenging coating on NMC based cathodes.« less

Duplex Ultrasonography Has Limited Utility in Detection of Postoperative DVT After Primary Total Joint Arthroplasty.

PubMed

Vira, Shaleen; Ramme, Austin J; Alaia, Michael J; Steiger, David; Vigdorchik, Jonathan M; Jaffe, Frederick

2016-07-01

Duplex ultrasound is routinely used to evaluate suspected deep venous thrombosis after total joint arthroplasty. When there is a clinical suspicion for a pulmonary embolism, a chest angiogram (chest CTA) is concomitantly obtained. Two questions were addressed: First, for the population of patients who receive duplex ultrasound after total joint arthroplasty, what is the rate of positive results? Second, for these patients, how many of these also undergo chest CTA for clinical suspicion of pulmonary embolus and how many of these tests are positive? Furthermore, what is the correlation between duplex ultrasound results and chest CTA results? A retrospective chart review was conducted of total joint replacement patients in 2011 at a single institution. Inclusion criteria were adult patients who underwent a postoperative duplex ultrasonography for clinical suspicion of deep venous thrombosis (DVT). Demographic data, result of duplex scan, clinical indications for obtaining the duplex scan, and DVT prophylaxis used were recorded. Additionally, if a chest CTA was obtained for clinical suspicion for pulmonary embolus, results and clinical indication for obtaining the test were recorded. The rate of positive results for duplex ultrasonography and chest CTA was computed and correlated based on clinical indications. Two hundred ninety-five patients underwent duplex ultrasonography of which only 0.7% were positive for a DVT. One hundred three patients underwent a chest CTA for clinical suspicion of a pulmonary embolism (PE) of which 26 revealed a pulmonary embolus, none of which had a positive duplex ultrasound. Postoperative duplex scans have a low rate of positive results. A substantial number of patients with negative duplex results subsequently underwent chest CTA for clinical suspicion for which a pulmonary embolus was found, presumably resulting from a DVT despite negative duplex ultrasound result. A negative duplex ultrasonography should not rule out the presence of a DVT which can embolize to the lungs and thus should not preclude further workup when clinical suspicion exists for a pulmonary embolus.

Thermophysical Properties of Cold and Vacuum Plasma Sprayed Cu-Cr-X Alloys, NiAl and NiCrAlY Coatings. Part 1; Electrical and Thermal Conductivity, Thermal Diffusivity, and Total Hemispherical Emissivity

NASA Technical Reports Server (NTRS)

Raj, S. V.

2017-01-01

This two-part paper reports the thermophysical properties of several cold and vacuum plasma sprayed monolithic Cu and Ni-based alloy coatings. Part I presents the electrical and thermal conductivity, thermal diffusivity, and total hemispherical emissivity data while Part II reports the specific heat capacity data for these coatings. Metallic copper alloys, stoichiometric NiAl and NiCrAlY coatings were fabricated by either the cold sprayed or the vacuum plasma spray deposition processes for thermal property measurements between 77 and 1223 K. The temperature dependencies of the thermal conductivities, thermal diffusivities, electrical conductivities and total hemispherical emissivities of these cold and vacuum sprayed monolithic coatings are reported in this paper. The electrical and thermal conductivity data correlate reasonably well for Cu-8%Cr-1%Al, Cu-23%Cr-5%Al and NiAl in accordance with the Wiedemann-Franz (WF) law although a better fit is obtained using the Smith-Palmer relationship. The Lorentz numbers determined from the WF law are close to the theoretical value.

Thermophysical Properties of Cold- and Vacuum Plasma-Sprayed Cu-Cr-X Alloys, NiAl and NiCrAlY Coatings I: Electrical and Thermal Conductivity, Thermal Diffusivity, and Total Hemispherical Emissivity

NASA Astrophysics Data System (ADS)

Raj, S. V.

2017-11-01

This two-part paper reports the thermophysical properties of several cold- and vacuum plasma-sprayed monolithic Cu- and Ni-based alloy coatings. Part I presents the electrical and thermal conductivity, thermal diffusivity, and total hemispherical emissivity data, while Part II reports the specific heat capacity data for these coatings. Metallic copper alloys and stoichiometric NiAl and NiCrAlY coatings were fabricated by either the cold spray or the vacuum plasma spray deposition processes for thermal property measurements between 77 and 1223 K. The temperature dependencies of the thermal conductivities, thermal diffusivities, electrical conductivities, and total hemispherical emissivities of these cold- and vacuum-sprayed monolithic coatings are reported in this paper. The electrical and thermal conductivity data correlate reasonably well for Cu-8%Cr-1%Al, Cu-23%Cr-5%Al, and NiAl in accordance with the Wiedemann-Franz (WF) law although a better fit is obtained using the Smith-Palmer relationship. The Lorentz numbers determined from the WF law are close to the theoretical value.

Structure and Mechanical Properties of Al-Cu-Fe-X Alloys with Excellent Thermal Stability.

PubMed

Školáková, Andrea; Novák, Pavel; Mejzlíková, Lucie; Průša, Filip; Salvetr, Pavel; Vojtěch, Dalibor

2017-11-05

In this work, the structure and mechanical properties of innovative Al-Cu-Fe based alloys were studied. We focused on preparation and characterization of rapidly solidified and hot extruded Al-Cu-Fe, Al-Cu-Fe-Ni and Al-Cu-Fe-Cr alloys. The content of transition metals affects mechanical properties and structure. For this reason, microstructure, phase composition, hardness and thermal stability have been investigated in this study. The results showed exceptional thermal stability of these alloys and very good values of mechanical properties. Alloying by chromium ensured the highest thermal stability, while nickel addition refined the structure of the consolidated alloy. High thermal stability of all tested alloys was described in context with the transformation of the quasicrystalline phases to other types of intermetallics.

Structure and Mechanical Properties of Al-Cu-Fe-X Alloys with Excellent Thermal Stability

PubMed Central

Školáková, Andrea; Novák, Pavel; Mejzlíková, Lucie; Průša, Filip; Salvetr, Pavel; Vojtěch, Dalibor

2017-01-01

In this work, the structure and mechanical properties of innovative Al-Cu-Fe based alloys were studied. We focused on preparation and characterization of rapidly solidified and hot extruded Al-Cu-Fe, Al-Cu-Fe-Ni and Al-Cu-Fe-Cr alloys. The content of transition metals affects mechanical properties and structure. For this reason, microstructure, phase composition, hardness and thermal stability have been investigated in this study. The results showed exceptional thermal stability of these alloys and very good values of mechanical properties. Alloying by chromium ensured the highest thermal stability, while nickel addition refined the structure of the consolidated alloy. High thermal stability of all tested alloys was described in context with the transformation of the quasicrystalline phases to other types of intermetallics. PMID:29113096

Novel 1.5 GPa-strength with 50%-ductility by transformation-induced plasticity of non-recrystallized austenite in duplex steels.

PubMed

Sohn, Seok Su; Song, Hyejin; Jo, Min Chul; Song, Taejin; Kim, Hyoung Seop; Lee, Sunghak

2017-04-28

Needs for steel designs of ultra-high strength and excellent ductility have been an important issue in worldwide automotive industries to achieve energy conservation, improvement of safety, and crashworthiness qualities. Because of various drawbacks in existing 1.5-GPa-grade steels, new development of formable cold-rolled ultra-high-strength steels is essentially needed. Here we show a plausible method to achieve ultra-high strengths of 1.0~1.5 GPa together with excellent ductility above 50% by actively utilizing non-recrystallization region and TRansformation-Induced Plasticity (TRIP) mechanism in a cold-rolled and annealed Fe-Mn-Al-C-based steel. We adopt a duplex microstructure composed of austenite and ultra-fine ferrite in order to overcome low-yield-strength characteristics of austenite. Persistent elongation up to 50% as well as ultra-high yield strength over 1.4 GPa are attributed to well-balanced mechanical stability of non-crystallized austenite with critical strain for TRIP. Our results demonstrate how the non-recrystallized austenite can be a metamorphosis in 1.5-GPa-grade steel sheet design.

Enzymatic Reaction with Unnatural Substrates: DNA Photolyase (Escherichia coli) Recognizes and Reverses Thymine [2+2] Dimers in the DNA Strand of a DNA/PNA Hybrid Duplex

NASA Astrophysics Data System (ADS)

Ramaiah, Danaboyina; Kan, Yongzhi; Koch, Troels; Orum, Henrik; Schuster, Gary B.

1998-10-01

Peptide nucleic acids (PNA) are mimics with normal bases connected to a pseudopeptide chain that obey Watson--Crick rules to form stable duplexes with itself and natural nucleic acids. This has focused attention on PNA as therapeutic or diagnostic reagents. Duplexes formed with PNA mirror some but not all properties of DNA. One fascinating aspect of PNA biochemistry is their reaction with enzymes. Here we show an enzyme reaction that operates effectively on a PNA/DNA hybrid duplex. A DNA oligonucleotide containing a cis, syn-thymine [2+2] dimer forms a stable duplex with PNA. The hybrid duplex is recognized by photolyase, and irradiation of the complex leads to the repair of the thymine dimer. This finding provides insight into the enzyme mechanism and provides a means for the selective repair of thymine photodimers.

Synthesis of 2',4'-propylene-bridged (carba-ENA) thymidine and its analogues: the engineering of electrostatic and steric effects at the bottom of the minor groove for nuclease and thermodynamic stabilities and elicitation of RNase H.

PubMed

Liu, Yi; Xu, Jianfeng; Karimiahmadabadi, Mansoureh; Zhou, Chuanzheng; Chattopadhyaya, Jyoti

2010-11-05

2',4'-Propylene-bridged thymidine (carba-ENA-T) and five 8'-Me/NH(2)/OH modified carba-ENA-T analogues have been prepared through intramolecular radical addition to C═N of the tethered oxime-ether. These carba-ENA nucleosides have been subsequently incorporated into 15mer oligodeoxynucleotides (AON), and their affinity toward cDNA and RNA, nuclease resistance, and RNase H recruitment capability have been investigated in comparison with those of the native and ENA counterparts. These carba-ENAs modified AONs are highly RNA-selective since all of them led to slight thermal stabilization effect for the AON:RNA duplex, but quite large destabilization effect for the AON:DNA duplex. It was found that different C8' substituents (at the bottom of the minor groove) on carba-ENA-T only led to rather small variation of thermal stability of the AON:RNA duplexes. We, however, observed that the parent carba-ENA-T modified AONs exhibited higher nucleolytic stability than those of the ENA-T modified counterparts. The nucleolytic stability of carba-ENA-T modified AONs can be further modulated by C8' substituent to variable extents depending on not only the chemical nature but also the stereochemical orientation of the C8' substituents: Thus, (1) 8'S-Me on carba-ENA increases the nucleolytic stability but 8'R-Me leads to a decreased effect; (2) 8'R-OH on carba-ENA had little, if any, effect on nuclease resistance but 8'S-OH resulted in significantly decreased nucleolytic stability; and (3) 8'-NH(2) substituted carba-ENA leads to obvious loss in the nuclease resistance. The RNA strand in all of the carba-ENA derivatives modified AON:RNA hybrid duplexes can be digested by RNase H1 with high efficiency, even at twice the rate of those of the native and ENA modified counterpart.

Energetics, Ion and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

PubMed

Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A

2018-06-22

Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.

Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex.

PubMed

Kanaori, K; Tamura, Y; Wada, T; Nishi, M; Kanehara, H; Morii, T; Tajima, K; Makino, K

1999-12-07

The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA.DNA duplexes could be explained by the structural factor.

Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century

ERIC Educational Resources Information Center

Bejar, Isaac I.; Graf, E. Aurora

2010-01-01

The duplex design by Bock and Mislevy for school-based testing is revisited and evaluated as a potential platform in test-based accountability assessments today. We conclude that the model could be useful in meeting the many competing demands of today's test-based accountability assessments, although many research questions will need to be…

Backbone conformation affects duplex initiation and duplex propagation in hybridisation of synthetic H-bonding oligomers.

PubMed

Iadevaia, Giulia; Núñez-Villanueva, Diego; Stross, Alexander E; Hunter, Christopher A

2018-06-06

Synthetic oligomers equipped with complementary H-bond donor and acceptor side chains form multiply H-bonded duplexes in organic solvents. Comparison of the duplex forming properties of four families of oligomers with different backbones shows that formation of an extended duplex with three or four inter-strand H-bonds is more challenging than formation of complexes that make only two H-bonds. The stabilities of 1 : 1 complexes formed between length complementary homo-oligomers equipped with either phosphine oxide or phenol recognition modules were measured in toluene. When the backbone is very flexible (pentane-1,5-diyl thioether), the stability increases uniformly by an order of magnitude for each additional base-pair added to the duplex: the effective molarities for formation of the first intramolecular H-bond (duplex initiation) and subsequent intramolecular H-bonds (duplex propagation) are similar. This flexible system is compared with three more rigid backbones that are isomeric combinations of an aromatic ring and methylene groups. One of the rigid systems behaves in exactly the same way as the flexible backbone, but the other two do not. For these systems, the effective molarity for formation of the first intramolecular H-bond is the same as that found for the other two backbones, but additional H-bonds are not formed between the longer oligomers. The effective molarities are too low for duplex propagation in these systems, because the oligomer backbones cannot adopt conformations compatible with formation of an extended duplex.

Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†

PubMed Central

Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.

2010-01-01

Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443

Geometry of an outcrop-scale duplex in Devonian flysch, Maine

USGS Publications Warehouse

Bradley, D.C.; Bradley, L.M.

1994-01-01

We describe an outcrop-scale duplex consisting of 211 exposed repetitions of a single bed. The duplex marks an early Acadian (Middle Devonian) oblique thrust zone in the Lower Devonian flysch of northern Maine. Detailed mapping at a scale of 1:8 has enabled us to measure accurately parameters such as horse length and thickness, ramp angles and displacements; we compare these and derivative values with those of published descriptions of duplexes, and with theoretical models. Shortening estimates based on line balancing are consistently smaller than two methods of area balancing, suggesting that layer-parallel shortening preceded thrusting. ?? 1994.

Capturing a DNA duplex under near-physiological conditions

NASA Astrophysics Data System (ADS)

Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.

2010-10-01

We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.

Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

2003-01-01

Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

PubMed

Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

2013-07-30

Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

Interface characterization of Cu-Mo coating deposited on Ti-Al alloys by arc spraying

NASA Astrophysics Data System (ADS)

Bai, Shengqiang; Li, Fei; Wu, Ting; Yin, Xianglin; Shi, Xun; Chen, Lidong

2015-03-01

Cu-Mo pseudobinary alloys are promising candidates as electrode materials in CoSb3-based skutterudite thermoelectric (TE) devices for TE power generation. In this study, Cu-Mo coatings were deposited onto Ti-Al substrates by applying a dual-wire electric arc spraying coating technique. The microstructure of the surfaces, cross sections and coating interfaces were analyzed by scanning electron microscopy (SEM) and energy dispersion spectrometry (EDS). Cu-Mo coatings showed a typical banded splat with compact microstructures, and have no coarse pores nor micro-cracks. The thermal shock resistance of the Cu-Mo coating was also investigated to show good combinations with Ti-Al substrates. After 50 thermal shock cycles, there were no cracks observed at the interface. In contrast, the test of the thermal shock resistance of the Cu coating on the Ti-Al substrate was also investigated. Due to a large difference in the thermal expansion coefficients between Cu and Ti-Al alloys, the Cu coating flaked from the Ti-Al substrate completely after 10 thermal shock cycles. The contact resistivity of the Ti-Al/Cu-Mo interface was about 1.6 μΩṡcm2 and this value was unchanged after 50 thermal shock cycles, indicating the low electric resistance and high thermal stability of the Cu-Mo/Ti-Al interface.

Genetic Heterogeneity in Streptococcus mutans1

PubMed Central

Coykendall, Alan L.

1971-01-01

The genetic homogeneity among eight cariogenic strains of Streptococcus mutans was assessed by deoxyribonucleic acid (DNA)-DNA reassociation experiments. DNA species were extracted from strains GS5, Ingbritt, 10449, FAl, BHT, E49, SLl, and KlR. Labeled DNA (14C-DNA) was extracted from strains 10449, FAl, and SLl. Denatured 14C-DNA fragments were allowed to reassociate, i.e., form hybrid duplexes, with denatured DNA immobilized on membrane filters incubated in 0.45 m NaCl-0.045 m sodium citrate at 67 or 75 C. At 67 C, 10449 14C-DNA reassociated extensively only with GS5 and Ingbritt DNA. FAl 14C-DNA hybridized extensively only with BHT DNA, and SLl 14C-DNA reassociated with KlR and E49 DNA. DNA which hybridized extensively at 67 C also reassociated to a high degree at 75 C. Thermal elution of 14C-FAl-BHT duplexes showed that the hybrid duplexes were thermostable. The results indicate that S. mutans is a genetically heterogeneous species. The strains studied can be divided into three (possibly four) genetic groups, and these groups closely parallel antigenic groups. PMID:5551636

6-Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation.

PubMed

Marathias, V M; Sawicki, M J; Bolton, P H

1999-07-15

The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

Low cost high temperature, duplex coating for superalloys

NASA Technical Reports Server (NTRS)

Young, S. G.; Deadmore, D. L.

1981-01-01

Duplex silicon-slurry/aluminide coating substantially improves high temperature resistance to oxidation and corrosion of nickel base alloys. Coating used in critical sections of power systems like turbojet engines extends their operating capabilities.

Inclusion of methoxy groups inverts the thermodynamic stabilities of DNA-RNA hybrid duplexes: A molecular dynamics simulation study.

PubMed

Suresh, Gorle; Priyakumar, U Deva

2015-09-01

Modified nucleic acids have found profound applications in nucleic acid based technologies such as antisense and antiviral therapies. Previous studies on chemically modified nucleic acids have suggested that modifications incorporated in furanose sugar especially at 2'-position attribute special properties to nucleic acids when compared to other modifications. 2'-O-methyl modification to deoxyribose sugars of DNA-RNA hybrids is one such modification that increases nucleic acid stability and has become an attractive class of compounds for potential antisense applications. It has been reported that modification of DNA strands with 2'-O-methyl group reverses the thermodynamic stability of DNA-RNA hybrid duplexes. Molecular dynamics simulations have been performed on two hybrid duplexes (DR and RD) which differ from each other and 2'-O-methyl modified counterparts to investigate the effect of 2'-O-methyl modification on their duplex stability. The results obtained suggest that the modification drives the conformations of both the hybrid duplexes towards A-RNA like conformation. The modified hybrid duplexes exhibit significantly contrasting dynamics and hydration patterns compared to respective parent duplexes. In line with the experimental results, the relative binding free energies suggest that the introduced modifications stabilize the less stable DR hybrid, but destabilize the more stable RD duplex. Binding free energy calculations suggest that the increased hydrophobicity is primarily responsible for the reversal of thermodynamic stability of hybrid duplexes. Free energy component analysis further provides insights into the stability of modified duplexes. Copyright © 2015 Elsevier Inc. All rights reserved.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Duplex Healing of Selectively Thiolated Guanosine Mismatches through a Cd2+ Chemical Stimulus.

PubMed

Lunn, Samantha M L; Hribesh, Samira; Whitfield, Colette J; Hall, Michael J; Houlton, Andrew; Bronowska, Agnieszka K; Tuite, Eimer M; Pike, Andrew R

2018-03-25

The on-column selective conversion of guanosine to thioguanosine (tG) yields modified oligomers that exhibit destabilisation over the fully complementary duplex. Restoration to a stabilised duplex is induced through thio-directed Cd 2+ coordination; a route for healing DNA damage. Short oligomers are G-specifically thiolated through a modified on-column protocol without the need for costly thioguanosine phosphoramidites. Addition of Cd 2+ ions to a duplex containing a highly disrupted tG central mismatch sequence, 3'-A 6 tG 4 T 6 -5', suggests a (tG) 8 Cd 2 central coordination regime, resulting in increased base stacking and duplex stability. Equilibrium molecular dynamic calculations support the hypothesis of metal-induced healing of the thiolated duplex. The 2 nm displacement of the central tG mismatched region is dramatically reduced after the addition of a chemical stimuli, Cd 2+ ions, returning to a minimized fluctuational state comparable to the unmodified fully complementary oligomer. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Modified naphthalene diimide as a suitable tetraplex DNA ligand: application to cancer diagnosis and anti-cancer drug

NASA Astrophysics Data System (ADS)

Takenaka, Shigeori

2017-07-01

It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.

Development of internally controlled duplex real-time NASBA diagnostics assays for the detection of microorganisms associated with bacterial meningitis.

PubMed

Clancy, Eoin; Coughlan, Helena; Higgins, Owen; Boo, Teck Wee; Cormican, Martin; Barrett, Louise; Smith, Terry J; Reddington, Kate; Barry, Thomas

2016-08-01

Three duplex molecular beacon based real-time Nucleic Acid Sequence Based Amplification (NASBA) assays have been designed and experimentally validated targeting RNA transcripts for the detection and identification of Haemophilus influenzae, Neisseria meningitidis and Streptococcus pneumoniae respectively. Each real-time NASBA diagnostics assay includes an endogenous non-competitive Internal Amplification Control (IAC) to amplify the splice variant 1 mRNA of the Homo sapiens TBP gene from human total RNA. All three duplex real-time NASBA diagnostics assays were determined to be 100% specific for the target species tested for. Also the Limits of Detection (LODs) for the H. influenzae, N. meningitidis and S. pneumoniae duplex real-time NASBA assays were 55.36, 0.99, and 57.24 Cell Equivalents (CE) respectively. These robust duplex real-time NASBA diagnostics assays have the potential to be used in a clinical setting for the rapid (<60min) specific detection and identification of the most prominent microorganisms associated with bacterial meningitis in humans. Copyright © 2016 Elsevier B.V. All rights reserved.

Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

DOEpatents

Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

2001-01-01

Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

A Location-Based Duplex Scheme for Cost Effective Rural Broadband Connectivity Using IEEE 802.22 Cognitive Radio Based Wireless Regional Area Networks

NASA Astrophysics Data System (ADS)

Kalidoss, R.; Bhagyaveni, M. A.; Vishvaksenan, K. S.

2014-08-01

The search for a method of utilizing the scarce spectrum in an efficient manner is an active area of research in both academic and industrial communities. IEEE 802.22 is a standard for wireless regional area network (WRAN) based on cognitive radio (CR) that operates over underutilized portions of TV bands (54-862 MHz). Time division duplex (TDD)-based WRAN cells have such advantages as dynamic traffic allocation, traffic asymmetry to users and ease of spectrum allocation. However, these cells suffer from severe cross time slot (CTS) interference when the frames of the cells are not synchronized with adjacent WRAN cells. In this paper, we evaluate the location-based duplex (LBD) scheme for eliminating the CTS interference. The proposed LBD system is much more flexible and efficient in providing asymmetric data service and eliminating CTS interference by exploiting the advantages of both TDD and frequency division duplex (FDD) schemes. We also compare the performance of LBD systems with virtual cell concepts. Furthermore, our simulation results reveal that LBD-based systems outperform the virtual cell approach in terms of the low signal-to-interference (SIR) ratio requirement by mitigating the effects of CTS.

A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins.

PubMed

Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa

2016-03-21

Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

PubMed Central

Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2015-01-01

The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000

2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.

PubMed

Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J

2017-08-01

We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less

Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

2001-04-01

Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

Interstrand disulfide crosslinking of DNA bases supports a double nucleotide unpairing mechanism for flap endonucleases.

PubMed

Beddows, Amanda; Patel, Nikesh; Finger, L David; Atack, John M; Williams, David M; Grasby, Jane A

2012-09-14

Flap endonucleases (FENs) are proposed to select their target phosphate diester by unpairing the two terminal nucleotides of duplex. Interstrand disulfide crosslinks, introduced by oxidation of thiouracil and thioguanine bases, abolished the specificity of human FEN1 for hydrolysis one nucleotide into the 5'-duplex.

Microstructure and thermal stability of Cu/Zr0.3Al0.7N/Zr0.2Al0.8N/Al34O60N6 cermet-based solar selective absorbing coatings

NASA Astrophysics Data System (ADS)

Meng, Jian-ping; Guo, Rui-rui; Li, Hu; Zhao, Lu-ming; Liu, Xiao-peng; Li, Zhou

2018-05-01

Solar selective absorbing coatings play a valuable role in photo-thermal conversion for high efficiency concentrating solar power systems (CSP). In this paper, a novel Cu/Zr0.3Al0.7N/Zr0.2Al0.8N/Al34O60N6 cermet-based solar selective absorbing coating was successfully deposited by ion beam assisted deposition. The optical properties, microstructure and element distribution in depth were investigated by spectroscopic ellipsometry, UV-vis-NIR spectrophotometer, transmission electron microscope (TEM) and Auger electron spectroscopy (AES), respectively. A high absorptance of 0.953 and a low thermal emittance of 0.079 at 400 °C are obtained by the integral computation according to the whole reflectance from 300 nm to 28,800 nm. After annealing treatment at 400 °C (in vacuum) for 192 h, the deposited coating exhibits the high thermal stability. Whereas, the photothermal conversion efficiency decreases from 12.10 to 6.86 due to the emittance increase after annealing at 600 °C for 192 h. Meanwhile, the nitrogen atom in the Zr0.3Al0.7N sub-layer diffuses toward the adjacent sub-layer due to the spinodal decomposition of metastable c-ZrAlN and the phase transition from c-AlN to h-AlN, which leads to the composition of the Zr0.3Al0.7N sub-layer deviates the initial design. This phenomenon has a guide effect for the thermal-stability improvement of cermet coatings. Additionally, a serious diffusion between copper and silicon substrate also contributes to the emittance increase.

Quantitative Detection of Small Molecule/DNA Complexes Employing a Force-Based and Label-Free DNA-Microarray

PubMed Central

Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.

2009-01-01

Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

2002-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

PubMed

Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

2013-07-01

Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

Synthesis and Thermal Analysis of Nano-Aluminum/Fluorinated Polyurethane Elastomeric Composites for Structural Energetics.

PubMed

Zhang, Xianyu; Kim, Jin Seuk; Kwon, Younghwan

2017-04-01

Here we describe the synthesis of polyurethane (PU)-based energetic nanocomposites loaded with nano-aluminum (n-Al) particles. The energetic nanocomposite was prepared by polyurethane reaction of poly(glycidyl azide-co-tetramethylene glycol) (PGT) prepolymers and IPDI/N-100 isocyanates with simultaneous catalyst-free azide-alkyne Click reaction in the presence of n-Al. Initial study carried out with various n-Al/fluorinated PGT blends and demonstrated the potential of fluorinated PGT prepolymer for an energetic PU matrix. Thermal analysis of n-Al/fluorinated PGT-based PU energetic nanocomposite was performed using DSC and TGA.

Pathfinder Technology Demonstrator: GlobalStar Testing and Results

NASA Technical Reports Server (NTRS)

Kuroda, Vanessa; Limes, Gregory L.; Han, Shi Lei; Hanson, John Eric; Christa, Scott E.

2016-01-01

The communications subsystem of a spacecraft is typically a SWaP (size, weight, and power) intensive subsystem in a SWaP constrained environment such as a CubeSat. Use of a satellite-based communication system, such as GlobalStars duplex GSP-1720 radio is a low SWaP potentially game-changing low-cost communication subsystem solution that was evaluated for feasibility for the NASA Pathfinder Technology Demonstrator (PTD) project. The PTD project is a series of 6U CubeSat missions to flight demonstrate and characterize novel small satellite payloads in low Earth orbit. GlobalStar is a low Earth orbit satellite constellation for satellite phone and low-speed data communications, and the GSP-1720 is their single board duplex radio most commonly used in satellite phones and shipment tracking devices. The PTD project tested the GSP-1720 to characterize its viability for flight using NASA GEVS (General Environmental Verification Standard) vibration and thermal vacuum levels, as well as testing the uplink-downlink connectivity, data throughput, and file transfer capabilities. This presentation will present the results of the environmental and capability testing of the GSP-1720 performed at NASA Ames Research Center, as well as the viability for CubeSat use in LEO.

Raman spectroscopy of DNA-metal complexes. II. The thermal denaturation of DNA in the presence of Sr2+, Ba2+, Mg2+, Ca2+, Mn2+, Co2+, Ni2+, and Cd2+.

PubMed

Duguid, J G; Bloomfield, V A; Benevides, J M; Thomas, G J

1995-12-01

Differential scanning calorimetry, laser Raman spectroscopy, optical densitometry, and pH potentiometry have been used to investigate DNA melting profiles in the presence of the chloride salts of Ba2+, Sr2+, Mg2+, Ca2+, Mn2+, Co2+, Ni2+, and Cd2+. Metal-DNA interactions have been observed for the molar ratio [M2+]/[PO2-] = 0.6 in aqueous solutions containing 5% by weight of 160 bp mononucleosomal calf thymus DNA. All of the alkaline earth metals, plus Mn2+, elevate the melting temperature of DNA (Tm > 75.5 degrees C), whereas the transition metals Co2+, Ni2+, and Cd2+ lower Tm. Calorimetric (delta Hcal) and van't Hoff (delta HVH) enthalpies of melting range from 6.2-8.7 kcal/mol bp and 75.6-188.6 kcal/mol cooperative unit, respectively, and entropies from 17.5 to 24.7 cal/K mol bp. The average number of base pairs in a cooperative melting unit () varied from 11.3 to 28.1. No dichotomy was observed between alkaline earth and transition DNA-metal complexes for any of the thermodynamic parameters other than their effects on Tm. These results complement Raman difference spectra, which reveal decreases in backbone order, base unstacking, distortion of glycosyl torsion angles, and rupture of hydrogen bonds, which occur after thermal denaturation. Raman difference spectroscopy shows that transition metals interact with the N7 atom of guanine in duplex DNA. A broader range of interaction sites with single-stranded DNA includes ionic phosphates, the N1 and N7 atoms of purines, and the N3 atom of pyrimidines. For alkaline earth metals, very little interaction was observed with duplex DNA, whereas spectra of single-stranded complexes are very similar to those of melted DNA without metal. However, difference spectra reveal some metal-specific perturbations at 1092 cm-1 (nPO2-), 1258 cm-1 (dC, dA), and 1668 cm-1 (nC==O, dNH2 dT, dG, dC). Increased spectral intensity could also be observed near 1335 cm-1 (dA, dG) for CaDNA. Optical densitometry, employed to detect DNA aggregation, reveals increased turbidity during the melting transition for all divalent DNA-metal complexes, except SrDNA and BaDNA. Turbidity was not observed for DNA in the absence of metal. A correlation was made between DNA melting, aggregation, and the ratio of Raman intensities I1335/I1374. At room temperature, DNA-metal interactions result in a pH drop of 1.2-2.2 units for alkaline earths and more than 2.5 units for transition metals. Sr2+, Ba2+, and Mg2+ cause protonated sites on the DNA to become thermally labile. These results lead to a model that describes DNA aggregation and denaturation during heating in the presence of divalent metal cations; 1) The cations initially interact with the DNA at phosphate and/or base sites, resulting in proton displacement. 2) A combination of metal-base interactions and heating disrupts the base pairing within the DNA duplex. This allows divalent metals and protons to bind to additional sites on the DNA bases during the aggregation/melting process. 3) Strands whose bases have swung open upon disruption are linked to neighboring strands by metal ion bridges. 4) Near the midpoint of the melting transition, thermal energy breaks up the aggregate. We have no evidence to indicate whether metal ion cross-bridges or direct base-base interactions rupture first. 5) Finally, all cross-links break, resulting in single-stranded DNA complexed with metal ions.

Validation of a novel venous duplex ultrasound objective structured assessment of technical skills for the assessment of venous reflux.

PubMed

Jaffer, Usman; Normahani, Pasha; Lackenby, Kimberly; Aslam, Mohammed; Standfield, Nigel J

2015-01-01

Duplex ultrasound measurement of reflux time is central to the diagnosis of venous incompetence. We have developed an assessment tool for Duplex measurement of venous reflux for both simulator and patient-based training. A novel assessment tool, Venous Duplex Ultrasound Assessment of Technical Skills (V-DUOSATS), was developed. A modified DUOSATS was used for simulator training. Participants of varying skill level were invited to viewed an instructional video and were allowed ample time to familiarize with the Duplex equipment. Attempts made by the participants were recorded and independently assessed by 3 expert assessors and 5 novice assessors using the modified V-DUOSATS. "Global" assessment was also done by expert assessors on a 4-point Likert scale. Content, construct, and concurrent validities as well as reliability were evaluated. Content and construct validity as well as reliability were demonstrated. Receiver operator characteristic analysis-established cut points of 19/22 and 21/30 were most appropriate for simulator and patient-based assessment, respectively. We have validated a novel assessment tool for Duplex venous reflux measurement. Further work is required to establish transference validity of simulator training to improve skill in scanning patients. We have developed and validated V-DUOSATS for simulator training. Copyright © 2015 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Maximizing synchronizability of duplex networks

NASA Astrophysics Data System (ADS)

Wei, Xiang; Emenheiser, Jeffrey; Wu, Xiaoqun; Lu, Jun-an; D'Souza, Raissa M.

2018-01-01

We study the synchronizability of duplex networks formed by two randomly generated network layers with different patterns of interlayer node connections. According to the master stability function, we use the smallest nonzero eigenvalue and the eigenratio between the largest and the second smallest eigenvalues of supra-Laplacian matrices to characterize synchronizability on various duplexes. We find that the interlayer linking weight and linking fraction have a profound impact on synchronizability of duplex networks. The increasingly large inter-layer coupling weight is found to cause either decreasing or constant synchronizability for different classes of network dynamics. In addition, negative node degree correlation across interlayer links outperforms positive degree correlation when most interlayer links are present. The reverse is true when a few interlayer links are present. The numerical results and understanding based on these representative duplex networks are illustrative and instructive for building insights into maximizing synchronizability of more realistic multiplex networks.

Full-duplex radio over fiber link with colorless source-free base station based on single sideband optical mm-wave signal with polarization rotated optical carrier

NASA Astrophysics Data System (ADS)

Ma, Jianxin

2016-07-01

A full-duplex radio-over fiber (RoF) link scheme based on single sideband (SSB) optical millimeter (mm)-wave signal with polarization-rotated optical carrier is proposed to realize the source-free colorless base station (BS), in which a polarization beam splitter (PBS) is used to abstract part of the optical carrier for conveying the uplink data. Since the optical carrier for the uplink does not bear the downlink signal, no cross-talk from the downlink contaminates the uplink signal. The simulation results demonstrate that both down- and up-links maintain good performance. The mm-wave signal distribution network based on the proposed full duplex fiber link scheme can use the uniform source-free colorless BSs, which makes the access system very simpler.

The Small Bodies Thermal Mapper: An Instrument for Future Missions to Study the Compositional and Thermal Properties of Phobos

NASA Astrophysics Data System (ADS)

Donaldson Hanna, Kerri; Bowles, Neil; Calcutt, Simon; Greenhagen, Benjamin; Glotch, Timothy; Edwards, Christopher

2015-04-01

The surface of Phobos holds many keys for understanding its formation and evolution as well as the history and dynamics of the Mars-Phobos system. Phobos has been the target for numerous flyby and sample return missions in the past (e.g. Rosetta [Pajola et al., 2012] and Phobos Grunt [Kuzmin et al., 2003]). Previous telescopic and spacecraft observations have revealed a surface that is compositionally heterogeneous [e.g. Pang et al., 1978; Pollack et al., 1978, Lunine et al., 1982; Murchie and Erard, 1996; Roush and Hogan, 2001; Rivkin et al., 2002; Giuranna et al., 2011; Fraeman et al., 2014] and with large variations in surface topography [e.g. Shi et al., 2011; 2012; Willner et al., 2014]. For any future sample return mission, remote sensing observations, in particular thermal infrared observations, will be key in characterising possible landing/sampling sites and placing returned samples into their geological context. The European Space Agency has identified Phootprint, a European sample return mission to Phobos, as a candidate mission of the Mars Robotic Exploration Preparation Programme 2 (MREP-2). Using this mission concept as a baseline, we have studied the options for a simple multichannel radiometer to provide thermal mapping and compositional remote sensing data. By mapping Phobos' diurnal thermal response, a thermal imaging instrument will provide key information on the nature of the surface and near sub-surface (the thermal inertia) and composition. These measurements will support visible imaging observations to determine landing sites that are compatible with the spacecraft's sampling mechanisms. Remotely sensed thermal maps of the surface will also prevent otherwise unpredictable thermal loads on the spacecraft due to variations in local topography and albedo. The instrument design resulting from this study, the Small Bodies Thermal Mapper (SBTM), is a compact multichannel radiometer and thermal imager. The SBTM is based on the Compact Modular Sounder (CMS) instrument currently flying on the UK's TechDemoSat-1 spacecraft in low Earth orbit. This gives a significant level of flight heritage with optimisations for the expected Phobos environment. The SBTM instrument uses a two-dimensional uncooled thermal detector array to provide imaging of Phobos. In addition, ten narrow-band infrared filters located around diagnostic mineral spectral features provide additional compositional discrimination. For the SBTM, the optimisations studied include options for the detector and filters required to cover the wide range of diurnal temperatures expected at Phobos (e.g. 130 to > 300 K) [e.g. Kuzmin et al., 2003]. Options studied include the use of a broadband micro bolometer array (e.g. http://www.ulis-ir.com/uploads/Products/PICO640E-041-BroadBand.pdf) or a thermopile detector [Foote et al., 1998] array. Optimisation of filter band passes for remote measurement of composition is also considered, based on mineral spectra measured under simulated Phobos environment [e.g. Glotch et al., 2014].

Duplex ultrasound surveillance after carotid artery endarterectomy.

PubMed

Al Shakarchi, Julien; Lowry, Danielle; Nath, Jay; Khawaja, Aurangzaib Z; Inston, Nicholas; Tiwari, Alok

2016-06-01

After carotid endarterectomy (CEA), patients have been regularly followed up by duplex ultrasound imaging. However, the evidence for long-term follow-up is not clear, especially if the results from an early duplex scan are normal. This study assessed and systematically reviewed the evidence base for long-term surveillance after CEA and a normal early scan. Electronic databases were searched for studies assessing duplex surveillance after CEA in accordance with Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. The primary outcome for this study was the incidence of restenosis after a normal early scan. The secondary outcome was the number of reinterventions after a normal early scan. The review included seven studies that reported 2317 procedures. Of those patients with a normal early scan, 2.8% (95% confidence interval, 0.7%-6%) developed a restenosis, and 0.4% (95% confidence interval, 0%-0.9%) underwent a reintervention for their restenosis during the follow-up period. This review confirms that routine postoperative duplex ultrasound surveillance after CEA is not necessary if the early duplex scan is normal. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Containerless processing of undercooled melts

NASA Technical Reports Server (NTRS)

Perepezko, J. H.

1993-01-01

The investigation focused on the control of microstructural evolution in Mn-Al, Fe-Ni, Ni-V, and Au-Pb-Sb alloys through the high undercooling levels provided by containerless processing, and provided fundamental new information on the control of nucleation. Solidification analysis was conducted by means of thermal analysis, x-ray diffraction, and metallographic characterization on samples processed in a laboratory scale drop tube system. The Mn-Al alloy system offers a useful model system with the capability of phase separation on an individual particle basis, thus permitting a more complete understanding of the operative kinetics and the key containerless processing variables. This system provided the opportunity of analyzing the nucleation rate as a function of processing conditions and allowed for the quantitative assessment of the relevant processing parameters. These factors are essential in the development of a containerless processing model which has a predictive capability. Similarly, Ni-V is a model system that was used to study duplex partitionless solidification, which is a structure possible only in high under cooling solidification processes. Nucleation kinetics for the competing bcc and fcc phases were studied to determine how this structure can develop and the conditions under which it may occur. The Fe-Ni alloy system was studied to identify microstructural transitions with controlled variations in sample size and composition during containerless solidification. This work was forwarded to develop a microstructure map which delineates regimes of structural evolution and provides a unified analysis of experimental observations. The Au-Pb-Sb system was investigated to characterize the thermodynamic properties of the undercooled liquid phase and to characterize the glass transition under a variety of processing conditions. By analyzing key containerless processing parameters in a ground based drop tube study, a carefully designed flight experiment may be planned to utilize the extended duration microgravity conditions of orbiting spacecraft.

Development of Al-Al3Ni Nanocomposite by Duplex Processing of Flame Spray and Friction Stir Processing, and Evaluation of Its Properties

NASA Astrophysics Data System (ADS)

Adel Mehraban, F.; Karimzadeh, F.; Abbasi, M. H.

2017-10-01

In this study, Al-Al3Ni nanocomposite was fabricated by friction stir processing (FSP) of a nickel-deposited Al6061-T6 plate. X-ray diffraction results showed that Al3Ni phase was formed because of an in situ reaction between the preplaced nickel and aluminum substrate. To predict the first phase formed during FSP, effective heat of formation (EHF) thermodynamic model was applied, and the results were in agreement with experimental data. The presence of facet nanoparticles in transmission electron microscopy micrographs of the stir zone (SZ) confirmed the formation of Al3Ni nano-reinforcements. Although microhardness and ultimate tensile strength in the SZ of nanocomposite degraded because of precipitates dissolution in Al6061-T6 during FSP, it showed improved tribological behavior at elevated temperatures.

Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

PubMed Central

Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

2016-01-01

A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

A Synchronous Digital Duplexing Technique for OFDMA-Based Indoor Communications

NASA Astrophysics Data System (ADS)

Park, Chang-Hwan; Ko, Yo-Han; Kim, Yeong-Jun; Park, Kyung-Won; Jeon, Won-Gi; Paik, Jong-Ho; Lee, Seok-Pil; Cho, Yong-Soo

In this paper, we propose a new digital duplexing scheme, called synchronous digital duplexing (SDD), which can increase data efficiency and flexibility of resource by transmitting uplink signal and downlink signal simultaneously in wireless communication. In order to transmit uplink and downlink signals simultaneously, the proposed SDD obtains mutual information among subscriber stations (SSs) with a mutual ranging symbol. This information is used for selection of transmission time, decision on cyclic suffix (CS) insertion, determination of CS length, and re-establishment of FFT starting point.

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

PubMed

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

Tool wear analysis during duplex stainless steel trochoidal milling

NASA Astrophysics Data System (ADS)

Amaro, Paulo; Ferreira, Pedro; Simões, Fernando

2018-05-01

In this study a tool with interchangeable inserts of sintered carbides coated with AlTiN were used to mill a duplex stainless steel with trochoidal strategies. Cutting speed range from 120 to 300 m/min were used and t he evaluation of tool deterioration and tool life was made according international standard ISO 8688-1. It was observed a progressive development of a flank wear and a cumulative cyclic process of localized adhesion of the chip to the cutting edge, followed by chipping, loss of the coating and substrate exposure. The tool life reached a maximum of 35 min. for cutting speed of 120 m/min. However, it was possible to maintain a tool life of 20-25 minutes when the cutting speed was increased up to 240 m/min.

Molecular basis for methoxyamine initiated mutagenesis. 1H nuclear magnetic resonance studies of base-modified oligodeoxynucleotides.

PubMed

Stone, M J; Nedderman, A N; Williams, D H; Lin, P K; Brown, D M

1991-12-05

In order to reach a more detailed understanding of the mechanism of the mutagenic action of methoxyamine and of N4-methoxycytidine and its 2'-deoxyribo-analogue, the solution structures of the self-complementary octanucleotide, d(CGAATTCG) and its analogues, d(CGAATCCG), d(CGAATMCG) and d(CGAATPCG) (designated 8mer-AT, 8mer-AC, 8mer-AM, and 8mer-AP, respectively), were investigated by 1H nuclear magnetic resonance spectroscopy; M is N4-methoxycytosine (mo4C) and P is an analogue, the bicyclic dihydropyrimido[4,5-c][1,2]oxazin-7-one, in which the N-O bond is held in the anti configuration with respect to N3 of the cytosine ring. Correlated spectroscopy and nuclear Overhauser spectroscopy allowed assignment of the base, anomeric and H2'/H2" protons in 8mers-AT, -AM and -AP, and showed that all three had features consistent with a regular B-DNA duplex structure. Duplex-to-coil transition temperatures were determined to be 52(+/- 2) degrees C (8mer-AT), 51(+/- 2) degrees C (8mer-AP), 32(+/- 2) degrees C (8mer-AM); on the chemical shift timescale, the melting transition was fast for 8mer-AT and 8mer-AP, but slow for 8mer-AM. Imino proton spectra were indicative of Watson-Crick base-pairing in 8mers-AT, -AP and -AM. The 8mer-AP duplex had a structure and melting characteristics virtually identical with those of the 8mer-AT duplex. The preferred syn configuration of the methoxyl group in M had a destabilising effect on the 8mer-AM duplex. At low temperatures, the A.M base-pair was in fast equilibrium between Watson-Crick and wobble configurations, with the methoxyl function anti-oriented, but the melting transition was accompanied by isomerization of the methoxyl group to the syn conformation. This syn-anti isomerization was the rate-determining step in the duplex-to-coil transition. The 8mer-AC oligomer did not form a stable duplex.

The effect of S-substitution at the O6-guanine site on the structure and dynamics of a DNA oligomer containing a G:T mismatch

PubMed Central

2017-01-01

The effect of S-substitution on the O6 guanine site of a 13-mer DNA duplex containing a G:T mismatch is studied using molecular dynamics. The structure, dynamic evolution and hydration of the S-substituted duplex are compared with those of a normal duplex, a duplex with S-substitution on guanine, but no mismatch and a duplex with just a G:T mismatch. The S-substituted mismatch leads to cell death rather than repair. One suggestion is that the G:T mismatch recognition protein recognises the S-substituted mismatch (GS:T) as G:T. This leads to a cycle of futile repair ending in DNA breakage and cell death. We find that some structural features of the helix are similar for the duplex with the G:T mismatch and that with the S-substituted mismatch, but differ from the normal duplex, notably the helical twist. These differences arise from the change in the hydrogen-bonding pattern of the base pair. However a marked feature of the S-substituted G:T mismatch duplex is a very large opening. This showed considerable variability. It is suggested that this enlarged opening would lend support to an alternative model of cell death in which the mismatch protein attaches to thioguanine and activates downstream damage-response pathways. Attack on the sulphur by reactive oxygen species, also leading to cell death, would also be aided by the large, variable opening. PMID:28910418

Photo-thermal characteristics of hybrid nanofluids based on Therminol-55 oil for concentrating solar collectors

NASA Astrophysics Data System (ADS)

Gulzar, Ovais; Qayoum, Adnan; Gupta, Rajat

2018-03-01

Hybrid nanofluids are the new generation efficient heat transfer fluids allowing greater control over the properties of base fluid as compared to mono-nanofluids. In this study, attempt has been made for increasing the efficiency for photo-thermal conversion by heat transfer fluid for high temperature solar collectors. Therminol-55, a high temperature heat transfer fluid is doped with Al2O3 and TiO2 nanoparticles with an aim to improve the thermal and optical properties. Effects of concentration and type of nanoparticle on photo-thermal conversion properties and absorbance in Therminol-55 have been studied. Spectrophotometric analysis has been carried for all nanofluids, namely, Al2O3-Therminol-55, TiO2-Therminol-55 and hybrid (Al2O3-TiO2)-Therminol-55 nanofluids with varying concentrations of 0.05, 0.075, 0.1, 0.25, 0.5 wt%. It was found that TiO2 nanofluids possess the maximum absorbance with minimal effect of nanoparticle concentration above 0.1 wt% followed by hybrid (Al2O3-TiO2) nanofluid (HNF) with strong dependence of concentration. Al2O3-Therminol-55 nanofluids exhibited least absorbance. The peak values of absorbance are 0.47, 2.15 and 2.144 in the visible region for Al2O3-Therminol-55, TiO2-Therminol-55 and hybrid (Al2O3-TiO2)-Therminol-55 nanofluids, respectively. It was observed that hybrid nanofluids show both bathochromic and hyperchromic shifts. Further, performance testing has been carried out using artificial source of light and it has been observed that hybrid nanofluids provide efficient photo-thermal conversion as compared to TiO2 and Al2O3-Therminol-55 nanofluids. Maximum temperatures of 152.9, 149.6, 158.6 °C were observed for 0.5 wt% Al2O3-Therminol-55, 0.1 wt% TiO2-Therminol-55, and 0.5 wt% hybrid (Al2O3-TiO2) nanofluid, respectively, against 125.8 °C of Therminol-55. Hybrid nanofluids based on Therminol-55 could be a potential candidate for high temperature concentrating collectors based on the superior properties over mono-nanofluids and base fluid.

Effect of ageing on precipitation and impact energy of 2101 economical duplex stainless steel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Wei; College of Materials Science and Engineering, Shanghai Jiaotong University, Shanghai 200240; Jiang Laizhu

2009-01-15

The impact energy and microstructure of a thermally aged 2101 duplex stainless steel with composition of Fe-21.4Cr-1.2Ni-5.7Mn-0.23 N-0.31Mo were studied. The results showed that the room temperature impact energy of specimens decreased gradually with ageing temperature up to 700 deg. C and then increased with aging over 700 deg. C. The minimum value of impact energy was 37 J after 700 deg. C aging, which was only 34% of that for as-annealed specimens. For specimens aged at 700 deg. C, the room temperature impact energy decreased significantly after 3 min and was halved after 10 min. Fractographs showed that, withmore » increasing aging time, the fracture morphology changed from fibrous fracture to transgranular and intragranular fracture. Scanning electron micrographs revealed that many precipitates were distributed along {alpha}/{gamma} and {alpha}/{alpha} interfaces. The precipitates were extracted and confirmed by X-ray diffraction to be Cr{sub 2}N. Therefore, it can be concluded that precipitation of Cr{sub 2}N is the main reason for the decrease of impact energy in aged 2101 duplex stainless steel.« less

Aluminum nitride coatings using response surface methodology to optimize the thermal dissipated performance of light-emitting diode modules

NASA Astrophysics Data System (ADS)

Jean, Ming-Der; Lei, Peng-Da; Kong, Ling-Hua; Liu, Cheng-Wu

2018-05-01

This study optimizes the thermal dissipation ability of aluminum nitride (AlN) ceramics to increase the thermal performance of light-emitting diode (LED) modulus. AlN powders are deposited on heat sink as a heat interface material, using an electrostatic spraying process. The junction temperature of the heat sink is developed by response surface methodology based on Taguchi methods. In addition, the structure and properties of the AlN coating are examined using X-ray photoelectron spectroscopy (XPS). In the XPS analysis, the AlN sub-peaks are observed at 72.79 eV for Al2p and 398.88 eV for N1s, and an N1s sub-peak is assigned to N-O at 398.60eV and Al-N bonding at 395.95eV, which allows good thermal properties. The results have shown that the use of AlN ceramic material on a heat sink can enhance the thermal performance of LED modules. In addition, the percentage error between the predicted and experimental results compared the quadric model with between the linear and he interaction models was found to be within 7.89%, indicating that it was a good predictor. Accordingly, RSM can effectively enhance the thermal performance of an LED, and the beneficial heat dissipation effects for AlN are improved by electrostatic spraying.

View west along Marine Barracks Way at rear of Marine ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

View west along Marine Barracks Way at rear of Marine Corps Officers' Housing, with carports on left and duplex on right - U.S. Naval Base, Pearl Harbor, Marine Corps Officers' Duplex Quarters, Salvor Street & Russell Avenue, Pearl City, Honolulu County, HI

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

PubMed

Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

2014-01-25

Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

PubMed

Nonin, S; Leroy, J L; Guéron, M

1995-08-22

We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

Effect of Particle Size on Thermal Conductivity of Nanofluid

NASA Astrophysics Data System (ADS)

Chopkar, M.; Sudarshan, S.; Das, P. K.; Manna, I.

2008-07-01

Nanofluids, containing nanometric metallic or oxide particles, exhibit extraordinarily high thermal conductivity. It is reported that the identity (composition), amount (volume percent), size, and shape of nanoparticles largely determine the extent of this enhancement. In the present study, we have experimentally investigated the impact of Al2Cu and Ag2Al nanoparticle size and volume fraction on the effective thermal conductivity of water and ethylene glycol based nanofluid prepared by a two-stage process comprising mechanical alloying of appropriate Al-Cu and Al-Ag elemental powder blend followed by dispersing these nanoparticles (1 to 2 vol pct) in water and ethylene glycol with different particle sizes. The thermal conductivity ratio of nanofluid, measured using an indigenously developed thermal comparator device, shows a significant increase of up to 100 pct with only 1.5 vol pct nanoparticles of 30- to 40-nm average diameter. Furthermore, an analytical model shows that the interfacial layer significantly influences the effective thermal conductivity ratio of nanofluid for the comparable amount of nanoparticles.

Phase Separation in Lean Grade Duplex Stainless Steel 2101

DOE PAGES

Garfinkel, D.; Poplawsky, Jonathan D.; Guo, Wei; ...

2015-08-19

The use of duplex stainless steels (DSS) in nuclear power generation systems is limited by thermal instability that leads to embrittlement in the temperature range of 204°C - 538°C. New lean grade alloys, such as 2101, offer the potential to mitigate these effects. Thermal embrittlement was quantified through impact toughness and hardness testing on samples of alloy 2101 after aging at 427°C for various durations (1-10,000 hours). Additionally, atom probe tomography (APT) was utilized in order to observe the kinetics of α-α’ separation and G-phase formation. Mechanical testing and APT data for two other DSS alloys, 2003 and 2205 weremore » used as a reference to 2101. The results show that alloy 2101 exhibits superior performance compared to the standard grade DSS alloy, 2205, but inferior to the lean grade alloy, 2003, in mechanical testing. APT data demonstrates that the degree of α-α’ separation found in alloy 2101 closely resembles that of 2205, and greatly exceeds 2003. Additionally, contrary to what was observed in 2003, 2101 demonstrated G-phase like precipitates after long aging times, though precipitates were not as abundant as was observed in 2205.« less

Influence of Microstructure and Shot Peening Treatment on Corrosion Resistance of AISI F55-UNS S32760 Super Duplex Stainless Steel.

PubMed

Ciuffini, Andrea Francesco; Barella, Silvia; Peral Martínez, Luis Borja; Mapelli, Carlo; Fernández Pariente, Inés

2018-06-19

Shot peening is a surface process commonly used in the aeronautic and automotive industries to improve fatigue resistance. Shot peening is proven to be beneficial in the fatigue behavior of components, but rarely has its influence on wear and pitting corrosion resistance been evaluated. In this work, shot peening was performed on AISI F55-UNS S32760 super-duplex stainless steel samples previously submitted to various thermal treatments, to obtain different initial microstructures and properties. Samples have been characterized in terms of microstructure morphology, local chemical composition, microhardness of each constituent phase, and energy dissipation modes. The enhanced properties provided by shot peening has been evaluated through residual stress depth profiles and Full Width at Half Maximum (FWHM) using X-ray diffraction (XRD), surface hardness, surface roughness, and corrosion resistance through salt spray fog tests. The 1400 °C solution thermal treatment was identified as the optimum initial condition, which maximizes the advantages of the shot peening treatment, even pitting corrosion resistance. These results are related to the uniformity of austenite and ferrite in terms of microstructure morphology, micromechanical properties, and alloying elements distribution.

Sodium-based hydrides for thermal energy applications

NASA Astrophysics Data System (ADS)

Sheppard, D. A.; Humphries, T. D.; Buckley, C. E.

2016-04-01

Concentrating solar-thermal power (CSP) with thermal energy storage (TES) represents an attractive alternative to conventional fossil fuels for base-load power generation. Sodium alanate (NaAlH4) is a well-known sodium-based complex metal hydride but, more recently, high-temperature sodium-based complex metal hydrides have been considered for TES. This review considers the current state of the art for NaH, NaMgH3- x F x , Na-based transition metal hydrides, NaBH4 and Na3AlH6 for TES and heat pumping applications. These metal hydrides have a number of advantages over other classes of heat storage materials such as high thermal energy storage capacity, low volume, relatively low cost and a wide range of operating temperatures (100 °C to more than 650 °C). Potential safety issues associated with the use of high-temperature sodium-based hydrides are also addressed.

Method of protecting a surface with a silicon-slurry/aluminide coating. [coatings for gas turbine engine blades and vanes

NASA Technical Reports Server (NTRS)

Deadmore, D. L.; Young, S. G. (Inventor)

1982-01-01

A low cost coating for protecting metallic base system substrates from high temperatures, high gas velocity oxidation, thermal fatigue and hot corrosion is described. The coating is particularly useful for protecting vanes and blades in aircraft and land based gas turbine engines. A lacquer slurry comprising cellulose nitrate containing high purity silicon powder is sprayed onto the superalloy substrates. The silicon layer is then aluminized to complete the coating. The Si-Al coating is less costly to produce than advanced aluminides and protects the substrate from oxidation and thermal fatigue for a much longer period of time than the conventional aluminide coatings. While more expensive Pt-Al coatings and physical vapor deposited MCrAlY coatings may last longer or provide equal protection on certain substrates, the Si-Al coating exceeded the performance of both types of coatings on certain superalloys in high gas velocity oxidation and thermal fatigue. Also, the Si-Al coating increased the resistance of certain superalloys to hot corrosion.

Piercing mandrel strengthening by surfacing with nickel aluminide-based alloy

NASA Astrophysics Data System (ADS)

Zorin, I. V.; Dubtsov, Yu N.; Sokolov, G. N.; Artem'ev, A. A.; Lysak, V. I.; Elsukov, S. N.

2017-02-01

Electrode composite wire (CW) was used for argon-arc surfacing of a thermal-resisting nickel aluminide-based alloy (Ni-Al-Cr-W-Mo-Ta system) on the butt-end surface of the non-water-cooled piercing mandrel. It was shown that multipassing surfacing forms a defect-free deposited metal based on the γ’-Ni3Al phase of various structural origins. Using high-temperature sclerometry and thermal fatigue testing methods, the metal deposited with CW containing ultrafine particle of 0.3-0.4 % wt. WC carbide features increased resistance to thermal and force effects at temperatures up to 1200 °C.

Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170174 computers ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Computer Maintenance Operations Center (CMOC), showing duplexed cyber 170-174 computers - Beale Air Force Base, Perimeter Acquisition Vehicle Entry Phased-Array Warning System, Techinical Equipment Building, End of Spencer Paul Road, north of Warren Shingle Road (14th Street), Marysville, Yuba County, CA

50 years of DNA ‘Breathing’: Reflections on Old and New Approaches

PubMed Central

von Hippel, Peter H.; Johnson, Neil P.; Marcus, Andrew H.

2015-01-01

Summary The coding sequences for genes, and much other regulatory information involved in genome expression, are located ‘inside’ the DNA duplex. Thus the ‘macromolecular machines’ that read-out this information from the base sequence of the DNA must somehow access the DNA ‘interior’. Double-stranded (ds) DNA is a highly structured and cooperatively stabilized system at physiological temperatures, but is also only marginally stable and undergoes a cooperative ‘melting phase transition’ at temperatures not far above physiological. Furthermore, due to its length and heterogeneous sequence, with AT-rich segments being less stable than GC-rich segments, the DNA genome ‘melts’ in a multistate fashion. Therefore the DNA genome must also manifest thermally driven structural (‘breathing’) fluctuations at physiological temperatures that should reflect the heterogeneity of the dsDNA stability near the melting temperature. Thus many of the breathing fluctuations of dsDNA are likely also to be sequence dependent, and could well contain information that should be ‘readable’ and useable by regulatory proteins and protein complexes in site-specific binding reactions involving dsDNA ‘opening’. Our laboratory has been involved in studying the breathing fluctuations of duplex DNA for about 50 years. In this ‘Reflections’ article we present a relatively chronological overview of these studies, starting with the use of simple chemical probes (such as hydrogen exchange, formaldehyde and simple DNA ‘melting’ proteins) to examine the local stability of the dsDNA structure, and culminating in sophisticated spectroscopic approaches that can be used to monitor the breathing-dependent interactions of regulatory complexes with their duplex DNA targets in ‘real time’. PMID:23840028

Increasing the Analytical Sensitivity by Oligonucleotides Modified with Para- and Ortho-Twisted Intercalating Nucleic Acids – TINA

PubMed Central

Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm

2011-01-01

The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988

Al2O3-based nanofluids: a review

PubMed Central

2011-01-01

Ultrahigh performance cooling is one of the important needs of many industries. However, low thermal conductivity is a primary limitation in developing energy-efficient heat transfer fluids that are required for cooling purposes. Nanofluids are engineered by suspending nanoparticles with average sizes below 100 nm in heat transfer fluids such as water, oil, diesel, ethylene glycol, etc. Innovative heat transfer fluids are produced by suspending metallic or nonmetallic nanometer-sized solid particles. Experiments have shown that nanofluids have substantial higher thermal conductivities compared to the base fluids. These suspended nanoparticles can change the transport and thermal properties of the base fluid. As can be seen from the literature, extensive research has been carried out in alumina-water and CuO-water systems besides few reports in Cu-water-, TiO2-, zirconia-, diamond-, SiC-, Fe3O4-, Ag-, Au-, and CNT-based systems. The aim of this review is to summarize recent developments in research on the stability of nanofluids, enhancement of thermal conductivities, viscosity, and heat transfer characteristics of alumina (Al2O3)-based nanofluids. The Al2O3 nanoparticles varied in the range of 13 to 302 nm to prepare nanofluids, and the observed enhancement in the thermal conductivity is 2% to 36%. PMID:21762528

CarbAl Heat Transfer Material

NASA Technical Reports Server (NTRS)

Fink, Richard

2015-01-01

The increasing use of power electronics, such as high-current semiconductor devices and modules, within space vehicles is driving the need to develop specialty thermal management materials in both the packaging of these discrete devices and the packaging of modules consisting of these device arrays. Developed by Applied Nanotech, Inc. (ANI), CarbAl heat transfer material is uniquely characterized by its low density, high thermal diffusivity, and high thermal conductivity. Its coefficient of thermal expansion (CTE) is similar to most power electronic materials, making it an effective base plate substrate for state-of-the-art silicon carbide (SiC) super junction transistors. The material currently is being used to optimize hybrid vehicle inverter packaging. Adapting CarbAl-based substrates to space applications was a major focus of the SBIR project work. In Phase I, ANI completed modeling and experimentation to validate its deployment in a space environment. Key parameters related to cryogenic temperature scaling of CTE, thermal conductivity, and mechanical strength. In Phase II, the company concentrated on improving heat sinks and thermally conductive circuit boards for power electronic applications.

Silicon-slurry/aluminide coating. [protecting gas turbine engine vanes and blades

NASA Technical Reports Server (NTRS)

Deadmore, D. L.; Young, S. G. (Inventor)

1983-01-01

A low cost coating protects metallic base system substrates from high temperatures, high gas velocity ovidation, thermal fatigue and hot corrosion and is particularly useful fo protecting vanes and blades in aircraft and land based gas turbine engines. A lacquer slurry comprising cellulose nitrate containing high purity silicon powder is sprayed onto the superalloy substrates. The silicon layer is then aluminized to complete the coating. The Si-Al coating is less costly to produce than advanced aluminides and protects the substrates from oxidation and thermal fatigue for a much longer period of time than the conventional aluminide coatings. While more expensive Pt-Al coatings and physical vapor deposited MCrAlY coatings may last longer or provide equal protection on certain substrates, the Si-Al coating exceeded the performance of both types of coatings on certain superalloys in high gas velocity oxidation and thermal fatigue and increased the resistance of certain superalloys to hot corrosion.

High thermally stable Ni /Ag(Al) alloy contacts on p-GaN

NASA Astrophysics Data System (ADS)

Chou, C. H.; Lin, C. L.; Chuang, Y. C.; Bor, H. Y.; Liu, C. Y.

2007-01-01

Ag agglomeration was found to occur at Ni /Ag to p-GaN contacts after annealing at 500°C. This Ag agglomeration led to the poor thermal stability showed by the Ni /Ag contacts in relation to the reflectivity and electrical properties. However, after alloying with 10at.% Al by e-gun deposition, the Ni /Ag(Al) p-GaN contacts were found to effectively retard Ag agglomeration thereby greatly enhancing the thermal stability. Based on the x-ray photoelectron spectroscopy analysis, the authors believe that the key for the retardation of Ag agglomeration was the formation of ternary Al-Ni-O layer at p-GaN interface.

High thermally stable Ni/Ag(Al) alloy contacts on p-GaN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, C. H.; Lin, C. L.; Chuang, Y. C.

2007-01-08

Ag agglomeration was found to occur at Ni/Ag to p-GaN contacts after annealing at 500 degree sign C. This Ag agglomeration led to the poor thermal stability showed by the Ni/Ag contacts in relation to the reflectivity and electrical properties. However, after alloying with 10 at. % Al by e-gun deposition, the Ni/Ag(Al) p-GaN contacts were found to effectively retard Ag agglomeration thereby greatly enhancing the thermal stability. Based on the x-ray photoelectron spectroscopy analysis, the authors believe that the key for the retardation of Ag agglomeration was the formation of ternary Al-Ni-O layer at p-GaN interface.

A sensitive duplex nanoparticle-assisted PCR assay for identifying porcine epidemic diarrhea virus and porcine transmissible gastroenteritis virus from clinical specimens.

PubMed

Zhu, Yu; Liang, Lin; Luo, Yakun; Wang, Guihua; Wang, Chunren; Cui, Yudong; Ai, Xia; Cui, Shangjin

2017-02-01

In this study, a novel duplex nanoparticle-assisted polymerase chain reaction (nanoPCR) assay was developed to detect porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). Two pairs of primers were designed based on the conserved region within the N gene of PEDV and TGEV. In a screening of 114 clinical samples from four provinces in China for PEDV and TGEV, 48.2 and 3.5 % of the samples, respectively, tested positive. Under optimized conditions, the duplex nanoPCR assay had a detection limit of 7.6 × 10 1 and 8.5 × 10 1 copies μL -1 for PEDV and TGEV, respectively. The sensitivity of the duplex nanoPCR assay was ten times higher than that of a conventional PCR assay. Moreover, no fragments were amplified when the duplex nanoPCR assay was used to test samples containing other porcine viruses. Our results indicate that the duplex nanoPCR assay described here is useful for the rapid detection of PEDV and TGEV and can be applied in clinical diagnosis.

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed Central

Berressem, R; Engels, J W

1995-01-01

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed

Berressem, R; Engels, J W

1995-09-11

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.

Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

PubMed

Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

2015-10-12

A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

PubMed Central

Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

2014-01-01

Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

PubMed

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

2016-07-01

Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

Direct Determination of the Equilibrium Unbinding Potential Profile for a Short DNA Duplex from Force Spectroscopy Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noy, A

2004-05-04

Modern force microscopy techniques allow researchers to use mechanical forces to probe interactions between biomolecules. However, such measurements often happen in non-equilibrium regime, which precludes straightforward extraction of the equilibrium energy information. Here we use the work averaging method based on Jarzynski equality to reconstruct the equilibrium interaction potential from the unbinding of a complementary 14-mer DNA duplex from the results of non-equilibrium single-molecule measurements. The reconstructed potential reproduces most of the features of the DNA stretching transition, previously observed only in equilibrium stretching of long DNA sequences. We also compare the reconstructed potential with the thermodynamic parameters of DNAmore » duplex unbinding and show that the reconstruction accurately predicts duplex melting enthalpy.« less

Evaluation of thermal conductivity and flexural strength properties of poly(methyl methacrylate) denture base material reinforced with different fillers.

PubMed

Kul, Esra; Aladağ, Lütfü İhsan; Yesildal, Ruhi

2016-11-01

Poly(methyl methacrylate) (PMMA) is widely used in prosthodontics as a denture base material. However, it has several disadvantages, including low strength and low thermal conductivity. The purpose of this in vitro study was to evaluate thermal conductivity and flexural strength after adding powdered Ag, TiO 2 , ZrO 2 , Al 2 O 3 , SiC, SiC-nano, Si 3 N 4 , and HA-nano in ratios of 10 wt% to PMMA. A total of 144 specimens were fabricated and divided into 18 groups. Specimens were left in water for 30 days. Thermal conductivity values were measured using a heat flowmeter, flexural strength was measured with a 3-point bend test, and specimens were investigated with environmental scanning electron microscopy. One-way ANOVA was used to compare means followed by using Duncan multiple range test (α=.05). The thermal conductivity value of PMMA increased significantly after the addition of Si 3 N 4 , SiC, Al 2 O 3 , SiC-nano, TiO 2 , ZrO 2 , HA-nano, and Ag. Progressive increases in thermal conductivity were observed in Si 3 N 4 , SiC, and Al 2 O 3 fillers. Flexural strength values of the control group were not significantly different from those of the SiC, Al 2 O 3 , or Ag group (P>.05). In the other groups, flexural strength values decreased significantly (P<.05). On the basis of electron microscopy, we observed that Si 3 N 4 , SiC, and Al 2 O 3 powders had higher thermal conductivity values that are dissipated more homogeneously in PMMA. Although the addition of 10 wt% SiC, Al 2 O 3, and Ag powder to PMMA significantly increased thermal conductivity, the flexural strength values of PMMA were not significantly changed. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage

PubMed Central

Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan

2012-01-01

ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876

DNA octaplex formation with an I-motif of water-mediated A-quartets: reinterpretation of the crystal structure of d(GCGAAAGC).

PubMed

Sato, Yoshiteru; Mitomi, Kenta; Sunami, Tomoko; Kondo, Jiro; Takénaka, Akio

2006-12-01

The crystal structure of the tetragonal form of d(gcGAAAgc) has been revised and reasonably refined including the disordered residues. The two DNA strands form a base-intercalated duplex, and the four duplexes are assembled according to the crystallographic 222 symmetry to form an octaplex. In the central region, the eight strands are associated by I-motif of double A-quartets. Furthermore, eight hydrated-magnesium cations link the four duplexes to support the octaplex formation. Based on these structural features, a proposal that folding of d(GAAA)n, found in the non-coding region of genomes, into an octaplex can induce slippage during replication to facilitate length polymorphism is presented.

Reducing duplex examinations in patients with iatrogenic pseudoaneurysms.

PubMed

Stone, Patrick A; Aburahma, Ali F; Flaherty, Sarah K

2006-06-01

Ultrasound-guided thrombin injection has become the initial treatment of choice for femoral access-related pseudoaneurysms. Patients typically undergo serial duplex examinations to assess for spontaneous resolution of small iatrogenic pseudoaneurysms (IPSAs) (<2.5 cm), or may require repeated diagnostic, therapeutic, and follow-up studies for larger IPSAs (>2.5 cm). We evaluated the impact of a revised treatment algorithm that includes primary treatment of both small (<2.5 cm) and larger pseudoaneurysms (>2.5 cm), rather than observation of smaller ones, and attempts to establish a single duplex examination via a point-of-care treatment strategy. We reviewed 105 consecutive patients treated with ultrasound-guided thrombin injection from July 2001 through September 2004. Patient, IPSAs, characteristics, and treatment methods were examined. The number of duplex examinations per patient was evaluated over the treatment interval. Also, published cost data were used to compare primary treatment of small ISPAs vs observation with serial duplex examinations. Successful thrombosis occurred in 103 (98.1%) of 105 treated pseudoaneurysms. No minor or major complications occurred after thrombin injection in either small or large ISPAs, and both failures requiring operation were in the large aneurysm group. The recurrence rate for the series was 1.9% (2/105), and both recurrences were successfully treated with an additional thrombin injection. A single injection was successful in treating 43 (97.7%) of 44 small (<2.5 cm) IPSAs, and one required a second injection. Patients had an average of 3.3 duplex examinations in our first year of treatment experience, which declined to 1.5 by our third year with the institution of a point-of-care service model for all pseudoaneurysms. Based on this decreased use of duplex examination and an average treatment cohort of 35 IPSA patients per year our institution, we determined this results in a reduction of 35 hours of laboratory time and nearly 70 ultrasounds per year. Similarly for small pseudoaneurysms, a point-of-service primary treatment program rather than observation results in an estimated cost savings of $12,000, based on treating 15 small IPSAs per year. Ultrasound-guided thrombin injection is safe and effective for the treatment of nearly all iatrogenic pseudoaneurysms. We recommend primary treatment of small pseudoaneurysms by ultrasound-guided thrombin injection rather than observation with serial duplex scans. A point-of-care treatment algorithm can result in cost savings by reducing the number of necessary duplex examinations.

Intramolecular electrocatalysis of 8-oxo-guanine oxidation: secondary structure control of electron transfer in osmium-labeled oligonucleotides.

PubMed

Holmberg, Rebecca C; Tierney, Mark T; Ropp, Patricia A; Berg, Eric E; Grinstaff, Mark W; Thorp, H Holden

2003-10-06

A phosphoramidite containing Os(bpy)(3)(2+) (Os; bpy, 2,2'-bipyridine) with a three-carbon linker was synthesized and used to prepare oligonucleotides with the Os redox catalyst appended to the 5'-end. The electrogenerated Os(III) is capable of oxidizing 7,8-dihydro-8-oxo-guanine (8G), but 8G is not electrochemically reactive at indium tin oxide electrodes because of poor electrode kinetics for the direct reaction. The hairpin-forming oligonucleotide Os-5'-ATG TCA GAT TAG CAG GCC TGA CAT 8G was synthesized and characterized by thermal denaturation and native gel electrophoresis both in the hairpin form and when hybridized to its Watson-Crick complement. The redox potential in both forms of the appended Os(III/II) couple was 0.63 V (all potentials vs Ag/AgCl), which is identical to that for the free complex. The diffusion coefficients of the hairpin form (10.2 x 10(-)(7) cm(2)/s) and the duplex form (8.7 x 10(-)(7) cm(2)/s) were consistent with values expected from studies of noncovalently bound redox labels, which suggest that the measured diffusion coefficient should be that of the appended DNA molecule. The oligonucleotide was designed such that in the duplex form, the 8G is far from the Os(III/II) couple, but in the hairpin form, the 8G is situated close to the redox center. For the duplex form, cyclic voltammetry studies showed that mediated oxidation of the 8G nucleobase occurred only through bimolecular reaction of the electrogenerated Os(III) of one duplex with the 8G of another duplex. However, in the hairpin form, intramolecular electron transfer from 8G to Os(III) in the same molecule was apparent in both chronoamperometry and cyclic voltammetry.

Molecular architecture: construction of self-assembled organophosphonate duplexes and their electrochemical characterization.

PubMed

Cattani-Scholz, Anna; Liao, Kung-Ching; Bora, Achyut; Pathak, Anshuma; Hundschell, Christian; Nickel, Bert; Schwartz, Jeffrey; Abstreiter, Gerhard; Tornow, Marc

2012-05-22

Self-assembled monolayers of phosphonates (SAMPs) of 11-hydroxyundecylphosphonic acid, 2,6-diphosphonoanthracene, 9,10-diphenyl-2,6-diphosphonoanthracene, and 10,10'-diphosphono-9,9'-bianthracene and a novel self-assembled organophosphonate duplex ensemble were synthesized on nanometer-thick SiO(2)-coated, highly doped silicon electrodes. The duplex ensemble was synthesized by first treating the SAMP prepared from an aromatic diphosphonic acid to form a titanium complex-terminated one; this was followed by addition of a second equivalent of the aromatic diphosphonic acid. SAMP homogeneity, roughness, and thickness were evaluated by AFM; SAMP film thickness and the structural contributions of each unit in the duplex were measured by X-ray reflection (XRR). The duplex was compared with the aliphatic and aromatic monolayer SAMPs to determine the effect of stacking on electrochemical properties; these were measured by impedance spectroscopy using aqueous electrolytes in the frequency range 20 Hz to 100 kHz, and data were analyzed using resistance-capacitance network based equivalent circuits. For the 11-hydroxyundecylphosphonate SAMP, C(SAMP) = 2.6 ± 0.2 μF/cm(2), consistent with its measured layer thickness (ca. 1.1 nm). For the anthracene-based SAMPs, C(SAMP) = 6-10 μF/cm(2), which is attributed primarily to a higher effective dielectric constant for the aromatic moieties (ε = 5-10) compared to the aliphatic one; impedance spectroscopy measured the additional capacitance of the second aromatic monolayer in the duplex (2ndSAMP) to be C(Ti/2ndSAMP) = 6.8 ± 0.7 μF/cm(2), in series with the first.

Development of a Duplex Ultrasound Simulator and Preliminary Validation of Velocity Measurements in Carotid Artery Models.

PubMed

Zierler, R Eugene; Leotta, Daniel F; Sansom, Kurt; Aliseda, Alberto; Anderson, Mark D; Sheehan, Florence H

2016-07-01

Duplex ultrasound scanning with B-mode imaging and both color Doppler and Doppler spectral waveforms is relied upon for diagnosis of vascular pathology and selection of patients for further evaluation and treatment. In most duplex ultrasound applications, classification of disease severity is based primarily on alterations in blood flow velocities, particularly the peak systolic velocity (PSV) obtained from Doppler spectral waveforms. We developed a duplex ultrasound simulator for training and assessment of scanning skills. Duplex ultrasound cases were prepared from 2-dimensional (2D) images of normal and stenotic carotid arteries by reconstructing the common carotid, internal carotid, and external carotid arteries in 3 dimensions and computationally simulating blood flow velocity fields within the lumen. The simulator displays a 2D B-mode image corresponding to transducer position on a mannequin, overlaid by color coding of velocity data. A spectral waveform is generated according to examiner-defined settings (depth and size of the Doppler sample volume, beam steering, Doppler beam angle, and pulse repetition frequency or scale). The accuracy of the simulator was assessed by comparing the PSV measured from the spectral waveforms with the true PSV which was derived from the computational flow model based on the size and location of the sample volume within the artery. Three expert examiners made a total of 36 carotid artery PSV measurements based on the simulated cases. The PSV measured by the examiners deviated from true PSV by 8% ± 5% (N = 36). The deviation in PSV did not differ significantly between artery segments, normal and stenotic arteries, or examiners. To our knowledge, this is the first simulation of duplex ultrasound that can create and display real-time color Doppler images and Doppler spectral waveforms. The results demonstrate that an examiner can measure PSV from the spectral waveforms using the settings on the simulator with a mean absolute error in the velocity measurement of less than 10%. With the addition of cases with a range of pathologies, this duplex ultrasound simulator will be a useful tool for training health-care providers in vascular ultrasound applications and for assessing their skills in an objective and quantitative manner. © The Author(s) 2016.

Thermal conductivity and viscosity measurements of ethylene glycol-based Al2O3 nanofluids

NASA Astrophysics Data System (ADS)

Pastoriza-Gallego, María José; Lugo, Luis; Legido, José Luis; Piñeiro, Manuel M.

2011-12-01

The dispersion and stability of nanofluids obtained by dispersing Al2O3 nanoparticles in ethylene glycol have been analyzed at several concentrations up to 25% in mass fraction. The thermal conductivity and viscosity were experimentally determined at temperatures ranging from 283.15 K to 323.15 K using an apparatus based on the hot-wire method and a rotational viscometer, respectively. It has been found that both thermal conductivity and viscosity increase with the concentration of nanoparticles, whereas when the temperature increases the viscosity diminishes and the thermal conductivity rises. Measured enhancements on thermal conductivity (up to 19%) compare well with literature values when available. New viscosity experimental data yield values more than twice larger than the base fluid. The influence of particle size on viscosity has been also studied, finding large differences that must be taken into account for any practical application. These experimental results were compared with some theoretical models, as those of Maxwell-Hamilton and Crosser for thermal conductivity and Krieger and Dougherty for viscosity.

The tectono-thermal evolution of the Waterbury dome, western Connecticut, based on U-Pb and 40Ar/39Ar ages

USGS Publications Warehouse

Dietsch, Craig; Kunk, Michael J.; Aleinikoff, John; Sutter, John F.

2010-01-01

Level 3 nappes were emplaced over the Waterbury dome along an Acadian décollement synchronous with the formation of a D3 thrust duplex in the dome. The décollement truncates the Ky + Kfs-in (migmatite) isograd in the dome core and a St-in isograd in level 3 nappes, indicating that peak metamorphic conditions in the dome core and nappe cover rocks formed in different places at different times. Metamorphic overgrowths on zircon from the felsic orthogneiss in the Waterbury dome have an age of 387 ± 5 Ma. Rocks of all levels and the décollement are folded by D4 folds that have a strongly developed, regional crenulation cleavage and D5 folds. The Waterbury dome was formed by thrust duplexing followed by fold interference during the Acadian orogeny. The 40Ar/39Ar ages of amphibole, muscovite, biotite, and K-feldspar from above and below the décollement are ca. 378 Ma, 355 Ma, 360 Ma (above) and 340 (below), and 288 Ma, respectively. Any kilometer-scale vertical movements between dome and nappe rocks were over by ca. 378 Ma. Core and cover rocks of the Waterbury dome record synchronous, post-Acadian cooling.

Thermophysical properties of heat-treated U-7Mo/Al dispersion fuel

NASA Astrophysics Data System (ADS)

Cho, Tae Won; Kim, Yeon Soo; Park, Jong Man; Lee, Kyu Hong; Kim, Sunghwan; Lee, Chong Tak; Yang, Jae Ho; Oh, Jang Soo; Sohn, Dong-Seong

2018-04-01

In this study, the effects of interaction layer (IL) on thermophysical properties of U-7Mo/Al dispersion fuel were examined. Microstructural analyses revealed that ILs were formed uniformly on U-Mo particles during heating of U-7Mo/Al samples. The IL volume fraction was measured by applying image analysis methods. The uranium loadings of the samples were calculated based on the measured meat densities at 298 K. The density of the IL was estimated by using the measured density and IL volume fraction. Thermal diffusivity and heat capacity of the samples after the heat treatment were measured as a function of temperature and volume fractions of U-Mo and IL. The thermal conductivity of IL-formed U-7Mo/Al was derived by using the measured thermal diffusivity, heat capacity, and density. The thermal conductivity obtained in the present study was lower than that predicted by the modified Hashin-Shtrikman model due to the theoretical model's inability to consider the thermal resistance at interfaces between the meat constituents.

Evaluation of Surface Modification as a Lunar Dust Mitigation Strategy for Thermal Control Surfaces

NASA Technical Reports Server (NTRS)

Gaier, James R.; Waters, Deborah L.; Misconin, Robert M.; Banks, Bruce A.; Crowder, Mark

2011-01-01

Three surface treatments were evaluated for their ability to lower the adhesion between lunar simulant dust and AZ93, AlFEP, and AgFEP thermal control surfaces under simulated lunar conditions. Samples were dusted in situ and exposed to a standardized puff of nitrogen gas. Thermal performance before dusting, after dusting, and after part of the dust was removed by the puff of gas, were compared to perform the assessment. None of the surface treatments was found to significantly affect the adhesion of lunar simulants to AZ93 thermal control paint. Oxygen ion beam texturing also did not lower the adhesion of lunar simulant dust to AlFEP or AgFEP. But a workfunction matching coating and a proprietary Ball Aerospace surface treatment were both found to significantly lower the adhesion of lunar simulants to AlFEP and AgFEP. Based on these results, it is recommended that all these two techniques be further explored as dust mitigation coatings for AlFEP and AgFEP thermal control surfaces.

Cross-plane thermal conductivity of (Ti,W)N/(Al,Sc)N metal/semiconductor superlattices

NASA Astrophysics Data System (ADS)

Saha, Bivas; Koh, Yee Rui; Comparan, Jonathan; Sadasivam, Sridhar; Schroeder, Jeremy L.; Garbrecht, Magnus; Mohammed, Amr; Birch, Jens; Fisher, Timothy; Shakouri, Ali; Sands, Timothy D.

2016-01-01

Reduction of cross-plane thermal conductivity and understanding of the mechanisms of heat transport in nanostructured metal/semiconductor superlattices are crucial for their potential applications in thermoelectric and thermionic energy conversion devices, thermal management systems, and thermal barrier coatings. We have developed epitaxial (Ti,W)N/(Al,Sc)N metal/semiconductor superlattices with periodicity ranging from 1 nm to 240 nm that show significantly lower thermal conductivity compared to the parent TiN/(Al,Sc)N superlattice system. The (Ti,W)N/(Al,Sc)N superlattices grow with [001] orientation on the MgO(001) substrates with well-defined coherent layers and are nominally single crystalline with low densities of extended defects. Cross-plane thermal conductivity (measured by time-domain thermoreflectance) decreases with an increase in the superlattice interface density in a manner that is consistent with incoherent phonon boundary scattering. Thermal conductivity values saturate at 1.7 W m-1K-1 for short superlattice periods possibly due to a delicate balance between long-wavelength coherent phonon modes and incoherent phonon scattering from heavy tungsten atomic sites and superlattice interfaces. First-principles density functional perturbation theory based calculations are performed to model the vibrational spectrum of the individual component materials, and transport models are used to explain the interface thermal conductance across the (Ti,W)N/(Al,Sc)N interfaces as a function of periodicity. The long-wavelength coherent phonon modes are expected to play a dominant role in the thermal transport properties of the short-period superlattices. Our analysis of the thermal transport properties of (Ti,W)N/(Al,Sc)N metal/semiconductor superlattices addresses fundamental questions about heat transport in multilayer materials.

Dynamic Recrystallization Behavior and Corrosion Resistance of a Dual-Phase Mg-Li Alloy

PubMed Central

Liu, Gang; Xie, Wen; Wei, Guobing; Yang, Yan; Liu, Junwei; Xu, Tiancai; Xie, Weidong; Peng, Xiaodong

2018-01-01

The hot deformation and dynamic recrystallization behavior of the dual-phase Mg-9Li-3Al-2Sr-2Y alloy had been investigated using a compression test. The typical dual-phase structure was observed, and average of grain size of as-homogenized alloy is about 110 µm. It mainly contains β-Li, α-Mg, Al4Sr and Al2Y phases. The dynamic recrystallization (DRX) kinetic was established based on an Avrami type equation. The onset of the DRX process occurred before the peak of the stress–strain flow curves. It shows that the DRX volume fraction increases with increasing deformation temperature or decreasing strain rate. The microstructure evolution during the hot compression at various temperatures and strain rates had been investigated. The DRX grain size became larger with the increasing testing temperature or decreasing strain rate because the higher temperature or lower strain rate can improve the migration of DRX grain boundaries. The fully recrystallized microstructure can be achieved in a small strain due to the dispersed island-shape α-Mg phases, continuous the Al4Sr phases and spheroidal Al2Y particles, which can accelerate the nucleation. The continuous Al4Sr phases along the grain boundaries are very helpful for enhancing the corrosion resistance of the duplex structured Mg-Li alloy, which can prevent the pitting corrosion and filiform corrosion. PMID:29522473

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

AlN Surface Passivation of GaN-Based High Electron Mobility Transistors by Plasma-Enhanced Atomic Layer Deposition.

PubMed

Tzou, An-Jye; Chu, Kuo-Hsiung; Lin, I-Feng; Østreng, Erik; Fang, Yung-Sheng; Wu, Xiao-Peng; Wu, Bo-Wei; Shen, Chang-Hong; Shieh, Jia-Ming; Yeh, Wen-Kuan; Chang, Chun-Yen; Kuo, Hao-Chung

2017-12-01

We report a low current collapse GaN-based high electron mobility transistor (HEMT) with an excellent thermal stability at 150 °C. The AlN was grown by N 2 -based plasma enhanced atomic layer deposition (PEALD) and shown a refractive index of 1.94 at 633 nm of wavelength. Prior to deposit AlN on III-nitrides, the H 2 /NH 3 plasma pre-treatment led to remove the native gallium oxide. The X-ray photoelectron spectroscopy (XPS) spectroscopy confirmed that the native oxide can be effectively decomposed by hydrogen plasma. Following the in situ ALD-AlN passivation, the surface traps can be eliminated and corresponding to a 22.1% of current collapse with quiescent drain bias (V DSQ ) at 40 V. Furthermore, the high temperature measurement exhibited a shift-free threshold voltage (V th ), corresponding to a 40.2% of current collapse at 150 °C. The thermal stable HEMT enabled a breakdown voltage (BV) to 687 V at high temperature, promising a good thermal reliability under high power operation.

Duplex/quadruplex oligonucleotides: Role of the duplex domain in the stabilization of a new generation of highly effective anti-thrombin aptamers.

PubMed

Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena

2018-02-01

Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.

Nominal Versus Local Shot-Peening Effects on Fatigue Lifetime in Ti-6Al-2Sn-4Zr-6Mo at Elevated Temperature (Preprint)

DTIC Science & Technology

2008-09-01

this study was the α+β titanium alloy, Ti- 6 -2- 4 - 6 , in the duplex microstructural condition. Two variants of the microstructure, which differed...condition, at a given stress level and temperature in the turbine engine alloy, Ti-6Al-2Sn-4Zr-6Mo (Ti- 6 -2- 4 - 6 ). The experimental conditions were chosen to...LSG surface. Fig. 1: Microstructures of the Ti- 6 -2- 4 - 6 alloy considered in the study; (a) Microstructure A and (b) Microstructure

Microstructure and corrosion behavior of shielded metal arc-welded dissimilar joints comprising duplex stainless steel and low alloy steel

NASA Astrophysics Data System (ADS)

Srinivasan, P. Bala; Muthupandi, V.; Sivan, V.; Srinivasan, P. Bala; Dietzel, W.

2006-12-01

This work describes the results of an investigation on a dissimilar weld joint comprising a boiler-grade low alloy steel and duplex stainless steel (DSS). Welds produced by shielded metal arc-welding with two different electrodes (an austenitic and a duplex grade) were examined for their microstructural features and properties. The welds were found to have overmatching mechanical properties. Although the general corrosion resistance of the weld metals was good, their pitting resistance was found to be inferior when compared with the DSS base material.

The energetic basis of the DNA double helix: a combined microcalorimetric approach

PubMed Central

Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.

2015-01-01

Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541

A 2',2'-disulfide-bridged dinucleotide conformationally locks RNA hairpins.

PubMed

Gauthier, Florian; Beltran, Frédéric; Biscans, Annabelle; Debart, Françoise; Dupouy, Christelle; Vasseur, Jean-Jacques

2018-05-02

The synthesis and the impact of a disulfide bridge between 2'-O-positions of two adjacent nucleotides in an RNA duplex and in the loop of RNA hairpins are reported. The incorporation of this 2',2'-disulfide (S-S) bridge enabled thermal and enzymatic stabilization of the hairpin depending on its position in the loop. The influence of the disulfide bridge on RNA folding was studied at the HIV Dimerization Initiation Site (DIS) as an RNA sequence model. We have shown that this S-S bridge locked the hairpin form, whereas the extended duplex form was generated after the reduction of the disulfide bond in the presence of tris(2-carboxyethyl)phosphine or glutathione. Thus, the S-S bridge can be useful for understanding RNA folding; an RNA molecular beacon locked by an S-S bridge was also investigated as a sensor for the detection of glutathione.

Design under Constraints: The Case of Large-Scale Assessment Systems

ERIC Educational Resources Information Center

Mislevy, Robert J.

2010-01-01

In "Updating the Duplex Design for Test-Based Accountability in the Twenty-First Century," Bejar and Graf (2010) propose extensions to the duplex design for large-scale assessment presented in Bock and Mislevy (1988). Examining the range of people who use assessment results--from students, teachers, administrators, curriculum designers,…

Duplex Design Project: Science Pilot Test.

ERIC Educational Resources Information Center

Center for Research on Evaluation, Standards, and Student Testing, Los Angeles, CA.

Work is reported towards the completion of a prototype duplex-design assessment instrument for grade-12 science. The student course-background questionnaire and the pretest section of the two-stage instrument that was developed were administered to all 134 12th-grade students at St. Clairsville High School (Ohio). Based on the information obtained…

Pyrrolo-dC modified duplex DNA as a novel probe for the sensitive assay of base excision repair enzyme activity.

PubMed

Lee, Chang Yeol; Park, Ki Soo; Park, Hyun Gyu

2017-12-15

We develop a novel approach to determine formamidopyrimidine DNA glycosylase (Fpg) activity by taking advantage of the unique fluorescence property of pyrrolo-dC (PdC) positioned opposite to 8-oxoguanine (8-oxoG) in duplex DNA. In its initial state, PdC in duplex DNA undergoes the efficient stacking and collisional quenching interactions, showing the low fluorescence signal. In contrast, the presence of Fpg, which specifically removes 8-oxoG and incises resulting apurinic (AP) site, transforms duplex DNA into single-stranded (ss) DNAs. As a result, the intrinsic fluorescence signal of PdC in ssDNA is recovered to exhibit the significantly enhanced fluorescence signal. Based on this Fpg-dependent fluorescence response of PdC, we could reliably determine Fpg activity down to 1.25U/ml with a linear response from 0 to 50U/ml. In addition, the diagnostic capability of this strategy was successfully demonstrated by reliably assaying Fpg activity in human blood serum, showing its great potential in the practical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

No Radiative Heat Transport Through Pyrolitic Lower Mantle

NASA Astrophysics Data System (ADS)

Lobanov, S.; Holtgrewe, N.; Badro, J.; Goncharov, A. F.

2017-12-01

Transport properties of the lower mantle, such as its thermal conductivity, are key parameters required to understand the nature and dynamics of the core-mantle boundary (CMB) region. Radiative thermal conductivity (krad) of the mantle is determined by its visible-infrared absorption coefficient (α) at high pressure (P) and temperature (T). The latter is highly uncertain at the CMB conditions as optical measurements at high temperature suffer from intense thermal radiation that diminishes the probe contrast. Room-temperature high-pressure studies of bridgmanite and ferropericlase absorption coefficients suggest a steady increase of mantle radiative conductivity with depth mirroring the temperature increase along the geotherm (Goncharov et al., 2008; Keppler et al., 2008). Here we reconstruct optical properties of the mantle as a function of depth by using fast time-resolved spectroscopic technology combined with laser-heated diamond anvil cells. We found a strong increase in the rock absorption coefficient upon heating to 3000 K at 40-135 GPa. Using the pressure- and temperature-dependent pyrolite absorption coefficient we establish that lower mantle radiative thermal conductivity is decreasing with depth from 0.35 W/m/K at 1000 km to 0.15 W/m/K at the CMB, making it 50 times smaller than the corresponding lattice thermal conductivity at such conditions (Ohta et al., 2017; Okuda et al., 2017). Combining our results with models of lattice thermal conductivity in pyrolitic lower mantle we obtain a CMB heat flow of 8.5 TW. This estimate implies an inner core age of 0.7-1.3 Gy and favors a low-to-moderate core thermal conductivity (< 80 W/m/K). A core with higher thermal conductivity (Ohta et al., 2016; Pozzo et al., 2012) would be thermally stratified, halting a thermally driven dynamo prior to the inner core growth, if no other mechanism is invoked, such as MgO (Badro et al., 2016) or SiO2 (Hirose et al., 2017) exsolution. On the other hand, the low iron thermal conductivity scenario (Konopkova et al., 2016) combined with our model of low thermal conductivity at the base of the mantle, suggests that core convection could have taken place prior to inner core growth whether sources of chemical buoyancy were present or not.

Review of Research Work on Ti-BASED Composite Coatings

NASA Astrophysics Data System (ADS)

Gabbitas, Brian; Salman, Asma; Zhang, Deliang; Cao, Peng

The service life of industrial components is limited predominantly by Chemical corrosion/mechanical wear. The project is concerned with the investigation of the capability of Ti(Al,O)/Al2O3 coatings to improve the service life of tool steel (H13) used for dies in aluminium high pressure die casting. This paper gives a general review on the research work conducted at the University of Waikato on producing and evaluating the titanium/alumina based composite coatings. The powder feedstocks for making the composite coatings were produced by high energy mechanical milling of a mixture of Al and TiO2 powders in two different molar ratios followed by a thermal reaction process. The feedstocks were then thermally sprayed using a high velocity air-fuel (HVAF) technique on H13 steel substrates to produce a Ti(Al,O)/Al2O3 composite coatings. The performance of the coating was assessed in terms of thermal shock resistance and reaction kinetics with molten aluminium. The composite powders and coatings were characterized using scanning electron microscopy (SEM), optical microscopy and X-ray diffractometry (XRD).

Metallic seal for thermal barrier coating systems

NASA Technical Reports Server (NTRS)

Miller, Robert A. (Inventor)

1990-01-01

The invention is particularly concerned with sealing thermal barrier coating systems of the type in use and being contemplated for use in diesel and other internal combustion engines. The invention also would find application in moderately high temperature regions of gas turbine engines and any other application employing a thermal barrier coating at moderate temperatures. Ni-35Cr-6Al-1Y, Ni-35Cr-6Al-1Yb, or other metallic alloy denoted as MCrAlx is applied over a zirconia-based thermal barrier overlayer. The close-out layer is glass-bead preened to densify its surface. This seals and protects the thermal barrier coating system.

Advantages of MgAlOx over gamma-Al2O3 as a support material for potassium-based high temperature lean NOx traps

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, Jinyong; Gao, Feng; Karim, Ayman M.

MgAlOx mixed oxides were employed as supports for potassium-based lean NOx traps (LNTs) targeted for high temperature applications. Effects of support compositions, K/Pt loadings, thermal aging and catalyst regeneration on NOx storage capacity were systematically investigated. The catalysts were characterized by XRD, NOx-TPD, TEM, STEM-HAADF and in-situ XAFS. The results indicate that MgAlOx mixed oxides have significant advantages over conventional gamma-Al2O3-supports for LNT catalysts, in terms of high temperature NOx trapping capacity and thermal stability. First, as a basic support, MgAlOx stabilizes stored nitrates (in the form of KNO3) to much higher temperatures than mildly acidic gamma-Al2O3. Second, MgAlOx minimizesmore » Pt sintering during thermal aging, which is not possible for gamma-Al2O3 supports. Notably, combined XRD, in-situ XAFS and STEM-HAADF results indicate that Pt species in the thermally aged Pt/MgAlOx samples are finely dispersed in the oxide matrix as isolated atoms. This strong metal-support interaction stabilizes Pt and minimizes the extent of sintering. However, such strong interactions result in Pt oxidation via coordination with the support so that NO oxidation activity can be adversely affected after aging which, in turn, decreases NOx trapping ability for these catalysts. Interestingly, a high-temperature reduction treatment regenerates essentially full NOx trapping performance. In fact, regenerated Pt/K/MgAlOx catalyst exhibits much better NOx trapping performance than fresh Pt/K/Al2O3 LNTs over the entire temperature range investigated here. In addition to thermal aging, Pt/K loading effects were systemically studied over the fresh samples. The results indicate that NOx trapping is kinetically limited at low temperatures, while thermodynamically limited at high temperatures. A simple conceptual model was developed to explain the Pt and K loading effects on NOx storage. An optimized K loading, which allows balancing between the stability of nitrates and exposed Pt surface, gives the best NOx trapping capability.« less

A physics-based crystallographic modeling framework for describing the thermal creep behavior of Fe-Cr alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wen, Wei; Capolungo, Laurent; Patra, Anirban

This Report addresses the Milestone M2MS-16LA0501032 of NEAMS Program (“Develop hardening model for FeCrAl cladding), with a deadline of 09/30/2016. Here we report a constitutive law for thermal creep of FeCrAl. This Report adds to and complements the one for Milestone M3MS-16LA0501034 (“Interface hardening models with MOOSE-BISON”), where we presented a hardening law for irradiated FeCrAl. The last component of our polycrystal-based constitutive behavior, namely, an irradiation creep model for FeCrAl, will be developed as part of the FY17 Milestones, and the three regimes will be coupled and interfaced with MOOSE-BISON.

Base-displaced intercalation of the 2-amino-3-methylimidazo[4,5-f]quinolone N2-dG adduct in the NarI DNA recognition sequence

PubMed Central

Stavros, Kallie M.; Hawkins, Edward K.; Rizzo, Carmelo J.; Stone, Michael P.

2014-01-01

2-Amino-3-methylimidazo[4,5-f]quinolone (IQ), a heterocyclic amine found in cooked meats, undergoes bioactivation to a nitrenium ion, which alkylates guanines at both the C8-dG and N2-dG positions. The conformation of a site-specific N2-dG-IQ adduct in an oligodeoxynucleotide duplex containing the iterated CG repeat restriction site of the NarI endonuclease has been determined. The IQ moiety intercalates, with the IQ H4a and CH3 protons facing the minor groove, and the IQ H7a, H8a and H9a protons facing the major groove. The adducted dG maintains the anti-conformation about the glycosyl bond. The complementary dC is extruded into the major groove. The duplex maintains its thermal stability, which is attributed to stacking between the IQ moiety and the 5′- and 3′-neighboring base pairs. This conformation is compared to that of the C8-dG-IQ adduct in the same sequence, which also formed a ‘base-displaced intercalated’ conformation. However, the C8-dG-IQ adopted the syn conformation placing the Watson−Crick edge of the modified dG into the major groove. In addition, the C8-dG-IQ adduct was oriented with the IQ CH3 group and H4a and H5a facing the major groove. These differences may lead to differential processing during DNA repair and replication. PMID:24366876

Full-duplex lightwave transport systems based on long-haul SMF and optical free-space transmissions.

PubMed

Chen, Chia-Yi; Lu, Hai-Han; Lin, Ying-Pyng; Wu, Po-Yi; Wu, Kuan-Hung; Yaug, Wei-Yuan

2013-10-07

A full-duplex lightwave transport system employing wavelength-division-multiplexing (WDM) and optical add-drop multiplexing techniques, as well as optical free-space transmission scheme is proposed and experimentally demonstrated. Over an 80-km single-mode fiber (SMF) and 2.4 m optical free-space transmissions, impressive bit error rate (BER) performance is obtained for long-haul fiber link and finite free-space transmission distance. Such a full-duplex lightwave transport system based on long-haul SMF and optical free-space transmissions has been successfully demonstrated, which cannot only present its advancement in lightwave application, but also reveal its simplicity and convenience for the real implementation. Our proposed systems are suitable for the lightwave communication systems in wired and wireless transmissions.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Architecture Studies Done for High-Rate Duplex Direct Data Distribution (D4) Services

NASA Technical Reports Server (NTRS)

2002-01-01

A study was sponsored to investigate a set of end-to-end system concepts for implementing a high-rate duplex direct data distribution (D4) space-to-ground communications link. The NASA Glenn Research Center is investigating these systems (both commercial and Government) as a possible method of providing a D4 communications service between NASA spacecraft in low Earth orbit and the respective principal investigators using or monitoring instruments aboard these spacecraft. Candidate commercial services were assessed regarding their near-term potential to provide a D4 type of service. The candidates included K-band and V-band geostationary orbit and nongeostationary orbit satellite relay services and direct downlink (D3) services. Internet protocol (IP) networking technologies were evaluated to enable the user-directed distribution and delivery of science data. Four realistic, near-future concepts were analyzed: 1) A duplex direct link (uplink plus downlink communication paths) between a low-Earth-orbit spacecraft and a principal-investigator-based autonomous Earth station; 2) A space-based relay using a future K-band nongeosynchronous-orbit system to handle both the uplink and downlink communication paths; 3) A hybrid link using both direct and relay services to achieve full duplex capability; 4) A dual-mode concept consisting of both a duplex direct link and a space relay duplex link operating independently. The concepts were analyzed in terms of contact time between the NASA spacecraft and the communications service and the achievable data throughput. Throughput estimates for the D4 systems were based on the infusion of advanced communications technology products (single and multibeam K-band phased-arrays and digital modems) being developed by Glenn. Cost estimates were also performed using extrapolated information from both terrestrial and current satellite communications providers. The throughput and cost estimates were used to compare the concepts.

Ti/C-3Ni/Al as a Replacement Time Delay Composition

DTIC Science & Technology

2013-11-07

of a radial thermal barrier, and by changing the microchannel diameter (3.0– 6.0 mm) and material (aluminum, stainless steel , quartz). Ex- perimental...T3 aluminum (Al) or 304L stainless steel (SS). Dimen- sions were selected so that the thermal mass (heat capaci- ty) of the Al channels was the same...KClO4/diatomaceous earth) are needed due to recent concerns over the toxicity of hex- avalent chromium and perchlorates. Systems based on con- densed

Value of delayed duplex ultrasound assessment after endothermal ablation of the great saphenous vein.

PubMed

Ryer, Evan J; Elmore, James R; Garvin, Robert P; Cindric, Matthew C; Dove, James T; Kekulawela, Stephanie; Franklin, David P

2016-08-01

Endothermal ablation (ETA) of the great saphenous vein (GSV) is associated with a small but definite risk of endothermal heat-induced thrombosis (EHIT) extending into the common femoral vein. Follow-up duplex ultrasound imaging to detect EHIT after ETA is considered standard of care, although the exact timing of duplex ultrasound imaging to detect EHIT after ETA remains unclear. We hypothesized that an additional duplex ultrasound assessment 1 week after ETA would not identify a significant number of patients with EHIT and would significantly increase health care costs. This was a retrospective review of consecutive ETA GSV procedures from 2007 to 2014. All patients were evaluated with duplex ultrasound imaging on postprocedure day 1, and 79% of patients underwent a second ultrasound assessment 1 week postprocedure. EHIT was considered present when proximal GSV closure progressed to level ≥4, based on a six-tier classification system. From January 1, 2007, until December 31, 2014, 842 patients underwent GSV ETA. Patients with EHIT were more likely to have had a prior deep venous thrombosis (DVT; P = .002) and a larger GSV (P = .006). Forty-three procedures (5.1%) were classified as having EHIT requiring anticoagulation, based on a level ≥4 proximal closure level. Of the 43 patients with EHIT, 20 (47%) were found on the initial ultrasound assessment performed 24 hours postprocedure, but 19 patients (44%) with EHIT would not have been identified with a single postoperative ultrasound scan performed 24 hours after intervention. These 19 patients had a level ≤3 closure level at the duplex ultrasound scan performed 24 hours postprocedure and progressed to EHIT on the delayed duplex ultrasound scan. Lastly, thrombotic complications in four patients (9%), representing three late DVT and one DVT/pulmonary embolism presenting to another hospital, would not have been identified regardless of the postoperative surveillance strategy. Maximum GSV diameter was the only significant predictor of progression to EHIT on multivariate analysis (P = .007). Based on 2014 United States dollars, the two-ultrasound surveillance paradigm is associated with health care charges of $31,109 per identified delayed venous thromboembolism event. Delayed duplex ultrasound assessment after ETA of the GSV comes with associated health care costs but does yield a significant number of patients with progression to EHIT. Better understanding of the timing, risk factors, and significance of EHIT is needed to cost-effectively care for patients after ETA for varicose veins. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Internal Carotid Artery Hypoplasia: Role of Color-Coded Carotid Duplex Sonography.

PubMed

Chen, Pei-Ya; Liu, Hung-Yu; Lim, Kun-Eng; Lin, Shinn-Kuang

2015-10-01

The purpose of this study was to determine the role of color-coded carotid duplex sonography for diagnosis of internal carotid artery hypoplasia. We retrospectively reviewed 25,000 color-coded carotid duplex sonograms in our neurosonographic database to establish more diagnostic criteria for internal carotid artery hypoplasia. A definitive diagnosis of internal carotid artery hypoplasia was made in 9 patients. Diagnostic findings on color-coded carotid duplex imaging include a long segmental small-caliber lumen (52% diameter) with markedly decreased flow (13% flow volume) in the affected internal carotid artery relative to the contralateral side but without intraluminal lesions. Indirect findings included markedly increased total flow volume (an increase of 133%) in both vertebral arteries, antegrade ipsilateral ophthalmic arterial flow, and a reduced vessel diameter with increased flow resistance in the ipsilateral common carotid artery. Ten patients with distal internal carotid artery dissection showed a similar color-coded duplex pattern, but the reductions in the internal and common carotid artery diameters and increase in collateral flow from the vertebral artery were less prominent than those in hypoplasia. The ipsilateral ophthalmic arterial flow was retrograde in 40% of patients with distal internal carotid artery dissection. In addition, thin-section axial and sagittal computed tomograms of the skull base could show the small diameter of the carotid canal in internal carotid artery hypoplasia and help distinguish hypoplasia from distal internal carotid artery dissection. Color-coded carotid duplex sonography provides important clues for establishing a diagnosis of internal carotid artery hypoplasia. A hypoplastic carotid canal can be shown by thin-section axial and sagittal skull base computed tomography to confirm the final diagnosis. © 2015 by the American Institute of Ultrasound in Medicine.

Characterization of microstructure and texture across dissimilar super duplex/austenitic stainless steel weldment joint by super duplex filler metal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eghlimi, Abbas, E-mail: a.eghlimi@ma.iut.ac.ir; Shamanian, Morteza; Eskandarian, Masoomeh

In the present paper, microstructural changes across an as-welded dissimilar austenitic/duplex stainless steel couple welded by a super duplex stainless steel filler metal using gas tungsten arc welding process is characterized with optical microscopy and electron back-scattered diffraction techniques. Accordingly, variations of microstructure, texture, and grain boundary character distribution of base metals, heat affected zones, and weld metal were investigated. The results showed that the weld metal, which was composed of Widmanstätten austenite side-plates and allotriomorphic grain boundary austenite morphologies, had the weakest texture and was dominated by low angle boundaries. The welding process increased the ferrite content but decreasedmore » the texture intensity at the heat affected zone of the super duplex stainless steel base metal. In addition, through partial ferritization, it changed the morphology of elongated grains of the rolled microstructure to twinned partially transformed austenite plateaus scattered between ferrite textured colonies. However, the texture of the austenitic stainless steel heat affected zone was strengthened via encouraging recrystallization and formation of annealing twins. At both interfaces, an increase in the special character coincident site lattice boundaries of the primary phase as well as a strong texture with <100> orientation, mainly of Goss component, was observed. - Graphical abstract: Display Omitted - Highlights: • Weld metal showed local orientation at microscale but random texture at macroscale. • Intensification of <100> orientated grains was observed adjacent to the fusion lines. • The austenite texture was weaker than that of the ferrite in all duplex regions. • Welding caused twinned partially transformed austenites to form at SDSS HAZ. • At both interfaces, the ratio of special CSL boundaries of the primary phase increased.« less

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

PubMed

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A6:T7 basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2'-deoxyaristeromycin moiety, A6, as a result of substitution of the endocyclic 4'-oxygen in the natural sugar with a methylene group in A6. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in alpha, sigma and gamma torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.

Enhancement of thermal transport in Gel Polymer Electrolytes with embedded BN/Al2O3 nano- and micro-particles

NASA Astrophysics Data System (ADS)

Vishwakarma, Vivek; Jain, Ankur

2017-09-01

While Gel Polymer Electrolytes (GPEs) have been widely investigated for use in next-generation Li-ion cells due to the potential for improved thermal safety, thermal transport within a GPE is still poorly understood. Among all materials in a Li-ion cell, the GPE has the lowest thermal conductivity, and hence determines the overall rate of heat flow in a Li-ion cell. This makes it critical to measure and understand thermal transport in a GPE and investigate trade-offs between thermal and ionic transport. This paper presents measurements of thermal and ionic conductivities in a PVdF-based GPE. The effect of incorporating BN/Al2O3 ceramic nano/microparticles in the GPE on thermal and ionic transport is characterized. Measurements indicate up to 2.5X improvement in thermal conductivity of activated GPE membranes, with relatively minor effect on electrochemical performance of GPE-based single-layer cells. The measured enhancement in thermal conductivity is in very good agreement with theoretical calculations based on the effective medium theory that accounts for thermal transport in a dispersed, two-phase medium such as a GPE. The fundamental insights gained in this work on thermal transport in a GPE and the role of nano/microparticle inclusions may facilitate thermal-electrochemical optimization and design of GPEs for safe, high-performance Li-ion cells.

Effects of yttrium, aluminum, and chromium concentrations in bond coatings on the performance of zirconia-yttria thermal barriers

NASA Technical Reports Server (NTRS)

Stecura, S.

1979-01-01

A cyclic furnace study was conducted between 990 - 280 C and 1095 - 280 C to evaluate the effects of yttrium, chromium, and aluminum concentrations in nickel base alloy bond coatings and also the effect of the bond coating thickness on the performance of yttria-stabilized zirconia thermal barrier coatings. The presence and the concentration of yttrium is very critical. Without yttrium, rapid oxidation of Ni-Al, Ni-Cr, and Ni-Cr-Al bond coatings causes zirconia thermal barrier coatings to fail very rapidly. Concentrations of chrominum and aluminum in Ni-Cr-Al-Y bond coating have a very significant effect on the thermal barrier coating life. This effect, however, is not as great as that due to yttrium. Furthermore, the thickness and the thickness uniformity also have a very significant effect on the life of the thermal barrier system.

Temperature Mapping of Air Film-Cooled Thermal Barrier Coated Surfaces Using Cr-Doped GdAlO3 Phosphor Thermography

NASA Technical Reports Server (NTRS)

Eldridge, Jeffrey I.; Shyam, Vikram; Wroblewski, Adam C.; Zhu, Dongming; Cuy, Michael D.; Wolfe, Douglas E.

2016-01-01

It has been recently shown that the high luminescence intensity from a Cr-doped GdAlO3 (Cr:GdAlO3) thermographic phosphor enables non-rastered full-field temperature mapping of thermal barrier coating (TBC) surfaces to temperatures above 1000C. In this presentation, temperature mapping by Cr:GdAlO3 based phosphor thermometry of air film-cooled TBC-coated surfaces is demonstrated for both scaled-up cooling hole geometries as well as for actual components in a burner rig test environment. The effects of thermal background radiation and flame chemiluminescence on the measurements are investigated, and advantages of this method over infrared thermography as well as the limitations of this method for studying air film cooling are discussed.

A Simultaneous Analytical Method for Duplex Identification of Porcine and Horse in the Meat Products by EvaGreen based Real-time PCR.

PubMed

Sakalar, Ergün; Ergün, Seyma Özçirak; Akar, Emine

2015-01-01

A duplex real-time polymerase chain reaction (PCR) based assay for the detection of porcine and horse meat in sausages was designed by using EvaGreen fluorescent dye. Primers were selected from mitochondrial 12S rRNA and 16S rRNA genes which are powerful regions for identification of horse and porcine meat. DNA from reference samples and industrial products was successfully extracted using the GIDAGEN® Multi-Fast DNA Isolation Kit. Genomes were identified based on their specific melting peaks (Mp) which are 82.5℃ and 78℃ for horse and porcine, respectively. The assay used in this study allowed the detection of as little as 0.0001% level of horse meat and 0.001% level of porcine meat in the experimental admixtures. These findings indicate that EvaGreen based duplex real-time PCR is a potentially sensitive, reliable, rapid and accurate assay for the detection of meat species adulterated with porcine and horse meats.

A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

PubMed

Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

2015-02-17

Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri

Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the basesmore » and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.« less

Insight into a conformation of the PNA-PNA duplex with (2‧R,4‧R)- and (2‧R,4‧S)-prolyl-(1S,2S)-2-aminocyclopentanecarboxylic acid backbones

NASA Astrophysics Data System (ADS)

Maitarad, Amphawan; Poomsuk, Nattawee; Vilaivan, Chotima; Vilaivan, Tirayut; Siriwong, Khatcharin

2018-04-01

Suitable conformations for peptide nucleic acid (PNA) self-hybrids with (2‧R,4‧R)- and (2‧R,4‧S)-prolyl-(1S,2S)-2-aminocyclopentanecarboxylic acid backbones (namely, acpcPNA and epi-acpcPNA, respectively) were investigated based on molecular dynamics simulations. The results revealed that hybridization of the acpcPNA was observed only in the parallel direction, with a conformation close to the P-type structure. In contrast, self-hybrids of the epi-acpcPNA were formed in the antiparallel and parallel directions; the antiparallel duplex adopted the B-form conformation, and the parallel duplex was between B- and P-forms. The calculated binding energies and the experimental data indicate that the antiparallel epi-acpcPNA self-hybrid was more stable than the parallel duplex.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.

PubMed

Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo

2013-11-15

We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

Insights into the structural features and stability of peptide nucleic acid with a D-prolyl-2-aminocyclopentane carboxylic acid backbone that binds to DNA and RNA.

PubMed

Poomsuk, Nattawee; Vilaivan, Tirayut; Siriwong, Khatcharin

2018-06-12

Peptide nucleic acid (PNA) is a powerful biomolecule with a wide variety of important applications. In this work, the molecular structures and binding affinity of PNA with a D-prolyl-2-aminocyclopentane carboxylic acid backbone (acpcPNA) that binds to both DNA and RNA were studied using molecular dynamics simulations. The simulated structures of acpcPNA-DNA and acpcPNA-RNA duplexes more closely resembled the typical structures of B-DNA and A-RNA than the corresponding duplexes of aegPNA. The calculated binding free energies are in good agreement with the experimental results that the acpcPNA-DNA duplex is more stable than the acpcPNA-RNA duplex regardless of the base sequences. The results provide further insights in the relationship between structure and stability of this unique PNA system. Copyright © 2018 Elsevier Inc. All rights reserved.

Development and application of absolute quantitative detection by duplex chamber-based digital PCR of genetically modified maize events without pretreatment steps.

PubMed

Zhu, Pengyu; Fu, Wei; Wang, Chenguang; Du, Zhixin; Huang, Kunlun; Zhu, Shuifang; Xu, Wentao

2016-04-15

The possibility of the absolute quantitation of GMO events by digital PCR was recently reported. However, most absolute quantitation methods based on the digital PCR required pretreatment steps. Meanwhile, singleplex detection could not meet the demand of the absolute quantitation of GMO events that is based on the ratio of foreign fragments and reference genes. Thus, to promote the absolute quantitative detection of different GMO events by digital PCR, we developed a quantitative detection method based on duplex digital PCR without pretreatment. Moreover, we tested 7 GMO events in our study to evaluate the fitness of our method. The optimized combination of foreign and reference primers, limit of quantitation (LOQ), limit of detection (LOD) and specificity were validated. The results showed that the LOQ of our method for different GMO events was 0.5%, while the LOD is 0.1%. Additionally, we found that duplex digital PCR could achieve the detection results with lower RSD compared with singleplex digital PCR. In summary, the duplex digital PCR detection system is a simple and stable way to achieve the absolute quantitation of different GMO events. Moreover, the LOQ and LOD indicated that this method is suitable for the daily detection and quantitation of GMO events. Copyright © 2016 Elsevier B.V. All rights reserved.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Oxidation resistant high temperature thermal cycling resistant coatings on silicon-based substrates and process for the production thereof

DOEpatents

Sarin, V.K.

1990-08-21

An oxidation resistant, high temperature thermal cycling resistant coated ceramic article for ceramic heat engine applications is disclosed. The substrate is a silicon-based material, i.e. a silicon nitride- or silicon carbide-based monolithic or composite material. The coating is a graded coating of at least two layers: an intermediate AlN or Al[sub x]N[sub y]O[sub z] layer and an aluminum oxide or zirconium oxide outer layer. The composition of the coating changes gradually from that of the substrate to that of the AlN or Al[sub x]N[sub y]O[sub z] layer and further to the composition of the aluminum oxide or zirconium oxide outer layer. Other layers may be deposited over the aluminum oxide layer. A CVD process for depositing the graded coating on the substrate is also disclosed.

Oxidation resistant high temperature thermal cycling resistant coatings on silicon-based substrates and process for the production thereof

DOEpatents

Sarin, Vinod K.

1990-01-01

An oxidation resistant, high temperature thermal cycling resistant coated ceramic article for ceramic heat engine applications. The substrate is a silicon-based material, i.e. a silicon nitride- or silicon carbide-based monolithic or composite material. The coating is a graded coating of at least two layers: an intermediate AlN or Al.sub.x N.sub.y O.sub.z layer and an aluminum oxide or zirconium oxide outer layer. The composition of the coating changes gradually from that of the substrate to that of the AlN or Al.sub.x N.sub.y O.sub.z layer and further to the composition of the aluminum oxide or zirconium oxide outer layer. Other layers may be deposited over the aluminum oxide layer. A CVD process for depositing the graded coating on the substrate is also disclosed.

Thermal conductivity and viscosity measurements of ethylene glycol-based Al2O3 nanofluids

PubMed Central

2011-01-01

The dispersion and stability of nanofluids obtained by dispersing Al2O3 nanoparticles in ethylene glycol have been analyzed at several concentrations up to 25% in mass fraction. The thermal conductivity and viscosity were experimentally determined at temperatures ranging from 283.15 K to 323.15 K using an apparatus based on the hot-wire method and a rotational viscometer, respectively. It has been found that both thermal conductivity and viscosity increase with the concentration of nanoparticles, whereas when the temperature increases the viscosity diminishes and the thermal conductivity rises. Measured enhancements on thermal conductivity (up to 19%) compare well with literature values when available. New viscosity experimental data yield values more than twice larger than the base fluid. The influence of particle size on viscosity has been also studied, finding large differences that must be taken into account for any practical application. These experimental results were compared with some theoretical models, as those of Maxwell-Hamilton and Crosser for thermal conductivity and Krieger and Dougherty for viscosity. PMID:21711737

Thermophysical properties of heat-treated U-7Mo/Al dispersion fuel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cho, Tae Won; Kim, Yeon Soo; Park, Jong Man

In this study, the effects of interaction layer (IL) on thermophysical properties of U-7Mo/Al dispersion fuel were examined. Microstructural analyses revealed that ILs were formed uniformly on U-Mo particles during heating of U-7Mo/Al samples. The IL volume fraction was measured by applying image analysis methods. The uranium loadings of the samples were calculated based on the measured meat densities at 298 K. The density of the IL was estimated by using the measured density and IL volume fraction. Thermal diffusivity and heat capacity of the samples after the heat treatment were measured as a function of temperature and volume fractionsmore » of U-Mo and IL. The thermal conductivity of IL-formed U-7Mo/Al was derived by using the measured thermal diffusivity, heat capacity, and density. The thermal conductivity obtained in the present study was lower than that predicted by the modified Hashin–Shtrikman model due to the theoretical model’s inability to consider the thermal resistance at interfaces between the meat constituents.« less

The role of molecular structure of sugar-phosphate backbone and nucleic acid bases in the formation of single-stranded and double-stranded DNA structures.

PubMed

Poltev, Valeri; Anisimov, Victor M; Danilov, Victor I; Garcia, Dolores; Sanchez, Carolina; Deriabina, Alexandra; Gonzalez, Eduardo; Rivas, Francisco; Polteva, Nina

2014-06-01

Our previous DFT computations of deoxydinucleoside monophosphate complexes with Na(+)-ions (dDMPs) have demonstrated that the main characteristics of Watson-Crick (WC) right-handed duplex families are predefined in the local energy minima of dDMPs. In this work, we study the mechanisms of contribution of chemically monotonous sugar-phosphate backbone and the bases into the double helix irregularity. Geometry optimization of sugar-phosphate backbone produces energy minima matching the WC DNA conformations. Studying the conformational variability of dDMPs in response to sequence permutation, we found that simple replacement of bases in the previously fully optimized dDMPs, e.g. by constructing Pyr-Pur from Pur-Pyr, and Pur-Pyr from Pyr-Pur sequences, while retaining the backbone geometry, automatically produces the mutual base position characteristic of the target sequence. Based on that, we infer that the directionality and the preferable regions of the sugar-phosphate torsions, combined with the difference of purines from pyrimidines in ring shape, determines the sequence dependence of the structure of WC DNA. No such sequence dependence exists in dDMPs corresponding to other DNA conformations (e.g., Z-family and Hoogsteen duplexes). Unlike other duplexes, WC helix is unique by its ability to match the local energy minima of the free single strand to the preferable conformations of the duplex. Copyright © 2013 Wiley Periodicals, Inc.

2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

PubMed Central

Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

2015-01-01

2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

Microstructure and Antiwear Property of Laser Cladding Ni-Co Duplex Coating on Copper.

PubMed

Wang, Yiyong; Liang, Zhipeng; Zhang, Junwei; Ning, Zhe; Jin, Hui

2016-07-28

Ni-Co duplex coatings were cladded onto Cu to improve the antiwear properties of Cu products. Prior to laser cladding, n-Al₂O₃/Ni layers were introduced as interlayers between laser cladding coatings and Cu substrates to improve the laser absorptivity of these substrates and ensure defect-free laser cladding coatings. The structure and morphology of the coatings were characterized by scanning electron microscopy and optical microscopy, and the phases of the coatings were analyzed by X-ray diffraction. Their hardness was measured using a microhardness tester. Experimental results showed that defect-free composite coatings were obtained and that the coatings were metallurgically bonded to the substrates. The surface of the Ni-Co duplex coatings comprised a Co-based solid solution, Cr₇C₃, (Fe,Ni) 23 C₆, and other strengthening phases. The microhardness and wear resistance of the duplex coatings were significantly improved compared with the Cu substrates. The average microhardness of the cladded coatings was 845.6 HV, which was approximately 8.2 times greater than that of the Cu substrates (102.6 HV). The volume loss of the Cu substrates was approximately 7.5 times greater than that of the Ni-Co duplex coatings after 60 min of sliding wear testing. The high hardness of and lack of defects in the Ni-Co duplex coatings reduced the plastic deformation and adhesive wear of the Cu substrates, resulting in improved wear properties.

Comparative analysis of different configurations of PLC-based safety systems from reliability point of view

NASA Technical Reports Server (NTRS)

Tapia, Moiez A.

1993-01-01

The study of a comparative analysis of distinct multiplex and fault-tolerant configurations for a PLC-based safety system from a reliability point of view is presented. It considers simplex, duplex and fault-tolerant triple redundancy configurations. The standby unit in case of a duplex configuration has a failure rate which is k times the failure rate of the standby unit, the value of k varying from 0 to 1. For distinct values of MTTR and MTTF of the main unit, MTBF and availability for these configurations are calculated. The effect of duplexing only the PLC module or only the sensors and the actuators module, on the MTBF of the configuration, is also presented. The results are summarized and merits and demerits of various configurations under distinct environments are discussed.

Effect of the temperature, strain rate and microstructure on flow and fracture characteristics of Ti-45Al-2Nb-2Mn+0.8vol.% TiB2 XD alloy

NASA Astrophysics Data System (ADS)

Erice, B.; Pérez-Martín, M. J.; Cendón, D. A.; Gálvez, F.

2012-05-01

A series of quasi-static and dynamic tensile tests at varying temperatures were carried out to determine the mechanical behaviour of Ti-45Al-2Nb-2Mn+0.8vol.% TiB2 XD as-HIPed alloy. The temperature for the tests ranged from room temperature to 850 ∘C. The effect of the temperature on the ultimate tensile strength, as expected, was almost negligible within the selected temperature range. Nevertheless, the plastic flow suffered some softening because of the temperature. This alloy presents a relatively low ductility; thus, a low tensile strain to failure. The dynamic tests were performed in a Split Hopkinson Tension Bar, showing an increase of the ultimate tensile strength due to the strain rate hardening effect. Johnson-Cook constitutive relation was used to model the plastic flow. A post-testing microstructural of the specimens revealed an inhomogeneous structure, consisting of lamellar α2 + γ structure and γ phase equiaxed grains in the centre, and a fully lamellar structure on the rest. The assessment of the duplex-fully lamellar area ratio showed a clear relationship between the microstructure and the fracture behaviour.

Observation of Dust Particle Gyromotion in a Magnetized Dusty Plasma

NASA Astrophysics Data System (ADS)

Compton, C. S.; Amatucci, W. E.; Gatling, G.; Tejero, E.

2008-11-01

In dusty plasma research, gyromotion of the dust has been difficult to observe experimentally. Previous experiments by Amatucci et al. have shown gyromotion of a single dust particle [1]. This early work was performed with alumina dust that had a size distribution and non-uniformly shaped particles. In the current experiment, evidence of spherical, monodispersed, dust particles exhibiting gyromotion has been observed. Silica particles 0.97 micrometers in diameter are suspended in a DC glow discharge argon plasma. The experiment is performed in the Naval Research Laboratory's DUsty PLasma EXperiment (DUPLEX Jr.). DUPLEX is a 61-cm tall by 46-cm diameter acrylic chamber allowing full 360 degree optical access for diagnostics. The neutral pressure for the experiment is 230 mTorr with a 275 V bias between the circular electrodes. The electrodes have a separation of 4 cm. A strong magnetic field is created by 2 pairs of neodymium iron boride magnets placed above and below the anode and cathode respectively. The resulting field is 1.4 kG. The dust particles are illuminated with a 25 mW, 672 nm laser. Images are captured using an intensified CCD camera and a consumer digital video cassette recorder. Recent evidence of gyromotion of spherical, monodispersed, dust particles will be presented. [1] Amatucci, W.E., et al., Phys. Plasmas, 11, 2097 (2004)

Synthesis of advanced aluminide intermetallic coatings by low-energy Al-ion radiation

NASA Astrophysics Data System (ADS)

Shen, Mingli; Gu, Yan; Zhao, Panpan; Zhu, Shenglong; Wang, Fuhui

2016-05-01

Metals that work at high temperatures (for instance, superalloys in gas-turbines) depend on thermally grown oxide (TGO, commonly alumina) to withstand corrosion attack. Nickel Aluminide (NiAl) as one superior alumina TGO former plays an important role in protective coatings for turbine blades in gas-turbine engines used for aircraft propulsion and power generation. Lowering TGO growth rate is essentially favored for offering sustainable protection, especially in thermal barrier coatings (TBC). However, it can only be achieved currently by a strategy of adding the third element (Pt or reactive elements) into NiAl during traditional diffusion- or deposition-based synthesis of the coating. Here we present a highly flexible Al-ion radiation-based synthesis of advanced NiAl coatings, achieving low TGO growth rate without relying on the third element addition. Our results expand the strategy for lowering TGO growth rate and demonstrate potentials for ion radiation in advancing materials synthesis.

Synthesis of advanced aluminide intermetallic coatings by low-energy Al-ion radiation

PubMed Central

Shen, Mingli; Gu, Yan; Zhao, Panpan; Zhu, Shenglong; Wang, Fuhui

2016-01-01

Metals that work at high temperatures (for instance, superalloys in gas-turbines) depend on thermally grown oxide (TGO, commonly alumina) to withstand corrosion attack. Nickel Aluminide (NiAl) as one superior alumina TGO former plays an important role in protective coatings for turbine blades in gas-turbine engines used for aircraft propulsion and power generation. Lowering TGO growth rate is essentially favored for offering sustainable protection, especially in thermal barrier coatings (TBC). However, it can only be achieved currently by a strategy of adding the third element (Pt or reactive elements) into NiAl during traditional diffusion- or deposition-based synthesis of the coating. Here we present a highly flexible Al-ion radiation-based synthesis of advanced NiAl coatings, achieving low TGO growth rate without relying on the third element addition. Our results expand the strategy for lowering TGO growth rate and demonstrate potentials for ion radiation in advancing materials synthesis. PMID:27194417

Synthesis of advanced aluminide intermetallic coatings by low-energy Al-ion radiation.

PubMed

Shen, Mingli; Gu, Yan; Zhao, Panpan; Zhu, Shenglong; Wang, Fuhui

2016-05-19

Metals that work at high temperatures (for instance, superalloys in gas-turbines) depend on thermally grown oxide (TGO, commonly alumina) to withstand corrosion attack. Nickel Aluminide (NiAl) as one superior alumina TGO former plays an important role in protective coatings for turbine blades in gas-turbine engines used for aircraft propulsion and power generation. Lowering TGO growth rate is essentially favored for offering sustainable protection, especially in thermal barrier coatings (TBC). However, it can only be achieved currently by a strategy of adding the third element (Pt or reactive elements) into NiAl during traditional diffusion- or deposition-based synthesis of the coating. Here we present a highly flexible Al-ion radiation-based synthesis of advanced NiAl coatings, achieving low TGO growth rate without relying on the third element addition. Our results expand the strategy for lowering TGO growth rate and demonstrate potentials for ion radiation in advancing materials synthesis.

Effects of Plasma ZrN Metallurgy and Shot Peening Duplex Treatment on Fretting Wear and Fretting Fatigue Behavior of Ti6Al4V Alloy.

PubMed

Tang, Jingang; Liu, Daoxin; Zhang, Xiaohua; Du, Dongxing; Yu, Shouming

2016-03-23

A metallurgical zirconium nitride (ZrN) layer was fabricated using glow metallurgy using nitriding with zirconiuming prior treatment of the Ti6Al4V alloy. The microstructure, composition and microhardness of the corresponding layer were studied. The influence of this treatment on fretting wear (FW) and fretting fatigue (FF) behavior of the Ti6Al4V alloy was studied. The composite layer consisted of an 8-μm-thick ZrN compound layer and a 50-μm-thick nitrogen-rich Zr-Ti solid solution layer. The surface microhardness of the composite layer is 1775 HK 0.1 . A gradient in cross-sectional microhardness distribution exists in the layer. The plasma ZrN metallurgical layer improves the FW resistance of the Ti6Al4V alloy, but reduces the base FF resistance. This occurs because the improvement in surface hardness results in lowering of the toughness and increasing in the notch sensitivity. Compared with shot peening treatment, plasma ZrN metallurgy and shot peening composite treatment improves the FW resistance and enhances the FF resistance of the Ti6Al4V alloy. This is attributed to the introduction of a compressive stress field. The combination of toughness, strength, FW resistance and fatigue resistance enhance the FF resistance for titanium alloy.

Effects of Plasma ZrN Metallurgy and Shot Peening Duplex Treatment on Fretting Wear and Fretting Fatigue Behavior of Ti6Al4V Alloy

PubMed Central

Tang, Jingang; Liu, Daoxin; Zhang, Xiaohua; Du, Dongxing; Yu, Shouming

2016-01-01

A metallurgical zirconium nitride (ZrN) layer was fabricated using glow metallurgy using nitriding with zirconiuming prior treatment of the Ti6Al4V alloy. The microstructure, composition and microhardness of the corresponding layer were studied. The influence of this treatment on fretting wear (FW) and fretting fatigue (FF) behavior of the Ti6Al4V alloy was studied. The composite layer consisted of an 8-μm-thick ZrN compound layer and a 50-μm-thick nitrogen-rich Zr–Ti solid solution layer. The surface microhardness of the composite layer is 1775 HK0.1. A gradient in cross-sectional microhardness distribution exists in the layer. The plasma ZrN metallurgical layer improves the FW resistance of the Ti6Al4V alloy, but reduces the base FF resistance. This occurs because the improvement in surface hardness results in lowering of the toughness and increasing in the notch sensitivity. Compared with shot peening treatment, plasma ZrN metallurgy and shot peening composite treatment improves the FW resistance and enhances the FF resistance of the Ti6Al4V alloy. This is attributed to the introduction of a compressive stress field. The combination of toughness, strength, FW resistance and fatigue resistance enhance the FF resistance for titanium alloy. PMID:28773345

Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

PubMed

Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

2018-02-01

Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

Finite element modeling of borehole heat exchanger systems. Part 1. Fundamentals

NASA Astrophysics Data System (ADS)

Diersch, H.-J. G.; Bauer, D.; Heidemann, W.; Rühaak, W.; Schätzl, P.

2011-08-01

Single borehole heat exchanger (BHE) and arrays of BHE are modeled by using the finite element method. The first part of the paper derives the fundamental equations for BHE systems and their finite element representations, where the thermal exchange between the borehole components is modeled via thermal transfer relations. For this purpose improved relationships for thermal resistances and capacities of BHE are introduced. Pipe-to-grout thermal transfer possesses multiple grout points for double U-shape and single U-shape BHE to attain a more accurate modeling. The numerical solution of the final 3D problems is performed via a widely non-sequential (essentially non-iterative) coupling strategy for the BHE and porous medium discretization. Four types of vertical BHE are supported: double U-shape (2U) pipe, single U-shape (1U) pipe, coaxial pipe with annular (CXA) and centred (CXC) inlet. Two computational strategies are used: (1) The analytical BHE method based on Eskilson and Claesson's (1988) solution, (2) numerical BHE method based on Al-Khoury et al.'s (2005) solution. The second part of the paper focusses on BHE meshing aspects, the validation of BHE solutions and practical applications for borehole thermal energy store systems.

Low Conductive Thermal Barrier Coatings Produced by Ion Beam Assisted EB-PVD with Controlled Porosity, Microstructure Refinement and Alloying Additions for High Temperature Applications

NASA Technical Reports Server (NTRS)

Wolfe, Douglas E.; Singh, Jogender

2005-01-01

Various advanced Hafnia-based thermal barrier coatings (TBC) were applied on nickel-based superalloy coupons by electron beam physical vapor deposition. In addition, microstructural modifications to the coating material were made in an effort to reduce the thermal conductivity of the coating materials. Various processing parameters and coating system modifications were made in order to deposit the alloyed TBC with the desired microstructure and thus coating performance, some of which include applying coatings at substrate temperatures of 1150 C on both PtAl and CoNiCrAlY bond coated samples, as well as using 8YSZ as a bond layer. In addition, various characterization techniques including thermal cyclic tests, scanning electron microscopy, x-ray diffraction, thermal conductivity, and reflectivity measurements were performed. Although the coating microstructure was never fully optimized due to funding being cut short, significant reductions in thermal conductivity were accomplished through both chemistry changes (composition) and microstructural modifications.

Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

2002-01-01

The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

Systematic investigation of structural, electronic, optical and thermal properties of ternary MoAlB; an ab initio approach

NASA Astrophysics Data System (ADS)

Rajpoot, Priyanka; Rastogi, Anugya; Verma, U. P.

2018-02-01

Structural, electronic, optical and thermal properties of molybdenum aluminum boride (MoAlB) have been analyzed systematically using the full potential linearized augmented plane wave method based on density functional theory at ambient condition as well as high pressure and high temperature. Density of states and band structure calculation reflect the metallic character of MoAlB. In addition to this, the electron charge density calculation reveals the strong covalent bonding, in between ‘B’ atoms as well as ‘Mo’ and ‘B’ atoms. Optical parameters exhibit anisotropic nature and MoAlB become transparent in ultraviolet region for the radiation of energy above 25 eV. The thermal properties were investigated by using the quasi-harmonic Debye model at high temperature and high pressure.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

An intercalation-locked parallel-stranded DNA tetraplex

DOE PAGES

Tripathi, S.; Zhang, D.; Paukstelis, P. J.

2015-01-27

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

NMR structure of the DNA decamer duplex containing double T*G mismatches of cis-syn cyclobutane pyrimidine dimer: implications for DNA damage recognition by the XPC-hHR23B complex.

PubMed

Lee, Joon-Hwa; Park, Chin-Ju; Shin, Jae-Sun; Ikegami, Takahisa; Akutsu, Hideo; Choi, Byong-Seok

2004-01-01

The cis-syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC-hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC-hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC-hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC-hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3' T*G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T*G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T*G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6-4) adduct, which is efficiently recognized by the XPC-hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC-hHR23B complex to DNA.

Phenomenological Model Describing the Formation of Peeling Defects on Hot-Rolled Duplex Stainless Steel 2205

NASA Astrophysics Data System (ADS)

Yong-jun, Zhang; Hui, Zhang; Jing-tao, Han

2017-05-01

The chemical composition, morphology, and microstructure of peeling defects formed on the surface of sheets from steel 2205 under hot rolling are studied. The microstructure of the surface is analyzed using scanning electron and light microscopy. The zones affected are shown to contain nonmetallic inclusions of types Al2O3 and CaO - SiO2 - Al2O3 - MgO in the form of streak precipitates and to have an unfavorable content of austenite, which causes decrease in the ductility of the area. The results obtained are used to derive a five-stage phenomenological model of formation of such defects.

Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

PubMed

van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

2012-03-27

In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

Al-26 from red giants. [connections with anomalous Mg-26 content in meteorites and solar system formation

NASA Technical Reports Server (NTRS)

Norgaard, H.

1980-01-01

Simplified models of thermally pulsing red giants are investigated, with particular emphasis on predicting the extent to which nuclear processing at the base of the convective envelope in conjunction with processing in the thermally unstable He shell can synthesize Al-26 (tau/1/2/ = 7.2 x 10 to the 5th yr). Values of Al-26/Al-27 of about 0.5-1, with Al-27/Al-27(solar) of about 1-2, are predicted in some cases. It is pointed out that such results can lead to isotope shifts in the absorption lines of AlH and AlO, which should be observationally identifiable in some late-type supergiants. The possible connection with the anomalous Mg-26 content (assigned to the decay of Al-26) detected in some meteorites and the connection with formation of the solar system are also touched on.

The morphology and treatment of coexisting ureteropelvic junction obstruction in lower moiety of duplex kidney.

PubMed

Liu, Wei; Zhang, Liujuan; Ma, Rui; Wu, Rongde

2016-10-01

Duplex kidney is a common congenital anomaly of the urinary tract, while ureteropelvic junction obstruction (UPJO) in lower unit of duplex kidney is rare. Surgical treatment can be challenging in such cases. The aim was to report our experience in managements of UPJO in lower moiety of duplex kidney. Among the pediatric patients with duplex system from 2007 to 2013, 7 children were diagnosed with UPJO in lower moiety. Their medical records were retrospectively analyzed, mainly focused on anatomic aspects and operation details. The lower pole UPJO associated with incomplete duplex systems were identified in 6 patients on the left side and 1 on the right side. Median patient age at surgery was 11 months (range 6-84 months). Prenatal hydronephrosis was detected in 4 patients, and 3 had intermittent abdominal pain. Hydronephrosis, thin parenchyma and presence of UPJO in lower moiety could be shown on computed tomography urogram (CTU). The ureters were fused in a "Y" shape without any dilation. Based on the length between UPJO to the confluence in retrograde ureteropyelography, patients were classified into group 1 (5 cases,≤3 cm) and group 2 (2 cases, >3 cm). In group 1, surgical procedure involved end-to-side pyeloureterostomy of the lower pelvis to the ureteral confluence in 4 cases and laparoscopic pyeloureterostomy in one case. The two patients in group 2 underwent laparoscopic pyeloplasty of lower moiety. In all of these patients hydronephrosis gradually improved and no complications were detected during follow-up. UPJO in a duplex kidney requires careful evaluation and treatment should be individualized. Ureteropyeloanastomosis is a feasible treatment for duplex kidneys associated to a functioning lower moiety with UPJO. With the technical improvements in laparoscopic pyeloplasty, this procedure can be performed using laparoscopy. Copyright © 2016 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

Development of one novel multiple-target plasmid for duplex quantitative PCR analysis of roundup ready soybean.

PubMed

Zhang, Haibo; Yang, Litao; Guo, Jinchao; Li, Xiang; Jiang, Lingxi; Zhang, Dabing

2008-07-23

To enforce the labeling regulations of genetically modified organisms (GMOs), the application of reference molecules as calibrators is becoming essential for practical quantification of GMOs. However, the reported reference molecules with tandem marker multiple targets have been proved not suitable for duplex PCR analysis. In this study, we developed one unique plasmid molecule based on one pMD-18T vector with three exogenous target DNA fragments of Roundup Ready soybean GTS 40-3-2 (RRS), that is, CaMV35S, NOS, and RRS event fragments, plus one fragment of soybean endogenous Lectin gene. This Lectin gene fragment was separated from the three exogenous target DNA fragments of RRS by inserting one 2.6 kb DNA fragment with no relatedness to RRS detection targets in this resultant plasmid. Then, we proved that this design allows the quantification of RRS using the three duplex real-time PCR assays targeting CaMV35S, NOS, and RRS events employing this reference molecule as the calibrator. In these duplex PCR assays, the limits of detection (LOD) and quantification (LOQ) were 10 and 50 copies, respectively. For the quantitative analysis of practical RRS samples, the results of accuracy and precision were similar to those of simplex PCR assays, for instance, the quantitative results were at the 1% level, the mean bias of the simplex and duplex PCR were 4.0% and 4.6%, respectively, and the statistic analysis ( t-test) showed that the quantitative data from duplex and simplex PCR had no significant discrepancy for each soybean sample. Obviously, duplex PCR analysis has the advantages of saving the costs of PCR reaction and reducing the experimental errors in simplex PCR testing. The strategy reported in the present study will be helpful for the development of new reference molecules suitable for duplex PCR quantitative assays of GMOs.

Aging effects on reactivity of an aluminum-based drinking-water treatment residual as a soil amendment.

PubMed

Agyin-Birikorang, S; O'Connor, G A

2009-01-01

Several studies have shown that drinking-water treatment residuals (WTR) could be used to control mobility of excess phosphorus (P) and other oxyanions in poorly sorbing soils. Presently, only "aged" WTRs (those left, or manipulated, to dewater) are land applied. However, if demand for WTRs increase in the near future, freshly-generated WTRs could be considered for land application. To our knowledge, few studies have examined the reactivity and equilibration time of freshly-generated alum-based WTR (Al-WTR). A laboratory thermal incubation study was, therefore, conducted to determine various extractable Al forms in Al-WTR as a function of WTR "age", and the time required for freshly generated Al-WTR to stabilize. Freshly-generated Al-WTR samples were collected directly from the discharge pumps of a drinking-water treatment plant, and thermally incubated at 52 degrees C, either with or without moisture control, for < or = 24 wk. Additional dewatered Al-WTR samples of various ages (2 wk- to 2 y old) were also included in the study. Various methods of extracting Al [total-, oxalate (200 and 5 mM), and Mehlich 1 extractants] were utilized to assess Al extractability over time. Freshly-generated Al-WTR samples were potentially more reactive (as reflected in greater 5 mM oxalate extractable Al concentration) than dewatered Al-WTR samples stockpiled for > or = 6 mo. Aluminum reactivity of the freshly-generated Al-WTR decreased with time. At least 6 wk of thermal incubation (corresponding to > or = 6 mo of field drying) was required to stabilize the most reactive Al form (5mM oxalate extractable Al concentration) of the Al-WTR. Although no adverse Al-WTR effects have been reported on plants and grazing animals (apparently because of low availability of free Al(3+) in Al-WTR), land application of freshly-generated Al-WTRs (at least, those with similar physicochemical characteristics as the one utilized for the study) should be avoided.

Satellite Power Systems (SPS) Concept Definition Study. Volume 3: SPS Concept Evolution

NASA Technical Reports Server (NTRS)

Hanley, G.

1978-01-01

A solar photovoltaic satellite based upon the utilization of a GaAlAs solar cell is defined. Topics covered include silicon-based photovoltaics, solar thermal power conversion, microwave energy transmission, power distribution, structures, attitude control and stationkeeping, thermal, and information management and control.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Wireless optical network for a home network

NASA Astrophysics Data System (ADS)

Bouchet, Olivier; Porcon, Pascal; Walewski, Joachim W.; Nerreter, Stefan; Langer, Klaus-Dieter; Fernández, Luz; Vucic, Jelena; Kamalakis, Thomas; Ntogari, Georgia; Neokosmidis, Ioannis; Gueutier, Eric

2010-08-01

During the European collaborative project OMEGA, two optical-wireless prototypes have been developed. The first prototype operates in the near-infrared spectral region and features Giga Ethernet connectivity, a simple transceiver architecture due to the use of on-off keying, a multi-sector transceiver, and an ultra-fast switch for sector-to-sector hand over. This full-duplex system, composed by one base station and one module, transmits data on three meters. The second prototype is a visible-light-communications system based on DMT signal processing and an adapted MAC sublayer. Data rates around to 100 Mb/s at the physical layer are achieved. This broadcast system, composed also by one base station and one module, transmits data up to two meters. In this paper we present the adapted optical wireless media-access-control sublayer protocol for visible-light communications. This protocol accommodates link adaptation from 128 Mb/s to 1024 Mb/s with multi-sector coverage, and half-duplex or full-duplex transmission.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

Predicting RNA Duplex Dimerization Free-Energy Changes upon Mutations Using Molecular Dynamics Simulations.

PubMed

Sakuraba, Shun; Asai, Kiyoshi; Kameda, Tomoshi

2015-11-05

The dimerization free energies of RNA-RNA duplexes are fundamental values that represent the structural stability of RNA complexes. We report a comparative analysis of RNA-RNA duplex dimerization free-energy changes upon mutations, estimated from a molecular dynamics simulation and experiments. A linear regression for nine pairs of double-stranded RNA sequences, six base pairs each, yielded a mean absolute deviation of 0.55 kcal/mol and an R(2) value of 0.97, indicating quantitative agreement between simulations and experimental data. The observed accuracy indicates that the molecular dynamics simulation with the current molecular force field is capable of estimating the thermodynamic properties of RNA molecules.

Stability of miRNA 5′terminal and seed regions is correlated with experimentally observed miRNA-mediated silencing efficacy

PubMed Central

Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko

2012-01-01

MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782

Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.

PubMed Central

Wilson, J H

1979-01-01

Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028

Temperature and electrolyte optimization of the α-hemolysin latch sensing zone for detection of base modification in double-stranded DNA.

PubMed

Johnson, Robert P; Fleming, Aaron M; Jin, Qian; Burrows, Cynthia J; White, Henry S

2014-08-19

The latch region of the wild-type protein pore α-hemolysin (α-HL) constitutes a sensing zone for individual abasic sites (and furan analogs) in double-stranded DNA (dsDNA). The presence of an abasic site or furan within a DNA duplex, electrophoretically captured in the α-HL vestibule and positioned at the latch region, can be detected based on the current blockage prior to duplex unzipping. We investigated variations in blockage current as a function of temperature (12-35°C) and KCl concentration (0.15-1.0 M) to understand the origin of the current signature and to optimize conditions for identifying the base modification. In 1 M KCl solution, substitution of a furan for a cytosine base in the latch region results in an ∼ 8 kJ mol(-1) decrease in the activation energy for ion transport through the protein pore. This corresponds to a readily measured ∼ 2 pA increase in current at room temperature. Optimal resolution for detecting the presence of a furan in the latch region is achieved at lower KCl concentrations, where the noise in the measured blockage current is significantly lower. The noise associated with the blockage current also depends on the stability of the duplex (as measured from the melting temperature), where a greater noise in the measured blockage current is observed for less stable duplexes. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Mechanism-based inhibition of C5-cytosine DNA methyltransferases by 2-H pyrimidinone.

PubMed

Hurd, P J; Whitmarsh, A J; Baldwin, G S; Kelly, S M; Waltho, J P; Price, N C; Connolly, B A; Hornby, D P

1999-02-19

DNA duplexes in which the target cytosine base is replaced by 2-H pyrimidinone have previously been shown to bind with a significantly greater affinity to C5-cytosine DNA methyltransferases than unmodified DNA. Here, it is shown that 2-H pyrimidinone, when incorporated into DNA duplexes containing the recognition sites for M.HgaI-2 and M.MspI, elicits the formation of inhibitory covalent nucleoprotein complexes. We have found that although covalent complexes are formed between 2-H pyrimidinone-modified DNA and both M.HgaI-2 and M.MspI, the kinetics of complex formation are quite distinct in each case. Moreover, the formation of a covalent complex is still observed between 2-H pyrimidinone DNA and M.MspI in which the active-site cysteine residue is replaced by serine or threonine. Covalent complex formation between M.MspI and 2-H pyrimidinone occurs as a direct result of nucleophilic attack by the residue at the catalytic position, which is enhanced by the absence of the 4-amino function in the base. The substitution of the catalytic cysteine residue by tyrosine or chemical modification of the wild-type enzyme with N-ethylmaleimide, abolishes covalent interaction. Nevertheless the 2-H pyrimidinone-substituted duplex still binds to M.MspI with a greater affinity than a standard cognate duplex, since the 2-H pyrimidinone base is mis-paired with guanine. Copyright 1999 Academic Press.

High-Temperature Oxidation-Resistant and Low Coefficient of Thermal Expansion NiAl-Base Bond Coat Developed for a Turbine Blade Application

NASA Technical Reports Server (NTRS)

2003-01-01

Many critical gas turbine engine components are currently made from Ni-base superalloys that are coated with a thermal barrier coating (TBC). The TBC consists of a ZrO2-based top coat and a bond coat that is used to enhance the bonding between the superalloy substrate and the top coat. MCrAlY alloys (CoCrAlY and NiCrAlY) are currently used as bond coats and are chosen for their very good oxidation resistance. TBC life is frequently limited by the oxidation resistance of the bond coat, along with a thermal expansion mismatch between the metallic bond coat and the ceramic top coat. The aim of this investigation at the NASA Glenn Research Center was to develop a new longer life, higher temperature bond coat by improving both the oxidation resistance and the thermal expansion characteristics of the bond coat. Nickel aluminide (NiAl) has excellent high-temperature oxidation resistance and can sustain a protective Al2O3 scale to longer times and higher temperatures in comparison to MCrAlY alloys. Cryomilling of NiAl results in aluminum nitride (AlN) formation that reduces the coefficient of thermal expansion (CTE) of the alloy and enhances creep strength. Thus, additions of cryomilled NiAl-AlN to CoCrAlY were examined as a potential bond coat. In this work, the composite alloy was investigated as a stand-alone substrate to demonstrate its feasibility prior to actual use as a coating. About 85 percent of prealloyed NiAl and 15 percent of standard commercial CoCrAlY alloys were mixed and cryomilled in an attritor with stainless steel balls used as grinding media. The milling was carried out in the presence of liquid nitrogen. The milled powder was consolidated by hot extrusion or by hot isostatic pressing. From the consolidated material, oxidation coupons, four-point bend, CTE, and tensile specimens were machined. The CTE measurements were made between room temperature and 1000 C in an argon atmosphere. It is shown that the CTE of the NiAl-AlN-CoCrAlY composite bond coat is lower than that of the commercially used coating alloy 16-6. To examine the potential of NiAl-AlN-CoCrAlY as a bond coat, we subjected two samples to cyclic furnace testing. The furnace cycle consisted of 45 min at 1163 C (2125 F ) followed by 15 min of cooling out of the furnace. The current NASA baseline TBC is a NiCrAlY bond coat below the 7YSZ top coat. The average TBC life for this baseline coating on Ren N5 is 188 plus or minus 19 cycles. NiAl-AlN-CoCrAlY specimens coated with the same 7YSZ top coat were still intact even after 1000 cycles. Therefore, the NiAl-AlN-CoCrAlY as a bulk substrate material, exhibits more than 5 times the life of the current state-of-the-art material. The next step is to evaluate this material as a coating on the same superalloy substrate.

Experimental cation redistribution in the tourmaline lucchesiite, CaFe2 + 3Al6(Si6O18)(BO3)3(OH)3O

NASA Astrophysics Data System (ADS)

Bosi, Ferdinando; Skogby, Henrik; Hålenius, Ulf; Ciriotti, Marco E.

2018-02-01

Natural Mg-rich lucchesiite was thermally treated in air and hydrogen atmosphere up to 800 °C to study potential changes in Fe-, Mg- and Al ordering over the octahedrally coordinated Y- and Z-sites, and to explore possible applications to intracrystalline geothermometry based on tourmaline. Overall, the experimental data (structural refinement, Mössbauer, infrared and optical absorption spectroscopy) show that thermal treatment of lucchesiite results in an increase of Fetot contents at Z balanced by an increase of Mg and Al at Y. This process is accompanied by a significant deprotonation of the O3 anion site. The Fe order-disorder reaction depends more on temperature, than on redox conditions. During heat treatment in H2, reduction of Fe3+ to Fe2+ was not observed despite strongly reducing conditions, indicating that the f O2 conditions do not exclusively control the Fe oxidation state at the present experimental conditions. On the basis of this and previous studies, the intersite order-disorder process induced by thermal treatment indicates that Fe redistribution is an important factor for Fe-Mg-Al-exchange and is significant at temperatures around 800 °C. As a result, Fe-Mg-Al intersite order-disorder is sensitive to temperature variations, whereas geothermometers based solely on Mg-Al order-disorder appear insensitive and involve large uncertainties. The presented findings are important for interpretation of the post-crystallization history of both tourmaline and tourmaline host rocks, and indicate that successful tourmaline geothermometers may be developed by thermal calibration of the Fe-Mg-Al order-disorder reaction.

Role of the heat capacity change in understanding and modeling melting thermodynamics of complementary duplexes containing standard and nucleobase-modified LNA.

PubMed

Hughesman, Curtis B; Turner, Robin F B; Haynes, Charles A

2011-06-14

Melting thermodynamic data obtained by differential scanning calorimetry (DSC) are reported for 43 duplexed oligonucleotides containing one or more locked nucleic acid (LNA) substitutions. The measured heat capacity change (ΔC(p)) for the helix-to-coil transition is used to compute the changes in enthalpy and entropy for melting of an LNA-bearing duplex at the T(m) of its corresponding isosequential unmodified DNA duplex to allow rigorous thermodynamic analysis of the stability enhancements provided by LNA substitutions. Contrary to previous studies, our analysis shows that the origin of the improved stability is almost exclusively a net reduction (ΔΔS° < 0) in the entropy gain accompanying the helix-to-coil transition, with the magnitude of the reduction dependent on the type of nucleobase and its base pairing properties. This knowledge and our average measured value for ΔC(p) of 42 ± 11 cal mol(-1) K(-1) bp(-1) are then used to derive a new model that accurately predicts melting thermodynamics and the increased melting temperature (ΔT(m)) of heteroduplexes formed between an unmodified DNA strand and a complementary strand containing any number and configuration of standard LNA nucleotides A, T, C, and G. This single-base thermodynamic (SBT) model requires only four entropy-related parameters in addition to ΔC(p). Finally, DSC data for 20 duplexes containing the nucleobase-modified LNAs 2-aminoadenine (D) and 2-thiothymine (H) are reported and used to determine SBT model parameters for D and H. The data and model suggest that along with the greater stability enhancement provided by D and H bases relative to their corresponding A and T analogues, the unique pseudocomplementary properties of D-H base pairs may make their use appealing for in vitro and in vivo applications.

Structural model of the p14/SF3b155 · branch duplex complex.

PubMed

Schellenberg, Matthew J; Dul, Erin L; MacMillan, Andrew M

2011-01-01

Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14 · bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein-RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14 · duplex interaction must be disrupted before the first step of splicing.

Structural model of the p14/SF3b155·branch duplex complex

PubMed Central

Schellenberg, Matthew J.; Dul, Erin L.; MacMillan, Andrew M.

2011-01-01

Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14•bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein–RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14•duplex interaction must be disrupted before the first step of splicing. PMID:21062891

Renal pelvis urothelial carcinoma of the upper moiety in complete right renal duplex: a case report.

PubMed

Zhang, Yiran; Yu, Quanfeng; Zhang, Zhihong; Liu, Ranlu; Xu, Yong

2015-01-01

Urothelial carcinoma (UC) originated from renal pelvis is the common tumor of the urinary system, however, neoplasia of the renal pelvis in duplex kidneys is extremely rare, especially in the complete renal and ureteral duplex cases. We present the first case of renal pelvis UC of the upper moiety in a complete right renal duplex. This male patient has bilateral complete renal and ureteral duplex. To the best of our knowledge, this is the first reported case of renal pelvis UC in a complete renal duplex system. After this experience we feel that the diagnosis of renal pelvis UC in duplex kidneys is not so easy, and once the diagnosis is determined, the whole renal duplex units and bladder cuff or ectopic orifice should be excised radically.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

PubMed Central

Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

2008-01-01

Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Crack propagation in functionally graded strip under thermal shock

NASA Astrophysics Data System (ADS)

Ivanov, I. V.; Sadowski, T.; Pietras, D.

2013-09-01

The thermal shock problem in a strip made of functionally graded composite with an interpenetrating network micro-structure of Al2O3 and Al is analysed numerically. The material considered here could be used in brake disks or cylinder liners. In both applications it is subjected to thermal shock. The description of the position-dependent properties of the considered functionally graded material are based on experimental data. Continuous functions were constructed for the Young's modulus, thermal expansion coefficient, thermal conductivity and thermal diffusivity and implemented as user-defined material properties in user-defined subroutines of the commercial finite element software ABAQUS™. The thermal stress and the residual stress of the manufacturing process distributions inside the strip are considered. The solution of the transient heat conduction problem for thermal shock is used for crack propagation simulation using the XFEM method. The crack length developed during the thermal shock is the criterion for crack resistance of the different graduation profiles as a step towards optimization of the composition gradient with respect to thermal shock sensitivity.

Sequence-Selective Formation of Synthetic H-Bonded Duplexes

PubMed Central

2017-01-01

Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (102 to 105 M–1). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor–acceptor sequences are avoided. PMID:28857551

The Effect of Al2O3 Addition on the Thermal Diffusivity of Heat Activated Acrylic Resin.

PubMed

Atla, Jyothi; Manne, Prakash; Gopinadh, A; Sampath, Anche; Muvva, Suresh Babu; Kishore, Krishna; Sandeep, Chiramana; Chittamsetty, Harika

2013-08-01

This study aimed at investigating the effect of adding 5% to 20% by weight aluminium oxide powder (Al2O3) on thermal diffusivity of heat-polymerized acrylic resin. Twenty five cylindrical test specimens with an embedded thermocouple were used to determine thermal diffusivity over a physiologic temperature range (0 to 70°C). The specimens were divided into five groups (5 specimens/group) which were coded A to E. Group A was the control group (unmodified acrylic resin specimens). The specimens of the remaining four groups were reinforced with 5%, 10%, 15%, and 20% Al2O3 by weight. RESULTS were analysed by using one-way analysis of variance (ANOVA). Test specimens which belonged to Group E showed the highest mean thermal diffusivity value of 10.7mm(2)/sec, followed by D (9.09mm(2)/sec), C (8.49mm(2)/sec), B(8.28mm(2)/sec) and A(6.48mm(2)/sec) groups respectively. Thermal diffusivities of the reinforced acrylic resins were found to be significantly higher than that of the unmodified acrylic resin. Thermal diffusivity was found to increase in proportion to the weight percentage of alumina filler. Al2O3 fillers have potential to provide increased thermal diffusivity. Increasing the heat transfer characteristics of the acrylic resin base material could lead to more patient satisfaction.

Eddy current techniques for super duplex stainless steel characterization

NASA Astrophysics Data System (ADS)

Camerini, C.; Sacramento, R.; Areiza, M. C.; Rocha, A.; Santos, R.; Rebello, J. M.; Pereira, G.

2015-08-01

Super duplex stainless steel (SDSS) is a two-phase material where the microstructure consists of grains of ferrite (δ) and austenite (γ). SDSS exhibit an attractive combination of properties, such as: strength, toughness and stress corrosion cracking resistance. Nevertheless, SDSS attain these properties after a controlled solution heat treatment, leading to a similar volumetric fraction of δ and γ. Any further heat treatment, welding operation for example, can change the balance of the original phases, or may also lead to precipitation of a deleterious phase, such as sigma (σ). For these situations, the material corrosion resistance is severely impaired. In the present study, several SDSS samples with low σ phase content and non-balanced microstructure were intentionally obtained by thermally treating SDSS specimens. Electromagnetic techniques, conventional Eddy Current Testing (ECT) and Saturated Low Frequency Eddy Current (SLOFEC), were employed to characterize the SDSS samples. The results showed that ECT and SLOFEC are reliable techniques to evaluate σ phase presence in SDSS and can provide an estimation of the δ content.

AGT Activity Towards Intrastrand Crosslinked DNA is Modulated by the Alkylene Linker.

PubMed

O'Flaherty, Derek K; Wilds, Christopher J

2017-12-05

DNA oligomers containing dimethylene and trimethylene intrastrand crosslinks (IaCLs) between the O4 and O6 atoms of neighboring thymidine (T) and 2'-deoxyguanosine (dG) residues were prepared by solid-phase synthesis. UV thermal denaturation (T m ) experiments revealed that these IaCLs had a destabilizing effect on the DNA duplex relative to the control. Circular dichroism spectroscopy suggested these IaCLs induced minimal structural distortions. Susceptibility to dealkylation by reaction with various O 6 -alkylguanine DNA alkyltransferases (AGTs) from human and Escherichia coli was evaluated. It was revealed that only human AGT displayed activity towards the IaCL DNA, with reduced efficiency as the IaCL shortened (from four to two methylene linkages). Changing the site of attachment of the ethylene linkage at the 5'-end of the IaCL to the N3 atom of T had minimal influence on duplex stability and structure, and was refractory to AGT activity. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

RNA major groove modifications improve siRNA stability and biological activity

PubMed Central

Terrazas, Montserrat; Kool, Eric T.

2009-01-01

RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976

Nucleic acid duplexes incorporating a dissociable covalent base pair

NASA Technical Reports Server (NTRS)

Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

Study of tunneling transport in Si-based tunnel field-effect transistors with ON current enhancement utilizing isoelectronic trap

NASA Astrophysics Data System (ADS)

Mori, Takahiro; Morita, Yukinori; Miyata, Noriyuki; Migita, Shinji; Fukuda, Koichi; Mizubayashi, Wataru; Masahara, Meishoku; Yasuda, Tetsuji; Ota, Hiroyuki

2015-02-01

The temperature dependence of the tunneling transport characteristics of Si diodes with an isoelectronic impurity has been investigated in order to clarify the mechanism of the ON-current enhancement in Si-based tunnel field-effect transistors (TFETs) utilizing an isoelectronic trap (IET). The Al-N complex impurity was utilized for IET formation. We observed three types of tunneling current components in the diodes: indirect band-to-band tunneling (BTBT), trap-assisted tunneling (TAT), and thermally inactive tunneling. The indirect BTBT and TAT current components can be distinguished with the plot described in this paper. The thermally inactive tunneling current probably originated from tunneling consisting of two paths: tunneling between the valence band and the IET trap and tunneling between the IET trap and the conduction band. The probability of thermally inactive tunneling with the Al-N IET state is higher than the others. Utilization of the thermally inactive tunneling current has a significant effect in enhancing the driving current of Si-based TFETs.

Effects of magnesium-based hydrogen storage materials on the thermal decomposition, burning rate, and explosive heat of ammonium perchlorate-based composite solid propellant.

PubMed

Liu, Leili; Li, Jie; Zhang, Lingyao; Tian, Siyu

2018-01-15

MgH 2 , Mg 2 NiH 4 , and Mg 2 CuH 3 were prepared, and their structure and hydrogen storage properties were determined through X-ray photoelectron spectroscopy and thermal analyzer. The effects of MgH 2 , Mg 2 NiH 4 , and Mg 2 CuH 3 on the thermal decomposition, burning rate, and explosive heat of ammonium perchlorate-based composite solid propellant were subsequently studied. Results indicated that MgH 2 , Mg 2 NiH 4 , and Mg 2 CuH 3 can decrease the thermal decomposition peak temperature and increase the total released heat of decomposition. These compounds can improve the effect of thermal decomposition of the propellant. The burning rates of the propellant increased using Mg-based hydrogen storage materials as promoter. The burning rates of the propellant also increased using MgH 2 instead of Al in the propellant, but its explosive heat was not enlarged. Nonetheless, the combustion heat of MgH 2 was higher than that of Al. A possible mechanism was thus proposed. Copyright © 2017. Published by Elsevier B.V.

Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

PubMed

Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

2017-06-01

A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

Toward Improved Fidelity of Thermal Explosion Simulations

NASA Astrophysics Data System (ADS)

Nichols, Albert; Becker, Richard; Burnham, Alan; Howard, W. Michael; Knap, Jarek; Wemhoff, Aaron

2009-06-01

We present results of an improved thermal/chemical/mechanical model of HMX based explosives like LX04 and LX10 for thermal cook-off. The original HMX model and analysis scheme were developed by Yoh et.al. for use in the ALE3D modeling framework. The improvements were concentrated in four areas. First, we added porosity to the chemical material model framework in ALE3D used to model HMX explosive formulations to handle the roughly 2% porosity in solid explosives. Second, we improved the HMX reaction network, which included the addition of a reactive phase change model base on work by Henson et.al. Third, we added early decomposition gas species to the CHEETAH material database to improve equations of state for gaseous intermediates and products. Finally, we improved the implicit mechanics module in ALE3D to more naturally handle the long time scales associated with thermal cookoff. The application of the resulting framework to the analysis of the Scaled Thermal Explosion (STEX) experiments will be discussed.

Assesment of influncing factors on mechanical and electrical properties of Al/Cu joints

NASA Astrophysics Data System (ADS)

Selvaraj, R. Meby; Hynes, N. Rajesh Jesudoss

2018-05-01

Joining of dissimilar materials opens up challenging opportunities in todays technology. Al/Cu weldments are used in applications that demands corrosion resistance, thermal and electrical conducting properties. In dissimilar joining mechanical and thermal properties result in large stress gradients during heating. The Al-Cu joints are lighter, cheaper and have conductivity equal to copper alloy. The main scope of this study is to assess the influencing factors of Al/Cu joints in mechanical and electrical properties. It includes the influence of the dilution between the base metals, influence of physical properties, influence of welding parameters, influence of filler metal, influence of heat treatment, and influence of electrical properties

Review of Thermal Spray Coating Applications in the Steel Industry: Part 2—Zinc Pot Hardware in the Continuous Galvanizing Line

NASA Astrophysics Data System (ADS)

Matthews, S.; James, B.

2010-12-01

This two-part article series reviews the application of thermal spray coating technology in the production of steel and steel sheet products. Part 2 of this article series is dedicated to coating solutions in the continuous galvanizing line. The corrosion mechanisms of Fe- and Co-based bulk materials are briefly reviewed as a basis for the development of thermal spray coating solutions. WC-Co thermal spray coatings are commonly applied to low Al-content galvanizing hardware due to their superior corrosion resistance compared to Fe and Co alloys. The effect of phase degradation, carbon content, and WC grain size are discussed. At high Al concentrations, the properties of WC-Co coatings degrade significantly, leading to the application of oxide-based coatings and corrosion-resistant boride containing coatings. The latest results of testing are summarized, highlighting the critical coating parameters.

Quantifying Cyclic Thermal Stresses Due to Solar Exposure in Rock Fragments in Gale Crater, Mars

NASA Astrophysics Data System (ADS)

Hallet, B.; Mackenzie-Helnwein, P.; Sletten, R. S.

2017-12-01

Curiosity and earlier rovers on Mars have revealed in detail rocky landscapes with decaying outcrops, rubble, stone-littered regolith, and bedrock exposures that reflect the weathering processes operating on rock exposed to Mars' cold and hyperarid environment. Evidence from diverse sources points to the importance of thermal stresses driven by cyclic solar exposure in contributing to the mechanical weathering of exposed rock and generation of regolith in various settings on Earth [1,2,3], and even more so on extraterrestrial bodies where large, rapid cyclic temperature variations are frequent (e.g. Mars [4], as well as comets [5], asteroids [6] and other airless bodies [7]). To study these thermal stresses, we use a 3d finite element (FE) model constrained by ground-based surface temperature measurements from Curiosity's Environmental Monitoring Station (REMS). The numerical model couples radiation and conduction with elastic response to determine the temperature and stress fields in individual rocks on the surface of Mars based on rock size and thermo-mechanical properties. We provide specific quantitative results for boulder-size basalt rocks resting on the ground using a realistic thermal forcing that closely matches the REMS temperature observations, and related thermal inertia data. Moreover, we introduce analytical studies showing that these numerical results can readily be generalized. They are quite universal, informing us about thermal stresses due to cyclic solar exposure in general, for rock fragments of different sizes, lithologies, and fracture- thermal- and mechanical-properties. Using Earth-analogue studies to gain insight, we also consider how the shapes, fractures, and surface details of rock fragments imaged by Curiosity likely reflect the importance of rock breakdown due to thermal stresses relative to wind-driven rock erosion and other surface processes on Mars. References:[1] McFadden L et al. (2005) Geol. Soc.Am. Bull. 117(1-2): 161-173 [2] Collins and Stock (2016) Nature Geoscience 9: 395-400 [3] Eppes M C et al. (2016) Geol. Soc.Am. Bull. 128(9-10), 1315-1338. [4] Eppes M C et al. (2015) Nature Communications 6:6712 [5] El-Maarry M R et al. (2015) Geophys. Res. Lett. 42:5170-5178 [6] Delbo M et al. (2014) Nature 508(7495): 233-236 [7] Molaro J L et al. (2017) Icarus 294, 247-261

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peter, William H.; Nandwana, Peeyush; Kirka, Michael M.

In this project, Avure and ORNL evaluated the influence of hot isostatic pressing (HIP) and thermal cycling as standalone post processing techniques on the microstructure of electron beam powder bed deposited Ti-6Al-4V and Inconel 718 alloys. Electron beam powder bed deposition is an effective technology for fabricating complex net shape components that cannot be manufactured with conventional processes. However, material deposited by this technology results in columnar grain growth which is detrimental for many applications. For Ti-6Al-4V, it has been found that thermal cycling alone is not sufficient to breakdown the columnar microstructure that is typical of electron beam powdermore » bed technology. HIP, on the other hand, has the potential to be an effective technique to break down the columnar microstructure of Ti-6Al-4V into a more equiaxed and refined β grain structure, and provide a more homogeneous microstructure compared to the thermally cycled samples. Overall, the project showed that hot isostatic pressing reduced/eliminated porosity in both Ti-6Al-4V and Inconel 718 However, based on the unique thermal cycle and the application of pressure in the HIP vessel, Ti-6Al-4V e-beam deposited microstructures were modified from columnar grain growth to equiaxed microstructures; a significant outcome to this collaboration. Inconel 718, on the other hand, shows no change in the macrostructure as a result of the current HIP cycle based on the thermal history, and would require further investigation. Though the results of HIP cycle were very good at changing the microstructure, further development in optimizing the post heat treatments and HIP cycles is required to improve mechanical properties.« less

Investigation on thermo physical characteristics of ethylene glycol based Al:ZnO nanofluids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiruba, R., E-mail: krbranjini@gmail.com, E-mail: drkingson@karunya.edu; George, Ritty; Gopalakrishnan, M.

2015-06-24

The present work describes the experimental aspects of viscosity and thermal conductivity characteristics of nanofluids. Aluminium doped zinc oxide nanostructures were synthesized by chemical precipitation method. Ultrasonic technique is used to disperse the nanostructures in ethylene glycol. Structural and morphological properties of Al doped ZnO nanostructures are characterized using X-ray diffractometer and scanning electron microscopic technique. The effect of concentration and temperature on thermo-physical properties of Al/ZnO nanofluids is also investigated. The experimental results showed there is enhancement in thermal conductivity with rise in temperature which can be utilized for coolant application.

Improvement of Corrosion Resistance of Binary Mg-Ca Alloys Using Duplex Aluminum-Chromium Coatings

NASA Astrophysics Data System (ADS)

Daroonparvar, Mohammadreza; Yajid, Muhamad Azizi Mat; Yusof, Noordin Mohd; Bakhsheshi-Rad, Hamid Reza; Adabi, Mohsen; Hamzah, Esah; Kamali, Hussein Ali

2015-07-01

Al-AlCr was coated on Mg-Ca and Mg-Zn-Ce-La alloys using physical vapor deposition method. The surface morphology of the specimens was characterized by x-ray diffraction, scanning electron microscopy equipped with energy-dispersive x-ray spectroscopy, and atomic force microscopy (AFM). The AFM results indicated that the average surface roughness of Al-AlCr coating on the Mg-Ca alloy is much lower than that of Al-AlCr coating on the Mg-Zn-Ce-La alloy. However, Al-AlCr coating on the Mg-Ca alloy presented a more compact structure with fewer pores, pinholes, and cracks than Al-AlCr coating on the Mg-Zn-Ce-La alloy. Electrochemical studies revealed that the novel coating (Al-AlCr) can remarkably reduce the corrosion rate of the Mg-Ca alloy in 3.5 wt.% NaCl solution. It was seen that the anodic current density of the Al-AlCr-coated Mg-Ca alloy was very small when compared to the Al-AlCr-coated Mg-Zn-Ce-La and uncoated alloys. Impedance modulus ( Z) of the Al-AlCr-coated samples was higher than that of the bare Mg alloys. Z of Al-AlCr-coated Mg-Ca alloy was higher than that of the Al-AlCr-coated Mg-Zn-Ce-La alloy at low frequency.

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

PubMed

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

PubMed

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III-aided cycling amplification.

PubMed

Zeng, Yan; Wan, Yi; Zhang, Dun; Qi, Peng

2015-01-01

A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III (Exo-III) aided cycling amplification has been developed. This magneto-DNA duplex probe contains a partly hybrid fluorophore-modified capture probe and a fluorophore-modified signal probe with magnetic microparticle as carrier. In the presence of a perfectly matched target bacterial DNA, blunt 3'-terminus of the capture probe is formed, activating the Exo-III aided cycling amplification. Thus, Exo-III catalyzes the stepwise removal of mononucleotides from this terminus, releasing both fluorophore-modified signal probe, fluorescent dyes of the capture probe and target DNA. The released target DNA then starts a new cycle, while released fluorescent fragments are recovered with magnetic separation for fluorescence signal collection. This system exhibited sensitive detection of bacterial DNA, with a detection limit of 14 pM because of the unique cleavage function of Exo-III, high fluorescence intensity, and separating function of magneto-DNA duplex probes. Besides this sensitivity, this strategy exhibited excellent selectivity with mismatched bacterial DNA targets and other bacterial species targets and good applicability in real seawater samples, hence, this strategy could be potentially used for qualitative and quantitative analysis of bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

PubMed Central

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Cyclic oxidation of cobalt-chromium-aluminum-yttrium and aluminide coatings on IN-100 and VIA alloys in high velocity gases

NASA Technical Reports Server (NTRS)

Deadmore, D. L.

1972-01-01

Embedded-alumina-particle aluminide (EAPA) coated and CoCrAlY coated IN-100 and NASA-TRW-VIA specimens were cyclically oxidation tested in a high velocity (approximately Mach 1) gas flame at 1093 C (2000 F). The EAPA coatings on both alloys performed very similarly to commercial pack aluminide coatings with respect to weight change and thermal fatigue cracking. The CoCrAlY coating on IN-100 had weight changes similar to commercial pack aluminide coatings but no thermal fatigue cracks appeared at 300 hours. The CoCrAlY coating on VIA performed significantly better than the commercial aluminide coatings, providing oxidation protection (based on weight change) to 450 hours and thermal fatigue crack prevention to at least 600 hours.

Factors influencing the thermally-induced strength degradation of B/Al composites

NASA Technical Reports Server (NTRS)

Dicarlo, J. A.

1982-01-01

Literature data related to the thermally-induced strength degradation of B/Al composites were examined in the light of fracture theories based on reaction-controlled fiber weakening. Under the assumption of a parabolic time-dependent growth for the interfacial reaction product, a Griffith-type fracture model was found to yield simple equations whose predictions were in good agreement with data for boron fiber average strength and for B/Al axial fracture strain. The only variables in these equations were the time and temperature of the thermal exposure and an empirical factor related to fiber surface smoothness prior to composite consolidation. Such variables as fiber diameter and aluminum alloy composition were found to have little influence. The basic and practical implications of the fracture model equations are discussed.

Zoster duplex: a clinical report and etiologic analysis.

PubMed

Zhang, Feng; Zhou, Jin

2015-01-01

Herpes zoster (HZ) duplex is a rare disease presentation. The mechanisms of varicella zoster virus (VZV) reactivation in multiple dermal regions are unknown. To present a HZ duplex case occurring in an immunocompetent woman and to analyze the possible underlying causes of HZ duplex. We present a HZ duplex case in an immunocompetent woman and analyzed the possible contributing factors in 36 HZ duplex cases. Continuously distributed variables were categorized by numbers and percentages. In our study, 24 cases (66.7%) were from Asia, 16 cases (44.4%) were in individuals ≥ 50 years of age, and 17 cases (47.2%) occurred in immunocompromised patients. Of the 36 cases, 23 involved women (63.9%) and 13 involved men. Eighteen patients suffering from HZ duplex, 13 of which were women (72.2%), did not suffer from any chronic systemic disease or have a long history of taking drugs. HZ duplex is a rare event that can occur in both immunocompetent and immunosuppressed individuals. HZ duplex might be associated with the Asia region, advanced age, immunosuppression, and being female.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zou, Yun; Zhang, Lehao; Li, Yang

Limitations of strength and formability are the major obstacles to the industrial application of magnesium alloys. Here, we demonstrate, by producing the duplex phases and fine intermetallic particles in composition-optimized superlight Mg-Li-Al alloys, a unique approach to simultaneously improve the comprehensive mechanical properties (a strength-ductility balance). In conclusion, the phase components and microstructures, including the size, morphology, and distribution of precipitated-intermetallic particles can be optimized by tuning the Li content, which strongly influences the work-hardening behavior and tension-compression yield asymmetry.

Short-range forecast of Shershnevskoie (South Ural) water-storage algal blooms: preliminary results of predictors' choosing and membership functions' construction

NASA Astrophysics Data System (ADS)

Gayazova, Anna; Abdullaev, Sanjar

2014-05-01

Short-range forecasting of algal blooms in drinking water reservoirs and other waterbodies is an actual element of water treatment system. Particularly, Shershnevskoie reservoir - the source of drinking water for Chelyabinsk city (South Ural region of Russia) - is exposed to interannual, seasonal and short-range fluctuations of blue-green alga Aphanizomenon flos-aquae and other dominant species abundance, which lead to technological problems and economic costs and adversely affect the water treatment quality. Whereas the composition, intensity and the period of blooms affected not only by meteorological seasonal conditions but also by ecological specificity of waterbody, that's important to develop object-oriented forecasting, particularly, search for an optimal number of predictors for such forecasting. Thereby, firstly fuzzy logic and fuzzy artificial neural network patterns for blue-green alga Microcystis aeruginosa (M. aeruginosa) blooms prediction in nearby undrained Smolino lake were developed. These results subsequently served as the base to derive membership functions for Shernevskoie reservoir forecasting patterns. Time series with the total lenght about 138-159 days of dominant species seasonal abundance, water temperature, cloud cover, wind speed, mineralization, phosphate and nitrate concentrations were obtained through field observations held at Lake Smolino (Chelyabinsk) in the warm season of 2009 and 2011 with time resolution of 2-7 days. The cross-correlation analysis of the data revealed the potential predictors of M. aeruginosa abundance quasi-periodic oscillations: green alga Pediastrum duplex (P. duplex) abundance and mineralization for 2009, P. duplex abundance, water temperature and concentration of nitrates for 2011. According to the results of cross-correlation analysis one membership function "P. duplex abundance" and one rule linking M. aeruginosa and P. duplex abundances were set up for database of 2009. Analogically, for database of 2011 three rules, linking membership functions of temperature, P. duplex abundance, nitrate concentration and M. aeruginosa abundance were set up. Developed fuzzy logic rules were good to predict M. aeruginosa intense outbreaks. For ANN method of forecasting specially written program was used to train the fuzzy artificial neural network on number of input selected predictors' values and output predicted factor's values to set up the predictive rules and membership functions automatically. As a result, two models based on mineralization and P. duplex abundance were developed for 2009. For 2011 four patterns were developed, the best result was obtained for model based on temperature and P. duplex abundance. Developed methods of forecasting were applied to predict outbreaks of Aphanizomenon flos-aquae and M. aeruginosa abundance in Shershnevskoie reservoir. For this purpose long-term data of chemical parameters, measured once in a month, data of dominant species abundance, measured fifth in a week and data of turbidity, water color, alkalinity, pH, obtained each day, were analyzed. Based on these empirical data significant factors were determined, membership functions were set up and preliminary models for Shershnevskoie reservoir were developed. As expected, these models differ significantly from developed for Smolino lake ones and should be tested on new data sets.

Mg2+ Effect on Argonaute and RNA Duplex by Molecular Dynamics and Bioinformatics Implications

PubMed Central

Nam, Seungyoon; Ryu, Hyojung; Son, Won-joon; Kim, Yon Hui; Kim, Kyung Tae; Balch, Curt; Nephew, Kenneth P.; Lee, Jinhyuk

2014-01-01

RNA interference (RNAi), mediated by small non-coding RNAs (e.g., miRNAs, siRNAs), influences diverse cellular functions. Highly complementary miRNA-target RNA (or siRNA-target RNA) duplexes are recognized by an Argonaute family protein (Ago2), and recent observations indicate that the concentration of Mg2+ ions influences miRNA targeting of specific mRNAs, thereby modulating miRNA-mRNA networks. In the present report, we studied the thermodynamic effects of differential [Mg2+] on slicing (RNA silencing cycle) through molecular dynamics simulation analysis, and its subsequent statistical analysis. Those analyses revealed different structural conformations of the RNA duplex in Ago2, depending on Mg2+ concentration. We also demonstrate that cation effects on Ago2 structural flexibility are critical to its catalytic/functional activity, with low [Mg2+] favoring greater Ago2 flexibility (e.g., greater entropy) and less miRNA/mRNA duplex stability, thus favoring slicing. The latter finding was supported by a negative correlation between expression of an Mg2+ influx channel, TRPM7, and one miRNA’s (miR-378) ability to downregulate its mRNA target, TMEM245. These results imply that thermodynamics could be applied to siRNA-based therapeutic strategies, using highly complementary binding targets, because Ago2 is also involved in RNAi slicing by exogenous siRNAs. However, the efficacy of a siRNA-based approach will differ, to some extent, based on the Mg2+ concentration even within the same disease type; therefore, different siRNA-based approaches might be considered for patient-to-patient needs. PMID:25330448

Rare-earth metals in nickel aluminide-based alloys: III. Structure and properties of multicomponent Ni3Al-based alloys

NASA Astrophysics Data System (ADS)

Bazyleva, O. A.; Povarova, K. B.; Kazanskaya, N. K.; Drozdov, A. A.

2009-04-01

The possibility of increasing the life of heterophase cast light Ni3Al-based superalloys at temperatures higher than 0.8 T m of Ni3Al is studied when their directional structure is additionally stabilized by nanoprecipitates, which form upon additional alloying of these alloys by refractory and active metals, and using special methods for preparing and melting of an alloy charge. The effect of the method of introducing the main components and refractory reaction-active and surface-active alloying elements into Ni3Al-based cast superalloys, which are thermally stable natural composite materials of the eutectic type, on the structure-phase state and the life of these alloys is studied. When these alloys are melted, it is necessary to perform a set of measures to form particles of refractory oxide cores covered with the β-NiAl phase and, then, γ'prim-Ni3Al phase precipitates during solidification. The latter phase forms the outer shell of grain nuclei, which provides high thermal stability and hot strength of an intermetallic compound-based alloy. As a result, a modified structure that is stabilized by the nanoprecipitates of nickel and aluminum lanthanides and the nanoprecipitates of phases containing refractory metals is formed. This structure enhances the life of the alloy at 1000 °C by a factor of 1.8-2.5.

Multistory duplexes with forward dipping roofs, north central Brooks Range, Alaska

USGS Publications Warehouse

Wallace, W.K.; Moore, Thomas E.; Plafker, G.

1997-01-01

The Endicott Mountains allochthon has been thrust far northward over the North Slope parautochthon in the northern Brooks Range. Progressively younger units are exposed northward within the allochthon. To the south, the incompetent Hunt Fork Shale has thickened internally by asymmetric folds and thrust faults. Northward, the competent Kanayut Conglomerate forms a duplex between a floor thrust in Hunt Fork and a roof thrust in the Kayak Shale. To the north, the competent Lisburne Group forms a duplex between a floor thrust in Kayak and a roof thrust in the Siksikpuk Formation. Both duplexes formed from north vergent detachment folds whose steep limbs were later truncated by south dipping thrust faults that only locally breach immediately overlying roof thrusts. Within the parautochthon, the Kayak, Lisburne, and Siksikpuk-equivalent Echooka Formation form a duplex identical to that in the allochthon. This duplex is succeeded abruptly northward by detachment folds in Lisburne. These folds are parasitic to an anticlinorium interpreted to reflect a fault-bend folded horse in North Slope "basement," with a roof thrust in Kayak and a floor thrust at depth. These structures constitute two northward tapered, internally deformed wedges that are juxtaposed at the base of the allochthon. Within each wedge, competent units have been shortened independently between detachments, located mainly in incompetent units. The basal detachment of each wedge cuts upsection forward (northward) to define a wedge geometry within which units dip regionally forward. These dips reflect forward decrease in internal structural thickening by forward vergent folds and hindward dipping thrust faults. Copyright 1997 by the American Geophysical Union.

Laser Cladding of γ-TiAl Intermetallic Alloy on Titanium Alloy Substrates

NASA Astrophysics Data System (ADS)

Maliutina, Iuliia Nikolaevna; Si-Mohand, Hocine; Piolet, Romain; Missemer, Florent; Popelyukh, Albert Igorevich; Belousova, Natalya Sergeevna; Bertrand, Philippe

2016-01-01

The enhancement of titanium and titanium alloy's tribological properties is of major interest in many applications such as the aerospace and automotive industry. Therefore, the current research paper investigates the laser cladding of Ti48Al2Cr2Nb powder onto Ti6242 titanium alloy substrates. The work was carried out in two steps. First, the optimal deposition parameters were defined using the so-called "combined parameters," i.e., the specific energy E specific and powder density G. Thus, the results show that those combined parameters have a significant influence on the geometry, microstructure, and microhardness of titanium aluminide-formed tracks. Then, the formation of dense, homogeneous, and defect-free coatings based on optimal parameters has been investigated. Optical and scanning electron microscopy techniques as well as energy-dispersive spectroscopy and X-ray diffraction analyses have shown that a duplex structure consisting of γ-TiAl and α 2-Ti3Al phases was obtained in the coatings during laser cladding. Moreover, it was shown that produced coatings exhibit higher values of microhardness (477 ± 9 Hv0.3) and wear resistance (average friction coefficient is 0.31 and volume of worn material is 5 mm3 after 400 m) compared to those obtained with bare titanium alloy substrates (353 Hv0.3, average friction coefficient is 0.57 and a volume of worn material after 400 m is 35 mm3).

G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

PubMed Central

Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

2015-01-01

The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

Triplex-forming oligonucleotides: a third strand for DNA nanotechnology

PubMed Central

2018-01-01

Abstract DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical (‘triplex’) structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone. PMID:29228337

Nucleic acid duplexes incorporating a dissociable covalent base pair

PubMed Central

Gao, Kui; Orgel, Leslie E.

1999-01-01

We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing

DTIC Science & Technology

2008-01-01

complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING

The Effect of Al2O3 Addition on the Thermal Diffusivity of Heat Activated Acrylic Resin

PubMed Central

Atla, Jyothi; Manne, Prakash; Gopinadh, A.; Sampath, Anche; Muvva, Suresh Babu; Kishore, Krishna; Sandeep, Chiramana; Chittamsetty, Harika

2013-01-01

Aim: This study aimed at investigating the effect of adding 5% to 20% by weight aluminium oxide powder (Al2O3) on thermal diffusivity of heat–polymerized acrylic resin. Material and Methods: Twenty five cylindrical test specimens with an embedded thermocouple were used to determine thermal diffusivity over a physiologic temperature range (0 to 70°C). The specimens were divided into five groups (5 specimens/group) which were coded A to E. Group A was the control group (unmodified acrylic resin specimens). The specimens of the remaining four groups were reinforced with 5%, 10%, 15%, and 20% Al2O3 by weight. Results were analysed by using one–way analysis of variance (ANOVA). Results: Test specimens which belonged to Group E showed the highest mean thermal diffusivity value of 10.7mm2/sec, followed by D (9.09mm2/sec), C (8.49mm2/sec), B(8.28mm2/sec) and A(6.48mm2/sec) groups respectively. Thermal diffusivities of the reinforced acrylic resins were found to be significantly higher than that of the unmodified acrylic resin. Thermal diffusivity was found to increase in proportion to the weight percentage of alumina filler. Conclusion: Al2O3 fillers have potential to provide increased thermal diffusivity. Increasing the heat transfer characteristics of the acrylic resin base material could lead to more patient satisfaction. PMID:24086917

Accurate Detection of Methicillin-Resistant Staphylococcus aureus in Mixtures by Use of Single-Bacterium Duplex Droplet Digital PCR.

PubMed

Luo, Jun; Li, Junhua; Yang, Hang; Yu, Junping; Wei, Hongping

2017-10-01

Accurate and rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) is needed to screen MRSA carriers and improve treatment. The current widely used duplex PCR methods are not able to differentiate MRSA from coexisting methicillin-susceptible S. aureus (MSSA) or other methicillin-resistant staphylococci. In this study, we aimed to develop a direct method for accurate and rapid detection of MRSA in clinical samples from open environments, such as nasal swabs. The new molecular assay is based on detecting the cooccurrence of nuc and mecA markers in a single bacterial cell by utilizing droplet digital PCR (ddPCR) with the chimeric lysin ClyH for cell lysis. The method consists of (i) dispersion of an intact single bacterium into nanoliter droplets, (ii) temperature-controlled release of genomic DNA (gDNA) by ClyH at 37°C, and (iii) amplification and detection of the markers ( nuc and mecA ) using standard TaqMan chemistries with ddPCR. Results were analyzed based on MRSA index ratios used for indicating the presence of the duplex-positive markers in droplets. The method was able to achieve an absolute limit of detection (LOD) of 2,900 CFU/ml for MRSA in nasal swabs spiked with excess amounts of Escherichia coli , MSSA, and other mecA -positive bacteria within 4 h. Initial testing of 104 nasal swabs showed that the method had 100% agreement with the standard culture method, while the normal duplex qPCR method had only about 87.5% agreement. The single-bacterium duplex ddPCR assay is rapid and powerful for more accurate detection of MRSA directly from clinical specimens. Copyright © 2017 American Society for Microbiology.

Accurate Detection of Methicillin-Resistant Staphylococcus aureus in Mixtures by Use of Single-Bacterium Duplex Droplet Digital PCR

PubMed Central

Luo, Jun; Li, Junhua; Yang, Hang; Yu, Junping

2017-01-01

ABSTRACT Accurate and rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) is needed to screen MRSA carriers and improve treatment. The current widely used duplex PCR methods are not able to differentiate MRSA from coexisting methicillin-susceptible S. aureus (MSSA) or other methicillin-resistant staphylococci. In this study, we aimed to develop a direct method for accurate and rapid detection of MRSA in clinical samples from open environments, such as nasal swabs. The new molecular assay is based on detecting the cooccurrence of nuc and mecA markers in a single bacterial cell by utilizing droplet digital PCR (ddPCR) with the chimeric lysin ClyH for cell lysis. The method consists of (i) dispersion of an intact single bacterium into nanoliter droplets, (ii) temperature-controlled release of genomic DNA (gDNA) by ClyH at 37°C, and (iii) amplification and detection of the markers (nuc and mecA) using standard TaqMan chemistries with ddPCR. Results were analyzed based on MRSA index ratios used for indicating the presence of the duplex-positive markers in droplets. The method was able to achieve an absolute limit of detection (LOD) of 2,900 CFU/ml for MRSA in nasal swabs spiked with excess amounts of Escherichia coli, MSSA, and other mecA-positive bacteria within 4 h. Initial testing of 104 nasal swabs showed that the method had 100% agreement with the standard culture method, while the normal duplex qPCR method had only about 87.5% agreement. The single-bacterium duplex ddPCR assay is rapid and powerful for more accurate detection of MRSA directly from clinical specimens. PMID:28724560

Long-range, full-duplex, modulated-reflector cell phone for voice/data transmission

DOEpatents

Neagley, Daniel L.; Briles, Scott D.; Coates, Don M.; Freund, Samuel M.

2002-01-01

A long-range communications apparatus utilizing modulated-reflector technology is described. The apparatus includes an energy-transmitting base station and remote units that do not emit radiation in order to communicate with the base station since modulated-reflector technology is used whereby information is attached to an RF carrier wave originating from the base station which is reflected by the remote unit back to the base station. Since the remote unit does not emit radiation, only a low-power power source is required for its operation. Information from the base station is transmitted to the remote unit using a transmitter and receiver, respectively. The range of such a communications system is determined by the properties of a modulated-reflector half-duplex link.

Synthesis and structures of a pincer-type rhodium(iii) complex: reactivity toward biomolecules.

PubMed

Milutinović, Milan M; Bogojeski, Jovana V; Klisurić, Olivera; Scheurer, Andreas; Elmroth, Sofi K C; Bugarčić, Živadin D

2016-10-04

A novel rhodium(iii) complex [Rh III (H 2 L tBu )Cl 3 ] (1) (H 2 L tBu = 2,6-bis(5-tert-butyl-1H-pyrazol-3-yl)pyridine) containing a pincer type, tridentate nitrogen-donor chelate system was synthesized. Single crystal X-ray structure analysis revealed that 1 crystallizes in the orthorhombic space group Pbcn with a = 20.7982(6), b = 10.8952(4), c = 10.9832(4) Å, V = 2488.80(15) Å 3 , and eight molecules in the unit cell. The rhodium center in the complex [Rh III (H 2 L tBu )Cl 3 ] (1) is coordinated in a slightly distorted octahedral geometry by the tridentate N,N,N-donor and three chloro ligands, adopting a mer arrangement with an essentially planar ligand skeleton. Due to the tridentate coordination of the N,N,N-donor, the central nitrogen atom N1 is located closer to the Rh III center. The reactivity of the synthesized complex toward small biomolecules (l-methionine (l-Met), guanosine-5'-monophosphate (5'-GMP), l-histidine (l-His) and glutathione (GSH)) and to a series of duplex DNAs and RNA was investigated. The order of reactivity of the studied small biomolecules is: 5'-GMP > GSH > l-Met > l-His. Duplex RNA reacts faster with the [Rh III (H 2 L tBu )Cl 3 ] complex than duplex DNA, while shorter duplex DNA (15mer GG) reacts faster compared with 22mer GG duplex DNA. In addition, a higher reactivity is achieved with a DNA duplex with a centrally located GG-sequence than with a 22GTG duplex DNA, in which the GG-sequence is separated by a T base. Furthermore, the interaction of this metal complex 1 with calf thymus DNA (CT-DNA) and bovine serum albumin (BSA) was examined by absorption (UV-Vis) and emission spectral studies (EthBr displacement studies). Overall, the studied complex exhibited good DNA and BSA interaction ability.

Effect of thermal fatigue on the structure and properties of Ni3Al-based alloy single crystals

NASA Astrophysics Data System (ADS)

Povarova, K. B.; Drozdov, A. A.; Bazyleva, O. A.; Bulakhtina, M. A.; Alad'ev, N. A.; Antonova, A. V.; Arginbaeva, E. G.; Morozov, A. E.

2014-05-01

The effect of thermal fatigue during tests of <001> and <111> single crystals according to the schedules 100 ai 850°C, 100 ai 1050°C, 100 ai 1100°C at a peak-to-peak stress Δσtc = 700-1000 MPa (sum of the maximum tensile and compressive stresses in a thermal cycle) on the structure, the fracture, and the fatigue life of an Ni3Al-based VKNA-1V alloy is studied. It is found that, at 103 thermal cycles, the <111> single crystals have the maximum thermal fatigue resistance at the maximum cycle temperature of 850 and 1050°C, and the properties of the <001> and <111> samples are almost the same at the maximum thermal cycle temperature of 1100°C. After thermal cycling at the maximum temperature of 850°C, the γ layers in the two-phase γ' + γ region in dendrites remain a single-phase structure, as in the as-cast material, and the layer thickness is 100-150 nm. When the maximum thermal cycle temperature increases to 1050 or 1100°C, the discontinuous γ-phase layers in the γ'(Ni3Al) matrix change their morphology and become shorter and wider (their thickness is 300-700 nm). The nickel-based supersaturated solid solution in these layers decomposes with the formation of secondary γ'(Ni3Al)-phase (γ'sec) precipitates in the form of cuboids 50 and 100 nm in size at the maximum cycle temperature of 1050 and 1100°C, respectively. The alternating stresses that appear during thermal cycling cause plastic deformation. As in nickel superalloys, this deformation at the first stage proceeds via the slip of screw dislocations along octahedral {111} planes. Networks of 60° dislocation segments form at γ'/γ interfaces in this case. Fracture begins at the lines of intersection of the slip planes of the {111} octahedron with the sample surface. During fractional, a crack passes from one octahedral plane to another and forms terraces and steps (crystallographic fracture); as a result, the fracture surface bends and becomes curved. In all cases, the fracture surfaces have a mixed brittle-ductile character with a combination of crystallographic and ductile (dimple) fracture elements.

Thermodynamic and structural characterization of 2′-nitrogen-modified RNA duplexes

PubMed Central

Pham, John W.; Radhakrishnan, Ishwar; Sontheimer, Erik J.

2004-01-01

2′-aminonucleosides are commonly used as sites of post-synthetic chemical modification within nucleic acids. As part of a larger cross-linking strategy, we appended alkyl groups onto the N2′ position of 2′-amino-modified RNAs via 2′-ureido and 2′-amido linkages. We have characterized the thermodynamics of 2′-amino, 2′-alkylamido and 2′-alkylureido-modified RNA duplexes and show that 2′-ureido-modified RNAs are significantly more stable than analogous 2′-amido-modified RNAs. Using NMR spectroscopy and NMR-based molecular modeling of 2′-modified RNA duplexes, we examined the effects that 2′-nitrogen modifications have on RNA helices. Our data suggest that the 2′-ureido group forms a specific intra-nucleoside interaction that cannot occur within 2′-amido-modified helices. These results indicate that 2′-ureido modifications are superior to analogous 2′-amido ones for applications that require stable base pairing. PMID:15247335

Duplexed sandwich immunoassays on a fiber-optic microarray.

PubMed

Rissin, David M; Walt, David R

2006-03-30

In this paper, we describe a duplexed imaging optical fiber array-based immunoassay for immunoglobulin A (IgA) and lactoferrin. To fabricate the individually addressable array, microspheres were functionalized with highly specific monoclonal antibodies. The microspheres were loaded in microwells etched into the distal face of an imaging optical fiber bundle. Two microsphere-based sandwich immunoassays were developed to simultaneously detect IgA and lactoferrin, two innate immune system proteins found in human saliva. Individual microspheres could be interrogated for the simultaneous measurement of both proteins. The working concentration range for IgA detection was between 700 pM and 100 nM, while the working concentration range for lactoferrin was between 385 pM and 10 nM. The cross-reactivity between detection antibodies and their non-specific targets was relatively low in comparison to the signal generated by the specific binding with their targets. These results suggest that the degree of multiplexing on this fiber-optic array platform can be increased beyond a duplex.

Manufacture and engine test of advanced oxide dispersion strengthened alloy turbine vanes. [for space shuttle thermal protection

NASA Technical Reports Server (NTRS)

Bailey, P. G.

1977-01-01

Oxide-Dispersion-strengthened (ODS) Ni-Cr-Al alloy systems were exploited for turbine engine vanes which would be used for the space shuttle thermal protection system. Available commercial and developmental advanced ODS alloys were evaluated, and three were selected based on established vane property goals and manufacturing criteria. The selected alloys were evaluated in an engine test. Candidate alloys were screened by strength, thermal fatigue resistance, oxidation and sulfidation resistance. The Ni-16Cr (3 to 5)Al-ThO2 system was identified as having attractive high temperature oxidation resistance. Subsequent work also indicated exceptional sulfidation resistance for these alloys.

Improved toughness of silicon carbide

NASA Technical Reports Server (NTRS)

Palm, J. A.

1976-01-01

Impact energy absorbing layers (EALs) comprised of partially densified silicon carbide were formed in situ on fully sinterable silicon carbide substrates. After final sintering, duplex silicon carbide structures resulted which were comprised of a fully sintered, high density silicon carbide substrate or core, overlayed with an EAL of partially sintered silicon carbide integrally bonded to its core member. Thermal cycling tests proved such structures to be moderately resistant to oxidation and highly resistant to thermal shock stresses. The strength of the developed structures in some cases exceeded but essentially it remained the same as the fully sintered silicon carbide without the EAL. Ballistic impact tests indicated that substantial improvements in the toughness of sintered silicon carbide were achieved by the use of the partially densified silicon carbide EALs.

Direct duplex real-time loop mediated isothermal amplification assay for the simultaneous detection of cow and goat species origin of milk and yogurt products for field use.

PubMed

Kim, Mi-Ju; Kim, Hae-Yeong

2018-04-25

A multiple loop-mediated isothermal amplification (LAMP) method was developed to detect cow and goat milk in the field using a portable fluorescence device. For rapid on-site detection, this duplex LAMP assay was used in combination with direct amplification, without DNA extraction. The cow- and goat-specific LAMP primer sets were designed based on the mitochondrial cytochrome b gene, and showed specificity against 13 other animal species in the reactions. The sensitivity of the duplex LAMP assay for cow and goat was 0.1 and 1 pg, respectively. The detection limit for both target species in milk mixtures was 2%. This assay successfully amplified and identified the two target species in 24 samples of commercial milk and yogurt products, with 30 min sampling-to-result analysis time. Therefore, this direct duplex real-time LAMP assay is useful for on-site simultaneous detection of cow and goat milk in commercial products, a capability needed to confirm accurate labeling. Copyright © 2017 Elsevier Ltd. All rights reserved.

Clinical utility of carotid duplex ultrasound prior to cardiac surgery.

PubMed

Lin, Judith C; Kabbani, Loay S; Peterson, Edward L; Masabni, Khalil; Morgan, Jeffrey A; Brooks, Sara; Wertella, Kathleen P; Paone, Gaetano

2016-03-01

Clinical utility and cost-effectiveness of carotid duplex examination prior to cardiac surgery have been questioned by the multidisciplinary committee creating the 2012 Appropriate Use Criteria for Peripheral Vascular Laboratory Testing. We report the clinical outcomes and postoperative neurologic symptoms in patients who underwent carotid duplex ultrasound prior to open heart surgery at a tertiary institution. Using the combined databases from our clinical vascular laboratory and the Society of Thoracic Surgery, a retrospective analysis of all patients who underwent carotid duplex ultrasound within 13 months prior to open heart surgery from March 2005 to March 2013 was performed. The outcomes between those who underwent carotid duplex scanning (group A) and those who did not (group B) were compared. Among 3233 patients in the cohort who underwent cardiac surgery, 515 (15.9%) patients underwent a carotid duplex ultrasound preoperatively, and 2718 patients did not (84.1%). Among the patients who underwent carotid screening vs no screening, there was no statistically significant difference in the risk factors of cerebrovascular disease (10.9% vs 12.7%; P = .26), prior stroke (8.2% vs 7.2%; P = .41), and prior transient ischemic attack (2.9% vs 3.3%; P = .24). For those undergoing isolated coronary artery bypass grafting (CABG), 306 (17.8%) of 1723 patients underwent preoperative carotid duplex ultrasound. Among patients who had carotid screening prior to CABG, the incidence of carotid disease was low: 249 (81.4%) had minimal or mild stenosis (<50%); 25 (8.2%) had unilateral moderate stenosis (50%-69%); 10 (3.3%) had bilateral moderate stenosis; 9 (2.9%) had unilateral severe stenosis (70%-99%); 5 (1.6%) had contralateral moderate stenosis; 2 (0.7%) had bilateral severe stenosis; 4 (1.3%) had unilateral occluded with contralateral less than 50% stenosis, 1 (0.3%) had unilateral occluded with contralateral (70%-99%) stenosis; and 1 had bilateral occluded carotid arteries. Primary outcomes of patients who underwent isolated CABG showed no difference in the perioperative mortality (2.9% vs 4.3%; P = .27) and stroke (2.9% vs 2.6%; P = .70) between patients undergoing preoperative duplex scanning and those who did not. Primary outcomes of patients who underwent open heart surgery also showed no difference in the perioperative mortality (5.1% vs 6.9%; P = .14) and stroke (2.6% vs 2.4%; P = .85) between patients undergoing preoperative duplex scanning and those who did not. Operative intervention of severe carotid stenosis prior to isolated CABG occurred in 2 of the 17 patients (11.8%) identified who underwent carotid endarterectomy with CABG. In this study, the correlation between preoperative duplex-documented high-grade carotid stenosis and postoperative stroke was low. Prudent use of preoperative carotid duplex ultrasound should be based on the presence of cerebrovascular symptoms and the type of open heart surgery. Copyright © 2016 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Parameter optimization and evaluation of mechanical and thermal properties of nanographene reinforced Al 6060 surface composite using FSP

NASA Astrophysics Data System (ADS)

Kalyanamanohar, V.; Appalachari, D. Gireesh Chandra

2018-04-01

Friction stir processing (FSP) is emerging as a promising technique for making surface composites. FSP can improve surface properties such as hardness, strength, ductility, corrosion resistance, fatigue life and formability without affecting the bulk properties of the material. The literatures reported that FSP can produces very fine equiaxed and homogeneous grain structure for different Al alloys. Al 6060 is heat treatable alloy which has high thermal and electrical properties than remaining Al alloys. Al 6060 is being used where high rate of heat exchange is needed i.e. engine cylinders, heat exchangers etc. As derived from the carbon materials, like graphene and CNTs dissipates heat rapidly that improves the life of the engine cylinders and heat exchangers. In this work, nanographene is reinforced in the Al 6060 using friction stir processing at different rotational speeds, traverse speeds, and at constant load and tool tilt angle. After processed, the effect of process parameters on microstructure of the surface composite was investigated. The SEM studies shows that the FSP produces very fine and homogenous grain structure and it is observed that smaller grain size structure is obtained at lower traverse speed and higher rotational speeds. Significant improvement in ultimate tensile strength(22.9%) and hardness (22.44%) when compared friction stir processed plate at 1400 rotational speed and 20mm/min traverse speed with base Al 6060 plate. Coefficient of thermal expansion test of nanographene reinforced Al 6060 shows 7.33% decrease in its coefficient of thermal expansion as graphene has tendency to reduce the anisotropic nature.

Factors influencing the thermally-induced strength degradation of B/Al composites

NASA Technical Reports Server (NTRS)

Dicarlo, J. A.

1983-01-01

Literature data related to the thermally-induced strength degradation of B/Al composites were examined in the light of fracture theories based on reaction-controlled fiber weakening. Under the assumption of a parabolic time-dependent growth for the interfacial reaction product, a Griffith-type fracture model was found to yield simple equations whose predictions were in good agreement with data for boron fiber average strength and for B/Al axial fracture strain. The only variables in these equations were the time and temperature of the thermal exposure and an empirical factor related to fiber surface smoothness prior to composite consolidation. Such variables as fiber diameter and aluminum alloy composition were found to have little influence. The basic and practical implications of the fracture model equations are discussed. Previously announced in STAR as N82-24297

Formation of Al15Mn3Si2 Phase During Solidification of a Novel Al-12%Si-4%Cu-1.2%Mn Heat-Resistant Alloy and Its Thermal Stability

NASA Astrophysics Data System (ADS)

Suo, Xiaojing; Liao, Hengcheng; Hu, Yiyun; Dixit, Uday S.; Petrov, Pavel

2018-02-01

The formation of Al15Mn3Si2 phase in Al-12Si-4Cu-1.2Mn (wt.%) alloy during solidification was investigated by adopting CALPHAD method and microstructural observation by optical microscopy, SEM-EDS, TEM-EDS/SAD and XRD analysis; SEM fixed-point observation method was applied to evaluate its thermal stability. As-cast microstructural observation consistently demonstrates the solidification sequence of the studied alloy predicted by phase diagram calculation. Based on the phase diagram calculation, SEM-EDS, TEM-EDS/SAD and XRD analysis, as well as evidences on Al-Si-Mn-Fe compounds from the literature, the primary and eutectic Mn-rich phases with different morphologies in the studied alloy are identified to be Al15Mn3Si2 that has a body-centered cubic (BCC) structure with a lattice constant of a = 1.352 nm. SEM fixed-point observation and XRD analysis indicate that Al15Mn3Si2 phase has more excellent thermal stability at high temperature than that of CuAl2 phase and can serve as the major strengthening phase in heat-resistant aluminum alloy that has to face a high-temperature working environment. Results of tension test show that addition of Mn can improve the strength of Al-Si-Cu alloy, especially at elevated temperature.

Ultra-short silicon MMI duplexer

NASA Astrophysics Data System (ADS)

Yi, Huaxiang; Huang, Yawen; Wang, Xingjun; Zhou, Zhiping

2012-11-01

The fiber-to-the-home (FTTH) systems are growing fast these days, where two different wavelengths are used for upstream and downstream traffic, typically 1310nm and 1490nm. The duplexers are the key elements to separate these wavelengths into different path in central offices (CO) and optical network unit (ONU) in passive optical network (PON). Multimode interference (MMI) has some benefits to be a duplexer including large fabrication tolerance, low-temperature dependence, and low-polarization dependence, but its size is too large to integrate in conventional case. Based on the silicon photonics platform, ultra-short silicon MMI duplexer was demonstrated to separate the 1310nm and 1490nm lights. By studying the theory of self-image phenomena in MMI, the first order images are adopted in order to keep the device short. A cascaded MMI structure was investigated to implement the wavelength splitting, where both the light of 1310nm and 1490nm was input from the same port, and the 1490nm light was coupling cross the first MMI and output at the cross-port in the device while the 1310nm light was coupling through the first and second MMI and output at the bar-port in the device. The experiment was carried on with the SOI wafer of 340nm top silicon. The cascaded MMI was investigated to fold the length of the duplexer as short as 117μm with the extinct ratio over 10dB.

Vacuum plasma coatings for turbine blades

NASA Technical Reports Server (NTRS)

Holmes, R. R.

1985-01-01

Turbine blades, vacuum plasma spray coated with NiCrAlY, CoCrAlY or NiCrAlY/Cr2O3, were evaluated and rated superior to standard space shuttle main engine (SSME) coated blades. Ratings were based primarily on 25 thermal cycles in the MSFC Burner Rig Tester, cycling between 1700 F (gaseous H2) and -423 F (liquid H2). These tests showed no spalling on blades with improved vacuum plasma coatings, while standard blades spalled. Thermal barrier coatings of ZrO2, while superior to standard coatings, lacked the overall performance desired. Fatigue and tensile specimens, machined from MAR-M-246(Hf) test bars identical to the blades were vacuum plasma spray coated, diffusion bond treated, and tested to qualify the vacuum plasma spray process for flight hardware testing and application. While NiCrAlY/Cr2O3 offers significant improvement over standard coatings in durability and thermal protection, studies continue with an objective to develop coatings offering even greater improvements.

Improved Ohmic-contact to AlGaN/GaN using Ohmic region recesses by self-terminating thermal oxidation assisted wet etching technique

NASA Astrophysics Data System (ADS)

Liu, J.; Wang, J.; Wang, H.; Zhu, L.; Wu, W.

2017-06-01

Lower Ti/Al/Ni/Au Ohmic contact resistance on AlGaN/GaN with wider rapid thermal annealing (RTA) temperature window was achieved using recessed Ohmic contact structure based on self-terminating thermal oxidation assisted wet etching technique (STOAWET), in comparison with conventional Ohmic contacts. Even at lower temperature such as 650°C, recessed structure by STOAWET could still obtain Ohmic contact with contact resistance of 1.97Ω·mm, while conventional Ohmic structure mainly featured as Schottky contact. Actually, both Ohmic contact recess and mesa isolation processes could be accomplished by STOAWET in one process step and the process window of STOAWET is wide, simplifying AlGaN/GaN HEMT device process. Our experiment shows that the isolation leakage current by STOAWET is about one order of magnitude lower than that by inductivity coupled plasma (ICP) performed on the same wafer.

Synthesis, spectroscopic, photoluminescence properties and biological evaluation of novel Zn(II) and Al(III) complexes of NOON tetradentate Schiff bases

NASA Astrophysics Data System (ADS)

Abdel Aziz, Ayman A.; Badr, Ibrahim H. A.; El-Sayed, Ibrahim S. A.

2012-11-01

Novel mononuclear Zn(II) and Al(III) complexes were synthesized from the reactions of Zn(OAc)2·2H2O and anhydrous AlCl3 with neutral N2O2 donor tetradentate Schiff bases; N,N'bis(salicylaldehyde)4,5-dimethyl-1,2-phenylenediamine (H2L1) and N,N'bis(salicylaldehyde)4,5-dichloro-1,2-phenylenediamine (H2L2). The new complexes were fully characterized by using micro analyses (CHN), FT-IR, 1H NMR, UV-Vis spectra and thermal analysis. The analytical data have been showed that, the stoichiometry of the complexes is 1:1. Spectroscopic data suggested tetrahedral and square pyramidal geometries for Zn(II) and Al(III) complexes, respectively. The synthesized Zn(II), and Al(III) complexes exhibited intense fluorescence emission in the visible region upon UV-excitation in methylene chloride solution at ambient temperature. This high fluorescence emission was assigned to the strong coordination of the ligands to the small and the highly charged Zn(II) and Al(III) ions. Such strong coordination seems to extend the π-conjugation of the complexes. Thermal analysis measurements indicated that the complexes have good thermal stability. As a potential application the biological activity (e.g., antimicrobial action) of the prepared ligands and complexes was assessed by in-vitro testing of their effect on the growth of various strains of bacteria and fungi.

Synthesis, spectroscopic, photoluminescence properties and biological evaluation of novel Zn(II) and Al(III) complexes of NOON tetradentate Schiff bases.

PubMed

Abdel Aziz, Ayman A; Badr, Ibrahim H A; El-Sayed, Ibrahim S A

2012-11-01

Novel mononuclear Zn(II) and Al(III) complexes were synthesized from the reactions of Zn(OAc)(2).2H(2)O and anhydrous AlCl(3) with neutral N2O2 donor tetradentate Schiff bases; N,N'bis(salicylaldehyde)4,5-dimethyl-1,2-phenylenediamine (H(2)L(1)) and N,N'bis(salicylaldehyde)4,5-dichloro-1,2-phenylenediamine (H(2)L(2)). The new complexes were fully characterized by using micro analyses (CHN), FT-IR, (1)H NMR, UV-Vis spectra and thermal analysis. The analytical data have been showed that, the stoichiometry of the complexes is 1:1. Spectroscopic data suggested tetrahedral and square pyramidal geometries for Zn(II) and Al(III) complexes, respectively. The synthesized Zn(II), and Al(III) complexes exhibited intense fluorescence emission in the visible region upon UV-excitation in methylene chloride solution at ambient temperature. This high fluorescence emission was assigned to the strong coordination of the ligands to the small and the highly charged Zn(II) and Al(III) ions. Such strong coordination seems to extend the π-conjugation of the complexes. Thermal analysis measurements indicated that the complexes have good thermal stability. As a potential application the biological activity (e.g., antimicrobial action) of the prepared ligands and complexes was assessed by in-vitro testing of their effect on the growth of various strains of bacteria and fungi. Copyright © 2012 Elsevier B.V. All rights reserved.

COLLABORATIVE RESEARCH AND DEVELOPMENT (CR&D) Delivery Order 0043: Deformation and Texture Development During Hot Working of Titanium

DTIC Science & Technology

2008-04-01

Hot Working of Titanium 5a. CONTRACT NUMBER F33615-03-D-5801-0043 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 61202F 6 . AUTHOR(S) A.A...micrographs and thus to correlate microstructural features and texture data [3- 6 ]. For instance, Germain, et al. [3, 4 ] linked local orientations...microstructures can be developed in alpha/beta titanium alloys by TMP [2- 4 ], namely, fully lamellar, fully equiaxed, and duplex (bi-modal). A mixture

Effect of Al2O3 phases on the enhancement of thermal conductivity and viscosity of nanofluids in engine oil

NASA Astrophysics Data System (ADS)

Vasheghani, Mohammadhassan; Marzbanrad, Ehsan; Zamani, Cyrus; Aminy, Mohamed; Raissi, Babak; Ebadzadeh, Toraj; Barzegar-Bafrooei, Hadi

2011-11-01

Thermal conductivity of α-Al2O3 was measured using hot wire method. α-Al2O3 (20 nm in size) was synthesized by microwave method for which, the results were compared with commercially available γ-Al2O3. Thermal conductivity of nanofluids was investigated considering, it is dependency on Al2O3 phase. It was observed that by adding 3 wt% of nano γ-Al2O3 and α-Al2O3 to the engine oil, thermal conductivity increases by 37 and 31%, respectively. The corresponding viscosity increase for the same amount of nano γ-Al2O3 and α-Al2O3 were 36 and 38%, respectively. It was concluded that the differences in thermal conductivity originate from higher specific surface area of γ-Al2O3 compared to the α-Al2O3 which is the result of porosity difference, obtained during the synthesis process.

Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

PubMed

Nakano, Shu-ichi; Sugimoto, Naoki

2014-08-05

The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

Direct Duplex Detection: An Emerging Tool in the RNA Structure Analysis Toolbox.

PubMed

Weidmann, Chase A; Mustoe, Anthony M; Weeks, Kevin M

2016-09-01

While a variety of powerful tools exists for analyzing RNA structure, identifying long-range and intermolecular base-pairing interactions has remained challenging. Recently, three groups introduced a high-throughput strategy that uses psoralen-mediated crosslinking to directly identify RNA-RNA duplexes in cells. Initial application of these methods highlights the preponderance of long-range structures within and between RNA molecules and their widespread structural dynamics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Adenine radicals generated in alternating AT duplexes by direct absorption of low-energy UV radiation.

PubMed

Banyasz, Akos; Ketola, Tiia; Martínez-Fernández, Lara; Improta, Roberto; Markovitsi, Dimitra

2018-04-17

There is increasing evidence that the direct absorption of photons with energies that are lower than the ionization potential of nucleobases may result in oxidative damage to DNA. The present work, which combines nanosecond transient absorption spectroscopy and quantum mechanical calculations, studies this process in alternating adenine-thymine duplexes (AT)n. We show that the one-photon ionization quantum yield of (AT)10 at 266 nm (4.66 eV) is (1.5 ± 0.3) × 10-3. According to our PCM/TD-DFT calculations carried out on model duplexes composed of two base pairs, (AT)1 and (TA)1, simultaneous base pairing and stacking does not induce important changes in the absorption spectra of the adenine radical cation and deprotonated radical. The adenine radicals, thus identified in the time-resolved spectra, disappear with a lifetime of 2.5 ms, giving rise to a reaction product that absorbs at 350 nm. In parallel, the fingerprint of reaction intermediates other than radicals, formed directly from singlet excited states and assigned to AT/TA dimers, is detected at shorter wavelengths. PCM/TD-DFT calculations are carried out to map the pathways leading to such species and to characterize their absorption spectra; we find that, in addition to the path leading to the well-known TA* photoproduct, an AT photo-dimerization path may be operative in duplexes.

Drastic stability change of X-X mismatch in d(CXG) trinucleotide repeat disorders under molecular crowding condition.

PubMed

Teng, Ye; Pramanik, Smritimoy; Tateishi-Karimata, Hisae; Ohyama, Tatsuya; Sugimoto, Naoki

2018-02-05

The trinucleotide repeat d(CXG) (X = A, C, G or T) is the most common sequence causing repeat expansion disorders. The formation of non-canonical structures, such as hairpin structures with X-X mismatches, has been proposed to affect gene expression and regulation, which are important in pathological studies of these devastating neurological diseases. However, little information is available regarding the thermodynamics of the repeat sequence under crowded cellular conditions where many non-canonical structures such as G-quadruplexes are highly stabilized, while duplexes are destabilised. In this study, we investigated the different stabilities of X-X mismatches in the context of internal d(CXG) self-complementary sequences in an environment with a high concentration of cosolutes to mimic the crowding conditions in cells. The stabilities of full-matched duplexes and duplexes with A-A, G-G, and T-T mismatched base pairs under molecular crowding conditions were notably decreased compared to under dilute conditions. However, the stability of the DNA duplex with a C-C mismatch base pair was only slightly destabilised. Investigating different stabilities of X-X mismatches in d(CXG) sequences is important for improving our understanding of the formation and transition of multiple non-canonical structures in trinucleotide repeat diseases, and may provide insights for pathological studies and drug development. Copyright © 2018 Elsevier Inc. All rights reserved.

Au nanoparticles/hollow molybdenum disulfide microcubes based biosensor for microRNA-21 detection coupled with duplex-specific nuclease and enzyme signal amplification.

PubMed

Shuai, Hong-Lei; Huang, Ke-Jing; Chen, Ying-Xu; Fang, Lin-Xia; Jia, Meng-Pei

2017-03-15

An ultrasensitive electrochemical biosensor for detecting microRNAs is fabricated based on hollow molybdenum disulfide (MoS 2 ) microcubes. Duplex-specific nuclease, enzyme and electrochemical-chemical-chemical redox cycling are used for signal amplification. Hollow MoS 2 microcubes constructed by ultrathin nanosheets are synthesized by a facile template-assisted strategy and used as supporting substrate. For biosensor assembling, biotinylated ssDNA capture probes are first immobilized on Au nanoparticles (AuNPs)/MoS 2 modified electrode in order to combine with streptavidin-conjugated alkaline phosphatase (SA-ALP). When capture probes hybridize with miRNAs, duplex-specific nuclease cleaves the formative duplexes. At the moment, the biotin group strips from the electrode surface and SA-ALP is incapacitated to attach onto electrode. Then, ascorbic acids induce the electrochemical-chemical-chemical redox cycling to produce electrochemical response in the presence of ferrocene methanol and tris (2-carboxyethyl) phosphine. Under optimum conditions, the proposed biosensor shows a good linear relationship between the current variation and logarithm of the microRNAs concentration ranging from 0.1fM to 0.1pM with a detection limit of 0.086fM (S/N=3). Furthermore, the biosensor is successfully applied to detect target miRNA-21 in human serum samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Thermal properties of U-7Mo/Al dispersion fuel

NASA Astrophysics Data System (ADS)

Cho, Tae Won; Kim, Yeon Soo; Park, Jong Man; Lee, Kyu Hong; Kim, Sunghwan; Lee, Chong-Tak; Yang, Jae Ho; Oh, Jang Soo; Won, Ju-Jin; Sohn, Dong-Seong

2017-12-01

The thermal diffusivity and heat capacity of U-7Mo/Al and U-7Mo/Al-5Si as functions of U-Mo fuel volume fraction and temperature were measured. The density of the sample was measured at room temperature and estimated using thermal expansion data at elevated temperatures. Using the measured data, the thermal conductivity was obtained as a function of U-Mo volume fraction and temperature. The thermal conductivity of U-7Mo/Al-5Si was found to be lower than that of U-7Mo/Al because of the Si addition to the Al. Due to a lower porosity and reduced interaction between U-Mo and Al in the sample, the thermal conductivity data reported in the present study were higher than those in the literature. The present data were found to be in agreement with the predictions of theoretical models.

2.7 μm emission of high thermally and chemically durable glasses based on AlF3

PubMed Central

Huang, Feifei; Ma, Yaoyao; Li, Weiwei; Liu, Xueqiang; Hu, Lili; Chen, Danping

2014-01-01

AlF3-based glasses (AlF3-YF3-CaF2-BaF2-SrF2-MgF2) with enhanced thermal and chemical stability were synthesized and compared with the well-known fluorozirconate glass (ZBLAN). The 2.7 μm mid-infrared emission in the AlF3-based glasses was also investigated through the absorption and emission spectra. Both the temperature of glass transition and the characteristic temperatures (ΔT, Hr, kgl) of the fluoroaluminate glasses were much larger than those of the ZBLAN glasses. The corrosion phenomenon can be observed by naked-eye, and the transmittance dropped dramatically (0% at 3 μm) when the ZBLAN glass was placed into distilled water. However, the AlF3-based glass was relatively stable. The fluoroaluminate glasses possessed large branching ratio (20%) along with the emission cross section (9.4×10−21 cm−2) of the Er3+:4I11/2→4I13/2 transition. Meanwhile, the enhanced 2.7 μm emission in highly Er3+-doped AYF glass was obtained. Therefore, these results showed that this kind of fluoride glass has a promising application for solid state lasers at 3 μm. PMID:24402172

Controlled High Filler Loading of Functionalized Al2O3-Filled Epoxy Composites for LED Thermal Management

NASA Astrophysics Data System (ADS)

Permal, Anithambigai; Devarajan, Mutharasu; Hung, Huong Ling; Zahner, Thomas; Lacey, David; Ibrahim, Kamarulazizi

2018-03-01

Thermal management in light-emitting diode (LED) has been extensively researched recently. This study is intended to develop an effective thermally conductive epoxy composite as thermal interface material (TIM) for headlamp LEDs. Silane-functionalized aluminum oxide (Al2O3) powder of different average particle sizes (44 and 10 µm) was studied for its feasibility as filler at its maximum loading. A detailed comparison of three different methods of particle dispersions, hand-mix, speed-mix and calendaring process (3-roll mill), has been reported. The dispersion of Al2O3 particles, the thermal conductivity and thermal degradation characteristics of the composites were investigated and explained in detail. At 75 wt.% filler loading, 10 and 44 µm Al2O3 achieved composite thermal conductivities of 1.13 and 2.08 W/mK, respectively, which is approximately 528 and 1055% of enhancement with respect to neat epoxy. The package-level thermal performance of the LED employing the Al2O3-filled TIMs was carried out using thermal transient analysis. The experimental junction-to-ambient thermal resistances ( R thJ-A) achieved were 6.65, 7.24, and 8.63 K/W for Al2O3_44µm, Al2O3_10µm and neat epoxy, respectively. The results revealed that the Al2O3_44µm fillers-filled composite performed better in both material-level and package-level thermal characteristics.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

PubMed

Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

PubMed

Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

2017-05-01

Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

PubMed Central

Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

The minute virus of mice (MVM) nonstructural protein NS1 induces nicking of MVM DNA at a unique site of the right-end telomere in both hairpin and duplex conformations in vitro.

PubMed

Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J

1997-10-01

The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).

Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

PubMed Central

Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-01-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

PubMed

Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-08-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

Ultrasensitive sensing platform for platelet-derived growth factor BB detection based on layered molybdenum selenide-graphene composites and Exonuclease III assisted signal amplification.

PubMed

Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong

2016-03-15

A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.

Gadolinium-enhanced versus time-of-flight magnetic resonance angiography: what is the benefit of contrast enhancement in evaluating carotid stenosis?

PubMed

Muhs, Bart E; Gagne, Paul; Wagener, Jael; Baker, Jessica; Ortega, Marta Ramirez; Adelman, Mark A; Cayne, Neal S; Rockman, Caron B; Maldonado, Thomas

2005-11-01

Accurate patient selection based on preoperative imaging is imperative to good risk reduction in patients undergoing carotid endarterectomy (CEA). The goal of this study was to assess the accuracy of gadolinium-enhanced magnetic resonance angiography (GE MRA) versus time-of-flight (TOF) MRA in the work-up of patients undergoing CEA. Patients undergoing CEA between 1999 and 2001 were identified from a prospectively maintained institutional database. GE or TOF MRA was obtained on extracranial carotid arteries (n = 319) in patients undergoing CEA. Stenosis on MRA images was graded as moderate (n = 76) or severe (n = 243) by an attending radiologist who was blind to duplex results. Duplex imaging was performed in an Intersocietal Commission for the Accreditation of Vascular Labs (ICAVL) accredited lab, and stenosis was stratified as moderate (50-79%, n = 76) or high (80-99%, n = 243) grade using University of Washington criteria. For each patient, the degree of stenosis as determined by MRA (GE versus TOF) was compared to percent stenosis on duplex. For moderate-grade lesions, GE MRA concurred with duplex in 11.1% (4/36), underestimated in 2.8% (1/36), and overestimated in 86.1% (31/36) of carotid arteries imaged. TOF MRA concurred with duplex in 35% (14/40), underestimated in 0% (0/40), and overestimated in 65% (26/40) of carotid arteries. High-grade lesions demonstrated improved concordance between MRA and duplex. For these lesions, GE MRA concurred with duplex in 95.6% (130/136) of carotid arteries imaged, never overestimated stenosis (0/136), and underestimated in 4.4% (6/136). TOF MRA concurred with duplex 96.3% (103/107), overestimated stenosis as an occlusion in 0.9% (1/107), and underestimated in 2.8% (3/107). In addition to neck visualization, the GE technique allowed simultaneous aortic arch imaging. This was accomplished in 79.1% (136/172) of all GE MRAs. Simultaneous aortic arch imaging was not technically feasible with TOF MRA. For moderate-grade lesions, both MR techniques are inaccurate predictors of degree of carotid stenosis and result in a significant overestimation of stenosis. Each technique demonstrates improved concordance with duplex ultrasound in the setting of severe carotid artery stenoses. The ability of GE MRA to simultaneously image the aortic arch and the neck may allow for detection of occult tandem lesions and other anatomic variations, which may be particularly important in preoperative planning for carotid artery stenting.

Water-evaporation reduction by duplex films: application to the human tear film.

PubMed

Cerretani, Colin F; Ho, Nghia H; Radke, C J

2013-09-01

Water-evaporation reduction by duplex-oil films is especially important to understand the physiology of the human tear film. Secreted lipids, called meibum, form a duplex film that coats the aqueous tear film and purportedly reduces tear evaporation. Lipid-layer deficiency is correlated with the occurrence of dry-eye disease; however, in-vitro experiments fail to show water-evaporation reduction by tear-lipid duplex films. We review the available literature on water-evaporation reduction by duplex-oil films and outline the theoretical underpinnings of spreading and evaporation kinetics that govern behavior of these systems. A dissolution-diffusion model unifies the data reported in the literature and identifies dewetting of duplex films into lenses as a key challenge to obtaining significant evaporation reduction. We develop an improved apparatus for measuring evaporation reduction by duplex-oil films including simultaneous assessment of film coverage, stability, and temperature, all under controlled external mass transfer. New data reported in this study fit into the larger body of work conducted on water-evaporation reduction by duplex-oil films. Duplex-oil films of oxidized mineral oil/mucin (MOx/BSM), human meibum (HM), and bovine meibum (BM) reduce water evaporation by a dissolution-diffusion mechanism, as confirmed by agreement between measurement and theory. The water permeability of oxidized-mineral-oil duplex films agrees with those reported in the literature, after correction for the presence of mucin. We find that duplex-oil films of bovine and human meibum at physiologic temperature reduce water evaporation only 6-8% for a 100-nm film thickness pertinent to the human tear film. Comparison to in-vivo human tear-evaporation measurements is inconclusive because evaporation from a clean-water surface is not measured and because the mass-transfer resistance is not characterized. Copyright © 2013 Elsevier B.V. All rights reserved.

A novel anti-frictional multiphase layer produced by plasma nitriding of PVD titanium coated ZL205A aluminum alloy

NASA Astrophysics Data System (ADS)

Lu, C.; Yao, J. W.; Wang, Y. X.; Zhu, Y. D.; Guo, J. H.; Wang, Y.; Fu, H. Y.; Chen, Z. B.; Yan, M. F.

2018-02-01

The heat treatment (consisting of solid solution and aging), is integrated with the nitriding process of titanium coated ZL205A aluminum alloy to improve the surface and matrix mechanical properties simultaneously. Two-step duplex treatment is adopted to prepare the gradient multiphase layer on a magnesium-free ZL205A aluminum-copper based alloy. Firstly, pure titanium film is deposited on the aluminum alloy substrate using magnetron sputtering. Secondly, the Ti-coated specimen is nitrided at the solid solution temperature of the substrate alloying elements in a gas mixture of N2 and H2 and aged at 175 °C. The microstructure evolution, microhardness as well as the wear resistance of obtained multiphase layers are investigated by means of scanning electron microscopy (SEM) equipped with energy dispersive X-ray spectrometer (EDS), microhardness tester and pin-on-disc tribometer. The multiphase layer, dominated by TiN0.3 or Al3Ti, is prepared with significantly increased layer depth after duplex treatment. The surface hardness of multiphase layer is remarkably improved from 23.7HV to 457HV. The core matrix hardness is also increased to 65HV after aging. The wear rate of the multiphase layer decreases about 55.22% and 49.28% in comparison with the aged and Ti coated specimens, respectively. The predominant wear mechanism for the multiphase layer is abrasive and oxidation, but severe adhesive wear for the aged and Ti coated specimens.

The reactive element effect of yttrium and yttrium silicon on high temperature oxidation of NiCrAl coating

NASA Astrophysics Data System (ADS)

Ramandhany, S.; Sugiarti, E.; Desiati, R. D.; Martides, E.; Junianto, E.; Prawara, B.; Sukarto, A.; Tjahjono, A.

2018-03-01

The microstructure formed on the bond coat affects the oxidation resistance, particularly the formation of a protective oxide layer. The adhesion of bond coat and TGO increased significantly by addition of reactive element. In the present work, the effect of yttrium and yttrium silicon as reactive element (RE) on NiCrAl coating was investigated. The NiCrAl (without RE) and NiCrAlX (X:Y or YSi) bond coating were deposited on Hastelloy C-276 substrate by High Velocity Oxygen Fuel (HVOF) method. Isothermal oxidation was carried out at 1000 °C for 100 hours. The results showed that the addition of RE could prevent the breakaway oxidation. Therefore, the coating with reactive element were more protective against high temperature oxidation. Furthermore, the oxidation rate of NiCrAlY coating was lower than NiCrAlYSi coating with the total mass change was ±2.394 mg/cm2 after 100 hours of oxidation. The thickness of oxide scale was approximately 1.18 μm consisting of duplex oxide scale of spinel NiCr2O4 in outer scale and protective α-Al2O3 in inner scale.

A Comparison of Performance Characteristics of Multistage Thermoelectric Coolers Based on Different Ceramic Substrates

NASA Astrophysics Data System (ADS)

Semenyuk, V.

2014-06-01

The influence of the thermal properties of the substrate on the performance of cascade thermoelectric coolers (TECs) is studied with an emphasis on a justified choice of substrate material. An analytical model is developed for predicting the thermal resistance of the substrate associated with three-dimensional heat transfer from a smaller cascade area into a larger cooling cascade. The model is used to define the maximum temperature difference for a line of standard multistage TECs based on various substrate materials with different thermal conductivities, including white 96% Al2O3 "Rubalit" ceramic, grey 99.8% Al2O3 "Policor" ceramic, and AlN and BeO ceramics. Two types of multistage TECs are considered, namely with series and series-parallel connection of TE pellets, having from two to five cascades with TE pellet length in the range from 0.3 mm to 2 mm. A comparative analysis of the obtained results is made, and recommendations are formulated concerning the selection of an appropriate substrate material providing the highest performance-to-cost ratio.

Wear and corrosion behaviour of Al2O3-TiO2 coatings produced by flame thermal projection

NASA Astrophysics Data System (ADS)

Forero-Duran, M.; Dulce-Moreno, H. J.; Ferrer-Pacheco, M.; Vargas-Galvis, F.

2017-12-01

Evaluated the wear resistance and the coatings corrosion behaviour of Al2O3-TiO2 prepared by thermal spraying by flame on AISI 1020 carbon steel substrates, previously coated with an alloy base Ni. For this purpose, were controlled parameters of thermal spraying and the use of powders of similar but different chemical composition is taken as a variable commercial reference for ceramic coating. SEM images allowed to know the morphology of the powders and coatings. Electrochemical techniques (Tafel) were applied to evaluate the protection against corrosion. Coatings were tested for wear with a tribometer configuration bola-disco. It was determined that the phases present in coatings are directly relate to the behaviour against corrosion and wear them. Keywords: wear, corrosion, thermal imaging.

Facile Atmospheric Pressure Synthesis of High Thermal Stability and Narrow-Band Red-Emitting SrLiAl3N4:Eu(2+) Phosphor for High Color Rendering Index White Light-Emitting Diodes.

PubMed

Zhang, Xuejie; Tsai, Yi-Ting; Wu, Shin-Mou; Lin, Yin-Chih; Lee, Jyh-Fu; Sheu, Hwo-Shuenn; Cheng, Bing-Ming; Liu, Ru-Shi

2016-08-03

Red phosphors (e.g., SrLiAl3N4:Eu(2+)) with high thermal stability and narrow-band properties are urgently explored to meet the next-generation high-power white light-emitting diodes (LEDs). However, to date, synthesis of such phosphors remains an arduous task. Herein, we report, for the first time, a facile method to synthesize SrLiAl3N4:Eu(2+) through Sr3N2, Li3N, Al, and EuN under atmospheric pressure. The as-synthesized narrow-band red-emitting phosphor exhibits excellent thermal stability, including small chromaticity shift and low thermal quenching. Intriguingly, the title phosphor shows an anomalous increase in theoretical lumen equivalent with the increase of temperature as a result of blue shift and band broadening of the emission band, which is crucial for high-power white LEDs. Utilizing the title phosphor, commercial YAG:Ce(3+), and InGaN-based blue LED chip, a proof-of-concept warm white LEDs with a color rendering index (CRI) of 91.1 and R9 = 68 is achieved. Therefore, our results highlight that this method, which is based on atmospheric pressure synthesis, may open a new means to explore narrow-band-emitting nitride phosphor. In addition, the underlying requirements to design Eu(2+)-doped narrow-band-emitting phosphors were also summarized.

Quantitative research on microscopic deformation behavior of Ti-6Al-4V two-phase titanium alloy based on finite element method

NASA Astrophysics Data System (ADS)

Peng, Yan; Chen, Guoxing; Sun, Jianliang; Shi, Baodong

2018-04-01

The microscopic deformation of Ti-6Al-4V titanium alloy shows great inhomogeneity due to its duplex-microstructure that consists of two phases. In order to study the deformation behaviors of the constituent phases, the 2D FE model based on the realistic microstructure is established by MSC.Marc nonlinear FE software, and the tensile simulation is carried out. The simulated global stress-strain response is confirmed by the tensile testing result. Then the strain and stress distribution in the constituent phases and their evolution with the increase of the global strain are analyzed. The results show that the strain and stress partitioning between the two phases are considerable, most of the strain is concentrated in soft primary α phase, while hard transformed β matrix undertakes most of the stress. Under the global strain of 0.05, the deformation bands in the direction of 45° to the stretch direction and the local stress in primary α phase near to the interface between the two phases are observed, and they become more significant when the global strain increases to 0.1. The strain and stress concentration factors of the two phases are obviously different at different macroscopic deformation stages, but they almost tend to be stable finally.

Amorphization and thermal stability of aluminum-based nanoparticles prepared from the rapid cooling of nanodroplets: effect of iron addition.

PubMed

Xiao, Shifang; Li, Xiaofan; Deng, Huiqiu; Deng, Lei; Hu, Wangyu

2015-03-07

Despite an intensive investigation on bimetallic nanoparticles, little attention has been paid to their amorphization in the past few decades. The study of amorphization on a nanoscale is of considerable significance for the preparation of amorphous nanoparticles and bulk metallic glass. Herein, we pursue the amorphization process of Al-based nanoparticles with classic molecular dynamics simulations and local structural analysis techniques. By a comparative study of the amorphization of pure Al and Fe-doped Al-based nanodroplets in the course of rapid cooling, we find that Fe addition plays a very important role in the vitrification of Al-based nanodroplets. Owing to the subsurface segregated Fe atoms with their nearest neighbors tending to form relatively stable icosahedral (ICO) clusters, the Fe-centred cluster network near the surface effectively suppresses the crystallization of droplets from surface nucleation and growth as the concentration of Fe attains a certain value. The glass formation ability of nanodroplets is suggested to be enhanced by the high intrinsic inner pressure as a result of small size and surface tension, combined with the dopant-inhibited surface nucleation. In addition, the effect of the size and the added concentration of nanoparticles on amorphization and the thermal stability of the amorphous nanoparticles are discussed. Our findings reveal the amorphization mechanism in Fe-doped Al-based nanoparticles and provide a theoretical guidance for the design of amorphous materials.

Strong enhancement in thermal conductivity of ethylene glycol-based nanofluids by amorphous and crystalline Al{sub 2}O{sub 3} nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gangwar, J.; Department of Physics, Panjab University, Chandigarh 160014; Srivastava, A. K., E-mail: aks@nplindia.org, E-mail: avanish.aks555@gmail.com

2014-08-11

In the present work, the temperature and concentration dependence of thermal conductivity (TC) enhancement in ethylene glycol (EG)-based amorphous and crystalline Al{sub 2}O{sub 3} nanofluids have been investigated at temperatures ranging from 0 to 100 °C. In our prior study, nanometer-sized particles of amorphous-, γ-, and α-Al{sub 2}O{sub 3} were prepared via a simple sol-gel process with annealing at different temperatures and characterized by various techniques. Building upon the earlier study, we probe here the crystallinity, microstructure, and morphology of the obtained α-Al{sub 2}O{sub 3} nanoparticles (NPs) by using X-ray powder diffraction with Rietveld full-profile refinement, scanning electron microscopy, and high-resolutionmore » transmission electron microscopy, respectively. In this study, we achieved a 74% enhancement in TC at higher temperature (100 °C) of base fluid EG by incorporating 1.0 vol. % of amorphous-Al{sub 2}O{sub 3}, whereas 52% and 37% enhancement is accomplished by adding γ- and α-Al{sub 2}O{sub 3} NPs, respectively. The amorphous phase of NPs appears to have good TC enhancement in nanofluids as compared to crystalline Al{sub 2}O{sub 3}. In a nutshell, these results are demonstrating the potential consequences of Al{sub 2}O{sub 3} NPs for applications of next-generation efficient energy transfer in nanofluids.« less

Duplex gall bladder: bystander or culprit.

PubMed

Kumar, Jogender; Yadav, Arushi

2017-08-30

Gall bladder (GB) duplication is a rare anatomical malformation, which can be detected by preoperative imaging study. We present a case of duplex gall bladder in a 14-year-old boy who presented with abdominal pain. On ultrasound, he had right nephrolithiasis and duplex gall bladder. Duplex gall bladder was confirmed on MR cholangiopancreatography. There was a dilemma for surgical management of duplex gall bladder; however, he became asymptomatic after conservative treatment. Prophylactic surgery is not recommended for asymptomatic incidentally detected duplex gall bladder. Radiologists and paediatric surgeons should be sensitised about the exact anatomy of this entity. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Enhancing the corrosion resistance of the 2205 duplex stainless steel bipolar plates in PEMFCs environment by surface enriched molybdenum

NASA Astrophysics Data System (ADS)

Jinlong, Lv; Zhuqing, Wang; Tongxiang, Liang; Ken, Suzuki; Hideo, Miura

Surface molybdenum enrichment on 2205 duplex stainless steel was obtained by the ball milling technique. The electrochemical results showed molybdenum enrichment on the surface of 2205 duplex stainless steel improved its corrosion resistance in a typical proton exchange membrane fuel cell environment. This was mainly attributed to higher molybdenum content in the passive film formed on 2205 duplex stainless steel after ball milling. The decreased donor and acceptor concentrations improved significantly the corrosion resistance of surface molybdenum-enriched 2205 duplex stainless steel bipolar plates in the simulated cathodic proton exchange membrane fuel cells environment. In addition, the interfacial contact resistance of the 2205 duplex stainless steel bipolar plates slightly decreased due to surface molybdenum enrichment.

Evaluation of Oxidation Damage in Thermal Barrier Coating Systems

NASA Technical Reports Server (NTRS)

Zhu, Dongming; Miller, Robert A.

1996-01-01

A method based on the technique of dilatometry has been established to quantitatively evaluate the interfacial damage due to the oxidation in a thermal barrier coating system. Strain isolation and adhesion coefficients have been proposed to characterize the thermal barrier coating (TBC) performance based on its thermal expansion behavior. It has been found that, for a thermal barrier coating system consisting of ZrO2-8%Y2O3/FeCrAlY/4140 steel substrate, the oxidation of the bond coat and substrate significantly reduced the ceramic coating adherence, as inferred from the dilatometry measurements. The in-situ thermal expansion measurements under 30 deg C to 700 deg C thermal cycling in air showed that the adhesion coefficient, A(sub i) decreased by 25% during the first 35 oxidation cycles. Metallography showed that delamination occurred at both the ceramic/bond coat and bond coat/substrate interfaces. In addition, the strain isolation effect has been improved by increasing the FeCrAlY bond coat thickness. The strain isolation coefficient, Si, increased from about 0.04 to 0.25, as the bond coat thickness changed from 0.1 mm to 1.0 mm. It may be possible to design optimum values of strain isolation and interface adhesion coefficients to achieve the best TBC performance.

Effect of aging temperature on phase decomposition and mechanical properties in cast duplex stainless steels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mburu, Sarah; Kolli, R. Prakash; Perea, Daniel E.

The microstructure and mechanical properties in unaged and thermally aged (at 280 °C, 320 °C, 360 °C, and 400 °C to 4300 h) CF–3 and CF–8 cast duplex stainless steels (CDSS) are investigated. The unaged CF–8 steel has Cr-rich M 23C 6 carbides located at the δ–ferrite/γ–austenite heterophase interfaces that were not observed in the CF–3 steel and this corresponds to a difference in mechanical properties. Both unaged steels exhibit incipient spinodal decomposition into Fe-rich α–domains and Cr-rich α’–domains. During aging, spinodal decomposition progresses and the mean wavelength (MW) and mean amplitude (MA) of the compositional fluctuations increase as amore » function of aging temperature. Additionally, G–phase precipitates form between the spinodal decomposition domains in CF–3 at 360 °C and 400 °C and in CF–8 at 400 °C. Finally, the microstructural evolution is correlated to changes in mechanical properties.« less

Effect of aging temperature on phase decomposition and mechanical properties in cast duplex stainless steels

DOE PAGES

Mburu, Sarah; Kolli, R. Prakash; Perea, Daniel E.; ...

2017-03-06

The microstructure and mechanical properties in unaged and thermally aged (at 280 °C, 320 °C, 360 °C, and 400 °C to 4300 h) CF–3 and CF–8 cast duplex stainless steels (CDSS) are investigated. The unaged CF–8 steel has Cr-rich M 23C 6 carbides located at the δ–ferrite/γ–austenite heterophase interfaces that were not observed in the CF–3 steel and this corresponds to a difference in mechanical properties. Both unaged steels exhibit incipient spinodal decomposition into Fe-rich α–domains and Cr-rich α’–domains. During aging, spinodal decomposition progresses and the mean wavelength (MW) and mean amplitude (MA) of the compositional fluctuations increase as amore » function of aging temperature. Additionally, G–phase precipitates form between the spinodal decomposition domains in CF–3 at 360 °C and 400 °C and in CF–8 at 400 °C. Finally, the microstructural evolution is correlated to changes in mechanical properties.« less

Effect of aging temperature on phase decomposition and mechanical properties in cast duplex stainless steels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mburu, Sarah; Kolli, R. Prakash; Perea, Daniel E.

The microstructure and mechanical properties in unaged and thermally aged (at 280 oC, 320 oC, 360 oC, and 400 oC to 4300 h) CF–3 and CF–8 cast duplex stainless steels (CDSS) are investigated. The unaged CF–8 steel has Cr-rich M23C6 carbides located at the δ–ferrite/γ– austenite heterophase interfaces that were not observed in the CF–3 steel and this corresponds to a difference in mechanical properties. Both unaged steels exhibit incipient spinodal decomposition into Fe-rich α–domains and Cr-rich α’–domains. During aging, spinodal decomposition progresses and the mean wavelength (MW) and mean amplitude (MA) of the compositional fluctuations increase as a functionmore » of aging temperature. Additionally, G–phase precipitates form between the spinodal decomposition domains in CF–3 at 360 oC and 400 oC and in CF–8 at 400 oC. The microstructural evolution is correlated to changes in mechanical properties.« less

Thermal conductivity of ternary III-V semiconductor alloys: The role of mass difference and long-range order

NASA Astrophysics Data System (ADS)

Mei, S.; Knezevic, I.

2018-03-01

Thermal transport in bulk ternary III-V arsenide (III-As) semiconductor alloys was investigated using equilibrium molecular dynamics with optimized Albe-Tersoff empirical interatomic potentials. Existing potentials for binary AlAs, GaAs, and InAs were optimized to match experimentally obtained acoustic-phonon dispersions and temperature-dependent thermal conductivity. Calculations of thermal transport in ternary III-Vs commonly employ the virtual-crystal approximation (VCA), where the structure is assumed to be a random alloy and all group-III atoms (cations) are treated as if they have an effective weighted-average mass. Here, we showed that it is critical to treat atomic masses explicitly and that the thermal conductivity obtained with explicit atomic masses differs considerably from the value obtained with the average VCA cation mass. The larger the difference between the cation masses, the poorer the VCA prediction for thermal conductivity. The random-alloy assumption in the VCA is also challenged because X-ray diffraction and transmission electron microscopy show order in InGaAs, InAlAs, and GaAlAs epilayers. We calculated thermal conductivity for three common types of order (CuPt-B, CuAu-I, and triple-period-A) and showed that the experimental results for In0.53Ga0.47As and In0.52Al0.48As, which are lattice matched to the InP substrate, can be reproduced in molecular dynamics simulation with 2% and 8% of random disorder, respectively. Based on our results, thermal transport in ternary III-As alloys appears to be governed by the competition between mass-difference scattering, which is much more pronounced than the VCA suggests, and the long-range order that these alloys support.

Investigation on the diagnostic sensitivity of molecular tools used for detection of koi herpesvirus.

PubMed

Bergmann, Sven M; Riechardt, Meike; Fichtner, Dieter; Lee, Peiyu; Kempter, Jolanta

2010-02-01

Previous and new PCRs for KHV detection were compared by estimation of their sensitivity in recognizing KHV DNA in plasmids, cell culture extracted KHV DNA and total DNA obtained from field tissue samples. A modified real-time PCR (Gilad et al., 2004), combined with an internal control system (IC2, Hoffmann et al., 2006) in a duplex assay, was used as a "gold standard". The lowest reliably determined virus concentration between, 5 and 10 KHV DNA genomic equivalents, was found by real-time PCR (Gilad et al., 2004), nested PCR (Bergmann et al., 2006) and one-tube semi-nested PCR. All other published and unpublished PCRs, as well as the commercial Loopamp, recognized KHV DNA at higher concentrations only. Additionally, KHV variants, newly adapted to European conditions, which could not be detected by PCR according to Bercovier et al. (2005) were found in two field samples from carp and koi from different regions of Germany. A negative influence of sample pooling was shown with field samples tested by real-time PCR. 2009 Elsevier B.V. All rights reserved.

Alloyed coatings for dispersion strengthened alloys

NASA Technical Reports Server (NTRS)

Wermuth, F. R.; Stetson, A. R.

1971-01-01

Processing techniques were developed for applying several diffusion barriers to TD-Ni and TD-NiCr. Barrier coated specimens of both substrates were clad with Ni-Cr-Al and Fe-Cr-Al alloys and diffusion annealed in argon. Measurement of the aluminum distribution after annealing showed that, of the readily applicable diffusion barriers, a slurry applied tungsten barrier most effectively inhibited the diffusion of aluminum from the Ni-Cr-Al clad into the TD-alloy substrates. No barrier effectively limited interdiffusion of the Fe-Cr-Al clad with the substrates. A duplex process was then developed for applying Ni-Cr-Al coating compositions to the tungsten barrier coated substrates. A Ni-(16 to 32)Cr-3Si modifier was applied by slurry spraying and firing in vacuum, and was then aluminized by a fusion slurry process. Cyclic oxidation tests at 2300 F resulted in early coating failure due to inadequate edge coverage and areas of coating porosity. EMP analysis showed that oxidation had consumed 70 to 80 percent of the aluminum in the coating in less than 50 hours.

Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

PubMed

Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

1998-09-23

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

PubMed

Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

2011-07-21

Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

Global Surface Thermal Inertia Derived from Dawn VIR Observations

NASA Astrophysics Data System (ADS)

Titus, T. N.; Becker, K. J.; Anderson, J.; Capria, M.; Tosi, F.; Prettyman, T. H.; De Sanctis, M. C.; Palomba, E.; Grassi, D.; Capaccioni, F.; Ammannito, E.; Combe, J.; McCord, T. B.; Li, J. Y.; Russell, C. T.; Raymond, C. A.

2012-12-01

Comparisons of surface temperatures, derived from Dawn [1] Visible and Infrared Mapping Spectrometer (VIR-MS) [2] observations , to thermal models suggest that Vesta generally has a low-thermal-inertia surface, between 25 and 35 J m^-2 K^-1 s^-½, consistent with a thick layer of fine-grain material [3]. Temperatures were calculated using a Bayesian approach to nonlinear inversion as described by Tosi et al. [4]. In order to compare observed temperatures of Vesta to model calculations, several geometric and photometric parameters must be known or estimated. These include local mean solar time, latitude, local slope, bond bolometric albedo, and the effective emissivity at 5μm. Local time, latitude, and local slope are calculated using the USGS ISIS software system [5]. We employ a multi-layered thermal-diffusion model called 'KRC' [6], which has been used extensively in the study of Martian thermophysical properties. This thermal model is easily modified for use with Vesta by replacing the Martian ephemeris input with the Vesta ephemeris and disabling the atmosphere. This model calculates surface temperatures throughout an entire Vesta year for specific sets of slope, azimuth, latitude and elevation, and a range of albedo and thermal-inertia values. The ranges of albedo and thermal inertia values create temperature indices that are closely matched to the dates and times observed by VIR. Based on observed temperatures and best-fit KRC thermal models, estimates of the annual mean surface temperatures were found to range from 176 K - 188 K for flat zenith-facing equatorial surfaces, but these temperatures can drop as low as 112 K for polar-facing slopes at mid-latitudes. [7] In this work, we will compare observed temperatures of the surface of Vesta (using data acquired by Dawn VIR-MS [2] during the approach, survey, high-altitude mapping and departure phases) to model temperature results using the KRC thermal model [5]. Where possible, temperature observations from multiple times of day or seasons will be used to better constrain the thermal inertia. The authors gratefully acknowledge the support of the Dawn Instrument, Operations, and Science Teams. This work was funded by the Dawn at Vesta Participating Science Program. [1] C.T. Russell et al. (2004) P&SS, 52, 465-489. [2] M.C. De Sanctis et al. (2011) SSRv 163, 329. [3] M.T. Capria et al. (2012) LPSC XLIII #1863 [4] F. Tosi et al. (2012) LPSC XLIII #1886. [5] J. Anderson et al. (2011) AGU Fall Meeting, #U31A-0009. [6] H.H. Kieffer H., et al. (1977) JGR, 82, 4249-4291. [7] Titus et al. (2012) EPSC, #800.

Tungsten fiber reinforced FeCralY: A first generation composite turbine blade material

NASA Technical Reports Server (NTRS)

Petrasek, D. W.; Winsa, E. A.; Westfall, L. J.; Signorelli, R. A.

1979-01-01

Tungsten-fiber/FeCrAlY (W/FeCrAlY) was identified as a promising aircraft engine, first generation, turbine blade composite material. Based on available data, W/FeCrAlY should have the stress-rupture, creep, tensile, fatigue, and impact strengths required for turbine blades operating from 1250 to 1370 K. It should also have adequate oxidation, hot corrosion, and thermal cycling damage resistance as well as high thermal conductivity. Concepts for potentially low cost blade fabrication were developed. These concepts were used to design a first stage JT9D convection cooled turbine blade having a calculated 50 K use-temperature advantage over the directionally solidified superalloy blade.

Assembly and analysis of eukaryotic Argonaute–RNA complexes in microRNA-target recognition

PubMed Central

Gan, Hin Hark; Gunsalus, Kristin C.

2015-01-01

Experimental studies have uncovered a variety of microRNA (miRNA)–target duplex structures that include perfect, imperfect and seedless duplexes. However, non-canonical binding modes from imperfect/seedless duplexes are not well predicted by computational approaches, which rely primarily on sequence and secondary structural features, nor have their tertiary structures been characterized because solved structures to date are limited to near perfect, straight duplexes in Argonautes (Agos). Here, we use structural modeling to examine the role of Ago dynamics in assembling viable eukaryotic miRNA-induced silencing complexes (miRISCs). We show that combinations of low-frequency, global modes of motion of Ago domains are required to accommodate RNA duplexes in model human and C. elegans Ago structures. Models of viable miRISCs imply that Ago adopts variable conformations at distinct target sites that generate distorted, imperfect miRNA-target duplexes. Ago's ability to accommodate a duplex is dependent on the region where structural distortions occur: distortions in solvent-exposed seed and 3′-end regions are less likely to produce steric clashes than those in the central duplex region. Energetic analyses of assembled miRISCs indicate that target recognition is also driven by favorable Ago-duplex interactions. Such structural insights into Ago loading and target recognition mechanisms may provide a more accurate assessment of miRNA function. PMID:26432829

H-Bond Self-Assembly: Folding versus Duplex Formation.

PubMed

Núñez-Villanueva, Diego; Iadevaia, Giulia; Stross, Alexander E; Jinks, Michael A; Swain, Jonathan A; Hunter, Christopher A

2017-05-17

Linear oligomers equipped with complementary H-bond donor (D) and acceptor (A) sites can interact via intermolecular H-bonds to form duplexes or fold via intramolecular H-bonds. These competing equilibria have been quantified using NMR titration and dilution experiments for seven systems featuring different recognition sites and backbones. For all seven architectures, duplex formation is observed for homo-sequence 2-mers (AA·DD) where there are no competing folding equilibria. The corresponding hetero-sequence AD 2-mers also form duplexes, but the observed self-association constants are strongly affected by folding equilibria in the monomeric states. When the backbone is flexible (five or more rotatable bonds separating the recognition sites), intramolecular H-bonding is favored, and the folded state is highly populated. For these systems, the stability of the AD·AD duplex is 1-2 orders of magnitude lower than that of the corresponding AA·DD duplex. However, for three architectures which have more rigid backbones (fewer than five rotatable bonds), intramolecular interactions are not observed, and folding does not compete with duplex formation. These systems are promising candidates for the development of longer, mixed-sequence synthetic information molecules that show sequence-selective duplex formation.

Mechanical Properties and Fracture Behaviors of the As-Extruded Mg-5Al-3Ca Alloys Containing Yttrium at Elevated Temperature.

PubMed

Son, Hyeon-Taek; Kim, Yong-Ho; Kim, Taek-Soo; Lee, Seong-Hee

2016-02-01

Effects of yttrium (Y) addition on mechanical properties and fracture behaviors of the as-extruded Mg-Al-Ca based alloys at elevated temperature were investigated by a tensile test. After hot extrusion, the average grain size was refined by Y addition and eutectic phases were broken down into fine particles. Y addition to Mg-5Al-3Ca based alloy resulted in the improvement of strength and ductility at elevated temperature due to fine grain and suppression of grain growth by formation of thermally stable Al2Y intermetallic compound.

Experiment on infrared radiation characteristic of colloid Fe/Al thermite

NASA Astrophysics Data System (ADS)

Zhen, Jian-wei; Li, Jin-ming; Guo, Meng-meng; Liu, Guo-qing; Wang, Guo-dong

2016-01-01

The Fe/Al thermite was made as bulk material. Mixed proportion with liquid energetic colloid, the Fe/Al thermite was made to be collid Fe/Al thermite combustible agent. Then, combustion test sample was got. The combustion process and the infrared radiation characteristic of colloid Fe/Al thermite was experiment by thermal infrared imager. It was showed that collid Fe/Al thermite combustible agent had better infrared radiation characteristic. It could be as based agentia of infrared decoy with the characteristic of persistent and wide spectral range.

Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

PubMed

Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

2010-08-01

Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

PubMed

Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

2016-09-01

Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

DEVELOPMENT OF ISOTOPICALLY ENRICHED BORON-DOPED ALUMINA DOSIMETER FOR THERMAL NEUTRONS.

PubMed

Sato, Fuminobu; Maekawa, Tatsuro; Kariba, Tomoharu; Kusaka, Sachie; Tanaka, Teruya; Murata, Isao

2017-12-01

A novel optically stimulated luminescence (OSL) detector containing isotopically enriched boron was developed for thermal neutron dosimetry. Alumina containing isotopically enriched boron (Al2O3:B) was synthesised by the sol-gel method. The Al2O3:B was annealed up to ~1800 K. For X-ray diffractometer (XRD) analysis, the diffraction pattern of the Al2O3:B had reflex peaks corresponding to α-Al2O3. The sensitivity of Al2O3:B to photons was slightly 2% of that of a commercial Al2O3:C. The Al2O3:B detector had satisfactory linearity in X-ray dose measurement. A thermal neutron field was constructed using a 241Am-Be neutron source and graphite blocks. A pair of Al2O3:10B and Al2O3:11B detectors were set in the thermal neutron field. The response of Al2O3:10B was larger than that of Al2O3:11B owing to the 10B(n,α)7Li reactions. The sensitivity of Al2O3:10B to thermal neutrons was estimated to be two orders less than the photon sensitivity. Therefore, the pair of Al2O3:10B and Al2O3:11B detectors were useful for thermal neutron dosimetry. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Color duplex assessment of 4th and 5th internal mammary artery perforators: the pedicles of the medially based lower pole breast flaps.

PubMed

Abdel-Monem, Kareem; Elshahat, Ahmed; Abou-Gamrah, Sherif; Eldin Abol-Atta, Hossam; Abd Eltawab, Reda; Massoud, Karim

2012-01-01

Reconstruction of a breast after mastectomy using the contralateral lower pole breast flap is an appealing procedure because it uses the tissues that were going to be excised during reduction of the sound breast to achieve symmetry. Literature mentioned that these flaps are supplied by the lower internal mammary artery perforators (IMAPs) with no further details. The aim of this study was to determine the site, size, and number of the 4th and 5th IMAPs by using preoperative color Duplex ultrasound and intraoperative exploration. Twenty breasts in 10 patients who presented for reduction mammoplasty were included in this study. Preoperative color duplex was used to determine IMAPs in the 4th and 5th intercostal spaces. These perforators were localized intraoperatively. Intravenous fluorescein injection was used to determine the perfusion of the lower pole breast flap on the basis of these perforators. Statistically, the 4th IMAPs diameters were significantly larger than the 5th IMAPs diameters (P < .05). The lower pole breast flap was perfused through these perforators. Color Duplex ultrasound is an accurate tool to preoperatively determine the 4th and 5th IMAPs.

Fabrication and investigation of electrochromatographic columns with a simplex configuration.

PubMed

Liu, Qing; Yang, Lijun; Wang, Qiuquan; Zhang, Bo

2014-07-04

Duplex capillary columns with a packed and an open section are widely used in electrochromatography (CEC). The duplex column configuration leads to non-uniform voltage drop, electrical field distribution and separation performance. It also adds to the complexity in understanding and optimizing electrochromatographic process. In this study, we introduced a simplex column configuration based on single particle fritting technology. The new column configuration has an essentially uniform packed bed through the entire column length, with only 1mm length left unpacked serving as the optical detection window. The study shows that a simplex column has higher separation efficiency than a duplex column, especially at the high voltage range, due to the consistent distribution of electrical field over the column length. In comparison to the duplex column, the simplex column presented a lower flow rate at the same applied voltage, suggesting that an open section may support a higher speed than a packed section. In practice, the long and short ends of the simplex column could be used as independent CEC columns respectively. This "two-in-one" bi-functional column configuration provided extra flexibilities in selecting and optimizing electrochromatographic conditions. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of pork contamination in meatball using genetic marker mitochondrial DNA cytochrome b gene by duplex-PCR

NASA Astrophysics Data System (ADS)

Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.

2017-04-01

Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.

Finite element analysis on the thermoelectric generator for the waste heat recovery of solar application

NASA Astrophysics Data System (ADS)

Zulkifli, Muhammad Nubli; Ilias, Izzudin; Abas, Amir; Muhamad, Wan Mansor Wan

2017-09-01

Thermoelectric generator (TEG) is the solid state device that converts the thermal gradient into electrical energy. TEG is widely used as the renewable energy source especially for the electronic equipment that operates with the small amount of electrical power. In the present analysis, the finite element analysis (FEA) using ANSYS is conducted on a model of the TEG attached with the aluminium, Al plate on the hot side of the TEG. This simple construction of TEG model was built in order to be used in the waste heat recovery of solar application. It was shown that the changes of the area and thickness of the Al plate increased the temperature gradient between hot and cold sides of TEG. This directly increase the voltage produced by the TEG based on the Seeback effect. The increase of the thermal gradient due to the increment of thickness and width of Al plate might be because of the increase of thermal resistance of Al plate. This finding provides a valuable data in design process to build a good TEG attached with Al plate for the waste heat recovery of solar application.

Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

PubMed

Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2011-01-01

To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

WDM-PON access network with lightwave source centralized full-duplex link based on SSB-OOFDM for wired and 60 GHz band wireless alternative accesses

NASA Astrophysics Data System (ADS)

Ma, Jianxin; Wang, Zhao; Zheng, Guoli

2014-04-01

A novel lightwave centralized full-duplex WDM-PON access network based on single sideband optical orthogonal frequency-division multiplexing (SSB-OOFDM) is proposed for providing wired and 60-GHz band wireless accesses alternately. At the OLT, the multi-channels with 10-Gb/s 4-QAM-RF-OFDM signals are SSB modulated on the optical local oscillators (OLOs). At the RN, one OOFDM signal along with two OLOs is abstracted and switched to the corresponding HONU, where the signal can be downconverted to the 10-GHz or 60-GHz band RF-OFDM signal by one OLO for wired or wireless access, while the other one is used to bear the uplink signal. Since the HONU is free from the light sources, the system complexity and cost are reduced. Full duplex transmission over 25 km fiber have been demonstrated that the error vector magnitude (EVM) of the down- and up-link signals are much below the FEC limit for both the wired and 60-GHz band wireless access services.

EXTRAPOLATION METHOD FOR MAXIMAL AND 24-H AVERAGE LTE TDD EXPOSURE ESTIMATION.

PubMed

Franci, D; Grillo, E; Pavoncello, S; Coltellacci, S; Buccella, C; Aureli, T

2018-01-01

The Long-Term Evolution (LTE) system represents the evolution of the Universal Mobile Telecommunication System technology. This technology introduces two duplex modes: Frequency Division Duplex and Time Division Duplex (TDD). Despite having experienced a limited expansion in the European countries since the debut of the LTE technology, a renewed commercial interest for LTE TDD technology has recently been shown. Therefore, the development of extrapolation procedures optimised for TDD systems becomes crucial, especially for the regulatory authorities. This article presents an extrapolation method aimed to assess the exposure to LTE TDD sources, based on the detection of the Cell-Specific Reference Signal power level. The method introduces a βTDD parameter intended to quantify the fraction of the LTE TDD frame duration reserved for downlink transmission. The method has been validated by experimental measurements performed on signals generated by both a vector signal generator and a test Base Transceiver Station installed at Linkem S.p.A facility in Rome. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A Prospective, Randomized Trial of Routine Duplex Ultrasound Surveillance on Arteriovenous Fistula Maturation.

PubMed

Han, Ahram; Min, Seung-Kee; Kim, Mi-Sook; Joo, Kwon Wook; Kim, Jungsun; Ha, Jongwon; Lee, Joongyub; Min, Sang-Il

2016-10-07

Use of arteriovenous fistulas, the most preferred type of access for hemodialysis, is limited by their high maturation failure rate. The aim of this study was to assess whether aggressive surveillance with routine duplex ultrasound and intervention can decrease the maturation failure rate of arteriovenous fistulas. We conducted a single-center, parallel-group, randomized, controlled trial of patients undergoing autogenous arteriovenous fistula. Patients were randomly assigned (1:1) to either the routine duplex or selective duplex group. In the routine duplex group, duplex ultrasound and physical examination were performed 2, 4, and 8 weeks postoperatively. In the selective duplex group, duplex examination was performed only when physical examination detected an abnormality. The primary end point was the maturation failure rate 8 weeks after fistula creation. Maturation failure was defined as the inability to achieve clinical maturation ( i.e. , a successful first use) and failure to achieve sonographic maturation (fistula flow >500 ml/min and diameter >6 mm) within 8 weeks. Between June 14, 2012, and June 25, 2014, 150 patients were enrolled (75 patients in each group), and 118 of those were included in the final analysis. The maturation failure rate was lower in the routine duplex group (8 of 59; 13.6%) than in the selective duplex group (15 of 59; 25.4%), but the difference was not statistically significant (odds ratio, 0.46; 95% confidence interval, 0.18 to 1.19; P =0.10). Factors associated with maturation failure were women (odds ratio, 3.84; 95% confidence interval, 1.05 to 14.06; P =0.04), coronary artery disease (odds ratio, 6.36; 95% confidence interval, 1.62 to 24.95; P <0.01), diabetes (odds ratio, 6.10; 95% confidence interval, 1.76 to 21.19; P <0.01), and the preoperative cephalic vein diameter (odds ratio, 0.30; 95% confidence interval, 0.13 to 0.71; P <0.01). Postoperative routine duplex surveillance failed to prove superiority compared with selective duplex after physical examination for reducing arteriovenous fistula maturation failure. However, the wide 95% confidence interval for the effect of intervention precludes a firm conclusion that routine duplex surveillance was not beneficial. Copyright © 2016 by the American Society of Nephrology.

(DNS)C: a fluorescent, environmentally sensitive cytidine derivative for the direct detection of GGG triad sequences.

PubMed

Kim, Ki Tae; Kim, Hyun Woo; Moon, Dohyun; Rhee, Young Min; Kim, Byeang Hyean

2013-09-14

With the goal of developing a fluorescent nucleoside sensitive to its environment, in this study we synthesized (DNS)C, a novel modified 2'-deoxycytidine bearing a 5-(dimethylamino)naphthalene-1-sulfonyl (dansyl) moiety at the N4 position, and tested its properties in monomeric and oligomeric states. (DNS)C undergoes intramolecular photoinduced electron transfer between its dansyl and cytosine units, resulting in remarkable changes in fluorescence that depend on the choice of solvent. In addition, the fluorescence behavior and thermal stability of oligonucleotides containing (DNS)C are dependent on the nature of the flanking and neighboring bases. Notably, (DNS)C exhibits fluorescence enhancement only in fully matched duplex DNA containing a GGG triad sequence. The environmental sensitivity of (DNS)C can be exploited as a fluorescence tool for monitoring the interactions of DNA with other biomolecules, including DNA, RNA, and proteins.

Current-voltage characteristics of double stranded versus single stranded DNA molecules

NASA Astrophysics Data System (ADS)

Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

2004-03-01

Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

Benefits of Automatic Duplexing Fact Sheet

EPA Pesticide Factsheets

This resource provides a how-to duplex guide, informs the reader on the benefits and cost savings from automatic duplexing, and several off the shelf print management software options for your facility.

Electron Beam Welding of Duplex Steels with using Heat Treatment

NASA Astrophysics Data System (ADS)

Schwarz, Ladislav; Vrtochová, Tatiana; Ulrich, Koloman

2010-01-01

This contribution presents characteristics, metallurgy and weldability of duplex steels with using concentrated energy source. The first part of the article describes metallurgy of duplex steels and the influence of nitrogen on their solidification. The second part focuses on weldability of duplex steels with using electron beam aimed on acceptable structure and corrosion resistance performed by multiple runs of defocused beam over the penetration weld.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Reliability analysis of single crystal NiAl turbine blades

NASA Technical Reports Server (NTRS)

Salem, Jonathan; Noebe, Ronald; Wheeler, Donald R.; Holland, Fred; Palko, Joseph; Duffy, Stephen; Wright, P. Kennard

1995-01-01

As part of a co-operative agreement with General Electric Aircraft Engines (GEAE), NASA LeRC is modifying and validating the Ceramic Analysis and Reliability Evaluation of Structures algorithm for use in design of components made of high strength NiAl based intermetallic materials. NiAl single crystal alloys are being actively investigated by GEAE as a replacement for Ni-based single crystal superalloys for use in high pressure turbine blades and vanes. The driving force for this research lies in the numerous property advantages offered by NiAl alloys over their superalloy counterparts. These include a reduction of density by as much as a third without significantly sacrificing strength, higher melting point, greater thermal conductivity, better oxidation resistance, and a better response to thermal barrier coatings. The current drawback to high strength NiAl single crystals is their limited ductility. Consequently, significant efforts including the work agreement with GEAE are underway to develop testing and design methodologies for these materials. The approach to validation and component analysis involves the following steps: determination of the statistical nature and source of fracture in a high strength, NiAl single crystal turbine blade material; measurement of the failure strength envelope of the material; coding of statistically based reliability models; verification of the code and model; and modeling of turbine blades and vanes for rig testing.

Structural energetics of the adenine tract from an intrinsic transcription terminator.

PubMed

Huang, Yuegao; Weng, Xiaoli; Russu, Irina M

2010-04-02

Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.

Contribution of thermal infrared images on the understanding of the subsurface/atmosphere exchanges on Earth.

NASA Astrophysics Data System (ADS)

Lopez, Teodolina; Antoine, Raphaël; Baratoux, David; Rabinowicz, Michel

2017-04-01

High temporal resolution of space-based thermal infrared images (METEOSAT, MODIS) and the development of field thermal cameras have permitted the development of thermal remote sensing in Earth Sciences. Thermal images are influenced by many factors such as atmosphere, solar radiation, topography and physico-chemical properties of the surface. However, considering these limitations, we have discovered that thermal images can be used in order to better understand subsurface hydrology. In order to reduce as much as possible the impact of these perturbing factors, our approach combine 1) field observations and 2) numerical modelling of surface/subsurface thermal processes. Thermal images of the Piton de la Fournaise volcano (Réunion Island), acquired by hand, show that the Formica Leo inactive scoria cone and some fractures close to the Bory-Dolomieu caldera are always warmer, inducing a thermal difference with the surrounding of at least 5°C and a Self-Potential anomaly [1, 2]. Topography cannot explain this thermal behaviour, but Piton de la Fournaise is known as highly permeable. This fact allows the development of an air convection within the whole permeable structure volcanic edifice [2]. Cold air enters the base of the volcano, and exits warmer upslope, as the air is warmed by the geothermal flow [1,2]. Then, we have decided to understand the interaction between subsurface hydrogeological flows and the humidity in the atmosphere. In the Lake Chad basin, regions on both sides of Lake Chad present a different thermal behaviour during the diurnal cycle and between seasons [3]. We propose that this thermal behaviour can only be explained by lateral variations of the surface permeability that directly impact the process of evaporation/condensation cycle. These studies bring new highlights on the understanding of the exchanges between subsurface and the atmosphere, as the presence of a very permeable media and/or variations of the surface permeability may enhance or not the evaporation/condensation cycle. [1] Antoine et al. (2009). J. Volcanol. Geotherm. Res., 183(3-4), 228-1140. [2] Antoine et al. (2017). Geothermics, 65, 81-98. [3] Lopez et al. (2016). Surv. Geophys., 37 (2), 471-502.

Duplex development and abandonment during evolution of the Lewis thrust system, southern Glacier National Park, Montana

NASA Astrophysics Data System (ADS)

Yin, An; Kelty, Thomas K.; Davis, Gregory A.

1989-09-01

Geologic mapping in southern Glacier National Park, Montana, reveals the presence of two duplexes sharing the same floor thrust fault, the Lewis thrust. The westernmost duplex (Brave Dog Mountain) includes the low-angle Brave Dog roof fault and Elk Mountain imbricate system, and the easternmost (Rising Wolf Mountain) duplex includes the low-angle Rockwell roof fault and Mt. Henry imbricate system. The geometry of these duplexes suggests that they differ from previously described geometric-kinematic models for duplex development. Their low-angle roof faults were preexisting structures that were locally utilized as roof faults during the formation of the imbricate systems. Crosscutting of the Brave Dog fault by the Mt. Henry imbricate system indicates that the two duplexes formed at different times. The younger Rockwell-Mt. Henry duplex developed 20 km east of the older Brave Dog-Elk Mountain duplex; the roof fault of the former is at a higher structural level. Field relations confirm that the low-angle Rockwell fault existed across the southern Glacier Park area prior to localized formation of the Mt. Henry imbricate thrusts beneath it. These thrusts kinematically link the Rockwell and Lewis faults and may be analogous to P shears that form between two synchronously active faults bounding a simple shear system. The abandonment of one duplex and its replacement by another with a new and higher roof fault may have been caused by (1) warping of the older and lower Brave Dog roof fault during the formation of the imbricate system (Elk Mountain) beneath it, (2) an upward shifting of the highest level of a simple shear system in the Lewis plate to a new decollement level in subhorizontal belt strata (= the Rockwell fault) that lay above inclined strata within the first duplex, and (3) a reinitiation of P-shear development (= Mt. Henry imbricate faults) between the Lewis thrust and the subparallel, synkinematic Rockwell fault.

Fabrication of a Tantalum-Based Josephson Junction for an X-Ray Detector

NASA Astrophysics Data System (ADS)

Morohashi, Shin'ichi; Gotoh, Kohtaroh; Yokoyama, Naoki

2000-06-01

We have fabricated a tantalum-based Josephson junction for an X-ray detector. The tantalum layer was selected for the junction electrode because of its long quasiparticle lifetime, large X-ray absorption efficiency and stability against thermal cycling. We have developed a buffer layer to fabricate the tantalum layer with a body-centered cubic structure. Based on careful consideration of their superconductivity, we have selected a niobium thin layer as the buffer layer for fabricating the tantalum base electrode, and a tungsten thin layer for the tantalum counter electrode. Fabricated Nb/AlOx-Al/Ta/Nb and Nb/Ta/W/AlOx-Al/Ta/Nb Josephson junctions exhibited current-voltage characteristics with a low subgap leakage current.

Geometry and kinematics of the fold-thrust belt and structural evolution of the major Himalayan fault zones in the Darjeeling -- Sikkim Himalaya, India

NASA Astrophysics Data System (ADS)

Bhattacharyya, Kathakali

The Darjeeling-Sikkim Himalaya lies in the eastern part of the Himalayan fold-thrust belt (FTB) in a zone of high arc-perpendicular convergence between the Indian and Eurasian plates. In this region two distinct faults form the Main Central thrust (MCT), the structurally higher MCT1 and the lower MCT2; both these faults have translated the Greater Himalayan hanging wall rocks farther towards the foreland than in the western Himalaya. The width of the sub-MCT Lesser Himalayan rocks progressively decreases from the western Himalaya to this part of the eastern Himalaya, and as a result, the width of the FTB is narrower in this region compared to the western Himalaya. Our structural analysis shows that in the Darjeeling-Sikkim Himalaya the sub-MCT Lesser Himalayan duplex is composed of two duplex systems and has a more complex geometry than in the rest of the Himalayan fold-thrust belt. The structurally higher Dating duplex is a hinterland-dipping duplex; the structurally lower Rangit duplex varies in geometry from a hinterland-dipping duplex in the north to an antiformal stack in the middle and a foreland-dipping duplex in the south. The MCT2 is the roof thrust of the Daling duplex and the Ramgarh thrust is the roof thrust of the Rangit duplex. In this region, the Ramgarh thrust has a complex structural history with continued reactivation during footwall imbrication. The foreland-dipping component of the Rangit duplex, along with the large displacement associated with the reactivation of the Ramgarh thrust accounts for the large translation of the MCT sheets in the Darjeeling-Sikkim Himalaya. The growth of the Lesser Himalayan duplex modified the final geometry of the overlying MCT sheets, resulting in a plunge culmination that manifests itself as a broad N-S trending "anticline" in the Darjeeling-Sikkim Himalaya. This is not a "river anticline" as its trace lies west of the Teesta river. A transport parallel balanced cross section across this region has accommodated a total minimum shortening of ˜502 km (˜82%) south of the South Tibetan Detachment system (STDS). Based on this shortening, the average long-term shortening rate is estimated to be ˜22mm/yr in this region. The available shortening estimates from different parts of the Himalayan arc show significant variations in shortening, but based on the present available data, it is difficult to evaluate the primary cause for this variation. The shortening in the Himalayan fold-thrust belt (FTB) is highest in the middle of the Himalayan arc (western Nepal) and progressively decreases towards the two syntaxes. Although the width of the Lesser Himalayan belt decreases in the eastern Himalaya, the Lesser Himalayan shortening percentage remains approximately similar to that in the Nepal Himalaya. In addition, the shortening accommodated within the Lesser Himalayan duplex progressively increases from the western to the eastern Himalaya where it accommodates nearly half of the total shortening. The regional restorations suggest that the width of the original Lesser Himalayan basin may have played an important role in partitioning the shortening in the Himalayan FTB. In addition, the retrodeformed cross section in the Darjeeling-Sikkim Himalaya provides insights into the palinspastic reconstruction of the Gondwana basin of Peninsular India, suggesting that this basin extended ˜150 km northward of its present northernmost exposure in this region. The balanced cross section suggests that each of the MCT sheets has undergone translation of ≥100km in this region. Although a regional scale flat-on-flat relationship is seen in the MCT sheets, there is a significant variation in overburden from the trailing portion to the leading edge of the MCT due to the geometry of the tapered crystalline orogenic wedge. Microstructural studies from three segments of the MCT2 fault zone suggest that the MCT2 zone has undergone strain softening by different mechanisms along different portions of its transport-parallel length, mainly as a result of changing overburden conditions. This regional strain softening provides a suitable explanation for the large translation of ≥100 km along a relatively thin MCT2 fault zone in the Darjeeling-Sikkim Himalaya.

Thermally induced cation redistribution in Fe-bearing oxy-dravite and potential geothermometric implications

NASA Astrophysics Data System (ADS)

Bosi, Ferdinando; Skogby, Henrik; Hålenius, Ulf

2016-05-01

Iron-bearing oxy-dravite was thermally treated in air and hydrogen atmosphere at 800 °C to study potential changes in Fe, Mg and Al ordering over the octahedrally coordinated Y and Z sites and to explore possible applications to intersite geothermometry based on tourmaline. Overall, the experimental data (structural refinement, Mössbauer, infrared and optical absorption spectroscopy) show that heating Fe-bearing tourmalines results in disordering of Fe over Y and Z balanced by ordering of Mg at Y, whereas Al does not change appreciably. The Fe disorder depends on temperature, but less on redox conditions. The degree of Fe3+-Fe2+ reduction is limited despite strongly reducing conditions, indicating that the f O2 conditions do not exclusively control the Fe oxidation state at the present experimental conditions. Untreated and treated samples have similar short- and long-range crystal structures, which are explained by stable Al-extended clusters around the O1 and O3 sites. In contrast to the stable Al clusters that preclude any temperature-dependent Mg-Al order-disorder, there occurs Mg diffusion linked to temperature-dependent exchange with Fe. Ferric iron mainly resides around O2- at O1 rather than (OH)-, but its intersite disorder induced by thermal treatment indicates that Fe redistribution is the driving force for Mg-Fe exchange and that its diffusion rates are significant at these temperatures. With increasing temperature, Fe progressively disorders over Y and Z, whereas Mg orders at Y according to the order-disorder reaction: YFe + ZMg → ZFe + YMg. The presented findings are important for interpretation of the post-crystallization history of both tourmaline and tourmaline host rocks and imply that successful tourmaline geothermometers may be developed by thermal calibration of the Mg-Fe order-disorder reaction, whereas any thermometers based on Mg-Al disorder will be insensitive and involve large uncertainties.

Residual Stresses in Thermal Barrier Coatings for a Cu-8Cr-4Nb Substrate System

NASA Technical Reports Server (NTRS)

Ghosn, Louis J.; Raj, Sai V.

2002-01-01

Analytical calculations were conducted to determine the thermal stresses developed in a coated copper-based alloy, Cu-8%(at.%)Cr-4%Nb (designated as GRCop-84), after plasma spraying and during heat-up in a simulated rocket engine environment. Finite element analyses were conducted for two coating systems consisting of a metallic top coat, a pure copper bond coat and the GRCop-84. The through thickness temperature variations were determined as a function of coating thickness for two metallic coatings, a Ni-17%(wt%)Cr-6%Al-0.5%Y alloy and a Ni-50%(at.%)Al alloy. The residual stresses after low-pressure plasma spraying of the NiCrAlY and NiAl coatings on GRCop-84 substrate were also evaluated. These analyses took into consideration a 50.8 mm copper bond coat and the effects of an interface coating roughness. The through the thickness thermal stresses developed in coated liners were also calculated after 15 minutes of exposure in a rocket environment with and without an interfacial roughness.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

NASA Astrophysics Data System (ADS)

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

PubMed Central

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308

Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

PubMed

Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

2011-07-01

This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

Preparation, mechanical strengths, and thermal

NASA Astrophysics Data System (ADS)

Inoue, A.; Furukawa, S.; Hagiwara, M.; Masumoto, T.

1987-05-01

Ni-based amorphous wires with good bending ductility have been prepared for Ni75Si8B17 and Ni78P12B10 alloys containing 1 to 2 at. pct Al or Zr by melt spinning in rotating water. The enhancement of the wire-formation tendency by the addition of Al has been clarified to be due to the increase in the stability of the melt jet through the formation of a thin A12O3 film on the outer surface. The maximum wire diameter is about 190 to 200 μm for the Ni-Si (or P)-B-Al alloys and increases to about 250 μm for the Ni-Si-B-Al-Cr alloys containing 4 to 6 at. pct Cr. The tensile fracture strength and fracture elongation are 2730 MPa and 2.9 pct for (Ni0.75Si0.08B0.17 99Al1) wire and 2170 MPa and 2.4 pct for (Ni0.78P0.12B0.1)99Al1 wire. These wires exhibit a fatigue limit under dynamic bending strain in air with a relative humidity of 65 pct; this limit is 0.50 pct for a Ni-Si-B-Al wire, which is higher by 0.15 pct than that of a Fe75Si10B15 amorphous wire. Furthermore, the Ni-base wires do not fracture during a 180-deg bending even for a sample annealed at temperatures just below the crystallization temperature, in sharp contrast to high embrittlement tendency for Fe-base amorphous alloys. Thus, the Ni-based amorphous wires have been shown to be an attractive material similar to Fe- and Co-based amorphous wires because of its high static and dynamic strength, high ductility, high stability to thermal embrittlement, and good corrosion resistance.

Stacked-unstacked equilibrium at the nick site of DNA.

PubMed

Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

2004-09-17

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Onset and Cessation of Thermal Convection within Titan's Ice Shell

NASA Astrophysics Data System (ADS)

Mitri, G.; Tobie, G.; Choblet, G.

2015-12-01

The onset of thermal convection within the outer ice shell of Titan is believed to be at the origin of methane outgassing on Titan (Tobie et al., 2006), a possible factor in Titan's resurfacing processes (Mitri et al., 2008), and to have a major role in the evolution and tectonic activity of this Saturnian icy satellite (Tobie et al., 2005; Mitri and Showman, 2008; Mitri et al., 2010). Recent measurements of the gravity field (Iess et al., 2010, 2012) and the modeling of the shape and topography (Zebker et al., 2009; Mitri et al., 2014) have recently improved our knowledge of the thermal state and structure of Titan's outer ice shell. Mitri et al. (2014) found that Titan's surface topography is consistent with an isostatically compensated ice shell of variable thickness, likely at the present in a thermally conductive state (see also Nimmo and Bills, 2010; Hemingway et al., 2013), overlying a relatively dense (~1200-1350 kg m-3) subsurface ocean. As Titan's ice shell is not currently experiencing thermal convection it is likely that the ice shell could have experienced during its history both the onset and the cessation of thermal convection; thermal convection could be present within the ice shell for limited times or in fact be episodic. We investigate the evolution of Titan's outer ice shell from the crystallization of the underlying ocean with a focus on the onset and cessation of thermal convection. To simulate convection in a growing ice shell, we numerically solve the thermal convection equations for a Newtonian rheology in a two dimensional Cartesian domain using finite element method, with a moving bottom boundary to ocean crystallization. We discuss how the crystallization process affects the onset of convection and in which conditions the cessation of thermal convection may occur. The geological consequences of the changes of the thermal state and structure of the outer ice shell will also be discussed.

Thermal diffusivity measurement of GaAs/AlGaAs thin-film structures

NASA Astrophysics Data System (ADS)

Chen, G.; Tien, C. L.; Wu, X.; Smith, J. S.

1994-05-01

This work develops a new measurement technique that determines the thermal diffusivity of thin films in both parallel and perpendicular directions, and presents experimental results on the thermal diffusivity of GaAs/AlGaAs-based thin-film structures. In the experiment, a modulated laser source heats up the sample and a fast-response temperature sensor patterned directly on the sample picks up the thermal response. From the phase delay between the heating source and the temperature sensor, the thermal diffusivity in either the parallel or perpendicular direction is obtained depending on the experimental configuration. The experiment is performed on a molecular-beam-epitaxy grown vertical-cavity surface-emitting laser (VCSEL) structure. The substrates of the samples are etched away to eliminate the effects of the interface between the film and the substrate. The results show that the thermal diffusivity of the VCSEL structure is 5-7 times smaller than that of its corresponding bulk media. The experiments also provide evidence on the anisotropy of thermal diffusivity caused solely by the effects of interfaces and boundaries of thin films.

Thermal and electron transport studies on the valence fluctuating compound YbNiAl4

NASA Astrophysics Data System (ADS)

Falkowski, M.; Kowalczyk, A.

2018-05-01

We report the thermoelectric power S and thermal conductivity κ measurements on the valence fluctuating compound YbNiAl4, furthermore taking into account the impact of the applied magnetic field. We discuss our new results with revisiting the magnetic [χ(T)], transport [ρ(T)], and thermodynamic [Cp(T)] properties in order to better understand the phenomenon of thermal and electron transport in this compound. The field dependence of the magnetoresistivity data is also given. The temperature dependence of thermoelectric power S(T) was found to exhibit a similar behaviour as expected for Yb-based compounds with divalent or nearly divalent Yb ions. In addition, the values of total thermal conductivity as a function of temperature κ(T) of YbNiAl4 are fairly low compared to those of pure metals which may be linked to the fact that the conduction band is perturbed by strong hybridization. A deeper analysis of the specific heat revealed the low-T anomaly of the ratio Cp(T)/T3, most likely associated with the localized low-frequency oscillators in this alloy. In addition, the Kadowaki-Woods ratio and the Wilson ratio are discussed with respect to the electronic correlations in YbNiAl4.

Thermal conductance of metallic atomic-size contacts: Phonon transport and Wiedemann-Franz law

NASA Astrophysics Data System (ADS)

Klöckner, J. C.; Matt, M.; Nielaba, P.; Pauly, F.; Cuevas, J. C.

2017-11-01

Motivated by recent experiments [Science 355, 1192 (2017), 10.1126/science.aam6622; Nat. Nanotechnol. 12, 430 (2017), 10.1038/nnano.2016.302], we present here an extensive theoretical analysis of the thermal conductance of atomic-size contacts made of three different metals, namely gold (Au), platinum (Pt), and aluminum (Al). The main goal of this work is to elucidate the role of phonons in the thermal transport through these atomic contacts as well as to study the validity of the Wiedemann-Franz law, which relates the electrical and the thermal conductance. For this purpose, we have employed two different custom-developed theoretical approaches. The first one is a transport method based on density functional theory (DFT) that allows one to accurately compute the contributions of both electrons and phonons to the thermal transport in few-atom-thick contacts. The second technique is based on a combination of classical molecular dynamics (MD) simulations and a tight-binding model that enables the efficient calculation of the electronic contribution to the thermal conductance of atomic contacts of larger size. Our DFT-based calculations show that the thermal conductance of few-atom contacts of Au and Pt is dominated by electrons, with phonons giving a contribution typically below 10% of the total thermal conductance, depending on the contact geometry. For these two metals we find that the small deviations from the Wiedemann-Franz law, reported experimentally, largely stem from phonons. In the case of Al contacts we predict that the phononic contribution can be considerably larger with up to 40% of the total thermal conductance. We show that these differences in the phononic contribution across metals originate mainly from their distinct Debye energies. On the other hand, our MD-based calculations demonstrate that the electronic contribution to the thermal conductance follows very closely the Wiedemann-Franz law, irrespective of the material and the contact size. Finally, the ensemble of our results consistently shows that the reported observation of quantized thermal transport at room temperature is restricted to few-atom contacts of Au, a monovalent metal in which the transport is dominated by the s valence orbitals. In the case of multivalent metals like Pt and Al this quantization is statistically absent due to the fact that additional orbitals contribute to the transport with conduction channels that have intermediate transmissions between 0 and 1, even in the case of single-atom contacts.

24. First floor, staircase, detail of newel post base ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

24. First floor, staircase, detail of newel post base - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Toward Improved Fidelity of Thermal Explosion Simulations

NASA Astrophysics Data System (ADS)

Nichols, A. L.; Becker, R.; Howard, W. M.; Wemhoff, A.

2009-12-01

We will present results of an effort to improve the thermal/chemical/mechanical modeling of HMX based explosives like LX04 and LX10 for thermal cook-off The original HMX model and analysis scheme were developed by Yoh et al. for use in the ALE3D modeling framework. The current results were built to remedy the deficiencies of that original model. We concentrated our efforts in four areas. The first area was addition of porosity to the chemical material model framework in ALE3D that is used to model the HMX explosive formulation. This is needed to handle the roughly 2% porosity in solid explosives. The second area was the improvement of the HMX reaction network, which included a reactive phase change model base on work by Henson et al. The third area required adding early decomposition gas species to the CHEETAH material database to develop more accurate equations of state for gaseous intermediates and products. Finally, it was necessary to improve the implicit mechanics module in ALE3D to more naturally handle the long time scales associated with thermal cook-off The application of the resulting framework to the analysis of the Scaled Thermal Explosion (STEX) experiments will be discussed.

Next Generation Ceramic Substrate Fabricated at Room Temperature.

PubMed

Kim, Yuna; Ahn, Cheol-Woo; Choi, Jong-Jin; Ryu, Jungho; Kim, Jong-Woo; Yoon, Woon-Ha; Park, Dong-Soo; Yoon, Seog-Young; Ma, Byungjin; Hahn, Byung-Dong

2017-07-26

A ceramic substrate must not only have an excellent thermal performance but also be thin, since the electronic devices have to become thin and small in the electronics industry of the next generation. In this manuscript, a thin ceramic substrate (thickness: 30-70 µm) is reported for the next generation ceramic substrate. It is fabricated by a new process [granule spray in vacuum (GSV)] which is a room temperature process. For the thin ceramic substrates, AlN GSV films are deposited on Al substrates and their electric/thermal properties are compared to those of the commercial ceramic substrates. The thermal resistance is significantly reduced by using AlN GSV films instead of AlN bulk-ceramics in thermal management systems. It is due to the removal of a thermal interface material which has low thermal conductivity. In particular, the dielectric strengths of AlN GSV films are much higher than those of AlN bulk-ceramics which are commercialized, approximately 5 times. Therefore, it can be expected that this GSV film is a next generation substrate in thermal management systems for the high power application.

Reducing the background fluorescence in mice receiving fluorophore/inhibitor DNA duplexes.

PubMed

Liang, Minmin; Liu, Xinrong; Liu, Guozheng; Dou, Shuping; Cheng, Dengfeng; Liu, Yuxia; Rusckowski, Mary; Hnatowich, Donald J

2011-02-07

In principle, a DNA duplex consisting of an antisense fluorophore-conjugated major strand hybridized to a shorter complementary inhibitor-conjugated minor strand should provide fluorescence only in the tumor after intravenous administration if designed to remain intact except in the presence in tumor of its mRNA target. While we have obtained impressive tumor images in mice using this approach, there remains some background fluorescence. In this study, tissue homogenates of selected mouse organs were incubated with a test duplex and the kinetics of duplex dissociation in normal tissues were measured. In this manner we were able to identify the liver as the likely major source responsible for the duplex dissociation providing this fluorescence background. Thereafter liver homogenates were used to screen a series of duplex candidates with variable-length minor strands, and dissociation was measured by gel electrophoresis. The selected fluorophore/inhibitor duplex with improved stability displayed an insignificant (P > 0.05) background fluorescence after administration to SKH-1 normal mice and apparently without affecting target mRNA binding in vitro in cell culture or in vivo in tumor bearing mice.

Synthesis of 5-(1,2,3-triazol-4-yl)-2'-deoxyuridines by a click chemistry approach: stacking of triazoles in the major groove gives increased nucleic acid duplex stability.

PubMed

Kocalka, Petr; Andersen, Nicolai K; Jensen, Frank; Nielsen, Poul

2007-11-23

A general protocol for converting alkyl and aryl halides into azides and for converting these in situ into 1,4-disubstituted triazoles was applied with 5-ethynyl-2'-deoxyuridine. This afforded three modified 2'-deoxyuridine analogues with either unsubstituted or 1-phenyl-/1-benzyl-substituted triazoles in their 5-positions. Modelling demonstrates coplanarity of the two heteroaromatic rings, and UV spectroscopy showed the uracil pK(a) values to be almost unchanged. The three nucleosides were introduced into nonamer oligonucleotides by phosphoramidite chemistry. The heteroaromatic triazoles became positioned in the major grooves of the short dsDNA and DNA-RNA duplexes. While single modifications led to decreased duplex stability, the stacking of four consecutive modifications led to enhanced duplex stability, especially for DNA-RNA duplexes. The duplex structures were studied by CD spectroscopy and molecular dynamics simulations, which supported the conjecture that the duplex stabilizing effect is due to efficient stacking of the heteroaromatic triazoles.

Plasma-Sprayed High Entropy Alloys: Microstructure and Properties of AlCoCrFeNi and MnCoCrFeNi

NASA Astrophysics Data System (ADS)

Ang, Andrew Siao Ming; Berndt, Christopher C.; Sesso, Mitchell L.; Anupam, Ameey; S, Praveen; Kottada, Ravi Sankar; Murty, B. S.

2015-02-01

High entropy alloys (HEAs) represent a new class of materials that present novel phase structures and properties. Apart from bulk material consolidation methods such as casting and sintering, HEAs can also be deposited as a surface coating. In this work, thermal sprayed HEA coatings are investigated that may be used as an alternative bond coat material for a thermal barrier coating system. Nanostructured HEAs that were based on AlCoCrFeNi and MnCoCrFeNi were prepared by ball milling and then plasma sprayed. Splat studies were assessed to optimise the appropriate thermal spray parameters and spray deposits were prepared. After mechanical alloying, aluminum-based and manganese-based HEA powders revealed contrary prominences of BCC and FCC phases in their X-ray diffraction patterns. However, FCC phase was observed as the major phase present in both of the plasma-sprayed AlCoCrFeNi and MnCoCrFeNi coatings. There were also minor oxide peaks detected, which can be attributed to the high temperature processing. The measured porosity levels for AlCoCrFeNi and MnCoCrFeNi coatings were 9.5 ± 2.3 and 7.4 ± 1.3 pct, respectively. Three distinct phase contrasts, dark gray, light gray and white, were observed in the SEM images, with the white regions corresponding to retained multicomponent HEAs. The Vickers hardness (HV0.3kgf) was 4.13 ± 0.43 and 4.42 ± 0.60 GPa for AlCoCrFeNi and MnCoCrFeNi, respectively. Both type of HEAs coatings exhibited anisotropic mechanical behavior due to their lamellar, composite-type microstructure.

The influence of point defects on the thermal conductivity of AlN crystals

NASA Astrophysics Data System (ADS)

Rounds, Robert; Sarkar, Biplab; Alden, Dorian; Guo, Qiang; Klump, Andrew; Hartmann, Carsten; Nagashima, Toru; Kirste, Ronny; Franke, Alexander; Bickermann, Matthias; Kumagai, Yoshinao; Sitar, Zlatko; Collazo, Ramón

2018-05-01

The average bulk thermal conductivity of free-standing physical vapor transport and hydride vapor phase epitaxy single crystal AlN samples with different impurity concentrations is analyzed using the 3ω method in the temperature range of 30-325 K. AlN wafers grown by physical vapor transport show significant variation in thermal conductivity at room temperature with values ranging between 268 W/m K and 339 W/m K. AlN crystals grown by hydride vapor phase epitaxy yield values between 298 W/m K and 341 W/m K at room temperature, suggesting that the same fundamental mechanisms limit the thermal conductivity of AlN grown by both techniques. All samples in this work show phonon resonance behavior resulting from incorporated point defects. Samples shown by optical analysis to contain carbon-silicon complexes exhibit higher thermal conductivity above 100 K. Phonon scattering by point defects is determined to be the main limiting factor for thermal conductivity of AlN within the investigated temperature range.

Effect of Si content on microstructure and thermo-physical properties of the joint of Sip/6063Al composite by laser melting deposition

NASA Astrophysics Data System (ADS)

Lei, Zhenglong; Tian, Ze; Li, Peng; Chen, Yanbin; Zhang, Hengquan; Gu, Jingyan; Su, Xuan

2017-12-01

Laser melting deposition (LMD), an additive manufacturing-based technology, was utilized to join Sip/6063Al composite creatively with different Si weight contents (Al-Si 5%, 12%, 20% and 30%). Influence of the Si content on the constitutional phases, microstructural characteristics, and thermo-physical properties of the layer by layer built-up weld beads was investigated. Experimental results showed that the increasing of deposited Si content could lead to a marked increment of both size and volume of precipitated Si phase, and the circled α-Al phase decreased as a whole. The Si/Al interface began to decrease for the sample Al-Si30 wt.% due to the connection of Si phases. The α-Al phase within the (Al, Si) eutectic were observed to exhibit two sub-micron solidification morphologies, columnar grains and equiaxed grains, respectively. In general, by increasing the content of the deposited Si, the thermal conductivity decreased owing to the decreasing of α-Al phase with high conductivity, and the coefficient of thermal expansion (CTE) had the same varying trend which was attributed to the increasing volume fraction of stiff precipitated Si phase and Si-Si contiguity.

Study of degradation processes kinetics in ohmic contacts of resonant tunneling diodes based on nanoscale AlAs/GaAs heterostructures under influence of temperature

NASA Astrophysics Data System (ADS)

Makeev, M. O.; Meshkov, S. A.

2017-07-01

The artificial aging of resonant tunneling diodes based on nanoscale AlAs/GaAs heterostructures was conducted. As a result of the thermal influence resonant tunneling diodes IV curves degrade firstly due to ohmic contacts' degradation. To assess AlAs/GaAs resonant tunneling diodes degradation level and to predict their reliability, a functional dependence of the contact resistance of resonant tunneling diode AuGeNi ohmic contacts on time and temperature was offered.

Substrate specificities of the ntg1 and ntg2 proteins of Saccharomyces cerevisiae for oxidized DNA bases are not identical.

PubMed Central

Sentürker, S; Auffret van der Kemp, P; You, H J; Doetsch, P W; Dizdaroglu, M; Boiteux, S

1998-01-01

Two genes of Saccharomyces cerevisiae, NTG1 and NTG2, encode proteins with a significant sequence homology to the endonuclease III of Escherichia coli. The Ntg1 and Ntg2 proteins were overexpressed in E.coli and purified to apparent homogeneity. The substrate specificity of Ntg1 and Ntg2 proteins for modified bases in oxidatively damaged DNA was investigated using gas chromatography/isotope-dilution mass spectrometry. The substrate used was calf-thymus DNA exposed to gamma-radiation in N2O-saturated aqueous solution. The results reveal excision by Ntg1 and Ntg2 proteins of six pyrimidine-derived lesions, 5-hydroxy-6-hydrothymine, 5-hydroxy-6-hydrouracil, 5-hydroxy-5-methylhydantoin, 5-hydroxyuracil, 5-hydroxycytosine and thymine glycol, and two purine-derived lesions, 2,6-diamino-4-hydroxy-5-formamidopyrimidine and 4,6-diamino-5-formamidopyrimidine from gamma-irradiated DNA. In contrast, Ntg1 and Ntg2 proteins do not release 8-hydroxyguanine or 8-hydroxyadenine from gamma-irradiated DNA. The Ntg1 and Ntg2 proteins also release 2, 6-diamino-4-hydroxy-5-N-methylformamido-pyrimidine from damaged poly(dG-dC).poly(dG-dC). Excision was measured as a function of enzyme concentration and time. Furthermore, kinetic parameters were determined for each lesion. The results show that kinetic constants varied among the different lesions for the same enzyme. We also investigated the capacity of the Ntg1 and Ntg2 proteins to cleave 34mer DNA duplexes containing a single 8-OH-Gua residue mispaired with each of the four DNA bases. The results show that the Ntg1 protein preferentially cleaves a DNA duplex containing 8-OH-Gua mispaired with a guanine. Moreover, the Ntg1 protein releases free 8-OH-Gua from 8-OH-Gua/Gua duplex but not from duplexes containing 8-OH-Gua mispaired with adenine, thymine or cytosine. In contrast, the Ntg2 protein does not incise duplexes containing 8-OH-Gua mispaired with any of the four DNA bases. These results demonstrate that substrate specificities of the Ntg1 and Ntg2 proteins are similar but not identical and clearly different from that of the endonuclease III of E.coli and its homologues in Schizosaccharomyces pombe or human cells. PMID:9826748

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Synthesis of peptide nucleic acids containing pyridazine derivatives as cytosine and thymine analogs, and their duplexes with complementary oligodeoxynucleotides.

PubMed

Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

2015-03-20

Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.

Synthesis of native-like crosslinked duplex RNA and study of its properties.

PubMed

Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

2017-04-01

A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA. Copyright © 2017. Published by Elsevier Ltd.

'Passive-roof' duplex geometry in the frontal structures of the Kirthar and Sulaiman mountain belts, Pakistan

NASA Astrophysics Data System (ADS)

Banks, C. J.; Warburton, J.

Exploration for hydrocarbons over the past few years has greatly improved our understanding of the geometry of frontal mountain belt structures. In this study we introduce and discuss the concept of the 'Passive-roof duplex', using as the main example the Kirthar and Sulaiman Ranges in the Baluchistan Province of Pakistan. Structures similar to those described here have been recognized previously in other mountain belts, and they appear to exist as a common feature in many more frontal regions of mountain belts. Our example of a Passive-roof duplex which we describe from Pakistan is compared briefly with similar structures reported by others. The Passive-roof duplex is here defined as a duplex whose roof thrust has backthrust sense ( Passive-roof thrust) and whose roof sequence (those rocks lying above the roof thrust) remains relatively 'stationary' during foreland directed piggy-back style propagation of horses within the duplex.

Quantifying the limits of through-plane thermal dissipation in 2D-material-based systems

NASA Astrophysics Data System (ADS)

Yasaei, Poya; Behranginia, Amirhossein; Hemmat, Zahra; El-Ghandour, Ahmed I.; Foster, Craig D.; Salehi-Khojin, Amin

2017-09-01

Through-plane thermal transport accounts for a major fraction of heat dissipation from hot-spots in many existing devices made of two-dimensional (2D) materials. In this report, we performed a set of electrical thermometry measurements and 3D finite element analyses to quantify the limits of power dissipation in monolayer graphene, a representative of 2D materials, fabricated on various technologically viable substrates such as chemical vapor deposited (CVD) diamond, tape-casted (sintered) aluminum nitride (AlN), and single crystalline c-plane sapphire as well as silicon with different oxide layers. We demonstrate that the heat dissipation through graphene on AlN substrate near room temperature outperforms those of CVD diamond and other studied substrates, owing to its superior thermal boundary conductance (TBC). At room temperature, our measurements reveal a TBC of 33.5 MW · m-2 · K-1 for graphene on AlN compared to 6.2 MW · m-2 · K-1 on diamond. This study highlights the importance of simultaneous optimization of the interfaces and the substrate and provides a route to maximize the heat removal capability of 2D-material-based devices.

Thermal Modeling of Al-Al and Al-Steel Friction Stir Spot Welding

NASA Astrophysics Data System (ADS)

Jedrasiak, P.; Shercliff, H. R.; Reilly, A.; McShane, G. J.; Chen, Y. C.; Wang, L.; Robson, J.; Prangnell, P.

2016-09-01

This paper presents a finite element thermal model for similar and dissimilar alloy friction stir spot welding (FSSW). The model is calibrated and validated using instrumented lap joints in Al-Al and Al-Fe automotive sheet alloys. The model successfully predicts the thermal histories for a range of process conditions. The resulting temperature histories are used to predict the growth of intermetallic phases at the interface in Al-Fe welds. Temperature predictions were used to study the evolution of hardness of a precipitation-hardened aluminum alloy during post-weld aging after FSSW.

Explicit ions/implicit water generalized Born model for nucleic acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tolokh, Igor S.; Thomas, Dennis G.; Onufriev, Alexey V.

Ion atmosphere around highly charged nucleic acid molecules plays a significant role in their dynamics, structure and interactions. Here we utilized the implicit solvent framework to develop a model for the explicit treatment of ions interacting with nucleic acid molecules. The proposed explicit ions/implicit water model is based on a significantly modified generalized Born (GB) model, and utilizes a non-standard approach to defining the solute/solvent dielectric boundary. Specifically, the model includes modifications to the GB interaction terms for the case of multiple interacting solutes – disconnected dielectric boundary around the solute-ion or ion-ion pairs. Fully analytical description of all energymore » components for charge-charge interactions is provided. The effectiveness of the approach is demonstrated by calculating the potential of mean force (PMF) for Na+-Cl− ion pair and by carrying out a set of Monte Carlo (MC) simulations of mono- and trivalent ions interacting with DNA and RNA duplexes. The monovalent (Na+) and trivalent (CoHex3+) counterion distributions predicted by the model are in close quantitative agreement with all-atom explicit water molecular dynamics simulations used as reference. Expressed in the units of energy, the maximum deviations of local ion concentrations from the reference are within kBT. The proposed explicit ions/implicit water GB model is able to resolve subtle features and differences of CoHex distributions around DNA and RNA duplexes. These features include preferential CoHex binding inside the major groove of RNA duplex, in contrast to CoHex biding at the "external" surface of the sugar-phosphate backbone of DNA duplex; these differences in the counterion binding patters were shown earlier to be responsible for the observed drastic differences in condensation propensities between short DNA and RNA duplexes. MC simulations of CoHex ions interacting with homopolymeric poly(dA·dT) DNA duplex with modified (de-methylated) and native Thymine bases are used to explore the physics behind CoHex-Thymine interactions. The simulations suggest that the ion desolvation penalty due to proximity to the low dielectric volume of the methyl group can contribute significantly to CoHex-Thymine interactions. Compared to the steric repulsion between the ion and the methyl group, the desolvation penalty interaction has a longer range, and may be important to consider in the context of methylation effects on DNA condensation.« less