A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif.

PubMed

Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin

2015-01-01

Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were -0.44 Kcal/mol and -9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

System-based strategies for p53 recovery.

PubMed

Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

2018-06-01

The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

Crosstalk between mitochondrial stress signals regulates yeast chronological lifespan.

PubMed

Schroeder, Elizabeth A; Shadel, Gerald S

2014-01-01

Mitochondrial DNA (mtDNA) exists in multiple copies per cell and is essential for oxidative phosphorylation. Depleted or mutated mtDNA promotes numerous human diseases and may contribute to aging. Reduced TORC1 signaling in the budding yeast, Saccharomyces cerevisiae, extends chronological lifespan (CLS) in part by generating a mitochondrial ROS (mtROS) signal that epigenetically alters nuclear gene expression. To address the potential requirement for mtDNA maintenance in this response, we analyzed strains lacking the mitochondrial base-excision repair enzyme Ntg1p. Extension of CLS by mtROS signaling and reduced TORC1 activity, but not caloric restriction, was abrogated in ntg1Δ strains that exhibited mtDNA depletion without defects in respiration. The DNA damage response (DDR) kinase Rad53p, which transduces pro-longevity mtROS signals, is also activated in ntg1Δ strains. Restoring mtDNA copy number alleviated Rad53p activation and re-established CLS extension following mtROS signaling, indicating that Rad53p senses mtDNA depletion directly. Finally, DDR kinases regulate nucleus-mitochondria localization dynamics of Ntg1p. From these results, we conclude that the DDR pathway senses and may regulate Ntg1p-dependent mtDNA stability. Furthermore, Rad53p senses multiple mitochondrial stresses in a hierarchical manner to elicit specific physiological outcomes, exemplified by mtDNA depletion overriding the ability of Rad53p to transduce an adaptive mtROS longevity signal. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Effects of delay and noise in a negative feedback regulatory motif

NASA Astrophysics Data System (ADS)

Palassini, Matteo; Dies, Marta

2009-03-01

The small copy number of the molecules involved in gene regulation can induce nontrivial stochastic phenomena such as noise-induced oscillations. An often neglected aspect of regulation dynamics are the delays involved in transcription and translation. Delays introduce analytical and computational complications because the dynamics is non-Markovian. We study the interplay of noise and delays in a negative feedback model of the p53 core regulatory network. Recent experiments have found pronounced oscillations in the concentrations of proteins p53 and Mdm2 in individual cells subjected to DNA damage. Similar oscillations occur in the Hes-1 and NK-kB systems, and in circadian rhythms. Several mechanisms have been proposed to explain this oscillatory behaviour, such as deterministic limit cycles, with and without delay, or noise-induced excursions in excitable models. We consider a generic delayed Master Equation incorporating the activation of Mdm2 by p53 and the Mdm2-promoted degradation of p53. In the deterministic limit and for large delays, the model shows a Hopf bifurcation. Via exact stochastic simulations, we find strong noise-induced oscillations well outside the limit-cycle region. We propose that this may be a generic mechanism for oscillations in gene regulatory systems.

Dynamic monitoring of p53 translocation to mitochondria for the analysis of specific inhibitors using luciferase-fragment complementation.

PubMed

Noda, Natsumi; Awais, Raheela; Sutton, Robert; Awais, Muhammad; Ozawa, Takeaki

2017-12-01

Intracellular protein translocation plays a pivotal role in regulating complex biological processes, including cell death. The tumor suppressor p53 is a transcription factor activated by DNA damage and oxidative stress that also translocates from the cytosol into the mitochondrial matrix to facilitate necrotic cell death. However, specific inhibitors of p53 mitochondrial translocation are largely unknown. To explore the inhibitors of p53, we developed a bioluminescent probe to monitor p53 translocation from cytosol to mitochondria using luciferase fragment complementation assays. The probe is composed of a novel pair of luciferase fragments, the N-terminus of green click beetle luciferase CBG68 (CBGN) and multiple-complement luciferase fragment (McLuc1). The combination of luciferase fragments showed significant luminescence intensity and high signal-to-background ratio. When the p53 connected with McLuc1 translocates from cytosol into mitochondrial matrix, CBGN in mitochondrial matrix enables to complement with McLuc1, resulting in the restoration of the luminescence. The luminescence intensity was significantly increased under hydrogen peroxide-induced oxidative stress following the complementation of CBGN and McLuc1. Pifithrin-μ, a selective inhibitor of p53 mitochondrial translocation, prevented the mitochondrial translocation of the p53 probe in a concentration-dependent manner. Furthermore, the high luminescence intensity made it easier to visualize the p53 translocation at a single cell level under a bioluminescence microscope. This p53 mitochondrial translocation assay is a new tool for high-throughput screening to identify novel p53 inhibitors, which could be developed as drugs to treat diseases in which necrotic cell death is a major contributor. © 2017 Wiley Periodicals, Inc.

HIPK2 modulates p53 activity towards pro-apoptotic transcription.

PubMed

Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

2009-10-14

Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.

Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

NASA Astrophysics Data System (ADS)

Samanta, Sudipta; Mukherjee, Sanchita

2017-10-01

The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

Mutant human tumor suppressor p53 modulates the activation of mitogen-activated protein kinase and nuclear factor-kappaB, but not c-Jun N-terminal kinase and activated protein-1.

PubMed

Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena

2006-01-01

The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF-kappaB distinctively, while modulating the pathways of JNK and AP-1 similarly. These differences may influence cellular processes such as proliferation, differentiation, and apoptosis. 2005 Wiley-Liss, Inc.

Metabolite and transcriptome analysis during fasting suggest a role for the p53-Ddit4 axis in major metabolic tissues

PubMed Central

2013-01-01

Background Fasting induces specific molecular and metabolic adaptions in most organisms. In biomedical research fasting is used in metabolic studies to synchronize nutritional states of study subjects. Because there is a lack of standardization for this procedure, we need a deeper understanding of the dynamics and the molecular mechanisms in fasting. Results We investigated the dynamic changes of liver gene expression and serum parameters of mice at several time points during a 48 hour fasting experiment and then focused on the global gene expression changes in epididymal white adipose tissue (WAT) as well as on pathways common to WAT, liver, and skeletal muscle. This approach produced several intriguing insights: (i) rather than a sequential activation of biochemical pathways in fasted liver, as current knowledge dictates, our data indicates a concerted parallel response; (ii) this first characterization of the transcriptome signature of WAT of fasted mice reveals a remarkable activation of components of the transcription apparatus; (iii) most importantly, our bioinformatic analyses indicate p53 as central node in the regulation of fasting in major metabolic tissues; and (iv) forced expression of Ddit4, a fasting-regulated p53 target gene, is sufficient to augment lipolysis in cultured adipocytes. Conclusions In summary, this combination of focused and global profiling approaches provides a comprehensive molecular characterization of the processes operating during fasting in mice and suggests a role for p53, and its downstream target Ddit4, as novel components in the transcriptional response to food deprivation. PMID:24191950

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

PubMed

Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

2009-06-17

P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

PubMed

Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.

Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

PubMed Central

Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160

Molecular dynamics simulation of S100B protein to explore ligand blockage of the interaction with p53 protein

NASA Astrophysics Data System (ADS)

Zhou, Zhigang; Li, Yumin

2009-10-01

As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.

Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

PubMed Central

Stegh, Alexander H.

2012-01-01

Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

PubMed

Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

2003-09-17

The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

PubMed Central

Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle

2016-01-01

Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199

A stapled p53 helix overcomes HDMX-mediated suppression of p53.

PubMed

Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D

2010-11-16

Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.

Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2

PubMed Central

Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja

2012-01-01

Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530

Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

PubMed Central

Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

2015-01-01

ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

A characterization of low luminance static and dynamic modulation transfer function curves for P-1, P-43, and P-53 phosphorus

NASA Astrophysics Data System (ADS)

Beasley, Howard H.; Martin, John S.; Klymenko, Victor; Harding, Thomas H.; Verona, Robert W.; Rash, Clarence E.

1995-07-01

A counterphase modulation technique is used to measure the static and dynamic modulation transfer functions for three phosphorus of current interest to U.S. Army aviation helmet-mounted displays (P-1, P-43, and P-53). A family of modulation transfer curves, one for each temporal frequency, is presented for each phosphorus. The measured MFT curves generally support the supposition that phosphorus persistence is a critical parameter in the ability of a CRT display to accurately reproduce contrast modulation transfer in dynamic environments.

Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*

PubMed Central

Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi

2011-01-01

Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449

The transcription factor p53: Not a repressor, solely an activator

PubMed Central

Fischer, Martin; Steiner, Lydia; Engeland, Kurt

2014-01-01

The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

R248Q mutation--Beyond p53-DNA binding.

PubMed

Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

2015-12-01

R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

The Transcription Factor p53 Influences Microglial Activation Phenotype

PubMed Central

Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.

2011-01-01

Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312

Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

PubMed Central

Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

2014-01-01

In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

PubMed

Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

2010-11-01

Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.

PubMed

Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru

2011-01-01

MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.

ROS-dependent activation of JNK converts p53 into an efficient inhibitor of oncogenes leading to robust apoptosis

PubMed Central

Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G

2014-01-01

Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150

β-Catenin C-terminal signals suppress p53 and are essential for artery formation

PubMed Central

Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

2016-01-01

Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

NASA Astrophysics Data System (ADS)

Sharifulina, S. A.; Uzdensky, A. B.

2015-03-01

The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

A Protein Turnover Signaling Motif Controls the Stimulus-Sensitivity of Stress Response Pathways

PubMed Central

Loriaux, Paul Michael; Hoffmann, Alexander

2013-01-01

Stimulus-induced perturbations from the steady state are a hallmark of signal transduction. In some signaling modules, the steady state is characterized by rapid synthesis and degradation of signaling proteins. Conspicuous among these are the p53 tumor suppressor, its negative regulator Mdm2, and the negative feedback regulator of NFκB, IκBα. We investigated the physiological importance of this turnover, or flux, using a computational method that allows flux to be systematically altered independently of the steady state protein abundances. Applying our method to a prototypical signaling module, we show that flux can precisely control the dynamic response to perturbation. Next, we applied our method to experimentally validated models of p53 and NFκB signaling. We find that high p53 flux is required for oscillations in response to a saturating dose of ionizing radiation (IR). In contrast, high flux of Mdm2 is not required for oscillations but preserves p53 sensitivity to sub-saturating doses of IR. In the NFκB system, degradation of NFκB-bound IκB by the IκB kinase (IKK) is required for activation in response to TNF, while high IKK-independent degradation prevents spurious activation in response to metabolic stress or low doses of TNF. Our work identifies flux pairs with opposing functional effects as a signaling motif that controls the stimulus-sensitivity of the p53 and NFκB stress-response pathways, and may constitute a general design principle in signaling pathways. PMID:23468615

Stabilization and activation of p53 are regulated independently by different phosphorylation events

PubMed Central

Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

1998-01-01

Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

PubMed

Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

2018-03-23

p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53

PubMed Central

Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.

2012-01-01

The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439

TRIM25 has a dual function in the p53/Mdm2 circuit.

PubMed

Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

2015-11-12

P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

Inhibition of Mdm2 Sensitizes Human Retinal Pigment Epithelial Cells to Apoptosis

PubMed Central

Ray, Ramesh M.; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

2011-01-01

Purpose. Because recent studies indicate that blocking the interaction between p53 and Mdm2 results in the nongenotoxic activation of p53, the authors sought to investigate whether the inhibition of p53-Mdm2 binding activates p53 and sensitizes human retinal epithelial cells to apoptosis. Methods. Apoptosis was evaluated by the activation of caspases and DNA fragmentation assays. The Mdm2 antagonist Nutlin-3 was used to dissociate p53 from Mdm2 and, thus, to increase p53 activity. Knockdown of p53 expression was accomplished by using p53 siRNA. Results. ARPE-19 and primary RPE cells expressed high levels of the antiapoptotic proteins Bcl-2 and Bcl-xL. Exposure of these cells to camptothecin (CPT) or TNF-α/ cycloheximide (CHX) failed to induce apoptosis. In contrast, treatment with the Mdm2 antagonist Nutlin-3 in the absence of CPT or TNF-α/CHX increased apoptosis. Activation of p53 in response to Nutlin-3 also increased levels of Noxa, p53-upregulated modulator of apoptosis (PUMA), and Siva-1, decreased expression of Bcl-2 and Bcl-xL, and simultaneously increased caspases-9 and -3 activities and DNA fragmentation. Knockdown of p53 decreased the basal expression of p21Cip1 and Bcl-2, inhibited the Nutlin-3–induced upregulation of Siva-1 and PUMA expression, and consequently inhibited caspase-3 activation. Conclusions. These results indicate that the normally available pool of intracellular p53 is predominantly engaged in the regulation of cell cycle checkpoints by p21Cip1 and does not trigger apoptosis in response to DNA-damaging agents. However, the blockage of p53 binding to Mdm2 frees a pool of p53 that is sufficient, even in the absence of DNA-damaging agents, to increase the expression of proapoptotic targets and to override the resistance of RPE cells to apoptosis. PMID:21345989

Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

PubMed Central

Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

2014-01-01

The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

PubMed Central

2010-01-01

Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

PubMed

Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

2005-12-08

TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

PubMed Central

Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

2013-01-01

The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.

PubMed

Garner, Elizabeth; Raj, Kenneth

2008-02-01

There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.

Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

PubMed

Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

2015-10-01

The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

PubMed Central

Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

2009-01-01

Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

Selective activation of p53-mediated tumour suppression in high-grade tumours.

PubMed

Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P

2010-11-25

Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

PubMed Central

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-01-01

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

Revealing determinants of two-phase dynamics of P53 network under gamma irradiation based on a reduced 2D relaxation oscillator model.

PubMed

Demirkıran, Gökhan; Kalaycı Demir, Güleser; Güzeliş, Cüneyt

2018-02-01

This study proposes a two-dimensional (2D) oscillator model of p53 network, which is derived via reducing the multidimensional two-phase dynamics model into a model of ataxia telangiectasia mutated (ATM) and Wip1 variables, and studies the impact of p53-regulators on cell fate decision. First, the authors identify a 6D core oscillator module, then reduce this module into a 2D oscillator model while preserving the qualitative behaviours. The introduced 2D model is shown to be an excitable relaxation oscillator. This oscillator provides a mechanism that leads diverse modes underpinning cell fate, each corresponding to a cell state. To investigate the effects of p53 inhibitors and the intrinsic time delay of Wip1 on the characteristics of oscillations, they introduce also a delay differential equation version of the 2D oscillator. They observe that the suppression of p53 inhibitors decreases the amplitudes of p53 oscillation, though the suppression increases the sustained level of p53. They identify Wip1 and P53DINP1 as possible targets for cancer therapies considering their impact on the oscillator, supported by biological findings. They model some mutations as critical changes of the phase space characteristics. Possible cancer therapeutic strategies are then proposed for preventing these mutations' effects using the phase space approach.

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

PubMed Central

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

PubMed

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

Identification of antipsychotic drug fluspirilene as a potential p53-MDM2 inhibitor: a combined computational and experimental study

NASA Astrophysics Data System (ADS)

Patil, Sachin P.; Pacitti, Michael F.; Gilroy, Kevin S.; Ruggiero, John C.; Griffin, Jonathan D.; Butera, Joseph J.; Notarfrancesco, Joseph M.; Tran, Shawn; Stoddart, John W.

2015-02-01

The inhibition of tumor suppressor p53 protein due to its direct interaction with oncogenic murine double minute 2 (MDM2) protein, plays a central role in almost 50 % of all human tumor cells. Therefore, pharmacological inhibition of the p53-binding pocket on MDM2, leading to p53 activation, presents an important therapeutic target against these cancers expressing wild-type p53. In this context, the present study utilized an integrated virtual and experimental screening approach to screen a database of approved drugs for potential p53-MDM2 interaction inhibitors. Specifically, using an ensemble rigid-receptor docking approach with four MDM2 protein crystal structures, six drug molecules were identified as possible p53-MDM2 inhibitors. These drug molecules were then subjected to further molecular modeling investigation through flexible-receptor docking followed by Prime/MM-GBSA binding energy analysis. These studies identified fluspirilene, an approved antipsychotic drug, as a top hit with MDM2 binding mode and energy similar to that of a native MDM2 crystal ligand. The molecular dynamics simulations suggested stable binding of fluspirilene to the p53-binding pocket on MDM2 protein. The experimental testing of fluspirilene showed significant growth inhibition of human colon tumor cells in a p53-dependent manner. Fluspirilene also inhibited growth of several other human tumor cell lines in the NCI60 cell line panel. Taken together, these computational and experimental data suggest a potentially novel role of fluspirilene in inhibiting the p53-MDM2 interaction. It is noteworthy here that fluspirilene has a long history of safe human use, thus presenting immediate clinical potential as a cancer therapeutic. Furthermore, fluspirilene could also serve as a structurally-novel lead molecule for the development of more potent, small-molecule p53-MDM2 inhibitors against several types of cancer. Importantly, the combined computational and experimental screening protocol presented in this study may also prove useful for screening other commercially-available compound databases for identification of novel, small molecule p53-MDM2 inhibitors.

Simultaneous activation of p53 and inhibition of XIAP enhance the activation of apoptosis signaling pathways in AML

PubMed Central

Carter, Bing Z.; Mak, Duncan H.; Schober, Wendy D.; Koller, Erich; Pinilla, Clemencia; Vassilev, Lyubomir T.; Reed, John C.

2010-01-01

Activation of p53 by murine double minute (MDM2) antagonist nutlin-3a or inhibition of X-linked inhibitor of apoptosis (XIAP) induces apoptosis in acute myeloid leukemia (AML) cells. We demonstrate that concomitant inhibition of MDM2 by nutlin-3a and of XIAP by small molecule antagonists synergistically induced apoptosis in p53 wild-type OCI-AML3 and Molm13 cells. Knockdown of p53 by shRNA blunted the synergy, and down-regulation of XIAP by antisense oligonucleotide (ASO) enhanced nutlin-3a–induced apoptosis, suggesting that the synergy was mediated by p53 activation and XIAP inhibition. This is supported by data showing that inhibition of both MDM2 and XIAP by their respective ASOs induced significantly more cell death than either ASO alone. Importantly, p53 activation and XIAP inhibition enhanced apoptosis in blasts from patients with primary AML, even when the cells were protected by stromal cells. Mechanistic studies demonstrated that XIAP inhibition potentiates p53-induced apoptosis by decreasing p53-induced p21 and that p53 activation enhances XIAP inhibition-induced cell death by promoting mitochondrial release of second mitochondria-derived activator of caspases (SMAC) and by inducing the expression of caspase-6. Because both XIAP and p53 are presently being targeted in ongoing clinical trials in leukemia, the combination strategy holds promise for expedited translation into the clinic. PMID:19897582

Ursodeoxycholic acid protects cardiomyocytes against cobalt chloride induced hypoxia by regulating transcriptional mediator of cells stress hypoxia inducible factor 1α and p53 protein.

PubMed

Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah

2017-10-01

In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile acid and is currently used to treat liver diseases. Recently, UDCA is shown to have a cardioprotection effects; however, the mechanism of UDCA cardioprotection is still poorly understood. The current data generated were the first to show that UDCA is able to inhibit the activation of HIF-1α and p53 protein during CoCl 2 -induced hypoxia in cardiomyocytes. This study provides an insight of UDCA mechanism in protecting cardiomyocytes against hypoxia. Copyright © 2017 John Wiley & Sons, Ltd.

Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

PubMed

Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

2017-08-01

Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

2013-06-15

Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

Involvement of stromal p53 in tumor-stroma interactions

PubMed Central

Bar, Jair; Moskovits, Neta; Oren, Moshe

2009-01-01

p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385

Activation of the miR-34a/SIRT1/p53 Signaling Pathway Contributes to the Progress of Liver Fibrosis via Inducing Apoptosis in Hepatocytes but Not in HSCs.

PubMed

Tian, Xiao-Feng; Ji, Fu-Jian; Zang, Hong-Liang; Cao, Hong

2016-01-01

Liver fibrosis results from a sustained wound healing response to chronic liver injury, and the activation of nonparenchymal hepatic stellate cells (HSCs) is the pivotal process. MicroRNA-34a (miR-34a) is the direct target gene of p53 and activates p53 through sirtuin 1 (SIRT1) simultaneously. The miR-34a/SIRT1/p53 signaling pathway thus forms a positive feedback loop wherein p53 induces miR-34a and miR-34a activates p53 by inhibiting SIRT1, playing an important role in cell proliferation and apoptosis. miR-34a expression has been found to be increased in animal models or in human patients with different liver diseases, including liver fibrosis. However, the exact role of this classical miR-34a/SIRT1/p53 signaling pathway in liver fibrosis remains unclear. In the present study, using a CCl4-induced rat liver fibrosis model, we found that the miR-34a/SIRT1/p53 signaling pathway was activated and could be inhibited by SIRT1 activator SRT1720. Further studies showed that the miR-34a/SIRT1/p53 signaling pathway was activated in hepatocytes but not in HSCs. The activation of this pathway in hepatocytes resulted in the apoptosis of hepatocytes and thus activated HSCs. Our data indicate that the miR-34a/SIRT1/p53 signaling pathway might be a promising therapeutic target for liver fibrosis.

p53 is a key regulator for osthole-triggered cancer pathogenesis.

PubMed

Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan

2014-01-01

Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.

Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tommaso, Anne di; Hagen, Jussara; Tompkins, Van

2009-04-15

The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala{sup 14} and Thr{sup 31}) were found to destabilize the protein while two others (Val{sup 24} and Ala{sup 41}) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significantmore » biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val{sup 24} was required for p53-independent growth suppression whereas multiple residues (Val{sup 24}, Thr{sup 31}, Ala{sup 41} and His{sup 60}) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.« less

Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

PubMed Central

Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

2012-01-01

Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

2011-01-01

Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

PubMed

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

On the interaction mechanisms of a p53 peptide and nutlin with the MDM2 and MDMX proteins: a Brownian dynamics study.

PubMed

ElSawy, Karim M; Verma, Chandra S; Joseph, Thomas L; Lane, David P; Twarock, Reidun; Caves, Leo S D

2013-02-01

The interaction of p53 with its regulators MDM2 and MDMX plays a major role in regulating the cell cycle. Inhibition of this interaction has become an important therapeutic strategy in oncology. Although MDM2 and MDMX share a very high degree of sequence/structural similarity, the small-molecule inhibitor nutlin appears to be an efficient inhibitor only of the p53-MDM2 interaction. Here, we investigate the mechanism of interaction of nutlin with these two proteins and contrast it with that of p53 using Brownian dynamics simulations. In contrast to earlier attempts to examine the bound states of the partners, here we locate initial reaction events in these interactions by identifying the regions of space around MDM2/MDMX, where p53/nutlin experience associative encounters with prolonged residence times relative to that in bulk solution. We find that the initial interaction of p53 with MDM2 is long-lived relative to nutlin, but, unlike nutlin, it takes place at the N- and C termini of the MDM2 protein, away from the binding site, suggestive of an allosteric mechanism of action. In contrast, nutlin initially interacts with MDM2 directly at the clefts of the binding site. The interaction of nutlin with MDMX, however, is very short-lived compared with MDM2 and does not show such direct initial interactions with the binding site. Comparison of the topology of the electrostatic potentials of MDM2 and MDMX and the locations of the initial encounters with p53/nutlin in tandem with structure-based sequence alignment revealed that the origin of the diminished activity of nutlin toward MDMX relative to MDM2 may stem partly from the differing topologies of the electrostatic potentials of the two proteins. Glu25 and Lys51 residues underpin these topological differences and appear to collectively play a key role in channelling nutlin directly toward the binding site on the MDM2 surface and are absent in MDMX. The results, therefore, provide new insight into the mechanism of p53/nutlin interactions with MDM2 and MDMX and could potentially have a broader impact on anticancer drug optimization strategies.

Inhibition of NAMPT pathway by FK866 activates the function of p53 in HEK293T cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thakur, Basant Kumar, E-mail: thakur.basant@mh-hannover.de; Department of Molecular Hematopoiesis, Hannover Medical School, Carl Neuberg Str-1, 30625 Hannover; Dittrich, Tino

2012-08-03

Highlights: Black-Right-Pointing-Pointer In 293T cells, p53 is considered to be inactive due to its interaction with the large T-antigen. Black-Right-Pointing-Pointer Acetylation of p53 at lysine 382 is important for its functional activation. Black-Right-Pointing-Pointer First evidence to document the presence of a functional p53 in 293T cells. Black-Right-Pointing-Pointer Inhibition of NAMPT/SIRT pathway by FK866 in 293T cells increases the functional activity of p53. Black-Right-Pointing-Pointer This activation of p53 involves reversible acetylation of p53 at lysine 382. -- Abstract: Inactivation of p53 protein by endogenous and exogenous carcinogens is involved in the pathogenesis of different human malignancies. In cancer associated with SV-40more » DNA tumor virus, p53 is considered to be non-functional mainly due to its interaction with the large T-antigen. Using the 293T cell line (HEK293 cells transformed with large T antigen) as a model, we provide evidence that p53 is one of the critical downstream targets involved in FK866-mediated killing of 293T cells. A reduced rate of apoptosis and an increased number of cells in S-phase was accompanied after knockdown of p53 in these cells. Inhibition of NAMPT by FK866, or inhibition of SIRT by nicotinamide decreased proliferation and triggered death of 293T cells involving the p53 acetylation pathway. Additionally, knockdown of p53 attenuated the effect of FK866 on cell proliferation, apoptosis, and cell cycle arrest. The data presented here shed light on two important facts: (1) that p53 in 293T cells is active in the presence of FK866, an inhibitor of NAMPT pathway; (2) the apoptosis induced by FK866 in 293T cells is associated with increased acetylation of p53 at Lys382, which is required for the functional activity of p53.« less

Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Sang Eun; Min, Yong Ki; Ha, Jae Du

2007-07-06

Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser{sup 6}, Ser{sup 15}, and Ser{sup 20}, which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21{sup WAF1/CIP}. Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular targetmore » of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent.« less

EBNA3C regulates p53 through induction of Aurora kinase B

PubMed Central

Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

2015-01-01

In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

p53 mutations promote proteasomal activity.

PubMed

Oren, Moshe; Kotler, Eran

2016-07-27

p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

ATM phosphorylation of Mdm2 Ser394 regulates the amplitude and duration of the DNA damage response in mice

PubMed Central

Gannon, Hugh S.; Woda, Bruce A.; Jones, Stephen N.

2012-01-01

Summary DNA damage induced by ionizing radiation (IR) activates the ATM kinase, which subsequently stabilizes and activates the p53 tumor suppressor protein. Although phosphorylation of p53 by ATM was found previously to modulate p53 levels and transcriptional activities in vivo, it does not appear to be a major regulator of p53 stability. We have utilized mice bearing altered Mdm2 alleles to demonstrate that ATM phosphorylation of Mdm2 serine 394 is required for robust p53 stabilization and activation after DNA damage. In addition, we demonstrate that dephosphorylation of Mdm2 Ser394 regulates attenuation of the p53-mediated response to DNA damage. Therefore, the phosphorylation status of Mdm2 Ser394 governs p53 protein levels and functions in cells undergoing DNA damage. PMID:22624716

Modeling and controlling the two-phase dynamics of the p53 network: a Boolean network approach

NASA Astrophysics Data System (ADS)

Lin, Guo-Qiang; Ao, Bin; Chen, Jia-Wei; Wang, Wen-Xu; Di, Zeng-Ru

2014-12-01

Although much empirical evidence has demonstrated that p53 plays a key role in tumor suppression, the dynamics and function of the regulatory network centered on p53 have not yet been fully understood. Here, we develop a Boolean network model to reproduce the two-phase dynamics of the p53 network in response to DNA damage. In particular, we map the fates of cells into two types of Boolean attractors, and we find that the apoptosis attractor does not exist for minor DNA damage, reflecting that the cell is reparable. As the amount of DNA damage increases, the basin of the repair attractor shrinks, accompanied by the rising of the apoptosis attractor and the expansion of its basin, indicating that the cell becomes more irreparable with more DNA damage. For severe DNA damage, the repair attractor vanishes, and the apoptosis attractor dominates the state space, accounting for the exclusive fate of death. Based on the Boolean network model, we explore the significance of links, in terms of the sensitivity of the two-phase dynamics, to perturbing the weights of links and removing them. We find that the links are either critical or ordinary, rather than redundant. This implies that the p53 network is irreducible, but tolerant of small mutations at some ordinary links, and this can be interpreted with evolutionary theory. We further devised practical control schemes for steering the system into the apoptosis attractor in the presence of DNA damage by pinning the state of a single node or perturbing the weight of a single link. Our approach offers insights into understanding and controlling the p53 network, which is of paramount importance for medical treatment and genetic engineering.

Functional activation of mutant p53V172F by platinum analogs in cisplatin-resistant human tumor cells is dependent on serine-20 phosphorylation

PubMed Central

Xie, Xiaolei; He, Guangan; Siddik, Zahid H.

2017-01-01

Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409

Reciprocal regulation of p53 and malic enzymes modulates metabolism and senescence.

PubMed

Jiang, Peng; Du, Wenjing; Mancuso, Anthony; Wellen, Kathryn E; Yang, Xiaolu

2013-01-31

Cellular senescence both protects multicellular organisms from cancer and contributes to their ageing. The pre-eminent tumour suppressor p53 has an important role in the induction and maintenance of senescence, but how it carries out this function remains poorly understood. In addition, although increasing evidence supports the idea that metabolic changes underlie many cell-fate decisions and p53-mediated tumour suppression, few connections between metabolic enzymes and senescence have been established. Here we describe a new mechanism by which p53 links these functions. We show that p53 represses the expression of the tricarboxylic-acid-cycle-associated malic enzymes ME1 and ME2 in human and mouse cells. Both malic enzymes are important for NADPH production, lipogenesis and glutamine metabolism, but ME2 has a more profound effect. Through the inhibition of malic enzymes, p53 regulates cell metabolism and proliferation. Downregulation of ME1 and ME2 reciprocally activates p53 through distinct MDM2- and AMP-activated protein kinase-mediated mechanisms in a feed-forward manner, bolstering this pathway and enhancing p53 activation. Downregulation of ME1 and ME2 also modulates the outcome of p53 activation, leading to strong induction of senescence, but not apoptosis, whereas enforced expression of either malic enzyme suppresses senescence. Our findings define physiological functions of malic enzymes, demonstrate a positive-feedback mechanism that sustains p53 activation, and reveal a connection between metabolism and senescence mediated by p53.

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

PubMed

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis

PubMed Central

Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying

2014-01-01

Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761

Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

PubMed Central

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

2016-01-01

Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

Increased Arf/p53 activity in stem cells, aging and cancer.

PubMed

Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

2017-04-01

Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

PubMed

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-11-02

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The critical role of catalase in prooxidant and antioxidant function of p53

PubMed Central

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Youn-hee; Kim, Donghern; Dai, Jin

Occupational and environmental exposure to arsenic (III) and chromium VI (Cr(VI)) have been confirmed to cause lung cancer. Mechanisms of these metals carcinogenesis are still under investigation. Selection of cell lines to be used is essential for the studies. Human bronchial epithelial BEAS-2B cells are the cells to be utilized by most of scientists. However, due to p53 missense mutation (CCG → TCG) at codon 47 and the codon 72 polymorphism (CGC → CCC) in BEAS-2B cells, its usage has frequently been questioned. The present study has examined activity and expression of 53 and its downstream target protein p21 uponmore » acute or chronic exposure of BEAS-2B cells to arsenic and Cr(VI). The results show that short-term exposure of BEAS-2B cells to arsenic or Cr(VI) was able to activate both p53 and p21. Chronic exposure of BEAS-2B cells to these two metals caused malignant cell transformation and tumorigenesis. In arsenic-transformed BEAS-2B cells reductions in p53 promoter activity, mRNA expression, and phosphorylation of p53 at Ser392 were observed, while the total p53 protein level remained the same compared to those in passage-matched parent ones. p21 promoter activity and expression were decreased in arsenic-transformed cells. Cr(VI)-transformed cells exhibit elevated p53 promoter activity, mRNA expression, and phosphorylation at Ser15, but reduced phosphorylation at Ser392 and total p53 protein level compared to passage-matched parent ones. p21 promoter activity and expression were elevated in Cr(VI)-transformed cells. These results demonstrate that p53 is able to respond to exposure of arsenic or Cr(VI), suggesting that BEAS-2B cells are an appropriate in vitro model to investigate arsenic or Cr(VI) induced lung cancer. - Highlights: • Short-term exposure of BEAS-2B cells to arsenic or Cr(VI) activates p53 and p21. • Chronic exposure of BEAS-2B cells to arsenic or Cr(VI) causes cell transformation and tumorigenesis. • Arsenic-transformed cells exhibit reduced activities of p53 and p21. • Cr(VI)-transformed cells exhibit increased activities of p53 and p21.« less

p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

2015-11-13

Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

p53 downregulates the Fanconi anaemia DNA repair pathway

PubMed Central

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-01-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

p53 downregulates the Fanconi anaemia DNA repair pathway.

PubMed

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

PubMed

Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

2016-09-06

The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

PubMed Central

Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

2000-01-01

p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence

PubMed Central

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-01-01

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.

PubMed

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-11-17

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX

PubMed Central

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-01-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX.

PubMed

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-11-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

PubMed

Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

2007-11-07

Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

Transcriptional inhibition of p21{sup WAF1/CIP1} gene (CDKN1) expression by survivin is at least partially p53-dependent: Evidence for survivin acting as a transcription factor or co-factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang

2012-05-04

Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less

Molecular dynamics simulations studies and free energy analysis on inhibitors of MDM2-p53 interaction.

PubMed

Niu, Rui-Juan; Zheng, Qing-Chuan; Zhang, Ji-Long; Zhang, Hong-Xing

2013-11-01

The oncoprotein MDM2 (murine double minute 2) negatively regulates the activity and stability of tumor suppressor p53. Inactivation of the MDM2-p53 interaction by potent inhibitors offers new possibilities for anticancer therapy. Molecular dynamics (MD) simulations were performed on three inhibitors-MDM2 complexes to investigate the stability and structural transitions. Simulations show that the backbone of MDM2 maintains stable during the whole time. However, slightly structural changes of inhibitors and MDM2 are observed. Furthermore, the molecular mechanics generalized Born surface area (MM-GBSA) approach was introduced to analyze the interactions between inhibitors and MDM2. The results show that binding of inhibitor pDIQ to MDM2 is significantly stronger than that of pMI and pDI to MDM2. The side chains of residues have more contribution than backbone of residues in energy decomposition. The structure-affinity analyses show that L54, I61, M62, Y67, Q72, H73 and V93 produce important interaction energy with inhibitors. The residue W/Y22' is also very important to the interaction between the inhibitors and MDM2. The three-dimensional structures at different times indicate that the mobility of Y100 influences on the binding of inhibitors to MDM2, and its change has important role in conformations of inhibitors and MDM2. Copyright © 2013 Elsevier Inc. All rights reserved.

Interfacial properties of acidified skim milk.

PubMed

Cases, E; Rampini, C; Cayot, Ph

2005-02-01

The purpose of this study is to investigate the tension properties and dilatational viscoelastic modulus of various skim milk proteins (whole milk, EDTA-treated milk, beta-casein, and beta-lactoglobulin) at an oil/water interface at 20 degrees C. Measurements are performed using a dynamic drop tensiometer for 15,000 s. The aqueous bulk phase is a skim milk simulated ultrafiltrate containing 11 x 10(-3) g L(-1) milk protein. At pH 6.7, beta-casein appears as the best to decrease the interfacial tension, whereas beta-lactoglobulin leads to the highest interfacial viscoelastic modulus value. Whole milk was almost as surface-active as individual beta-casein in terms of the final (steady-state) lowering of the interfacial tension, but the rate of tension lowering was smaller. EDTA treatment improved the rate of tension lowering of whole milk. The acidification of milk, from previous measurements, would lead to the enhancement of surface activity. At t=15,000 s, the order of effectiveness is pH 4.3 > pH 5.3 = pH 5.6 > pH 6.7 whole milk, suggesting that pH 4.3 whole milk is the best surface active. As compared to pH 6.7 whole milk, the use of pH 5.3 and pH 5.6 milk as surface active would result in the use of milk containing more free beta-casein born of pH-dissociated casein micelles.

Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

PubMed

Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

2015-01-01

A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

PubMed Central

Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

2016-01-01

p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

Regulation of autophagy by cytoplasmic p53.

PubMed

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

Inhibition of p53 Mutant Peptide Aggregation In Vitro by Cationic Osmolyte Acetylcholine Chloride.

PubMed

Chen, Zhaolin; Kanapathipillai, Mathumai

2017-01-01

Mutations of tumor suppressor protein p53 are present in almost about 50% of all cancers. It has been reported that the p53 mutations cause aggregation and subsequent loss of p53 function, leading to cancer progression. Here in this study we focus on the inhibitory effects of cationic osmolyte molecules acetylcholine chloride, and choline on an aggregation prone 10 amino acid p53 mutant peptide WRPILTIITL, and the corresponding wildtype peptide RRPILTIITL in vitro. The characterization tools used for this study include Thioflavin- T (ThT) induced fluorescence, transmission electron microscopy (TEM), congo red binding, turbidity, dynamic light scattering (DLS), and cell viability assays. The results show that acetylcholine chloride in micromolar concentrations significantly inhibit p53 mutant peptide aggregation in vitro, and could be promising candidate for p53 mutant/ misfolded protein aggregation inhibition. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

PubMed

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

PubMed Central

Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

2010-01-01

Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Soo Kyung; Gwak, Jungsug; Song, Im-Sook

Highlights: {yields} TopIn activates p53-dependent transcription in colon cancer cells. {yields} TopIn induces apoptosis in colon cancer cells. {yields} TopIn selectively inhibits topoisomerase I activity. {yields} TopIn does not affect the activity of BCRP and MDR-1. -- Abstract: The tumor suppressor p53 plays an important role in cellular emergency mechanisms through regulating the genes involved in cell cycle arrest and apoptosis. To identify small molecules that can activate p53-responsive transcription, we performed chemical screening using genetically engineered HCT116 reporter cells. We found that TopIn (7-phenyl-6H-[1,2,5]oxadiazolo[3,4-e]indole 3-oxide) efficiently activated p53-mediated transcriptional activity and induced phosphorylation of p53 at Ser15, thereby stabilizingmore » the p53 protein. Furthermore, TopIn upregulated the expression of p21{sup WAF1/CIP1}, a downstream target of p53, and suppressed cellular proliferation in various colon cancer cells. Additionally, TopIn induced DNA fragmentation, caspase-3/7 activation and poly ADP ribose polymerase cleavage, typical biochemical markers of apoptosis, in p53 wild-type and mutated colon cancer cells. Finally, we found that TopIn inhibited topoisomerase I activity, but not topoisomerase II, in vitro and induced the formation of the topoisomerase I-DNA complex in HCT116 colon cancer cells. Unlike camptothecin (CPT) and its derivative SN38, TopIn did not affect the activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP) or multidrug-resistant protein-1 (MDR-1). These results suggest that TopIn may present a promising new topoisomerase I-targeting anti-tumor therapeutics.« less

The tumour suppressor CYLD regulates the p53 DNA damage response

PubMed Central

Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

2016-01-01

The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

The Role of JMY in p53 Regulation.

PubMed

Adighibe, Omanma; Pezzella, Francesco

2018-05-31

Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting

Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less

ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

PubMed Central

Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

2001-01-01

The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

Group-based QSAR and molecular dynamics mechanistic analysis revealing the mode of action of novel piperidinone derived protein-protein inhibitors of p53-MDM2.

PubMed

Goyal, Sukriti; Grover, Sonam; Dhanjal, Jaspreet Kaur; Tyagi, Chetna; Goyal, Manisha; Grover, Abhinav

2014-06-01

Tumour suppressor p53 is known to play a central role in prevention of tumour development, DNA repair, senescence and apoptosis which is in normal cells maintained by negative feedback regulator MDM2 (Murine Double Minute 2). In case of dysfunctioning of this regulatory loop, tumour development starts thus resulting in cancerous condition. Inhibition of p53-MDM2 binding would result in activation of the tumour suppressor. In this study, a novel robust fragment-based QSAR model has been developed for piperidinone derived compounds experimentally known to inhibit p53-MDM2 interaction. The QSAR model developed showed satisfactory statistical parameters for the experimentally reported dataset (r(2)=0.9415, q(2)=0.8958, pred_r(2)=0.8894 and F-test=112.7314), thus judging the robustness of the model. Low standard error values (r(2)_se=0.3003, q(2)_se=0.4009 and pred_r(2)_se=0.3315) confirmed the accuracy of the developed model. The regression equation obtained constituted three descriptors (R2-DeltaEpsilonA, R1-RotatableBondCount and R2-SssOCount), two of which had positive contribution while third showed negative correlation. Based on the developed QSAR model, a combinatorial library was generated and activities of the compounds were predicted. These compounds were docked with MDM2 and two top scoring compounds with binding affinities of -10.13 and -9.80kcal/mol were selected. The binding modes of actions of these complexes were analyzed using molecular dynamics simulations. Analysis of the developed fragment-based QSAR model revealed that addition of unsaturated electronegative groups at R2 site and groups with more rotatable bonds at R1 improved the inhibitory activity of these potent lead compounds. The detailed analysis carried out in this study provides a considerable basis for the design and development of novel piperidinone-based lead molecules against cancer and also provides mechanistic insights into their mode of actions. Copyright © 2014 Elsevier Inc. All rights reserved.

AAVPG: A vigilant vector where transgene expression is induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

P53 Is Involved in a Three-Dimensional Architecture-Mediated Decrease in Chemosensitivity in Colon Cancer.

PubMed

He, Jianming; Liang, Xi; Luo, Fen; Chen, Xuedan; Xu, Xueqing; Wang, Fengchao; Zhang, Zhenping

2016-01-01

Three-dimensional (3D) culture models represent a better approximation of solid tumor tissue architecture, especially cell adhesion, in vivo than two-dimensional (2D) cultures do. Here, we explored the role of architecture in chemosensitivity to platinum in colon cancer. Under the 3D culture condition, colon cancer cells formed multicellular spheroids, consisting of layers of cells. 3D cultures displayed significantly decreased sensitivity to platinum compared with 2D cultures. Platinum increased p53 in a dose-dependent and time-dependent manner. There was no detectable difference in basal p53 levels between 3D cultures and 2D cultures but cisplatin induced less p53 in both HCT116 3D cultures and LoVo 3D cultures. It was not due to cisplatin concentration because cisplatin induced similar γ-H2AX in 3D vs 2D. Knockdown of p53 significantly decreased sensitivity to platinum in 3D cultures. Knockdown of p53 decreased cleaved caspase 3 and apoptosis induced by cisplatin. These findings indicate that 3D architecture confers decreased chemosensitivity to platinum and p53 is involved in the mechanism. Knockdown of p53 decreased cisplatin's induction of c-Jun N-terminal kinase 1/2 (JNK1/2) activation, whereas inhibition of JNK1/2 activation increased chemosensitivity. Inhibition of p38 activation decreased cisplatin's induction of p53, but no difference in p38 activation by cisplatin was observed between 2D cultures and 3D cultures. Taken together, our results suggest that p53 is involved in a 3D architecture-mediated decrease in chemosensitivity to platinum in colon cancer. Mitogen-activated protein kinases (JNK1/2 and p38) do not play a dominant role in the mechanism.

A high-throughput cellular assay to quantify the p53-degradation activity of E6 from different human papillomavirus types.

PubMed

Gagnon, David; Archambault, Jacques

2015-01-01

A subset of human papillomaviruses (HPVs), known as the high-risk types, are the causative agents of cervical cancer and other malignancies of the anogenital region and oral mucosa. The capacity of these viruses to induce cancer and to immortalize cells in culture relies in part on a critical function of their E6 oncoprotein, that of promoting the poly-ubiquitination of the cellular tumor suppressor protein p53 and its subsequent degradation by the proteasome. Here, we describe a cellular assay to measure the p53-degradation activity of E6 from different HPV types. This assay is based on a translational fusion of p53 to Renilla luciferase (Rluc-p53) that remains sensitive to degradation by high-risk E6 and whose steady-state levels can be accurately measured in standard luciferase assays. The p53-degradation activity of any E6 protein can be tested and quantified in transiently transfected cells by determining the amount of E6-expression vector required to reduce by half the levels of RLuc-p53 luciferase activity (50 % effective concentration [EC50]). The high-throughput and quantitative nature of this assay makes it particularly useful to compare the p53-degradation activities of E6 from several HPV types in parallel.

Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

PubMed

Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

2016-03-01

The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Mulberry leaf polyphenol extract induced apoptosis involving regulation of adenosine monophosphate-activated protein kinase/fatty acid synthase in a p53-negative hepatocellular carcinoma cell.

PubMed

Yang, Tzi-Peng; Lee, Huei-Jane; Ou, Ting-Tsz; Chang, Ya-Ju; Wang, Chau-Jong

2012-07-11

The polyphenols in mulberry leaf possess the ability to inhibit cell proliferation, invasion, and metastasis of tumors. It was reported that the p53 status plays an important role in switching apoptosis and the cell cycle following adenosine monophosphate-activated protein kinase (AMPK) activation. In this study, we aimed to detect the effect of the mulberry leaf polyphenol extract (MLPE) on inducing cell death in p53-negative (Hep3B) and p53-positive (Hep3B with transfected p53) hepatocellular carcinoma cells and also to clarify the role of p53 in MLPE-treated cells. After treatment of the Hep3B cells with MLPE, apoptosis was induced via the AMPK/PI3K/Akt and Bcl-2 family pathways. Transient transfection of p53 into Hep3B cells led to switching autophagy instead of apoptosis by MLPE treatment. We demonstrated that acridine orange staining and protein expressions of LC-3 and beclin-1 were increased in p53-transfected cells. These results implied induction of apoptosis or autophagy in MLPE-treated hepatocellular carcinoma cells can be due to the p53 status. We also found MLPE can not only activate AMPK but also diminish fatty acid synthase, a molecular target for cancer inhibition. At present, our results indicate MLPE can play an active role in mediating the cell death of hepatocellular carcinoma cells and the p53 might play an important role in regulating the death mechanisms.

Local activation of p53 in the tumor microenvironment overcomes immune suppression and enhances antitumor immunity

PubMed Central

Guo, Gang; Yu, Miao; Xiao, Wei; Celis, Esteban; Cui, Yan

2017-01-01

Mutations in tumor suppressor p53 remain a vital mechanism of tumor escape from apoptosis and senescence. Emerging evidence suggests that p53 dysfunction also fuels inflammation and supports tumor immune evasion, thereby serving as an immunological driver of tumorigenesis. Therefore, targeting p53 in the tumor microenvironment (TME) also represents an immunologically desirable strategy for reversing immunosuppression and enhancing antitumor immunity. Using a pharmacological p53 activator nutlin-3a, we show that local p53 activation in TME comprising overt tumor infiltrating leukocytes (TILeus) induces systemic antitumor immunity and tumor regression, but not in TME with scarce TILeus, such as B16 melanoma. Maneuvers that recruit leukocytes to TME, such as TLR3 ligand in B16 tumors, greatly enhanced nutlin-induced antitumor immunity and tumor control. Mechanistically, nutlin-3a-induced antitumor immunity was contingent on two non-redundant but immunologically synergistic p53-dependent processes: reversal of immunosuppression in TME and induction of tumor immunogenic cell death (ICD), leading to activation and expansion of polyfunctional CD8 CTLs and tumor regression. Our study demonstrates that unlike conventional tumoricidal therapies, which rely on effective p53 targeting in each tumor cell and often associate with systemic toxicity, this immune-based strategy requires only limited local p53 activation to alter the immune landscape of TME and subsequently amplify immune response to systemic antitumor immunity. Hence, targeting the p53 pathway in TME can be exploited to reverse immunosuppression and augment therapeutic benefits beyond tumoricidal effects to harness tumor-specific, durable, and systemic antitumor immunity with minimal toxicity. PMID:28280037

Induction of apoptosis in Ehrlich ascites tumour cells via p53 activation by a novel small-molecule MDM2 inhibitor - LQFM030.

PubMed

da Mota, Mariana F; Cortez, Alane P; Benfica, Polyana L; Rodrigues, Bruna Dos S; Castro, Thalyta F; Macedo, Larissa M; Castro, Carlos H; Lião, Luciano M; de Carvalho, Flávio S; Romeiro, Luiz A S; Menegatti, Ricardo; Verli, Hugo; Villavicencio, Bianca; Valadares, Marize C

2016-09-01

The activation of the p53 pathway through the inhibition of MDM2 has been proposed as a novel therapeutic strategy against tumours. A series of cis-imidazoline analogues, termed nutlins, were reported to displace the recombinant p53 protein from its complex with MDM2 by binding to MDM2 in the p53 pocket, and exhibited an antitumour activity both in vitro and in vivo. Thus, the purpose of this study was to evaluate the antitumour properties of LQFM030 (2), a nutlin analogue created by employing the strategy of molecular simplification. LQFM030 (2) cytotoxicity was evaluated in Ehrlich ascites tumour (EAT) cells, p53 wild type, by the trypan blue exclusion test, and the mechanisms involved in EAT cell death were investigated by light and fluorescence microscopy, flow cytometry, real-time PCR and Western blotting. Our results demonstrate that LQFM030 has dose-dependent antiproliferative activity and cytotoxic activity on EAT cells, induces the accumulation of p53 protein and promotes cell cycle arrest and apoptosis. p53 gene transcription was unaffected by LQFM030 (2); however, MDM2 mRNA increased and MDM2 protein decreased. These results suggest that the small-molecule p53 activator LQFM030 (2) has the potential for further development as a novel cancer therapeutic agent. © 2016 Royal Pharmaceutical Society.

On p53 revival using system oriented drug dosage design.

PubMed

Haseeb, Muhammad; Azam, Shumaila; Bhatti, A I; Azam, Rizwan; Ullah, Mukhtar; Fazal, Sahar

2017-02-21

We propose a new paradigm in the drug design for the revival of the p53 pathway in cancer cells. It is shown that the current strategy of using small molecule based Mdm2 inhibitors is not enough to adequately revive p53 in cancerous cells, especially when it comes to the extracting pulsating behavior of p53. This fact has come to notice when a novel method for the drug dosage design is introduced using system oriented concepts. As a test case, small molecule drug Mdm2 repressor Nutlin 3a is considered. The proposed method determines the dose of Nutlin to revive p53 pathway functionality. For this purpose, PBK dynamics of Nutlin have also been integrated with p53 pathway model. The p53 pathway is the focus of researchers for the last thirty years for its pivotal role as a frontline cancer suppressant protein due to its effect on cell cycle checkpoints and cell apoptosis in response to a DNA strand break. That is the reason for finding p53 being absent in more than 50% of tumor cancers. Various drugs have been proposed to revive p53 in cancer cells. Small molecule based drugs are at the foremost and are the subject of advanced clinical trials. The dosage design of these drugs is an important issue. We use control systems concepts to develop the drug dosage so that the cancer cells can be treated in appropriate time. We investigate by using a computational model how p53 protein responds to drug Nutlin 3a, an agent that interferes with the MDM2-mediated p53 regulation. The proposed integrated model describes in some detail the regulation network of p53 including the negative feedback loop mediated by MDM2 and the positive feedback loop mediated by Mdm2 mRNA as well as the reversible represses of MDM2 caused by Nutlin. The reported PBK dynamics of Nutlin 3a are also incorporated to see the full effect. It has been reported that p53 response to stresses in two ways. Either it has a sustained (constant) p53 response, or there are oscillations in p53 concentration. The claimed dosage strategy achieves the p53 response in the first case. However, for the induction of oscillations, it is shown through bifurcation analysis that to achieve oscillating behavior of p53 inhibition of Mdm2 is not enough, rather antirepression of the p53-Mdm2 complex is also needed which leads to the need of a new drug design paradigm. Copyright © 2016 Elsevier Ltd. All rights reserved.

Regulation of autophagy by cytoplasmic p53

PubMed Central

Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2009-01-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

PubMed Central

Du, Cheng; Wu, Hong; Leng, Roger P.

2016-01-01

Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

PubMed

Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

2009-04-01

Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

PubMed Central

Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

2006-01-01

The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

PubMed Central

Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

2016-01-01

Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

p53 Restoration in Induction and Maintenance of Senescence: Differential Effects in Premalignant and Malignant Tumor Cells

PubMed Central

Harajly, Mohamad; Zalzali, Hasan; Nawaz, Zafar; Ghayad, Sandra E.; Ghamloush, Farah; Basma, Hussein; Zainedin, Samiha; Rabeh, Wissam; Jabbour, Mark; Tawil, Ayman; Badro, Danielle A.; Evan, Gerard I.

2015-01-01

The restoration of p53 has been suggested as a therapeutic approach in tumors. However, the timing of p53 restoration in relation to its efficacy during tumor progression still is unclear. We now show that the restoration of p53 in murine premalignant proliferating pineal lesions resulted in cellular senescence, while p53 restoration in invasive pineal tumors did not. The effectiveness of p53 restoration was not dependent on p19Arf expression but showed an inverse correlation with Mdm2 expression. In tumor cells, p53 restoration became effective when paired with either DNA-damaging therapy or with nutlin, an inhibitor of p53-Mdm2 interaction. Interestingly, the inactivation of p53 after senescence resulted in reentry into the cell cycle and rapid tumor progression. The evaluation of a panel of human supratentorial primitive neuroectodermal tumors (sPNET) showed low activity of the p53 pathway. Together, these data suggest that the restoration of the p53 pathway has different effects in premalignant versus invasive pineal tumors, and that p53 activation needs to be continually sustained, as reversion from senescence occurs rapidly with aggressive tumor growth when p53 is lost again. Finally, p53 restoration approaches may be worth exploring in sPNET, where the p53 gene is intact but the pathway is inactive in the majority of examined tumors. PMID:26598601

Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

PubMed

Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

2018-03-09

The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

The Central Sirtuin 1/p53 Pathway Is Essential for the Orexigenic Action of Ghrelin

PubMed Central

Velásquez, Douglas A.; Martínez, Gloria; Romero, Amparo; Vázquez, María J.; Boit, Katia D.; Dopeso-Reyes, Iria G.; López, Miguel; Vidal, Anxo; Nogueiras, Ruben; Diéguez, Carlos

2011-01-01

OBJECTIVE Ghrelin is a stomach-derived peptide that increases food intake through the activation of hypothalamic AMP-activated protein kinase (AMPK). However, the molecular mechanisms initiated by the activation of the ghrelin receptor, which in turn lead to AMPK activation, remain unclear. Sirtuin 1 (SIRT1) is a deacetylase activated in response to calorie restriction that acts through the tumor suppressor gene p53. We tested the hypothesis that the central SIRT1/p53 pathway might be mediating the orexigenic action of ghrelin. RESEARCH DESIGN AND METHODS SIRT1 inhibitors, such as Ex527 and sirtinol, and AMPK activators, such as AICAR, were administered alongside ghrelin in the brain of rats and mice (wild-type versus p53 knockout [KO]). Their hypothalamic effects on lipid metabolism and changes in transcription factors and neuropeptides were assessed by Western blot and in situ hybridization. RESULTS The central pretreatment with Ex527, a potent SIRT1 inhibitor, blunted the ghrelin-induced food intake in rats. Mice lacking p53, a target of SIRT1 action, failed to respond to ghrelin in feeding behavior. Ghrelin failed to phosphorylate hypothalamic AMPK when rats were pretreated with Ex527, as it did in p53 KO mice. It is noteworthy that the hypothalamic SIRT1/p53 pathway seems to be specific for mediating the orexigenic action of ghrelin, because central administration of AICAR, a potent AMPK activator, increased food intake in p53 KO mice. Finally, blockade of the central SIRT1 pathway did not modify ghrelin-induced growth hormone secretion. CONCLUSIONS Ghrelin specifically triggers a central SIRT1/p53 pathway that is essential for its orexigenic action, but not for the release of growth hormone. PMID:21386086

Age-Related Susceptibility to Apoptosis in Human Retinal Pigment Epithelial Cells Is Triggered by Disruption of p53–Mdm2 Association

PubMed Central

Bhattacharya, Sujoy; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

2012-01-01

Purpose. Relatively little is known about the contribution of p53/Mdm2 pathway in apoptosis of retinal pigment epithelial (RPE) cells or its possible link to dysfunction of aging RPE or to related blinding disorders such as age-related macular degeneration (AMD). Methods. Age-associated changes in p53 activation were evaluated in primary RPE cultures from human donor eyes of various ages. Apoptosis was evaluated by activation of caspases and DNA fragmentation. Gene-specific small interfering RNA was used to knock down expression of p53. Results. We observed that the basal rate of p53-dependent apoptosis increased in an age-dependent manner in human RPE. The age-dependent increase in apoptosis was linked to alterations in several aspects of the p53 pathway. p53 phosphorylation Ser15 was increased through the stimulation of ATM-Ser1981. p53 acetylation Lys379 was increased through the inhibition of SIRT1/2. These two posttranslational modifications of p53 blocked the sequestration of p53 by Mdm2, thus resulting in an increase in free p53 and of p53 stimulation of apoptosis through increased expression of PUMA (p53 upregulated modulator of apoptosis) and activation of caspase-3. Aged RPE also had reduced expression of antiapoptotic Bcl-2, which contributed to the increase in apoptosis. Of particular interest in these studies was that pharmacologic treatments to block p53 phosphorylation, acetylation, or expression were able to protect RPE cells from apoptosis. Conclusions. Our studies suggest that aging in the RPE leads to alterations of specific checkpoints in the apoptotic pathway, which may represent important molecular targets for the treatment of RPE-related aging disorders such as AMD. PMID:23139272

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

PubMed

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-08-27

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

PubMed Central

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-01-01

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

Abrogation of p53 by its antisense in MCF-7 breast carcinoma cells increases cyclin D1 via activation of Akt and promotion of cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar

2007-11-15

The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expressionmore » levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.« less

P53 protein in proliferation, repair and apoptosis of cells.

PubMed

Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

2014-05-01

The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

PubMed

Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

2011-09-27

Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

Isoindolinone inhibitors of the murine double minute 2 (MDM2)-p53 protein-protein interaction: structure-activity studies leading to improved potency.

PubMed

Hardcastle, Ian R; Liu, Junfeng; Valeur, Eric; Watson, Anna; Ahmed, Shafiq U; Blackburn, Timothy J; Bennaceur, Karim; Clegg, William; Drummond, Catherine; Endicott, Jane A; Golding, Bernard T; Griffin, Roger J; Gruber, Jan; Haggerty, Karen; Harrington, Ross W; Hutton, Claire; Kemp, Stuart; Lu, Xiaohong; McDonnell, James M; Newell, David R; Noble, Martin E M; Payne, Sara L; Revill, Charlotte H; Riedinger, Christiane; Xu, Qing; Lunec, John

2011-03-10

Inhibition of the MDM2-p53 interaction has been shown to produce an antitumor effect, especially in MDM2 amplified tumors. The isoindolinone scaffold has proved to be versatile for the discovery of MDM2-p53 antagonists. Optimization of previously reported inhibitors, for example, NU8231 (7) and NU8165 (49), was guided by MDM2 NMR titrations, which indicated key areas of the binding interaction to be explored. Variation of the 2-N-benzyl and 3-alkoxy substituents resulted in the identification of 3-(4-chlorophenyl)-3-((1-(hydroxymethyl)cyclopropyl)methoxy)-2-(4-nitrobenzyl)isoindolin-1-one (74) as a potent MDM2-p53 inhibitor (IC(50) = 0.23 ± 0.01 μM). Resolution of the enantiomers of 74 showed that potent MDM2-p53 activity primarily resided with the (+)-R-enantiomer (74a; IC(50) = 0.17 ± 0.02 μM). The cellular activity of key compounds has been examined in cell lines with defined p53 and MDM2 status. Compound 74a activates p53, MDM2, and p21 transcription in MDM2 amplified cells and shows moderate selectivity for wild-type p53 cell lines in growth inhibition assays.

Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos

PubMed Central

El Husseini, Nazem; Schlisser, Ava E.; Hales, Barbara F.

2016-01-01

Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. PMID:27208086

Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

PubMed

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-02-11

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

PubMed Central

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

Metabolic activation of 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine and DNA adduct formation depends on p53: Studies in Trp53(+/+),Trp53(+/-) and Trp53(-/-) mice.

PubMed

Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M

2016-02-15

The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. © 2015 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

PubMed

Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

2013-04-16

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy

PubMed Central

Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.

2013-01-01

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378

A minimally invasive assay for individual assessment of the ATM/CHEK2/p53 pathway activity.

PubMed

Kabacik, Sylwia; Ortega-Molina, Ana; Efeyan, Alejo; Finnon, Paul; Bouffler, Simon; Serrano, Manuel; Badie, Christophe

2011-04-01

Ionizing radiation induces DNA Double-Strand Breaks (DSBs) which activate the ATM/CHEK2/p53 pathway leading to cell cycle arrest and apoptosis through transcription of genes including CDKN1A (p21) and BBC3 (PUMA). This pathway prevents genomic instability and tumorigenesis as demonstrated in heritable syndromes [e.g. Ataxia Telangiectasia (AT); Li-Fraumeni syndrome (LFS)]. Here, a simple assay based on gene expression in peripheral blood to measure accurately ATM/CHEK2/p53 pathway activity is described. The expression of p21, Puma and Sesn2 was determined in blood from mice with different gene copy numbers of Atm, Trp53 (p53), Chek2 or Arf and in human blood and mitogen stimulated T-lymphocyte (MSTL) cultures from AT, AT carriers, LFS patients, and controls, both before and after ex vivo ionizing irradiation. Mouse Atm/Chek2/p53 activity was highly dependent on the copy number of each gene except Arf. In human MSTL, an AT case, AT carriers and LFS patients showed responses distinct from healthy donors. The relationship between gene copy number and transcriptional induction upon radiation was linear for p21 and Puma and correlated well with cancer incidence in p53 variant mice. This reliable blood test provides an assay to determine ATM/CHEK2/p53 pathway activity and demonstrates the feasibility of assessing the activity of this essential cancer protection pathway in simple assays. These findings may have implications for the individualized prediction of cancer susceptibility.

p53-regulated autophagy is controlled by glycolysis and determines cell fate

PubMed Central

Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

2015-01-01

The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

PubMed

Rani, Reena; Li, Jie; Pang, Qishen

2008-12-01

Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

PubMed Central

Rani, Reena; Li, Jie; Pang, Qishen

2008-01-01

Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.

PubMed

Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun

2005-07-01

Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

Downregulated long non-coding RNA MEG3 in breast cancer regulates proliferation, migration and invasion by depending on p53’s transcriptional activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Lin; Li, Yu; Yang, Bangxiang, E-mail: b19933009@qq.coom

Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition ofmore » proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.« less

The Isoforms of the p53 Protein

PubMed Central

Khoury, Marie P.; Bourdon, Jean-Christophe

2010-01-01

p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance.

PubMed

Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R

2016-04-12

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.

The Roles of p53 in Mitochondrial Dynamics and Cancer Metabolism: The Pendulum between Survival and Death in Breast Cancer?

PubMed

Moulder, David E; Hatoum, Diana; Tay, Enoch; Lin, Yiguang; McGowan, Eileen M

2018-06-08

Cancer research has been heavily geared towards genomic events in the development and progression of cancer. In contrast, metabolic regulation, such as aberrant metabolism in cancer, is poorly understood. Alteration in cellular metabolism was once regarded simply as a consequence of cancer rather than as playing a primary role in cancer promotion and maintenance. Resurgence of cancer metabolism research has identified critical metabolic reprogramming events within biosynthetic and bioenergetic pathways needed to fulfill the requirements of cancer cell growth and maintenance. The tumor suppressor protein p53 is emerging as a key regulator of metabolic processes and metabolic reprogramming in cancer cells—balancing the pendulum between cell death and survival. This review provides an overview of the classical and emerging non-classical tumor suppressor roles of p53 in regulating mitochondrial dynamics: mitochondrial engagement in cell death processes in the prevention of cancer. On the other hand, we discuss p53 as a key metabolic switch in cellular function and survival. The focus is then on the conceivable roles of p53 in breast cancer metabolism. Understanding the metabolic functions of p53 within breast cancer metabolism will, in due course, reveal critical metabolic hotspots that cancers advantageously re-engineer for sustenance. Illustration of these events will pave the way for finding novel therapeutics that target cancer metabolism and serve to overcome the breast cancer burden.

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

PubMed

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.

PubMed

Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C

2001-11-09

Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Mutation at p53 serine 389 does not rescue the embryonic lethality in mdm2 or mdm4 null mice.

PubMed

Iwakuma, Tomoo; Parant, John M; Fasulo, Mark; Zwart, Edwin; Jacks, Tyler; de Vries, Annemieke; Lozano, Guillermina

2004-10-07

Mdm2 and its homolog Mdm4 inhibit the function of the tumor suppressor p53. Targeted disruption of either mdm2 or mdm4 genes in mice results in embryonic lethality that is completely rescued by concomitant deletion of p53, suggesting that deletion of negative regulators of p53 results in a constitutively active p53. Thus, these mouse models offer a unique in vivo system to assay the functional significance of different p53 modifications. Phosphorylation of serine 389 in murine p53 occurs specifically after ultraviolet-light-induced DNA damage, and phosphorylation of this site enhances p53 activity both in vitro and in vivo. Recently, mice with a serine to alanine substitution at serine 389 (p53S389A) in the endogenous p53 locus were generated. To examine the in vivo significance of serine 389 phosphorylation during embryogenesis, we crossed these mutant mice to mice lacking mdm2 or mdm4. The p53S389A allele did not alter the embryonic lethality of mdm2 or mdm4. Additional crosses to assay the effect of one p53S389A allele with a p53 null allele also did not rescue the lethal phenotypes. In conclusion, the phenotypes due to loss of mdm2 or mdm4 were not even partially rescued by p53S389A, suggesting that p53S389A is functionally wild type during embryogenesis.

Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

PubMed

Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

2000-11-23

Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leão, Mariana; Gomes, Sara; Bessa, Cláudia

In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either permore » se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.« less

Ionizing Radiation-Induced Responses in Human Cells with Differing TP53 Status

PubMed Central

Mirzayans, Razmik; Andrais, Bonnie; Scott, April; Wang, Ying W.; Murray, David

2013-01-01

Ionizing radiation triggers diverse responses in human cells encompassing apoptosis, necrosis, stress-induced premature senescence (SIPS), autophagy, and endopolyploidy (e.g., multinucleation). Most of these responses result in loss of colony-forming ability in the clonogenic survival assay. However, not all modes of so-called clonogenic cell “death” are necessarily advantageous for therapeutic outcome in cancer radiotherapy. For example, the crosstalk between SIPS and autophagy is considered to influence the capacity of the tumor cells to maintain a prolonged state of growth inhibition that unfortunately can be succeeded by tumor regrowth and disease recurrence. Likewise, endopolyploid giant cells are able to segregate into near diploid descendants that continue mitotic activities. Herein we review the current knowledge on the roles that the p53 and p21WAF1 tumor suppressors play in determining the fate of human fibroblasts (normal and Li-Fraumeni syndrome) and solid tumor-derived cells after exposure to ionizing radiation. In addition, we discuss the important role of WIP1, a p53-regulated oncogene, in the temporal regulation of the DNA damage response and its contribution to p53 dynamics post-irradiation. This article highlights the complexity of the DNA damage response and provides an impetus for rethinking the nature of cancer cell resistance to therapeutic agents. PMID:24232458

Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

PubMed Central

Meng, X; Carlson, NR; Dong, J; Zhang, Y

2016-01-01

The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 are non-redundant pathways possessing similar capabilities to activate p53 upon c-Myc overexpression. PMID:25823025

Alterations in knee kinematics after partial medial meniscectomy are activity dependent.

PubMed

Edd, Shannon N; Netravali, Nathan A; Favre, Julien; Giori, Nicholas J; Andriacchi, Thomas P

2015-06-01

Alterations in knee kinematics after partial meniscectomy have been linked to the increased risk of osteoarthritis in this population. Understanding differences in kinematics during static versus dynamic activities of increased demand can provide important information regarding the possible underlying mechanisms of these alterations. Differences in the following 2 kinematics measures will increase with activity demand: (1) the offset toward external tibial rotation for the meniscectomized limb compared with the contralateral limb during stance and (2) the difference in knee flexion angle at initial foot contact between the meniscectomized and contralateral limbs. Controlled laboratory study. This study compared side-to-side differences in knee flexion and rotation angles during static and dynamic activities. Thirteen patients (2 female) were tested in a motion capture laboratory at 6 ± 2 months after unilateral, arthroscopic, partial medial meniscectomy during a static reference pose and during 3 dynamic activities: walking, stair ascent, and stair descent. The meniscectomized limb demonstrated more external tibial rotation compared with the contralateral limb during dynamic activities, and there was a trend that this offset increased with activity demand (repeated-measures analysis of variance [ANOVA] for activity, P = .07; mean limb difference: static pose, -0.1° ± 3.3°, P = .5; walking, 1.2° ± 3.8°, P = .1; stair ascent, 2.0° ± 3.2°, P = .02; stair descent, 3.0° ± 3.5°, P = .005). Similarly, the meniscectomized knee was more flexed at initial contact than the contralateral limb during dynamic activities (repeated-measures ANOVA for activity P = .006; mean limb difference: reference pose, 1.0° ± 2.5°, P = .09; walking, 2.0° ± 3.9°, P = .05; stair ascent, 5.9° ± 5.3°, P = .009; stair descent, 3.5° ± 4.0°, P = .004). These results suggest both a structural element and a potential muscular element for the differences in kinematics after partial medial meniscectomy and highlight the importance of challenging the knee with activities of increased demands to detect differences in kinematics from the contralateral limb. With further investigation, these findings could help guide clinical rehabilitation of patients with torn meniscus tissue, especially in the context of the patients' increased risk of joint degeneration. © 2015 The Author(s).

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

Inhibition of SIRT1 Catalytic Activity Increases p53 Acetylation but Does Not Alter Cell Survival following DNA Damage

PubMed Central

Solomon, Jonathan M.; Pasupuleti, Rao; Xu, Lei; McDonagh, Thomas; Curtis, Rory; DiStefano, Peter S.; Huber, L. Julie

2006-01-01

Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527, a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1 in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary epithelial cells. PMID:16354677

Fluoride induces apoptosis via inhibiting SIRT1 activity to activate mitochondrial p53 pathway in human neuroblastoma SH-SY5Y cells.

PubMed

Tu, Wei; Zhang, Qian; Liu, Yin; Han, Lianyong; Wang, Qin; Chen, Panpan; Zhang, Shun; Wang, Aiguo; Zhou, Xue

2018-05-15

There has been a great concern about the neurotoxicity of fluoride since it can pass through the blood-brain barrier and accumulate in the brain. It has been suggested that apoptosis plays a vital role in neurotoxicity of fluoride. However, whether p53-mediated apoptotic pathway is involved is still unclear. Our results showed that apoptosis was induced after treatment with 40 and 60 mg/L of NaF for 24 h in human neuroblastoma SH-SY5Y cells. Exposure to 60 mg/L of NaF for 24 h significantly upregulated the levels of p53 and apoptosis-related proteins including PUMA, cytochrome c (cyto c), cleaved caspase-3 and cleaved PARP, whereas downregulated Bcl-2 in SH-SY5Y cells. Meanwhile, fluoride increased p53 nuclear translocation, cyto c release from mitochondria to cytoplasm and mitochondrial translocation of Bax in SH-SY5Y cells. Fluoride-induced increases of apoptotic rates and apoptosis-related protein levels were significantly attenuated by inhibiting p53 transcriptional activity with pifithrin-α. In addition, fluoride inhibited the deacetylase activity of SIRT1 and increased p53 (acetyl K382) level in SH-SY5Y cells. Apoptosis and upregulation of cleaved caspase-3, cleaved PARP and p53 (acetyl K382) induced by fluoride could be ameliorated by SIRT1 overexpression or its activator resveratrol in SH-SY5Y cells. Taken together, our study demonstrates that fluoride induces apoptosis by inhibiting the deacetylase activity of SIRT1 to activate mitochondrial p53 pathway in SH-SY5Y cells, which depends on p53 transcriptional activity. Thus, SIRT1 may be a promising target to protect against neurotoxicity induced by fluoride. Copyright © 2018 Elsevier Inc. All rights reserved.

Mdm2 is required for survival of hematopoietic stem cells/progenitors via dampening of ROS-induced p53 activity

USDA-ARS?s Scientific Manuscript database

Mdm2 is an E3 ubiquitin ligase that targets p53 for degradation. p53(515C) (encoding p53R172P) is a hypomorphic allele of p53 that rescues the embryonic lethality of Mdm2(-/-) mice. Mdm2(-/-) p53(515C/515C) mice, however, die by postnatal day 13 resulting from hematopoietic failure. Hematopoietic st...

TRIM25 enhances cell growth and cell survival by modulating p53 signals via interaction with G3BP2 in prostate cancer.

PubMed

Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi

2018-04-01

Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

Distinct downstream targets manifest p53-dependent pathologies in mice.

PubMed

Pant, V; Xiong, S; Chau, G; Tsai, K; Shetty, G; Lozano, G

2016-11-03

Mdm2, the principal negative regulator of p53, is critical for survival, a fact clearly demonstrated by the p53-dependent death of germline or conditional mice following deletion of Mdm2. On the other hand, Mdm2 hypomorphic (Mdm2 Puro/Δ7-12 ) or heterozygous (Mdm2 +/- ) mice that express either 30 or 50% of normal Mdm2 levels, respectively, are viable but present distinct phenotypes because of increased p53 activity. Mdm2 levels are also transcriptionally regulated by p53. We evaluated the significance of this reciprocal relationship in a new hypomorphic mouse model inheriting an aberrant Mdm2 allele with insertion of the neomycin cassette and deletion of 184-bp sequence in intron 3. These mice also carry mutations in the Mdm2 P2-promoter and thus express suboptimal levels of Mdm2 entirely encoded from the P1-promoter. Resulting mice exhibit abnormalities in skin pigmentation and reproductive tissue architecture, and are subfertile. Notably, all these phenotypes are rescued on a p53-null background. Furthermore, these phenotypes depend on distinct p53 downstream activities as genetic ablation of the pro-apoptotic gene Puma reverts the reproductive abnormalities but not skin hyperpigmentation, whereas deletion of cell cycle arrest gene p21 does not rescue either phenotype. Moreover, p53-mediated upregulation of Kitl influences skin pigmentation. Altogether, these data emphasize tissue-specific p53 activities that regulate cell fate.

p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

PubMed

Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

2015-03-01

The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65

PubMed Central

Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E.; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S.; Kaneki, Masao

2015-01-01

Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-Nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson’s disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. PMID:25389371

Inhibition of Mdmx (Mdm4) in vivo induces anti-obesity effects.

PubMed

Kon, Ning; Wang, Donglai; Li, Tongyuan; Jiang, Le; Qiang, Li; Gu, Wei

2018-01-26

Although cell-cycle arrest, senescence and apoptosis remain as major canonical activities of p53 in tumor suppression, the emerging role of p53 in metabolism has been a topic of great interest. Nevertheless, it is not completely understood how p53-mediated metabolic activities are regulated in vivo and whether this part of the activities has an independent role beyond tumor suppression. Mdmx (also called Mdm4), like Mdm2, acts as a major suppressor of p53 but the embryonic lethality of mdmx-null mice creates difficulties to evaluate its physiological significance in metabolism. Here, we report that the embryonic lethality caused by the deficiency of mdmx , in contrast to the case for mdm2 , is fully rescued in the background of p53 3KR/3KR , an acetylation-defective mutant unable to induce cell-cycle arrest, senescence and apoptosis. p53 3KR/3KR /mdmx -/- mice are healthy but skinny without obvious developmental defects. p53 3KR/3KR /mdmx -/- mice are resistant to fat accumulation in adipose tissues upon high fat diet. Notably, the levels of p53 protein are only slightly increased and can be further induced upon DNA damage in p53 3KR/3KR /mdmx -/- mice, suggesting that Mdmx is only partially required for p53 degradation in vivo . Further analyses indicate that the anti-obesity phenotypes in p53 3KR/3KR /mdmx -/- mice are caused by activation of lipid oxidation and thermogenic programs in adipose tissues. These results demonstrate the specific effects of the p53/Mdmx axis in lipid metabolism and adipose tissue remodeling and reveal a surprising role of Mdmx inhibition in anti-obesity effects beyond, commonly expected, tumor suppression. Thus, our study has significant implications regarding Mdmx inhibitors in the treatment of obesity related diseases.

Modulation of the poly (ADP-ribose) polymerase inhibitor response and DNA recombination in breast cancer cells by drugs affecting endogenous wild-type p53.

PubMed

Ireno, Ivanildce Cristiane; Wiehe, Rahel Stephanie; Stahl, Andreea Iulia; Hampp, Stephanie; Aydin, Sevtap; Troester, Melissa A; Selivanova, Galina; Wiesmüller, Lisa

2014-10-01

Synthetic lethal interactions between poly (ADP-ribose) polymerase (PARP) and homologous recombination (HR) repair pathways have been exploited for the development of novel mono- and combination cancer therapies. The tumor suppressor p53 was demonstrated to exhibit indirect and direct regulatory activities in DNA repair, particularly in DNA double-strand break (DSB)-induced and replication-associated HR. In this study, we tested a potential influence of the p53 status on the response to PARP inhibition, which is known to cause replication stress. Silencing endogenous or inducibly expressing p53 we found a protective effect of p53 on PARP inhibitor (PARPi)-mediated cytotoxicities. This effect was specific for wild-type versus mutant p53 and observed in cancer but not in non-transformed cell lines. Enhanced cytotoxicities after treatment with the p53-inhibitory drug Pifithrinα further supported p53-mediated resistance to PARP inhibition. Surprisingly, we equally observed increased PARPi sensitivity in the presence of the p53-activating compound Nutlin-3. As a common denominator, both drug responses correlated with decreased HR activities: Pifithrinα downregulated spontaneous HR resulting in damage accumulation. Nutlin-3 induced a decrease of DSB-induced HR, which was accompanied by a severe drop in RAD51 protein levels. Thus, we revealed a novel link between PARPi responsiveness and p53-controlled HR activities. These data expand the concept of cell and stress type-dependent healer and killer functions of wild-type p53 in response to cancer therapeutic treatment. Our findings have implications for the individualized design of cancer therapies using PARPi and the potentially combined use of p53-modulatory drugs. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

p53: traffic cop at the crossroads of DNA repair and recombination.

PubMed

Sengupta, Sagar; Harris, Curtis C

2005-01-01

p53 mutants that lack DNA-binding activities, and therefore, transcriptional activities, are among the most common mutations in human cancer. Recently, a new role for p53 has come to light, as the tumour suppressor also functions in DNA repair and recombination. In cooperation with its function in transcription, the transcription-independent roles of p53 contribute to the control and efficiency of DNA repair and recombination.

The RNA surveillance protein SMG1 activates p53 in response to DNA double-strand breaks but not exogenously oxidized mRNA

PubMed Central

Gewandter, Jennifer S; Bambara, Robert A

2011-01-01

DNA damage, stalled replication forks, errors in mRNA splicing and availability of nutrients activate specific phosphatidylinositiol-3-kinase-like kinases (PIKKs) that in turn phosphorylate downstream targets such as p53 on serine 15. While the PIKK proteins ATM and ATR respond to specific DNA lesions, SMG1 responds to errors in mRNA splicing and when cells are exposed to genotoxic stress. Yet, whether genotoxic stress activates SMG1 through specific types of DNA lesions or RNA damage remains poorly understood. Here, we demonstrate that siRNA oligonucleotides targeting the mRNA surveillance proteins SMG1, Upf1, Upf2 or the PIKK protein ATM attenuated p53 (ser15) phosphorylation in cells damaged by high oxygen (hyperoxia), a model of persistent oxidative stress that damages nucleotides. In contrast, loss of SMG1 or ATM, but not Upf1 or Upf2 reduced p53 (ser15) phosphorylation in response to DNA double strand breaks produced by expression of the endonuclease I-PpoI. To determine whether SMG1-dependent activation of p53 was in response to oxidative mRNA damage, mRNA encoding green fluorescence protein (GFP) transcribed in vitro was oxidized by Fenton chemistry and transfected into cells. Although oxidation of GFP mRNA resulted in dose-dependent fragmentation of the mRNA and reduced expression of GFP, it did not stimulate p53 or the p53-target gene p21. These findings establish SMG1 activates p53 in response to DNA double strand breaks independent of the RNA surveillance proteins Upf1 or Upf2; however, these proteins can stimulate p53 in response to oxidative stress but not necessarily oxidized RNA. PMID:21701263

Modulation of p53 cellular function and cell death by African swine fever virus.

PubMed

Granja, Aitor G; Nogal, María L; Hurtado, Carolina; Salas, José; Salas, María L; Carrascosa, Angel L; Revilla, Yolanda

2004-07-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells.

Modulation of p53 Cellular Function and Cell Death by African Swine Fever Virus

PubMed Central

Granja, Aitor G.; Nogal, María L.; Hurtado, Carolina; Salas, José; Salas, María L.; Carrascosa, Angel L.; Revilla, Yolanda

2004-01-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells. PMID:15194793

p53 R175H hydrophobic patch and H-bond reorganization observed by MD simulation.

PubMed

Thayer, Kelly M; Quinn, Taylor R

2016-03-01

Molecular dynamics simulations probe the origins of aberrant functionality of R175H p53, which normally prevent tumorigenesis. This hotspot mutation exhibits loss of its essential zinc cofactor, aggregation, and activation of gain of function promoters, characteristics contributing to the loss of normal p53 activity. This study provided molecular level insight into the reorganization of the hydrogen bonding network and the formation of a hydrophobic patch on the surface of the protein. The hydrogen bonding network globally redistributes at the expense of the stability of the β-sandwich structure, and surface residues reorganize to expose a 250 Å(2) hydrophobic patch of residues covering approximately 2% of the solvent accessible surface. These changes could both stabilize the protein in the conformation exposing the patch to solvent to mediate the reported aggregation, and cause a destabilization in the area associated with DNA binding residues to affect the specificity. The development of the patch prior to loss of zinc indicates that stabilizing the patch quickly may prevent zinc loss. Considerations for rational design of small molecule therapeutics in light of the structural insight has been discussed and it suggest the positive ring around the hydrophobic patch and conserved residues may constitute a druggable site. © 2015 Wiley Periodicals, Inc.

The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.

PubMed

Gong, Yi; Ju, Chenyu; Zhang, Xiaobo

2015-10-01

The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.

Osteoblast differentiation and skeletal development are regulated by Mdm2–p53 signaling

PubMed Central

Lengner, Christopher J.; Steinman, Heather A.; Gagnon, James; Smith, Thomas W.; Henderson, Janet E.; Kream, Barbara E.; Stein, Gary S.; Lian, Jane B.; Jones, Stephen N.

2006-01-01

Mdm2 is required to negatively regulate p53 activity at the peri-implantation stage of early mouse development. However, the absolute requirement for Mdm2 throughout embryogenesis and in organogenesis is unknown. To explore Mdm2–p53 signaling in osteogenesis, Mdm2-conditional mice were bred with Col3.6-Cre–transgenic mice that express Cre recombinase in osteoblast lineage cells. Mdm2-conditional Col3.6-Cre mice die at birth and display multiple skeletal defects. Osteoblast progenitor cells deleted for Mdm2 have elevated p53 activity, reduced proliferation, reduced levels of the master osteoblast transcriptional regulator Runx2, and reduced differentiation. In contrast, p53-null osteoprogenitor cells have increased proliferation, increased expression of Runx2, increased osteoblast maturation, and increased tumorigenic potential, as mice specifically deleted for p53 in osteoblasts develop osteosarcomas. These results demonstrate that p53 plays a critical role in bone organogenesis and homeostasis by negatively regulating bone development and growth and by suppressing bone neoplasia and that Mdm2-mediated inhibition of p53 function is a prerequisite for Runx2 activation, osteoblast differentiation, and proper skeletal formation. PMID:16533949

53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

PubMed

Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

2016-07-02

Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

PubMed

Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

2010-11-01

Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells

PubMed Central

2011-01-01

Background Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. Results We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. Conclusions we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. PMID:21801448

Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells.

PubMed

Liu, Juan; Uematsu, Hiroshi; Tsuchida, Nobuo; Ikeda, Masa-Aki

2011-07-31

Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells.

p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

PubMed

Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

2018-03-06

Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

Zn(II)-curc targets p53 in thyroid cancer cells.

PubMed

Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

2015-10-01

TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach

DTIC Science & Technology

2006-01-01

B) Cells were transfected with 1 mg of the indicated luciferase reporter constructs and 50 ng of pRL- Renilla . 24 hrs post transfections p53 was...induced by removal of tetracyline. Cells were lysed and assayed for luciferase and Renilla activities 24 hrs after induction of p53. The indicated

A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

PubMed Central

Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

2018-01-01

Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

Integrated High Throughput Analysis Identifies GSK3 as a Crucial Determinant of p53-Mediated Apoptosis in Lung Cancer Cells.

PubMed

Zhang, Yu; Zhu, Chenyang; Sun, Bangyao; Lv, Jiawei; Liu, Zhonghua; Liu, Shengwang; Li, Hai

2017-01-01

p53 dysfunction is frequently observed in lung cancer. Although restoring the tumour suppressor function of p53 is recently approved as a putative strategy for combating cancers, the lack of understanding of the molecular mechanism underlying p53-mediated lung cancer suppression has limited the application of p53-based therapies in lung cancer. Using RNA sequencing, we determined the transcriptional profile of human non-small cell lung carcinoma A549 cells after treatment with two p53-activating chemical compounds, nutlin and RITA, which could induce A549 cell cycle arrest and apoptosis, respectively. Bioinformatics analysis of genome-wide gene expression data showed that distinct transcription profiles were induced by nutlin and RITA and 66 pathways were differentially regulated by these two compounds. However, only two of these pathways, 'Adherens junction' and 'Axon guidance', were found to be synthetic lethal with p53 re-activation, as determined via integrated analysis of genome-wide gene expression profile and short hairpin RNA (shRNA) screening. Further functional protein association analysis of significantly regulated genes associated with these two synthetic lethal pathways indicated that GSK3 played a key role in p53-mediated A549 cell apoptosis, and then gene function study was performed, which revealed that GSK3 inhibition promoted p53-mediated A549 cell apoptosis in a p53 post-translational activity-dependent manner. Our findings provide us with new insights regarding the mechanism by which p53 mediates A549 apoptosis and may cast light on the development of more efficient p53-based strategies for treating lung cancer. © 201 The Author(s). Published by S. Karger AG, Basel.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Fuming; Saha, Abhik; Murakami, Masanao

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

PubMed

He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

2016-01-01

The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

MG132 plus apoptosis antigen-1 (APO-1) antibody cooperate to restore p53 activity inducing autophagy and p53-dependent apoptosis in HPV16 E6-expressing keratinocytes.

PubMed

Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio

2017-01-01

The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance

PubMed Central

Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R

2016-01-01

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462

LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint

PubMed Central

Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549

Diaryl- and triaryl-pyrrole derivatives: inhibitors of the MDM2-p53 and MDMX-p53 protein-protein interactions†Electronic supplementary information (ESI) available: Experimental details for compound synthesis, analytical data for all compounds and intermediates. Details for the biological evaluation. Further details for the modeling. Table of combustion analysis data. See DOI: 10.1039/c3md00161jClick here for additional data file.

PubMed

Blackburn, Tim J; Ahmed, Shafiq; Coxon, Christopher R; Liu, Junfeng; Lu, Xiaohong; Golding, Bernard T; Griffin, Roger J; Hutton, Claire; Newell, David R; Ojo, Stephen; Watson, Anna F; Zaytzev, Andrey; Zhao, Yan; Lunec, John; Hardcastle, Ian R

2013-09-21

Screening identified 2-(3-((4,6-dioxo-2-thioxotetrahydropyrimidin-5(2 H )-ylidene)methyl)-2,5-dimethyl-1 H -pyrrol-1-yl)-4,5,6,7-tetrahydrobenzo[ b ]thiophene-3-carbonitrile as an MDM2-p53 inhibitor (IC 50 = 12.3 μM). MDM2-p53 and MDMX-p53 activity was seen for 5-((1-(4-chlorophenyl)-2,5-diphenyl-1 H -pyrrol-3-yl)methylene)-2-thioxodihydropyrimidine-4,6(1 H ,5 H )-dione (MDM2 IC 50 = 0.11 μM; MDMX IC 50 = 4.2 μM) and 5-((1-(4-nitrophenyl)-2,5-diphenyl-1 H -pyrrol-3-yl)methylene)pyrimidine-2,4,6(1 H ,3 H ,5 H )-trione (MDM2 IC 50 = 0.15 μM; MDMX IC 50 = 4.2 μM), and cellular activity consistent with p53 activation in MDM2 amplified cells. Further SAR studies demonstrated the requirement for the triarylpyrrole moiety for MDMX-p53 activity but not for MDM2-p53 inhibition.

Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

PubMed

Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

1998-01-01

A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

MicroRNAs as Key Effectors in the p53 Network.

PubMed

Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni

2017-01-01

The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis.

PubMed

Rigby, Cynthia M; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K; Dhar, Deepanshi; Orlicky, David J; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53 +/- ) and p53 knockout (p53 -/- ) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53 +/+ mice, p53 +/- mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53 +/+ mice but silibinin' protective efficacy was significantly compromised in p53 +/- mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53 -/- mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53 +/+ mice while its efficacy was partially compromised in p53 -/- mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis

PubMed Central

Rigby, Cynthia M.; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K.; Dhar, Deepanshi; Orlicky, David J.; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53+/−) and p53 knockout (p53−/−) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53+/+ mice, p53+/− mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53+/+ mice but silibinin’ protective efficacy was significantly compromised in p53+/− mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53−/− mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53+/+ mice while its efficacy was partially compromised in p53−/− mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. PMID:27729375

Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

PubMed Central

Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

2012-01-01

Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

Intratumoral delivery of docetaxel enhances antitumor activity of Ad-p53 in murine head and neck cancer xenograft model.

PubMed

Yoo, George H; Subramanian, Geetha; Ezzat, Waleed H; Tulunay, Ozlem E; Tran, Vivian R; Lonardo, Fulvio; Ensley, John F; Kim, Harold; Won, Joshua; Stevens, Timothy; Zumstein, Louis A; Lin, Ho-Sheng

2010-01-01

The aim of this study is to determine the ability of intratumorally delivered docetaxel to enhance the antitumor activity of adenovirus-mediated delivery of p53 (Ad-p53) in murine head and neck cancer xenograft model. A xenograft head and neck squamous cell carcinoma mouse model was used. Mice were randomized into 4 groups of 6 mice receiving 6 weeks of biweekly intratumoral injection of (a) diluent, (b) Ad-p53 (1 x 10(10) viral particles per injection), (c) docetaxel (1 mg/kg per injection), and (d) combination of Ad-p53 (1 x 10(10) viral particles per injection) and docetaxel (1 mg/kg per injection). Tumor size, weight, toxicity, and overall and disease-free survival rates were determined. Intratumoral treatments with either docetaxel alone or Ad-p53 alone resulted in statistically significant antitumor activity and improved survival compared with control group. Furthermore, combined delivery of Ad-p53 and docetaxel resulted in a statistically significant reduction in tumor weight when compared to treatment with either Ad-p53 or docetaxel alone. Intratumoral delivery of docetaxel enhanced the antitumor effect of Ad-p53 in murine head and neck cancer xenograft model. The result of this preclinical in vivo study is promising and supports further clinical testing to evaluate efficacy of combined intratumoral docetaxel and Ad-p53 in treatment of head and neck cancer. Copyright (c) 2010 Elsevier Inc. All rights reserved.

40 Years of Research Put p53 in Translation

PubMed Central

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

HIPK2 restricts SIRT1 activity upon severe DNA damage by a phosphorylation-controlled mechanism

PubMed Central

Conrad, E; Polonio-Vallon, T; Meister, M; Matt, S; Bitomsky, N; Herbel, C; Liebl, M; Greiner, V; Kriznik, B; Schumacher, S; Krieghoff-Henning, E; Hofmann, T G

2016-01-01

Upon severe DNA damage a cellular signalling network initiates a cell death response through activating tumour suppressor p53 in association with promyelocytic leukaemia (PML) nuclear bodies. The deacetylase Sirtuin 1 (SIRT1) suppresses cell death after DNA damage by antagonizing p53 acetylation. To facilitate efficient p53 acetylation, SIRT1 function needs to be restricted. How SIRT1 activity is regulated under these conditions remains largely unclear. Here we provide evidence that SIRT1 activity is limited upon severe DNA damage through phosphorylation by the DNA damage-responsive kinase HIPK2. We found that DNA damage provokes interaction of SIRT1 and HIPK2, which phosphorylates SIRT1 at Serine 682 upon lethal damage. Furthermore, upon DNA damage SIRT1 and HIPK2 colocalize at PML nuclear bodies, and PML depletion abrogates DNA damage-induced SIRT1 Ser682 phosphorylation. We show that Ser682 phosphorylation inhibits SIRT1 activity and impacts on p53 acetylation, apoptotic p53 target gene expression and cell death. Mechanistically, we found that DNA damage-induced SIRT1 Ser682 phosphorylation provokes disruption of the complex between SIRT1 and its activator AROS. Our findings indicate that phosphorylation-dependent restriction of SIRT1 activity by HIPK2 shapes the p53 response. PMID:26113041

SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

2014-06-15

Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less

Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos.

PubMed

El Husseini, Nazem; Schlisser, Ava E; Hales, Barbara F

2016-08-01

Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Metabolic oxidative stress elicited by the copper(II) complex [Cu(isaepy)2] triggers apoptosis in SH-SY5Y cells through the induction of the AMP-activated protein kinase/p38MAPK/p53 signalling axis: evidence for a combined use with 3-bromopyruvate in neuroblastoma treatment.

PubMed

Filomeni, Giuseppe; Cardaci, Simone; Da Costa Ferreira, Ana Maria; Rotilio, Giuseppe; Ciriolo, Maria Rosa

2011-08-01

We have demonstrated previously that the complex bis[(2-oxindol-3-ylimino)-2-(2-aminoethyl)pyridine-N,N']copper(II), named [Cu(isaepy)(2)], induces AMPK (AMP-activated protein kinase)-dependent/p53-mediated apoptosis in tumour cells by targeting mitochondria. In the present study, we found that p38(MAPK) (p38 mitogen-activated protein kinase) is the molecular link in the phosphorylation cascade connecting AMPK to p53. Transfection of SH-SY5Y cells with a dominant-negative mutant of AMPK resulted in a decrease in apoptosis and a significant reduction in phospho-active p38(MAPK) and p53. Similarly, reverse genetics of p38(MAPK) yielded a reduction in p53 and a decrease in the extent of apoptosis, confirming an exclusive hierarchy of activation that proceeds via AMPK/p38(MAPK)/p53. Fuel supplies counteracted [Cu(isaepy)(2)]-induced apoptosis and AMPK/p38(MAPK)/p53 activation, with glucose being the most effective, suggesting a role for energetic imbalance in [Cu(isaepy)(2)] toxicity. Co-administration of 3BrPA (3-bromopyruvate), a well-known inhibitor of glycolysis, and succinate dehydrogenase, enhanced apoptosis and AMPK/p38(MAPK)/p53 signalling pathway activation. Under these conditions, no toxic effect was observed in SOD (superoxide dismutase)-overexpressing SH-SY5Y cells or in PCNs (primary cortical neurons), which are, conversely, sensitized to the combined treatment with [Cu(isaepy)(2)] and 3BrPA only if grown in low-glucose medium or incubated with the glucose-6-phosphate dehydrogenase inhibitor dehydroepiandrosterone. Overall, the results suggest that NADPH deriving from the pentose phosphate pathway contributes to PCN resistance to [Cu(isaepy)(2)] toxicity and propose its employment in combination with 3BrPA as possible tool for cancer treatment. © The Authors Journal compilation © 2011 Biochemical Society

Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

PubMed Central

Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

2016-01-01

The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

Modeling of Arylamide Helix Mimetics in the p53 Peptide Binding Site of hDM2 Suggests Parallel and Anti-Parallel Conformations Are Both Stable

PubMed Central

Fuller, Jonathan C.; Jackson, Richard M.; Edwards, Thomas A.; Wilson, Andrew J.; Shirts, Michael R.

2012-01-01

The design of novel α-helix mimetic inhibitors of protein-protein interactions is of interest to pharmaceuticals and chemical genetics researchers as these inhibitors provide a chemical scaffold presenting side chains in the same geometry as an α-helix. This conformational arrangement allows the design of high affinity inhibitors mimicking known peptide sequences binding specific protein substrates. We show that GAFF and AutoDock potentials do not properly capture the conformational preferences of α-helix mimetics based on arylamide oligomers and identify alternate parameters matching solution NMR data and suitable for molecular dynamics simulation of arylamide compounds. Results from both docking and molecular dynamics simulations are consistent with the arylamides binding in the p53 peptide binding pocket. Simulations of arylamides in the p53 binding pocket of hDM2 are consistent with binding, exhibiting similar structural dynamics in the pocket as simulations of known hDM2 binders Nutlin-2 and a benzodiazepinedione compound. Arylamide conformations converge towards the same region of the binding pocket on the 20 ns time scale, and most, though not all dihedrals in the binding pocket are well sampled on this timescale. We show that there are two putative classes of binding modes for arylamide compounds supported equally by the modeling evidence. In the first, the arylamide compound lies parallel to the observed p53 helix. In the second class, not previously identified or proposed, the arylamide compound lies anti-parallel to the p53 helix. PMID:22916232

RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice

PubMed Central

Herold, Marco J.

2016-01-01

Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

Similarities and differences in the p53-mdm2 and NF-kB feedback loops

NASA Astrophysics Data System (ADS)

Krishna, Sandeep

2008-03-01

Ultradian oscillations in the p53 and NF-kB signalling systems are produced using similar mechanisms: a negative feedback loop combined with an effective time delay. However, seemingly small differences in the molecular implementation of this mechanism mean that the NF-kB system is in equilibrium in the resting state, while the p53 system is far from equilibrium. I will discuss how this affects the dynamical response of the systems. In particular, I will argue that the nonequilibrium driving makes the p53 system respond much faster to external stimuli than the NF-kB system. The interesting question then is whether this makes sense physiologically, and is consistent with the fact that p53 triggers cell-cycle arrest and apoptosis, while NF-kB triggers the immune response.

Inferring Toxicological Responses of HepG2 Cells from ...

EPA Pesticide Factsheets

Understanding the dynamic perturbation of cell states by chemicals can aid in for predicting their adverse effects. High-content imaging (HCI) was used to measure the state of HepG2 cells over three time points (1, 24, and 72 h) in response to 976 ToxCast chemicals for 10 different concentrations (0.39-200µM). Cell state was characterized by p53 activation (p53), c-Jun activation (SK), phospho-Histone H2A.x (OS), phospho-Histone H3 (MA), alpha tubulin (Mt), mitochondrial membrane potential (MMP), mitochondrial mass (MM), cell cycle arrest (CCA), nuclear size (NS) and cell number (CN). Dynamic cell state perturbations due to each chemical concentration were utilized to infer coarse-grained dependencies between cellular functions as Boolean networks (BNs). BNs were inferred from data in two steps. First, the data for each state variable were discretized into changed/active (> 1 standard deviation), and unchanged/inactive values. Second, the discretized data were used to learn Boolean relationships between variables. In our case, a BN is a wiring diagram between nodes that represent 10 previously described observable phenotypes. Functional relationships between nodes were represented as Boolean functions. We found that inferred BN show that HepG2 cell response is chemical and concentration specific. We observed presence of both point and cycle BN attractors. In addition, there are instances where Boolean functions were not found. We believe that this may be either

The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

NASA Technical Reports Server (NTRS)

Kohli, M.; Jorgensen, T. J.

1999-01-01

The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65.

PubMed

Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S; Kaneki, Masao

2014-11-11

Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson's disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. Copyright © 2014, American Association for the Advancement of Science.

Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, Chunhua; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu; Ma, Xa

2014-12-15

Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleavedmore » PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly activated in Mn-exposed brain cells. • p53 translocates into mitochondria following Mn exposure. • p53 causes mitochondrial deficit via transcription-dependent and -independent actions. • PFT-α and PFT-μ ameliorate Mn-induced mitochondrial deficit and neuronal apoptosis.« less

Extracellular NAMPT/visfatin causes p53 deacetylation via NAD production and SIRT1 activation in breast cancer cells.

PubMed

Behrouzfar, Kiarash; Alaee, Mohammad; Nourbakhsh, Mitra; Gholinejad, Zafar; Golestani, Abolfazl

2017-08-01

Visfatin, which is secreted as an adipokine and cytokine, has been implicated in cancer development and progression. In this study, we investigated the NAD-producing ability of visfatin and its relationship with SIRT1 (silent information regulator 2) and p53 to clarify the role of visfatin in breast cancer. MCF-7 breast cancer cells were cultured and treated with visfatin. SIRT1 activity was assessed by measuring fluorescence intensity from fluoro-substrate peptide. To investigate the effect of visfatin on p53 acetylation, SDS-PAGE followed by western blotting was performed using specific antibodies against p53 and its acetylated form. Total NAD was measured both in cell lysate and the extracellular medium by colorimetric method. Visfatin increased both extracellular and intracellular NAD concentrations. It also induced proliferation of breast cancer cells, an effect that was abolished by inhibition of its enzymatic activity. Visfatin significantly increased SIRT1 activity, accompanied by induction of p53 deacetylation. In conclusion, the results show that extracellular visfatin produces NAD that causes upregulation of SIRT1 activity and p53 deacetylation. These findings explain the relationship between visfatin and breast cancer progression. Copyright © 2017 John Wiley & Sons, Ltd.

Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

PubMed

Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

2013-05-01

DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

PubMed Central

Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

2016-01-01

Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

MDM2 restrains estrogen-mediated AKT activation by promoting TBK1-dependent HPIP degradation

PubMed Central

Shostak, K; Patrascu, F; Göktuna, S I; Close, P; Borgs, L; Nguyen, L; Olivier, F; Rammal, A; Brinkhaus, H; Bentires-Alj, M; Marine, J-C; Chariot, A

2014-01-01

Restoration of p53 tumor suppressor function through inhibition of its interaction and/or enzymatic activity of its E3 ligase, MDM2, is a promising therapeutic approach to treat cancer. However, because the MDM2 targetome extends beyond p53, MDM2 inhibition may also cause unwanted activation of oncogenic pathways. Accordingly, we identified the microtubule-associated HPIP, a positive regulator of oncogenic AKT signaling, as a novel MDM2 substrate. MDM2-dependent HPIP degradation occurs in breast cancer cells on its phosphorylation by the estrogen-activated kinase TBK1. Importantly, decreasing Mdm2 gene dosage in mouse mammary epithelial cells potentiates estrogen-dependent AKT activation owing to HPIP stabilization. In addition, we identified HPIP as a novel p53 transcriptional target, and pharmacological inhibition of MDM2 causes p53-dependent increase in HPIP transcription and also prevents HPIP degradation by turning off TBK1 activity. Our data indicate that p53 reactivation through MDM2 inhibition may result in ectopic AKT oncogenic activity by maintaining HPIP protein levels. PMID:24488098

Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

PubMed

Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

2016-03-01

Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

Generation of oscillations by the p53-Mdm2 feedback loop: A theoretical and experimental study

PubMed Central

Lev Bar-Or, Ruth; Maya, Ruth; Segel, Lee A.; Alon, Uri; Levine, Arnold J.; Oren, Moshe

2000-01-01

The intracellular activity of the p53 tumor suppressor protein is regulated through a feedback loop involving its transcriptional target, mdm2. We present a simple mathematical model suggesting that, under certain circumstances, oscillations in p53 and Mdm2 protein levels can emerge in response to a stress signal. A delay in p53-dependent induction of Mdm2 is predicted to be required, albeit not sufficient, for this oscillatory behavior. In line with the predictions of the model, oscillations of both p53 and Mdm2 indeed occur on exposure of various cell types to ionizing radiation. Such oscillations may allow cells to repair their DNA without risking the irreversible consequences of continuous excessive p53 activation. PMID:11016968

BTK blocks the inhibitory effects of MDM2 on p53 activity

PubMed Central

Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador

2017-01-01

p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977

NF-kappaB and p53 are the dominant apoptosis-inducing transcription factors elicited by the HIV-1 envelope.

PubMed

Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido

2004-03-01

The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.

Smad Ubiquitylation Regulatory Factor 1/2 (Smurf1/2) Promotes p53 Degradation by Stabilizing the E3 Ligase MDM2*

PubMed Central

Nie, Jing; Xie, Ping; Liu, Lin; Xing, Guichun; Chang, Zhijie; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2010-01-01

The tumor suppressor p53 protein is tightly regulated by a ubiquitin-proteasomal degradation mechanism. Several E3 ubiquitin ligases, including MDM2 (mouse double minute 2), have been reported to play an essential role in the regulation of p53 stability. However, it remains unclear how the activity of these E3 ligases is regulated. Here, we show that the HECT-type E3 ligase Smurf1/2 (Smad ubiquitylation regulatory factor 1/2) promotes p53 degradation by enhancing the activity of the E3 ligase MDM2. We provide evidence that the role of Smurf1/2 on the p53 stability is not dependent on the E3 activity of Smurf1/2 but rather is dependent on the activity of MDM2. We find that Smurf1/2 stabilizes MDM2 by enhancing the heterodimerization of MDM2 with MDMX, during which Smurf1/2 interacts with MDM2 and MDMX. We finally provide evidence that Smurf1/2 regulates apoptosis through p53. To our knowledge, this is the first report to demonstrate that Smurf1/2 functions as a factor to stabilize MDM2 protein rather than as a direct E3 ligase in regulation of p53 degradation. PMID:20484049

The tumour suppressor protein, p53, is involved in the activation of the apoptotic cascade by Delta9-tetrahydrocannabinol in cultured cortical neurons.

PubMed

Downer, Eric J; Gowran, Aoife; Murphy, Aine C; Campbell, Veronica A

2007-06-14

Cannabis is the most commonly used illegal drug of abuse in Western society. Delta(9)-tetrahydrocannabinol, the psychoactive ingredient of marijuana, regulates a variety of neuronal processes including neurotransmitter release and synaptic transmission. An increasing body of evidence suggests that cannabinoids play a key role in the regulation of neuronal viability. In cortical neurons tetrahydrocannabinol has a neurodegenerative effect, the mechanisms of which are poorly understood, but involve the cannabinoid receptor subtype, CB(1). In this study we report that tetrahydrocannabinol (5 muM) evokes a rapid phosphorylation, and thus activation, of the tumour suppressor protein, p53, in a manner involving the cannabinoid CB(1) receptor, and the stress-activated protein kinase, c-jun N-terminal kinase, in cultured cortical neurons. Tetrahydrocannabinol increased expression of the p53-transcriptional target, Bax and promoted Bcl phosphorylation. These events were abolished by the p53 inhibitor, pifithrin-alpha (100 nM). The tetrahydrocannabinol-induced activation of the pro-apoptotic cysteine protease, caspase-3, and DNA fragmentation was also blocked by pifithrin-alpha. A siRNA knockdown of p53 further verified the role of p53 in tetrahydrocannabinol-induced apoptosis. This study demonstrates a novel cannabinoid signalling pathway involving p53 that culminates in neuronal apoptosis.

Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway.

PubMed

Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W

2015-08-21

Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.

Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

PubMed Central

Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.

2015-01-01

Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280

p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

PubMed Central

Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

2010-01-01

The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

Selective FLT3 inhibitor FI-700 neutralizes Mcl-1 and enhances p53-mediated apoptosis in AML cells with activating mutations of FLT3 through Mcl-1/Noxa axis.

PubMed

Kojima, K; Konopleva, M; Tsao, T; Andreeff, M; Ishida, H; Shiotsu, Y; Jin, L; Tabe, Y; Nakakuma, H

2010-01-01

Treatment using Fms-like tyrosine kinase-3 (FLT3) inhibitors is a promising approach to overcome the dismal prognosis of acute myeloid leukemia (AML) with activating FLT3 mutations. Current trials are combining FLT3 inhibitors with p53-activating conventional chemotherapy. The mechanisms of cytotoxicity of FLT3 inhibitors are poorly understood. We investigated the interaction of FLT3 and p53 pathways after their simultaneous blockade using the selective FLT3 inhibitor FI-700 and the MDM2 inhibitor Nutlin-3 in AML. We found that FI-700 immediately reduced antiapoptotic Mcl-1 levels and enhanced Nutlin-induced p53-mediated mitochondrial apoptosis in FLT3/internal tandem duplication cells through the Mcl-1/Noxa axis. FI-700 induced proteasome-mediated degradation of Mcl-1, resulting in the reduced ability of Mcl-1 to sequester proapoptotic Bim. Nutlin-3 induced Noxa, which displaced Bim from Mcl-1. The FI-700/Nutlin-3 combination profoundly activated Bax and induced apoptosis. Our findings suggest that FI-700 actively enhances p53 signaling toward mitochondrial apoptosis and that a combination strategy aimed at inhibiting FLT3 and activating p53 signaling could potentially be effective in AML.

p53 as a retrovirus-induced oxidative stress modulator.

PubMed

Kim, Soo Jin; Wong, Paul K Y

2015-01-01

Infection of astrocytes by the neuropathogenic mutant of Moloney murine leukemia virus, ts1, exhibits increased levels of reactive oxygen species (ROS) and signs of oxidative stress compared with uninfected astrocytes. Previously, we have demonstrated that ts1 infection caused two separate events of ROS upregulation. The first upregulation occurs during early viral establishment in host cells and the second during the virus-mediated apoptotic process. In this study, we show that virus-mediated ROS upregulation activates the protein kinase, ataxia telangiectasia mutated, which in turn phosphorylates serine 15 on p53. This activation of p53 however, is unlikely associated with ts1-induced cell death. Rather p53 appears to be involved in suppressing intracellular ROS levels in astrocytes under oxidative stress. The activated p53 appears to delay retroviral gene expression by suppressing NADPH oxidase, a superoxide-producing enzyme. These results suggest that p53 plays a role as a retrovirus-mediated oxidative stress modulator. © 2015 The Authors.

ERK mediated upregulation of death receptor 5 overcomes the lack of p53 functionality in the diaminothiazole DAT1 induced apoptosis in colon cancer models: efficiency of DAT1 in Ras-Raf mutated cells.

PubMed

Thamkachy, Reshma; Kumar, Rohith; Rajasekharan, K N; Sengupta, Suparna

2016-03-08

p53 is a tumour suppressor protein that plays a key role in many steps of apoptosis, and malfunctioning of this transcription factor leads to tumorigenesis. Prognosis of many tumours also depends upon the p53 status. Most of the clinically used anticancer compounds activate p53 dependent pathway of apoptosis and hence require p53 for their mechanism of action. Further, Ras/Raf/MEK/ERK axis is an important signaling pathway activated in many cancers. Dependence of diaminothiazoles, compounds that have gained importance recently due to their anticancer and anti angiogenic activities, were tested in cancer models with varying p53 or Ras/Raf mutational status. In this study we have used p53 mutated and knock out colon cancer cells and xenograft tumours to study the role of p53 in apoptosis mediated by diaminothiazoles. Colon cancer cell lines with varying mutational status for Ras or Raf were also used. We have also examined the toxicity and in vivo efficacy of a lead diaminothiazole 4-Amino-5-benzoyl-2-(4-methoxy phenylamino)thiazole (DAT1) in colon cancer xenografts. We have found that DAT1 is active in both in vitro and in vivo models with nonfunctional p53. Earlier studies have shown that extrinsic pathway plays major role in DAT1 mediated apoptosis. In this study, we have found that DAT1 is causing p53 independent upregulation of the death receptor 5 by activating the Ras/Raf/MEK/ERK signaling pathway both in wild type and p53 suppressed colon cancer cells. These findings are also confirmed by the in vivo results. Further, DAT1 is more efficient to induce apoptosis in colon cancer cells with mutated Ras or Raf. Minimal toxicity in both acute and subacute studies along with the in vitro and in vivo efficacy of DAT1 in cancers with both wild type and nonfunctional p53 place it as a highly beneficial candidate for cancer chemotherapy. Besides, efficiency in cancer cells with mutations in the Ras oncoprotein or its downstream kinase Raf raise interest in diaminothiazole class of compounds for further follow-up.

Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

PubMed Central

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

2014-01-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

IRSp53 is colocalised with WAVE2 at the tips of protruding lamellipodia and filopodia independently of Mena.

PubMed

Nakagawa, Hiroyuki; Miki, Hiroaki; Nozumi, Motohiro; Takenawa, Tadaomi; Miyamoto, Shigeaki; Wehland, Jürgen; Small, J Victor

2003-06-15

The insulin receptor tyrosine kinase substrate p53 (IRSp53) links Rac and WAVE2 and has been implicated in lamellipodia protrusion. Recently, however, IRSp53 has been reported to bind to both Cdc42 and Mena to induce filopodia. To shed independent light on IRSp53 function we determined the localisations and dynamics of IRSp53 and WAVE2 in B16 melanoma cells. In cells spread well on a laminin substrate, IRSp53 was localised by antibody labelling at the tips of both lamellipodia and filopodia. The same localisation was observed in living cells with IRSp53 tagged with enhanced green florescence protein (EGFP-IRSp53), but only during protrusion. From the transfection of deletion mutants the N-terminal region of IRSp53, which binds active Rac, was shown to be responsible for its localisation. Although IRSp53 has been reported to regulate filopodia formation with Mena, EGFP-IRSp53 showed the same localisation in MVD7 Ena/VASP (vasodilator stimulated phosphoprotein) family deficient cells. WAVE2 tagged with DsRed1 colocalised with EGFP-IRSp53 at the tips of protruding lamellipodia and filopodia and, in double-transfected cells, the IRSp53 signal in filopodia decreased before that of WAVE2 during retraction. These results suggest an alternative modulatory role for IRSp53 in the extension of both filopodia and lamellipodia, through WAVE2.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation.

PubMed

Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P; Whelan, Rebecca J; Patankar, Manish S

2016-06-08

The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors.

Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation

PubMed Central

Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P.; Whelan, Rebecca J.; Patankar, Manish S.

2016-01-01

The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors. PMID:27270209

Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.

PubMed

Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya

2009-07-01

p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Critical functions of RhoB in support of glioblastoma tumorigenesis

PubMed Central

Ma, Yufang; Gong, Yuanying; Cheng, Zhixiang; Loganathan, Sudan; Kao, Crystal; Sarkaria, Jann N.; Abel, Ty W.; Wang, Jialiang

2015-01-01

Background RhoB is a member of the Rho small GTPase family that regulates cytoskeletal dynamics and vesicle trafficking. The RhoB homologs, RhoA and RhoC, have been shown to promote cancer progression and metastasis. In contrast, the functions of RhoB in human cancers are context dependent. Although expression of RhoB inversely correlates with disease progression in several epithelial cancers, recent data suggest that RhoB may support malignant phenotypes in certain cancer types. Methods We assessed RhoB protein levels in glioma surgical specimens and patient-derived xenografts. The roles of RhoB in glioblastoma were determined by loss-of-function and gain-of-function assays in vitro and in vivo. The impact on p53 and STAT3 signaling was investigated. Results RhoB expression was similar in tumor specimens compared with normal neural tissues obtained from epilepsy surgery. RhoB was expressed in the vast majority of xenograft tumors and spheroid cultures. Knockdown of RhoB induced cell-cycle arrest and apoptosis and compromised in vivo tumorigenic potential. However, overexpression of wild-type RhoB or a constitutively active mutant (RhoB-V14) did not significantly affect cell growth, which suggests that RhoB is not a rate-limiting oncogenic factor and is consistent with the scarcity of RhoB mutations in human cancer. Knockdown of RhoB reduced basal STAT3 activity and impaired cytokine-induced STAT3 activation. In glioblastoma tumors retaining wild-type p53, depletion of RhoB also activated p53 and induced expression of p21CIP1/WAF1. Conclusions Our data suggest that RhoB belongs to an emerging class of “nononcogene addiction” factors that are essential for maintenance of malignant phenotypes in human cancers. PMID:25216671

New Insights into the Mechanism of Inhibition of p53 by Simian Virus 40 Large T Antigen

PubMed Central

Sheppard, Hilary M.; Corneillie, Siska I.; Espiritu, Christine; Gatti, Andrea; Liu, Xuan

1999-01-01

Simian virus 40 (SV40) large tumor antigen (T antigen) has been shown to inhibit p53-dependent transcription by preventing p53 from binding to its cognate cis element. Data presented in this report provide the first direct functional evidence that T antigen, under certain conditions, may also repress p53-dependent transcription by a mechanism in which the transactivation domain of p53 is abrogated while DNA binding is unaffected. Specifically, p53 purified as a complex with T antigen from mouse cells was found to bind DNA as a transcriptionally inactive intact complex, while that purified from human cells was found to bind DNA independently of T antigen and could activate p53-dependent transcription. This difference in activity may be dependent on a different interaction of T antigen with mouse and human p53 and, in addition, on the presence of super T, which is found only in transformed rodent cells. These results suggest that subtle yet important differences exist between the inhibition of p53 by T antigen in mouse and human cells. The implications of this finding with respect to SV40-associated malignancies are discussed. PMID:10082540

Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

PubMed Central

Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

2011-01-01

We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

Hepatitis C virus Core overcomes all-trans retinoic acid-induced apoptosis in human hepatoma cells by inhibiting p14 expression via DNA methylation

PubMed Central

Kwak, Juri; Choi, Jung-Hye; Jang, Kyung Lib

2017-01-01

All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, is known to induce p14 expression via promoter hypomethylation to activate the p14-MDM2-p53 pathway, which leads to activation of the p53-dependent apoptotic pathway and subsequent induction of apoptosis in human hepatoma cells. In the present study, we found that hepatitis C virus (HCV) Core derived from ectopic expression or HCV infection overcomes ATRA-induced apoptosis in p53-positive hepatoma cells. For this effect, HCV Core upregulated both protein levels and enzyme activities of DNA methyltransferase 1 (DNMT1), DNMT3a, and DNMT3b and thereby repressed p14 expression via promoter hypermethylation, resulting in inactivation of the pathway leading to p53 accumulation in the presence of ATRA. As a result, HCV Core prevented ATRA from activating several apoptosis-related molecules, including Bax, p53 upregulated modulator of apoptosis, caspase-9, caspase-3, and poly (ADP-ribose) polymerase. In addition, complementation of p14 in the Core-expressing cells by either ectopic expression or treatment with 5-Aza-2′dC almost completely abolished the potential of HCV Core to suppress ATRA-induced apoptosis. Based on these observations, we conclude that HCV Core executes its oncogenic potential by suppressing the p53-dependent apoptosis induced by ATRA in human hepatoma cells. PMID:29156743

Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

PubMed

Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

2017-10-15

Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and DNA damage-mediated cellular stresses. This seems to be the first report that p53 activates a viral oncogene; therefore, the discovery would be interesting to a broad readership from the fields of oncology to virology. Copyright © 2017 American Society for Microbiology.

Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53

PubMed Central

Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich

2011-01-01

Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600

Deubiquitinating enzyme regulation of the p53 pathway: A lesson from Otub1

PubMed Central

Sun, Xiao-Xin; Dai, Mu-Shui

2014-01-01

Deubiquitination has emerged as an important mechanism of p53 regulation. A number of deubiquitinating enzymes (DUBs) from the ubiquitin-specific protease family have been shown to regulate the p53-MDM2-MDMX networks. We recently reported that Otub1, a DUB from the OTU-domain containing protease family, is a novel p53 regulator. Interestingly, Otub1 abrogates p53 ubiquitination and stabilizes and activates p53 in cells independently of its deubiquitinating enzyme activity. Instead, it does so by inhibiting the MDM2 cognate ubiquitin-conjugating enzyme (E2) UbcH5. Otub1 also regulates other biological signaling through this non-canonical mechanism, suppression of E2, including the inhibition of DNA-damage-induced chromatin ubiquitination. Thus, Otub1 evolves as a unique DUB that mainly suppresses E2 to regulate substrates. Here we review the current progress made towards the understanding of the complex regulation of the p53 tumor suppressor pathway by DUBs, the biological function of Otub1 including its positive regulation of p53, and the mechanistic insights into how Otub1 suppresses E2. PMID:24920999

Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy.

PubMed

Simon, Christian M; Dai, Ya; Van Alstyne, Meaghan; Koutsioumpa, Charalampia; Pagiazitis, John G; Chalif, Joshua I; Wang, Xiaojian; Rabinowitz, Joseph E; Henderson, Christopher E; Pellizzoni, Livio; Mentis, George Z

2017-12-26

The hallmark of spinal muscular atrophy (SMA), an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation.

PubMed

Jung, Yu Yeon; Son, Dong Ju; Lee, Hye Lim; Kim, Dae Hwan; Song, Min Jong; Ham, Young Wan; Kim, Youngsoo; Han, Sang Bae; Park, Mi Hee; Hong, Jin Tae

2017-08-01

Parkin is associated with various inflammatory diseases, including Parkinson's disease (PD) and rheumatoid arthritis (RA). However, the precise role of Parkin in RA is unclear. The present study addressed this issue by comparing the development of RA between non-transgenic (non-Tg) mice and PARK2 knockout (KO) mice. We found that cyclooxygenase-2 and inducible nitric oxide synthase expression and nuclear factor-κB activity were reduced but p53 activation was increased in PARK2 KO as compared to non-Tg mice. These effects were associated with reduced p53 degradation. Parkin was found to interact with p53; however, this was abolished in Parkin KO mice, which prevented p53 degradation. Treatment of PARK2 KO mice with p53 inhibitor increased Parkin expression as well as inflammation and RA development while decreasing nuclear p53 translocation, demonstrating that PARK2 deficiency inhibits inflammation in RA via suppression of p53 degradation. These results suggest that RA development may be reduced in PD patients. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

PubMed

Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

2017-04-01

Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Growth factor independence-1 antagonizes a p53-induced DNA damage response pathway in lymphoblastic leukemia

PubMed Central

Khandanpour, Cyrus; Phelan, James D.; Vassen, Lothar; Schütte, Judith; Chen, Riyan; Horman, Shane R.; Gaudreau, Marie-Claude; Krongold, Joseph; Zhu, Jinfang; Paul, William E.; Dührsen, Ulrich; Göttgens, Bertie; Grimes, H. Leighton; Möröy, Tarik

2013-01-01

Summary Most patients with acute lymphoblastic leukemia (ALL) fail current treatments highlighting the need for better therapies. Since oncogenic signaling activates a p53-dependent DNA-damage response and apoptosis, leukemic cells must devise appropriate countermeasures. We show here that growth factor independence 1 (Gfi1) can serve such a function, since Gfi1 ablation exacerbates p53 responses, and lowers the threshold for p53-induced cell death. Specifically, Gfi1 restricts p53 activity and expression of pro-apoptotic p53 targets such as Bax, Noxa (Pmaip1) and Puma (Bbc3). Subsequently, Gfi1 ablation cures mice from leukemia and limits the expansion of primary human T-ALL xenografts in mice. This suggests that targeting Gfi1 could improve the prognosis of patients with T-ALL or other lymphoid leukemias. PMID:23410974

Feedback modulation of neural network synchrony and seizure susceptibility by Mdm2-p53-Nedd4-2 signaling.

PubMed

Jewett, Kathryn A; Christian, Catherine A; Bacos, Jonathan T; Lee, Kwan Young; Zhu, Jiuhe; Tsai, Nien-Pei

2016-03-22

Neural network synchrony is a critical factor in regulating information transmission through the nervous system. Improperly regulated neural network synchrony is implicated in pathophysiological conditions such as epilepsy. Despite the awareness of its importance, the molecular signaling underlying the regulation of neural network synchrony, especially after stimulation, remains largely unknown. In this study, we show that elevation of neuronal activity by the GABA(A) receptor antagonist, Picrotoxin, increases neural network synchrony in primary mouse cortical neuron cultures. The elevation of neuronal activity triggers Mdm2-dependent degradation of the tumor suppressor p53. We show here that blocking the degradation of p53 further enhances Picrotoxin-induced neural network synchrony, while promoting the inhibition of p53 with a p53 inhibitor reduces Picrotoxin-induced neural network synchrony. These data suggest that Mdm2-p53 signaling mediates a feedback mechanism to fine-tune neural network synchrony after activity stimulation. Furthermore, genetically reducing the expression of a direct target gene of p53, Nedd4-2, elevates neural network synchrony basally and occludes the effect of Picrotoxin. Finally, using a kainic acid-induced seizure model in mice, we show that alterations of Mdm2-p53-Nedd4-2 signaling affect seizure susceptibility. Together, our findings elucidate a critical role of Mdm2-p53-Nedd4-2 signaling underlying the regulation of neural network synchrony and seizure susceptibility and reveal potential therapeutic targets for hyperexcitability-associated neurological disorders.

Solitary pulmonary nodules: Comparison of dynamic first-pass contrast-enhanced perfusion area-detector CT, dynamic first-pass contrast-enhanced MR imaging, and FDG PET/CT.

PubMed

Ohno, Yoshiharu; Nishio, Mizuho; Koyama, Hisanobu; Seki, Shinichiro; Tsubakimoto, Maho; Fujisawa, Yasuko; Yoshikawa, Takeshi; Matsumoto, Sumiaki; Sugimura, Kazuro

2015-02-01

To prospectively compare the capabilities of dynamic perfusion area-detector computed tomography (CT), dynamic magnetic resonance (MR) imaging, and positron emission tomography (PET) combined with CT (PET/CT) with use of fluorine 18 fluorodeoxyglucose (FDG) for the diagnosis of solitary pulmonary nodules. The institutional review board approved this study, and written informed consent was obtained from each subject. A total of 198 consecutive patients with 218 nodules prospectively underwent dynamic perfusion area-detector CT, dynamic MR imaging, FDG PET/CT, and microbacterial and/or pathologic examinations. Nodules were classified into three groups: malignant nodules (n = 133) and benign nodules with low (n = 53) or high (n = 32) biologic activity. Total perfusion was determined with dual-input maximum slope models at area-detector CT, maximum and slope of enhancement ratio at MR imaging, and maximum standardized uptake value (SUVmax) at PET/CT. Next, all indexes for malignant and benign nodules were compared with the Tukey honest significant difference test. Then, receiver operating characteristic analysis was performed for each index. Finally, sensitivity, specificity, and accuracy were compared with the McNemar test. All indexes showed significant differences between malignant nodules and benign nodules with low biologic activity (P < .0001). The area under the receiver operating characteristic curve for total perfusion was significantly larger than that for other indexes (.0006 ≤ P ≤ .04). The specificity and accuracy of total perfusion were significantly higher than those of maximum relative enhancement ratio (specificity, P < .0001; accuracy, P < .0001), slope of enhancement ratio (specificity, P < .0001; accuracy, P < .0001), and SUVmax (specificity, P < .0001; accuracy, P < .0001). Dynamic perfusion area-detector CT is more specific and accurate than dynamic MR imaging and FDG PET/CT in the diagnosis of solitary pulmonary nodules in routine clinical practice. © RSNA, 2014.

The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

PubMed Central

Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.

2013-01-01

Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868

Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

PubMed

Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

2012-02-01

Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

Notch1 Signaling Sensitizes Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis in Human Hepatocellular Carcinoma Cells by Inhibiting Akt/Hdm2-mediated p53 Degradation and Up-regulating p53-dependent DR5 Expression*

PubMed Central

Wang, Chunmei; Qi, Runzi; Li, Nan; Wang, Zhengxin; An, Huazhang; Zhang, Qinghua; Yu, Yizhi; Cao, Xuetao

2009-01-01

Notch signaling plays a critical role in regulating cell proliferation, differentiation, and apoptosis. Our previous study showed that overexpression of Notch1 could inhibit human hepatocellular carcinoma (HCC) cell growth by arresting the cell cycle and inducing apoptosis. HCC cells are resistant to apoptotic induction by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), so new therapeutic approaches have been explored to sensitize HCC cells to TRAIL-induced apoptosis. We are wondering whether and how Notch1 signaling can enhance the sensitivity of HCC cells to TRAIL-induced apoptosis. In this study, we found that overexpression of ICN, the constitutive activated form of Notch1, up-regulated p53 protein expression in HCC cells by inhibiting proteasome degradation. p53 up-regulation was further observed in human primary hepatocellular carcinoma cells after activation of Notch signaling. Inhibition of the Akt/Hdm2 pathway by Notch1 signaling was responsible for the suppression of p53 proteasomal degradation, thus contributing to the Notch1 signaling-mediated up-regulation of p53 expression. Accordingly, Notch1 signaling could make HCC cells more sensitive to TRAIL-induced apoptosis, whereas Notch1 signaling lost the synergistic promotion of TRAIL-induced apoptosis in p53-silenced HepG2 HCC cells and p53-defective Hep3B HCC cells. The data suggest that enhancement of TRAIL-induced apoptosis by Notch1 signaling is dependent upon p53 up-regulation. Furthermore, Notch1 signaling could enhance DR5 expression in a p53-dependent manner. Taken together, Notch1 signaling sensitizes TRAIL-induced apoptosis in HCC cells by inhibiting Akt/Hdm2-mediated p53 degradation and up-regulating p53-dependent DR5 expression. Thus, our results suggest that activation of Notch1 signaling may be a promising approach to improve the therapeutic efficacy of TRAIL-resistant HCC. PMID:19376776

Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

PubMed

Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

2012-06-01

Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

Regulation of p53 Stability and Apoptosis by a ROR Agonist

PubMed Central

Wang, Yongjun; Solt, Laura A.; Kojetin, Douglas J.; Burris, Thomas P.

2012-01-01

Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer. PMID:22509368

Regulation of p53 stability and apoptosis by a ROR agonist.

PubMed

Wang, Yongjun; Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P

2012-01-01

Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.

WIP1 deficiency inhibits HTLV-1 Tax oncogenesis: novel therapeutic prospects for treatment of ATL?

PubMed Central

2012-01-01

Attenuation of p53 activity appears to be a major step in Human T-lymphotropic virus type 1 (HTLV-1) Tax transformation. However, p53 genomic mutations are late and rather infrequent events in HTLV-1 induced Adult T cell leukemia (ATL). The paper by Zane et al. shows that a mediator of p53 activity, Wild-type p53-induced phosphatase 1 (Wip1), contributes to Tax-induced oncogenesis in a mouse model. Wip1 may therefore be a novel target for therapeutic approaches. PMID:23256570

Dynamic imaging of adaptive stress response pathway activation for prediction of drug induced liver injury.

PubMed

Wink, Steven; Hiemstra, Steven W; Huppelschoten, Suzanne; Klip, Janna E; van de Water, Bob

2018-05-01

Drug-induced liver injury remains a concern during drug treatment and development. There is an urgent need for improved mechanistic understanding and prediction of DILI liabilities using in vitro approaches. We have established and characterized a panel of liver cell models containing mechanism-based fluorescent protein toxicity pathway reporters to quantitatively assess the dynamics of cellular stress response pathway activation at the single cell level using automated live cell imaging. We have systematically evaluated the application of four key adaptive stress pathway reporters for the prediction of DILI liability: SRXN1-GFP (oxidative stress), CHOP-GFP (ER stress/UPR response), p21 (p53-mediated DNA damage-related response) and ICAM1 (NF-κB-mediated inflammatory signaling). 118 FDA-labeled drugs in five human exposure relevant concentrations were evaluated for reporter activation using live cell confocal imaging. Quantitative data analysis revealed activation of single or multiple reporters by most drugs in a concentration and time dependent manner. Hierarchical clustering of time course dynamics and refined single cell analysis allowed the allusion of key events in DILI liability. Concentration response modeling was performed to calculate benchmark concentrations (BMCs). Extracted temporal dynamic parameters and BMCs were used to assess the predictive power of sub-lethal adaptive stress pathway activation. Although cellular adaptive responses were activated by non-DILI and severe-DILI compounds alike, dynamic behavior and lower BMCs of pathway activation were sufficiently distinct between these compound classes. The high-level detailed temporal- and concentration-dependent evaluation of the dynamics of adaptive stress pathway activation adds to the overall understanding and prediction of drug-induced liver liabilities.

Rpl27a mutation in the sooty foot ataxia mouse phenocopies high p53 mouse models

PubMed Central

Terzian, Tamara; Dumble, Melissa; Arbab, Farinaz; Thaller, Christina; Donehower, Lawrence A; Lozano, Guillermina; Justice, Monica J; Roop, Dennis R; Box, Neil F

2013-01-01

Ribosomal stress is an important, yet poorly understood, mechanism that results in activation of the p53 tumour suppressor. We present a mutation in the ribosomal protein Rpl27a gene (sooty foot ataxia mice), isolated through a sensitized N-ethyl-N-nitrosourea (ENU) mutagenesis screen for p53 pathway defects, that shares striking phenotypic similarities with high p53 mouse models, including cerebellar ataxia, pancytopenia and epidermal hyperpigmentation. This phenocopy is rescued in a haploinsufficient p53 background. A detailed examination of the bone marrow in these mice identified reduced numbers of haematopoietic stem cells and a p53-dependent c-Kit down-regulation. These studies suggest that reduced Rpl27a increases p53 activity in vivo, further evident with a delay in tumorigenesis in mutant mice. Taken together, these data demonstrate that Rpl27a plays a crucial role in multiple tissues and that disruption of this ribosomal protein affects both development and transformation. PMID:21674502

The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

PubMed

Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

2014-01-01

TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

WNT activation by lithium abrogates TP53 mutation associated radiation resistance in medulloblastoma.

PubMed

Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri

2014-12-24

TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.

Synthesis and evaluation of modified chalcone based p53 stabilizing agents.

PubMed

Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdel-Hamid; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib

2017-09-01

Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (CAL-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI 50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI 50 of 0.473±0.043µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-h post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Neuronal Ischemic Tolerance Is Conditioned by the Tp53 Arg72Pro Polymorphism.

PubMed

Ramos-Araque, Maria E; Rodriguez, Cristina; Vecino, Rebeca; Cortijo Garcia, Elisa; de Lera Alfonso, Mercedes; Sanchez Barba, Mercedes; Colàs-Campàs, Laura; Purroy, Francisco; Arenillas, Juan F; Almeida, Angeles; Delgado-Esteban, Maria

2018-04-23

Cerebral preconditioning (PC) confers endogenous brain protection after stroke. Ischemic stroke patients with a prior transient ischemic attack (TIA) may potentially be in a preconditioned state. Although PC has been associated with the activation of pro-survival signals, the mechanism by which preconditioning confers neuroprotection is not yet fully clarified. Recently, we have described that PC-mediated neuroprotection against ischemic insult is promoted by p53 destabilization, which is mediated by its main regulator MDM2. Moreover, we have previously described that the human Tp53 Arg72Pro single nucleotide polymorphism (SNP) controls susceptibility to ischemia-induced neuronal apoptosis and governs the functional outcome of patients after stroke. Here, we studied the contribution of the human Tp53 Arg72Pro SNP on PC-induced neuroprotection after ischemia. Our results showed that cortical neurons expressing the Pro72-p53 variant exhibited higher PC-mediated neuroprotection as compared with Arg72-p53 neurons. PC prevented ischemia-induced nuclear and cytosolic p53 stabilization in Pro72-p53 neurons. However, PC failed to prevent mitochondrial p53 stabilization, which occurs in Arg72-p53 neurons after ischemia. Furthermore, PC promoted neuroprotection against ischemia by controlling the p53/active caspase-3 pathway in Pro72-p53, but not in Arg72-p53 neurons. Finally, we found that good prognosis associated to TIA within 1 month prior to ischemic stroke was restricted to patients harboring the Pro72 allele. Our findings demonstrate that the Tp53 Arg72Pro SNP controls PC-promoted neuroprotection against a subsequent ischemic insult by modulating mitochondrial p53 stabilization and then modulates TIA-induced ischemic tolerance.

Combined CSL and p53 downregulation promotes cancer-associated fibroblast activation

PubMed Central

Procopio, Maria-Giuseppina; Laszlo, Csaba; Labban, Dania Al; Kim, Dong Eun; Bordignon, Pino; Jo, Seunghee; Goruppi, Sandro; Menietti, Elena; Ostano, Paola; Ala, Ugo; Provero, Paolo; Hoetzenecker, Wolfram; Neel, Victor; Kilarski, Witek; Swartz, Melody A.; Brisken, Cathrin; Lefort, Karine; Dotto, G. Paolo

2015-01-01

Stromal fibroblast senescence has been linked to aging-associated cancer risk. However, density and proliferation of cancer-associated fibroblasts (CAF) are frequently increased. Loss or down-modulation of the Notch effector CSL/RBP-Jκ in dermal fibroblasts is sufficient for CAF activation and ensuing keratinocyte-derived tumors. We report that CSL silencing induces senescence of primary fibroblasts from dermis, oral mucosa, breast and lung. CSL functions in these cells as direct repressor of multiple senescence- and CAF-effector genes. It also physically interacts with p53, repressing its activity. CSL is down-modulated in stromal fibroblasts of premalignant skin actinic keratosis lesions and squamous cell carcinomas (SCC), while p53 expression and function is down-modulated only in the latter, with paracrine FGF signaling as likely culprit. Concomitant loss of CSL and p53 overcomes fibroblast senescence, enhances expression of CAF effectors and promotes stromal and cancer cell expansion. The findings support a CAF activation/stromal co-evolution model under convergent CSL/p53 control. PMID:26302407

p53/PUMA expression in human pulmonary fibroblasts mediates cell activation and migration in silicosis.

PubMed

Wang, Wei; Liu, Haijun; Dai, Xiaoniu; Fang, Shencun; Wang, Xingang; Zhang, Yingming; Yao, Honghong; Zhang, Xilong; Chao, Jie

2015-11-18

Phagocytosis of SiO2 into the lung causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Clinical evidence has indicated that the activation of alveolar macrophages by SiO2 produces rapid and sustained inflammation characterized by the generation of monocyte chemotactic protein 1, which, in turn, induces fibrosis. However, the details of events downstream of monocyte chemotactic protein 1 activity in pulmonary fibroblasts remain unclear. Here, to elucidate the role of p53 in fibrosis induced by silica, both the upstream molecular mechanisms and the functional effects on cell proliferation and migration were investigated. Experiments using primary cultured adult human pulmonary fibroblasts led to the following results: 1) SiO2 treatment resulted in a rapid and sustained increase in p53 and PUMA protein levels; 2) the MAPK and PI3K pathways were involved in the SiO2-induced alteration of p53 and PUMA expression; and 3) RNA interference targeting p53 and PUMA prevented the SiO2-induced increases in fibroblast activation and migration. Our study elucidated a link between SiO2-induced p53/PUMA expression in fibroblasts and cell migration, thereby providing novel insight into the potential use of p53/PUMA in the development of novel therapeutic strategies for silicosis treatment.

Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.

PubMed

Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M

2009-10-01

The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.

Ensemble-based virtual screening reveals dual-inhibitors for the p53-MDM2/MDMX interactions.

PubMed

Barakat, Khaled; Mane, Jonathan; Friesen, Douglas; Tuszynski, Jack

2010-02-26

The p53 protein, a guardian of the genome, is inactivated by mutations or deletions in approximately half of human tumors. While in the rest of human tumors, p53 is expressed in wild-type form, yet it is inhibited by over-expression of its cellular regulators MDM2 and MDMX proteins. Although the p53-binding sites within the MDMX and MDM2 proteins are closely related, known MDM2 small-molecule inhibitors have been shown experimentally not to bind to its homolog, MDMX. As a result, the activity of these inhibitors including Nutlin3 is compromised in tumor cells over-expressing MDMX, preventing these compounds from fully activating the p53 protein. Here, we applied the relaxed complex scheme (RCS) to allow for the full receptor flexibility in screening for dual-inhibitors that can mutually antagonize the two p53-regulator proteins. First, we filtered the NCI diversity set, DrugBank compounds and a derivative library for MDM2-inhibitors against 28 dominant MDM2-conformations. Then, we screened the MDM2 top hits against the binding site of p53 within the MDMX target. Results described herein identify a set of compounds that have been computationally predicted to ultimately activate the p53 pathway in tumor cells retaining the wild-type protein. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

PubMed

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

2014-07-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

Regulation of MDM2 Activity by Nucleolin

DTIC Science & Technology

2007-06-01

protein also able to bind and inhibit ARF (Itahana et al., 2003; Bertwistle et al., 2004; Korgaonkar et al., 2005). A role for the nucleolus in the...found to sequester Mdm2 in the nucleolus (Weber et al., 1999), although this activity does not appear to be requisite for ARF-dependent p53 stabilization...from the nucleolus to the nucleoplasm in a reaction stimulated by physical interaction with p53, but independent of the ability of p53 to activate

Suppression of HPV E6 and E7 expression by BAF53 depletion in cervical cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Kiwon; Lee, Ah-Young; Kwon, Yunhee Kim

Highlights: {yields} Integration of HPV into host genome critical for activation of E6 and E7 oncogenes. {yields} BAF53 is essential for higher-order chromatin structure. {yields} BAF53 knockdown suppresses E6 and E7 from HPV integrants, but not from episomal HPVs. {yields} BAF53 knockdown decreases H3K9Ac and H4K12Ac on P105 promoter of integrated HPV 18. {yields} BAF53 knockdown restores the p53-dependent signaling pathway in HeLa and SiHa cells. -- Abstract: Deregulation of the expression of human papillomavirus (HPV) oncogenes E6 and E7 plays a pivotal role in cervical carcinogenesis because the E6 and E7 proteins neutralize p53 and Rb tumor suppressor pathways,more » respectively. In approximately 90% of all cervical carcinomas, HPVs are found to be integrated into the host genome. Following integration, the core-enhancer element and P105 promoter that control expression of E6 and E7 adopt a chromatin structure that is different from that of episomal HPV, and this has been proposed to contribute to activation of E6 and E7 expression. However, the molecular basis underlying this chromatin structural change remains unknown. Previously, BAF53 has been shown to be essential for the integrity of higher-order chromatin structure and interchromosomal interactions. Here, we examined whether BAF53 is required for activated expression of E6 and E7 genes. We found that BAF53 knockdown led to suppression of expression of E6 and E7 genes from HPV integrants in cervical carcinoma cell lines HeLa and SiHa. Conversely, expression of transiently transfected HPV18-LCR-Luciferase was not suppressed by BAF53 knockdown. The level of the active histone marks H3K9Ac and H4K12Ac on the P105 promoter of integrated HPV 18 was decreased in BAF53 knockdown cells. BAF53 knockdown restored the p53-dependent signaling pathway in HeLa and SiHa cells. These results suggest that activated expression of the E6 and E7 genes of integrated HPV is dependent on BAF53-dependent higher-order chromatin structure or nuclear motor activity.« less

Phosphorylation and ubiquitination-dependent degradation of CABIN1 releases p53 for transactivation upon genotoxic stress.

PubMed

Choi, Soo-Youn; Jang, Hyonchol; Roe, Jae-Seok; Kim, Seong-Tae; Cho, Eun-Jung; Youn, Hong-Duk

2013-02-01

CABIN1 acts as a negative regulator of p53 by keeping p53 in an inactive state on chromatin. Genotoxic stress causes rapid dissociation of CABIN1 and activation of p53. However, its molecular mechanism is still unknown. Here, we reveal the phosphorylation- and ubiquitination-dependent degradation of CABIN1 upon DNA damage, releasing p53 for transcriptional activation. The DNA-damage-signaling kinases, ATM and CHK2, phosphorylate CABIN1 and increase the degradation of CABIN1 protein. Knockdown or overexpression of these kinases influences the stability of CABIN1 protein showing that their activity is critical for degradation of CABIN1. Additionally, CABIN1 was found to undergo ubiquitin-dependent proteasomal degradation mediated by the CRL4DDB2 ubiquitin ligase complex. Both phosphorylation and ubiquitination of CABIN1 appear to be relevant for controlling the level of CABIN1 protein upon genotoxic stress.

Suppression of Familial Adenomatous Polyposis by CP-31398, a TP53 modulator, in APCmin/+ Mice1

PubMed Central

Rao, Chinthalapally V.; Swamy, Malisetty V.; Patlolla, Jagan M.R.; Kopelovich, Levy

2008-01-01

p53 mutations occur in a large number of human malignancies. Mutant p53 is unable to affect downstream genes necessary for DNA repair, cell cycle regulation, and apoptosis. The styrylquinazoline CP-31398 can rescue destabilized mutant p53 expression and promote activity of wild-type p53. The present study examines chemopreventive effects of CP-31398 on intestinal adenoma development in an animal model of familial adenomatous polyposis (FAP). Effects were examined at both early and late stages of adenoma formation. Effects of CP-31398 on early-stage adenomas were determined by feeding 7-week-old female C57B/6J-APCmin (heterozygous) and wild-type C57BL/6J mice with American Institute of Nutrition (AIN)-76A diets containing 0, 100, or 200 ppm CP-31398 for 75 days. To examine activity toward late-stage adenomas, CP31398 administration was delayed until 15 weeks of age and continued for 50 days. During early-stage intervention, dietary CP-31398 suppressed development of intestinal tumors by 36% (p < 0.001) and 75% (p < 0.0001), at low and high dose, respectively. During late-stage intervention, CP-31398 also significantly suppressed intestinal polyp formation, albeit to a lesser extent than observed with early intervention. Adenomas in treated mice showed increased apoptotic cell death and decreased proliferation in conjunction with increased expression of p53, p21WAF1/CIP, cleaved caspase-3, and cleaved poly (ADP-ribose) polymerase (PARP). These observations demonstrate for the first time that the p53-modulating agent CP-31398 possesses significant chemopreventive activity in vivo against intestinal neoplastic lesions in genetically-predisposed APCmin/+ mice. Chemopreventive activity of other agents that restore tumor suppressor functions of mutant p53 in tumor cells is currently under investigation. PMID:18794156

Nutlin-3 induces HO-1 expression by activating JNK in a transcription-independent manner of p53.

PubMed

Choe, Yun-Jeong; Lee, Sun-Young; Ko, Kyung Won; Shin, Seok Joon; Kim, Ho-Shik

2014-03-01

A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1 in a transcription-independent manner of p53. Nutlin-3 induced HO-1 expression at the level of transcription in human cancer cells such as U2OS and RKO cells. This induction of HO-1 did not occur in SAOS cells in which p53 was mutated and was prevented by knocking down the p53 protein using p53 siRNA transfection, but not by PFT-α, an inhibitor of the transcriptional activity of p53. Accompanying HO-1 expression, nutlin-3 stimulated the accumulation of ROS and the phosphorylation of MAPKs such as JNK, p38 MAPK and ERK1/2. Nutlin-3-induced HO-1 expression was suppressed by TEMPO, a ROS scavenger, and chemical inhibitors of JNK and p38 MAPK but not ERK1/2. In addition, nutlin‑3-induced phosphorylation of JNK but not p38 MAPK was inhibited by TEMPO. Notably, the levels of nutlin-3-induced ROS were correlated with the mitochondrial translocation of p53 and this induction was prevented by PFT-μ, an inhibitor of the mitochondrial translocation of p53. Consistent with the effect of the ROS scavenger and MAPK inhibitors, PFT-μ reduced HO-1 expression and the phosphorylation of JNK induced by nutlin-3. In the experiments of analyzing cell death, the knockdown of HO-1 augmented nutlin-3-induced apoptosis. Collectively, these results suggest that nutlin-3 induces HO-1 expression via the activation of both JNK which is dependent on ROS generated by p53 translocated to the mitochondria and p38 MAPK which appears to be stimulated by a ROS-independent mechanism, and this HO-1 induction may inhibit nutlin-3-induced apoptosis, constituting a negative feedback loop of p53-induced apoptosis.

Pre-clinical efficacy and synergistic potential of the MDM2-p53 antagonists, Nutlin-3 and RG7388, as single agents and in combined treatment with cisplatin in ovarian cancer

PubMed Central

Zanjirband, Maryam; Edmondson, Richard J.; Lunec, John

2016-01-01

Ovarian cancer is the fifth leading cause of cancer-related female deaths. Due to serious side effects, relapse and resistance to standard chemotherapy, better and more targeted approaches are required. Mutation of the TP53 gene accounts for 50% of all human cancers. In the remaining malignancies, non-genotoxic activation of wild-type p53 by small molecule inhibition of the MDM2-p53 binding interaction is a promising therapeutic strategy. Proof of concept was established with the cis-imidazoline Nutlin-3, leading to the development of RG7388 and other compounds currently in early phase clinical trials. This preclinical study evaluated the effect of Nutlin-3 and RG7388 as single agents and in combination with cisplatin in a panel of ovarian cancer cell lines. Median-drug-effect analysis showed Nutlin-3 or RG7388 combination with cisplatin was additive to, or synergistic in a p53-dependent manner, resulting in increased p53 activation, cell cycle arrest and apoptosis, associated with increased p21WAF1 protein and/or caspase-3/7 activity compared to cisplatin alone. Although MDM2 inhibition activated the expression of p53-dependent DNA repair genes, the growth inhibitory and pro-apoptotic effects of p53 dominated the response. These data indicate that combination treatment with MDM2 inhibitors and cisplatin has synergistic potential for the treatment of ovarian cancer, dependent on cell genotype. PMID:27223080

DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

PubMed

Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

2016-07-26

DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

PubMed

Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

2017-12-15

TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

PubMed

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

PubMed

Llanos, Susana; Serrano, Manuel

2010-10-01

Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

MG53 participates in ischaemic postconditioning through the RISK signalling pathway

PubMed Central

Zhang, Yan; Lv, Fengxiang; Jin, Li; Peng, Wei; Song, Ruisheng; Ma, Jianjie; Cao, Chun-Mei; Xiao, Rui-Ping

2011-01-01

Aims Recent studies show that ischaemic postconditioning (PostC), similar to the well-established ischaemic preconditioning (IPC), confers cardioprotection against ischaemia/reperfusion (IR) injury, and both IPC and PostC can activate the reperfusion injury salvage kinase (RISK) pathway and the survivor activating factor enhancement (SAFE) pathway. PostC is clinically more attractive because of its therapeutic application at the predictable onset of reperfusion. Our previous studies have demonstrated that MG53 is a primary component of the IPC machinery. Here, we investigated the potential role of MG53 in PostC-mediated myocardial protection and explored the underlying mechanism. Methods and results Using Langendorff perfusion, we investigated IR injury in wild-type (wt) and MG53-deficient (mg53−/−) mouse hearts with or without PostC. IR-induced myocardial damage was markedly exacerbated in mg53−/− hearts compared with wt controls. PostC protected wt hearts against IR-induced myocardial infarction, myocyte necrosis, and apoptosis, but failed to protect mg53−/− hearts. The loss of PostC protection in mg53−/− hearts was attributed to selectively impaired PostC-activated RISK signalling. Mechanistically, MG53 is required for the interaction between caveolin 3 (CaV3) and the p85 subunit of phosphoinositide 3-kinase (p85-PI3K) and PostC-mediated activation of the RISK pathway. Importantly, a structure–function study revealed that the MG53 tripartite motif (TRIM) domain (aa1–284) physically interacted with CaV3 but not p85-PI3K, whereas the MG53 SPRY domain (aa285–477) interacted with p85-PI3K but not CaV3, indicating that MG53 binds to CaV3 and p85 at its N- and C-terminus, respectively. Conclusions We conclude that MG53 participates in PostC-mediated cardioprotection largely through tethering CaV3 and PI3K and subsequent activation of the RISK pathway. PMID:21285295

C/EBPbeta represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19(Arf).

PubMed

Ewing, S J; Zhu, S; Zhu, F; House, J S; Smart, R C

2008-11-01

CCAAT/enhancer-binding protein-beta (C/EBPbeta) is a mediator of cell survival and tumorigenesis. When C/EBPbeta(-/-) mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19(Arf) and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19(Arf) is dramatically elevated in C/EBPbeta(-/-) epidermis and that C/EBPbeta represses a p19(Arf) promoter reporter. To determine whether p19(Arf) is responsible for the proapoptotic phenotype in C/EBPbeta(-/-) mice, C/EBPbeta(-/-);p19(Arf-/-) mice were generated. C/EBPbeta(-/-);p19(Arf-/-) mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19(Arf) is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPbeta(-/-) epidermis, we generated K14-ER:Ras;C/EBPbeta(-/-) mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPbeta(-/-) mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPbeta represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPbeta may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents.

C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

PubMed Central

Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC

2013-01-01

CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

PubMed

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

p53 Reactivation by PRIMA-1(Met) (APR-246) sensitises (V600E/K)BRAF melanoma to vemurafenib.

PubMed

Krayem, Mohammad; Journe, Fabrice; Wiedig, Murielle; Morandini, Renato; Najem, Ahmad; Salès, François; van Kempen, Leon C; Sibille, Catherine; Awada, Ahmad; Marine, Jean-Christophe; Ghanem, Ghanem

2016-03-01

Intrinsic and acquired resistance of metastatic melanoma to (V600E/K)BRAF and/or MEK inhibitors, which is often caused by activation of the PI3K/AKT survival pathway, represents a major clinical challenge. Given that p53 is capable of antagonising PI3K/AKT activation we hypothesised that pharmacological restoration of p53 activity may increase the sensitivity of BRAF-mutant melanoma to MAPK-targeted therapy and eventually delay and/or prevent acquisition of drug resistance. To test this possibility we exposed a panel of vemurafenib-sensitive and resistant (innate and acquired) (V600E/K)BRAF melanomas to a (V600E/K)BRAF inhibitor (vemurafenib) alone or in combination with a direct p53 activator (PRIMA-1(Met)/APR-246). Strikingly, PRIMA-1(Met) synergised with vemurafenib to induce apoptosis and suppress proliferation of (V600E/K)BRAF melanoma cells in vitro and to inhibit tumour growth in vivo. Importantly, this drug combination decreased the viability of both vemurafenib-sensitive and resistant melanoma cells irrespectively of the TP53 status. Notably, p53 reactivation was invariably accompanied by PI3K/AKT pathway inhibition, the activity of which was found as a dominant resistance mechanism to BRAF inhibition in our lines. From all various combinatorial modalities tested, targeting the MAPK and PI3K signalling pathways through p53 reactivation or not, the PRIMA-1(Met)/vemurafenib combination was the most cytotoxic. We conclude that PRIMA-1(Met) through its ability to directly reactivate p53 regardless of the mechanism causing its deactivation, and thereby dampen PI3K signalling, sensitises (V600E/K)BRAF-positive melanoma to BRAF inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

Around and beyond 53BP1 Nuclear Bodies.

PubMed

Fernandez-Vidal, Anne; Vignard, Julien; Mirey, Gladys

2017-12-05

Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.

p53, a New Master Regulator of Stem Cell Differentiation | Center for Cancer Research

Cancer.gov

When the genome is damaged, a key player in stabilizing and maintaining genomic integrity is a protein called p53.  This protein can activate or shut down gene activity in response to DNA damage.  But how exactly does p53 accomplish its task? This question has yet to be answered completely at the molecular level.   

The role of p53 in cancer drug resistance and targeted chemotherapy.

PubMed

Hientz, Karin; Mohr, André; Bhakta-Guha, Dipita; Efferth, Thomas

2017-01-31

Cancer has long been a grievous disease complicated by innumerable players aggravating its cure. Many clinical studies demonstrated the prognostic relevance of the tumor suppressor protein p53 for many human tumor types. Overexpression of mutated p53 with reduced or abolished function is often connected to resistance to standard medications, including cisplatin, alkylating agents (temozolomide), anthracyclines, (doxorubicin), antimetabolites (gemcitabine), antiestrogenes (tamoxifen) and EGFR-inhibitors (cetuximab). Such mutations in the TP53 gene are often accompanied by changes in the conformation of the p53 protein. Small molecules that restore the wild-type conformation of p53 and, consequently, rebuild its proper function have been identified. These promising agents include PRIMA-1, MIRA-1, and several derivatives of the thiosemicarbazone family. In addition to mutations in p53 itself, p53 activity may be also be impaired due to alterations in p53's regulating proteins such as MDM2. MDM2 functions as primary cellular p53 inhibitor and deregulation of the MDM2/p53-balance has serious consequences. MDM2 alterations often result in its overexpression and therefore promote inhibition of p53 activity. To deal with this problem, a judicious approach is to employ MDM2 inhibitors. Several promising MDM2 inhibitors have been described such as nutlins, benzodiazepinediones or spiro-oxindoles as well as novel compound classes such as xanthone derivatives and trisubstituted aminothiophenes. Furthermore, even naturally derived inhibitor compounds such as α-mangostin, gambogic acid and siladenoserinols have been discovered. In this review, we discuss in detail such small molecules that play a pertinent role in affecting the p53-MDM2 signaling axis and analyze their potential as cancer chemotherapeutics.

1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

PubMed Central

Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

2016-01-01

Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

PubMed

Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

2008-07-01

We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

COH-203, a novel microtubule inhibitor, exhibits potent anti-tumor activity via p53-dependent senescence in hepatocellular carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, Huan; Zuo, Dai-Ying; Bai, Zhao-Shi

Highlights: • COH-203 exhibits anti-hepatoma effects in vitro and in vivo with low toxicity. • COH-203 inhibits tubulin polymerization. • COH-203 induces mitotic arrest followed by mitotic slippage in BEL-7402 cells. • COH-203 induces p53-dependent senescence in BEL-7402 cells. - Abstract: 5-(3-Hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-3H-1, 2-dithiol-3-one (COH-203) is a novel synthesized analogue of combretastatin A-4 that can be classified as a microtubule inhibitor. In this study, we evaluated the anti-hepatoma effect of COH-203 in vitro and in vivo and explored the underlying molecular mechanisms. COH-203 was shown to be more effective in inhibiting the proliferation of liver cancer cells compared with normal livermore » cells. COH-203 also displayed potent anti-tumor activity in a hepatocellular carcinoma xenograft model without significant toxicity. Mechanistic studies demonstrated that treatment with COH-203 induced mitotic arrest by inhibiting tubulin polymerization in BEL-7402 liver cancer cells. Long-term COH-203 treatment in BEL-7402 cells led to mitotic slippage followed by senescence via the p14{sup Arf}–p53–p21 and p16{sup INK4α}–Rb pathways. Furthermore, suppression of p53 via pifithrin-α (p53 inhibitor) and p53-siRNA attenuated COH-203-induced senescence in BEL-7402 cells, suggesting that COH-203 induced senescence p53-dependently. In conclusion, we report for the first time that COH-203, one compound in the combretastatin family, promotes anti-proliferative activity through the induction of p-53 dependent senescence. Our findings will provide a molecular rationale for the development of COH-203 as a promising anti-tumor agent.« less

mTOR inhibitors blunt the p53 response to nucleolar stress by regulating RPL11 and MDM2 levels

PubMed Central

Goudarzi, Kaveh M; Nistér, Monica; Lindström, Mikael S

2014-01-01

Mechanistic target of rapamycin (mTOR) is a master regulator of cell growth through its ability to stimulate ribosome biogenesis and mRNA translation. In contrast, the p53 tumor suppressor negatively controls cell growth and is activated by a wide range of insults to the cell. The mTOR and p53 signaling pathways are connected by a number of different mechanisms. Chemotherapeutics that inhibit ribosome biogenesis often induce nucleolar stress and activation of p53. Here we have investigated how the p53 response to nucleolar stress is affected by simultaneous mTOR inhibition in osteosarcoma and glioma cell lines. We found that inhibitors of the mTOR pathway including rapamycin, wortmannin, and caffeine blunted the p53 response to nucleolar stress induced by actinomycin D. Synthetic inhibitors of mTOR (temsirolimus, LY294.002 and PP242) also impaired actinomycin D triggered p53 stabilization and induction of p21. Ribosomal protein (RPL11) is known to be required for p53 protein stabilization following nucleolar stress. Treatment of cells with mTOR inhibitors may lead to reduced synthesis of RPL11 and thereby destabilize p53. We found that rapamycin mimicked the effect of RPL11 depletion in terms of blunting the p53 response to nucleolar stress. However, the extent to which the levels of p53 and RPL11 were reduced by rapamycin varied between cell lines. Additional mechanisms whereby rapamycin blunts the p53 response to nucleolar stress are likely to be involved. Indeed, rapamycin increased the levels of endogenous MDM2 despite inhibition of its phosphorylation at Ser-166. Our findings may have implications for the design of combinatorial cancer treatments with mTOR pathway inhibitors. PMID:25482947

Friend or Foe: MicroRNAs in the p53 network.

PubMed

Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

2018-04-10

The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

p53 suppresses type II endometrial carcinomas in mice and governs endometrial tumour aggressiveness in humans

PubMed Central

Wild, Peter J; Ikenberg, Kristian; Fuchs, Thomas J; Rechsteiner, Markus; Georgiev, Strahil; Fankhauser, Niklaus; Noske, Aurelia; Roessle, Matthias; Caduff, Rosmarie; Dellas, Athanassios; Fink, Daniel; Moch, Holger; Krek, Wilhelm; Frew, Ian J

2012-01-01

Type II endometrial carcinomas are a highly aggressive group of tumour subtypes that are frequently associated with inactivation of the TP53 tumour suppressor gene. We show that mice with endometrium-specific deletion of Trp53 initially exhibited histological changes that are identical to known precursor lesions of type II endometrial carcinomas in humans and later developed carcinomas representing all type II subtypes. The mTORC1 signalling pathway was frequently activated in these precursor lesions and tumours, suggesting a genetic cooperation between this pathway and Trp53 deficiency in tumour initiation. Consistent with this idea, analyses of 521 human endometrial carcinomas identified frequent mTORC1 pathway activation in type I as well as type II endometrial carcinoma subtypes. mTORC1 pathway activation and p53 expression or mutation status each independently predicted poor patient survival. We suggest that molecular alterations in p53 and the mTORC1 pathway play different roles in the initiation of the different endometrial cancer subtypes, but that combined p53 inactivation and mTORC1 pathway activation are unifying pathogenic features among histologically diverse subtypes of late stage aggressive endometrial tumours. PMID:22678923

Delayed cell cycle progression in selenoprotein W depleted cells is regulated by a mitogen-activated protein kinase kinase 4–p38–p53 pathway

USDA-ARS?s Scientific Manuscript database

Selenoprotein W (SEPW1) is a ubiquitous, highly conserved thioredoxin-like protein whose depletion causes a p53- and p21Cip1-dependent G1-phase cell cycle arrest in breast and prostate epithelial cells. SEPW1 depletion increases phosphorylation of Ser33 in p53, which is associated with decreased p53...

Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

PubMed

Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

1998-01-01

Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

The p53-Reactivating Small Molecule RITA Induces Senescence in Head and Neck Cancer Cells

PubMed Central

Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L.; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N.; Skinner, Heath D.

2014-01-01

TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC. PMID:25119136

The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

PubMed

Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

2013-10-17

Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

PubMed

Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

2016-01-01

Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

Novel Derivative of Benzofuran Induces Cell Death Mostly by G2/M Cell Cycle Arrest through p53-dependent Pathway but Partially by Inhibition of NF-κB*

PubMed Central

Manna, Sunil K.; Bose, Julie S.; Gangan, Vijay; Raviprakash, Nune; Navaneetha, Thota; Raghavendra, Pongali B.; Babajan, Banaganapalli; Kumar, Chitta S.; Jain, Swatantra K.

2010-01-01

The Dracaena resin is widely used in traditional medicine as an anticancer agent, and benzofuran lignan is the active component. In this report, we provide evidence that the synthetic derivative of benzofuran lignan (Benfur) showed antitumor activities. It induced apoptosis in p53-positive cells. Though it inhibited endotoxin-induced nuclear factor κB (NF-κB) activation in both p53-positive and -negative cells, the activation of caspase 3 was observed in p53-positive cells. It showed partial cell death effect in both p53-positive and -negative cells through inhibition of NF-κB. Cell cycle analysis using flow cytometry showed that treatment with this novel benozofuran lignan derivative to Jurkat T-cells, but not U-937 cells, resulted in a G2/M arrest in a dose- and time-dependent manner. It increased amounts of p21, p27, and cyclin B, but not phospho-Rb through p53 nuclear translocation in Jurkat T-cells, but not in U-937 cells. It inhibited amounts of MDM2 (murine double minute 2) by repressing the transcription factor Sp1, which was also proved in silico. It induced cell death in tumor cells, but not in primary T-cells. Overall, our data suggest that Benfur-mediated cell death is partially dependent upon NF-κB, but predominantly dependent on p53. Thus, this novel benzofuran lignan derivative can be effective chemopreventive or chemotherapeutic agent against malignant T-cells. PMID:20472557

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

PubMed

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

PubMed Central

2014-01-01

Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies. PMID:24927749

Dynamized Preparations in Cell Culture

PubMed Central

Sunila, Ellanzhiyil Surendran; Preethi, Korengath Chandran; Kuttan, Girija

2009-01-01

Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929) and Chinese Hamster Ovary (CHO) cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The effect of dynamized medicines to induce apoptosis was also evaluated and we studied how dynamized medicines affected genes expressed during apoptosis. Mother tinctures as well as some dynamized medicines showed significant cytotoxicity to cells during short and long-term incubation. Potentiated alcohol control did not produce any cytotoxicity at concentrations studied. The dynamized medicines were found to inhibit CHO cell colony formation and thymidine uptake in L929 cells and those of Thuja, Hydrastis and Carcinosinum were found to induce apoptosis in DLA cells. Moreover, dynamized Carcinosinum was found to induce the expression of p53 while dynamized Thuja produced characteristic laddering pattern in agarose gel electrophoresis of DNA. These results indicate that dynamized medicines possess cytotoxic as well as apoptosis-inducing properties. PMID:18955237

Modeling the Etiology of p53-mutated Cancer Cells*

PubMed Central

Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

2016-01-01

p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

Lithocholic acid is an endogenous inhibitor of MDM4 and MDM2

PubMed Central

Vogel, Simon M.; Bauer, Matthias R.; Joerger, Andreas C.; Wilcken, Rainer; Brandt, Tobias; Veprintsev, Dmitry B.; Rutherford, Trevor J.; Fersht, Alan R.; Boeckler, Frank M.

2012-01-01

The proteins MDM2 and MDM4 are key negative regulators of the tumor suppressor protein p53, which are frequently upregulated in cancer cells. They inhibit the transactivation activity of p53 by binding separately or in concert to its transactivation domain. MDM2 is also a ubiquitin ligase that leads to the degradation of p53. Accordingly, MDM2 and MDM4 are important targets for drugs to inhibit their binding to p53. We found from in silico screening and confirmed by experiment that lithocholic acid (LCA) binds to the p53 binding sites of both MDM2 and MDM4 with a fivefold preference for MDM4. LCA is an endogenous steroidal bile acid, variously reported to have both carcinogenic and apoptotic activities. The comparison of LCA effects on apoptosis in HCT116 p53+/+ vs. p53-/- cells shows a predominantly p53-mediated induction of caspase-3/7. The dissociation constants are in the μM region, but only modest inhibition of binding of MDM2 and MDM4 is required to negate their upregulation because they have to compete with transcriptional coactivator p300 for binding to p53. Binding was weakened by structural changes in LCA, and so it may be a natural ligand of MDM2 and MDM4, raising the possibility that MDM proteins may be sensors for specific steroids. PMID:23035244

Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

PubMed

Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

2014-12-01

Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

Dual targeting of wild-type and mutant p53 by small molecule RITA results in the inhibition of N-Myc and key survival oncogenes and kills neuroblastoma cells in vivo and in vitro.

PubMed

Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina

2013-09-15

Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

SIRT1 activation mediates heat-induced survival of UVB damaged Keratinocytes.

PubMed

Calapre, Leslie; Gray, Elin S; Kurdykowski, Sandrine; David, Anthony; Descargues, Pascal; Ziman, Mel

2017-06-10

Exposure to heat stress after UVB irradiation induces a reduction of apoptosis, resulting in survival of DNA damaged human keratinocytes. This heat-mediated evasion of apoptosis appears to be mediated by activation of SIRT1 and inactivation of p53 signalling. In this study, we assessed the role of SIRT1 in the inactivation of p53 signalling and impairment of DNA damage response in UVB plus heat exposed keratinocytes. Activation of SIRT1 after multiple UVB plus heat exposures resulted in increased p53 deacetylation at K382, which is known to affect its binding to specific target genes. Accordingly, we noted decreased apoptosis and down regulation of the p53 targeted pro-apoptotic gene BAX and the DNA repair genes ERCC1 and XPC after UVB plus heat treatments. In addition, UVB plus heat induced increased expression of the cell survival gene Survivin and the proliferation marker Ki67. Notably, keratinocytes exposed to UVB plus heat in the presence of the SIRT1 inhibitor, Ex-527, showed a similar phenotype to those exposed to UV alone; i.e. an increase in p53 acetylation, increased apoptosis and low levels of Survivin. This study demonstrate that heat-induced SIRT1 activation mediates survival of DNA damaged keratinocytes through deacetylation of p53 after exposure to UVB plus heat.

Mutant p53 protein localized in the cytoplasm inhibits autophagy.

PubMed

Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

2008-10-01

The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

MDM2 controls NRF2 antioxidant activity in prevention of diabetic kidney disease.

PubMed

Guo, Weiying; Tian, Dan; Jia, Ye; Huang, Wenlin; Jiang, Mengnan; Wang, Junnan; Sun, Weixia; Wu, Hao

2018-04-26

Oxidative stress and P53 contribute to the pathogenesis of diabetic kidney disease (DKD). Nuclear factor erythroid 2-related factor 2 (NRF2) is a master regulator of cellular antioxidant defense system, is negatively regulated by P53 and prevents DKD. Recent findings revealed an important role of mouse double minute 2 (MDM2) in protection against DKD. However, the mechanism remained unclear. We hypothesized that MDM2 enhances NRF2 antioxidant signaling in DKD given that MDM2 is a key negative regulator of P53. The MDM2 inhibitor nutlin3a elevated renal P53, inhibited NRF2 signaling and induced oxidative stress, inflammation, fibrosis, DKD-like renal pathology and albuminuria in the wild-type (WT) non-diabetic mice. These effects exhibited more prominently in nutlin3a-treated WT diabetic mice. Interestingly, nutlin3a failed to induce greater renal injuries in the Nrf2 knockout (KO) mice under both the diabetic and non-diabetic conditions, indicating that NRF2 predominantly mediates MDM2's action. On the contrary, P53 inhibition by pifithrin-α activated renal NRF2 signaling and the expression of Mdm2, and attenuated DKD in the WT diabetic mice, but not in the Nrf2 KO diabetic mice. In high glucose-treated mouse mesangial cells, P53 gene silencing completely abolished nutlin3a's inhibitory effect on NRF2 signaling. The present study demonstrates for the first time that MDM2 controls renal NRF2 antioxidant activity in DKD via inhibition of P53, providing MDM2 activation and P53 inhibition as novel strategies in the management of DKD. Copyright © 2018 Elsevier B.V. All rights reserved.

Expression screening using a Medaka cDNA library identifies evolutionarily conserved regulators of the p53/Mdm2 pathway.

PubMed

Zhang, Ping; Kratz, Anne Sophie; Salama, Mohammed; Elabd, Seham; Heinrich, Thorsten; Wittbrodt, Joachim; Blattner, Christine; Davidson, Gary

2015-10-08

The p53 tumor suppressor protein is mainly regulated by alterations in the half-life of the protein, resulting in significant differences in p53 protein levels in cells. The major regulator of this process is Mdm2, which ubiquitinates p53 and targets it for proteasomal degradation. This process can be enhanced or reduced by proteins that associate with p53 or Mdm2 and several proteins have been identified with such an activity. Furthermore, additional ubiquitin ligases for p53 have been identified in recent years. Nevertheless, our understanding of how p53 abundance and Mdm2 activity are regulated remains incomplete. Here we describe a cell culture based overexpression screen to identify evolutionarily conserved regulators of the p53/Mdm2 circuit. The results from this large-scale screening method will contribute to a better understanding of the regulation of these important proteins. Expression screening was based on co-transfection of H1299 cells with pools of cDNA's from a Medaka library together with p53, Mdm2 and, as internal control, Ror2. After cell lysis, SDS-PAGE/WB analysis was used to detect alterations in these proteins. More than one hundred hits that altered the abundance of either p53, Mdm2, or both were identified in the primary screen. Subscreening of the library pools that were identified in the primary screen identified several potential novel regulators of p53 and/or Mdm2. We also tested whether the human orthologues of the Medaka genes regulate p53 and/or Mdm2 abundance. All human orthologues regulated p53 and/or Mdm2 abundance in the same manner as the proteins from Medaka, which underscores the suitability of this screening methodology for the identification of new modifiers of p53 and Mdm2. Despite enormous efforts in the last two decades, many unknown regulators for p53 and Mdm2 abundance are predicted to exist. This cross-species approach to identify evolutionarily conserved regulators demonstrates that our Medaka unigene cDNA library represents a powerful tool to screen for these novel regulators of the p53/Mdm2 pathway.

Interaction between the Cockayne syndrome B and p53 proteins: implications for aging.

PubMed

Frontini, Mattia; Proietti-De-Santis, Luca

2012-02-01

The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53’s levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis.

p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

PubMed Central

Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

2011-01-01

Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation

PubMed Central

Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.

2011-01-01

p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464

E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution.

PubMed

Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

2015-10-01

Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53(-/-) mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy.

E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution

PubMed Central

Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

2015-01-01

Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53−/− mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy. PMID:25656653

Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

PubMed

Pagano, Bruno; Jama, Abdullah; Martinez, Pierre; Akanho, Ester; Bui, Tam T T; Drake, Alex F; Fraternali, Franca; Nikolova, Penka V

2013-01-01

The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs) of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

PubMed Central

Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

2014-01-01

The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

Reversion of apoptotic resistance of TP53-mutated Burkitt lymphoma B-cells to spindle poisons by exogenous activation of JNK and p38 MAP kinases.

PubMed

Farhat, M; Poissonnier, A; Hamze, A; Ouk-Martin, C; Brion, J-D; Alami, M; Feuillard, J; Jayat-Vignoles, C

2014-05-01

Defects in apoptosis are frequently the cause of cancer emergence, as well as cellular resistance to chemotherapy. These phenotypes may be due to mutations of the tumor suppressor TP53 gene. In this study, we examined the effect of various mitotic spindle poisons, including the new isocombretastatin derivative isoNH2CA-4 (a tubulin-destabilizing molecule, considered to bind to the colchicine site by analogy with combretastatin A-4), on BL (Burkitt lymphoma) cells. We found that resistance to spindle poison-induced apoptosis could be reverted in tumor protein p53 (TP53)-mutated cells by EBV (Epstein Barr virus) infection. This reversion was due to restoration of the intrinsic apoptotic pathway, as assessed by relocation of the pro-apoptotic molecule Bax to mitochondria, loss of mitochondrial integrity and activation of the caspase cascade with PARP (poly ADP ribose polymerase) cleavage. EBV sensitized TP53-mutated BL cells to all spindle poisons tested, including vincristine and taxol, an effect that was systematically downmodulated by pretreatment of cells with inhibitors of p38 and c-Jun N-terminal kinase (JNK) mitogen-activated protein kinases. Exogenous activation of p38 and JNK pathways by dihydrosphingosine reverted resistance of TP53-mutated BL cells to spindle poisons. Dihydrosphingosine treatment of TP53-deficient Jurkat and K562 cell lines was also able to induce cell death. We conclude that activation of p38 and JNK pathways may revert resistance of TP53-mutated cells to spindle poisons. This opens new perspectives for developing alternative therapeutic strategies when the TP53 gene is inactivated.

Expressions of p53 and p21 in primary gastric lymphomas.

PubMed Central

Go, J. H.; Yang, W. I.

2001-01-01

The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression.

PubMed

Cathcart, Jillian M; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

2016-09-20

Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype.

The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR

PubMed Central

Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

2010-01-01

Summary The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca2+-independent-phospholipase A2 (iPLA2). We previously reported that inhibition of iPLA2 arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA2 induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA2. The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA2-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway. PMID:18032786

The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR.

PubMed

Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

2007-12-01

The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca(2+)-independent-phospholipase A(2) (iPLA(2)). We previously reported that inhibition of iPLA(2) arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA(2) induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA(2). The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA(2)-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway.

p53 mediates bcl-2 phosphorylation and apoptosis via activation of the Cdc42/JNK1 pathway.

PubMed

Thomas, A; Giesler, T; White, E

2000-11-02

A member of the small G protein family, cdc42, was isolated from a screen undertaken to identify p53-inducible genes during apoptosis in primary baby rat kidney (BRK) cells transformed with E1A and a temperature-sensitive mutant p53 using a PCR-based subtractive hybridization method. Cdc42 is a GTPase that belongs to the Rho/Rac subfamily of Ras-like GTPases. In response to external stimuli, Cdc42 is known to transduce signals to regulate the organization of the actin cytoskeleton, induce DNA synthesis in quiescent fibroblasts, and promote apoptosis in neuronal and immune cells. In this study, we have demonstrated that cdc42 mRNA and protein were up-regulated in the presence of wild-type p53 in BRK cells, followed by cytoplasmic to plasma membrane translocation of Cdc42. Overexpression of Cdc42 in the presence of a dominant-negative mutant p53 induced apoptosis rapidly, indicating that Cdc42 functions downstream of p53. Furthermore, stable expression of a dominant-negative mutant of Cdc42 partially inhibited p53-mediated apoptosis. The Bcl-2 family members Bcl-xL, and the adenovirus protein E1B 19K, inhibited Cdc42-mediated apoptosis, whereas Bcl-2 did not. We provide evidence that PAK1 and JNK1 may play a role downstream of Cdc42 to transduce its apoptotic signal. Cdc42/PAK1 activates JNK1-induced phosphorylation of Bcl-2, thereby inactivating its function, and that a phosphorylation resistant mutant (Bcl-2S70,87A,T56,74A) gains the ability to inhibit Cdc42- and p53-mediated apoptosis. Thus, one mechanism by which p53 promotes apoptosis is through activation of Cdc42 and inactivation of Bcl-2.

Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan

Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less

Wild-type p53 reactivation by small-molecule Minnelide™ in human papillomavirus (HPV)-positive head and neck squamous cell carcinoma.

PubMed

Caicedo-Granados, Emiro; Lin, Rui; Fujisawa, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok

2014-12-01

The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Double-edged swords as cancer therapeutics: novel, orally active, small molecules simultaneously inhibit p53-MDM2 interaction and the NF-κB pathway.

PubMed

Zhuang, Chunlin; Miao, Zhenyuan; Wu, Yuelin; Guo, Zizhao; Li, Jin; Yao, Jianzhong; Xing, Chengguo; Sheng, Chunquan; Zhang, Wannian

2014-02-13

Simultaneous inactivation of p53 and hyperactivation of nuclear factor-κB (NF-κB) is a common occurrence in human cancer. Currently, antitumor agents are being designed to selectively activate p53 or inhibit NF-κB. However, there is no concerted effort yet to deliberately design inhibitors that can simultaneously do both. This paper provided a proof-of-concept study that p53-MDM2 interaction and NF-κB pathway can be simultaneously targeted by a small-molecule inhibitor. A series of pyrrolo[3,4-c]pyrazole derivatives were rationally designed and synthesized as the first-in-class inhibitors of p53-MDM2 interaction and NF-κB pathway. Most of the compounds were identified to possess nanomolar p53-MDM2 inhibitory activity. Compounds 5q and 5s suppressed NF-κB activation through inhibition of IκBα phosphorylation and elevation of the cytoplasmic levels of p65 and phosphorylated IKKα/β. Biochemical assay for the kinases also supported the fact that pyrrolo[3,4-c]pyrazole compounds directly targeted the NF-κB pathway. In addition, four compounds (5j, 5q, 5s, and 5u) effectively inhibited tumor growth in the A549 xenograft model. Further pharmacokinetic study revealed that compound 5q exhibited excellent oral bioavailability (72.9%).

Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

PubMed

Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

2017-01-01

The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

PubMed Central

Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

2017-01-01

Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

PubMed Central

2010-01-01

Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

PubMed

Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

2010-05-01

Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

PubMed

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53

PubMed Central

York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.

2016-01-01

Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821

Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

PubMed

York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

2017-09-01

Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

PML is a ROS sensor activating p53 upon oxidative stress

PubMed Central

Soilihi, Hassane

2017-01-01

Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625

Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway

PubMed Central

Llanos, Susana; Serrano, Manuel

2013-01-01

Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage. PMID:20935493

PML is a ROS sensor activating p53 upon oxidative stress.

PubMed

Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues

2017-11-06

Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.

Posttranslational Modifications of p53 in Replicative Senescence Overlapping but Distinct from Those Induced by DNA Damage

PubMed Central

Webley, Katherine; Bond, Jane A.; Jones, Christopher J.; Blaydes, Jeremy P.; Craig, Ashley; Hupp, Ted; Wynford-Thomas, David

2000-01-01

Replicative senescence in human fibroblasts is absolutely dependent on the function of the phosphoprotein p53 and correlates with activation of p53-dependent transcription. However, no evidence for posttranslational modification of p53 in senescence has been presented, raising the possibility that changes in transcriptional activity result from upregulation of a coactivator. Using a series of antibodies with phosphorylation-sensitive epitopes, we now show that senescence is associated with major changes at putative regulatory sites in the N and C termini of p53 consistent with increased phosphorylation at serine-15, threonine-18, and serine-376 and decreased phosphorylation at serine-392. Ionizing and UV radiation generated overlapping but distinct profiles of response, with increased serine-15 phosphorylation being the only common change. These results support a direct role for p53 in signaling replicative senescence and are consistent with the generation by telomere erosion of a signal which shares some but not all of the features of DNA double-strand breaks. PMID:10733583

Inhibitory effect of PDGF-BB and serum-stimulated responses in vascular smooth muscle cell proliferation by hinokitiol via up-regulation of p21 and p53.

PubMed

Li, Jiun-Yi; Liu, Chun-Ping; Shiao, Wei-Cheng; Jayakumar, Thanasekaran; Li, Yi-Shin; Chang, Nen-Chung; Huang, Shih-Yi; Hsieh, Cheng-Ying

2018-04-01

Vascular smooth muscle cell (VSMC) proliferation plays a major role in the progression of vascular diseases. In the present study, we established the efficacy and the mechanisms of action of hinokitiol, a tropolone derivative found in Chamaecyparis taiwanensis , Cupressaceae, in relation to platelet-derived growth factor-BB (PDGF-BB) and serum-dependent VSMC proliferation. Primary cultured rat VSMCs were pre-treated with hinokitiol and then stimulated by PDGF-BB (10 ng/ml) or serum (10% fetal bovine serum). Cell proliferation and cytotoxicity were determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and lactose dehydrogenase assay, respectively. The degree of DNA synthesis was evaluated by BrdU-incorporation measurements and observed using confocal microscopy. Immunoblotting was utilized to determine the protein level of p-extracellular signal-regulated kinase (ERK) 1/2, p-Akt, p-phosphoinositide 3-kinase (PI3K), p-Janus kinase 2 (JAK2), p-p53, and p21 Cip1 . The promoter activity of p21 and p53 activity were measured by dual luciferase reporter assay. Treatment with hinokitiol (1-10 μM) inhibited PDGF-BB and serum-induced VSMC proliferation and DNA synthesis in a concentration-dependent manner. Cytotoxicity was not observed in hinokitiol-treated VSMCs at the studied concentrations. Pre-incubation of VSMCs with hinokitiol did not alter PDGF-BB-induced phosphorylation of ERK1/2, Akt, PI3K or JAK2. Interestingly, hinokitiol induced promoter activity of p21 and p21 protein expression in VSMCs. Furthermore, hinokitiol augmented p53 protein phosphorylation and subsequently led to enhanced p53 activity. These data suggest that the anti-proliferative effects of hinokitiol in VSMCs may be mediated by activation of p21 and p53 signaling pathways, and it may contribute to the prevention of vascular diseases associated with VSMC proliferation.

Inhibitory effect of PDGF-BB and serum-stimulated responses in vascular smooth muscle cell proliferation by hinokitiol via up-regulation of p21 and p53

PubMed Central

Li, Jiun-Yi; Liu, Chun-Ping; Shiao, Wei-Cheng; Jayakumar, Thanasekaran; Li, Yi-Shin; Chang, Nen-Chung

2018-01-01

Introduction Vascular smooth muscle cell (VSMC) proliferation plays a major role in the progression of vascular diseases. In the present study, we established the efficacy and the mechanisms of action of hinokitiol, a tropolone derivative found in Chamaecyparis taiwanensis, Cupressaceae, in relation to platelet-derived growth factor-BB (PDGF-BB) and serum-dependent VSMC proliferation. Material and methods Primary cultured rat VSMCs were pre-treated with hinokitiol and then stimulated by PDGF-BB (10 ng/ml) or serum (10% fetal bovine serum). Cell proliferation and cytotoxicity were determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and lactose dehydrogenase assay, respectively. The degree of DNA synthesis was evaluated by BrdU-incorporation measurements and observed using confocal microscopy. Immunoblotting was utilized to determine the protein level of p-extracellular signal-regulated kinase (ERK) 1/2, p-Akt, p-phosphoinositide 3-kinase (PI3K), p-Janus kinase 2 (JAK2), p-p53, and p21Cip1. The promoter activity of p21 and p53 activity were measured by dual luciferase reporter assay. Results Treatment with hinokitiol (1–10 μM) inhibited PDGF-BB and serum-induced VSMC proliferation and DNA synthesis in a concentration-dependent manner. Cytotoxicity was not observed in hinokitiol-treated VSMCs at the studied concentrations. Pre-incubation of VSMCs with hinokitiol did not alter PDGF-BB-induced phosphorylation of ERK1/2, Akt, PI3K or JAK2. Interestingly, hinokitiol induced promoter activity of p21 and p21 protein expression in VSMCs. Furthermore, hinokitiol augmented p53 protein phosphorylation and subsequently led to enhanced p53 activity. Conclusions These data suggest that the anti-proliferative effects of hinokitiol in VSMCs may be mediated by activation of p21 and p53 signaling pathways, and it may contribute to the prevention of vascular diseases associated with VSMC proliferation. PMID:29765446

Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

PubMed

Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

2017-11-03

Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.

p53 Loss synergizes with estrogen and papillomaviral oncogenes to induce cervical and breast cancers.

PubMed

Shai, Anny; Pitot, Henry C; Lambert, Paul F

2008-04-15

Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53(f/f) mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6(WT)p53(f/f) mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53(f/f) mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor alpha. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract.

Effects of the Kava Chalcone Flavokawain A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53

PubMed Central

Tang, Yaxiong; Simoneau, Anne R.; Xie, Jun; Shahandeh, Babbak; Zi, Xiaolin

2010-01-01

Flavokawain A is the predominant chalcone from kava extract. We have assessed the mechanisms of flavokawain A's action on cell cycle regulation. In a p53 wild-type, low-grade, and papillary bladder cancer cell line (RT4), flavokawain A increased p21/WAF1 and p27/KIP1, which resulted in a decrease in cyclin-dependent kinase-2 (CDK2) kinase activity and subsequent G1 arrest. The increase of p21/WAF1 protein corresponded to an increased mRNA level, whereas p27/KIP1 accumulation was associated with the down-regulation of SKP2 and then increased the stability of the p27/KIP1 protein. The accumulation of p21/WAF1 and p27/KIP1 was independent of cell cycle position and thus not a result of the cell cycle arrest. In contrast, flavokawain A induced a G2-M arrest in six p53 mutant-type, high-grade bladder cancer cell lines (T24, UMUC3, TCCSUP, 5637, HT1376, and HT1197). Flavokawain A significantly reduced the expression of CDK1-inhibitory kinases, Myt1 and Wee1, and caused cyclin B1 protein accumulation leading to CDK1 activation in T24 cells. Suppression of p53 expression by small interfering RNA in RT4 cells restored Cdc25C expression and down-regulated p21/WAF1 expression, which allowed Cdc25C and CDK1 activation and then led to a G2-M arrest and an enhanced growth-inhibitory effect by flavokawain A. Consistently, flavokawain A also caused a pronounced CDK1 activation and G2-M arrest in p53 knockout but not in p53 wild-type HCT116 cells. This selectivity of flavokawain A for inducing a G2-M arrest in p53-defective cells deserves further investigation as a new mechanism for the prevention and treatment of bladder cancer. PMID:19138991

Immunohistochemical expression of protein p53 in neoplasms of the mammary gland in bitches.

PubMed

Rodo, A; Malicka, E

2008-01-01

The aim of the study was to investigate the presence of protein p53 in correlation with other tumor traits: histological type, tumor grade and proliferative activity. Material for the investigation comprised mammary gland tumours collected from dogs, the patients of veterinary clinics, during surgical procedures, and archival samples. Alltogether 21 adenomas, 31 complex carcinomas, 35 simple carcinomas and 12 solid carcinomas were qualified for further investigation. No protein p53 expression was found in adenomas. Cancers show positive reaction in 32.5%. The highest percent of p53 positive neoplasms was observed in solid carcinomas and neoplasms with the highest degree of histological malignancy. The smallest number showing this expression was observed in adenomas and the highest was characteristic for solid carcinomas. Considering the tumour grading, it was found that an increase in neoplasm malignancy was positively correlated with the number of the cells showing the expression of protein p53. The differences were statistically significant. Statistically significant positive correlations were observed between the proliferative activity and protein p53 expression. Higher accumulation of protein p53 in more malignant neoplasms suggests that mutations of protein p53 can be responsible for higher proliferation in neoplasms with advanced progression of malignancy.

The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

PubMed

Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

2018-06-01

The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

Computational Studies of Difference in Binding Modes of Peptide and Non-Peptide Inhibitors to MDM2/MDMX Based on Molecular Dynamics Simulations

PubMed Central

Chen, Jianzhong; Zhang, Dinglin; Zhang, Yuxin; Li, Guohui

2012-01-01

Inhibition of p53-MDM2/MDMX interaction is considered to be a promising strategy for anticancer drug design to activate wild-type p53 in tumors. We carry out molecular dynamics (MD) simulations to study the binding mechanisms of peptide and non-peptide inhibitors to MDM2/MDMX. The rank of binding free energies calculated by molecular mechanics generalized Born surface area (MM-GBSA) method agrees with one of the experimental values. The results suggest that van der Waals energy drives two kinds of inhibitors to MDM2/MDMX. We also find that the peptide inhibitors can produce more interaction contacts with MDM2/MDMX than the non-peptide inhibitors. Binding mode predictions based on the inhibitor-residue interactions show that the π–π, CH–π and CH–CH interactions dominated by shape complimentarity, govern the binding of the inhibitors in the hydrophobic cleft of MDM2/MDMX. Our studies confirm the residue Tyr99 in MDMX can generate a steric clash with the inhibitors due to energy and structure. This finding may theoretically provide help to develop potent dual-specific or MDMX inhibitors. PMID:22408446

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

PubMed Central

1994-01-01

Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041

Negative feedback regulation of wild-type p53 biosynthesis.

PubMed Central

Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

1995-01-01

When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

Role of nuclear bodies in apoptosis signalling.

PubMed

Krieghoff-Henning, Eva; Hofmann, Thomas G

2008-11-01

Promyelocytic leukemia nuclear bodies (PML NBs) are dynamic macromolecular multiprotein complexes that recruit and release a plethora of proteins. A considerable number of PML NB components play vital roles in apoptosis, senescence regulation and tumour suppression. The molecular basis by which PML NBs control these cellular responses is still just beginning to be understood. In addition to PML itself, numerous further tumour suppressors including transcriptional regulator p53, acetyl transferase CBP (CREB binding protein) and protein kinase HIPK2 (homeodomain interacting protein kinase 2) are recruited to PML NBs in response to genotoxic stress or oncogenic transformation and drive the senescence and apoptosis response by regulating p53 activity. Moreover, in response to death-receptor activation, PML NBs may act as nuclear depots that release apoptotic factors, such as the FLASH (FLICE-associated huge) protein, to amplify the death signal. PML NBs are also associated with other nuclear domains including Cajal bodies and nucleoli and share apoptotic regulators with these domains, implying crosstalk between NBs in apoptosis regulation. In conclusion, PML NBs appear to regulate cell death decisions through different, pathway-specific molecular mechanisms.

Exercise Activates p53 and Negatively Regulates IGF-1 Pathway in Epidermis within a Skin Cancer Model.

PubMed

Yu, Miao; King, Brenee; Ewert, Emily; Su, Xiaoyu; Mardiyati, Nur; Zhao, Zhihui; Wang, Weiqun

2016-01-01

Exercise has been previously reported to lower cancer risk through reducing circulating IGF-1 and IGF-1-dependent signaling in a mouse skin cancer model. This study aims to investigate the underlying mechanisms by which exercise may down-regulate the IGF-1 pathway via p53 and p53-related regulators in the skin epidermis. Female SENCAR mice were pair-fed an AIN-93 diet with or without 10-week treadmill exercise at 20 m/min, 60 min/day and 5 days/week. Animals were topically treated with TPA 2 hours before sacrifice and the target proteins in the epidermis were analyzed by both immunohistochemistry and Western blot. Under TPA or vehicle treatment, MDM2 expression was significantly reduced in exercised mice when compared with sedentary control. Meanwhile, p53 was significantly elevated. In addition, p53-transcriptioned proteins, i.e., p21, IGFBP-3, and PTEN, increased in response to exercise. There was a synergy effect between exercise and TPA on the decreased MDM2 and increased p53, but not p53-transcripted proteins. Taken together, exercise appeared to activate p53, resulting in enhanced expression of p21, IGFBP-3, and PTEN that might induce a negative regulation of IGF-1 pathway and thus contribute to the observed cancer prevention by exercise in this skin cancer model.

The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function

PubMed Central

Lo, Pang-Kuo; Lee, Ji Shin; Sukumar, Saraswati

2011-01-01

We previously identified FOXF1 as a potential tumor suppressor gene with an essential role in preventing DNA rereplication to maintain genomic stability, which is frequently inactivated in breast cancer through the epigenetic mechanism. Here we further addressed the role of the p53-p21WAF1 checkpoint pathway in DNA rereplication induced by silencing of FOXF1. Knockdown of FOXF1 by small interference RNA (siRNA) rendered colorectal p53-null and p21WAF1-null HCT116 cancer cells more susceptible to rereplication and apoptosis than the wild-type parental cells. In parental HCT116 cells with a functional p53 checkpoint, the p53-p21WAF1 checkpoint pathway was activated upon FOXF1 knockdown, which was concurrent with suppression of the CDK2-Rb cascade and induction of G1 arrest. In contrast, these events were not observed in FOXF1-depleted HCT116-p53−/− and HCT116-p21−/− cells, indicating the p53-dependent checkpoint function is vital for inhibiting CDK2 to induce G1 arrest and protect cells from rereplication. The pharmacologic inhibitor (caffeine) of Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3 related (ATR) protein kinases abolished activation of the p53-p21WAF1 pathway upon FOXF1 knockdown, suggesting that suppression of FOXF1 function triggered the ATM/ATR-mediated DNA damage response. Cosilencing of p53 by siRNA synergistically enhanced the effect of FOXF1 depletion on stimulation of DNA rereplication and apoptosis in wild-type HCT116. Finally, we show that FOXF1 expression is predominantly silenced in breast and colorectal cancer cell lines with inactive p53. Our study demonstrated that the p53-p21WAF1 checkpoint pathway is an intrinsically protective mechanism to prevent DNA rereplication induced by silencing of FOXF1. PMID:21964066

Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer

PubMed Central

Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel

2016-01-01

Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766

B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang Xin; Xu Ke; Xu Yufang

The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report heremore » that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P{sub 2} promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research Highlights: > B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. > B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. > B1 induced significant increase of p53 binding to Bcl-2 P{sub 2} promoter TATA box.« less

Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

PubMed

Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

2015-11-01

Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

A dual role of p53 in the control of autophagy.

PubMed

Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

2008-08-01

Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

Bim directly antagonizes Bcl-xl in doxorubicin-induced prostate cancer cell apoptosis independently of p53.

PubMed

Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei

2016-01-01

Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.

p53 is a major component of the transcriptional and apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling.

PubMed

Nayak, G; Cooper, G M

2012-10-11

The phosphatidylinositol (PI) 3-kinase/Akt signaling pathway has a prominent role in cell survival and proliferation, in part, by regulating gene expression at the transcriptional level. Previous work using global expression profiling identified FOXOs and the E-box-binding transcription factors MITF and USF1 as key targets of PI 3-kinase signaling that lead to the induction of proapoptotic and cell cycle arrest genes in response to inhibition of PI 3-kinase. In this study, we investigated the role of p53 downstream of PI 3-kinase signaling by analyzing the effects of inhibition of PI 3-kinase in Rat-1 cells, which have wild-type p53, compared with Rat-1 cells expressing a dominant-negative p53 mutant. Expression of dominant-negative p53 conferred partial resistance to apoptosis induced by inhibition of PI 3-kinase. Global gene expression profiling combined with computational and experimental analysis of transcription factor binding sites demonstrated that p53, along with FOXO, MITF and USF1, contributed to gene induction in response to PI 3-kinase inhibition. Activation of p53 was mediated by phosphorylation of the histone acetyltransferase Tip60 by glycogen synthase kinase (GSK) 3, leading to activation of p53 by acetylation. Many of the genes targeted by p53 were also targeted by FOXO and E-box-binding transcription factors, indicating that p53 functions coordinately with these factors to regulate gene expression downstream of PI 3-kinase/Akt/GSK3 signaling.

Concurrent acetylation of FoxO1/3a and p53 due to sirtuins inhibition elicit Bim/PUMA mediated mitochondrial dysfunction and apoptosis in berberine-treated HepG2 cells.

PubMed

Shukla, Shatrunajay; Sharma, Ankita; Pandey, Vivek Kumar; Raisuddin, Sheikh; Kakkar, Poonam

2016-01-15

Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD(+) dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P<0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increased the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P<0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD(+)/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1-10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P<0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria-mediated apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.

Usp5 links suppression of p53 and FAS levels in melanoma to the BRAF pathway

PubMed Central

Potu, Harish; Peterson, Luke F.; Pal, Anupama; Verhaegen, Monique; Cao, Juxiang; Talpaz, Moshe; Donato, Nicholas J.

2014-01-01

Usp5 is a deubiquitinase (DUB) previously shown to regulate unanchored polyubiquitin (Ub) chains, p53 transcriptional activity and double-strand DNA repair. In BRAF mutant melanoma cells, Usp5 activity was suppressed by BRAF inhibitor (vemurafenib) in sensitive but not in acquired or intrinsically resistant cells. Usp5 knockdown overcame acquired vemurafenib resistance and sensitized BRAF and NRAS mutant melanoma cells to apoptosis initiated by MEK inhibitor, cytokines or DNA-damaging agents. Knockdown and overexpression studies demonstrated that Usp5 regulates p53 (and p73) levels and alters cell growth and cell cycle distribution associated with p21 induction. Usp5 also regulates the intrinsic apoptotic pathway by modulating p53-dependent FAS expression. A small molecule DUB inhibitor (EOAI3402143) phenocopied the FAS induction and apoptotic sensitization of Usp5 knockdown and fully blocked melanoma tumor growth in mice. Overall, our results demonstrate that BRAF activates Usp5 to suppress cell cycle checkpoint control and apoptosis by blocking p53 and FAS induction; all of which can be restored by small molecule-mediated Usp5 inhibition. These results suggest that Usp5 inhibition can provide an alternate approach in recovery of diminished p53 (or p73) function in melanoma and can add to the targeted therapies already used in the treatment of melanoma. PMID:24980819

p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers

PubMed Central

Shai, Anny; Pitot, Henry C.; Lambert, Paul F.

2010-01-01

Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729

p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

PubMed

Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

2018-05-28

p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Phosphorylation of p53 modifies sensitivity to ionizing radiation.

PubMed

Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi

2011-06-01

Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.

Interaction between the Cockayne syndrome B and p53 proteins: implications for aging

PubMed Central

Frontini, Mattia; Proietti-De-Santis, Luca

2012-01-01

The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53's levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis. PMID:22383384

Unbalancing p53/Mdm2/IGF-1R axis by Mdm2 activation restrains the IGF-1-dependent invasive phenotype of skin melanoma

PubMed Central

Worrall, C; Suleymanova, N; Crudden, C; Trocoli Drakensjö, I; Candrea, E; Nedelcu, D; Takahashi, S-I; Girnita, L; Girnita, A

2017-01-01

Melanoma tumors usually retain wild-type p53; however, its tumor-suppressor activity is functionally disabled, most commonly through an inactivating interaction with mouse double-minute 2 homolog (Mdm2), indicating p53 release from this complex as a potential therapeutic approach. P53 and the tumor-promoter insulin-like growth factor type 1 receptor (IGF-1R) compete as substrates for the E3 ubiquitin ligase Mdm2, making their relative abundance intricately linked. Hence we investigated the effects of pharmacological Mdm2 release from the Mdm2/p53 complex on the expression and function of the IGF-1R. Nutlin-3 treatment increased IGF-1R/Mdm2 association with enhanced IGF-1R ubiquitination and a dual functional outcome: receptor downregulation and selective downstream signaling activation confined to the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway. This Nutlin-3 functional selectivity translated into IGF-1-mediated bioactivities with biphasic effects on the proliferative and metastatic phenotype: an early increase and late decrease in the number of proliferative and migratory cells, while the invasiveness was completely inhibited following Nutlin-3 treatment through an impaired IGF-1-mediated matrix metalloproteinases type 2 activation mechanism. Taken together, these experiments reveal the biased agonistic properties of Nutlin-3 for the mitogen-activated protein kinase pathway, mediated by Mdm2 through IGF-1R ubiquitination and provide fundamental insights into destabilizing p53/Mdm2/IGF-1R circuitry that could be developed for therapeutic gain. PMID:28092675

Concurrent acetylation of FoxO1/3a and p53 due to sirtuins inhibition elicit Bim/PUMA mediated mitochondrial dysfunction and apoptosis in berberine-treated HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shukla, Shatrunajay; Department of Medical Elementology and Toxicology, Jamia Hamdard; Sharma, Ankita

Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD{sup +} dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P < 0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increasedmore » the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P < 0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD{sup +}/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1–10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P < 0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria-mediated apoptosis. - Highlights: • Berberine inhibits sirtuins at transcriptional as well as at translational level. • Sirtuins inhibition leads to acetylation of non-histone proteins, FoxO1/3a and p53. • Acetylated FoxO and p53 transcriptionally upregulate BH3-only proteins Bim and PUMA respectively. • BH3-only proteins trigger mitochondrial dysfunction culminating into apoptosis. • SRT-1720 (SIRT-1 activator) partially restores Bax/Bcl-2 ratio and reduces berberine induced cytotoxicity in HepG2 cells.« less

p53 in survival, death and metabolic health: a lifeguard with a licence to kill.

PubMed

Kruiswijk, Flore; Labuschagne, Christiaan F; Vousden, Karen H

2015-07-01

The function of p53 as a tumour suppressor has been attributed to its ability to promote cell death or permanently inhibit cell proliferation. However, in recent years, it has become clear that p53 can also contribute to cell survival. p53 regulates various metabolic pathways, helping to balance glycolysis and oxidative phosphorylation, limiting the production of reactive oxygen species, and contributing to the ability of cells to adapt to and survive mild metabolic stresses. Although these activities may be integrated into the tumour suppressive functions of p53, deregulation of some elements of the p53-induced response might also provide tumours with a survival advantage.

The nucleolus directly regulates p53 export and degradation.

PubMed

Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

2011-09-05

The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

Inhibition of the ERK phosphorylation plays a role in terbinafine-induced p21 up-regulation and DNA synthesis inhibition in human vascular endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, P.-Y.; Hsu, S.-P.; Liang, Y.-C.

2008-05-15

Previously, we showed that terbinafine (TB) induces cell-cycle arrest in cultured human umbilical vein endothelial cells (HUVEC) through an up-regulation of the p21 protein. The aim of this study is to delineate the molecular mechanisms underlying TB-induced increase of p21 protein. RT-PCR analysis demonstrated that the mRNA levels of p21 and p53 were increased in the TB-treated HUVEC. The p21 promoter activity was also increased by TB treatment. Transfection of HUVEC with p53 dominant negative (DN) abolished the TB-induced increases of p21 promoter activity and protein level, suggesting that the TB-induced increase of p21 is p53-dependent. Western blot analysis demonstratedmore » that TB decreased the levels of phosphorylated extracellular signal-regulated kinase (ERK). Over-expression of mitogen-activated protein kinase (MEK)-1, the immediate upstream activator kinase of ERK, abolished the TB-induced increases of p21 and p53 protein and decrease of thymidine incorporation. The ERK inhibitor (PD98059) enhanced the TB-induced inhibition of thymidine incorporation into HUVEC. Taken together, these data suggest that the decrease of ERK activity plays a role in the TB-induced up-regulation of p21 in HUVEC. On the other hand, pretreatment of the cells with geranylgeraniol (GGOH), farnesol (FOH), or Ras inhibitor peptide did not affect the TB-induced decrease of thymidine incorporation. Taken together, our results suggest that TB might cause a decrease of MEK, which in turn up-regulates p53 through the inhibition of ERK phosphorylation, and finally causes an increase of p21 expression and cell-cycle arrest.« less

UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53{sup Ser-15} phosphorylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader

2009-06-12

Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser{sup 15}. Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not preventmore » Dubca cell apoptosis, suggesting that p53{sup Ser-15} phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.« less

Around and beyond 53BP1 Nuclear Bodies

PubMed Central

Fernandez-Vidal, Anne; Vignard, Julien

2017-01-01

Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction. PMID:29206178

Self-aggregation and coaggregation of the p53 core fragment with its aggregation gatekeeper variant.

PubMed

Lei, Jiangtao; Qi, Ruxi; Wei, Guanghong; Nussinov, Ruth; Ma, Buyong

2016-03-21

Recent studies suggested that p53 aggregation can lead to loss-of-function (LoF), dominant-negative (DN) and gain-of-function (GoF) effects, with adverse cancer consequences. The p53 aggregation-nucleating (251)ILTIITL(257) fragment is a key segment in wild-type p53 aggregation; however, an I254R mutation can prevent it. It was suggested that self-assembly of wild-type p53 and its cross-interaction with mutants differ from the classical amyloid nucleation-growth mechanism. Here, using replica exchange molecular dynamics (REMD) simulations, we studied the cross-interactions of this p53 core fragment and its aggregation rescue I254R mutant. We found that the core fragment displays strong aggregation propensity, whereas the gatekeeper I254R mutant tends to be disordered, consistent with experiments. Our cross-interaction results reveal that the wild-type p53 fragment promotes β-sheet formation of the I254R mutant by shifting the disordered mutant peptides into aggregating states. As a result, the system has similar oligomeric structures, inter-peptide interactions and free energy landscape as the wild type fragment does, revealing a prion-like process. We also found that in the cross-interaction system, the wild-type species has higher tendency to interact with the mutant than with itself. This phenomenon illustrates synergistic effects between the p53 (251)ILTIITL(257) fragment and the mutant resembling prion cross-species propagation, cautioning against exploiting it in drug discovery.

Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression

PubMed Central

Cathcart, Jillian M.; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

2016-01-01

Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype. PMID:27531896

PUMA promotes Bax translocation in FOXO3a-dependent pathway during STS-induced apoptosis

NASA Astrophysics Data System (ADS)

Zhang, Yingjie; Chen, Qun

2009-08-01

PUMA (p53 up-regulated modulator of apoptosis, also called Bbc3) was first identified as a BH3-only Bcl-2 family protein that is transcriptionally up-regulated by p53 and activated upon p53-dependent apoptotic stimuli, such as treatment with DNA-damaging drugs or UV irradiation. Recently studies have been shown that Puma is also up-regulated in response to certain p53-independent apoptotic stimuli, such as growth factor deprivation or treatment with glucocorticoids or STS (staurosporine). However, the molecular mechanisms of PUMA up-regulation and how PUMA functions in response to p53-independent apoptotic stimuli remain poorly understood. In this study, based on real-time single cell analysis, flow cytometry and western blotting technique, we investigated the function of PUMA in living human lung adenocarcinoma cells (ASTC-a-1) after STS treatment. Our results show that FOXO3a was activated by STS stimulation and then translocated from cytosol to nucleus. The expression of PUMA was up-regulated via a FOXO3a-dependent manner after STS treatment, while p53 had little function in this process. Moreover, cell apoptosis and Bax translocation induced by STS were not blocked by Pifithrin-α (p53 inhibitor), which suggested that p53 was not involved in this signaling pathway. Taken together, these results indicate that PUMA promoted Bax translocation in a FOXO3a-dependment pathway during STS-induced apoptosis, while p53 was dispensable in this process.

Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

PubMed Central

Tu, Chao; Tan, Yu-Hong; Shaw, Gary; Zhou, Zheng; Bai, Yawen; Luo, Ray; Ji, Xinhua

2008-01-01

Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53. PMID:18453682

Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

PubMed

Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

2010-04-15

Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

PubMed

Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

2018-04-17

The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

p205, a potential tumor suppressor, inhibits cell proliferation via multiple pathways of cell cycle regulation.

PubMed

Asefa, Benyam; Dermott, Jonathan M; Kaldis, Philipp; Stefanisko, Karen; Garfinkel, David J; Keller, Jonathan R

2006-02-20

p205 is a member of the interferon-inducible p200 family of proteins that regulate cell proliferation. Over-expression of p205 inhibits cell growth, although its mechanism of action is currently unknown. Therefore, we evaluated the effect of p205 on the p53 and Rb-dependent pathways of cell cycle regulation. p205 expression results in elevated levels of p21, and activates the p21 promoter in vitro in a p53-dependent manner. In addition, p205 induces increased expression of Rb, and binds directly to Rb and p53. Interestingly, p205 also induces growth inhibition independent of p53 and Rb by delaying G2/M progression in proliferating cells, and is a substrate for Cdk2 kinase activity. Finally, we have identified other binding partners of p205 by a yeast two-hybrid screen, including the paired homeodomain protein HoxB2. Taken together, our results indicate that p205 induces growth arrest by interaction with multiple transcription factors that regulate the cell cycle, including but not entirely dependent on the Rb- and p53-mediated pathways of growth inhibition.

Curcumin induces permanent growth arrest of human colon cancer cells: link between senescence and autophagy.

PubMed

Mosieniak, Grazyna; Adamowicz, Marek; Alster, Olga; Jaskowiak, Hubert; Szczepankiewicz, Andrzej A; Wilczynski, Grzegorz M; Ciechomska, Iwona A; Sikora, Ewa

2012-06-01

Curcumin, a natural polyphenol derived from the rhizome of Curcuma longa, is a potent anticancer agent, which restricts tumor cell growth both in vitro and in vivo. Thus far curcumin was shown to induce death of cancer cells. This study reports the induction of cellular senescence of human colon cancer cells HCT116 upon curcumin treatment. The SA-β-galactosidase activation was observed both in p53+/+ and p53-/- cells, however the latter ones were less sensitive to the prosenescent activity of curcumin. Upregulation of p53 and p21 proteins was observed in p53+/+ HCT116, while p53-independent induction of p21 was noticed in p53-/- HCT116. Moreover, the senescence of HCT116 cells was accompanied by autophagy, that was confirmed by electron microscopy observations of autophagosomes in the curcumin-treated cells as well as LC3-II expression, punctue staining of LC3 and increased content of acidic vacuoles. Inhibition of autophagy, due to the diminished expression of ATG5 by RNAi decreased the number of senescent cells induced by curcumin, but did not lead to increased cell death. Altogether, we demonstrated a new antitumor activity of curcumin leading to cancer cell senescence and revealed the presence of a functional link between senescence and autophagy in curcumin-treated cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

The effects of a novel aliphatic-chain hydroxamate derivative WMJ-S-001 in HCT116 colorectal cancer cell death

PubMed Central

Huang, Yu-Han; Huang, Shiu-Wen; Hsu, Ya-Fen; Ou, George; Huang, Wei-Jan; Hsu, Ming-Jen

2015-01-01

Hydroxamate derivatives have attracted considerable attention due to their broad pharmacological properties and have been extensively investigated. We recently demonstrated that WMJ-S-001, a novel aliphatic hydroxamate derivative, exhibits anti-inflammatory and anti-angiogenic activities. In this study, we explored the underlying mechanisms by which WMJ-S-001 induces HCT116 colorectal cancer cell death. WMJ-S-001 inhibited cell proliferation and induced cell apoptosis in HCT116 cells. These actions were associated with AMP-activated protein kinase (AMPK) and p38 mitogen-activated protein kinase (MAPK) activation, p53 phosphorylation and acetylation, as well as the modulation of p21cip/Waf1, cyclin D1, survivin and Bax. AMPK-p38MAPK signaling blockade reduced WMJ-S-001-induced p53 phosphorylation. Transfection with AMPK dominant negative mutant (DN) reduced WMJ-S-001’s effects on p53 and Sp1 binding to the survivn promoter region. Transfection with HDAC3-Flag or HDAC4-Flag also abrogated WMJ-S-001’s enhancing effect on p53 acetylation. WMJ-S-001’s actions on p21cip/Waf1, cyclin D1, survivin, Bax were reduced in p53-null HCT116 cells. Furthermore, WMJ-S-001 was shown to suppress the growth of subcutaneous xenografts of HCT116 cells in vivo. In summary, the death of HCT116 colorectal cancer cells exposed to WMJ-S-001 may involve AMPK-p38MAPK-p53-survivin cascade. These results support the role of WMJ-S-001 as a potential drug candidate and warrant the clinical development in the treatment of cancer. PMID:26510776

Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

PubMed Central

Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

2016-01-01

Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

A Designed Peptide Targets Two Types of Modifications of p53 with Anti-cancer Activity.

PubMed

Liang, Lunxi; Wang, Huanbin; Shi, Hubing; Li, Zhaoli; Yao, Han; Bu, Zhigao; Song, Ningning; Li, Chushu; Xiang, Dabin; Zhang, Yao; Wang, Jilin; Hu, Ye; Xu, Qi; Ma, Yanlei; Cheng, Zhongyi; Wang, Yingchao; Zhao, Shuliang; Qian, Jin; Chen, Yingxuan; Fang, Jing-Yuan; Xu, Jie

2018-06-21

Many cancer-related proteins are controlled by composite post-translational modifications (PTMs), but prevalent strategies only target one type of modification. Here we describe a designed peptide that controls two types of modifications of the p53 tumor suppressor, based on the discovery of a protein complex that suppresses p53 (suppresome). We found that Morn3, a cancer-testis antigen, recruits different PTM enzymes, such as sirtuin deacetylase and ubiquitin ligase, to confer composite modifications on p53. The molecular functions of Morn3 were validated through in vivo assays and chemico-biological intervention. A rationally designed Morn3-targeting peptide (Morncide) successfully activated p53 and suppressed tumor growth. These findings shed light on the regulation of protein PTMs and present a strategy for targeting two modifications with one molecule. Copyright © 2018 Elsevier Ltd. All rights reserved.

Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

PubMed

Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

2018-03-01

Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

PubMed Central

Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

2017-01-01

Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denamur, Sophie; Boland, Lidvine

Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasomemore » by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.« less

β2-AR activation induces chemoresistance by modulating p53 acetylation through upregulating Sirt1 in cervical cancer cells.

PubMed

Chen, Hongyu; Zhang, Wei; Cheng, Xiang; Guo, Liang; Xie, Shuai; Ma, Yuanfang; Guo, Ning; Shi, Ming

2017-07-01

It has been suggested that β2-adrenergic receptor (β2-AR)-mediated signaling induced by catecholamines regulates the degradation of p53. However, the underlying molecular mechanisms were not known. In the present study, we demonstrated that catecholamines upregulated the expression of silent information regulator 1 (Sirt1) through activating β2-AR-mediated signaling pathway, since selective β2-AR antagonist ICI 118, 551 and non-selective β-blocker proprenolol effectively repressed isoproterenol (ISO)-induced Sirt1 expression. Catecholamines inhibited doxorubicin (DOX)-induced p53 acetylation and transcription-activation activities by inducing the expression of Sirt1. Knockdown of the Sirt1 expression by the specific siRNA remarkably blocked the inhibitory effects of ISO on DOX-induced p53 acetylation. In addition, we demonstrated that catecholamines induced resistance of cervical cancer cells to chemotherapeutics both in vitro and in vivo and that β2-AR was overexpressed in cervical cancer tissues. Our data suggest that the p53-dependent, chemotherapeutics-induced cytotoxicity in cervical cancer cells may be compromised by catecholamines-induced upregulation of the Sirt1 expression through activating the β2-AR signaling. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice

PubMed Central

Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.

2014-01-01

Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

PubMed Central

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-01-01

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

PubMed

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

p53 inactivation decreases dependence on estrogen/ERK signalling for proliferation but promotes EMT and susceptility to 3-bromopyruvate in ERα+ breast cancer MCF-7 cells.

PubMed

Rieber, Manuel; Strasberg-Rieber, Mary

2014-03-15

Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Chk2 mediates RITA-induced apoptosis.

PubMed

de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

2012-06-01

Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA.

Chk2 mediates RITA-induced apoptosis

PubMed Central

de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

2012-01-01

Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA. PMID:22158418

Blocking angiotensin II Type 1 receptor triggers apoptotic cell death in human pancreatic cancer cells.

PubMed

Gong, Qiaoke; Davis, Molly; Chipitsyna, Galina; Yeo, Charles J; Arafat, Hwyda A

2010-07-01

Pancreatic ductal adenocarcinoma (PDA) is an aggressive malignancy with an annual mortality rate close to its annual incidence. We recently demonstrated that angiotensin II (AngII) type 1 receptor (AT1R) might be involved in PDA angiogenesis. This study evaluated the antiproliferative and proapoptotic effects of an AT1R blocker, losartan, in PDA cells with different p53 mutation status. Cell cycle was analyzed by flow cytometric analysis of DNA content; apoptosis by annexin V-fluorescein isothiocyanate (V-FITC) and terminal deoxytransferase (TdT)-mediated dUTP nick-end labeling staining; messenger RNA and protein by real-time polymerase chain reaction and Western blotting; caspase-3 activity by colorimetric assay; and promoter activity by luciferase assay. Losartan dose-dependently decreased cell survival and increased their preG1 accumulation. It also increased p53, p21, p27, and Bax and reduced Bcl-2 and Bcl-xl expression. In wtp53 cells, losartan increased p53 transcription and activated caspase-3 in both cell lines. However, its proapoptotic effects in mtp53 cells were mainly caspase-3-dependent. Our data describe the involvement of AT1R in PDA cell apoptotic machinery and provide the first evidences that losartan stimulates the proapoptotic signaling pathways regardless of the p53 mutation status. As loss of p53 function is frequently observed in PDA patients, our data suggest AT1R blockade as a novel therapeutic strategy to control PDA growth.

Knockdown of hepatoma-derived growth factor-related protein-3 induces apoptosis of H1299 cells via ROS-dependent and p53-independent NF-κB activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Hong Shik; Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791; Baek, Jeong-Hwa

2014-07-11

Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates themore » radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells.« less

Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

PubMed

Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

2017-05-09

Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

I(2)(PP2A) regulates p53 and Akt correlatively and leads the neurons to abort apoptosis.

PubMed

Liu, Gong-Ping; Wei, Wei; Zhou, Xin; Zhang, Yao; Shi, Hai-Hong; Yin, Jun; Yao, Xiu-Qing; Peng, Cai-Xia; Hu, Juan; Wang, Qun; Li, Hong-Lian; Wang, Jian-Zhi

2012-02-01

A chronic neuron loss is the cardinal pathology in Alzheimer disease (AD), but it is still not understood why most neurons in AD brain do not accomplish apoptosis even though they are actually exposed to an environment with enriched proapoptotic factors. Protein phosphatase-2A inhibitor-2 (I(2)(PP2A)), an endogenous PP2A inhibitor, is significantly increased in AD brain, but the role of I(2)(PP2A) in AD-like neuron loss is elusive. Here, we show that I(2)(PP2A) regulates p53 and Akt correlatively. The mechanisms involve activated transcription and p38 MAPK activities. More importantly, we demonstrate that the simultaneous activation of Akt induced by I(2)(PP2A) counteracts the hyperactivated p53-induced cell apoptosis. Furthermore, I(2)(PP2A), p53 and Akt are all elevated in the brain of mouse model and AD patients. Our results suggest that the increased I(2)(PP2A) may trigger apoptosis by p53 upregulation, but due to simultaneous activation of Akt, the neurons are aborted from the apoptotic pathway. This finding contributes to the understanding of why most neurons in AD brain do not undergo apoptosis. Copyright © 2010. Published by Elsevier Inc.

Mutant p53 dictates the oncogenic activity of c-Abl in triple-negative breast cancers

PubMed Central

Morrison, Chevaun D; Chang, Jenny C; Keri, Ruth A; Schiemann, William P

2017-01-01

We recently established c-Abl as a potent suppressor of triple-negative breast cancer (TNBC) progression through its reactivation of a p53:p21 signaling axis coupled to senescence. Moreover, we observed co-expression of p53 and c-Abl to be essential for normal mammary epithelial cell physiology, as this relationship is lost upon breast cancer progression. Cytoplasmic c-Abl activity is markedly increased in some TNBCs and contributes to disease progression; however, the mechanisms underlying these events remain largely unknown. In addressing this question, we show here that c-Abl is predominantly restricted to the cytoplasm of human MDA-MB-231 TNBC cells, and to the nucleus of human MCF-7 luminal A cells. TTK is a mitotic protein kinase that phosphorylates c-Abl on Thr735, thereby creating a recognition binding motif for 14-3-3 adaptor proteins in response to oxidative stress. By interrogating the METABRIC database, we observed a significant correlation between p53 expression and that of c-Abl and TTK in basal-like breast cancers. Moreover, heterologous expression of TTK in MCF-7 cells significantly stimulated their growth in part via a c-Abl-dependent mechanism. Conversely, depleting TTK expression in MDA-MB-231 cells not only inhibited their organoid growth in 3D-cultures, but also sensitized them to the tumor suppressing activities of c-Abl independent of its subcellular localization. Moreover, we show that mutant p53 forms cytoplasmic complexes with c-Abl, thereby dictating the subcellular localization of c-Abl and the sensitivity of MDA-MB-231 cells to Imatinib. In response to nutrient deprivation, c-Abl:p53 complexes readily accumulate in the nucleus, resulting in the hyperactivation of c-Abl and initiation of its anti-tumor activities. Collectively, we identified a novel mutant p53:c-Abl cytoplasmic signaling complex that promotes MDA-MB-231 cell growth and highlights the contextual cues that confer oncogenic activity to c-Abl in breast cancer. PMID:28661474

Cyclin-dependent kinases regulate apoptosis of intestinal epithelial cells

PubMed Central

Bhattacharya, Sujoy; Ray, Ramesh M.; Johnson, Leonard R.

2014-01-01

Homeostasis of the gastrointestinal epithelium is dependent upon a balance between cell proliferation and apoptosis. Cyclin-dependent kinases (Cdks) are well known for their role in cell proliferation. Previous studies from our group have shown that polyamine-depletion of intestinal epithelial cells (IEC-6) decreases cyclin-dependent kinase 2 (Cdk2) activity, increases p53 and p21Cip1 protein levels, induces G1 arrest, and protects cells from camptothecin (CPT)-induced apoptosis. Although emerging evidence suggests that members of the Cdk family are involved in the regulation of apoptosis, their roles directing apoptosis of IEC-6 cells are not known. In this study, we report that inhibition of Cdk1, 2, and 9 (with the broad range Cdk inhibitor, AZD5438) in proliferating IEC-6 cells triggered DNA damage, activated p53 signaling, inhibited proliferation, and induced apoptosis. By contrast, inhibition of Cdk2 (with NU6140) increased p53 protein and activity, inhibited proliferation, but had no effect on apoptosis. Notably, AZD5438 sensitized, whereas, NU6140 rescued proliferating IEC-6 cells from CPT-induced apoptosis. However, in colon carcinoma (Caco2) cells with mutant p53, treatment with either AZD5438 or NU6140 blocked proliferation, albeit more robustly with AZD5438. Both Cdk inhibitors induced apoptosis in Caco2 cells in a p53-independent manner. In serum starved quiescent IEC-6 cells, both AZD5438 and NU6140 decreased TNF- /CPT-induced activation of p53 and, consequently, rescued cells from apoptosis, indicating that sustained Cdk activity is required for apoptosis of quiescent cells. Furthermore, AZD5438 partially reversed the protective effect of polyamine depletion whereas NU6140 had no effect. Together, these results demonstrate that Cdks possess opposing roles in the control of apoptosis in quiescent and proliferating cells. In addition, Cdk inhibitors uncouple proliferation from apoptosis in a p53-dependent manner. PMID:24242917

N-Methyl, N-propynyl-2-phenylethylamine (MPPE), a Selegiline Analog, Attenuates MPTP-induced Dopaminergic Toxicity with Guaranteed Behavioral Safety: Involvement of Inhibitions of Mitochondrial Oxidative Burdens and p53 Gene-elicited Pro-apoptotic Change.

PubMed

Shin, Eun-Joo; Nam, Yunsung; Lee, Ji Won; Nguyen, Phuong-Khue Thi; Yoo, Ji Eun; Tran, The-Vinh; Jeong, Ji Hoon; Jang, Choon-Gon; Oh, Young J; Youdim, Moussa B H; Lee, Phil Ho; Nabeshima, Toshitaka; Kim, Hyoung-Chun

2016-11-01

Selegiline is a monoamine oxidase-B (MAO-B) inhibitor with anti-Parkinsonian effects, but it is metabolized to amphetamines. Since another MAO-B inhibitor N-Methyl, N-propynyl-2-phenylethylamine (MPPE) is not metabolized to amphetamines, we examined whether MPPE induces behavioral side effects and whether MPPE affects dopaminergic toxicity induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Multiple doses of MPPE (2.5 and 5 mg/kg/day) did not show any significant locomotor activity and conditioned place preference, whereas selegiline (2.5 and 5 mg/kg/day) significantly increased these behavioral side effects. Treatment with MPPE resulted in significant attenuations against decreases in mitochondrial complex I activity, mitochondrial Mn-SOD activity, and expression induced by MPTP in the striatum of mice. Consistently, MPPE significantly attenuated MPTP-induced oxidative stress and MPPE-mediated antioxidant activity appeared to be more pronounced in mitochondrial-fraction than in cytosolic-fraction. Because MPTP promoted mitochondrial p53 translocation and p53/Bcl-xL interaction, it was also examined whether mitochondrial p53 inhibitor pifithrin-μ attenuates MPTP neurotoxicity. MPPE, selegiline, or pifithrin-μ significantly attenuated mitochondrial p53/Bcl-xL interaction, impaired mitochondrial transmembrane potential, cytosolic cytochrome c release, and cleaved caspase-3 in wild-type mice. Subsequently, these compounds significantly ameliorated MPTP-induced motor impairments. Neuroprotective effects of MPPE appeared to be more prominent than those of selegiline. MPPE or selegiline did not show any additional protective effects against the attenuation by p53 gene knockout, suggesting that p53 gene is a critical target for these compounds. Our results suggest that MPPE possesses anti-Parkinsonian potentials with guaranteed behavioral safety and that the underlying mechanism of MPPE requires inhibition of mitochondrial oxidative stress, mitochondrial translocation of p53, and pro-apoptotic process.

Novel function of STAT1beta in B cells: induction of cell death by a mechanism different from that of STAT1alpha.

PubMed

Najjar, Imen; Schischmanoff, Pierre Olivier; Baran-Marszak, Fanny; Deglesne, Pierre-Antoine; Youlyouz-Marfak, Ibtissam; Pampin, Mathieu; Feuillard, Jean; Bornkamm, Georg W; Chelbi-Alix, Mounira K; Fagard, Remi

2008-12-01

Alternate splicing of STAT1 produces two isoforms: alpha, known as the active form, and beta, previously shown to act as a dominant-negative factor. Most studies have dealt with STAT1alpha, showing its involvement in cell growth control and cell death. To examine the specific function of either isoform in cell death, a naturally STAT1-deficient human B cell line was transfected to express STAT1alpha or STAT1beta. STAT1alpha, expressed alone, enhanced cell death, potentiated the fludarabine-induced apoptosis, and enhanced the nuclear location, the phosphorylation, and the transcriptional activity of p53. Unexpectedly, STAT1beta, expressed alone, induced cell death through a mechanism that was independent of the nuclear function of p53. Indeed, in STAT1beta-expressing B cells, p53 was strictly cytoplasmic where it formed clusters, and there was no induction of the transcriptional activity of p53. These data reveal a novel role of STAT1beta in programmed cell death, which is independent of p53.

DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

PubMed

Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

2016-01-05

On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

PubMed Central

Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

2016-01-01

On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

The Origins and Evolution of the p53 Family of Genes

PubMed Central

Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.

2010-01-01

A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129

p53 and c-myc activation by Pasteurella haemolytica leukotoxin is correlated with bovine mononuclear cells apoptosis.

PubMed

Marcatili, A; D'Isanto, M; Vitiello, M; Galdiero, R; Galdiero, M

2002-04-01

To analyse the role of Pasteurella haemolytica Leukotoxin (LKT) in the mechanism of apoptotic cell death of bovine lymphocytes, we evaluated DNA fragmentation and p53 and c-myc expression. P. haemolytica strain ATCC 14003 was cultivated for LKT production. DNA fragmentation was analysed by electrophoresis on Agarose gel. DNA strand breaks in individual apoptotic cells were also detected by an in situ Terminal deoxy nucleotidyl Transferase (TdT). The Polymerase Chain Reaction (PCR) procedure was used for verified p53 and c-myc activation by P. haemolytica LKT. LKT was able to induce DNA fragmentation in a dose and time-dependent fashion. The greatest apoptotic effect was obtained using LKT at a concentration of 0.25 U. The results show that p53 and c-myc activation by LKT is correlated with apoptosis of bovine lymphocytes and monocytes. Our data suggest that LKT may have an important role in the bacterial virulence of Pasteurella haemolytica.

Vitamin D receptor deficit induces activation of renin angiotensin system via SIRT1 modulation in podocytes.

PubMed

Chandel, Nirupama; Ayasolla, Kamesh; Wen, Hongxiu; Lan, Xiqian; Haque, Shabirul; Saleem, Moin A; Malhotra, Ashwani; Singhal, Pravin C

2017-02-01

Vitamin D receptor (VDR) deficient status has been shown to be associated with the activation of renin angiotensin system (RAS). We hypothesized that lack of VDR would enhance p53 expression in podocytes through down regulation of SIRT1; the former would enhance the transcription of angiotensinogen (Agt) and angiotensinogen II type 1 receptor (AT1R) leading to the activation of RAS. Renal tissues of VDR mutant (M) mice displayed increased expression of p53, Agt, renin, and AT1R. In vitro studies, VDR knockout podocytes not only displayed up regulation p53 but also displayed enhanced expression of Agt, renin and AT1R. VDR deficient podocytes also displayed an increase in mRNA expression for p53, Agt, renin, and AT1R. Interestingly, renal tissues of VDR-M as well as VDR heterozygous (h) mice displayed attenuated expression of deacetylase SIRT1. Renal tissues of VDR-M mice showed acetylation of p53 at lysine (K) 382 residues inferring that enhanced p53 expression in renal tissues could be the result of ongoing acetylation, a consequence of SIRT1 deficient state. Notably, podocytes lacking SIRT1 not only showed acetylation of p53 at lysine (K) 382 residues but also displayed enhanced p53 expression. Either silencing of SIRT1/VDR or treatment with high glucose enhanced podocyte PPAR-y expression, whereas, immunoprecipitation (IP) of their lysates with anti-retinoid X receptor (RXR) antibody revealed presence of PPAR-y. It appears that either the deficit of SIRT1 has de-repressed expression of PPAR-y or enhanced podocyte expression of PPAR-y (in the absence of VDR) has contributed to the down regulation of SIRT1. Copyright © 2017 Elsevier Inc. All rights reserved.

Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

PubMed

Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

2016-04-01

P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

p53-mediated inhibition of angiogenesis through up-regulation of a collagen prolyl hydroxylase.

PubMed

Teodoro, Jose G; Parker, Albert E; Zhu, Xiaochun; Green, Michael R

2006-08-18

Recent evidence suggests that antiangiogenic therapy is sensitive to p53 status in tumors, implicating a role for p53 in the regulation of angiogenesis. Here we show that p53 transcriptionally activates the alpha(II) collagen prolyl-4-hydroxylase [alpha(II)PH] gene, resulting in the extracellular release of antiangiogenic fragments of collagen type 4 and 18. Conditioned media from cells ectopically expressing either p53 or alpha(II)PH selectively inhibited growth of primary human endothelial cells. When expressed intracellularly or exogenously delivered, alpha(II)PH significantly inhibited tumor growth in mice. Our results reveal a genetic and biochemical linkage between the p53 tumor suppressor pathway and the synthesis of antiangiogenic collagen fragments.

Anticancer Activity of Marine Sponge Hyrtios sp. Extract in Human Colorectal Carcinoma RKO Cells with Different p53 Status

PubMed Central

Lim, Hyun Kyung; Bae, Woori; Lee, Hyi-Seung

2014-01-01

Drug development using marine bioresources is limited even though the ocean occupies about 70% of the earth and contains a large number of biological materials. From the screening test of the marine sponge extracts, we found Hyrtios sp. sponge collected from Chuuk island, Micronesia. In this study, the Hyrtios sp. extract was examined for anticancer activity against human colorectal carcinoma RKO cells that are wildtype for p53 and RKO-E6 that are p53 defective. The Hyrtios sp. extract dose-dependently inhibited viability in both cell lines. Multinucleation as an indication of mitotic catastrophe was also observed. Cytotoxicity tests gave significantly different results for RKO and RKO-E6 cells after 48 h exposure to Hyrtios sp. extract. In RKO cells treated with Hyrtios sp. extract, cell death occurred by induction of p53 and p21 proteins. In p53-defective RKO-E6 cells, Hyrtios sp. extract decreased expression of JNK protein and increased p21 protein. These results indicate that Hyrtios sp. extract induced apoptosis via different pathways depending on p53 status and could be a good natural product for developing new anticancer drugs. PMID:25243139

A stapled peptide antagonist of MDM2 carried by polymeric micelles sensitizes glioblastoma to temozolomide treatment through p53 activation

PubMed Central

Chen, Xishan; Tai, Lingyu; Gao, Jie; Qian, Jianchang; Zhang, Mingfei; Li, Beibei; Xie, Cao; Lu, Linwei; Lu, Wuyuan; Lu, Weiyue

2017-01-01

Antagonizing MDM2 and MDMX to activate the tumor suppressor protein p53 is an attractive therapeutic paradigm for the treatment of glioblastoma multiforme (GBM). However, challenges remain with respect to the poor ability of p53 activators to efficiently cross the blood–brain barrier and/or blood–brain tumor barrier and to specifically target tumor cells. To circumvent these problems, we developed a cyclic RGD peptide-conjugated poly(-ethylene glycol)-co-poly(lactic acid) polymeric micelle (RGD-M) that carried a stapled peptide antagonist of both MDM2 and MDMX (sPMI). The peptide-carrying micelle RGD-M/sPMI was prepared via film-hydration method with high encapsulation efficiency and loading capacity as well as ideal size distribution. Micelle encapsulation dramatically increased the solubility of sPMI, thus alleviating its serum sequestration. In vitro studies showed that RGD-M/sPMI efficiently inhibited the proliferation of glioma cells in the presence of serum by activating the p53 signaling pathway. Further, RGD-M/sPMI exerted potent tumor growth inhibitory activity against human glioblastoma in nude mouse xenograft models. Importantly, the combination of RGD-M/sPMI and temozolomide — a standard chemotherapy drug for GBM increased antitumor efficacy against glioblastoma in experimental animals. Our results validate a combination therapy using p53 activators with temozolomide as a more effective treatment for GBM. PMID:26428461

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

PubMed Central

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

2012-01-01

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

PubMed

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

2012-04-05

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

Transcriptome profiling identifies p53 as a key player during calreticulin deficiency: Implications in lipid accumulation.

PubMed

Vig, Saurabh; Talwar, Puneet; Kaur, Kirandeep; Srivastava, Rohit; Srivastava, Arvind K; Datta, Malabika

2015-01-01

Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering identified 34 significant clusters, of which p53 occupied the central hub node in the highest node-rich cluster. Toward validation, we show that CRT knockdown leads to inhibition of p53 protein levels. Both, CRT and p53 siRNA promote hepatic lipid accumulation and this was accompanied by elevated SREBP-1c and FAS levels. p53 was identified to bind at -219 bp on the SREBP-1c promoter and in the presence of CRT siRNA, there was decreased occupancy of p53 on this binding element. This was associated with increased SREBP-1c promoter activity and both, mutation in this binding site or p53 over-expression antagonised the effects of CRT knockdown. We, therefore, identify a negatively regulating p53 binding site on the SREBP-1c promoter that is critical during hepatic lipid accumulation. These results were validated in mouse primary hepatocytes and toward a physiological relevance, we report that while the levels of CRT and p53 are reduced in the fatty livers of diabetic db/db mice, SREBP-1c levels are significantly elevated. Our results suggest that decreased CRT levels might be involved in the development of a fatty liver by preventing p53 occupancy on the SREBP-1c promoter and thereby facilitating SREBP-1c up-regulation and consequently, lipid accumulation.

Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity

PubMed Central

Kaller, Markus; Götz, Ursula; Hermeking, Heiko

2017-01-01

We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524

Induction of Mitotic Cell Death by Overriding G2/M Checkpoint in Endometrial Cancer Cells with Non-functional p53

PubMed Central

Meng, Xiangbing; Laidler, Laura L.; Kosmacek, Elizabeth A.; Yang, Shujie; Xiong, Zhi; Zhu, Danlin; Wang, Xinjun; Dai, Donghai; Zhang, Yuping; Wang, Xiaofang; Brachova, Pavla; Albitar, Lina; Liu, Dawei; Ianzini, Fiorenza; Mackey, Michael A.; Leslie, Kimberly K.

2012-01-01

Objective Endometrial tumors with non-functional p53, such as serous uterine endometrial carcinomas, are aggressive malignancies with a poor outcome, yet they have an Achilles’ heel: due to loss of p53 function, these tumors may be sensitive to treatments which abrogate the G2/M checkpoint. Our objective was to exploit this weakness to induce mitotic cell death using two strategies: (1) EGFR inhibitor gefitinib combined with paclitaxel to arrest cells at mitosis, or (2) BI2536, an inhibitor of polo-like kinase 1 (PLK1), to block PLK1 activity. Methods We examined the impact of combining gefitinib and paclitaxel or PLK1 inhibitor on expression of G2/M checkpoint controllers, cell viability, and cell cycle progression in endometrial cancer cells with mutant p53. Results In cells lacking normal p53 activity, each treatment activated CDC25C and inactivated Wee1, which in turn activated cdc2 and sent cells rapidly through the G2/M checkpoint and into mitosis. Live cell imaging demonstrated irreversible mitotic arrest and eventual cell death. Combinatorial therapy with paclitaxel and gefitinib was highly synergistic and resulted in a 10-fold reduction in the IC50 for paclitaxel, from 14 nM as a single agent to 1.3 nM in the presence of gefitinib. However, BI2536 alone at low concentrations (5 nM) was the most effective treatment and resulted in massive mitotic cell death. In a xenograft mouse model with p53-deficient cells, low dose BI2536 significantly inhibited tumor growth. Conclusions These findings reveal induction of mitotic cell death as a therapeutic strategy for endometrial tumors lacking functional p53. PMID:23146687

Acentriolar mitosis activates a p53-dependent apoptosis pathway in the mouse embryo

PubMed Central

Bazzi, Hisham; Anderson, Kathryn V.

2014-01-01

Centrosomes are the microtubule-organizing centers of animal cells that organize interphase microtubules and mitotic spindles. Centrioles are the microtubule-based structures that organize centrosomes, and a defined set of proteins, including spindle assembly defective-4 (SAS4) (CPAP/CENPJ), is required for centriole biogenesis. The biological functions of centrioles and centrosomes vary among animals, and the functions of mammalian centrosomes have not been genetically defined. Here we use a null mutation in mouse Sas4 to define the cellular and developmental functions of mammalian centrioles in vivo. Sas4-null embryos lack centrosomes but survive until midgestation. As expected, Sas4−/− mutants lack primary cilia and therefore cannot respond to Hedgehog signals, but other developmental signaling pathways are normal in the mutants. Unlike mutants that lack cilia, Sas4−/− embryos show widespread apoptosis associated with global elevated expression of p53. Cell death is rescued in Sas4−/− p53−/− double-mutant embryos, demonstrating that mammalian centrioles prevent activation of a p53-dependent apoptotic pathway. Expression of p53 is not activated by abnormalities in bipolar spindle organization, chromosome segregation, cell-cycle profile, or DNA damage response, which are normal in Sas4−/− mutants. Instead, live imaging shows that the duration of prometaphase is prolonged in the mutants while two acentriolar spindle poles are assembled. Independent experiments show that prolonging spindle assembly is sufficient to trigger p53-dependent apoptosis. We conclude that a short delay in the prometaphase caused by the absence of centrioles activates a previously undescribed p53-dependent cell death pathway in the rapidly dividing cells of the mouse embryo. PMID:24706806

Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

PubMed Central

Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

2014-01-01

Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

PubMed Central

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-01-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

PubMed

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-09-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

Poly(beta-amino ester) nanoparticle-delivery of p53 has activity against small cell lung cancer in vitro and in vivo

PubMed Central

Kamat, Chandrashekhar D.; Shmueli, Ron B.; Connis, Nick; Rudin, Charles M.; Green, Jordan J.; Hann, Christine L.

2013-01-01

Small cell lung cancer (SCLC) is an aggressive disease with one of the highest case-fatality rates among cancer. The recommended therapy for SCLC has not changed significantly over the past 30 years; new therapeutic approaches are a critical need. TP53 is mutated in the majority of SCLC cases and its loss is required in transgenic mouse models of the disease. We synthesized an array of biodegradable poly(beta-amino ester) (PBAE) polymers which self-assemble with DNA and assayed for transfection efficiency in the p53-mutant H446 SCLC cell line using high-throughput methodologies. Two of the top candidates were selected for further characterization and TP53 delivery in vitro and in vivo. Nanoparticle delivery of TP53 resulted in expression of exogenous p53, induction of p21, induction of apoptosis and accumulation of cells in sub-G1 consistent with functional p53 activity. Intratumoral injection of subcutaneous H446 xenografts with polymers carrying TP53 caused marked tumor growth inhibition. This is the first demonstration of TP53 gene therapy in SCLC using non-viral polymeric nanoparticles. This technology may have general applicability as a novel anti-cancer strategy based on restoration of tumor suppressor gene function. PMID:23364678

FGF1 protects neuroblastoma SH-SY5Y cells from p53-dependent apoptosis through an intracrine pathway regulated by FGF1 phosphorylation

PubMed Central

Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore

2017-01-01

Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426

Mechanisms of dihydrotestosterone action on resveratrol-induced anti-proliferation in breast cancer cells with different ERα status

PubMed Central

Chang, Tung-Cheng; Changou, Chun A.; Lai, Hsuan-Yu; Fu, Earl; HuangFu, Wei-Chun; Davis, Paul J.; Lin, Hung-Yun; Liu, Leroy F.

2015-01-01

Dihydrotestosterone (DHT) has been shown to promote breast cancer growth via different mechanisms. In addition to binding to ERα, the DHT membrane receptor exists on integrin αvβ3. Resveratrol induces p53-dependent apoptosis via plasma membrane integrin αvβ3. Resveratrol and DHT signals are both transduced by activated ERK1/2; however, DHT promotes cell proliferation in cancer cells, whereas resveratrol is pro-apoptotic. In this study, we examined the mechanism by which DHT inhibits resveratrol-induced apoptosis in human ERα positive (MCF-7) and negative (MDA-MB-231) breast cancer cells. DHT inhibited resveratrol-stimulated phosphorylation of Ser-15 of p53 in a concentration-dependent manner. These effects of DHT on resveratrol action were blocked by an ERα antagonist, ICI 182,780, in MCF-7 breast cancer cells. DHT inhibited resveratrol-induced nuclear complex of p53-COX-2 formation which is required p53-dependent apoptosis. ChIP studies of COX-2/p53 binding to DNA and expression of p53-responsive genes indicated that DHT inhibited resveratrol-induced p53-directed transcriptional activity. In addition, DHT did inhibit resveratrol-induced COX-2/p53-dependent gene expression. These results suggest that DHT inhibits p53-dependent apoptosis in breast cancer cells by interfering with nuclear COX-2 accumulation which is essential for stimulation of apoptotic pathways. Thus, the surface receptor sites for resveratrol and DHT are discrete and activate ERK1/2-dependent downstream effects on apoptosis that are distinctive. These studies provide new insights into the antagonizing effects of resveratrol versus DHT, an important step toward better understanding and eventually treating breast cancer. It also indicates the complex pathways by which apoptosis is induced by resveratrol in DHT-depleted and -repleted environments. PMID:26456774

The human T-cell leukemia virus type-1 p30II protein activates p53 and induces the TIGAR and suppresses oncogene-induced oxidative stress during viral carcinogenesis.

PubMed

Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert

2018-05-01

In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes

PubMed Central

Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang

1998-01-01

Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and is therefore of questionable significance in protection against skin cancer induction. PMID:9708817

Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

PubMed

Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

2009-06-19

The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

Conformational detection of p53's oligomeric state by FlAsH Fluorescence

PubMed Central

Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

2009-01-01

The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo. PMID:19393630

CRISPR-Cas9-based target validation for p53-reactivating model compounds

PubMed Central

Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

2015-01-01

Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461

Do metaboreceptors alter heat loss responses following dynamic exercise?

PubMed

McGinn, Ryan; Swift, Brendan; Binder, Konrad; Gagnon, Daniel; Kenny, Glen P

2014-01-01

Metaboreceptor activation during passive heating is known to influence cutaneous vascular conductance (CVC) and sweat rate (SR). However, whether metaboreceptors modulate the suppression of heat loss following dynamic exercise remains unclear. On separate days, before and after 15 min of high-intensity treadmill running in the heat (35°C), eight males underwent either 1) no isometric handgrip exercise (IHG) or ischemia (CON), 2) 1 min IHG (60% of maximum, IHG), 3) 1 min IHG followed by 2 min of ischemia (IHG+OCC), 4) 2 min of ischemia (OCC), or 5) 1 min IHG followed by 2 min of ischemia with application of lower body negative pressure (IHG+LBNP). SR (ventilated capsule), cutaneous blood flow (Laser-Doppler), and mean arterial pressure (Finometer) were measured continuously before and after dynamic exercise. Following dynamic exercise, CVC was reduced with IHG exercise (P < 0.05) and remained attenuated with post-IHG ischemia during IHG+OCC relative to CON (39 ± 2 vs. 47 ± 6%, P < 0.05). Furthermore, the reduction in CVC was exacerbated by application of LBNP during post-IHG ischemia (35 ± 3%, P < 0.05) relative to IHG+OCC. SR increased during IHG exercise (P < 0.05) and remained elevated during post-IHG ischemia relative to CON following dynamic exercise (0.94 ± 0.15 vs. 0.53 ± 0.09 mg·min(-1)·cm(-2), P < 0.05). In contrast, application of LBNP during post-IHG ischemia had no effect on SR (0.93 ± 0.09 mg·min(-1)·cm(-2), P > 0.05) relative to post-IHG ischemia during IHG+OCC. We show that CVC is reduced and that SR is increased by metaboreceptor activation following dynamic exercise. In addition, we show that the metaboreflex-induced loading of the baroreceptors can influence the CVC response, but not the sweating response.

Regulation of p53 by reversible post-transcriptional and post-translational mechanisms in liver and skeletal muscle of an anoxia tolerant turtle, Trachemys scripta elegans.

PubMed

Zhang, Jing; Biggar, Kyle K; Storey, Kenneth B

2013-01-15

The red-eared slider turtle (Trachemys scripta elegans) exhibits well-developed natural anoxia tolerance that depends on multiple biochemical adaptations, including anoxia-induced hypometabolism. We hypothesized that signaling by the p53 protein could aid in establishing the hypometabolic state by arresting the cell cycle, protecting against DNA damage as well as altering pathways of energy metabolism. Immunoblotting was used to evaluate the regulation and post-transcriptional modifications of p53 in liver and skeletal muscle of red-eared slider turtles subjected to 5h or 20h of anoxic submergence. Tissue specific regulation of p53 was observed with the liver showing a more rapid activation of p53 in response to anoxia as well as differential expression of seven serine phosphorylation and two lysine acetylation sites when compared with skeletal muscle. Protein expression of MDM2, a major p53 inhibitor, was also examined but did not change during anoxia. Reverse-transcriptase PCR was used to assess transcript levels of selected p53 target genes (14-3-3σ, Gadd45α and Pgm) and one microRNA (miR-34a); results showed down-regulation of Pgm and up-regulation of the other three. These findings show an activation of p53 in response to anoxia exposure and suggest an important role for the p53 stress response pathway in regulating natural anoxia tolerance and hypometabolism in a vertebrate facultative anaerobe. Copyright © 2012 Elsevier B.V. All rights reserved.

Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53

PubMed Central

Murakami, Yohei; Takada, Shoji

2012-01-01

Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606

ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

PubMed

Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

2013-01-01

ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

Synthesis of novel forskolin isoxazole derivatives with potent anti-cancer activity against breast cancer cell lines.

PubMed

Burra, Srinivas; Voora, Vani; Rao, Ch Prasad; Vijay Kumar, P; Kancha, Rama Krishna; David Krupadanam, G L

2017-09-15

Forskolin C 1 -isoxazole derivatives (3,5-regioisomers) (11a-e, 14, 15a-h and 15, 16a-g) were synthesized regioselectively by adopting 1,3-dipolar cycloadditions. These derivatives were tested using estrogen receptor positive breast cancer cell lines MCF-7 and BT-474. Majority of the compounds exhibited activity against the p53-positive MCF-7 breast cancer cells but not against the p53-negative BT-474 breast cancer cells. Among forskolin derivatives, compounds 11a, 11c, 14a, 14f, 14g, 14h, 15b, 16g and 17b exhibited higher anti-cancer activity against MCF-7 cell line with an IC 50 ≤1µM. The derivative 14f exhibited highest activity in both p53-positive (MCF-7) and p53-negative (BT-474) breast cancer cell lines with an IC 50 of 0.5µM. Copyright © 2017. Published by Elsevier Ltd.

p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

NASA Astrophysics Data System (ADS)

Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

1995-02-01

Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation

PubMed Central

Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

2009-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types—MDM2, Pirh2, and COP1—and the HECT-domain type—ARF-BP1—have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G1 phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation. PMID:19509332

JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.

PubMed

Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

2009-06-23

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.

Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

PubMed

Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

2015-01-01

Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

PubMed Central

Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

2015-01-01

Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

Nitric oxide prodrug JS-K inhibits ubiquitin E1 and kills tumor cells retaining wild-type p53.

PubMed

Kitagaki, J; Yang, Y; Saavedra, J E; Colburn, N H; Keefer, L K; Perantoni, A O

2009-01-29

Nitric oxide (NO) is a major effector molecule in cancer prevention. A number of studies have shown that NO prodrug JS-K (O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate) induces apoptotic cell death in vitro and in vivo, indicating that it is a promising new therapeutic for cancer. However, the mechanism of its tumor-killing activity remains unclear. Ubiquitin plays an important role in the regulation of tumorigenesis and cell apoptosis. Our earlier report has shown that inactivation of the ubiquitin system through blocking E1 (ubiquitin-activating enzyme) activity preferentially induces apoptosis in p53-expressing transformed cells. As E1 has an active cysteine residue that could potentially interact with NO, we hypothesized that JS-K could inactivate E1 activity. E1 activity was evaluated by detecting ubiquitin-E1 conjugates through immunoblotting. JS-K strikingly inhibits the ubiquitin-E1 thioester formation in cells in a dose-dependent manner with an IC(50) of approximately 2 microM, whereas a JS-K analog that cannot release NO did not affect these levels in cells. Moreover, JS-K decreases total ubiquitylated proteins and increases p53 levels, which is mainly regulated by ubiquitin and proteasomal degradation. Furthermore, JS-K preferentially induces cell apoptosis in p53-expressing transformed cells. These findings indicate that JS-K inhibits E1 activity and kills transformed cells harboring wild-type p53.

C-terminal cleavage of DeltaNp63alpha is associated with TSA-induced apoptosis in immortalized corneal epithelial cells.

PubMed

Robertson, Danielle M; Ho, Su-Inn; Cavanagh, H Dwight

2010-08-01

In the central human corneal epithelium, loss of DeltaNp63 occurs in all surface epithelial cells preparing to undergo desquamation, suggesting a potential role for DeltaNp63 isoforms in mediating surface cell apoptotic shedding. In this study, the authors investigated a role for DeltaNp63 isoforms in caspase-mediated apoptosis in a telomerase-immortalized corneal epithelial cell line. For in vitro studies, hTCEpi cells were cultured in KGM-2 serum-free culture media containing 0.15 mM calcium. To assess dynamic protein interactions among individual DeltaNp63 isoforms, DeltaNp63-EGFP expression plasmids were transiently expressed in hTCEpi cells and evaluated by FRAP. Trichostatin-A (TSA; 3.31 muM) was used to induce cell death as measured by caspase activity. Cleavage and loss of endogenous DeltaNp63alpha, DeltaNp63-EGFP expression plasmids, and p53 were assessed after treatment with TSA and siRNA. Transient expression of DeltaNp63-EGFP alpha and beta isoforms resulted in the formation of a smaller isoform similar in size to DeltaNp63gamma-EGFP. FRAP demonstrated that DeltaNp63alpha-EGFP has greater immobile fraction than beta or gamma. TSA induced caspase-mediated apoptotic pathways; caspase induction was accompanied by a decrease in endogenous DeltaNp63alpha and p53. TSA upregulated DeltaNp63-EGFP plasmid expression; this was accompanied by a selective increase in cleavage of DeltaNp63alpha-EGFP. siRNA knockdown of DeltaNp63alpha correlated with a reduction in p53 independently of TSA. DeltaNp63alpha is the dominant active isoform in corneal epithelial cell nuclei. Loss of DeltaNp63alpha occurs during apoptotic signaling by cleavage at the C terminus. The corresponding loss of p53 suggests that a significant relationship appears to exist between these two regulatory proteins.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kasper, Jocelyn S.; Harvard Medical School, Boston, MA; Arai, Takehiro

CUL7 is a member of the cullin RING ligase family and forms an SCF-like complex with SKP1 and FBXW8. CUL7 is required for normal mouse embryonic development and cellular proliferation, and is highly homologous to PARC, a p53-associated, parkin-like cytoplasmic protein. We determined that CUL7, in a manner similar to PARC, can bind directly to p53 but does not affect p53 expression. We identified a discrete, co-linear domain in CUL7 that is conserved in PARC and HERC2, and is necessary and sufficient for p53-binding. The presence of p53 stabilized expression of this domain and we demonstrate that this p53-binding domainmore » of CUL7 contributes to the cytoplasmic localization of CUL7. The results support the model that p53 plays a role in regulation of CUL7 activity.« less

Expression of matrix metalloproteinase 1, matrix metalloproteinase 2, and matrix metalloproteinase 9 in carcinoma of the head and neck.

PubMed

Franchi, Alessandro; Santucci, Marco; Masini, Emanuela; Sardi, Iacopo; Paglierani, Milena; Gallo, Oreste

2002-11-01

Numerous reports have documented a direct involvement of matrix metalloproteinase (MMP) overexpression in the development and progression of head and neck squamous cell carcinoma (HNSCC). In this study, the authors examined whether the expression of MMPs in HNSCC is correlated with other steps involved in tumor growth and metastasis, like angiogenesis, activation the nitric oxide (NO) pathway, and alteration of the p53 tumor suppressor gene. MMP-1, MMP-2, and MMP-9 expression levels were examined immunohistochemically in samples from 43 patients with HNSCC. Microvessel density (MVD) was determined by immunostaining of endothelial cells with anti-CD31 monoclonal antibody. Inducible nitric oxide synthase (iNOS) activity and cyclic guanosine monophosphatate (cGMP) levels were assessed in fresh tumor samples, whereas exons 5-9 of the p53 gene were analyzed by reverse transcriptase-polymerase chain reaction, single-strand conformation polymorphism analysis and were sequenced. MMP-1 overexpression (>10% of tumor cells) was identified in 32 tumors (74.5%), whereas elevated levels of MMP-2 and MMP-9 were detected in 17 tumors (39.5%) each. Tumors with MMP-9 overexpression were characterized by significantly higher MVD (P = 0.05) and significantly higher iNOS activity and cGMP levels (P = 0.005 and P = 0.02, respectively). Moreover, p53 mutation was associated strongly with MMP-9 overexpression (P = 0.004). Conversely, no correlation was found between MMP-1 and MMP-2 expression, angiogenesis, iNOS activity, cGMP levels, and p53 mutation in this series. This study documents the existence of a correlation between MMP-9 expression, activity of the iNOS pathway, p53 status, and angiogenesis in patients with HNSCC. This raises the possibility that p53 mutation, which frequently is present in HNSCC, may result in increased angiogenesis and invasiveness related to increased nitric oxide and MMP production by tumor cells, ultimately contributing to tumor progression. Copyright 2002 American Cancer Society.

The c-Abl signaling network in the radioadaptive response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chi-Min, Yuan

2014-01-28

The radioadaptive response, or radiation hormesis, i.e. a low dose of radiation can protect cells and organisms from the effects of a subsequent higher dose, is a widely recognized phenomenon. Mechanisms underlying such radiation hormesis, however, remain largely unclear. Preliminary studies indicate an important role of c-Abl signaling in mediating the radioadaptive response. We propose to investigate how c-Abl regulates the crosstalk between p53 and NFκB in response to low doses irradiation. We found in our recent study that low dose IR induces a reciprocal p53 suppression and NFκB activation, which induces HIF-a and subsequently a metabolic reprogramming resulting inmore » a transition from oxidative phosphorylation to glycolysis. Of importance is that this glycolytic switch is essential for the radioadaptive response. This low-dose radiationinduced HIF1α activation was in sharp contrast with the high-dose IR-induced p53 activation and HIF1α inhibition. HIF1α and p53 seem to play distinct roles in mediating the radiation dose-dependent metabolic response. The induction of HIF1α-mediated glycolysis is restricted to a low dose range of radiation, which may have important implications in assessing the level of radiation exposure and its potential health risk. Our results support a dose-dependent metabolic response to IR. When IR doses are below the threshold of causing detectable DNA damage (<0.2Gy) and thus little p53 activation, HIF1α is induced resulting in induction of glycolysis and increased radiation resistance. When the radiation dose reaches levels eliciting DNA damage, p53 is activated and diminishes the activity of HIF1α and glycolysis, leading to the induction of cell death. Our work challenges the LNT model of radiation exposure risk and provides a metabolic mechanism of radioadaptive response. The study supports a need for determining the p53 and HIF1α activity as a potential reliable biological readout of radiation exposure in humans. The exquisite sensitivity of cellular metabolism to low doses of radiation could also serve as a valuable biomarker for estimating the health effects of low-level radiation exposure.« less

An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

PubMed Central

Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

2016-01-01

The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

Characterization of enzymatic properties of human ribonucleotide reductase holoenzyme reconstituted in vitro from hRRM1, hRRM2, and p53R2 subunits.

PubMed

Qiu, Weihua; Zhou, Bingsen; Darwish, Dana; Shao, Jimin; Yen, Yun

2006-02-10

Ribonucleotide reductase (RR) is a highly regulated enzyme in the deoxyribonucleotide synthesis pathway. RR is responsible for the de novo conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates, which are essential for DNA synthesis and repair. Besides two subunits, hRRM1 and hRRM2, p53R2 is a newly identified member of RR family that is induced by ultraviolet light in a p53-dependent manner. To understand the molecular interaction of RR subunits, we employed a eukaryotic expression system to express and purify all three subunits. After in vitro reconstitution, the results of [(3)H]CDP reduction assay showed that both eukaryotic recombinant hRRM2 and p53R2 proteins could interact with hRRM1 to form functional RR holoenzyme. The reconstituted RR activity was time-dependent and the reaction rate reached the plateau phase after 40min incubation. No matter the concentration, RR holoenzyme reconstituted from p53R2 and hRRM1 could only achieve about 40-75% kinetic activity of that from hRRM2 and hRRM1. The synthetic C-terminal heptapeptide competition assays confirmed that hRRM2 and p53R2 share the same binding site on hRRM1, but the binding site on hRRM1 demonstrated higher affinity for hRRM2 than for p53R2. In allosteric regulation assay, the effect of activation or inhibition of hRRM1 with ATP or dATP suggested that these effectors could regulate RR activity independent of different RR small subunits. Taken together, the eukaryotic expression system RR holoenzyme will provide a very useful tool to understand the molecular mechanisms of RR activity and the interactions of its subunits.

A Fusion Protein of the p53 Transaction Domain and the p53-Binding Domain of the Oncoprotein MdmX as an Efficient System for High-Throughput Screening of MdmX Inhibitors.

PubMed

Chen, Rong; Zhou, Jingjing; Qin, Lingyun; Chen, Yao; Huang, Yongqi; Liu, Huili; Su, Zhengding

2017-06-27

In nearly half of cancers, the anticancer activity of p53 protein is often impaired by the overexpressed oncoprotein Mdm2 and its homologue, MdmX, demanding efficient therapeutics to disrupt the aberrant p53-MdmX/Mdm2 interactions to restore the p53 activity. While many potent Mdm2-specific inhibitors have already undergone clinical investigations, searching for MdmX-specific inhibitors has become very attractive, requiring a more efficient screening strategy for evaluating potential scaffolds or leads. In this work, considering that the intrinsic fluorescence residue Trp23 in the p53 transaction domain (p53p) plays an important role in determining the p53-MdmX/Mdm2 interactions, we constructed a fusion protein to utilize this intrinsic fluorescence signal to monitor high-throughput screening of a compound library. The fusion protein was composed of the p53p followed by the N-terminal domain of MdmX (N-MdmX) through a flexible amino acid linker, while the whole fusion protein contained a sole intrinsic fluorescence probe. The fusion protein was then evaluated using fluorescence spectroscopy against model compounds. Our results revealed that the variation of the fluorescence signal was highly correlated with the concentration of the ligand within 65 μM. The fusion protein was further evaluated with respect to its feasibility for use in high-throughput screening using a model compound library, including controls. We found that the imidazo-indole scaffold was a bona fide scaffold for template-based design of MdmX inhibitors. Thus, the p53p-N-MdmX fusion protein we designed provides a convenient and efficient tool for high-throughput screening of new MdmX inhibitors. The strategy described in this work should be applicable for other protein targets to accelerate drug discovery.

Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

2013-01-01

Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

Auto-ubiquitination of Mdm2 Enhances Its Substrate Ubiquitin Ligase Activity*

PubMed Central

Ranaweera, Ruchira S.; Yang, Xiaolu

2013-01-01

The RING domain E3 ubiquitin ligase Mdm2 is the master regulator of the tumor suppressor p53. It targets p53 for proteasomal degradation, restraining the potent activity of p53 and enabling cell survival and proliferation. Like most E3 ligases, Mdm2 can also ubiquitinate itself. How Mdm2 auto-ubiquitination may influence its substrate ubiquitin ligase activity is undefined. Here we show that auto-ubiquitination of Mdm2 is an activating event. Mdm2 that has been conjugated to polyubiquitin chains, but not to single ubiquitins, exhibits substantially enhanced activity to polyubiquitinate p53. Mechanistically, auto-ubiquitination of Mdm2 facilitates the recruitment of the E2 ubiquitin-conjugating enzyme. This occurs through noncovalent interactions between the ubiquitin chains on Mdm2 and the ubiquitin binding domain on E2s. Mutations that diminish the noncovalent interactions render auto-ubiquitination unable to stimulate Mdm2 substrate E3 activity. These results suggest a model in which polyubiquitin chains on an E3 increase the local concentration of E2 enzymes and permit the processivity of substrate ubiquitination. They also support the notion that autocatalysis may be a prevalent mode for turning on the activity of latent enzymes. PMID:23671280

Glucocorticoid receptor activation inhibits p53-induced apoptosis of MCF10Amyc cells via induction of protein kinase Cε.

PubMed

Aziz, Moammir H; Shen, Hong; Maki, Carl G

2012-08-24

Glucocorticoid receptor (GR) is a ligand-dependent transcription factor that can promote apoptosis or survival in a cell-specific manner. Activated GR has been reported to inhibit apoptosis in mammary epithelial cells and breast cancer cells by increasing pro-survival gene expression. In this study, activated GR inhibited p53-dependent apoptosis in MCF10A cells and human mammary epithelial cells that overexpress the MYC oncogene. Specifically, GR agonists hydrocortisone or dexamethasone inhibited p53-dependent apoptosis induced by cisplatin, ionizing radiation, or the MDM2 antagonist Nutlin-3. In contrast, the GR antagonist RU486 sensitized the cells to apoptosis by these agents. Apoptosis inhibition was associated with maintenance of mitochondrial membrane potential, diminished caspase-3 and -7 activation, and increased expression at both the mRNA and protein level of the anti-apoptotic PKC family member PKCε. Knockdown of PKCε via siRNA targeting reversed the protective effect of dexamethasone and restored apoptosis sensitivity. These data provide evidence that activated GR can inhibit p53-dependent apoptosis through induction of the anti-apoptotic factor PKCε.

Adenovirally mediated p53 overexpression diversely influence the cell cycle of HEp-2 and CAL 27 cell lines upon cisplatin and methotrexate treatment.

PubMed

Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta

2009-12-01

p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and on the chemotherapeutics' modality of action.

Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

PubMed

Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

2017-10-01

In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

E2 Proteins from High- and Low-Risk Human Papillomavirus Types Differ in Their Ability To Bind p53 and Induce Apoptotic Cell Death

PubMed Central

Parish, Joanna L.; Kowalczyk, Anna; Chen, Hsin-Tien; Roeder, Geraldine E.; Sessions, Richard; Buckle, Malcolm; Gaston, Kevin

2006-01-01

The E2 proteins from oncogenic (high-risk) human papillomaviruses (HPVs) can induce apoptotic cell death in both HPV-transformed and non-HPV-transformed cells. Here we show that the E2 proteins from HPV type 6 (HPV6) and HPV11, two nononcogenic (low-risk) HPV types, fail to induce apoptosis. Unlike the high-risk HPV16 E2 protein, these low-risk E2 proteins fail to bind p53 and fail to induce p53-dependent transcription activation. Interestingly, neither the ability of p53 to activate transcription nor the ability of p53 to bind DNA, are required for HPV16 E2-induced apoptosis in non-HPV-transformed cells. However, mutations that reduce the binding of the HPV16 E2 protein to p53 inhibit E2-induced apoptosis in non-HPV-transformed cells. In contrast, the interaction between HPV16 E2 and p53 is not required for this E2 protein to induce apoptosis in HPV-transformed cells. Thus, our data suggest that this high-risk HPV E2 protein induces apoptosis via two pathways. One pathway involves the binding of E2 to p53 and can operate in both HPV-transformed and non-HPV-transformed cells. The second pathway requires the binding of E2 to the viral genome and can only operate in HPV-transformed cells. PMID:16611918

Wasabi 6-(methylsulfinyl)hexyl isothiocyanate induces apoptosis in human colorectal cancer cells through p53-independent mitochondrial dysfunction pathway.

PubMed

Yano, Satoshi; Wu, Shusong; Sakao, Kozue; Hou, De-Xing

2018-05-14

6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC), a major bioactive compound in Wasabi [Wasabia japonica (Miq.) Matsum.], has revealed the inhibitory effect on colon carcinogenesis in rat cancer model although the underlying mechanism is unclear. In this study, we used two types of human colorectal cancer cells (HCT116 p53 +/+ and HCT116 p53 -/- ) to investigate the anticancer activity and molecular mechanisms of 6-MSITC. Interestingly, 6-MSITC inhibited the cell proliferation in both types of cells with similar IC 50 value although a light increase in the phosphorylation and accumulation of P53 protein was observed in HCT116 p53 +/+ cells at 24 h after treatment. In addition, 6-MSITC increased the ratio of proapoptotic cells in both types of cells with the same fashion in a p53-independent manner. The data from mitochondrial analysis revealed that 6-MSITC enhanced the ratio of proapoptotic B-cell lymphoma-2-associated X protein/antiapoptotic myeloid cell leukemia 1, and sequentially caused mitochondrial membrane potential (ΔΨ m ) loss, cytochrome c release, and caspase-3 activation in both types of cells. Taken together, Wasabi 6-MSITC induced apoptosis of human colorectal cancer cells in p53-independent mitochondrial dysfunction pathway. These findings suggest that 6-MSITC might be a potential agent for colon cancer chemoprevention although with p53 mutation. © 2018 BioFactors, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

PubMed

Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

2016-11-04

Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

Modulation of the cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by Zac1 through the antagonistic regulators p53 and histone deacetylase 1 in HeLa Cells.

PubMed

Liu, Pei-Yao; Chan, James Yi-Hsin; Lin, Hsiu-Chen; Wang, Sung-Ling; Liu, Shu-Ting; Ho, Ching-Liang; Chang, Li-Chien; Huang, Shih-Ming

2008-07-01

Zac1 is a novel seven-zinc finger protein which possesses the ability to bind specifically to GC-rich DNA elements. Zac1 not only promotes apoptosis and cell cycle arrest but also acts as a transcriptional cofactor for p53 and a number of nuclear receptors. Our previous study indicated that the enhancement of p53 activity by Zac1 is much more pronounced in HeLa cells compared with other cell lines tested. This phenomenon might be due to the coactivator effect of Zac1 on p53 and the ability of Zac1 to reverse E6 inhibition of p53. In the present study, we showed that Zac1 acted synergistically with either p53 or a histone deacetylase inhibitor, trichostatin A, to enhance p21(WAF1/Cip1) promoter activity. We showed that Zac1 physically interacted with some nuclear receptor corepressors such as histone deacetylase 1 (HDAC1) and mSin3a, and the induction of p21(WAF1/Cip1) gene and protein by Zac1 was suppressed by either overexpressing HDAC1 or its deacetylase-dead mutant. In addition, our data suggest that trichostatin A-induced p21(WAF1/Cip1) protein expression might be mediated through a p53-independent and HDAC deacetylase-independent pathway. Taken together, our data suggest that Zac1 might be involved in regulating the p21(WAF1/Cip1) gene and protein expression through its protein-protein interaction with p53 and HDAC1 in HeLa cells.

SOX14 activates the p53 signaling pathway and induces apoptosis in a cervical carcinoma cell line

PubMed Central

Stanisavljevic, Danijela; Petrovic, Isidora; Vukovic, Vladanka; Schwirtlich, Marija; Gredic, Marija; Stevanovic, Milena

2017-01-01

SOX14 is a member of the SOX family of transcription factors mainly involved in the regulation of neural development. Recently, it became evident that SOX14 is one of four hypermethylated genes in cervical carcinoma, considered as a tumor suppressor candidate in this type of malignancy. In this paper we elucidated the role of SOX14 in the regulation of malignant properties of cervical carcinoma cells in vitro. Functional analysis performed in HeLa cells revealed that SOX14 overexpression decreased viability and promoted apoptosis through altering the expression of apoptosis related genes. Our results demonstrated that overexpression of SOX14 initiated accumulation of p53, demonstrating potential cross-talk between SOX14 and the p53 signaling pathway. Further analysis unambiguously showed that SOX14 triggered posttranslational modification of p53 protein, as detected by the significantly increased level of phospho-p53 (Ser-15) in SOX14-overexpressing HeLa cells. Moreover, the obtained results revealed that SOX14 activated p53 protein, which was confirmed by elevated p21Waf1/Cip1, a well known target gene of p53. This study advances our understanding about the role of SOX14 and might explain the molecular mechanism by which this transcription factor could exert tumor suppressor properties in cervical carcinoma. PMID:28926586

Radiosensitivity profiles from a panel of ovarian cancer cell lines exhibiting genetic alterations in p53 and disparate DNA-dependent protein kinase activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.

2009-09-07

The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expressionmore » levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.« less

Decursin exerts anti-cancer activity in MDA-MB-231 breast cancer cells via inhibition of the Pin1 activity and enhancement of the Pin1/p53 association.

PubMed

Kim, Ji-Hyun; Jung, Ji Hoon; Kim, Sung-Hoon; Jeong, Soo-Jin

2014-02-01

The peptidyl-prolyl cis/trans isomerase Pin1 is overexpressed in a wide variety of cancer cells and thus considered as an important target molecule for cancer therapy. This study demonstrates that decursin, a bioactive compound from Angelica gigas, exert the anti-cancer effect against breast cancer cells via regulation of Pin1 and its related signaling molecules. We observed that decursin induced G1 arrest with decrease in cyclin D1 level in Pin1-expressing breast cancer cells MDA-MB-231, but not Pin1-non-expressing breast cancer cells MDA-MB-157. In addition, decursin significantly reduced protein expression and enzymatic activity of Pin1 in MDA-MB-231 cells. Further, we found that decursin treatment enhanced the p53 expression level and failed to down-regulate Pin1 in the cells transfected with p53 siRNA, indicating the importance of p53 in the decursin-mediated Pin1 inhibition in MDA-MB-231 cells. Decursin stimulated association between Pin1 to p53. Moreover, decursin facilitated p53 transcription in MDA-MB-231 cells. Overall, our current study suggests the potential of decursin as an attractive cancer therapeutic agent for breast cancer by targeting Pin1 protein. Copyright © 2013 John Wiley & Sons, Ltd.

Adenovirus-Mediated p202 Gene Transfer in Breast Cancer Gene Therapy

DTIC Science & Technology

2005-05-01

transcriptional regulation of genes important for cell cycle control, differentiation, and apoptosis (1, 3, 4). Our previous studies have shown that p202...leads to induction of p53 and activation of p53 target gene (e.g., p21 CIP 1). 10. The positive regulation of p53 by IFIXcd can be observed only in...cancers. Together, our data suggest that both Ad-p202 and IFIX may be further developed into efficient therapeutic agents for human cancer gene

Global Conformational Selection and Local Induced Fit for the Recognition between Intrinsic Disordered p53 and CBP

PubMed Central

Yu, Qingfen; Ye, Wei; Wang, Wei; Chen, Hai-Feng

2013-01-01

The transactivation domain (TAD) of tumor suppressor p53 can bind with the nuclear coactivator binding domain (NCBD) of cyclic-AMP response element binding protein (CBP) and activate transcription. NMR experiments demonstrate that both apo-NCBD and TAD are intrinsic disordered and bound NCBD/TAD undergoes a transition to well folded. The recognition mechanism between intrinsic disordered proteins is still hotly debated. Molecular dynamics (MD) simulations in explicit solvent are used to study the recognition mechanism between intrinsic disordered TAD and NCBD. The average RMSD values between bound and corresponding apo states and Kolmogorov-Smirnov P test analysis indicate that TAD and NCBD may follow an induced fit mechanism. Quantitative analysis indicates there is also a global conformational selection. In summary, the recognition of TAD and NCBD might obey a local induced fit and global conformational selection. These conclusions are further supported by high-temperature unbinding kinetics and room temperature landscape analysis. These methods can be used to study the recognition mechanism of other intrinsic disordered proteins. PMID:23555731

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

PubMed

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

A tryptophanol-derived oxazolopiperidone lactam is cytotoxic against tumors via inhibition of p53 interaction with murine double minute proteins.

PubMed

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A L; dos Santos, Daniel J V A; Pérez, Maria; Queiroz, Glória; Leão, Mariana; Santos, Maria M M; Saraiva, Lucília

2015-01-01

Inactivation of the p53 tumor suppressor protein by interaction with murine double minute (MDM) proteins, MDM2 and MDMX, is a common event in human tumors expressing wild-type p53. In these tumors, the simultaneous inhibition of these interactions with MDMs, for a full p53 reactivation, represents a promising anticancer strategy. Herein, we report the identification of a dual inhibitor of the p53 interaction with MDM2 and MDMX, the (S)-tryptophanol derivative OXAZ-1, from the screening of a small library of enantiopure tryptophanol-derived oxazolopiperidone lactams, using a yeast-based assay. With human colon adenocarcinoma HCT116 cell lines expressing wild-type p53 (HCT116 p53(+/+)) and its p53-null isogenic derivative (HCT116 p53(-/-)), it was shown that OXAZ-1 induced a p53-dependent tumor growth-inhibitory effect. In fact, OXAZ-1 induced p53 stabilization, up-regulated p53 transcription targets, such as MDM2, MDMX, p21, Puma and Bax, and led to PARP cleavage, in p53(+/+), but not in p53(-/-), HCT116 cells. In addition, similar tumor cytotoxic effects were observed for OXAZ-1 against MDMX-overexpressing breast adenocarcinoma MCF-7 tumor cells, commonly described as highly resistant to MDM2-only inhibitors. In HCT116 p53(+/+) cells, the disruption of the p53 interaction with MDMs by OXAZ-1 was further confirmed by co-immunoprecipitation. It was also shown that OXAZ-1 potently triggered a p53-dependent mitochondria-mediated apoptosis, characterized by reactive oxygen species generation, mitochondrial membrane potential dissipation, Bax translocation to mitochondria, and cytochrome c release, and exhibited a p53-dependent synergistic effect with conventional chemotherapeutic drugs. Collectively, in this work, a novel selective activator of the p53 pathway is reported with promising antitumor properties to be explored either alone or combined with conventional chemotherapeutic drugs. Moreover, OXAZ-1 may represent a promising starting scaffold to search for new dual inhibitors of the p53-MDMs interaction. Copyright © 2015 Elsevier Ltd. All rights reserved.

Deletion of ribosomal protein genes is a common vulnerability in human cancer, especially in concert with TP53 mutations.

PubMed

Ajore, Ram; Raiser, David; McConkey, Marie; Jöud, Magnus; Boidol, Bernd; Mar, Brenton; Saksena, Gordon; Weinstock, David M; Armstrong, Scott; Ellis, Steven R; Ebert, Benjamin L; Nilsson, Björn

2017-04-01

Heterozygous inactivating mutations in ribosomal protein genes (RPGs) are associated with hematopoietic and developmental abnormalities, activation of p53, and altered risk of cancer in humans and model organisms. Here we performed a large-scale analysis of cancer genome data to examine the frequency and selective pressure of RPG lesions across human cancers. We found that hemizygous RPG deletions are common, occurring in about 43% of 10,744 cancer specimens and cell lines. Consistent with p53-dependent negative selection, such lesions are underrepresented in TP53 -intact tumors ( P  ≪ 10 -10 ), and shRNA-mediated knockdown of RPGs activated p53 in TP53 -wild-type cells. In contrast, we did not see negative selection of RPG deletions in TP53 -mutant tumors. RPGs are conserved with respect to homozygous deletions, and shRNA screening data from 174 cell lines demonstrate that further suppression of hemizygously deleted RPGs inhibits cell growth. Our results establish RPG haploinsufficiency as a strikingly common vulnerability of human cancers that associates with TP53 mutations and could be targetable therapeutically. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

PubMed

Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

2016-07-19

The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

Genomic alterations in spontaneous and carcinogen-induced murine melanoma cell lines.

PubMed

Melnikova, Vladislava O; Bolshakov, Svetlana V; Walker, Christopher; Ananthaswamy, Honnavara N

2004-03-25

We have conducted an analysis of genetic alterations in spontaneous murine melanoma cell line B16F0 and its two metastatic clones, B16F1 and B16F10 and the carcinogen-induced murine melanoma cell lines CM519, CM3205, and K1735. We found that unlike human melanomas, the murine melanoma cell lines did not have activating mutations in the Braf oncogene at exon 11 or 15. However, there were distinct patterns of alterations in the ras, Ink4a/Arf, and p53 genes in the two melanoma groups. In the spontaneous B16 melanoma cell lines, expression of p16Ink4a and p19Arf tumor suppressor proteins was lost as a consequence of a large deletion spanning Ink4a/Arf exons 1alpha, 1beta, and 2. In contrast, the carcinogen-induced melanoma cell lines expressed p16Ink4a but had inactivating mutations in either p19Arf (K1735) or p53 (CM519 and CM3205). Inactivation of p19Arf or p53 in carcinogen-induced melanomas was accompanied by constitutive activation of mitogen-activated protein kinases (MAPKs) and/or mutation-associated activation of N-ras. These results indicate that genetic alterations in p16Ink4a/p19Arf, p53 and ras-MAPK pathways can cooperate in the development of murine melanoma.

JS-K, a GST-activated nitric oxide donor prodrug, enhances chemo-sensitivity in renal carcinoma cells and prevents cardiac myocytes toxicity induced by Doxorubicin.

PubMed

Qiu, Mingning; Ke, Longzhi; Zhang, Sai; Zeng, Xin; Fang, Zesong; Liu, Jianjun

2017-08-01

Doxorubicin, a highly effective and widely used anthracycline antibiotic in multiple chemotherapy regimens, has been limited by its cardiotoxicity. The aim of this study is to investigate the effect of nitric oxide donor prodrug JS-K on proliferation and apoptosis in renal carcinoma cells and cardiac myocytes toxicity induced by Doxorubicin and to explore possible p53-related mechanism in renal carcinoma cells. The effect of JS-K on anti-cancer activity of Doxorubicin was investigated in renal carcinoma cells via detecting cell proliferation, cytotoxicity, cell death and apoptosis and expressions of apoptotic-related proteins. Effect of p53 on the combination of JS-K and Doxorubicin was determined using p53 inhibitor Pifithrin-α and p53 activator III. Furthermore, the effect of JS-K on cardiac myocytes toxicity of Doxorubicin was investigated in H9c2 (2-1) cardiac myocytes via measuring cell growth, cell death and apoptosis, expressions of proteins involved in apoptosis and intracellular reactive oxygen species. We demonstrated that JS-K could increase Doxorubicin-induced renal carcinoma cell growth suppression and apoptosis and could increase expressions of proteins that are involved in apoptosis. Additionally, Pifithrin-α reversed the promoting effect of JS-K on Doxorubicin-induced renal carcinoma cell apoptosis; conversely, the p53 activator III exacerbated the promoting effect of JS-K on Doxorubicin-induced renal carcinoma cell apoptosis. Furthermore, JS-K protected H9c2 (2-1) cardiac myocytes against Doxorubicin-induced toxicity and decreased Doxorubicin-induced reactive oxygen species production. JS-K enhances the anti-cancer activity of Doxorubicin in renal carcinoma cells by upregulating p53 expression and prevents cardiac myocytes toxicity of Doxorubicin by decreasing oxidative stress.

Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

PubMed Central

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

2011-01-01

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

PubMed

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

2011-09-23

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

Proton induces apoptosis of hypoxic tumor cells by the p53-dependent and p38/JNK MAPK signaling pathways.

PubMed

Lee, Kheun Byeol; Kim, Kye-Ryung; Huh, Tae-Lin; Lee, You Mie

2008-12-01

Tumor hypoxia is a main obstacle for radiation therapy. To investigate whether exposure to a proton beam can overcome radioresistance in hypoxic tumor cells, three kinds of cancer cells, Lewis lung carcinoma (LLC) cells, hepatoma HepG2 and Molt-4 leukemia cells, were treated with a proton beam (35 MeV, 1, 2, 5, 10 Gy) in the presence or absence of hypoxia. Cell death rates were determined 72 h after irradiation. Hypoxic cells exposed to the proton beam underwent a typical apoptotic program, showing condensed nuclei, fragmented DNA ladders, and poly-ADP-ribose polymerase (PARP) cleavage. Fluorescence-activated cell sorter analysis revealed a significant increase in Annexin-V-positive cells. Cells treated with the proton beam and hypoxia displayed increased expression of p53, p21 and Bax, but decreased levels of phospho-Rb, Bcl-2 and XIAP, as well as activated caspase-9 and -3. The proton beam with hypoxia induced cell death in wild-type HCT116 cells, but not in a p53 knockout cell line, demonstrating a requirement for p53. As reactive oxygen species (ROS) were also significantly increased, apoptosis could also be abolished by treatment with the anti-oxidant N-acetyl cysteine (NAC). P38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) were activated by the treatment, and their respective DN mutants restored the cell death induced by either proton therapy alone or with hypoxia. In conclusion, proton beam treatment did not differently regulate cancer cell apoptosis either in normoxic or hypoxic conditions via a p53-dependent mechanism and by the activation of p38/JNK MAPK pathways through ROS.

Expression of regulatory proteins and proliferative activity in relation to phenotypic characteristics of upper urothelial carcinoma.

PubMed

Dolićanin, Zana; Velicković, Ljubinka Janković; Djordjević, Biljana; Visnjić, Milan; Pesić, Ivana; Ristić, Ana; Marjanović, Vesna

2011-07-01

Deregulation of the normal cell cycle is common in upper urothelial carcinoma (UUC). The aim of this study was to investigate the expression of regulatory proteins of the cell cycle (p53, p16, cyclin D1, HER-2) and proliferative Ki-67 activity in UUC, and to determine their interaction and influence on the phenotypic characteristics of UUC. In 44 patients with UUC, histopathological and immunohistochemical analyses (p53, p16, cyclin D1, HER-2, and Ki-67) of tumors were done. Overexpression/altered expression of p53, p16, cyclin D1 or HER-2 was detected in 20%, 57%, 64%, and 57% of tumors, respectively. Eleven (25%) UUC had a high proliferative Ki-67 index. Forty patients (91%) had at least one marker altered, while four (9%) tumors had a wild-type status. Analysis of relationship between expressions of molecular markers showed that only high expression of p53 was significantly associated with altered p16 activity (p < 0.05). High Ki-67 index was associated with the high stage (p < 0.005), solid growth (p < 0.01), high grade (p < 0.05), and multifocality p < 0.05) of UUC, while high expression of p53 was associated with the solid growth (p < 0.05). In regression models that included all molecular markers and phenotypic characteristics, only Ki-67 correlated with the growth (p < 0.0001), stage (p < 0.01), grade (p < 0.05) and multifocality (p < 0.05) of UCC; (Ki-67 and HER-2 expression correlated with the lymphovascular invasion (p < 0.05). This investigation showed that only negative regulatory proteins of the cell cycle, p53 and p16, were significantly associated in UUC, while proliferative marker Ki-67 was in relation to the key phenotypic characteristics of UUC in the best way.

Nucleophosmin regulates the stability and transcriptional activity of p53.

PubMed

Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe

2002-07-01

Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.

Functional characterization of p53 pathway components in the ancient metazoan Trichoplax adhaerens

NASA Astrophysics Data System (ADS)

Siau, Jia Wei; Coffill, Cynthia R.; Zhang, Weiyun Villien; Tan, Yaw Sing; Hundt, Juliane; Lane, David; Verma, Chandra; Ghadessy, Farid

2016-09-01

The identification of genes encoding a p53 family member and an Mdm2 ortholog in the ancient placozoan Trichoplax adhaerens advocates for the evolutionary conservation of a pivotal stress-response pathway observed in all higher eukaryotes. Here, we recapitulate several key functionalities ascribed to this known interacting protein pair by analysis of the placozoan proteins (Tap53 and TaMdm2) using both in vitro and cellular assays. In addition to interacting with each other, the Tap53 and TaMdm2 proteins are also able to respectively bind human Mdm2 and p53, providing strong evidence for functional conservation. The key p53-degrading function of Mdm2 is also conserved in TaMdm2. Tap53 retained DNA binding associated with p53 transcription activation function. However, it lacked transactivation function in reporter genes assays using a heterologous cell line, suggesting a cofactor incompatibility. Overall, the data supports functional roles for TaMdm2 and Tap53, and further defines the p53 pathway as an evolutionary conserved fulcrum mediating cellular response to stress.

Cell cycle regulation and apoptosis mediated by p53 in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei.

PubMed

Nuñez-Hernandez, Dahlia M; Felix-Portillo, Monserrath; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria

2018-01-01

Although hypoxic aquatic environments cause negative effects on shrimp, these animals can withstand somewhat hypoxia, but the cellular mechanisms underlying this capacity are still poorly understood. In humans, mild hypoxia causes the induction of many proteins to allow cell survival. In contrast, apoptosis is induced during severe hypoxia leading to cell death. p53 is a key transcription factor that determines cells fate towards cell cycle arrest or induction of apoptosis in humans. The aim of this work was to study the role of p53 in cell cycle regulation and apoptosis in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei. p53 was silenced by RNAi and afterwards the shrimp were exposed to hypoxia. Cdk-2 was used as indicator of cell cycle progression while caspase-3 expression and caspase activity were analyzed as indicators of apoptosis. p53 levels in hepatopancreas were significantly higher at 48 h after hypoxic treatment. Increased expression levels of Cdk-2 were found in p53-silenced shrimp after 24 and 48 h in the normoxic treatments as well as 48 h after hypoxia, indicating a possible role of p53 in cell cycle regulation. In response to hypoxia, unsilenced shrimp showed an increase in caspase-3 expression levels, however an increase was also observed in caspase activity at 24 h of normoxic conditions in p53-silenced shrimps. Taken together these results indicate the involvement of p53 in regulation of cell cycle and apoptosis in the white shrimp in response to hypoxia. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

PubMed

De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

2017-05-01

Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Accumulation of p53 in infectious mononucleosis tissues.

PubMed

Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

2000-11-01

Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

Proteasome inhibition mediates p53 reactivation and anti-cancer activity of 6-gingerol in cervical cancer cells.

PubMed

Rastogi, Namrata; Duggal, Shivali; Singh, Shailendra Kumar; Porwal, Konica; Srivastava, Vikas Kumar; Maurya, Rakesh; Bhatt, M L B; Mishra, Durga Prasad

2015-12-22

Human papilloma virus (HPV) expressing E6 and E7 oncoproteins, is known to inactivate the tumor suppressor p53 through proteasomal degradation in cervical cancers. Therefore, use of small molecules for inhibition of proteasome function and induction of p53 reactivation is a promising strategy for induction of apoptosis in cervical cancer cells. The polyphenolic alkanone, 6-Gingerol (6G), present in the pungent extracts of ginger (Zingiber officinale Roscoe) has shown potent anti-tumorigenic and pro-apoptotic activities against a variety of cancers. In this study we explored the molecular mechanism of action of 6G in human cervical cancer cells in vitro and in vivo. 6G potently inhibited proliferation of the HPV positive cervical cancer cells. 6G was found to: (i) inhibit the chymotrypsin activity of proteasomes, (ii) induce reactivation of p53, (iii) increase levels of p21, (iv) induce DNA damage and G2/M cell cycle arrest, (v) alter expression levels of p53-associated apoptotic markers like, cleaved caspase-3 and PARP, and (vi) potentiate the cytotoxicity of cisplatin. 6G treatment induced significant reduction of tumor volume, tumor weight, proteasome inhibition and p53 accumulation in HeLa xenograft tumor cells in vivo. The 6G treatment was devoid of toxic effects as it did not affect body weights, hematological and osteogenic parameters. Taken together, our data underscores the therapeutic and chemosensitizing effects of 6G in the management and treatment of cervical cancer.

Proteasome inhibition mediates p53 reactivation and anti-cancer activity of 6-Gingerol in cervical cancer cells

PubMed Central

Rastogi, Namrata; Duggal, Shivali; Singh, Shailendra Kumar; Porwal, Konica; Srivastava, Vikas Kumar; Maurya, Rakesh; Bhatt, Madan L.B.; Mishra, Durga Prasad

2015-01-01

Human papilloma virus (HPV) expressing E6 and E7 oncoproteins, is known to inactivate the tumor suppressor p53 through proteasomal degradation in cervical cancers. Therefore, use of small molecules for inhibition of proteasome function and induction of p53 reactivation is a promising strategy for induction of apoptosis in cervical cancer cells. The polyphenolic alkanone, 6-Gingerol (6G), present in the pungent extracts of ginger (Zingiber officinale Roscoe) has shown potent anti-tumorigenic and pro-apoptotic activities against a variety of cancers. In this study we explored the molecular mechanism of action of 6G in human cervical cancer cells in vitro and in vivo. 6G potently inhibited proliferation of the HPV positive cervical cancer cells. 6G was found to: (i) inhibit the chymotrypsin activity of proteasomes, (ii) induce reactivation of p53, (iii) increase levels of p21, (iv) induce DNA damage and G2/M cell cycle arrest, (v) alter expression levels of p53-associated apoptotic markers like, cleaved caspase-3 and PARP, and (vi) potentiate the cytotoxicity of cisplatin. 6G treatment induced significant reduction of tumor volume, tumor weight, proteasome inhibition and p53 accumulation in HeLa xenograft tumor cells in vivo. The 6G treatment was devoid of toxic effects as it did not affect body weights, hematological and osteogenic parameters. Taken together, our data underscores the therapeutic and chemosensitizing effects of 6G in the management and treatment of cervical cancer. PMID:26621832

Vectors to Increase Production Efficiency of Inducible Pluripotent Stem Cell (iPSC) | NCI Technology Transfer Center | TTC

Cancer.gov

This invention describes the discovery that specific p53 isoform increase the number of inducible pluripotent stem cells (iPS). It is known that the activity of p53 regulates the self-renewal and pluripotency of normal and cancer stem cells, and also affects re-programming efficiency of iPS cells. This p53 isoform-based technology provides a more natural process of increasing iPS cell production than previous methods of decreasing p53. NCI seeks licensees for this technology.

Rapid and efficient hydrophilicity tuning of p53/mdm2 antagonists*

PubMed Central

Srivastava, Stuti; Beck, Barbara; Wang, Wei; Czarna, Anna; Holak, Tad A.; Dömling, Alexander

2009-01-01

The protein-protein interaction of p53 and mdm2 is an important anticancer target. The interface, however, is very hydrophobic and naturally results in very hydrophobic antagonists. We used the Orru three component reaction (O-3CR) along with a rapid and efficient, recently discovered amidation reaction to dramatically improve the water solubility of our recently discovered low molecular weight p53/mdm2 antagonists. Arrays of amides were synthesized with improved hydrophilicity and retainment and/or improvement of p53/mdm2 inhibitory activity. PMID:19548636

Discovery and Cocrystal Structure of Benzodiazepinedione HDM2 Antagonists that Activate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grasberger,B.; Lu, T.; Schubert, C.

2005-01-01

HDM2 binds to an {alpha}-helical transactivation domain of p53, inhibiting its tumor suppressive functions. A miniaturized thermal denaturation assay was used to screen chemical libraries, resulting in the discovery of a novel series of benzodiazepinedione antagonists of the HDM2-p53 interaction. The X-ray crystal structure of improved antagonists bound to HDM2 reveals their {alpha}-helix mimetic properties. These optimized molecules increase the transcription of p53 target genes and decrease proliferation of tumor cells expressing wild-type p53.

Identification of a small molecule that overcomes HdmX-mediated suppression of p53

PubMed Central

Chakrabarti, Amit; Karan, Sukanya; Liu, Zhigang; Xia, Zhiqiang; Gundluru, Mahesh; Moreton, Stephen; Saunthararajah, Yogen; Jackson, Mark W; Agarwal, Mukesh K; Wald, David N

2016-01-01

Inactivation of the p53 tumor suppressor by mutation or overexpression of negative regulators occurs frequently in cancer. Since p53 plays a key role in regulating proliferation or apoptosis in response to DNA damaging chemotherapies, strategies aimed at reactivating p53 are increasingly being sought. Strategies to reactivate wild-type p53 include the use of small molecules capable of releasing wild-type p53 from key, cellular negative regulators, such as Hdm2 and HdmX. Derivatives of the Hdm2 antagonist Nutlin-3 are in clinical trials. However, Nutlin-3 specifically disrupts Hdm2-p53, leaving tumors harboring high levels of HdmX resistant to Nutlin-3 treatment. Here we identify CTX1, a novel small molecule that overcomes HdmX-mediated p53 repression. CTX1 binds directly to HdmX to prevent p53-HdmX complex formation, resulting in the rapidly induction of p53 in a DNA damage-independent manner. Treatment of a panel of cancer cells with CTX1 induced apoptosis or suppressed proliferation and importantly, CTX1 demonstrates promising activity as a single agent in a mouse model of circulating primary human leukemia. CTX1 is a small molecule HdmX inhibitor that demonstrates promise as a cancer therapeutic candidate. PMID:26883273

Various stress stimuli rewire the profile of liver secretome in a p53-dependent manner.

PubMed

Charni-Natan, Meital; Solomon, Hilla; Molchadsky, Alina; Jacob-Berger, Adi; Goldfinger, Naomi; Rotter, Varda

2018-05-29

Liver is an important secretory organ that consistently manages various insults in order to retain whole-body homeostasis. Importantly, it was suggested that the tumor-suppressor p53 plays a role in a variety of liver physiological processes and thus it is being regarded as a systemic homeostasis regulator. Using high-throughput mass spectrometric analysis, we identified various p53-dependent liver secretome profiles. This allowed a global view on the role of p53 in maintaining the harmony of liver and whole-body homeostasis. We found that p53 altered the liver secretome differently under various conditions. Under physiological conditions, p53 controls factors that are related mainly to lipid metabolism and injury response. Upon exposure to various types of cancer therapy agents, the hepatic p53 is activated and induces the secretion of proteins related to additional pathways, such as hemostasis, immune response, and cell adhesion. Interestingly, we identified a possible relationship between p53-dependent liver functions and lung tumors. The latter modify differently liver secretome profile toward the secretion of proteins mainly related to cell migration and immune response. The notion that p53 may rewire the liver secretome profile suggests a new non-cell autonomous role of p53 that affect different liver functions and whole organism homeostasis.

Dynamic of oxidative and nitrosative stress markers during the convalescent period of stroke patients undergoing rehabilitation.

PubMed

Manolescu, Bogdan Nicolae; Berteanu, M; Oprea, E; Chiriac, N; Dumitru, L; Vladoiu, S; Popa, O; Ianas, O

2011-07-01

Stroke patients have a redox imbalance, a consequence of both the cerebrovascular event and the associated pathological conditions. Our study was aimed to investigate the dynamic of some oxidative and nitrosative markers during the convalescent phase of postacute stroke patients undergoing rehabilitation. We assessed thiol, advanced oxidation protein product, protein carbonyl, 3-nitro-l-tyrosine, ceruloplasmin and oxidized LDL concentrations, as well as gamma-glutamyltranspeptidase (GGT) activity in 20 patients at the beginning of the hospitalization and at the discharge moment, respectively, and 24 apparently healthy controls. We found significantly increased values for GGT (P = 0.04), ceruloplasmin (P = 0.01) and protein carbonyl (P = 0.04) in stroke patients at the hospitalization moment when compared with healthy controls, while total thiols were significantly decreased (P = 0.002). Rehabilitation was associated with a significant decrease of protein carbonyl (P = 0.03) and oxidized LDL particle concentrations (P = 0.03), as well as GGT activity (P = 0.02). At the hospitalization moment, both GGT and ceruloplasmin were significantly negatively correlated with non-proteic thiols (r = -0.44, P = 0.049, and r = -0.53, P = 0.015, respectively) and significantly positively with protein carbonyls (r = +0.80, P < 0.001, and r = +0.69, P < 0.001, respectively) suggesting putative roles of GGT and ceruloplasmin in the redox imbalance. These results highlight the existence of a redox imbalance in postacute stroke patients, and the possible benefits of an antioxidant-based therapy for the recovery of these patients.