qSR: a quantitative super-resolution analysis tool reveals the cell-cycle dependent organization of RNA Polymerase I in live human cells.

PubMed

Andrews, J O; Conway, W; Cho, W -K; Narayanan, A; Spille, J -H; Jayanth, N; Inoue, T; Mullen, S; Thaler, J; Cissé, I I

2018-05-09

We present qSR, an analytical tool for the quantitative analysis of single molecule based super-resolution data. The software is created as an open-source platform integrating multiple algorithms for rigorous spatial and temporal characterizations of protein clusters in super-resolution data of living cells. First, we illustrate qSR using a sample live cell data of RNA Polymerase II (Pol II) as an example of highly dynamic sub-diffractive clusters. Then we utilize qSR to investigate the organization and dynamics of endogenous RNA Polymerase I (Pol I) in live human cells, throughout the cell cycle. Our analysis reveals a previously uncharacterized transient clustering of Pol I. Both stable and transient populations of Pol I clusters co-exist in individual living cells, and their relative fraction vary during cell cycle, in a manner correlating with global gene expression. Thus, qSR serves to facilitate the study of protein organization and dynamics with very high spatial and temporal resolutions directly in live cell.

High Throughput Protein Quantitation using MRM Viewer Software and Dynamic MRM on a Triple Quadruple Mass Spectrometer

PubMed Central

Miller, C.; Waddell, K.; Tang, N.

2010-01-01

RP-122 Peptide quantitation using Multiple Reaction Monitoring (MRM) has been established as an important methodology for biomarker verification andvalidation.This requires high throughput combined with high sensitivity to analyze potentially thousands of target peptides in each sample.Dynamic MRM allows the system to only acquire the required MRMs of the peptide during a retention window corresponding to when each peptide is eluting. This reduces the number of concurrent MRM and therefore improves quantitation and sensitivity. MRM Selector allows the user to generate an MRM transition list with retention time information from discovery data obtained on a QTOF MS system.This list can be directly imported into the triple quadrupole acquisition software.However, situations can exist where a) the list of MRMs contain an excess of MRM transitions allowable under the ideal acquisition conditions chosen ( allowing for cycle time and chromatography conditions), or b) too many transitions in a certain retention time region which would result in an unacceptably low dwell time and cycle time.A new tool - MRM viewer has been developed to help users automatically generate multiple dynamic MRM methods from a single MRM list.In this study, a list of 3293 MRM transitions from a human plasma sample was compiled.A single dynamic MRM method with 3293 transitions results in a minimum dwell time of 2.18ms.Using MRM viewer we can generate three dynamic MRM methods with a minimum dwell time of 20ms which can give a better quality MRM quantitation.This tool facilitates both high throughput and high sensitivity for MRM quantitation.

Further evidences for sleep instability and impaired spindle-delta dynamics in schizophrenia: a whole-night polysomnography study with neuroloop-gain and sleep-cycle analysis.

PubMed

Sasidharan, Arun; Kumar, Sunil; Nair, Ajay Kumar; Lukose, Ammu; Marigowda, Vrinda; John, John P; Kutty, Bindu M

2017-10-01

Sleep offers a unique window into the brain dysfunctions in schizophrenia. Many past sleep studies have reported abnormalities in both macro-sleep architecture (like increased awakenings) as well as micro-sleep-architecture (like spindle deficits) in patients with schizophrenia (PSZ). The present study attempts to replicate previous reports of macro- and micro-sleep-architectural abnormalities in schizophrenia. In addition, the study also examined sleep-stage changes and spindle-delta dynamics across sleep-cycles to provide further evidence in support of the dysfunctional thalamocortical mechanisms causing sleep instability and poor sleep maintenance associated with schizophrenia pathophysiology. Whole-night polysomnography was carried out among 45 PSZ and 39 age- and gender-matched healthy control subjects. Sleep-stage dynamics were assessed across sleep-cycles using a customized software algorithm. Spindle-delta dynamics across sleep-cycles were determined using neuroloop-gain analysis. PSZ showed macro-sleep architecture abnormalities such as prolonged sleeplessness, increased intermittent-awakenings, long sleep-onset latency, reduced non-rapid eye movement (NREM) stage 2 sleep, increased stage transitions, and poor sleep efficiency. They also showed reduced spindle density (sigma neuroloop-gain) but comparable slow wave density (delta neuroloop-gain) throughout the sleep. Sleep-cycle-wise analysis revealed transient features of sleep instability due to significantly increased intermittent awakenings especially in the first and third sleep-cycles, and unstable and recurrent stage transitions in both NREM (first sleep-cycle) and rapid eye movement (REM) sleep-periods (second sleep-cycle). Spindle deficits were persistent across the first three cycles and were positively correlated with sleep disruption during the subsequent REM sleep. In addition to replicating previously reported sleep deficits in PSZ, the current study showed subtle deficits in NREM-REM alterations across whole-night polysomnography. These results point towards a possible maladaptive interplay between unstable thalamocortical networks, resulting in sleep-cycle-specific instability patterns associated with schizophrenia pathophysiology. Copyright © 2017 Elsevier B.V. All rights reserved.

Implementation of a production Ada project: The GRODY study

NASA Technical Reports Server (NTRS)

Godfrey, Sara; Brophy, Carolyn Elizabeth

1989-01-01

The use of the Ada language and design methodologies that encourage full use of its capabilities have a strong impact on all phases of the software development project life cycle. At the National Aeronautics and Space Administration/Goddard Space Flight Center (NASA/GSFC), the Software Engineering Laboratory (SEL) conducted an experiment in parallel development of two flight dynamics systems in FORTRAN and Ada. The differences observed during the implementation, unit testing, and integration phases of the two projects are described and the lessons learned during the implementation phase of the Ada development are outlined. Included are recommendations for future Ada development projects.

On the engineering of crucial software

NASA Technical Reports Server (NTRS)

Pratt, T. W.; Knight, J. C.; Gregory, S. T.

1983-01-01

The various aspects of the conventional software development cycle are examined. This cycle was the basis of the augmented approach contained in the original grant proposal. This cycle was found inadequate for crucial software development, and the justification for this opinion is presented. Several possible enhancements to the conventional software cycle are discussed. Software fault tolerance, a possible enhancement of major importance, is discussed separately. Formal verification using mathematical proof is considered. Automatic programming is a radical alternative to the conventional cycle and is discussed. Recommendations for a comprehensive approach are presented, and various experiments which could be conducted in AIRLAB are described.

Development of a Stirling System Dynamic Model With Enhanced Thermodynamics

NASA Technical Reports Server (NTRS)

Regan, Timothy F.; Lewandowski, Edward J.

2005-01-01

The Stirling Convertor System Dynamic Model developed at NASA Glenn Research Center is a software model developed from first principles that includes the mechanical and mounting dynamics, the thermodynamics, the linear alternator, and the controller of a free-piston Stirling power convertor, along with the end user load. As such it represents the first detailed modeling tool for fully integrated Stirling convertor-based power systems. The thermodynamics of the model were originally a form of the isothermal Stirling cycle. In some situations it may be desirable to improve the accuracy of the Stirling cycle portion of the model. An option under consideration is to enhance the SDM thermodynamics by coupling the model with Gedeon Associates Sage simulation code. The result will be a model that gives a more accurate prediction of the performance and dynamics of the free-piston Stirling convertor. A method of integrating the Sage simulation code with the System Dynamic Model is described. Results of SDM and Sage simulation are compared to test data. Model parameter estimation and model validation are discussed.

Development of a Stirling System Dynamic Model with Enhanced Thermodynamics

NASA Astrophysics Data System (ADS)

Regan, Timothy F.; Lewandowski, Edward J.

2005-02-01

The Stirling Convertor System Dynamic Model developed at NASA Glenn Research Center is a software model developed from first principles that includes the mechanical and mounting dynamics, the thermodynamics, the linear alternator, and the controller of a free-piston Stirling power convertor, along with the end user load. As such it represents the first detailed modeling tool for fully integrated Stirling convertor-based power systems. The thermodynamics of the model were originally a form of the isothermal Stirling cycle. In some situations it may be desirable to improve the accuracy of the Stirling cycle portion of the model. An option under consideration is to enhance the SDM thermodynamics by coupling the model with Gedeon Associates' Sage simulation code. The result will be a model that gives a more accurate prediction of the performance and dynamics of the free-piston Stirling convertor. A method of integrating the Sage simulation code with the System Dynamic Model is described. Results of SDM and Sage simulation are compared to test data. Model parameter estimation and model validation are discussed.

Dynamic visualization techniques for high consequence software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollock, G.M.

1998-02-01

This report documents a prototype tool developed to investigate the use of visualization and virtual reality technologies for improving software surety confidence. The tool is utilized within the execution phase of the software life cycle. It provides a capability to monitor an executing program against prespecified requirements constraints provided in a program written in the requirements specification language SAGE. The resulting Software Attribute Visual Analysis Tool (SAVAnT) also provides a technique to assess the completeness of a software specification. The prototype tool is described along with the requirements constraint language after a brief literature review is presented. Examples of howmore » the tool can be used are also presented. In conclusion, the most significant advantage of this tool is to provide a first step in evaluating specification completeness, and to provide a more productive method for program comprehension and debugging. The expected payoff is increased software surety confidence, increased program comprehension, and reduced development and debugging time.« less

Trends in computer hardware and software.

PubMed

Frankenfeld, F M

1993-04-01

Previously identified and current trends in the development of computer systems and in the use of computers for health care applications are reviewed. Trends identified in a 1982 article were increasing miniaturization and archival ability, increasing software costs, increasing software independence, user empowerment through new software technologies, shorter computer-system life cycles, and more rapid development and support of pharmaceutical services. Most of these trends continue today. Current trends in hardware and software include the increasing use of reduced instruction-set computing, migration to the UNIX operating system, the development of large software libraries, microprocessor-based smart terminals that allow remote validation of data, speech synthesis and recognition, application generators, fourth-generation languages, computer-aided software engineering, object-oriented technologies, and artificial intelligence. Current trends specific to pharmacy and hospitals are the withdrawal of vendors of hospital information systems from the pharmacy market, improved linkage of information systems within hospitals, and increased regulation by government. The computer industry and its products continue to undergo dynamic change. Software development continues to lag behind hardware, and its high cost is offsetting the savings provided by hardware.

Structural dynamics payload loads estimates

NASA Technical Reports Server (NTRS)

Engels, R. C.

1982-01-01

Methods for the prediction of loads on large space structures are discussed. Existing approaches to the problem of loads calculation are surveyed. A full scale version of an alternate numerical integration technique to solve the response part of a load cycle is presented, and a set of short cut versions of the algorithm developed. The implementation of these techniques using the software package developed is discussed.

Increase Return on Investment of Software Development Life Cycle by Managing the Risk - A Case Study

DTIC Science & Technology

2015-04-01

for increasing the return on investment during the Software Development Life Cycle ( SDLC ) through selected quantitative analyses employing both the...defect rate, return on investment (ROI), software development life cycle ( SDLC ) DE FE N SE A C Q U IS IT IO N UN IVERSITY ALU M N I A SSO C IATIO N R...becomes comfortable due to its intricacies and learning cycle. The same may be said with respect to software development life cycle ( SDLC ) management

Probabilistic Fatigue Damage Program (FATIG)

NASA Technical Reports Server (NTRS)

Michalopoulos, Constantine

2012-01-01

FATIG computes fatigue damage/fatigue life using the stress rms (root mean square) value, the total number of cycles, and S-N curve parameters. The damage is computed by the following methods: (a) traditional method using Miner s rule with stress cycles determined from a Rayleigh distribution up to 3*sigma; and (b) classical fatigue damage formula involving the Gamma function, which is derived from the integral version of Miner's rule. The integration is carried out over all stress amplitudes. This software solves the problem of probabilistic fatigue damage using the integral form of the Palmgren-Miner rule. The software computes fatigue life using an approach involving all stress amplitudes, up to N*sigma, as specified by the user. It can be used in the design of structural components subjected to random dynamic loading, or by any stress analyst with minimal training for fatigue life estimates of structural components.

Software Program: Software Management Guidebook

NASA Technical Reports Server (NTRS)

1996-01-01

The purpose of this NASA Software Management Guidebook is twofold. First, this document defines the core products and activities required of NASA software projects. It defines life-cycle models and activity-related methods but acknowledges that no single life-cycle model is appropriate for all NASA software projects. It also acknowledges that the appropriate method for accomplishing a required activity depends on characteristics of the software project. Second, this guidebook provides specific guidance to software project managers and team leaders in selecting appropriate life cycles and methods to develop a tailored plan for a software engineering project.

The embedded software life cycle - An expanded view

NASA Technical Reports Server (NTRS)

Larman, Brian T.; Loesh, Robert E.

1989-01-01

Six common issues that are encountered in the development of software for embedded computer systems are discussed from the perspective of their interrelationships with the development process and/or the system itself. Particular attention is given to concurrent hardware/software development, prototyping, the inaccessibility of the operational system, fault tolerance, the long life cycle, and inheritance. It is noted that the life cycle for embedded software must include elements beyond simply the specification and implementation of the target software.

Addressing software security risk mitigations in the life cycle

NASA Technical Reports Server (NTRS)

Gilliam, David; Powell, John; Haugh, Eric; Bishop, Matt

2003-01-01

The NASA Office of Safety and Mission Assurance (OSMA) has funded the Jet Propulsion Laboratory (JPL) with a Center Initiative, 'Reducing Software Security Risk through an Integrated Approach' (RSSR), to address this need. The Initiative is a formal approach to addressing software security in the life cycle through the instantiation of a Software Security Assessment Instrument (SSAI) for the development and maintenance life cycles.

Security Risks: Management and Mitigation in the Software Life Cycle

NASA Technical Reports Server (NTRS)

Gilliam, David P.

2004-01-01

A formal approach to managing and mitigating security risks in the software life cycle is requisite to developing software that has a higher degree of assurance that it is free of security defects which pose risk to the computing environment and the organization. Due to its criticality, security should be integrated as a formal approach in the software life cycle. Both a software security checklist and assessment tools should be incorporated into this life cycle process and integrated with a security risk assessment and mitigation tool. The current research at JPL addresses these areas through the development of a Sotfware Security Assessment Instrument (SSAI) and integrating it with a Defect Detection and Prevention (DDP) risk management tool.

Software engineering and the role of Ada: Executive seminar

NASA Technical Reports Server (NTRS)

Freedman, Glenn B.

1987-01-01

The objective was to introduce the basic terminology and concepts of software engineering and Ada. The life cycle model is reviewed. The application of the goals and principles of software engineering is applied. An introductory understanding of the features of the Ada language is gained. Topics addressed include: the software crises; the mandate of the Space Station Program; software life cycle model; software engineering; and Ada under the software engineering umbrella.

Demographic-Based Perceptions of Adequacy of Software Security's Presence within Individual Phases of the Software Development Life Cycle

ERIC Educational Resources Information Center

Kramer, Aleksey

2013-01-01

The topic of software security has become paramount in information technology (IT) related scholarly research. Researchers have addressed numerous software security topics touching on all phases of the Software Development Life Cycle (SDLC): requirements gathering phase, design phase, development phase, testing phase, and maintenance phase.…

Standard practices for the implementation of computer software

NASA Technical Reports Server (NTRS)

Irvine, A. P. (Editor)

1978-01-01

A standard approach to the development of computer program is provided that covers the file cycle of software development from the planning and requirements phase through the software acceptance testing phase. All documents necessary to provide the required visibility into the software life cycle process are discussed in detail.

Hybrid Modeling for Testing Intelligent Software for Lunar-Mars Closed Life Support

NASA Technical Reports Server (NTRS)

Malin, Jane T.; Nicholson, Leonard S. (Technical Monitor)

1999-01-01

Intelligent software is being developed for closed life support systems with biological components, for human exploration of the Moon and Mars. The intelligent software functions include planning/scheduling, reactive discrete control and sequencing, management of continuous control, and fault detection, diagnosis, and management of failures and errors. Four types of modeling information have been essential to system modeling and simulation to develop and test the software and to provide operational model-based what-if analyses: discrete component operational and failure modes; continuous dynamic performance within component modes, modeled qualitatively or quantitatively; configuration of flows and power among components in the system; and operations activities and scenarios. CONFIG, a multi-purpose discrete event simulation tool that integrates all four types of models for use throughout the engineering and operations life cycle, has been used to model components and systems involved in the production and transfer of oxygen and carbon dioxide in a plant-growth chamber and between that chamber and a habitation chamber with physicochemical systems for gas processing.

Towards a general object-oriented software development methodology

NASA Technical Reports Server (NTRS)

Seidewitz, ED; Stark, Mike

1986-01-01

An object is an abstract software model of a problem domain entity. Objects are packages of both data and operations of that data (Goldberg 83, Booch 83). The Ada (tm) package construct is representative of this general notion of an object. Object-oriented design is the technique of using objects as the basic unit of modularity in systems design. The Software Engineering Laboratory at the Goddard Space Flight Center is currently involved in a pilot program to develop a flight dynamics simulator in Ada (approximately 40,000 statements) using object-oriented methods. Several authors have applied object-oriented concepts to Ada (e.g., Booch 83, Cherry 85). It was found that these methodologies are limited. As a result a more general approach was synthesized with allows a designer to apply powerful object-oriented principles to a wide range of applications and at all stages of design. An overview is provided of this approach. Further, how object-oriented design fits into the overall software life-cycle is considered.

Learning & Personality Types: A Case Study of a Software Design Course

ERIC Educational Resources Information Center

Ahmed, Faheem; Campbell, Piers; Jaffar, Ahmad; Alkobaisi, Shayma; Campbell, Julie

2010-01-01

The software industry has continued to grow over the past decade and there is now a need to provide education and hands-on training to students in various phases of software life cycle. Software design is one of the vital phases of the software development cycle. Psychological theories assert that not everybody is fit for all kind of tasks as…

Research on Occupational Safety, Health Management and Risk Control Technology in Coal Mines.

PubMed

Zhou, Lu-Jie; Cao, Qing-Gui; Yu, Kai; Wang, Lin-Lin; Wang, Hai-Bin

2018-04-26

This paper studies the occupational safety and health management methods as well as risk control technology associated with the coal mining industry, including daily management of occupational safety and health, identification and assessment of risks, early warning and dynamic monitoring of risks, etc.; also, a B/S mode software (Geting Coal Mine, Jining, Shandong, China), i.e., Coal Mine Occupational Safety and Health Management and Risk Control System, is developed to attain the aforementioned objectives, namely promoting the coal mine occupational safety and health management based on early warning and dynamic monitoring of risks. Furthermore, the practical effectiveness and the associated pattern for applying this software package to coal mining is analyzed. The study indicates that the presently developed coal mine occupational safety and health management and risk control technology and the associated software can support the occupational safety and health management efforts in coal mines in a standardized and effective manner. It can also control the accident risks scientifically and effectively; its effective implementation can further improve the coal mine occupational safety and health management mechanism, and further enhance the risk management approaches. Besides, its implementation indicates that the occupational safety and health management and risk control technology has been established based on a benign cycle involving dynamic feedback and scientific development, which can provide a reliable assurance to the safe operation of coal mines.

Research on Occupational Safety, Health Management and Risk Control Technology in Coal Mines

PubMed Central

Zhou, Lu-jie; Cao, Qing-gui; Yu, Kai; Wang, Lin-lin; Wang, Hai-bin

2018-01-01

This paper studies the occupational safety and health management methods as well as risk control technology associated with the coal mining industry, including daily management of occupational safety and health, identification and assessment of risks, early warning and dynamic monitoring of risks, etc.; also, a B/S mode software (Geting Coal Mine, Jining, Shandong, China), i.e., Coal Mine Occupational Safety and Health Management and Risk Control System, is developed to attain the aforementioned objectives, namely promoting the coal mine occupational safety and health management based on early warning and dynamic monitoring of risks. Furthermore, the practical effectiveness and the associated pattern for applying this software package to coal mining is analyzed. The study indicates that the presently developed coal mine occupational safety and health management and risk control technology and the associated software can support the occupational safety and health management efforts in coal mines in a standardized and effective manner. It can also control the accident risks scientifically and effectively; its effective implementation can further improve the coal mine occupational safety and health management mechanism, and further enhance the risk management approaches. Besides, its implementation indicates that the occupational safety and health management and risk control technology has been established based on a benign cycle involving dynamic feedback and scientific development, which can provide a reliable assurance to the safe operation of coal mines. PMID:29701715

Addressing software security and mitigations in the life cycle

NASA Technical Reports Server (NTRS)

Gilliam, David; Powell, John; Haugh, Eric; Bishop, Matt

2003-01-01

Traditionally, security is viewed as an organizational and Information Technology (IIJ systems function comprising of Firewalls, intrusion detection systems (IDS), system security settings and patches to the operating system (OS) and applications running on it. Until recently, little thought has been given to the importance of security as a formal approach in the software life cycle. The Jet Propulsion Laboratory has approached the problem through the development of an integrated formal Software Security Assessment Instrument (SSAI) with six foci for the software life cycle.

Addressing software security and mitigations in the life cycle

NASA Technical Reports Server (NTRS)

Gilliam, David; Powell, John; Haugh, Eric; Bishop, Matt

2004-01-01

Traditionally, security is viewed as an organizational and Information Technology (IT) systems function comprising of firewalls, intrusion detection systems (IDS), system security settings and patches to the operating system (OS) and applications running on it. Until recently, little thought has been given to the importance of security as a formal approach in the software life cycle. The Jet Propulsion Laboratory has approached the problem through the development of an integrated formal Software Security Assessment Instrument (SSAI) with six foci for the software life cycle.

Pre Service Teachers' Usage of Dynamic Mathematics Software

ERIC Educational Resources Information Center

Bulut, Mehmet; Bulut, Neslihan

2011-01-01

Aim of this study is about mathematics education and dynamic mathematics software. Dynamic mathematics software provides new opportunities for using both computer algebra system and dynamic geometry software. GeoGebra selected as dynamic mathematics software in this research. In this study, it is investigated that what is the usage of pre service…

Improving the Aircraft Design Process Using Web-Based Modeling and Simulation

NASA Technical Reports Server (NTRS)

Reed, John A.; Follen, Gregory J.; Afjeh, Abdollah A.; Follen, Gregory J. (Technical Monitor)

2000-01-01

Designing and developing new aircraft systems is time-consuming and expensive. Computational simulation is a promising means for reducing design cycle times, but requires a flexible software environment capable of integrating advanced multidisciplinary and multifidelity analysis methods, dynamically managing data across heterogeneous computing platforms, and distributing computationally complex tasks. Web-based simulation, with its emphasis on collaborative composition of simulation models, distributed heterogeneous execution, and dynamic multimedia documentation, has the potential to meet these requirements. This paper outlines the current aircraft design process, highlighting its problems and complexities, and presents our vision of an aircraft design process using Web-based modeling and simulation.

Improving the Aircraft Design Process Using Web-based Modeling and Simulation

NASA Technical Reports Server (NTRS)

Reed, John A.; Follen, Gregory J.; Afjeh, Abdollah A.

2003-01-01

Designing and developing new aircraft systems is time-consuming and expensive. Computational simulation is a promising means for reducing design cycle times, but requires a flexible software environment capable of integrating advanced multidisciplinary and muitifidelity analysis methods, dynamically managing data across heterogeneous computing platforms, and distributing computationally complex tasks. Web-based simulation, with its emphasis on collaborative composition of simulation models, distributed heterogeneous execution, and dynamic multimedia documentation, has the potential to meet these requirements. This paper outlines the current aircraft design process, highlighting its problems and complexities, and presents our vision of an aircraft design process using Web-based modeling and simulation.

An Integrated Fuel Depletion Calculator for Fuel Cycle Options Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, Erich; Scopatz, Anthony

2016-04-25

Bright-lite is a reactor modeling software developed at the University of Texas Austin to expand upon the work done with the Bright [1] reactor modeling software. Originally, bright-lite was designed to function as a standalone reactor modeling software. However, this aim was refocused t couple bright-lite with the Cyclus fuel cycle simulator [2] to make it a module for the fuel cycle simulator.

Programmable, automated transistor test system

NASA Technical Reports Server (NTRS)

Truong, L. V.; Sundburg, G. R.

1986-01-01

A programmable, automated transistor test system was built to supply experimental data on new and advanced power semiconductors. The data will be used for analytical models and by engineers in designing space and aircraft electric power systems. A pulsed power technique was used at low duty cycles in a nondestructive test to examine the dynamic switching characteristic curves of power transistors in the 500 to 1000 V, 10 to 100 A range. Data collection, manipulation, storage, and output are operator interactive but are guided and controlled by the system software.

Modeling SMAP Spacecraft Attitude Control Estimation Error Using Signal Generation Model

NASA Technical Reports Server (NTRS)

Rizvi, Farheen

2016-01-01

Two ground simulation software are used to model the SMAP spacecraft dynamics. The CAST software uses a higher fidelity model than the ADAMS software. The ADAMS software models the spacecraft plant, controller and actuator models, and assumes a perfect sensor and estimator model. In this simulation study, the spacecraft dynamics results from the ADAMS software are used as CAST software is unavailable. The main source of spacecraft dynamics error in the higher fidelity CAST software is due to the estimation error. A signal generation model is developed to capture the effect of this estimation error in the overall spacecraft dynamics. Then, this signal generation model is included in the ADAMS software spacecraft dynamics estimate such that the results are similar to CAST. This signal generation model has similar characteristics mean, variance and power spectral density as the true CAST estimation error. In this way, ADAMS software can still be used while capturing the higher fidelity spacecraft dynamics modeling from CAST software.

STAR-CCM+ Verification and Validation Plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pointer, William David

2016-09-30

The commercial Computational Fluid Dynamics (CFD) code STAR-CCM+ provides general purpose finite volume method solutions for fluid dynamics and energy transport. This document defines plans for verification and validation (V&V) of the base code and models implemented within the code by the Consortium for Advanced Simulation of Light water reactors (CASL). The software quality assurance activities described herein are port of the overall software life cycle defined in the CASL Software Quality Assurance (SQA) Plan [Sieger, 2015]. STAR-CCM+ serves as the principal foundation for development of an advanced predictive multi-phase boiling simulation capability within CASL. The CASL Thermal Hydraulics Methodsmore » (THM) team develops advanced closure models required to describe the subgrid-resolution behavior of secondary fluids or fluid phases in multiphase boiling flows within the Eulerian-Eulerian framework of the code. These include wall heat partitioning models that describe the formation of vapor on the surface and the forces the define bubble/droplet dynamic motion. The CASL models are implemented as user coding or field functions within the general framework of the code. This report defines procedures and requirements for V&V of the multi-phase CFD capability developed by CASL THM. Results of V&V evaluations will be documented in a separate STAR-CCM+ V&V assessment report. This report is expected to be a living document and will be updated as additional validation cases are identified and adopted as part of the CASL THM V&V suite.« less

First-Order-hold interpolation digital-to-analog converter with application to aircraft simulation

NASA Technical Reports Server (NTRS)

Cleveland, W. B.

1976-01-01

Those who design piloted aircraft simulations must contend with the finite size and speed of the available digital computer and the requirement for simulation reality. With a fixed computational plant, the more complex the model, the more computing cycle time is required. While increasing the cycle time may not degrade the fidelity of the simulated aircraft dynamics, the larger steps in the pilot cue feedback variables (such as the visual scene cues), may be disconcerting to the pilot. The first-order-hold interpolation (FOHI) digital-to-analog converter (DAC) is presented as a device which offers smooth output, regardless of cycle time. The Laplace transforms of these three conversion types are developed and their frequency response characteristics and output smoothness are compared. The FOHI DAC exhibits a pure one-cycle delay. Whenever the FOHI DAC input comes from a second-order (or higher) system, a simple computer software technique can be used to compensate for the DAC phase lag. When so compensated, the FOHI DAC has (1) an output signal that is very smooth, (2) a flat frequency response in frequency ranges of interest, and (3) no phase error. When the input comes from a first-order system, software compensation may cause the FOHI DAC to perform as an FOHE DAC, which, although its output is not as smooth as that of the FOHI DAC, has a smoother output than that of the ZOH DAC.

Real-time software failure characterization

NASA Technical Reports Server (NTRS)

Dunham, Janet R.; Finelli, George B.

1990-01-01

A series of studies aimed at characterizing the fundamentals of the software failure process has been undertaken as part of a NASA project on the modeling of a real-time aerospace vehicle software reliability. An overview of these studies is provided, and the current study, an investigation of the reliability of aerospace vehicle guidance and control software, is examined. The study approach provides for the collection of life-cycle process data, and for the retention and evaluation of interim software life-cycle products.

Integrating automated support for a software management cycle into the TAME system

NASA Technical Reports Server (NTRS)

Sunazuka, Toshihiko; Basili, Victor R.

1989-01-01

Software managers are interested in the quantitative management of software quality, cost and progress. An integrated software management methodology, which can be applied throughout the software life cycle for any number purposes, is required. The TAME (Tailoring A Measurement Environment) methodology is based on the improvement paradigm and the goal/question/metric (GQM) paradigm. This methodology helps generate a software engineering process and measurement environment based on the project characteristics. The SQMAR (software quality measurement and assurance technology) is a software quality metric system and methodology applied to the development processes. It is based on the feed forward control principle. Quality target setting is carried out before the plan-do-check-action activities are performed. These methodologies are integrated to realize goal oriented measurement, process control and visual management. A metric setting procedure based on the GQM paradigm, a management system called the software management cycle (SMC), and its application to a case study based on NASA/SEL data are discussed. The expected effects of SMC are quality improvement, managerial cost reduction, accumulation and reuse of experience, and a highly visual management reporting system.

Dynamic Modeling of New Technology Succession: Projecting the Impact of Macro Events and Micro Behaviors On Software Market Cycles

NASA Astrophysics Data System (ADS)

Mertz, Sharon A.; Groothuis, Adam; Fellman, Philip Vos

The subject of technology succession and new technology adoption in a generalized sense has been addressed by numerous authors for over one hundred years. Models which accommodate macro-level events as well as micro-level actions are needed to gain insight to future market outcomes. In the ICT industry, macro-level factors affecting technology adoption include global events and shocks, economic factors, and global regulatory trends. Micro-level elements involve individual agent actions and interactions, such as the behaviors of buyers and suppliers in reaction to each other, and to macro events. Projecting technology adoption and software market composition and growth requires evaluating a special set of technology characteristics, buyer behaviors, and supplier issues and responses which make this effort particularly challenging.

Method of experimental and calculation determination of dissipative properties of carbon

NASA Astrophysics Data System (ADS)

Kazakova, Olga I.; Smolin, Igor Yu.; Bezmozgiy, Iosif M.

2017-12-01

This paper describes the process of definition of relations between the damping ratio and strain/state levels in a material. For these purposes, the experimental-calculation approach was applied. The experimental research was performed on plane composite specimens. The tests were accompanied by finite element modeling using the ANSYS software. Optimization was used as a tool for FEM property setting and for finding the above-mentioned relations. A difference between the calculation and experimental results was accepted as objective functions of this optimization. The optimization cycle was implemented using the pSeven DATADVANCE software platform. The developed approach makes it possible to determine the relations between the damping ratio and strain/state levels in the material, which can be used for computer modeling of the structure response under dynamic loading.

Towards a general object-oriented software development methodology

NASA Technical Reports Server (NTRS)

Seidewitz, ED; Stark, Mike

1986-01-01

Object diagrams were used to design a 5000 statement team training exercise and to design the entire dynamics simulator. The object diagrams are also being used to design another 50,000 statement Ada system and a personal computer based system that will be written in Modula II. The design methodology evolves out of these experiences as well as the limitations of other methods that were studied. Object diagrams, abstraction analysis, and associated principles provide a unified framework which encompasses concepts from Yourdin, Booch, and Cherry. This general object-oriented approach handles high level system design, possibly with concurrency, through object-oriented decomposition down to a completely functional level. How object-oriented concepts can be used in other phases of the software life-cycle, such as specification and testing is being studied concurrently.

Information system life-cycle and documentation standards, volume 1

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

The Software Management and Assurance Program (SMAP) Information System Life-Cycle and Documentation Standards Document describes the Version 4 standard information system life-cycle in terms of processes, products, and reviews. The description of the products includes detailed documentation standards. The standards in this document set can be applied to the life-cycle, i.e., to each phase in the system's development, and to the documentation of all NASA information systems. This provides consistency across the agency as well as visibility into the completeness of the information recorded. An information system is software-intensive, but consists of any combination of software, hardware, and operational procedures required to process, store, or transmit data. This document defines a standard life-cycle model and content for associated documentation.

Simulation in a dynamic prototyping environment: Petri nets or rules?

NASA Technical Reports Server (NTRS)

Moore, Loretta A.; Price, Shannon W.; Hale, Joseph P.

1994-01-01

An evaluation of a prototyped user interface is best supported by a simulation of the system. A simulation allows for dynamic evaluation of the interface rather than just a static evaluation of the screen's appearance. This allows potential users to evaluate both the look (in terms of the screen layout, color, objects, etc.) and feel (in terms of operations and actions which need to be performed) of a system's interface. Because of the need to provide dynamic evaluation of an interface, there must be support for producing active simulations. The high-fidelity training simulators are normally delivered too late to be effectively used in prototyping the displays. Therefore, it is important to build a low fidelity simulator, so that the iterative cycle of refining the human computer interface based upon a user's interactions can proceed early in software development.

Simulation in a dynamic prototyping environment: Petri nets or rules?

NASA Technical Reports Server (NTRS)

Moore, Loretta A.; Price, Shannon; Hale, Joseph P.

1994-01-01

An evaluation of a prototyped user interface is best supported by a simulation of the system. A simulation allows for dynamic evaluation of the interface rather than just a static evaluation of the screen's appearance. This allows potential users to evaluate both the look (in terms of the screen layout, color, objects, etc.) and feel (in terms of operations and actions which need to be performed) of a system's interface. Because of the need to provide dynamic evaluation of an interface, there must be support for producing active simulations. The high-fidelity training simulators are delivered too late to be effectively used in prototyping the displays. Therefore, it is important to build a low fidelity simulator, so that the iterative cycle of refining the human computer interface based upon a user's interactions can proceed early in software development.

Recommended approach to software development, revision 3

NASA Technical Reports Server (NTRS)

Landis, Linda; Waligora, Sharon; Mcgarry, Frank; Pajerski, Rose; Stark, Mike; Johnson, Kevin Orlin; Cover, Donna

1992-01-01

Guidelines for an organized, disciplined approach to software development that is based on studies conducted by the Software Engineering Laboratory (SEL) since 1976 are presented. It describes methods and practices for each phase of a software development life cycle that starts with requirements definition and ends with acceptance testing. For each defined life cycle phase, guidelines for the development process and its management, and for the products produced and their reviews are presented.

Software Development Life Cycle Security Issues

NASA Astrophysics Data System (ADS)

Kaur, Daljit; Kaur, Parminder

2011-12-01

Security is now-a-days one of the major problems because of many reasons. Security is now-a-days one of the major problems because of many reasons. The main cause is that software can't withstand security attacks because of vulnerabilities in it which are caused by defective specifications design and implementation. We have conducted a survey asking software developers, project managers and other people in software development about their security awareness and implementation in Software Development Life Cycle (SDLC). The survey was open to participation for three weeks and this paper explains the survey results.

ESD/MITRE Software Acquisition Symposium Proceedings; an ESD/Industry Dialogue held in Bedford, Massachusetts on May 6-7, 1986

DTIC Science & Technology

1986-05-07

Cycle? Moderator: Christine M. Anderson Dennis D. Doe Manager of Engineering Software and Artificial Intelligence Boeing Aerospace Company In... intelligence systems development pro- cess affect the life cycle? Artificial intelligence developers seem to be the last haven for people who don’t...of Engineering Software and Artificial Intelligence at the Boeing Aerospace Company. In this capacity, Mr. Doe is the focal point for software

A Strategy for Improved System Assurance

DTIC Science & Technology

2007-06-20

Quality (Measurements Life Cycle Safety, Security & Others) ISO /IEC 12207 * Software Life Cycle Processes ISO 9001 Quality Management System...14598 Software Product Evaluation Related ISO /IEC 90003 Guidelines for the Application of ISO 9001:2000 to Computer Software IEEE 12207 Industry...Implementation of International Standard ISO /IEC 12207 IEEE 1220 Standard for Application and Management of the System Engineering Process Use in

National Cycle Program (NCP) Common Analysis Tool for Aeropropulsion

NASA Technical Reports Server (NTRS)

Follen, G.; Naiman, C.; Evans, A.

1999-01-01

Through the NASA/Industry Cooperative Effort (NICE) agreement, NASA Lewis and industry partners are developing a new engine simulation, called the National Cycle Program (NCP), which is the initial framework of NPSS. NCP is the first phase toward achieving the goal of NPSS. This new software supports the aerothermodynamic system simulation process for the full life cycle of an engine. The National Cycle Program (NCP) was written following the Object Oriented Paradigm (C++, CORBA). The software development process used was also based on the Object Oriented paradigm. Software reviews, configuration management, test plans, requirements, design were all apart of the process used in developing NCP. Due to the many contributors to NCP, the stated software process was mandatory for building a common tool intended for use by so many organizations. The U.S. aircraft and airframe companies recognize NCP as the future industry standard for propulsion system modeling.

Improvements in the efficiency of turboexpanders in cryogenic applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agahi, R.R.; Lin, M.C.; Ershaghi, B.

1996-12-31

Process designers have utilized turboexpanders in cryogenic processes because of their higher thermal efficiencies when compared with conventional refrigeration cycles. Process design and equipment performance have improved substantially through the utilization of modern technologies. Turboexpander manufacturers have also adopted Computational Fluid Dynamic Software, Computer Numerical Control Technology and Holography Techniques to further improve an already impressive turboexpander efficiency performance. In this paper, the authors explain the design process of the turboexpander utilizing modern technology. Two cases of turboexpanders processing helium (4.35{degrees}K) and hydrogen (56{degrees}K) will be presented.

Software Quality Assurance Metrics

NASA Technical Reports Server (NTRS)

McRae, Kalindra A.

2004-01-01

Software Quality Assurance (SQA) is a planned and systematic set of activities that ensures conformance of software life cycle processes and products conform to requirements, standards and procedures. In software development, software quality means meeting requirements and a degree of excellence and refinement of a project or product. Software Quality is a set of attributes of a software product by which its quality is described and evaluated. The set of attributes includes functionality, reliability, usability, efficiency, maintainability, and portability. Software Metrics help us understand the technical process that is used to develop a product. The process is measured to improve it and the product is measured to increase quality throughout the life cycle of software. Software Metrics are measurements of the quality of software. Software is measured to indicate the quality of the product, to assess the productivity of the people who produce the product, to assess the benefits derived from new software engineering methods and tools, to form a baseline for estimation, and to help justify requests for new tools or additional training. Any part of the software development can be measured. If Software Metrics are implemented in software development, it can save time, money, and allow the organization to identify the caused of defects which have the greatest effect on software development. The summer of 2004, I worked with Cynthia Calhoun and Frank Robinson in the Software Assurance/Risk Management department. My task was to research and collect, compile, and analyze SQA Metrics that have been used in other projects that are not currently being used by the SA team and report them to the Software Assurance team to see if any metrics can be implemented in their software assurance life cycle process.

Education and research in fluid dynamics

NASA Astrophysics Data System (ADS)

López González-Nieto, P.; Redondo, J. M.; Cano, J. L.

2009-04-01

Fluid dynamics constitutes an essential subject for engineering, since auronautic engineers (airship flights in PBL, flight processes), industrial engineers (fluid transportation), naval engineers (ship/vessel building) up to agricultural engineers (influence of the weather conditions on crops/farming). All the above-mentioned examples possess a high social and economic impact on mankind. Therefore, the fluid dynamics education of engineers is very important, and, at the same time, this subject gives us an interesting methodology based on a cycle relation among theory, experiments and numerical simulation. The study of turbulent plumes -a very important convective flow- is a good example because their theoretical governing equations are simple; it is possible to make experimental plumes in an aesy way and to carry out the corresponding numerical simulatons to verify experimental and theoretical results. Moreover, it is possible to get all these aims in the educational system (engineering schools or institutions) using a basic laboratory and the "Modellus" software.

Software engineering and Ada (Trademark) training: An implementation model for NASA

NASA Technical Reports Server (NTRS)

Legrand, Sue; Freedman, Glenn

1988-01-01

The choice of Ada for software engineering for projects such as the Space Station has resulted in government and industrial groups considering training programs that help workers become familiar with both a software culture and the intricacies of a new computer language. The questions of how much time it takes to learn software engineering with Ada, how much an organization should invest in such training, and how the training should be structured are considered. Software engineering is an emerging, dynamic discipline. It is defined by the author as the establishment and application of sound engineering environments, tools, methods, models, principles, and concepts combined with appropriate standards, guidelines, and practices to support computing which is correct, modifiable, reliable and safe, efficient, and understandable throughout the life cycle of the application. Neither the training programs needed, nor the content of such programs, have been well established. This study addresses the requirements for training for NASA personnel and recommends an implementation plan. A curriculum and a means of delivery are recommended. It is further suggested that a knowledgeable programmer may be able to learn Ada in 5 days, but that it takes 6 to 9 months to evolve into a software engineer who uses the language correctly and effectively. The curriculum and implementation plan can be adapted for each NASA Center according to the needs dictated by each project.

A Recommended Framework for the Network-Centric Acquisition Process

DTIC Science & Technology

2009-09-01

ISO /IEC 12207 , Systems and Software Engineering-Software Life-Cycle Processes  ANSI/EIA 632, Processes for Engineering a System. There are...engineering [46]. Some of the process models presented in the DAG are:  ISO /IEC 15288, Systems and Software Engineering-System Life-Cycle Processes...e.g., ISO , IA, Security, etc.). Vetting developers helps ensure that they are using industry best industry practices and maximize the IA compliance

Metrinome: Continuous Monitoring and Security Validation of Distributed Systems

DTIC Science & Technology

2014-03-01

Integration into the SDLC ( Software Development Life Cycle), Retrieved Nov 06 2013, https://www.owasp.org/ images/f/f6/Integration_into_the_SDLC.ppt [2...assessment as part of the software development life cycle, current approaches suffer from a number of shortcomings that limit their application in...with assessing security and correct functionality. Second, integrated and end-to-end testing and experimentation is often postponed until software

Development of a Communications Front End Processor (FEP) for the VAX-11/780 Using an LSI-11/23.

DTIC Science & Technology

1983-12-01

9 Approach . . . . . . . . . . . . . . . . . . 11 Software Development Life Cycle . . . . . . . 11 Requirements Analysis...proven to be useful (25] during the Software Development Life Cycle of a project. Development tools and documentation aids used throughout this effort...include "Structure Charts" ( ref Appendix B ), a "Data Dictionary" ( ref Appendix C ),and Program Design Language CPDL). 1.5.1 Software Development- Life

RT-Syn: A real-time software system generator

NASA Technical Reports Server (NTRS)

Setliff, Dorothy E.

1992-01-01

This paper presents research into providing highly reusable and maintainable components by using automatic software synthesis techniques. This proposal uses domain knowledge combined with automatic software synthesis techniques to engineer large-scale mission-critical real-time software. The hypothesis centers on a software synthesis architecture that specifically incorporates application-specific (in this case real-time) knowledge. This architecture synthesizes complex system software to meet a behavioral specification and external interaction design constraints. Some examples of these external constraints are communication protocols, precisions, timing, and space limitations. The incorporation of application-specific knowledge facilitates the generation of mathematical software metrics which are used to narrow the design space, thereby making software synthesis tractable. Success has the potential to dramatically reduce mission-critical system life-cycle costs not only by reducing development time, but more importantly facilitating maintenance, modifications, and extensions of complex mission-critical software systems, which are currently dominating life cycle costs.

Data Assimilation Cycling for Weather Analysis

NASA Technical Reports Server (NTRS)

Tran, Nam; Li, Yongzuo; Fitzpatrick, Patrick

2008-01-01

This software package runs the atmospheric model MM5 in data assimilation cycling mode to produce an optimized weather analysis, including the ability to insert or adjust a hurricane vortex. The program runs MM5 through a cycle of short forecasts every three hours where the vortex is adjusted to match the observed hurricane location and storm intensity. This technique adjusts the surrounding environment so that the proper steering current and environmental shear are achieved. MM5cycle uses a Cressman analysis to blend observation into model fields to get a more accurate weather analysis. Quality control of observations is also done in every cycle to remove bad data that may contaminate the analysis. This technique can assimilate and propagate data in time from intermittent and infrequent observations while maintaining the atmospheric field in a dynamically balanced state. The software consists of a C-shell script (MM5cycle.driver) and three FORTRAN programs (splitMM5files.F, comRegrid.F, and insert_vortex.F), and are contained in the pre-processor component of MM5 called "Regridder." The model is first initialized with data from a global model such as the Global Forecast System (GFS), which also provides lateral boundary conditions. These data are separated into single-time files using splitMM5.F. The hurricane vortex is then bogussed in the correct location and with the correct wind field using insert_vortex.F. The modified initial and boundary conditions are then recombined into the model fields using comRegrid.F. The model then makes a three-hour forecast. The three-hour forecast data from MM5 now become the analysis for the next short forecast run, where the vortex will again be adjusted. The process repeats itself until the desired time of analysis is achieved. This code can also assimilate observations if desired.

Software Quality Metrics: A Software Management Monitoring Method for Air Force Logistics Command in Its Software Quality Assurance Program for the Quantitative Assessment of the System Development Life Cycle under Configuration Management.

DTIC Science & Technology

1982-03-01

pilot systems. Magnitude of the mutant error is classified as: o Program does not compute. o Program computes but does not run test data. o Program...14 Test and Integration ... ............ .. 105 15 The Mapping of SQM to the SDLC ........ ... 108 16 ADS Development .... .............. . 224 17...and funds. While the test phase concludes the normal development cycle, one should realize that with software the development continues in the

Resource utilization during software development

NASA Technical Reports Server (NTRS)

Zelkowitz, Marvin V.

1988-01-01

This paper discusses resource utilization over the life cycle of software development and discusses the role that the current 'waterfall' model plays in the actual software life cycle. Software production in the NASA environment was analyzed to measure these differences. The data from 13 different projects were collected by the Software Engineering Laboratory at NASA Goddard Space Flight Center and analyzed for similarities and differences. The results indicate that the waterfall model is not very realistic in practice, and that as technology introduces further perturbations to this model with concepts like executable specifications, rapid prototyping, and wide-spectrum languages, we need to modify our model of this process.

Impact of Agile Software Development Model on Software Maintainability

ERIC Educational Resources Information Center

Gawali, Ajay R.

2012-01-01

Software maintenance and support costs account for up to 60% of the overall software life cycle cost and often burdens tightly budgeted information technology (IT) organizations. Agile software development approach delivers business value early, but implications on software maintainability are still unknown. The purpose of this quantitative study…

Developing a Virtual Physics World

ERIC Educational Resources Information Center

Wegener, Margaret; McIntyre, Timothy J.; McGrath, Dominic; Savage, Craig M.; Williamson, Michael

2012-01-01

In this article, the successful implementation of a development cycle for a physics teaching package based on game-like virtual reality software is reported. The cycle involved several iterations of evaluating students' use of the package followed by instructional and software development. The evaluation used a variety of techniques, including…

Support for life-cycle product reuse in NASA's SSE

NASA Technical Reports Server (NTRS)

Shotton, Charles

1989-01-01

The Software Support Environment (SSE) is a software factory for the production of Space Station Freedom Program operational software. The SSE is to be centrally developed and maintained and used to configure software production facilities in the field. The PRC product TTCQF provides for an automated qualification process and analysis of existing code that can be used for software reuse. The interrogation subsystem permits user queries of the reusable data and components which have been identified by an analyzer and qualified with associated metrics. The concept includes reuse of non-code life-cycle components such as requirements and designs. Possible types of reusable life-cycle components include templates, generics, and as-is items. Qualification of reusable elements requires analysis (separation of candidate components into primitives), qualification (evaluation of primitives for reusability according to reusability criteria) and loading (placing qualified elements into appropriate libraries). There can be different qualifications for different installations, methodologies, applications and components. Identifying reusable software and related components is labor-intensive and is best carried out as an integrated function of an SSE.

A "Do-It-Yourself" phenotyping system: measuring growth and morphology throughout the diel cycle in rosette shaped plants.

PubMed

Dobrescu, Andrei; Scorza, Livia C T; Tsaftaris, Sotirios A; McCormick, Alistair J

2017-01-01

Improvements in high-throughput phenotyping technologies are rapidly expanding the scope and capacity of plant biology studies to measure growth traits. Nevertheless, the costs of commercial phenotyping equipment and infrastructure remain prohibitively expensive for wide-scale uptake, while academic solutions can require significant local expertise. Here we present a low-cost methodology for plant biologists to build their own phenotyping system for quantifying growth rates and phenotypic characteristics of Arabidopsis thaliana rosettes throughout the diel cycle. We constructed an image capture system consisting of a near infra-red (NIR, 940 nm) LED panel with a mounted Raspberry Pi NoIR camera and developed a MatLab-based software module (iDIEL Plant) to characterise rosette expansion. Our software was able to accurately segment and characterise multiple rosettes within an image, regardless of plant arrangement or genotype, and batch process image sets. To further validate our system, wild-type Arabidopsis plants (Col-0) and two mutant lines with reduced Rubisco contents, pale leaves and slow growth phenotypes ( 1a3b and 1a2b ) were grown on a single plant tray. Plants were imaged from 9 to 24 days after germination every 20 min throughout the 24 h light-dark growth cycle (i.e. the diel cycle). The resulting dataset provided a dynamic and uninterrupted characterisation of differences in rosette growth and expansion rates over time for the three lines tested. Our methodology offers a straightforward solution for setting up automated, scalable and low-cost phenotyping facilities in a wide range of lab environments that could greatly increase the processing power and scalability of Arabidopsis soil growth experiments.

Assessment of drug-induced arrhythmic risk using limit cycle and autocorrelation analysis of human iPSC-cardiomyocyte contractility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirby, R. Jason

2016-08-15

Cardiac safety assays incorporating label-free detection of human stem-cell derived cardiomyocyte contractility provide human relevance and medium throughput screening to assess compound-induced cardiotoxicity. In an effort to provide quantitative analysis of the large kinetic datasets resulting from these real-time studies, we applied bioinformatic approaches based on nonlinear dynamical system analysis, including limit cycle analysis and autocorrelation function, to systematically assess beat irregularity. The algorithms were integrated into a software program to seamlessly generate results for 96-well impedance-based data. Our approach was validated by analyzing dose- and time-dependent changes in beat patterns induced by known proarrhythmic compounds and screening a cardiotoxicitymore » library to rank order compounds based on their proarrhythmic potential. We demonstrate a strong correlation for dose-dependent beat irregularity monitored by electrical impedance and quantified by autocorrelation analysis to traditional manual patch clamp potency values for hERG blockers. In addition, our platform identifies non-hERG blockers known to cause clinical arrhythmia. Our method provides a novel suite of medium-throughput quantitative tools for assessing compound effects on cardiac contractility and predicting compounds with potential proarrhythmia and may be applied to in vitro paradigms for pre-clinical cardiac safety evaluation. - Highlights: • Impedance-based monitoring of human iPSC-derived cardiomyocyte contractility • Limit cycle analysis of impedance data identifies aberrant oscillation patterns. • Nonlinear autocorrelation function quantifies beat irregularity. • Identification of hERG and non-hERG inhibitors with known risk of arrhythmia • Automated software processes limit cycle and autocorrelation analyses of 96w data.« less

Software engineering standards and practices

NASA Technical Reports Server (NTRS)

Durachka, R. W.

1981-01-01

Guidelines are presented for the preparation of a software development plan. The various phases of a software development project are discussed throughout its life cycle including a general description of the software engineering standards and practices to be followed during each phase.

ELISA, a demonstrator environment for information systems architecture design

NASA Technical Reports Server (NTRS)

Panem, Chantal

1994-01-01

This paper describes an approach of reusability of software engineering technology in the area of ground space system design. System engineers have lots of needs similar to software developers: sharing of a common data base, capitalization of knowledge, definition of a common design process, communication between different technical domains. Moreover system designers need to simulate dynamically their system as early as possible. Software development environments, methods and tools now become operational and widely used. Their architecture is based on a unique object base, a set of common management services and they host a family of tools for each life cycle activity. In late '92, CNES decided to develop a demonstrative software environment supporting some system activities. The design of ground space data processing systems was chosen as the application domain. ELISA (Integrated Software Environment for Architectures Specification) was specified as a 'demonstrator', i.e. a sufficient basis for demonstrations, evaluation and future operational enhancements. A process with three phases was implemented: system requirements definition, design of system architectures models, and selection of physical architectures. Each phase is composed of several activities that can be performed in parallel, with the provision of Commercial Off the Shelves Tools. ELISA has been delivered to CNES in January 94, currently used for demonstrations and evaluations on real projects (e.g. SPOT4 Satellite Control Center). It is on the way of new evolutions.

Software Engineering Guidebook

NASA Technical Reports Server (NTRS)

Connell, John; Wenneson, Greg

1993-01-01

The Software Engineering Guidebook describes SEPG (Software Engineering Process Group) supported processes and techniques for engineering quality software in NASA environments. Three process models are supported: structured, object-oriented, and evolutionary rapid-prototyping. The guidebook covers software life-cycles, engineering, assurance, and configuration management. The guidebook is written for managers and engineers who manage, develop, enhance, and/or maintain software under the Computer Software Services Contract.

The Importance of Uncertainty and Sensitivity Analysis in Process-based Models of Carbon and Nitrogen Cycling in Terrestrial Ecosystems with Particular Emphasis on Forest Ecosystems — Selected Papers from a Workshop Organized by the International Society for Ecological Modelling (ISEM) at the Third Biennal Meeting of the International Environmental Modelling and Software Society (IEMSS) in Burlington, Vermont, USA, August 9-13, 2006

USGS Publications Warehouse

Larocque, Guy R.; Bhatti, Jagtar S.; Liu, Jinxun; Ascough, James C.; Gordon, Andrew M.

2008-01-01

Many process-based models of carbon (C) and nitrogen (N) cycles have been developed for terrestrial ecosystems, including forest ecosystems. They address many basic issues of ecosystems structure and functioning, such as the role of internal feedback in ecosystem dynamics. The critical factor in these phenomena is scale, as these processes operate at scales from the minute (e.g. particulate pollution impacts on trees and other organisms) to the global (e.g. climate change). Research efforts remain important to improve the capability of such models to better represent the dynamics of terrestrial ecosystems, including the C, nutrient, (e.g. N) and water cycles. Existing models are sufficiently well advanced to help decision makers develop sustainable management policies and planning of terrestrial ecosystems, as they make realistic predictions when used appropriately. However, decision makers must be aware of their limitations by having the opportunity to evaluate the uncertainty associated with process-based models (Smith and Heath, 2001 and Allen et al., 2004). The variation in scale of issues currently being addressed by modelling efforts makes the evaluation of uncertainty a daunting task.

Computer Software for Life Cycle Cost.

DTIC Science & Technology

1987-04-01

34 111. 1111I .25 IL4 jj 16 MICROCOPY RESOLUTION TEST CHART hut FILE C AIR CoMMNAMN STFF COLLG STUJDET PORTO i COMpUTER SOFTWARE FOR LIFE CYCLE CO879...obsolete), physical life (utility before physically wearing out), or application life (utility in a given function)." (7:5) The costs are usually

Using Articulate Virtual Laboratories in Teaching Energy Conversion at the U.S. Naval Academy.

ERIC Educational Resources Information Center

Wu, C.

1998-01-01

The Mechanical Engineering Department at the U.S. Naval Academy is currently evaluating a new teaching method which uses computer software. Utilizing the thermodynamic-based software CyclePad, Intelligent Computer Aided Instruction is incorporated in an advanced energy conversion course for Mechanical Engineering students. The CyclePad software…

49 CFR 229.305 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... cohesion. Component means an electronic element, device, or appliance (including hardware or software) that... and software version, is documented and maintained through the life-cycle of the products in use. Executive software means software common to all installations of a given electronic product. It generally is...

49 CFR 229.305 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-10-01

... cohesion. Component means an electronic element, device, or appliance (including hardware or software) that... and software version, is documented and maintained through the life-cycle of the products in use. Executive software means software common to all installations of a given electronic product. It generally is...

49 CFR 229.305 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... cohesion. Component means an electronic element, device, or appliance (including hardware or software) that... and software version, is documented and maintained through the life-cycle of the products in use. Executive software means software common to all installations of a given electronic product. It generally is...

Dynamic Weather Routes Architecture Overview

NASA Technical Reports Server (NTRS)

Eslami, Hassan; Eshow, Michelle

2014-01-01

Dynamic Weather Routes Architecture Overview, presents the high level software architecture of DWR, based on the CTAS software framework and the Direct-To automation tool. The document also covers external and internal data flows, required dataset, changes to the Direct-To software for DWR, collection of software statistics, and the code structure.

Development of test methodology for dynamic mechanical analysis instrumentation

NASA Technical Reports Server (NTRS)

Allen, V. R.

1982-01-01

Dynamic mechanical analysis instrumentation was used for the development of specific test methodology in the determination of engineering parameters of selected materials, esp. plastics and elastomers, over a broad range of temperature with selected environment. The methodology for routine procedures was established with specific attention given to sample geometry, sample size, and mounting techniques. The basic software of the duPont 1090 thermal analyzer was used for data reduction which simplify the theoretical interpretation. Clamps were developed which allowed 'relative' damping during the cure cycle to be measured for the fiber-glass supported resin. The correlation of fracture energy 'toughness' (or impact strength) with the low temperature (glassy) relaxation responses for a 'rubber-modified' epoxy system was negative in result because the low-temperature dispersion mode (-80 C) of the modifier coincided with that of the epoxy matrix, making quantitative comparison unrealistic.

Mechano-logical model of C. elegans germ line suggests feedback on the cell cycle

PubMed Central

Atwell, Kathryn; Qin, Zhao; Gavaghan, David; Kugler, Hillel; Hubbard, E. Jane Albert; Osborne, James M.

2015-01-01

The Caenorhabditis elegans germ line is an outstanding model system in which to study the control of cell division and differentiation. Although many of the molecules that regulate germ cell proliferation and fate decisions have been identified, how these signals interact with cellular dynamics and physical forces within the gonad remains poorly understood. We therefore developed a dynamic, 3D in silico model of the C. elegans germ line, incorporating both the mechanical interactions between cells and the decision-making processes within cells. Our model successfully reproduces key features of the germ line during development and adulthood, including a reasonable ovulation rate, correct sperm count, and appropriate organization of the germ line into stably maintained zones. The model highlights a previously overlooked way in which germ cell pressure may influence gonadogenesis, and also predicts that adult germ cells might be subject to mechanical feedback on the cell cycle akin to contact inhibition. We provide experimental data consistent with the latter hypothesis. Finally, we present cell trajectories and ancestry recorded over the course of a simulation. The novel approaches and software described here link mechanics and cellular decision-making, and are applicable to modeling other developmental and stem cell systems. PMID:26428008

A software engineering approach to expert system design and verification

NASA Technical Reports Server (NTRS)

Bochsler, Daniel C.; Goodwin, Mary Ann

1988-01-01

Software engineering design and verification methods for developing expert systems are not yet well defined. Integration of expert system technology into software production environments will require effective software engineering methodologies to support the entire life cycle of expert systems. The software engineering methods used to design and verify an expert system, RENEX, is discussed. RENEX demonstrates autonomous rendezvous and proximity operations, including replanning trajectory events and subsystem fault detection, onboard a space vehicle during flight. The RENEX designers utilized a number of software engineering methodologies to deal with the complex problems inherent in this system. An overview is presented of the methods utilized. Details of the verification process receive special emphasis. The benefits and weaknesses of the methods for supporting the development life cycle of expert systems are evaluated, and recommendations are made based on the overall experiences with the methods.

Simulation of Attitude and Trajectory Dynamics and Control of Multiple Spacecraft

NASA Technical Reports Server (NTRS)

Stoneking, Eric T.

2009-01-01

Agora software is a simulation of spacecraft attitude and orbit dynamics. It supports spacecraft models composed of multiple rigid bodies or flexible structural models. Agora simulates multiple spacecraft simultaneously, supporting rendezvous, proximity operations, and precision formation flying studies. The Agora environment includes ephemerides for all planets and major moons in the solar system, supporting design studies for deep space as well as geocentric missions. The environment also contains standard models for gravity, atmospheric density, and magnetic fields. Disturbance force and torque models include aerodynamic, gravity-gradient, solar radiation pressure, and third-body gravitation. In addition to the dynamic and environmental models, Agora supports geometrical visualization through an OpenGL interface. Prototype models are provided for common sensors, actuators, and control laws. A clean interface accommodates linking in actual flight code in place of the prototype control laws. The same simulation may be used for rapid feasibility studies, and then used for flight software validation as the design matures. Agora is open-source and portable across computing platforms, making it customizable and extensible. It is written to support the entire GNC (guidance, navigation, and control) design cycle, from rapid prototyping and design analysis, to high-fidelity flight code verification. As a top-down design, Agora is intended to accommodate a large range of missions, anywhere in the solar system. Both two-body and three-body flight regimes are supported, as well as seamless transition between them. Multiple spacecraft may be simultaneously simulated, enabling simulation of rendezvous scenarios, as well as formation flying. Built-in reference frames and orbit perturbation dynamics provide accurate modeling of precision formation control.

Exploring Protein Stability by Comparative Molecular Dynamics Simulations of Homologous Hyperthermophilic, Mesophilic, and Psychrophilic Proteins.

PubMed

Khan, Sara; Farooq, Umar; Kurnikova, Maria

2016-11-28

In the present studies, we analyzed the influence of temperature on the stability and dynamics of the α subunit of tryptophan synthase (TRPS) from hyperthermophilic, mesophilic, and psychrophilic homologues at different temperatures by molecular dynamics simulations. Employing different indicators such as root-mean-square deviations, root-mean-square fluctuations, principal component analysis, and free energy landscapes, this study manifests the diverse behavior of these homologues with changes in temperature. Especially, an enhancement in the collective motions, classified as representative motions, is observed at high temperature. Similarly, the criterion for the selection of electrostatic interactions in terms of their life span (duty cycle) has indeed helped in identifying the short- and long-lived electrostatic interactions and how they affect the protein's overall stability at different temperatures. Rigidity and flexibility patterns of the homologous proteins are examined using FIRST software along with the calculation of duty cycles with various threshold limits at different temperatures. Rigid cluster decomposition in TRPS of psychrophilic, mesophilic, and hyperthermophilic origin identifies the flexible and rigid regions in the protein. Early loss of rigidity is observed in mesophilic TRPS via loss of contact between the major fragments of the protein compared with the other homologues. In spite of the high similarity of their three-dimensional structures, the overall responses of the three proteins to varying temperatures are significantly different.

The Implications of Using Integrated Software Support Environment for Design of Guidance and Control Systems Software

DTIC Science & Technology

1990-02-01

inspections are performed before each formal review of each software life cycle phase. * Required software audits are performed . " The software is acceptable... Audits : Software audits are performed bySQA consistent with thegeneral audit rules and an auditreportis prepared. Software Quality Inspection (SQI...DSD Software Development Method 3-34 DEFINITION OF ACRONYMS Acronym Full Name or Description MACH Methode d’Analyse et de Conception Flierarchisee

Modular, Autonomous Command and Data Handling Software with Built-In Simulation and Test

NASA Technical Reports Server (NTRS)

Cuseo, John

2012-01-01

The spacecraft system that plays the greatest role throughout the program lifecycle is the Command and Data Handling System (C&DH), along with the associated algorithms and software. The C&DH takes on this role as cost driver because it is the brains of the spacecraft and is the element of the system that is primarily responsible for the integration and interoperability of all spacecraft subsystems. During design and development, many activities associated with mission design, system engineering, and subsystem development result in products that are directly supported by the C&DH, such as interfaces, algorithms, flight software (FSW), and parameter sets. A modular system architecture has been developed that provides a means for rapid spacecraft assembly, test, and integration. This modular C&DH software architecture, which can be targeted and adapted to a wide variety of spacecraft architectures, payloads, and mission requirements, eliminates the current practice of rewriting the spacecraft software and test environment for every mission. This software allows missionspecific software and algorithms to be rapidly integrated and tested, significantly decreasing time involved in the software development cycle. Additionally, the FSW includes an Onboard Dynamic Simulation System (ODySSy) that allows the C&DH software to support rapid integration and test. With this solution, the C&DH software capabilities will encompass all phases of the spacecraft lifecycle. ODySSy is an on-board simulation capability built directly into the FSW that provides dynamic built-in test capabilities as soon as the FSW image is loaded onto the processor. It includes a six-degrees- of-freedom, high-fidelity simulation that allows complete closed-loop and hardware-in-the-loop testing of a spacecraft in a ground processing environment without any additional external stimuli. ODySSy can intercept and modify sensor inputs using mathematical sensor models, and can intercept and respond to actuator commands. ODySSy integration is unique in that it allows testing of actual mission sequences on the flight vehicle while the spacecraft is in various stages of assembly, test, and launch operations all without any external support equipment or simulators. The ODySSy component of the FSW significantly decreases the time required for integration and test by providing an automated, standardized, and modular approach to integrated avionics and component interface and functional verification. ODySSy further provides the capability for on-orbit support in the form of autonomous mission planning and fault protection.

Potentials for Spatial Geometry Curriculum Development with Three-Dimensional Dynamic Geometry Software in Lower Secondary Mathematics

ERIC Educational Resources Information Center

Miyazaki, Mikio; Kimiho, Chino; Katoh, Ryuhei; Arai, Hitoshi; Ogihara, Fumihiro; Oguchi, Yuichi; Morozumi, Tatsuo; Kon, Mayuko; Komatsu, Kotaro

2012-01-01

Three-dimensional dynamic geometry software has the power to enhance students' learning of spatial geometry. The purpose of this research is to clarify what potential using three-dimensional dynamic geometry software can offer us in terms of how to develop the spatial geometry curriculum in lower secondary schools. By focusing on the impacts the…

A conceptual model for megaprogramming

NASA Technical Reports Server (NTRS)

Tracz, Will

1990-01-01

Megaprogramming is component-based software engineering and life-cycle management. Magaprogramming and its relationship to other research initiatives (common prototyping system/common prototyping language, domain specific software architectures, and software understanding) are analyzed. The desirable attributes of megaprogramming software components are identified and a software development model and resulting prototype megaprogramming system (library interconnection language extended by annotated Ada) are described.

Towards understanding software: 15 years in the SEL

NASA Technical Reports Server (NTRS)

Mcgarry, Frank; Pajerski, Rose

1990-01-01

For 15 years, the Software Engineering Laboratory (SEL) at GSFC has been carrying out studies and experiments for the purpose of understanding, assessing, and improving software, and software processes within a production software environment. The SEL comprises three major organizations: (1) the GSFC Flight Dynamics Division; (2) the University of Maryland Computer Science Department; and (3) the Computer Sciences Corporation Flight Dynamics Technology Group. These organizations have jointly carried out several hundred software studies, producing hundreds of reports, papers, and documents: all describing some aspect of the software engineering technology that has undergone analysis in the flight dynamics environment. The studies range from small controlled experiments (such as analyzing the effectiveness of code reading versus functional testing) to large, multiple-project studies (such as assessing the impacts of Ada on a production environment). The key findings that NASA feels have laid the foundation for ongoing and future software development and research activities are summarized.

The Improvement Cycle: Analyzing Our Experience

NASA Technical Reports Server (NTRS)

Pajerski, Rose; Waligora, Sharon

1996-01-01

NASA's Software Engineering Laboratory (SEL), one of the earliest pioneers in the areas of software process improvement and measurement, has had a significant impact on the software business at NASA Goddard. At the heart of the SEL's improvement program is a belief that software products can be improved by optimizing the software engineering process used to develop them and a long-term improvement strategy that facilitates small incremental improvements that accumulate into significant gains. As a result of its efforts, the SEL has incrementally reduced development costs by 60%, decreased error rates by 85%, and reduced cycle time by 25%. In this paper, we analyze the SEL's experiences on three major improvement initiatives to better understand the cyclic nature of the improvement process and to understand why some improvements take much longer than others.

Software metrics: Software quality metrics for distributed systems. [reliability engineering

NASA Technical Reports Server (NTRS)

Post, J. V.

1981-01-01

Software quality metrics was extended to cover distributed computer systems. Emphasis is placed on studying embedded computer systems and on viewing them within a system life cycle. The hierarchy of quality factors, criteria, and metrics was maintained. New software quality factors were added, including survivability, expandability, and evolvability.

Formal assessment instrument for ensuring the security of NASA's networks, systems and software

NASA Technical Reports Server (NTRS)

Gilliam, D. P.; Powell, J. D.; Sherif, J.

2002-01-01

To address the problem of security for NASA's networks, systems and software, NASA has funded the Jet Propulsion Lab in conjunction with UC Davis to begin work on developing a software security assessment instrument for use in the software development and maintenance life cycle.

Flight Dynamic Simulation of Fighter In the Asymmetric External Store Release Process

NASA Astrophysics Data System (ADS)

Safi’i, Imam; Arifianto, Ony; Nurohman, Chandra

2018-04-01

In the fighter design, it is important to evaluate and analyze the flight dynamic of the aircraft earlier in the development process. One of the case is the dynamics of external store release process. A simulation tool can be used to analyze the fighter/external store system’s dynamics in the preliminary design stage. This paper reports the flight dynamics of Jet Fighter Experiment (JF-1 E) in asymmetric Advance Medium Range Air to Air Missile (AMRAAM) release process through simulations. The JF-1 E and AIM 120 AMRAAAM models are built by using Advanced Aircraft Analysis (AAA) and Missile Datcom software. By using these softwares, the aerodynamic stability and control derivatives can be obtained and used to model the dynamic characteristic of the fighter and the external store. The dynamic system is modeled by using MATLAB/Simulink software. By using this software, both the fighter/external store integration and the external store release process is simulated, and the dynamic of the system can be analyzed.

The Use of Air Injection Nozzles for the Forced Excitation of Axial Compressor Blades

NASA Astrophysics Data System (ADS)

Raubenheimer, G. A.; van der Spuy, S. J.; von Backström, T. W.

2013-03-01

Turbomachines are exposed to many factors which may cause failure of its components. One of these, high cycle fatigue, can be caused by blade flutter. This paper evaluates the use of an air injection nozzle as a means of exciting vibrations on the first stage rotor blades of a rotating axial compressor. Unsteady simulations of the excitation velocity perturbations were performed on the Computational Fluid Dynamics (CFD) software, Numeca FINE™/Turbo. Experimental testing on a three-stage, low Mach number axial flow compressor provided data that was used to implement boundary conditions and to verify certain aspects of the unsteady simulation results.

CONTIN XPCS: software for inverse transform analysis of X-ray photon correlation spectroscopy dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrews, Ross N.; Narayanan, Suresh; Zhang, Fan

X-ray photon correlation spectroscopy (XPCS) and dynamic light scattering (DLS) reveal materials dynamics using coherent scattering, with XPCS permitting the investigation of dynamics in a more diverse array of materials than DLS. Heterogeneous dynamics occur in many material systems. The authors' recent work has shown how classic tools employed in the DLS analysis of heterogeneous dynamics can be extended to XPCS, revealing additional information that conventional Kohlrausch exponential fitting obscures. The present work describes the software implementation of inverse transform analysis of XPCS data. This software, calledCONTIN XPCS, is an extension of traditionalCONTINanalysis and accommodates the various dynamics encountered inmore » equilibrium XPCS measurements.« less

CONTIN XPCS: software for inverse transform analysis of X-ray photon correlation spectroscopy dynamics

DOE PAGES

Andrews, Ross N.; Narayanan, Suresh; Zhang, Fan; ...

2018-02-01

X-ray photon correlation spectroscopy (XPCS) and dynamic light scattering (DLS) reveal materials dynamics using coherent scattering, with XPCS permitting the investigation of dynamics in a more diverse array of materials than DLS. Heterogeneous dynamics occur in many material systems. The authors' recent work has shown how classic tools employed in the DLS analysis of heterogeneous dynamics can be extended to XPCS, revealing additional information that conventional Kohlrausch exponential fitting obscures. The present work describes the software implementation of inverse transform analysis of XPCS data. This software, calledCONTIN XPCS, is an extension of traditionalCONTINanalysis and accommodates the various dynamics encountered inmore » equilibrium XPCS measurements.« less

Software Management Environment (SME) concepts and architecture, revision 1

NASA Technical Reports Server (NTRS)

Hendrick, Robert; Kistler, David; Valett, Jon

1992-01-01

This document presents the concepts and architecture of the Software Management Environment (SME), developed for the Software Engineering Branch of the Flight Dynamic Division (FDD) of GSFC. The SME provides an integrated set of experience-based management tools that can assist software development managers in managing and planning flight dynamics software development projects. This document provides a high-level description of the types of information required to implement such an automated management tool.

Concepts associated with a unified life cycle analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whelan, Gene; Peffers, Melissa S.; Tolle, Duane A.

There is a risk associated with most things in the world, and all things have a life cycle unto themselves, even brownfields. Many components can be described by a''cycle of life.'' For example, five such components are life-form, chemical, process, activity, and idea, although many more may exist. Brownfields may touch upon several of these life cycles. Each life cycle can be represented as independent software; therefore, a software technology structure is being formulated to allow for the seamless linkage of software products, representing various life-cycle aspects. Because classes of these life cycles tend to be independent of each other,more » the current research programs and efforts do not have to be revamped; therefore, this unified life-cycle paradigm builds upon current technology and is backward compatible while embracing future technology. Only when two of these life cycles coincide and one impacts the other is there connectivity and a transfer of information at the interface. The current framework approaches (e.g., FRAMES, 3MRA, etc.) have a design that is amenable to capturing (1) many of these underlying philosophical concepts to assure backward compatibility of diverse independent assessment frameworks and (2) linkage communication to help transfer the needed information at the points of intersection. The key effort will be to identify (1) linkage points (i.e., portals) between life cycles, (2) the type and form of data passing between life cycles, and (3) conditions when life cycles interact and communicate. This paper discusses design aspects associated with a unified life-cycle analysis, which can support not only brownfields but also other types of assessments.« less

Landsat-7 Simulation and Testing Environments

NASA Technical Reports Server (NTRS)

Holmes, E.; Ha, K.; Hawkins, K.; Lombardo, J.; Ram, M.; Sabelhaus, P.; Scott, S.; Phillips, R.

1999-01-01

A spacecraft Attitude Control and Determination Subsystem (ACDS) is heavily dependent upon simulation throughout its entire development, implementation and ground test cycle. Engineering simulation tools are typically developed to design and analyze control systems to validate the design and software simulation tools are required to qualify the flight software. However, the need for simulation does not end here. Operating the ACDS of a spacecraft on the ground requires the simulation of spacecraft dynamics, disturbance modeling and celestial body motion. Sensor data must also be simulated and substituted for actual sensor data on the ground so that the spacecraft will respond by sending commands to the actuators as they will on orbit. And finally, the simulators is the primary training tool and test-bed for the Flight Operations Team. In this paper various ACDS simulation, developed for or used by the Landsat 7 project will be described. The paper will include a description of each tool, its unique attributes, and its role in the overall development and testing of the ACDS. Finally, a section is included which discusses how the coordinated use of these simulation tools can maximize the probability of uncovering software, hardware and operations errors during the ground test process.

Space station dynamics, attitude control and momentum management

NASA Technical Reports Server (NTRS)

Sunkel, John W.; Singh, Ramen P.; Vengopal, Ravi

1989-01-01

The Space Station Attitude Control System software test-bed provides a rigorous environment for the design, development and functional verification of GN and C algorithms and software. The approach taken for the simulation of the vehicle dynamics and environmental models using a computationally efficient algorithm is discussed. The simulation includes capabilities for docking/berthing dynamics, prescribed motion dynamics associated with the Mobile Remote Manipulator System (MRMS) and microgravity disturbances. The vehicle dynamics module interfaces with the test-bed through the central Communicator facility which is in turn driven by the Station Control Simulator (SCS) Executive. The Communicator addresses issues such as the interface between the discrete flight software and the continuous vehicle dynamics, and multi-programming aspects such as the complex flow of control in real-time programs. Combined with the flight software and redundancy management modules, the facility provides a flexible, user-oriented simulation platform.

The software-cycle model for re-engineering and reuse

NASA Technical Reports Server (NTRS)

Bailey, John W.; Basili, Victor R.

1992-01-01

This paper reports on the progress of a study which will contribute to our ability to perform high-level, component-based programming by describing means to obtain useful components, methods for the configuration and integration of those components, and an underlying economic model of the costs and benefits associated with this approach to reuse. One goal of the study is to develop and demonstrate methods to recover reusable components from domain-specific software through a combination of tools, to perform the identification, extraction, and re-engineering of components, and domain experts, to direct the applications of those tools. A second goal of the study is to enable the reuse of those components by identifying techniques for configuring and recombining the re-engineered software. This component-recovery or software-cycle model addresses not only the selection and re-engineering of components, but also their recombination into new programs. Once a model of reuse activities has been developed, the quantification of the costs and benefits of various reuse options will enable the development of an adaptable economic model of reuse, which is the principal goal of the overall study. This paper reports on the conception of the software-cycle model and on several supporting techniques of software recovery, measurement, and reuse which will lead to the development of the desired economic model.

Software Assurance: Five Essential Considerations for Acquisition Officials

DTIC Science & Technology

2007-05-01

May 2007 www.stsc.hill.af.mil 17 2 • address security concerns in the software development life cycle ( SDLC )? • Are there formal software quality...What threat modeling process, if any, is used when designing the software ? What analysis, design, and construction tools are used by your software design...the-shelf (COTS), government off-the-shelf (GOTS), open- source, embedded, and legacy software . Attackers exploit unintentional vulnerabil- ities or

Being "slow to see" is a dynamic visual function consequence of infantile nystagmus syndrome: model predictions and patient data identify stimulus timing as its cause.

PubMed

Wang, Z I; Dell'Osso, L F

2007-05-01

The objective of this study was to investigate the dynamic properties of infantile nystagmus syndrome (INS) that affect visual function; i.e., which factors influence latency of the initial reflexive saccade (Ls) and latency to target acquisition (Lt). We used our behavioral ocular motor system (OMS) model to simulate saccadic responses (in the presence of INS) to target jumps at different times within a single INS cycle and at random times during multiple cycles. We then studied the responses of 4 INS subjects with different waveforms to test the model's predictions. Infrared reflection was used for 1 INS subject, high-speed digital video for 3. We recorded and analyzed human responses to large and small target-step stimuli. We evaluated the following factors: stimulus time within the cycle (Tc), normalized Tc (Tc%), initial orbital position (Po), saccade amplitude, initial retinal error (e(i)), and final retinal error (e(f)). The ocular motor simulations were performed in MATLAB Simulink environment and the analysis was performed in MATLAB environment using OMLAB software. Both the OMS model and OMtools software are available from http://http:www.omlab.org. Our data analysis showed that for each subject, Ls was a fixed value that is typically higher than the normal saccadic latency. Although saccadic latency appears somewhat lengthened in INS, the amount is insufficient to cause the "slow-to-see" impression. For Lt, Tc% was the most influential factor for each waveform type. The main refixation strategies employed by INS subjects made use of slow and fast phases and catch-up saccades, or combinations of them. These strategies helped the subjects to foveate effectively after target movement, sometimes at the cost of increased target acquisition time. Foveating or braking saccades intrinsic to the nystagmus waveforms seemed to disrupt the OMS' ability to accurately calculate reflexive saccades' amplitude and refoveate. Our OMS model simulations demonstrated this emergent behavior and predicted the lengthy target acquisition times found in the patient data.

A Bibliography of the Personal Software Process (PSP) and the Team Software Process (TSP)

DTIC Science & Technology

2009-10-01

Postmortem.‖ Proceedings of the TSP Symposium (September 2007). http://www.sei.cmu.edu/tspsymposium/ Rickets , Chris; Lindeman, Robert; & Hodgins, Brad... Rickets , Chris A. ―A TSP Software Maintenance Life Cycle.‖ CrossTalk (March 2005). Rozanc, I. & Mahnic, V. ―Teaching Software Quality with Emphasis on PSP

Gravbox - The First Augmented Reality Sandbox for Gravitational Dynamics

NASA Astrophysics Data System (ADS)

Isbell, Jacob; Deam, Sophie; Reed, Mason; Bettis, Wyatt; Lu, Jianbo; Luppen, Zachary; Maier, Erin; McCurdy, Ross; Moore, Sadie; Fu, Hai

2018-01-01

Gravitational effects are an overarching theme in astronomy education, yet existing classroom demonstrations are insufficient in elucidating complex gravitational interactions. Inspired by the augmented reality (AR) sandbox developed by geologists, we have developed Gravbox, the first AR sandbox to demonstrate gravitational dynamics. The arbitrary topography of the sand surface represents the mass distribution of a two-dimensional universe. The computer reads the topography with a Kinect camera, calculates the orbit of a test particle with user-defined position and velocity, and projects the topography contour map and orbit animation with an overhead projector, all within a duty cycle of one second. This creates an interactive and intuitive tool to help students at all levels understand gravitational effects. In this contribution, we will describe the development of the Gravbox prototype and show its current capabilities. The Gravbox software will be publicly available along with a building tutorial.

Artificial intelligence approaches to software engineering

NASA Technical Reports Server (NTRS)

Johannes, James D.; Macdonald, James R.

1988-01-01

Artificial intelligence approaches to software engineering are examined. The software development life cycle is a sequence of not so well-defined phases. Improved techniques for developing systems have been formulated over the past 15 years, but pressure continues to attempt to reduce current costs. Software development technology seems to be standing still. The primary objective of the knowledge-based approach to software development presented in this paper is to avoid problem areas that lead to schedule slippages, cost overruns, or software products that fall short of their desired goals. Identifying and resolving software problems early, often in the phase in which they first occur, has been shown to contribute significantly to reducing risks in software development. Software development is not a mechanical process but a basic human activity. It requires clear thinking, work, and rework to be successful. The artificial intelligence approaches to software engineering presented support the software development life cycle through the use of software development techniques and methodologies in terms of changing current practices and methods. These should be replaced by better techniques that that improve the process of of software development and the quality of the resulting products. The software development process can be structured into well-defined steps, of which the interfaces are standardized, supported and checked by automated procedures that provide error detection, production of the documentation and ultimately support the actual design of complex programs.

Adopting Open Source Software to Address Software Risks during the Scientific Data Life Cycle

NASA Astrophysics Data System (ADS)

Vinay, S.; Downs, R. R.

2012-12-01

Software enables the creation, management, storage, distribution, discovery, and use of scientific data throughout the data lifecycle. However, the capabilities offered by software also present risks for the stewardship of scientific data, since future access to digital data is dependent on the use of software. From operating systems to applications for analyzing data, the dependence of data on software presents challenges for the stewardship of scientific data. Adopting open source software provides opportunities to address some of the proprietary risks of data dependence on software. For example, in some cases, open source software can be deployed to avoid licensing restrictions for using, modifying, and transferring proprietary software. The availability of the source code of open source software also enables the inclusion of modifications, which may be contributed by various community members who are addressing similar issues. Likewise, an active community that is maintaining open source software can be a valuable source of help, providing an opportunity to collaborate to address common issues facing adopters. As part of the effort to meet the challenges of software dependence for scientific data stewardship, risks from software dependence have been identified that exist during various times of the data lifecycle. The identification of these risks should enable the development of plans for mitigating software dependencies, where applicable, using open source software, and to improve understanding of software dependency risks for scientific data and how they can be reduced during the data life cycle.

Fast interactive real-time volume rendering of real-time three-dimensional echocardiography: an implementation for low-end computers

NASA Technical Reports Server (NTRS)

Saracino, G.; Greenberg, N. L.; Shiota, T.; Corsi, C.; Lamberti, C.; Thomas, J. D.

2002-01-01

Real-time three-dimensional echocardiography (RT3DE) is an innovative cardiac imaging modality. However, partly due to lack of user-friendly software, RT3DE has not been widely accepted as a clinical tool. The object of this study was to develop and implement a fast and interactive volume renderer of RT3DE datasets designed for a clinical environment where speed and simplicity are not secondary to accuracy. Thirty-six patients (20 regurgitation, 8 normal, 8 cardiomyopathy) were imaged using RT3DE. Using our newly developed software, all 3D data sets were rendered in real-time throughout the cardiac cycle and assessment of cardiac function and pathology was performed for each case. The real-time interactive volume visualization system is user friendly and instantly provides consistent and reliable 3D images without expensive workstations or dedicated hardware. We believe that this novel tool can be used clinically for dynamic visualization of cardiac anatomy.

Application of high performance computing for studying cyclic variability in dilute internal combustion engines

DOE Office of Scientific and Technical Information (OSTI.GOV)

FINNEY, Charles E A; Edwards, Kevin Dean; Stoyanov, Miroslav K

2015-01-01

Combustion instabilities in dilute internal combustion engines are manifest in cyclic variability (CV) in engine performance measures such as integrated heat release or shaft work. Understanding the factors leading to CV is important in model-based control, especially with high dilution where experimental studies have demonstrated that deterministic effects can become more prominent. Observation of enough consecutive engine cycles for significant statistical analysis is standard in experimental studies but is largely wanting in numerical simulations because of the computational time required to compute hundreds or thousands of consecutive cycles. We have proposed and begun implementation of an alternative approach to allowmore » rapid simulation of long series of engine dynamics based on a low-dimensional mapping of ensembles of single-cycle simulations which map input parameters to output engine performance. This paper details the use Titan at the Oak Ridge Leadership Computing Facility to investigate CV in a gasoline direct-injected spark-ignited engine with a moderately high rate of dilution achieved through external exhaust gas recirculation. The CONVERGE CFD software was used to perform single-cycle simulations with imposed variations of operating parameters and boundary conditions selected according to a sparse grid sampling of the parameter space. Using an uncertainty quantification technique, the sampling scheme is chosen similar to a design of experiments grid but uses functions designed to minimize the number of samples required to achieve a desired degree of accuracy. The simulations map input parameters to output metrics of engine performance for a single cycle, and by mapping over a large parameter space, results can be interpolated from within that space. This interpolation scheme forms the basis for a low-dimensional metamodel which can be used to mimic the dynamical behavior of corresponding high-dimensional simulations. Simulations of high-EGR spark-ignition combustion cycles within a parametric sampling grid were performed and analyzed statistically, and sensitivities of the physical factors leading to high CV are presented. With these results, the prospect of producing low-dimensional metamodels to describe engine dynamics at any point in the parameter space will be discussed. Additionally, modifications to the methodology to account for nondeterministic effects in the numerical solution environment are proposed« less

Improved determination of dynamic balance using the centre of mass and centre of pressure inclination variables in a complete golf swing cycle.

PubMed

Choi, Ahnryul; Sim, Taeyong; Mun, Joung Hwan

2016-01-01

Golf requires proper dynamic balance to accurately control the club head through a harmonious coordination of each human segment and joint. In this study, we evaluated the ability for dynamic balance during a golf swing by using the centre of mass (COM)-centre of pressure (COP) inclination variables. Twelve professional, 13 amateur and 10 novice golfers participated in this study. Six infrared cameras, two force platforms and SB-Clinic software were used to measure the net COM and COP trajectories. In order to evaluate dynamic balance ability, the COM-COP inclination angle, COM-COP inclination angular velocity and normalised COM-COP inclination angular jerk were used. Professional golfer group revealed a smaller COM-COP inclination angle and angular velocity than novice golfer group in the lead/trail direction (P < 0.01). In the normalised COM-COP inclination angular jerk, the professional golfer group showed a lower value than the other two groups in all directions. Professional golfers tend to exhibit improved dynamic balance, and this can be attributed to the neuromusculoskeletal system that maintains balance with proper postural control. This study has the potential to allow for an evaluation of the dynamic balance mechanism and will provide useful basic information for swing training and prevention of golf injuries.

Methodology for Software Reliability Prediction. Volume 1.

DTIC Science & Technology

1987-11-01

SPACECRAFT 0 MANNED SPACECRAFT B ATCH SYSTEM AIRBORNE AVIONICS 0 UNMANNED EVENT C014TROL a REAL TIME CLOSED 0 UNMANNED SPACECRAFT LOOP OPERATINS SPACECRAFT...software reliability. A Software Reliability Measurement Framework was established which spans the life cycle of a software system and includes the...specification, prediction, estimation, and assessment of software reliability. Data from 59 systems , representing over 5 million lines of code, were

Theoretical and software considerations for nonlinear dynamic analysis

NASA Technical Reports Server (NTRS)

Schmidt, R. J.; Dodds, R. H., Jr.

1983-01-01

In the finite element method for structural analysis, it is generally necessary to discretize the structural model into a very large number of elements to accurately evaluate displacements, strains, and stresses. As the complexity of the model increases, the number of degrees of freedom can easily exceed the capacity of present-day software system. Improvements of structural analysis software including more efficient use of existing hardware and improved structural modeling techniques are discussed. One modeling technique that is used successfully in static linear and nonlinear analysis is multilevel substructuring. This research extends the use of multilevel substructure modeling to include dynamic analysis and defines the requirements for a general purpose software system capable of efficient nonlinear dynamic analysis. The multilevel substructuring technique is presented, the analytical formulations and computational procedures for dynamic analysis and nonlinear mechanics are reviewed, and an approach to the design and implementation of a general purpose structural software system is presented.

A Preliminary Data Model for Orbital Flight Dynamics in Shuttle Mission Control

NASA Technical Reports Server (NTRS)

ONeill, John; Shalin, Valerie L.

2000-01-01

The Orbital Flight Dynamics group in Shuttle Mission Control is investigating new user interfaces in a project called RIOTS [RIOTS 2000]. Traditionally, the individual functions of hardware and software guide the design of displays, which results in an aggregated, if not integrated interface. The human work system has then been designed and trained to navigate, operate and integrate the processors and displays. The aim of RIOTS is to reduce the cognitive demands of the flight controllers by redesigning the user interface to support the work of the flight controller. This document supports the RIOTS project by defining a preliminary data model for Orbital Flight Dynamics. Section 2 defines an information-centric perspective. An information-centric approach aims to reduce the cognitive workload of the flight controllers by reducing the need for manual integration of information across processors and displays. Section 3 describes the Orbital Flight Dynamics domain. Section 4 defines the preliminary data model for Orbital Flight Dynamics. Section 5 examines the implications of mapping the data model to Orbital Flight Dynamics current information systems. Two recurring patterns are identified in the Orbital Flight Dynamics work the iteration/rework cycle and the decision-making/information integration/mirroring role relationship. Section 6 identifies new requirements on Orbital Flight Dynamics work and makes recommendations based on changing the information environment, changing the implementation of the data model, and changing the two recurring patterns.

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

49 CFR 236.903 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-10-01

... electrical, mechanical, hardware, or software) that is part of a system or subsystem. Configuration..., including the hardware components and software version, is documented and maintained through the life-cycle... or compensates individuals to perform the duties specified in § 236.921 (a). Executive software means...

Systems biology by the rules: hybrid intelligent systems for pathway modeling and discovery.

PubMed

Bosl, William J

2007-02-15

Expert knowledge in journal articles is an important source of data for reconstructing biological pathways and creating new hypotheses. An important need for medical research is to integrate this data with high throughput sources to build useful models that span several scales. Researchers traditionally use mental models of pathways to integrate information and development new hypotheses. Unfortunately, the amount of information is often overwhelming and these are inadequate for predicting the dynamic response of complex pathways. Hierarchical computational models that allow exploration of semi-quantitative dynamics are useful systems biology tools for theoreticians, experimentalists and clinicians and may provide a means for cross-communication. A novel approach for biological pathway modeling based on hybrid intelligent systems or soft computing technologies is presented here. Intelligent hybrid systems, which refers to several related computing methods such as fuzzy logic, neural nets, genetic algorithms, and statistical analysis, has become ubiquitous in engineering applications for complex control system modeling and design. Biological pathways may be considered to be complex control systems, which medicine tries to manipulate to achieve desired results. Thus, hybrid intelligent systems may provide a useful tool for modeling biological system dynamics and computational exploration of new drug targets. A new modeling approach based on these methods is presented in the context of hedgehog regulation of the cell cycle in granule cells. Code and input files can be found at the Bionet website: www.chip.ord/~wbosl/Software/Bionet. This paper presents the algorithmic methods needed for modeling complicated biochemical dynamics using rule-based models to represent expert knowledge in the context of cell cycle regulation and tumor growth. A notable feature of this modeling approach is that it allows biologists to build complex models from their knowledge base without the need to translate that knowledge into mathematical form. Dynamics on several levels, from molecular pathways to tissue growth, are seamlessly integrated. A number of common network motifs are examined and used to build a model of hedgehog regulation of the cell cycle in cerebellar neurons, which is believed to play a key role in the etiology of medulloblastoma, a devastating childhood brain cancer.

Orbit Determination Toolbox

NASA Technical Reports Server (NTRS)

Carpenter, James R.; Berry, Kevin; Gregpru. Late; Speckman, Keith; Hur-Diaz, Sun; Surka, Derek; Gaylor, Dave

2010-01-01

The Orbit Determination Toolbox is an orbit determination (OD) analysis tool based on MATLAB and Java that provides a flexible way to do early mission analysis. The toolbox is primarily intended for advanced mission analysis such as might be performed in concept exploration, proposal, early design phase, or rapid design center environments. The emphasis is on flexibility, but it has enough fidelity to produce credible results. Insight into all flight dynamics source code is provided. MATLAB is the primary user interface and is used for piecing together measurement and dynamic models. The Java Astrodynamics Toolbox is used as an engine for things that might be slow or inefficient in MATLAB, such as high-fidelity trajectory propagation, lunar and planetary ephemeris look-ups, precession, nutation, polar motion calculations, ephemeris file parsing, and the like. The primary analysis functions are sequential filter/smoother and batch least-squares commands that incorporate Monte-Carlo data simulation, linear covariance analysis, measurement processing, and plotting capabilities at the generic level. These functions have a user interface that is based on that of the MATLAB ODE suite. To perform a specific analysis, users write MATLAB functions that implement truth and design system models. The user provides his or her models as inputs to the filter commands. The software provides a capability to publish and subscribe to a software bus that is compliant with the NASA Goddard Mission Services Evolution Center (GMSEC) standards, to exchange data with other flight dynamics tools to simplify the flight dynamics design cycle. Using the publish and subscribe approach allows for analysts in a rapid design center environment to seamlessly incorporate changes in spacecraft and mission design into navigation analysis and vice versa.

Flight dynamics system software development environment (FDS/SDE) tutorial

NASA Technical Reports Server (NTRS)

Buell, John; Myers, Philip

1986-01-01

A sample development scenario using the Flight Dynamics System Software Development Environment (FDS/SDE) is presented. The SDE uses a menu-driven, fill-in-the-blanks format that provides online help at all steps, thus eliminating lengthy training and allowing immediate use of this new software development tool.

Unexpected Control Structure Interaction on International Space Station

NASA Technical Reports Server (NTRS)

Gomez, Susan F.; Platonov, Valery; Medina, Elizabeth A.; Borisenko, Alexander; Bogachev, Alexey

2017-01-01

On June 23, 2011, the International Space Station (ISS) was performing a routine 180 degree yaw maneuver in support of a Russian vehicle docking when the on board Russian Segment (RS) software unexpectedly declared two attitude thrusters failed and switched thruster configurations in response to unanticipated ISS dynamic motion. Flight data analysis after the maneuver indicated that higher than predicted structural loads had been induced at various locations on the United States (U.S.) segment of the ISS. Further analysis revealed that the attitude control system was firing thrusters in response to both structural flex and rigid body rates, which resonated the structure and caused high loads and fatigue cycles. It was later determined that the thruster themselves were healthy. The RS software logic, which was intended to react to thruster failures, had instead been heavily influenced by interaction between the control system and structural flex. This paper will discuss the technical aspects of the control structure interaction problem that led to the RS control system firing thrusters in response to structural flex, the factors that led to insufficient preflight analysis of the thruster firings, and the ramifications the event had on the ISS. An immediate consequence included limiting which thrusters could be used for attitude control. This complicated the planning of on-orbit thruster events and necessitated the use of suboptimal thruster configurations that increased propellant usage and caused thruster lifetime usage concerns. In addition to the technical aspects of the problem, the team dynamics and communication shortcomings that led to such an event happening in an environment where extensive analysis is performed in support of human space flight will also be examined. Finally, the technical solution will be presented, which required a multidisciplinary effort between the U.S. and Russian control system engineers and loads and dynamics structural engineers to develop and implement an extensive modification in the RS software logic for ISS attitude control thruster firings.

Earth Observing System/Advanced Microwave Sounding Unit-A (EOS/AMSU-A) software management plan

NASA Technical Reports Server (NTRS)

Schwantje, Robert

1994-01-01

This document defines the responsibilites for the management of the like-cycle development of the flight software installed in the AMSU-A instruments, and the ground support software used in the test and integration of the AMSU-A instruments.

Software Formal Inspections Standard

NASA Technical Reports Server (NTRS)

1993-01-01

This Software Formal Inspections Standard (hereinafter referred to as Standard) is applicable to NASA software. This Standard defines the requirements that shall be fulfilled by the software formal inspections process whenever this process is specified for NASA software. The objective of this Standard is to define the requirements for a process that inspects software products to detect and eliminate defects as early as possible in the software life cycle. The process also provides for the collection and analysis of inspection data to improve the inspection process as well as the quality of the software.

A Data Specification for Software Project Performance Measures: Results of a Collaboration on Performance Measurement

DTIC Science & Technology

2008-07-01

cycle Evolution of a system, product, service, project or other human-made entity from conception through retirement [ ISO 12207 ]. Logical line of...012 [ ISO 1995] International Organization for Standardization. ISO /IEC 12207 :1995—Information technology— Software life cycle processes. http...definitions, authors were asked to use or align with already existing standards such as those available through ISO and IEEE when possible. Literature

Systematic on-site monitoring of compliance dust samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grayson, R.L.; Gandy, J.R.

1996-12-31

Maintaining compliance with U.S. respirable coal mine dust standards can be difficult on high-productivity longwall panels. Comprehensive and systematic analysis of compliance dust sample data, coupled with access to the U.S. Bureau of Mines (USBM) DUSTPRO, can yield important information for use in maintaining compliance. The objective of this study was to develop and apply a customized software for the collection, storage, modification, and analysis of respirable dust data while providing for flexible export of data and linking with the USBM`s expert advisory system on dust control. An executable, IBM-compatible software was created and customized for use by the personmore » in charge of collecting, submitting, analyzing, and monitoring respirable dust compliance samples. Both descriptive statistics and multiple regression analysis were incorporated. The software allows ASCH files to be exported and directly links with DUSTPRO. After development and validation of the software, longwall compliance data from two different mines was analyzed to evaluate the value of the software. Data included variables on respirable dust concentration, tons produced, the existence of roof/floor rock (dummy variable), and the sampling cycle (dummy variables). Because of confidentiality, specific data will not be presented, only the equations and ANOVA tables. The final regression models explained 83.8% and 61.1% of the variation in the data for the two panels. Important correlations among variables within sampling cycles showed the value of using dummy variables for sampling cycles. The software proved flexible and fast for its intended use. The insights obtained from use improved the systematic monitoring of respirable dust compliance data, especially for pinpointing the most effective dust control methods during specific sampling cycles.« less

Software attribute visualization for high integrity software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollock, G.M.

1998-03-01

This report documents a prototype tool developed to investigate the use of visualization and virtual reality technologies for improving software surety confidence. The tool is utilized within the execution phase of the software life cycle. It provides a capability to monitor an executing program against prespecified requirements constraints provided in a program written in the requirements specification language SAGE. The resulting Software Attribute Visual Analysis Tool (SAVAnT) also provides a technique to assess the completeness of a software specification.

Solving Equations of Multibody Dynamics

NASA Technical Reports Server (NTRS)

Jain, Abhinandan; Lim, Christopher

2007-01-01

Darts++ is a computer program for solving the equations of motion of a multibody system or of a multibody model of a dynamic system. It is intended especially for use in dynamical simulations performed in designing and analyzing, and developing software for the control of, complex mechanical systems. Darts++ is based on the Spatial-Operator- Algebra formulation for multibody dynamics. This software reads a description of a multibody system from a model data file, then constructs and implements an efficient algorithm that solves the dynamical equations of the system. The efficiency and, hence, the computational speed is sufficient to make Darts++ suitable for use in realtime closed-loop simulations. Darts++ features an object-oriented software architecture that enables reconfiguration of system topology at run time; in contrast, in related prior software, system topology is fixed during initialization. Darts++ provides an interface to scripting languages, including Tcl and Python, that enable the user to configure and interact with simulation objects at run time.

Core Logistics Capability Policy Applied to USAF Combat Aircraft Avionics Software: A Systems Engineering Analysis

DTIC Science & Technology

2010-06-01

cannot make a distinction between software maintenance and development” (Sharma, 2004). ISO /IEC 12207 Software Lifecycle Processes offers a guide to...synopsis of ISO /IEC 12207 , Raghu Singh of the Federal Aviation Administration states “Whenever a software product needs modifications, the development...Corporation. Singh, R. (1998). International Standard ISO /IEC 12207 Software Life Cycle Processes. Washington: Federal Aviation Administration. The Joint

CrossTalk: The Journal of Defense Software Engineering. Volume 21, Number 1

DTIC Science & Technology

2008-01-01

project manage- ment and the individual components of the software life-cycle model ; it will be awarded for...software professionals that had been formally educated in software project manage- ment. The study indicated that our industry is lacking in program managers...soft- ware developments get bigger, more complicated, and more dependent on senior software pro- fessionals to get the project on the right path

The Software Engineering Laboratory: An operational software experience factory

NASA Technical Reports Server (NTRS)

Basili, Victor R.; Caldiera, Gianluigi; Mcgarry, Frank; Pajerski, Rose; Page, Gerald; Waligora, Sharon

1992-01-01

For 15 years, the Software Engineering Laboratory (SEL) has been carrying out studies and experiments for the purpose of understanding, assessing, and improving software and software processes within a production software development environment at NASA/GSFC. The SEL comprises three major organizations: (1) NASA/GSFC, Flight Dynamics Division; (2) University of Maryland, Department of Computer Science; and (3) Computer Sciences Corporation, Flight Dynamics Technology Group. These organizations have jointly carried out several hundred software studies, producing hundreds of reports, papers, and documents, all of which describe some aspect of the software engineering technology that was analyzed in the flight dynamics environment at NASA. The studies range from small, controlled experiments (such as analyzing the effectiveness of code reading versus that of functional testing) to large, multiple project studies (such as assessing the impacts of Ada on a production environment). The organization's driving goal is to improve the software process continually, so that sustained improvement may be observed in the resulting products. This paper discusses the SEL as a functioning example of an operational software experience factory and summarizes the characteristics of and major lessons learned from 15 years of SEL operations.

Evolution of Secondary Software Businesses: Understanding Industry Dynamics

NASA Astrophysics Data System (ADS)

Tyrväinen, Pasi; Warsta, Juhani; Seppänen, Veikko

Primary software industry originates from IBM's decision to unbundle software-related computer system development activities to external partners. This kind of outsourcing from an enterprise internal software development activity is a common means to start a new software business serving a vertical software market. It combines knowledge of the vertical market process with competence in software development. In this research, we present and analyze the key figures of the Finnish secondary software industry, in order to quantify its interaction with the primary software industry during the period of 2000-2003. On the basis of the empirical data, we present a model for evolution of a secondary software business, which makes explicit the industry dynamics. It represents the shift from internal software developed for competitive advantage to development of products supporting standard business processes on top of standardized technologies. We also discuss the implications for software business strategies in each phase.

Learning Fraction Comparison by Using a Dynamic Mathematics Software--GeoGebra

ERIC Educational Resources Information Center

Poon, Kin Keung

2018-01-01

GeoGebra is a mathematics software system that can serve as a tool for inquiry-based learning. This paper deals with the application of a fraction comparison software, which is constructed by GeoGebra, for use in a dynamic mathematics environment. The corresponding teaching and learning issues have also been discussed.

Learning fraction comparison by using a dynamic mathematics software - GeoGebra

NASA Astrophysics Data System (ADS)

Poon, Kin Keung

2018-04-01

GeoGebra is a mathematics software system that can serve as a tool for inquiry-based learning. This paper deals with the application of a fraction comparison software, which is constructed by GeoGebra, for use in a dynamic mathematics environment. The corresponding teaching and learning issues have also been discussed.

Modeling Coastal Salinity in Quasi 2D and 3D Using a DUALEM-421 and Inversion Software.

PubMed

Davies, Gareth; Huang, Jingyi; Monteiro Santos, Fernando Acacio; Triantafilis, John

2015-01-01

Rising sea levels, owing to climate change, are a threat to fresh water coastal aquifers. This is because saline intrusions are caused by increases and intensification of medium-large scale influences including sea level rise, wave climate, tidal cycles, and shifts in beach morphology. Methods are therefore required to understand the dynamics of these interactions. While traditional borehole and galvanic contact resistivity (GCR) techniques have been successful they are time-consuming. Alternatively, frequency-domain electromagnetic (FEM) induction is potentially useful as physical contact with the ground is not required. A DUALEM-421 and EM4Soil inversion software package are used to develop a quasi two- (2D) and quasi three-dimensional (3D) electromagnetic conductivity images (EMCI) across Long Reef Beach located north of Sydney Harbour, New South Wales, Australia. The quasi 2D models discern: the dry sand (<10 mS/m) associated with the incipient dune; sand with fresh water (10 to 20 mS/m); mixing of fresh and saline water (20 to 500 mS/m), and; saline sand of varying moisture (more than 500 mS/m). The quasi 3D EMCIs generated for low and high tides suggest that daily tidal cycles do not have a significant effect on local groundwater salinity. Instead, the saline intrusion is most likely influenced by medium-large scale drivers including local wave climate and morphology along this wave-dominated beach. Further research is required to elucidate the influence of spring-neap tidal cycles, contrasting beach morphological states and sea level rise. © 2014, National Ground Water Association.

Low cycle fatigue numerical estimation of a high pressure turbine disc for the AL-31F jet engine

NASA Astrophysics Data System (ADS)

Spodniak, Miroslav; Klimko, Marek; Hocko, Marián; Žitek, Pavel

This article deals with the description of an approximate numerical estimation approach of a low cycle fatigue of a high pressure turbine disc for the AL-31F turbofan jet engine. The numerical estimation is based on the finite element method carried out in the SolidWorks software. The low cycle fatigue assessment of a high pressure turbine disc was carried out on the basis of dimensional, shape and material disc characteristics, which are available for the particular high pressure engine turbine. The method described here enables relatively fast setting of economically feasible low cycle fatigue of the assessed high pressure turbine disc using a commercially available software. The numerical estimation of accuracy of a low cycle fatigue depends on the accuracy of required input data for the particular investigated object.

Non-Newtonian blood flow dynamics in a right internal carotid artery with a saccular aneurysm

NASA Astrophysics Data System (ADS)

Valencia, Alvaro; Zarate, Alvaro; Galvez, Marcelo; Badilla, Lautaro

2006-02-01

Flow dynamics plays an important role in the pathogenesis and treatment of cerebral aneurysms. The temporal and spatial variations of wall shear stress in the aneurysm are hypothesized to be correlated with its growth and rupture. In addition, the assessment of the velocity field in the aneurysm dome and neck is important for the correct placement of endovascular coils. This work describes the flow dynamics in a patient-specific model of carotid artery with a saccular aneurysm under Newtonian and non-Newtonian fluid assumptions. The model was obtained from three-dimensional rotational angiography image data and blood flow dynamics was studied under physiologically representative waveform of inflow. The three-dimensional continuity and momentum equations for incompressible and unsteady laminar flow were solved with a commercial software using non-structured fine grid with 283 115 tetrahedral elements. The intra-aneurysmal flow shows complex vortex structure that change during one pulsatile cycle. The effect of the non-Newtonian properties of blood on the wall shear stress was important only in the arterial regions with high velocity gradients, on the aneurysmal wall the predictions with the Newtonian and non-Newtonian blood models were similar.

Lean Development with the Morpheus Simulation Software

NASA Technical Reports Server (NTRS)

Brogley, Aaron C.

2013-01-01

The Morpheus project is an autonomous robotic testbed currently in development at NASA's Johnson Space Center (JSC) with support from other centers. Its primary objectives are to test new 'green' fuel propulsion systems and to demonstrate the capability of the Autonomous Lander Hazard Avoidance Technology (ALHAT) sensor, provided by the Jet Propulsion Laboratory (JPL) on a lunar landing trajectory. If successful, these technologies and lessons learned from the Morpheus testing cycle may be incorporated into a landing descent vehicle used on the moon, an asteroid, or Mars. In an effort to reduce development costs and cycle time, the project employs lean development engineering practices in its development of flight and simulation software. The Morpheus simulation makes use of existing software packages where possible to reduce the development time. The development and testing of flight software occurs primarily through the frequent test operation of the vehicle and incrementally increasing the scope of the test. With rapid development cycles, risk of loss of the vehicle and loss of the mission are possible, but efficient progress in development would not be possible without that risk.

Software Assurance Curriculum Project Volume 2: Undergraduate Course Outlines

DTIC Science & Technology

2010-08-01

Contents Acknowledgments iii Abstract v 1 An Undergraduate Curriculum Focus on Software Assurance 1 2 Computer Science I 7 3 Computer Science II...confidence that can be integrated into traditional software development and acquisition process models . Thus, in addition to a technology focus...testing throughout the software development life cycle ( SDLC ) AP Security and complexity—system development challenges: security failures

Software engineering from a Langley perspective

NASA Technical Reports Server (NTRS)

Voigt, Susan

1994-01-01

A brief introduction to software engineering is presented. The talk is divided into four sections beginning with the question 'What is software engineering', followed by a brief history of the progression of software engineering at the Langley Research Center in the context of an expanding computing environment. Several basic concepts and terms are introduced, including software development life cycles and maturity levels. Finally, comments are offered on what software engineering means for the Langley Research Center and where to find more information on the subject.

Implementing a modeling software for animated protein-complex interactions using a physics simulation library.

PubMed

Ueno, Yutaka; Ito, Shuntaro; Konagaya, Akihiko

2014-12-01

To better understand the behaviors and structural dynamics of proteins within a cell, novel software tools are being developed that can create molecular animations based on the findings of structural biology. This study proposes our method developed based on our prototypes to detect collisions and examine the soft-body dynamics of molecular models. The code was implemented with a software development toolkit for rigid-body dynamics simulation and a three-dimensional graphics library. The essential functions of the target software system included the basic molecular modeling environment, collision detection in the molecular models, and physical simulations of the movement of the model. Taking advantage of recent software technologies such as physics simulation modules and interpreted scripting language, the functions required for accurate and meaningful molecular animation were implemented efficiently.

Preliminary GPS orbit determination results for the Extreme Ultraviolet Explorer

NASA Technical Reports Server (NTRS)

Gold, Kenn; Bertiger, Willy; Wu, Sien; Yunck, Tom

1993-01-01

A single-frequency Motorola Global Positioning System (GPS) receiver was launched with the Extreme Ultraviolet Explorer mission in June 1992. The receiver utilizes dual GPS antennas placed on opposite sides of the satellite to obtain full GPS coverage as it rotates during its primary scanning mission. A data set from this GPS experiment has been processed at the Jet Propulsion Laboratory with the GIPSY-OASIS 2 software package. The single-frequency, dual antenna approach and the low altitude (approximately 500 km) orbit of the satellite create special problems for the GPS orbit determination analysis. The low orbit implies that the dynamics of the spacecraft will be difficult to model, and that atmospheric drag will be an important error source. A reduced-dynamic solution technique was investigated in which ad hoc accelerations were estimated at each time step to absorb dynamic model error. In addition, a single-frequency ionospheric correction was investigated, and a cycle-slip detector was written. Orbit accuracy is currently better than 5 m. Further optimization should improve this to about 1 m.

Dynamic Characteristics of a Simple Brayton Cryocycle

NASA Astrophysics Data System (ADS)

Kutzschbach, A.; Kauschke, M.; Haberstroh, Ch.; Quack, H.

2006-04-01

The goal of the overall program is to develop a dynamic numerical model of helium refrigerators and the associated cooling systems based on commercial simulation software. The aim is to give system designers a tool to search for optimum control strategies during the construction phase of the refrigerator with the help of a plant "simulator". In a first step, a simple Brayton refrigerator has been investigated, which consists of a compressor, an after-cooler, a counter-current heat exchanger, a turboexpander and a heat source. Operating modes are "refrigeration" and "liquefaction". Whereas for the steady state design only component efficiencies are needed and mass and energy balances have to be calculated, for the dynamic calculation one needs also the thermal masses and the helium inventory. Transient mass and energy balances have to be formulated for many small elements and then solved simultaneously for all elements. Starting point of the simulation of the Brayton cycle is the steady state operation at design conditions. The response of the system to step and cyclic changes of the refrigeration or liquefaction rate are calculated and characterized.

Faster than Real-Time Dynamic Simulation for Large-Size Power System with Detailed Dynamic Models using High-Performance Computing Platform

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Renke; Jin, Shuangshuang; Chen, Yousu

This paper presents a faster-than-real-time dynamic simulation software package that is designed for large-size power system dynamic simulation. It was developed on the GridPACKTM high-performance computing (HPC) framework. The key features of the developed software package include (1) faster-than-real-time dynamic simulation for a WECC system (17,000 buses) with different types of detailed generator, controller, and relay dynamic models, (2) a decoupled parallel dynamic simulation algorithm with optimized computation architecture to better leverage HPC resources and technologies, (3) options for HPC-based linear and iterative solvers, (4) hidden HPC details, such as data communication and distribution, to enable development centered on mathematicalmore » models and algorithms rather than on computational details for power system researchers, and (5) easy integration of new dynamic models and related algorithms into the software package.« less

Computer Program Development Specification for IDAMST Operational Flight Programs. Addendum 1. Executive Software.

DTIC Science & Technology

1976-11-01

system. b. Read different program configurations to reconfigure the software during flight. c. Write Digital Integrated Test System (DITS) results...associated witn > inor C):l.e Event must be Unlatched. The sole difference between a Latched ana an lnratcrec Condition is that upon the Scheduling...Table. Furthermore, the block of pointers for one Minor Cycle may be wholly contained witnir the Diock of ocinters for a different Minor Cycle. For

Integrated testing and verification system for research flight software

NASA Technical Reports Server (NTRS)

Taylor, R. N.

1979-01-01

The MUST (Multipurpose User-oriented Software Technology) program is being developed to cut the cost of producing research flight software through a system of software support tools. An integrated verification and testing capability was designed as part of MUST. Documentation, verification and test options are provided with special attention on real-time, multiprocessing issues. The needs of the entire software production cycle were considered, with effective management and reduced lifecycle costs as foremost goals.

IEEE Computer Society/Software Engineering Institute Software Process Achievement (SPA) Award 2009

DTIC Science & Technology

2011-03-01

capabilities to our GDM. We also introduced software as a service ( SaaS ) as part our technology solutions and have further enhanced our ability to...model PROSPER Infosys production support methodology Q&P quality and productivity R&D research and development SaaS software as a service ... Software Development Life Cycle (SDLC) 23 Table 10: Scientific Estimation Coverage by Service Line 27 CMU/SEI-2011-TR-008 | vi CMU/SEI-2011

Benchmarking of dynamic simulation predictions in two software platforms using an upper limb musculoskeletal model

PubMed Central

Saul, Katherine R.; Hu, Xiao; Goehler, Craig M.; Vidt, Meghan E.; Daly, Melissa; Velisar, Anca; Murray, Wendy M.

2014-01-01

Several opensource or commercially available software platforms are widely used to develop dynamic simulations of movement. While computational approaches are conceptually similar across platforms, technical differences in implementation may influence output. We present a new upper limb dynamic model as a tool to evaluate potential differences in predictive behavior between platforms. We evaluated to what extent differences in technical implementations in popular simulation software environments result in differences in kinematic predictions for single and multijoint movements using EMG- and optimization-based approaches for deriving control signals. We illustrate the benchmarking comparison using SIMM-Dynamics Pipeline-SD/Fast and OpenSim platforms. The most substantial divergence results from differences in muscle model and actuator paths. This model is a valuable resource and is available for download by other researchers. The model, data, and simulation results presented here can be used by future researchers to benchmark other software platforms and software upgrades for these two platforms. PMID:24995410

Benchmarking of dynamic simulation predictions in two software platforms using an upper limb musculoskeletal model.

PubMed

Saul, Katherine R; Hu, Xiao; Goehler, Craig M; Vidt, Meghan E; Daly, Melissa; Velisar, Anca; Murray, Wendy M

2015-01-01

Several opensource or commercially available software platforms are widely used to develop dynamic simulations of movement. While computational approaches are conceptually similar across platforms, technical differences in implementation may influence output. We present a new upper limb dynamic model as a tool to evaluate potential differences in predictive behavior between platforms. We evaluated to what extent differences in technical implementations in popular simulation software environments result in differences in kinematic predictions for single and multijoint movements using EMG- and optimization-based approaches for deriving control signals. We illustrate the benchmarking comparison using SIMM-Dynamics Pipeline-SD/Fast and OpenSim platforms. The most substantial divergence results from differences in muscle model and actuator paths. This model is a valuable resource and is available for download by other researchers. The model, data, and simulation results presented here can be used by future researchers to benchmark other software platforms and software upgrades for these two platforms.

Design and development of a community carbon cycle benchmarking system for CMIP5 models

NASA Astrophysics Data System (ADS)

Mu, M.; Hoffman, F. M.; Lawrence, D. M.; Riley, W. J.; Keppel-Aleks, G.; Randerson, J. T.

2013-12-01

Benchmarking has been widely used to assess the ability of atmosphere, ocean, sea ice, and land surface models to capture the spatial and temporal variability of observations during the historical period. For the carbon cycle and terrestrial ecosystems, the design and development of an open-source community platform has been an important goal as part of the International Land Model Benchmarking (ILAMB) project. Here we designed and developed a software system that enables the user to specify the models, benchmarks, and scoring systems so that results can be tailored to specific model intercomparison projects. We used this system to evaluate the performance of CMIP5 Earth system models (ESMs). Our scoring system used information from four different aspects of climate, including the climatological mean spatial pattern of gridded surface variables, seasonal cycle dynamics, the amplitude of interannual variability, and long-term decadal trends. We used this system to evaluate burned area, global biomass stocks, net ecosystem exchange, gross primary production, and ecosystem respiration from CMIP5 historical simulations. Initial results indicated that the multi-model mean often performed better than many of the individual models for most of the observational constraints.

Emerging High School Students' Problem Solving Trajectories Based on the Use of Dynamic Software

ERIC Educational Resources Information Center

Santos-Trigo, Manuel; Cristobal-Escalante, Cesar

2008-01-01

This study documents problem solving approaches that high school students develop as a result of using systematically Cabri-Geometry software. Results show that the use of the software becomes an important tool for students to construct dynamic representations of the problems that were used to identify and examine different mathematical relations.…

Teachers' Critical Evaluations of Dynamic Geometry Software Implementation in 1:1 Classrooms

ERIC Educational Resources Information Center

Ware, Jennifer; Stein, Sarah

2014-01-01

Although the use of dynamic software in high school mathematics in the United States has emerged as a research topic, little research has been conducted on how teachers integrate new software in relation to at-home technology networks. Interviews with eight mathematics teachers from four North Carolina counties participating in 1:1 laptop…

Design and reliability analysis of DP-3 dynamic positioning control architecture

NASA Astrophysics Data System (ADS)

Wang, Fang; Wan, Lei; Jiang, Da-Peng; Xu, Yu-Ru

2011-12-01

As the exploration and exploitation of oil and gas proliferate throughout deepwater area, the requirements on the reliability of dynamic positioning system become increasingly stringent. The control objective ensuring safety operation at deep water will not be met by a single controller for dynamic positioning. In order to increase the availability and reliability of dynamic positioning control system, the triple redundancy hardware and software control architectures were designed and developed according to the safe specifications of DP-3 classification notation for dynamically positioned ships and rigs. The hardware redundant configuration takes the form of triple-redundant hot standby configuration including three identical operator stations and three real-time control computers which connect each other through dual networks. The function of motion control and redundancy management of control computers were implemented by software on the real-time operating system VxWorks. The software realization of task loose synchronization, majority voting and fault detection were presented in details. A hierarchical software architecture was planed during the development of software, consisting of application layer, real-time layer and physical layer. The behavior of the DP-3 dynamic positioning control system was modeled by a Markov model to analyze its reliability. The effects of variation in parameters on the reliability measures were investigated. The time domain dynamic simulation was carried out on a deepwater drilling rig to prove the feasibility of the proposed control architecture.

Development of computer software for pavement life cycle cost analysis.

DOT National Transportation Integrated Search

1988-01-01

The life cycle cost analysis program (LCCA) is designed to automate and standardize life cycle costing in Virginia. It allows the user to input information necessary for the analysis, and it then completes the calculations and produces a printed copy...

Software Requirements Specification for an Ammunition Management System

DTIC Science & Technology

1986-09-01

thesis takes the form of a software requirements specification. Such a specification, according to Pressman [Ref. 7], establishes a complete...defined by Pressman , is depicted in Figure 1.1. 11 Figure 1.1 Generalized Software Life Cycle The common thread which binds the various phases together...application of software engineering principles requires an established methodology. This methodology, according to Pressman [Ref. 8:p. 151 is an

Model-based software process improvement

NASA Technical Reports Server (NTRS)

Zettervall, Brenda T.

1994-01-01

The activities of a field test site for the Software Engineering Institute's software process definition project are discussed. Products tested included the improvement model itself, descriptive modeling techniques, the CMM level 2 framework document, and the use of process definition guidelines and templates. The software process improvement model represents a five stage cyclic approach for organizational process improvement. The cycles consist of the initiating, diagnosing, establishing, acting, and leveraging phases.

Musing on the Use of Dynamic Software and Mathematics Epistemology

ERIC Educational Resources Information Center

Santos-Trigo, Manuel; Reyes-Rodriguez, Aaron; Espinosa-Perez, Hugo

2007-01-01

Different computational tools may offer teachers and students distinct opportunities in representing, exploring and solving mathematical tasks. In this context, we illustrate that the use of dynamic software (Cabri Geometry) helped high school teachers to think of and represent a particular task dynamically. In this process, the teachers had the…

Prompting Teacher Geometric Reasoning through Coaching in a Dynamic Geometry Software Context

ERIC Educational Resources Information Center

Knapp, Andrea K.; Barrett, Jeffrey E.; Moore, Cynthia J.

2016-01-01

This study investigated the ways in which four middle grades teachers developed mathematical knowledge for teaching (MKT) geometry as they implemented dynamic geometry software in their classrooms with the assistance of a coach. Teachers developed various components of MKT by observing coaches teach, by dynamic discourse with students, which is…

Model-Based Analysis of Cell Cycle Responses to Dynamically Changing Environments

PubMed Central

Seaton, Daniel D; Krishnan, J

2016-01-01

Cell cycle progression is carefully coordinated with a cell’s intra- and extracellular environment. While some pathways have been identified that communicate information from the environment to the cell cycle, a systematic understanding of how this information is dynamically processed is lacking. We address this by performing dynamic sensitivity analysis of three mathematical models of the cell cycle in Saccharomyces cerevisiae. We demonstrate that these models make broadly consistent qualitative predictions about cell cycle progression under dynamically changing conditions. For example, it is shown that the models predict anticorrelated changes in cell size and cell cycle duration under different environments independently of the growth rate. This prediction is validated by comparison to available literature data. Other consistent patterns emerge, such as widespread nonmonotonic changes in cell size down generations in response to parameter changes. We extend our analysis by investigating glucose signalling to the cell cycle, showing that known regulation of Cln3 translation and Cln1,2 transcription by glucose is sufficient to explain the experimentally observed changes in cell cycle dynamics at different glucose concentrations. Together, these results provide a framework for understanding the complex responses the cell cycle is capable of producing in response to dynamic environments. PMID:26741131

Understanding bicycling in cities using system dynamics modelling.

PubMed

Macmillan, Alexandra; Woodcock, James

2017-12-01

Increasing urban bicycling has established net benefits for human and environmental health. Questions remain about which policies are needed and in what order, to achieve an increase in cycling while avoiding negative consequences. Novel ways of considering cycling policy are needed, bringing together expertise across policy, community and research to develop a shared understanding of the dynamically complex cycling system. In this paper we use a collaborative learning process to develop a dynamic causal model of urban cycling to develop consensus about the nature and order of policies needed in different cycling contexts to optimise outcomes. We used participatory system dynamics modelling to develop causal loop diagrams (CLDs) of cycling in three contrasting contexts: Auckland, London and Nijmegen. We combined qualitative interviews and workshops to develop the CLDs. We used the three CLDs to compare and contrast influences on cycling at different points on a "cycling trajectory" and drew out policy insights. The three CLDs consisted of feedback loops dynamically influencing cycling, with significant overlap between the three diagrams. Common reinforcing patterns emerged: growing numbers of people cycling lifts political will to improve the environment; cycling safety in numbers drives further growth; and more cycling can lead to normalisation across the population. By contrast, limits to growth varied as cycling increases. In Auckland and London, real and perceived danger was considered the main limit, with added barriers to normalisation in London. Cycling congestion and "market saturation" were important in the Netherlands. A generalisable, dynamic causal theory for urban cycling enables a more ordered set of policy recommendations for different cities on a cycling trajectory. Participation meant the collective knowledge of cycling stakeholders was represented and triangulated with research evidence. Extending this research to further cities, especially in low-middle income countries, would enhance generalizability of the CLDs.

A Graphical User Interface for Software-assisted Tracking of Protein Concentration in Dynamic Cellular Protrusions.

PubMed

Saha, Tanumoy; Rathmann, Isabel; Galic, Milos

2017-07-11

Filopodia are dynamic, finger-like cellular protrusions associated with migration and cell-cell communication. In order to better understand the complex signaling mechanisms underlying filopodial initiation, elongation and subsequent stabilization or retraction, it is crucial to determine the spatio-temporal protein activity in these dynamic structures. To analyze protein function in filopodia, we recently developed a semi-automated tracking algorithm that adapts to filopodial shape-changes, thus allowing parallel analysis of protrusion dynamics and relative protein concentration along the whole filopodial length. Here, we present a detailed step-by-step protocol for optimized cell handling, image acquisition and software analysis. We further provide instructions for the use of optional features during image analysis and data representation, as well as troubleshooting guidelines for all critical steps along the way. Finally, we also include a comparison of the described image analysis software with other programs available for filopodia quantification. Together, the presented protocol provides a framework for accurate analysis of protein dynamics in filopodial protrusions using image analysis software.

Observing Crop-Height Dynamics Using a UAV

NASA Astrophysics Data System (ADS)

Ziliani, M. G.; Parkes, S. D.; McCabe, M.

2017-12-01

Retrieval of vegetation height during a growing season is a key indicator for monitoring crop status, offering insight to the forecast yield relative to previous planting cycles. Improvement in Unmanned Aerial Vehicle (UAV) technologies, supported by advances in computer vision and photogrammetry software, has enabled retrieval of crop heights with much higher spatial resolution and coverage. These methodologies retrieve a Digital Surface Map (DSM), which combine terrain and crop elements to obtain a Crop Surface Map (CSM). Here we describe an automated method for deriving high resolution CSMs from a DSM, using RGB imagery from a UAV platform. Importantly, the approach does not require the need for a digital terrain map (DTM). The method involves distinguishing between vegetation and bare-ground cover pixels, using vegetation index maps from the RGB orthomosaic derived from the same flight as the DSM. We show that the absolute crop height can be extracted to within several centimeters, exploiting the data captured from a single UAV flight. In addition, the method is applied across five surveys during a maize growing cycle and compared against a terrain map constructed from a baseline UAV survey undertaken prior to crop growth. Results show that the approach is able to reproduce the observed spatial variability of the crop height within the maize field throughout the duration of the growing season. This is particularly valuable since it may be employed to detect intra-field problems (i.e. fertilizer variability, inefficiency in the irrigation system, salinity etc.) at different stages of the season, from which remedial action can be initiated to mitigate against yield loss. The method also demonstrates that UAV imagery combined with commercial photogrammetry software can determine a CSM from a single flight without the requirement of a prior DTM. This, together with the dynamic crop height estimation, provide useful information with which to inform precision agricultural management at the local scale.

Orbit determination software development for microprocessor based systems: Evaluation and recommendations

NASA Technical Reports Server (NTRS)

Shenitz, C. M.; Mcgarry, F. E.; Tasaki, K. K.

1980-01-01

A guide is presented for National Aeronautics and Space Administration management personnel who stand to benefit from the lessons learned in developing microprocessor-based flight dynamics software systems. The essential functional characteristics of microprocessors are presented. The relevant areas of system support software are examined, as are the distinguishing characteristics of flight dynamics software. Design examples are provided to illustrate the major points presented, and actual development experience obtained in this area is provided as evidence to support the conclusions reached.

Views of Pre-Service Teachers Following Teaching Experience on Use of Dynamic Geometry Software

ERIC Educational Resources Information Center

Günes, Kardelen; Tapan-Broutin, Menekse Seden

2017-01-01

The study aims to determine the views of final-year pre-service mathematics teachers towards their experience of the use of dynamic geometry software in teaching, following the implementation processes that they carried out when using this software in a real classroom environment. The study was designed as a case study, which is one of the…

Towards Model-Driven End-User Development in CALL

ERIC Educational Resources Information Center

Farmer, Rod; Gruba, Paul

2006-01-01

The purpose of this article is to introduce end-user development (EUD) processes to the CALL software development community. EUD refers to the active participation of end-users, as non-professional developers, in the software development life cycle. Unlike formal software engineering approaches, the focus in EUD on means/ends development is…

Substructured multibody molecular dynamics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grest, Gary Stephen; Stevens, Mark Jackson; Plimpton, Steven James

2006-11-01

We have enhanced our parallel molecular dynamics (MD) simulation software LAMMPS (Large-scale Atomic/Molecular Massively Parallel Simulator, lammps.sandia.gov) to include many new features for accelerated simulation including articulated rigid body dynamics via coupling to the Rensselaer Polytechnic Institute code POEMS (Parallelizable Open-source Efficient Multibody Software). We use new features of the LAMMPS software package to investigate rhodopsin photoisomerization, and water model surface tension and capillary waves at the vapor-liquid interface. Finally, we motivate the recipes of MD for practitioners and researchers in numerical analysis and computational mechanics.

Dynamic Modelling with "MLE-Energy Dynamic" for Primary School

NASA Astrophysics Data System (ADS)

Giliberti, Enrico; Corni, Federico

During the recent years simulation and modelling are growing instances in science education. In primary school, however, the main use of software is the simulation, due to the lack of modelling software tools specially designed to fit/accomplish the needs of primary education. In particular primary school teachers need to use simulation in a framework that is both consistent and simple enough to be understandable by children [2]. One of the possible area to approach modelling is about the construction of the concept of energy, in particular for what concerns the relations among substance, potential, power [3]. Following the previous initial research results with this approach [2], and with the static version of the software MLE Energy [1], we suggest the design and the experimentation of a dynamic modelling software—MLE dynamic-capable to represent dynamically the relations occurring when two substance-like quantities exchange energy, modifying their potential. By means of this software the user can graphically choose the dependent and independent variables and leave the other parameters fixed. The software has been initially evaluated, during a course of science education with a group of primary school teachers-to-be, to test the ability of the software to improve teachers' way of thinking in terms of substance-like quantities and their effects (graphical representation of the extensive, intensive variables and their mutual relations); moreover, the software has been tested with a group of primary school teachers, asking their opinion about the software didactical relevance in the class work.

Table-driven configuration and formatting of telemetry data in the Deep Space Network

NASA Technical Reports Server (NTRS)

Manning, Evan

1994-01-01

With a restructured software architecture for telemetry system control and data processing, the NASA/Deep Space Network (DSN) has substantially improved its ability to accommodate a wide variety of spacecraft in an era of 'better, faster, cheaper'. In the new architecture, the permanent software implements all capabilities needed by any system user, and text tables specify how these capabilities are to be used for each spacecraft. Most changes can now be made rapidly, outside of the traditional software development cycle. The system can be updated to support a new spacecraft through table changes rather than software changes, reducing the implementation, test, and delivery cycle for such a change from three months to three weeks. The mechanical separation of the text table files from the program software, with tables only loaded into memory when that mission is being supported, dramatically reduces the level of regression testing required. The format of each table is a different compromise between ease of human interpretation, efficiency of computer interpretation, and flexibility.

Deep space network software cost estimation model

NASA Technical Reports Server (NTRS)

Tausworthe, R. C.

1981-01-01

A parametric software cost estimation model prepared for Jet PRopulsion Laboratory (JPL) Deep Space Network (DSN) Data System implementation tasks is described. The resource estimation mdel modifies and combines a number of existing models. The model calibrates the task magnitude and difficulty, development environment, and software technology effects through prompted responses to a set of approximately 50 questions. Parameters in the model are adjusted to fit JPL software life-cycle statistics.

Dynamic interrogative data capture (DIDC) : concept of operations.

DOT National Transportation Integrated Search

2016-04-01

This Concept of Operations (ConOps) describes the characteristics of the Dynamic Interrogative Data Capture (DIDC) algorithms and associated software. The objective of the DIDC algorithms and software is to optimize the capture and transmission of ve...

Software Reviews.

ERIC Educational Resources Information Center

Science and Children, 1989

1989-01-01

Reviews of seven software packages are presented including "The Environment I: Habitats and EcoSystems; II Cycles and Interactions"; "Super Sign Maker"; "The Great Knowledge Race: Substance Abuse"; "Exploring Science: Temperature"; "Fast Food Calculator and RD Aide"; "The Human Body:…

Photo-Pictures and Dynamic Software or about the Motivation of the Art-Oriented Students

ERIC Educational Resources Information Center

Chehlarova, Toni; Chehlarova, Koya

2014-01-01

This paper deals with ideas about dynamic presentation of photo-pictures by means of dynamic software GeoGebra in order to motivate art students to get acquainted with some specific mathematical functions. The results of the experiment include deeper understanding of the functions' nature, search of new functions for dealing with a practical…

An Analysis of How and Why High School Geometry Teachers Implement Dynamic Geometry Software Tasks for Student Engagement

ERIC Educational Resources Information Center

Nirode, Wayne

2012-01-01

This study examined teachers' use of student tasks involving dynamic geometry software, in which a figure is constructed then altered while maintaining its constructed properties. Although researchers, professional organizations, and policy makers generally have been proponents of dynamic geometry for instruction, there is little research about…

Research on Generating Method of Embedded Software Test Document Based on Dynamic Model

NASA Astrophysics Data System (ADS)

Qu, MingCheng; Wu, XiangHu; Tao, YongChao; Liu, Ying

2018-03-01

This paper provides a dynamic model-based test document generation method for embedded software that provides automatic generation of two documents: test requirements specification documentation and configuration item test documentation. This method enables dynamic test requirements to be implemented in dynamic models, enabling dynamic test demand tracking to be easily generated; able to automatically generate standardized, standardized test requirements and test documentation, improved document-related content inconsistency and lack of integrity And other issues, improve the efficiency.

Research a Novel Integrated and Dynamic Multi-object Trade-Off Mechanism in Software Project

NASA Astrophysics Data System (ADS)

Jiang, Weijin; Xu, Yuhui

Aiming at practical requirements of present software project management and control, the paper presented to construct integrated multi-object trade-off model based on software project process management, so as to actualize integrated and dynamic trade-oil of the multi-object system of project. Based on analyzing basic principle of dynamic controlling and integrated multi-object trade-off system process, the paper integrated method of cybernetics and network technology, through monitoring on some critical reference points according to the control objects, emphatically discussed the integrated and dynamic multi- object trade-off model and corresponding rules and mechanism in order to realize integration of process management and trade-off of multi-object system.

Predicting the Dynamics of Protein Abundance

PubMed Central

Mehdi, Ahmed M.; Patrick, Ralph; Bailey, Timothy L.; Bodén, Mikael

2014-01-01

Protein synthesis is finely regulated across all organisms, from bacteria to humans, and its integrity underpins many important processes. Emerging evidence suggests that the dynamic range of protein abundance is greater than that observed at the transcript level. Technological breakthroughs now mean that sequencing-based measurement of mRNA levels is routine, but protocols for measuring protein abundance remain both complex and expensive. This paper introduces a Bayesian network that integrates transcriptomic and proteomic data to predict protein abundance and to model the effects of its determinants. We aim to use this model to follow a molecular response over time, from condition-specific data, in order to understand adaptation during processes such as the cell cycle. With microarray data now available for many conditions, the general utility of a protein abundance predictor is broad. Whereas most quantitative proteomics studies have focused on higher organisms, we developed a predictive model of protein abundance for both Saccharomyces cerevisiae and Schizosaccharomyces pombe to explore the latitude at the protein level. Our predictor primarily relies on mRNA level, mRNA–protein interaction, mRNA folding energy and half-life, and tRNA adaptation. The combination of key features, allowing for the low certainty and uneven coverage of experimental observations, gives comparatively minor but robust prediction accuracy. The model substantially improved the analysis of protein regulation during the cell cycle: predicted protein abundance identified twice as many cell-cycle-associated proteins as experimental mRNA levels. Predicted protein abundance was more dynamic than observed mRNA expression, agreeing with experimental protein abundance from a human cell line. We illustrate how the same model can be used to predict the folding energy of mRNA when protein abundance is available, lending credence to the emerging view that mRNA folding affects translation efficiency. The software and data used in this research are available at http://bioinf.scmb.uq.edu.au/proteinabundance/. PMID:24532840

Predicting the dynamics of protein abundance.

PubMed

Mehdi, Ahmed M; Patrick, Ralph; Bailey, Timothy L; Bodén, Mikael

2014-05-01

Protein synthesis is finely regulated across all organisms, from bacteria to humans, and its integrity underpins many important processes. Emerging evidence suggests that the dynamic range of protein abundance is greater than that observed at the transcript level. Technological breakthroughs now mean that sequencing-based measurement of mRNA levels is routine, but protocols for measuring protein abundance remain both complex and expensive. This paper introduces a Bayesian network that integrates transcriptomic and proteomic data to predict protein abundance and to model the effects of its determinants. We aim to use this model to follow a molecular response over time, from condition-specific data, in order to understand adaptation during processes such as the cell cycle. With microarray data now available for many conditions, the general utility of a protein abundance predictor is broad. Whereas most quantitative proteomics studies have focused on higher organisms, we developed a predictive model of protein abundance for both Saccharomyces cerevisiae and Schizosaccharomyces pombe to explore the latitude at the protein level. Our predictor primarily relies on mRNA level, mRNA-protein interaction, mRNA folding energy and half-life, and tRNA adaptation. The combination of key features, allowing for the low certainty and uneven coverage of experimental observations, gives comparatively minor but robust prediction accuracy. The model substantially improved the analysis of protein regulation during the cell cycle: predicted protein abundance identified twice as many cell-cycle-associated proteins as experimental mRNA levels. Predicted protein abundance was more dynamic than observed mRNA expression, agreeing with experimental protein abundance from a human cell line. We illustrate how the same model can be used to predict the folding energy of mRNA when protein abundance is available, lending credence to the emerging view that mRNA folding affects translation efficiency. The software and data used in this research are available at http://bioinf.scmb.uq.edu.au/proteinabundance/.

Using a software-defined computer in teaching the basics of computer architecture and operation

NASA Astrophysics Data System (ADS)

Kosowska, Julia; Mazur, Grzegorz

2017-08-01

The paper describes the concept and implementation of SDC_One software-defined computer designed for experimental and didactic purposes. Equipped with extensive hardware monitoring mechanisms, the device enables the students to monitor the computer's operation on bus transfer cycle or instruction cycle basis, providing the practical illustration of basic aspects of computer's operation. In the paper, we describe the hardware monitoring capabilities of SDC_One and some scenarios of using it in teaching the basics of computer architecture and microprocessor operation.

IEEE Std 730 Software Quality Assurance: Supporting CMMI-DEV v1.3, Product and Process Quality Assurance

DTIC Science & Technology

2011-05-27

frameworks 4 CMMI-DEV IEEE / ISO / IEC 15288 / 12207 Quality Assurance ©2011 Walz IEEE Life Cycle Processes & Artifacts • Systems Life Cycle Processes...TAG to ISO TC 176 Quality Management • Quality: ASQ, work experience • Software: three books, consulting, work experience • Systems: Telecom & DoD...and IEEE 730 SQA need to align. The P730 IEEE standards working group has expanded the scope of the SQA process standard to align with IS 12207

Product-oriented Software Certification Process for Software Synthesis

NASA Technical Reports Server (NTRS)

Nelson, Stacy; Fischer, Bernd; Denney, Ewen; Schumann, Johann; Richardson, Julian; Oh, Phil

2004-01-01

The purpose of this document is to propose a product-oriented software certification process to facilitate use of software synthesis and formal methods. Why is such a process needed? Currently, software is tested until deemed bug-free rather than proving that certain software properties exist. This approach has worked well in most cases, but unfortunately, deaths still occur due to software failure. Using formal methods (techniques from logic and discrete mathematics like set theory, automata theory and formal logic as opposed to continuous mathematics like calculus) and software synthesis, it is possible to reduce this risk by proving certain software properties. Additionally, software synthesis makes it possible to automate some phases of the traditional software development life cycle resulting in a more streamlined and accurate development process.

Stability analysis using SDSA tool

NASA Astrophysics Data System (ADS)

Goetzendorf-Grabowski, Tomasz; Mieszalski, Dawid; Marcinkiewicz, Ewa

2011-11-01

The SDSA (Simulation and Dynamic Stability Analysis) application is presented as a tool for analysing the dynamic characteristics of the aircraft just in the conceptual design stage. SDSA is part of the CEASIOM (Computerized Environment for Aircraft Synthesis and Integrated Optimization Methods) software environment which was developed within the SimSAC (Simulating Aircraft Stability And Control Characteristics for Use in Conceptual Design) project, funded by the European Commission 6th Framework Program. SDSA can also be used as stand alone software, and integrated with other design and optimisation systems using software wrappers. This paper focuses on the main functionalities of SDSA and presents both computational and free flight experimental results to compare and validate the presented software. Two aircraft are considered, the EADS Ranger 2000 and the Warsaw University designed PW-6 glider. For the two cases considered here the SDSA software is shown to be an excellent tool for predicting dynamic characteristics of an aircraft.

CONTIN XPCS: Software for Inverse Transform Analysis of X-Ray Photon Correlation Spectroscopy Dynamics

PubMed Central

Narayanan, Suresh; Zhang, Fan; Kuzmenko, Ivan; Ilavsky, Jan

2018-01-01

X-ray photon correlation spectroscopy (XPCS) and dynamic light scattering (DLS) both reveal dynamics using coherent scattering, but X-rays permit investigating of dynamics in a much more diverse array of materials. Heterogeneous dynamics occur in many such materials, and we showed how classic tools employed in analysis of heterogeneous DLS dynamics extend to XPCS, revealing additional information that conventional Kohlrausch exponential fitting obscures. This work presents the software implementation of inverse transform analysis of XPCS data called CONTIN XPCS, an extension of traditional CONTIN that accommodates dynamics encountered in equilibrium XPCS measurements. PMID:29875507

CONTIN XPCS: Software for Inverse Transform Analysis of X-Ray Photon Correlation Spectroscopy Dynamics.

PubMed

Andrews, Ross N; Narayanan, Suresh; Zhang, Fan; Kuzmenko, Ivan; Ilavsky, Jan

2018-02-01

X-ray photon correlation spectroscopy (XPCS) and dynamic light scattering (DLS) both reveal dynamics using coherent scattering, but X-rays permit investigating of dynamics in a much more diverse array of materials. Heterogeneous dynamics occur in many such materials, and we showed how classic tools employed in analysis of heterogeneous DLS dynamics extend to XPCS, revealing additional information that conventional Kohlrausch exponential fitting obscures. This work presents the software implementation of inverse transform analysis of XPCS data called CONTIN XPCS, an extension of traditional CONTIN that accommodates dynamics encountered in equilibrium XPCS measurements.

The Knowledge-Based Software Assistant: Beyond CASE

NASA Technical Reports Server (NTRS)

Carozzoni, Joseph A.

1993-01-01

This paper will outline the similarities and differences between two paradigms of software development. Both support the whole software life cycle and provide automation for most of the software development process, but have different approaches. The CASE approach is based on a set of tools linked by a central data repository. This tool-based approach is data driven and views software development as a series of sequential steps, each resulting in a product. The Knowledge-Based Software Assistant (KBSA) approach, a radical departure from existing software development practices, is knowledge driven and centers around a formalized software development process. KBSA views software development as an incremental, iterative, and evolutionary process with development occurring at the specification level.

Harnessing cell-to-cell variations to probe bacterial structure and biophysics

NASA Astrophysics Data System (ADS)

Cass, Julie A.

Advances in microscopy and biotechnology have given us novel insights into cellular biology and physics. While bacteria were long considered to be relatively unstructured, the development of fluorescence microscopy techniques, and spatially and temporally resolved high-throughput quantitative studies, have uncovered that the bacterial cell is highly organized, and its structure rigorously maintained. In this thesis I will describe our gateTool software, designed to harness cell-to-cell variations to probe bacterial structure, and discuss two exciting aspects of structure that we have employed gateTool to investigate: (i) chromosome organization and the cellular mechanisms for controlling DNA dynamics, and (ii) the study of cell wall synthesis, and how the genes in the synthesis pathway impact cellular shape. In the first project, we develop a spatial and temporal mapping of cell-cycle-dependent chromosomal organization, and use this quantitative map to discover that chromosomal loci segregate from midcell with universal dynamics. In the second project, I describe preliminary time- lapse and snapshot imaging analysis suggesting phentoypical coherence across peptidoglycan synthesis pathways.

Modeling and simulation performance of photovoltaic system integration battery and supercapacitor paralellization of MPPT prototipe for solar vehicle

NASA Astrophysics Data System (ADS)

Ajiatmo, Dwi; Robandi, Imam

2017-03-01

This paper proposes a control scheme photovoltaic, battery and super capacitor connected in parallel for use in a solar vehicle. Based on the features of battery charging, the control scheme consists of three modes, namely, mode dynamic irradian, constant load mode and constant voltage charging mode. The shift of the three modes can be realized by controlling the duty cycle of the mosffet Boost converter system. Meanwhile, the high voltage which is more suitable for the application can be obtained. Compared with normal charging method with parallel connected current limiting detention and charging method with dynamic irradian mode, constant load mode and constant voltage charging mode, the control scheme is proposed to shorten the charging time and increase the use of power generated from the PV array. From the simulation results and analysis conducted to determine the performance of the system in state transient and steady-state by using simulation software Matlab / Simulink. Response simulation results demonstrate the suitability of the proposed concept.

Update on Integrated Optical Design Analyzer

NASA Technical Reports Server (NTRS)

Moore, James D., Jr.; Troy, Ed

2003-01-01

Updated information on the Integrated Optical Design Analyzer (IODA) computer program has become available. IODA was described in Software for Multidisciplinary Concurrent Optical Design (MFS-31452), NASA Tech Briefs, Vol. 25, No. 10 (October 2001), page 8a. To recapitulate: IODA facilitates multidisciplinary concurrent engineering of highly precise optical instruments. The architecture of IODA was developed by reviewing design processes and software in an effort to automate design procedures. IODA significantly reduces design iteration cycle time and eliminates many potential sources of error. IODA integrates the modeling efforts of a team of experts in different disciplines (e.g., optics, structural analysis, and heat transfer) working at different locations and provides seamless fusion of data among thermal, structural, and optical models used to design an instrument. IODA is compatible with data files generated by the NASTRAN structural-analysis program and the Code V (Registered Trademark) optical-analysis program, and can be used to couple analyses performed by these two programs. IODA supports multiple-load-case analysis for quickly accomplishing trade studies. IODA can also model the transient response of an instrument under the influence of dynamic loads and disturbances.

An application generator for rapid prototyping of Ada real-time control software

NASA Technical Reports Server (NTRS)

Johnson, Jim; Biglari, Haik; Lehman, Larry

1990-01-01

The need to increase engineering productivity and decrease software life cycle costs in real-time system development establishes a motivation for a method of rapid prototyping. The design by iterative rapid prototyping technique is described. A tool which facilitates such a design methodology for the generation of embedded control software is described.

Automated Estimation Of Software-Development Costs

NASA Technical Reports Server (NTRS)

Roush, George B.; Reini, William

1993-01-01

COSTMODL is automated software development-estimation tool. Yields significant reduction in risk of cost overruns and failed projects. Accepts description of software product developed and computes estimates of effort required to produce it, calendar schedule required, and distribution of effort and staffing as function of defined set of development life-cycle phases. Written for IBM PC(R)-compatible computers.

Testing and analysis of the impact on engine cycle parameters and control system modifications using hydrogen or methane as fuel in an industrial gas turbine

NASA Astrophysics Data System (ADS)

Funke, H. H.-W.; Keinz, J.; Börner, S.; Hendrick, P.; Elsing, R.

2016-07-01

The paper highlights the modification of the engine control software of the hydrogen (H2) converted gas turbine Auxiliary Power Unit (APU) GTCP 36-300 allowing safe and accurate methane (CH4) operation achieved without mechanical changes of the metering unit. The acceleration and deceleration characteristics of the engine controller from idle to maximum load are analyzed comparing H2 and CH4. Also, the paper presents the influence on the thermodynamic cycle of gas turbine resulting from the different fuels supported by a gas turbine cycle simulation of H2 and CH4 using the software GasTurb.

FUNDAMENTALS OF LIFE CYCLE ASSESSMENT AND OFF-THE-SHELF SOFTWARE DEMONSTRATION

EPA Science Inventory

As the name implies, Life Cycle Assesssment (LCA) evaluates the entire life cycle of a product, process, activity, or service, not just simple economics at the time of delivery. This course on LCA covers the following issues:
Basic principles of LCA for use in producing, des...

Ndarts

NASA Technical Reports Server (NTRS)

Jain, Abhinandan

2011-01-01

Ndarts software provides algorithms for computing quantities associated with the dynamics of articulated, rigid-link, multibody systems. It is designed as a general-purpose dynamics library that can be used for the modeling of robotic platforms, space vehicles, molecular dynamics, and other such applications. The architecture and algorithms in Ndarts are based on the Spatial Operator Algebra (SOA) theory for computational multibody and robot dynamics developed at JPL. It uses minimal, internal coordinate models. The algorithms are low-order, recursive scatter/ gather algorithms. In comparison with the earlier Darts++ software, this version has a more general and cleaner design needed to support a larger class of computational dynamics needs. It includes a frames infrastructure, allows algorithms to operate on subgraphs of the system, and implements lazy and deferred computation for better efficiency. Dynamics modeling modules such as Ndarts are core building blocks of control and simulation software for space, robotic, mechanism, bio-molecular, and material systems modeling.

Programming support environment issues in the Byron programming environment

NASA Technical Reports Server (NTRS)

Larsen, Matthew J.

1986-01-01

Issues are discussed which programming support environments need to address in order to successfully support software engineering. These concerns are divided into two categories. The first category, issues of how software development is supported by an environment, includes support of the full life cycle, methodology flexibility, and support of software reusability. The second category contains issues of how environments should operate, such as tool reusability and integration, user friendliness, networking, and use of a central data base. This discussion is followed by an examination of Byron, an Ada based programming support environment developed at Intermetrics, focusing on the solutions Byron offers to these problems, including the support provided for software reusability and the test and maintenance phases of the life cycle. The use of Byron in project development is described briefly, and some suggestions for future Byron tools and user written tools are presented.

Cost benefits of advanced software: A review of methodology used at Kennedy Space Center

NASA Technical Reports Server (NTRS)

Joglekar, Prafulla N.

1993-01-01

To assist rational investments in advanced software, a formal, explicit, and multi-perspective cost-benefit analysis methodology is proposed. The methodology can be implemented through a six-stage process which is described and explained. The current practice of cost-benefit analysis at KSC is reviewed in the light of this methodology. The review finds that there is a vicious circle operating. Unsound methods lead to unreliable cost-benefit estimates. Unreliable estimates convince management that cost-benefit studies should not be taken seriously. Then, given external demands for cost-benefit estimates, management encourages software enginees to somehow come up with the numbers for their projects. Lacking the expertise needed to do a proper study, courageous software engineers with vested interests use ad hoc and unsound methods to generate some estimates. In turn, these estimates are unreliable, and the cycle continues. The proposed methodology should help KSC to break out of this cycle.

Ada education in a software life-cycle context

NASA Technical Reports Server (NTRS)

Clough, Anne J.

1986-01-01

Some of the experience gained from a comprehensive educational program undertaken at The Charles Stark Draper Lab. to introduce the Ada language and to transition modern software engineering technology into the development of Ada and non-Ada applications is described. Initially, a core group, which included manager, engineers and programmers, received training in Ada. An Ada Office was established to assume the major responsibility for training, evaluation, acquisition and benchmarking of tools, and consultation on Ada projects. As a first step in this process, and in-house educational program was undertaken to introduce Ada to the Laboratory. Later, a software engineering course was added to the educational program as the need to address issues spanning the entire software life cycle became evident. Educational efforts to date are summarized, with an emphasis on the educational approach adopted. Finally, lessons learned in administering this program are addressed.

Cost and schedule estimation study report

NASA Technical Reports Server (NTRS)

Condon, Steve; Regardie, Myrna; Stark, Mike; Waligora, Sharon

1993-01-01

This report describes the analysis performed and the findings of a study of the software development cost and schedule estimation models used by the Flight Dynamics Division (FDD), Goddard Space Flight Center. The study analyzes typical FDD projects, focusing primarily on those developed since 1982. The study reconfirms the standard SEL effort estimation model that is based on size adjusted for reuse; however, guidelines for the productivity and growth parameters in the baseline effort model have been updated. The study also produced a schedule prediction model based on empirical data that varies depending on application type. Models for the distribution of effort and schedule by life-cycle phase are also presented. Finally, this report explains how to use these models to plan SEL projects.

Effect of thermal and mechanical parameter’s damage numerical simulation cycling effects on defects in hot metal forming processes

NASA Astrophysics Data System (ADS)

El Amri, Abdelouahid; el yakhloufi Haddou, Mounir; Khamlichi, Abdellatif

2017-10-01

Damage mechanisms in hot metal forming processes are accelerated by mechanical stresses arising during Thermal and mechanical properties variations, because it consists of the materials with different thermal and mechanical loadings and swelling coefficients. In this work, 3D finite element models (FEM) are developed to simulate the effect of Temperature and the stresses on the model development, using a general purpose FE software ABAQUS. Explicit dynamic analysis with coupled Temperature displacement procedure is used for a model. The purpose of this research was to study the thermomechanical damage mechanics in hot forming processes. The important process variables and the main characteristics of various hot forming processes will also be discussed.

Full Life-Cycle Defect Management Assessment: Initial Inspection Data Collection Results and Research Questions for Further Study

NASA Technical Reports Server (NTRS)

Shull, Forrest; Feldmann, Raimund; Haingaertner, Ralf; Regardie, Myrna; Seaman, Carolyn

2007-01-01

It is often the case in software projects that when schedule and budget resources are limited, the Verification and Validation (V&V) activities suffer. Fewer V&V activities can be afforded and moreover, short-term challenges can result in V&V activities being scaled back or dropped altogether. As a result, too often the default solution is to save activities for improving software quality until too late in the life-cycle, relying on late-term code inspections followed by thorough testing activities to reduce defect counts to acceptable levels. As many project managers realize, however, this is a resource-intensive way of achieving the required quality for software. The Full Life-cycle Defect Management Assessment Initiative, funded by NASA s Office of Safety and Mission Assurance under the Software Assurance Research Program, aims to address these problems by: Improving the effectiveness of early life-cycle V&V activities to make their benefits more attractive to team leads. Specifically, we focus on software inspection, a proven method that can be applied to any software work product, long before executable code has been developed; Better communicating this effectiveness to software development teams, along with suggestions for parameters to improve in the future to increase effectiveness; Analyzing the impact of early life-cycle V&V on the effectiveness and cost required for late life-cycle V&V activities, such as testing, in order to make the tradeoffs more apparent. This white paper reports on an initial milestone in this work, the development of a preliminary model of inspection effectiveness across multiple NASA Centers. This model contributes toward reaching our project goals by: Allowing an examination of inspection parameters, across different types of projects and different work products, for an analysis of factors that impact defect detection effectiveness. Allowing a comparison of this NASA-specific model to existing recommendations in the literature regarding how to plan effective inspections. Forming a baseline model which can be extended to incorporate factors describing: the numbers and types of defects that are missed by inspections; how such defects flow downstream through software development phases; how effectively they can be caught by testing activities in the late stages of development. The model has been implemented in a prototype web-enabled decision-support tool which allows developers to enter their inspection data and receive feedback based on a comparison against the model. The tool also allows users to access reusable materials (such as checklists) from projects included in the baseline. Both the tool itself and the model underlying it will continue to be extended throughout the remainder of this initiative. As results of analyzing inspection effectiveness for defect containment are determined, they can be shared via the tool and also via updates to existing training courses on metrics and software inspections. Moreover, the tool will help satisfy key CMMI requirements for the NASA Centers, as it will enable NASA to take a global view across peer review results for various types of projects to identify systemic problems. This analysis can result in continuous improvements to the approach to verification.

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

Grasping objects autonomously in simulated KC-135 zero-g

NASA Technical Reports Server (NTRS)

Norsworthy, Robert S.

1994-01-01

The KC-135 aircraft was chosen for simulated zero gravity testing of the Extravehicular Activity Helper/retriever (EVAHR). A software simulation of the EVAHR hardware, KC-135 flight dynamics, collision detection and grasp inpact dynamics has been developed to integrate and test the EVAHR software prior to flight testing on the KC-135. The EVAHR software will perform target pose estimation, tracking, and motion estimation for rigid, freely rotating, polyhedral objects. Manipulator grasp planning and trajectory control software has also been developed to grasp targets while avoiding collisions.

An automated live imaging platform for studying merozoite egress-invasion in malaria cultures.

PubMed

Crick, Alex J; Tiffert, Teresa; Shah, Sheel M; Kotar, Jurij; Lew, Virgilio L; Cicuta, Pietro

2013-03-05

Most cases of severe and fatal malaria are caused by the intraerythrocytic asexual reproduction cycle of Plasmodium falciparum. One of the most intriguing and least understood stages in this cycle is the brief preinvasion period during which dynamic merozoite-red-cell interactions align the merozoite apex in preparation for penetration. Studies of the molecular mechanisms involved in this process face formidable technical challenges, requiring multiple observations of merozoite egress-invasion sequences in live cultures under controlled experimental conditions, using high-resolution microscopy and a variety of fluorescent imaging tools. Here we describe a first successful step in the development of a fully automated, robotic imaging platform to enable such studies. Schizont-enriched live cultures of P. falciparum were set up on an inverted stage microscope with software-controlled motorized functions. By applying a variety of imaging filters and selection criteria, we identified infected red cells that were likely to rupture imminently, and recorded their coordinates. We developed a video-image analysis to detect and automatically record merozoite egress events in 100% of the 40 egress-invasion sequences recorded in this study. We observed a substantial polymorphism of the dynamic condition of pre-egress infected cells, probably reflecting asynchronies in the diversity of confluent processes leading to merozoite release. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The COMPASS Tokamak Plasma Control Software Performance

NASA Astrophysics Data System (ADS)

Valcarcel, Daniel F.; Neto, André; Carvalho, Ivo S.; Carvalho, Bernardo B.; Fernandes, Horácio; Sousa, Jorge; Janky, Filip; Havlicek, Josef; Beno, Radek; Horacek, Jan; Hron, Martin; Panek, Radomir

2011-08-01

The COMPASS tokamak has began operation at the IPP Prague in December 2008. A new control system has been built using an ATCA-based real-time system developed at IST Lisbon. The control software is implemented on top of the MARTe real-time framework attaining control cycles as short as 50 μs, with a jitter of less than 1 μs. The controlled parameters, important for the plasma performance, are the plasma current, position of the plasma current center, boundary shape and horizontal and vertical velocities. These are divided in two control cycles: slow at 500 μs and fast at 50 μs. The project has two phases. First, the software implements a digital controller, similar to the analog one used during the COMPASS-D operation in Culham. In the slow cycle, the plasma current and position are measured and controlled with PID and feedforward controllers, respectively, the shaping magnetic field is preprogrammed. The vertical instability and horizontal equilibrium are controlled with the faster 50-μs cycle PID controllers. The second phase will implement a plasma-shape reconstruction algorithm and controller, aiming at optimized plasma performance. The system was designed to be as modular as possible by breaking the functional requirements of the control system into several independent and specialized modules. This splitting enabled tuning the execution of each system part and to use the modules in a variety of applications with different time constraints. This paper presents the design and overall performance of the COMPASS control software.

A map of protein dynamics during cell-cycle progression and cell-cycle exit

PubMed Central

Gookin, Sara; Min, Mingwei; Phadke, Harsha; Chung, Mingyu; Moser, Justin; Miller, Iain; Carter, Dylan

2017-01-01

The cell-cycle field has identified the core regulators that drive the cell cycle, but we do not have a clear map of the dynamics of these regulators during cell-cycle progression versus cell-cycle exit. Here we use single-cell time-lapse microscopy of Cyclin-Dependent Kinase 2 (CDK2) activity followed by endpoint immunofluorescence and computational cell synchronization to determine the temporal dynamics of key cell-cycle proteins in asynchronously cycling human cells. We identify several unexpected patterns for core cell-cycle proteins in actively proliferating (CDK2-increasing) versus spontaneously quiescent (CDK2-low) cells, including Cyclin D1, the levels of which we find to be higher in spontaneously quiescent versus proliferating cells. We also identify proteins with concentrations that steadily increase or decrease the longer cells are in quiescence, suggesting the existence of a continuum of quiescence depths. Our single-cell measurements thus provide a rich resource for the field by characterizing protein dynamics during proliferation versus quiescence. PMID:28892491

User Interface Design for Dynamic Geometry Software

ERIC Educational Resources Information Center

Kortenkamp, Ulrich; Dohrmann, Christian

2010-01-01

In this article we describe long-standing user interface issues with Dynamic Geometry Software and common approaches to address them. We describe first prototypes of multi-touch-capable DGS. We also give some hints on the educational benefits of proper user interface design.

A physical framework for implementing virtual models of intracranial pressure and cerebrospinal fluid dynamics in hydrocephalus shunt testing.

PubMed

Venkataraman, Pranav; Browd, Samuel R; Lutz, Barry R

2016-09-01

OBJECTIVE The surgical placement of a shunt designed to resolve the brain's impaired ability to drain excess CSF is one of the most common treatments for hydrocephalus. The use of a dynamic testing platform is an important part of shunt testing that can faithfully reproduce the physiological environment of the implanted shunts. METHODS A simulation-based framework that serves as a proof of concept for enabling the application of virtual intracranial pressure (ICP) and CSF models to a physical shunt-testing system was engineered. This was achieved by designing hardware and software that enabled the application of dynamic model-driven inlet and outlet pressures to a shunt and the subsequent measurement of the resulting drainage rate. RESULTS A set of common physiological scenarios was simulated, including oscillations in ICP due to respiratory and cardiac cycles, changes in baseline ICP due to changes in patient posture, and transient ICP spikes caused by activities such as exercise, coughing, sneezing, and the Valsalva maneuver. The behavior of the Strata valve under a few of these physiological conditions is also demonstrated. CONCLUSIONS Testing shunts with dynamic ICP and CSF simulations can facilitate the optimization of shunts to be more failure resistant and better suited to patient physiology.

A Structured Approach for Reviewing Architecture Documentation

DTIC Science & Technology

2009-12-01

as those found in ISO 12207 [ ISO /IEC 12207 :2008] (for software engineering), ISO 15288 [ ISO /IEC 15288:2008] (for systems engineering), the Rational...Open Distributed Processing - Reference Model: Foundations ( ISO /IEC 10746-2). 1996. [ ISO /IEC 12207 :2008] International Organization for...Standardization & International Electrotechnical Commission. Sys- tems and software engineering – Software life cycle processes ( ISO /IEC 12207 ). 2008. [ ISO

An Incremental Life-cycle Assurance Strategy for Critical System Certification

DTIC Science & Technology

2014-11-04

for Safe Aircraft Operation Embedded software systems introduce a new class of problems not addressed by traditional system modeling & analysis...Platform Runtime Architecture Application Software Embedded SW System Engineer Data Stream Characteristics Latency jitter affects control behavior...do system level failures still occur despite fault tolerance techniques being deployed in systems ? Embedded software system as major source of

Functional description of the ISIS system

NASA Technical Reports Server (NTRS)

Berman, W. J.

1979-01-01

Development of software for avionic and aerospace applications (flight software) is influenced by a unique combination of factors which includes: (1) length of the life cycle of each project; (2) necessity for cooperation between the aerospace industry and NASA; (3) the need for flight software that is highly reliable; (4) the increasing complexity and size of flight software; and (5) the high quality of the programmers and the tightening of project budgets. The interactive software invocation system (ISIS) which is described is designed to overcome the problems created by this combination of factors.

Software Reliability, Measurement, and Testing. Volume 2. Guidebook for Software Reliability Measurement and Testing

DTIC Science & Technology

1992-04-01

contractor’s existing data collection, analysis and corrective action system shall be utilized, with modification only as necessary to meet the...either from test or from analysis of field data . The procedures of MIL-STD-756B assume that the reliability of a 18 DEFINE IDENTIFY SOFTWARE LIFE CYCLE...to generate sufficient data to report a statistically valid reliability figure for a class of software. Casual data gathering accumulates data more

Assessment of three different software systems in the evaluation of dynamic MRI of the breast.

PubMed

Kurz, K D; Steinhaus, D; Klar, V; Cohnen, M; Wittsack, H J; Saleh, A; Mödder, U; Blondin, D

2009-02-01

The aim was to compare the diagnostic performance and handling of dynamic contrast-enhanced MRI of the breast with two commercial software solutions ("CADstream" and "3TP") and one self-developed software system ("Mammatool"). Identical data sets of dynamic breast MRI from 21 patients were evaluated retrospectively with all three software systems. The exams were classified according to the BI-RADS classification. The number of lesions in the parametric mapping was compared to histology or follow-up of more than 2 years. In addition, 25 quality criteria were judged by 3 independent investigators with a score from 0 to 5. Statistical analysis was performed to document the quality ranking of the different software systems. There were 9 invasive carcinomas, one pure DCIS, one papilloma, one radial scar, three histologically proven changes due to mastopathy, one adenosis and two fibroadenomas. Additionally two patients with enhancing parenchyma followed with MRI for more than 3 years and one scar after breast conserving therapy were included. All malignant lesions were classified as BI-RADS 4 or 5 using all software systems and showed significant enhancement in the parametric mapping. "CADstream" showed the best score on subjective quality criteria. "3TP" showed the lowest number of false-positive results. "Mammatool" produced the lowest number of benign tissues indicated with parametric overlay. All three software programs tested were adequate for sensitive and efficient assessment of dynamic MRI of the breast. Improvements in specificity may be achievable.

Product specification documentation standard and Data Item Descriptions (DID). Volume of the information system life-cycle and documentation standards, volume 3

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

This is the third of five volumes on Information System Life-Cycle and Documentation Standards which present a well organized, easily used standard for providing technical information needed for developing information systems, components, and related processes. This volume states the Software Management and Assurance Program documentation standard for a product specification document and for data item descriptions. The framework can be applied to any NASA information system, software, hardware, operational procedures components, and related processes.

One approach for evaluating the Distributed Computing Design System (DCDS)

NASA Technical Reports Server (NTRS)

Ellis, J. T.

1985-01-01

The Distributed Computer Design System (DCDS) provides an integrated environment to support the life cycle of developing real-time distributed computing systems. The primary focus of DCDS is to significantly increase system reliability and software development productivity, and to minimize schedule and cost risk. DCDS consists of integrated methodologies, languages, and tools to support the life cycle of developing distributed software and systems. Smooth and well-defined transistions from phase to phase, language to language, and tool to tool provide a unique and unified environment. An approach to evaluating DCDS highlights its benefits.

A method for tailoring the information content of a software process model

NASA Technical Reports Server (NTRS)

Perkins, Sharon; Arend, Mark B.

1990-01-01

The framework is defined for a general method for selecting a necessary and sufficient subset of a general software life cycle's information products, to support new software development process. Procedures for characterizing problem domains in general and mapping to a tailored set of life cycle processes and products is presented. An overview of the method is shown using the following steps: (1) During the problem concept definition phase, perform standardized interviews and dialogs between developer and user, and between user and customer; (2) Generate a quality needs profile of the software to be developed, based on information gathered in step 1; (3) Translate the quality needs profile into a profile of quality criteria that must be met by the software to satisfy the quality needs; (4) Map the quality criteria to set of accepted processes and products for achieving each criterion; (5) Select the information products which match or support the accepted processes and product of step 4; and (6) Select the design methodology which produces the information products selected in step 5.

A method for tailoring the information content of a software process model

NASA Technical Reports Server (NTRS)

Perkins, Sharon; Arend, Mark B.

1990-01-01

The framework is defined for a general method for selecting a necessary and sufficient subset of a general software life cycle's information products, to support new software development process. Procedures for characterizing problem domains in general and mapping to a tailored set of life cycle processes and products is presented. An overview of the method is shown using the following steps: (1) During the problem concept definition phase, perform standardized interviews and dialogs between developer and user, and between user and customer; (2) Generate a quality needs profile of the software to be developed, based on information gathered in step 1; (3) Translate the quality needs profile into a profile of quality criteria that must be met by the software to satisfy the quality needs; (4) Map the quality criteria to a set of accepted processes and products for achieving each criterion; (5) select the information products which match or support the accepted processes and product of step 4; and (6) Select the design methodology which produces the information products selected in step 5.

Multiscale Fatigue Life Prediction for Composite Panels

NASA Technical Reports Server (NTRS)

Bednarcyk, Brett A.; Yarrington, Phillip W.; Arnold, Steven M.

2012-01-01

Fatigue life prediction capabilities have been incorporated into the HyperSizer Composite Analysis and Structural Sizing Software. The fatigue damage model is introduced at the fiber/matrix constituent scale through HyperSizer s coupling with NASA s MAC/GMC micromechanics software. This enables prediction of the micro scale damage progression throughout stiffened and sandwich panels as a function of cycles leading ultimately to simulated panel failure. The fatigue model implementation uses a cycle jumping technique such that, rather than applying a specified number of additional cycles, a specified local damage increment is specified and the number of additional cycles to reach this damage increment is calculated. In this way, the effect of stress redistribution due to damage-induced stiffness change is captured, but the fatigue simulations remain computationally efficient. The model is compared to experimental fatigue life data for two composite facesheet/foam core sandwich panels, demonstrating very good agreement.

RWater - A Novel Cyber-enabled Data-driven Educational Tool for Interpreting and Modeling Hydrologic Processes

NASA Astrophysics Data System (ADS)

Rajib, M. A.; Merwade, V.; Zhao, L.; Song, C.

2014-12-01

Explaining the complex cause-and-effect relationships in hydrologic cycle can often be challenging in a classroom with the use of traditional teaching approaches. With the availability of observed rainfall, streamflow and other hydrology data on the internet, it is possible to provide the necessary tools to students to explore these relationships and enhance their learning experience. From this perspective, a new online educational tool, called RWater, is developed using Purdue University's HUBzero technology. RWater's unique features include: (i) its accessibility including the R software from any java supported web browser; (ii) no installation of any software on user's computer; (iii) all the work and resulting data are stored in user's working directory on RWater server; and (iv) no prior programming experience with R software is necessary. In its current version, RWater can dynamically extract streamflow data from any USGS gaging station without any need for post-processing for use in the educational modules. By following data-driven modules, students can write small scripts in R and thereby create visualizations to identify the effect of rainfall distribution and watershed characteristics on runoff generation, investigate the impacts of landuse and climate change on streamflow, and explore the changes in extreme hydrologic events in actual locations. Each module contains relevant definitions, instructions on data extraction and coding, as well as conceptual questions based on the possible analyses which the students would perform. In order to assess its suitability in classroom implementation, and to evaluate users' perception over its utility, the current version of RWater has been tested with three different groups: (i) high school students, (ii) middle and high school teachers; and (iii) upper undergraduate/graduate students. The survey results from these trials suggest that the RWater has potential to improve students' understanding on various relationships in hydrologic cycle, leading towards effective dissemination of hydrology education ranging from K-12 to the graduate level. RWater is a publicly available for use at: https://mygeohub.org/tools/rwater.

Control Software for Piezo Stepping Actuators

NASA Technical Reports Server (NTRS)

Shields, Joel F.

2013-01-01

A control system has been developed for the Space Interferometer Mission (SIM) piezo stepping actuator. Piezo stepping actuators are novel because they offer extreme dynamic range (centimeter stroke with nanometer resolution) with power, thermal, mass, and volume advantages over existing motorized actuation technology. These advantages come with the added benefit of greatly reduced complexity in the support electronics. The piezo stepping actuator consists of three fully redundant sets of piezoelectric transducers (PZTs), two sets of brake PZTs, and one set of extension PZTs. These PZTs are used to grasp and move a runner attached to the optic to be moved. By proper cycling of the two brake and extension PZTs, both forward and backward moves of the runner can be achieved. Each brake can be configured for either a power-on or power-off state. For SIM, the brakes and gate of the mechanism are configured in such a manner that, at the end of the step, the actuator is in a parked or power-off state. The control software uses asynchronous sampling of an optical encoder to monitor the position of the runner. These samples are timed to coincide with the end of the previous move, which may consist of a variable number of steps. This sampling technique linearizes the device by avoiding input saturation of the actuator and makes latencies of the plant vanish. The software also estimates, in real time, the scale factor of the device and a disturbance caused by cycling of the brakes. These estimates are used to actively cancel the brake disturbance. The control system also includes feedback and feedforward elements that regulate the position of the runner to a given reference position. Convergence time for smalland medium-sized reference positions (less than 200 microns) to within 10 nanometers can be achieved in under 10 seconds. Convergence times for large moves (greater than 1 millimeter) are limited by the step rate.

Numerical Study of the Cerebro-Spinal Fluid (CSF) Dynamics Under Quasistatic Condition During a Cardiac Cycle

DTIC Science & Technology

2001-10-25

THE CEREBRO -SPINAL FLUID (CSF) DYNAMICS UNDER QUASI- STATIC CONDITION DURING A CARDIAC CYCLE Loïc FIN, Reinhard GREBE, Olivier BALÉDENT, Ilana...from... to) - Title and Subtitle Numerical Study of the Cerebro -Spinal Fluid (CSF) Dynamics Under Quasistatic Condition During a Cardiac Cycle

Formal Analysis of the Remote Agent Before and After Flight

NASA Technical Reports Server (NTRS)

Havelund, Klaus; Lowry, Mike; Park, SeungJoon; Pecheur, Charles; Penix, John; Visser, Willem; White, Jon L.

2000-01-01

This paper describes two separate efforts that used the SPIN model checker to verify deep space autonomy flight software. The first effort occurred at the beginning of a spiral development process and found five concurrency errors early in the design cycle that the developers acknowledge would not have been found through testing. This effort required a substantial manual modeling effort involving both abstraction and translation from the prototype LISP code to the PROMELA language used by SPIN. This experience and others led to research to address the gap between formal method tools and the development cycle used by software developers. The Java PathFinder tool which directly translates from Java to PROMELA was developed as part of this research, as well as automatic abstraction tools. In 1999 the flight software flew on a space mission, and a deadlock occurred in a sibling subsystem to the one which was the focus of the first verification effort. A second quick-response "cleanroom" verification effort found the concurrency error in a short amount of time. The error was isomorphic to one of the concurrency errors found during the first verification effort. The paper demonstrates that formal methods tools can find concurrency errors that indeed lead to loss of spacecraft functions, even for the complex software required for autonomy. Second, it describes progress in automatic translation and abstraction that eventually will enable formal methods tools to be inserted directly into the aerospace software development cycle.

Modeling Physical Systems Using Vensim PLE Systems Dynamics Software

NASA Astrophysics Data System (ADS)

Widmark, Stephen

2012-02-01

Many physical systems are described by time-dependent differential equations or systems of such equations. This makes it difficult for students in an introductory physics class to solve many real-world problems since these students typically have little or no experience with this kind of mathematics. In my high school physics classes, I address this problem by having my students use a variety of software solutions to model physical systems described by differential equations. These include spreadsheets, applets, software my students themselves create, and systems dynamics software. For the latter, cost is often the main issue in choosing a solution for use in a public school and so I researched no-cost software. I found Sphinx SD,2OptiSim,3 Systems Dynamics,4 Simile (Trial Edition),5 and Vensim PLE.6 In evaluating each of these solutions, I looked for the fewest restrictions in the license for educational use, ease of use by students, power, and versatility. In my opinion, Vensim PLE best fulfills these criteria.7

Integrating open-source software applications to build molecular dynamics systems.

PubMed

Allen, Bruce M; Predecki, Paul K; Kumosa, Maciej

2014-04-05

Three open-source applications, NanoEngineer-1, packmol, and mis2lmp are integrated using an open-source file format to quickly create molecular dynamics (MD) cells for simulation. The three software applications collectively make up the open-source software (OSS) suite known as MD Studio (MDS). The software is validated through software engineering practices and is verified through simulation of the diglycidyl ether of bisphenol-a and isophorone diamine (DGEBA/IPD) system. Multiple simulations are run using the MDS software to create MD cells, and the data generated are used to calculate density, bulk modulus, and glass transition temperature of the DGEBA/IPD system. Simulation results compare well with published experimental and numerical results. The MDS software prototype confirms that OSS applications can be analyzed against real-world research requirements and integrated to create a new capability. Copyright © 2014 Wiley Periodicals, Inc.

NASA Workshop on Computational Structural Mechanics 1987, part 3

NASA Technical Reports Server (NTRS)

Sykes, Nancy P. (Editor)

1989-01-01

Computational Structural Mechanics (CSM) topics are explored. Algorithms and software for nonlinear structural dynamics, concurrent algorithms for transient finite element analysis, computational methods and software systems for dynamics and control of large space structures, and the use of multi-grid for structural analysis are discussed.

Software tools for data modelling and processing of human body temperature circadian dynamics.

PubMed

Petrova, Elena S; Afanasova, Anastasia I

2015-01-01

This paper is presenting a software development for simulating and processing thermometry data. The motivation of this research is the miniaturization of actuators attached to human body which allow frequent temperature measurements and improve the medical diagnosis procedures related to circadian dynamics.

Object Oriented Learning Objects

ERIC Educational Resources Information Center

Morris, Ed

2005-01-01

We apply the object oriented software engineering (OOSE) design methodology for software objects (SOs) to learning objects (LOs). OOSE extends and refines design principles for authoring dynamic reusable LOs. Our learning object class (LOC) is a template from which individualised LOs can be dynamically created for, or by, students. The properties…

Numerical simulation of two consecutive nasal respiratory cycles: toward a better understanding of nasal physiology.

PubMed

de Gabory, Ludovic; Reville, Nicolas; Baux, Yannick; Boisson, Nicolas; Bordenave, Laurence

2018-01-16

Computational fluid dynamic (CFD) simulations have greatly improved the understanding of nasal physiology. We postulate that simulating the entire and repeated respiratory nasal cycles, within the whole sinonasal cavities, is mandatory to gather more accurate observations and better understand airflow patterns. A 3-dimensional (3D) sinonasal model was constructed from a healthy adult computed tomography (CT) scan which discretized in 6.6 million cells (mean volume, 0.008 mm 3 ). CFD simulations were performed with ANSYS©FluentTMv16.0.0 software with transient and turbulent airflow (k-ω model). Two respiratory cycles (8 seconds) were simulated to assess pressure, velocity, wall shear stress, and particle residence time. The pressure gradients within the sinus cavities varied according to their place of connection to the main passage. Alternations in pressure gradients induced a slight pumping phenomenon close to the ostia but no movement of air was observed within the sinus cavities. Strong movements were observed within the inferior meatus during expiration contrary to the inspiration, as in the olfactory cleft at the same time. Particle residence time was longer during expiration than inspiration due to nasal valve resistance, as if the expiratory phase was preparing the next inspiratory phase. Throughout expiration, some particles remained in contact with the lower turbinates. The posterior part of the olfactory cleft was gradually filled with particles that did not leave the nose at the next respiratory cycle. This pattern increased as the respiratory cycle was repeated. CFD is more efficient and reliable when the entire respiratory cycle is simulated and repeated to avoid losing information. © 2018 ARS-AAOA, LLC.

Industry best practices for the software development life cycle

DOT National Transportation Integrated Search

2007-11-01

In the area of software development, there are many different views of what constitutes a best practice. The goal of this project was to identify a set of industry best practice techniques that fit the needs of the Montana Department of Transportatio...

Integrated Modeling Environment

NASA Technical Reports Server (NTRS)

Mosier, Gary; Stone, Paul; Holtery, Christopher

2006-01-01

The Integrated Modeling Environment (IME) is a software system that establishes a centralized Web-based interface for integrating people (who may be geographically dispersed), processes, and data involved in a common engineering project. The IME includes software tools for life-cycle management, configuration management, visualization, and collaboration.

Rapid near-optimal trajectory generation and guidance law development for single-stage-to-orbit airbreathing vehicles

NASA Technical Reports Server (NTRS)

Calise, A. J.; Flandro, G. A.; Corban, J. E.

1990-01-01

General problems associated with on-board trajectory optimization, propulsion system cycle selection, and with the synthesis of guidance laws were addressed for an ascent to low-earth-orbit of an air-breathing single-stage-to-orbit vehicle. The NASA Generic Hypersonic Aerodynamic Model Example and the Langley Accelerator aerodynamic sets were acquired and implemented. Work related to the development of purely analytic aerodynamic models was also performed at a low level. A generic model of a multi-mode propulsion system was developed that includes turbojet, ramjet, scramjet, and rocket engine cycles. Provisions were made in the dynamic model for a component of thrust normal to the flight path. Computational results, which characterize the nonlinear sensitivity of scramjet performance to changes in vehicle angle of attack, were obtained and incorporated into the engine model. Additional trajectory constraints were introduced: maximum dynamic pressure; maximum aerodynamic heating rate per unit area; angle of attack and lift limits; and limits on acceleration both along and normal to the flight path. The remainder of the effort focused on required modifications to a previously derived algorithm when the model complexity cited above was added. In particular, analytic switching conditions were derived which, under appropriate assumptions, govern optimal transition from one propulsion mode to another for two cases: the case in which engine cycle operations can overlap, and the case in which engine cycle operations are mutually exclusive. The resulting guidance algorithm was implemented in software and exercised extensively. It was found that the approximations associated with the assumed time scale separation employed in this work are reasonable except over the Mach range from roughly 5 to 8. This phenomenon is due to the very large thrust capability of scramjets in this Mach regime when sized to meet the requirement for ascent to orbit. By accounting for flight path angle and flight path angle rate in construction of the flight path over this Mach range, the resulting algorithm provides the means for rapid near-optimal trajectory generation and propulsion cycle selection over the entire Mach range from take-off to orbit.

Models and metrics for software management and engineering

NASA Technical Reports Server (NTRS)

Basili, V. R.

1988-01-01

This paper attempts to characterize and present a state of the art view of several quantitative models and metrics of the software life cycle. These models and metrics can be used to aid in managing and engineering software projects. They deal with various aspects of the software process and product, including resources allocation and estimation, changes and errors, size, complexity and reliability. Some indication is given of the extent to which the various models have been used and the success they have achieved.

Software Assurance in Acquisition: Mitigating Risks to the Enterprise. A Reference Guide for Security-Enhanced Software Acquisition and Outsourcing

DTIC Science & Technology

2009-02-01

management, available at <http://www.iso.org/ iso /en/CatalogueDetailPage.CatalogueDetail?CSNUMBER=39612&ICS1=35&ICS2=40 &ICS3=>. ISO /IEC 27001 . Information...Management of the Systems Engineering Process. [ ISO /IEC 27001 ] ISO /IEC 27001 :2005. Information technology -- Security techniques -- Information security...software life cycles [ ISO /IEC 15026]. Software assurance is a key element of national security and homeland security. It is critical because dramatic

Ada Software Design Methods Formulation.

DTIC Science & Technology

1982-10-01

cycle organization is also appropriate for another reason. The source material for the case studies is the work of the two contractors who participated in... working version of the system exist. The integration phase takes the pieces developed and combines them into a single working system. Interfaces...hardware, developed separately from the software, is united with the software, and further testing is performed until the system is a working whole

Software Engineering Education Directory

DTIC Science & Technology

1988-01-01

Dana Hausman and Suzanne Woolf were crucial to the successful completion of this edition of the directory. Their teamwork, energy, and dedication...for this directory began in the summer of 1986 with a questionnaire mailed to schools selected from Peterson’s Graduate Programs in Engineering and...Christoper, and Siegel, Stan Software Cost Estimation and Life-Cycle Control by Putnam, Lawrence H. Software Quality Assurance: A Practical Approach by

The Effect of Learning Geometry Topics of 7th Grade in Primary Education with Dynamic Geometer's Sketchpad Geometry Software to Success and Retention

ERIC Educational Resources Information Center

Kesan, Cenk; Caliskan, Sevdane

2013-01-01

The aim of this study is to investigate the effect of learning geometry topics of 7th grade in primary education with dynamic geometer's sketchpad geometry software to student's success and retention. The experimental research design with The Posttest-Only Control Group was used in this study. In the experimental group, dynamic geometer's…

An Architecture, System Engineering, and Acquisition Approach for Space System Software Resiliency

NASA Astrophysics Data System (ADS)

Phillips, Dewanne Marie

Software intensive space systems can harbor defects and vulnerabilities that may enable external adversaries or malicious insiders to disrupt or disable system functions, risking mission compromise or loss. Mitigating this risk demands a sustained focus on the security and resiliency of the system architecture including software, hardware, and other components. Robust software engineering practices contribute to the foundation of a resilient system so that the system "can take a hit to a critical component and recover in a known, bounded, and generally acceptable period of time". Software resiliency must be a priority and addressed early in the life cycle development to contribute a secure and dependable space system. Those who develop, implement, and operate software intensive space systems must determine the factors and systems engineering practices to address when investing in software resiliency. This dissertation offers methodical approaches for improving space system resiliency through software architecture design, system engineering, increased software security, thereby reducing the risk of latent software defects and vulnerabilities. By providing greater attention to the early life cycle phases of development, we can alter the engineering process to help detect, eliminate, and avoid vulnerabilities before space systems are delivered. To achieve this objective, this dissertation will identify knowledge, techniques, and tools that engineers and managers can utilize to help them recognize how vulnerabilities are produced and discovered so that they can learn to circumvent them in future efforts. We conducted a systematic review of existing architectural practices, standards, security and coding practices, various threats, defects, and vulnerabilities that impact space systems from hundreds of relevant publications and interviews of subject matter experts. We expanded on the system-level body of knowledge for resiliency and identified a new software architecture framework and acquisition methodology to improve the resiliency of space systems from a software perspective with an emphasis on the early phases of the systems engineering life cycle. This methodology involves seven steps: 1) Define technical resiliency requirements, 1a) Identify standards/policy for software resiliency, 2) Develop a request for proposal (RFP)/statement of work (SOW) for resilient space systems software, 3) Define software resiliency goals for space systems, 4) Establish software resiliency quality attributes, 5) Perform architectural tradeoffs and identify risks, 6) Conduct architecture assessments as part of the procurement process, and 7) Ascertain space system software architecture resiliency metrics. Data illustrates that software vulnerabilities can lead to opportunities for malicious cyber activities, which could degrade the space mission capability for the user community. Reducing the number of vulnerabilities by improving architecture and software system engineering practices can contribute to making space systems more resilient. Since cyber-attacks are enabled by shortfalls in software, robust software engineering practices and an architectural design are foundational to resiliency, which is a quality that allows the system to "take a hit to a critical component and recover in a known, bounded, and generally acceptable period of time". To achieve software resiliency for space systems, acquirers and suppliers must identify relevant factors and systems engineering practices to apply across the lifecycle, in software requirements analysis, architecture development, design, implementation, verification and validation, and maintenance phases.

Emergence of evolutionary cycles in size-structured food webs.

PubMed

Ritterskamp, Daniel; Bearup, Daniel; Blasius, Bernd

2016-11-07

The interplay of population dynamics and evolution within ecological communities has been of long-standing interest for ecologists and can give rise to evolutionary cycles, e.g. taxon cycles. Evolutionary cycling was intensely studied in small communities with asymmetric competition; the latter drives the evolutionary processes. Here we demonstrate that evolutionary cycling arises naturally in larger communities if trophic interactions are present, since these are intrinsically asymmetric. To investigate the evolutionary dynamics of a trophic community, we use an allometric food web model. We find that evolutionary cycles emerge naturally for a large parameter ranges. The origin of the evolutionary dynamics is an intrinsic asymmetry in the feeding kernel which creates an evolutionary ratchet, driving species towards larger bodysize. We reveal different kinds of cycles: single morph cycles, and coevolutionary and mixed cycling of complete food webs. The latter refers to the case where each trophic level can have different evolutionary dynamics. We discuss the generality of our findings and conclude that ongoing evolution in food webs may be more frequent than commonly believed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Improving software quality - The use of formal inspections at the Jet Propulsion Laboratory

NASA Technical Reports Server (NTRS)

Bush, Marilyn

1990-01-01

The introduction of software formal inspections (Fagan Inspections) at JPL for finding and fixing defects early in the software development life cycle are reviewed. It is estimated that, by the year 2000, some software efforts will rise to as much as 80 percent of the total. Software problems are especially important at NASA as critical flight software must be error-free. It is shown that formal inspections are particularly effective at finding and removing defects having to do with clarity, correctness, consistency, and completeness. A very significant discovery was that code audits were not as effective at finding defects as code inspections.

A high order approach to flight software development and testing

NASA Technical Reports Server (NTRS)

Steinbacher, J.

1981-01-01

The use of a software development facility is discussed as a means of producing a reliable and maintainable ECS software system, and as a means of providing efficient use of the ECS hardware test facility. Principles applied to software design are given, including modularity, abstraction, hiding, and uniformity. The general objectives of each phase of the software life cycle are also given, including testing, maintenance, code development, and requirement specifications. Software development facility tools are summarized, and tool deficiencies recognized in the code development and testing phases are considered. Due to limited lab resources, the functional simulation capabilities may be indispensable in the testing phase.

Robotics On-Board Trainer (ROBoT)

NASA Technical Reports Server (NTRS)

Johnson, Genevieve; Alexander, Greg

2013-01-01

ROBoT is an on-orbit version of the ground-based Dynamics Skills Trainer (DST) that astronauts use for training on a frequent basis. This software consists of two primary software groups. The first series of components is responsible for displaying the graphical scenes. The remaining components are responsible for simulating the Mobile Servicing System (MSS), the Japanese Experiment Module Remote Manipulator System (JEMRMS), and the H-II Transfer Vehicle (HTV) Free Flyer Robotics Operations. The MSS simulation software includes: Robotic Workstation (RWS) simulation, a simulation of the Space Station Remote Manipulator System (SSRMS), a simulation of the ISS Command and Control System (CCS), and a portion of the Portable Computer System (PCS) software necessary for MSS operations. These components all run under the CentOS4.5 Linux operating system. The JEMRMS simulation software includes real-time, HIL, dynamics, manipulator multi-body dynamics, and a moving object contact model with Tricks discrete time scheduling. The JEMRMS DST will be used as a functional proficiency and skills trainer for flight crews. The HTV Free Flyer Robotics Operations simulation software adds a functional simulation of HTV vehicle controllers, sensors, and data to the MSS simulation software. These components are intended to support HTV ISS visiting vehicle analysis and training. The scene generation software will use DOUG (Dynamic On-orbit Ubiquitous Graphics) to render the graphical scenes. DOUG runs on a laptop running the CentOS4.5 Linux operating system. DOUG is an Open GL-based 3D computer graphics rendering package. It uses pre-built three-dimensional models of on-orbit ISS and space shuttle systems elements, and provides realtime views of various station and shuttle configurations.

Gate-to-gate Life-Cycle Inventory of Hardboard Production in North America

Treesearch

Richard Bergman

2014-01-01

Whole-building life-cycle assessments (LCAs) populated by life-cycle inventory (LCI) data are incorporated into environmental footprint software tools for establishing green building certification by building professionals and code. However, LCI data on some wood building products are still needed to help fill gaps in the data and thus provide a more complete picture...

Dynamic Geometry Software Improves Mathematical Achievement: Systematic Review and Meta-Analysis

ERIC Educational Resources Information Center

Chan, Kan Kan; Leung, Siu Wai

2014-01-01

Dynamic geometry software (DGS) aims to enhance mathematics education. This systematic review and meta-analysis evaluated the quasi-experimental studies on the effectiveness of DGS-based instruction in improving students' mathematical achievement. Research articles published between 1990 and 2013 were identified from major databases according to a…

Making Enzyme Kinetics Dynamic via Simulation Software

ERIC Educational Resources Information Center

Potratz, Jeffrey P.

2017-01-01

An interactive classroom demonstration that enhances students' knowledge of steady-state and Michaelis-Menten enzyme kinetics is described. The instructor uses a free version of professional-quality KinTek Explorer simulation software and student input to construct dynamic versions of three static hallmark images commonly used to introduce enzyme…

Learning Geometry through Dynamic Geometry Software

ERIC Educational Resources Information Center

Forsythe, Sue

2007-01-01

In this article, the author investigates effective teaching and learning of geometrical concepts using dynamic geometry software (DGS). Based from her students' reactions to her project, the author found that her students' understanding of the concepts was better than if they had learned geometry through paper-based tasks. However, mixing computer…

Analysis and specification tools in relation to the APSE

NASA Technical Reports Server (NTRS)

Hendricks, John W.

1986-01-01

Ada and the Ada Programming Support Environment (APSE) specifically address the phases of the system/software life cycle which follow after the user's problem was translated into system and software development specifications. The waterfall model of the life cycle identifies the analysis and requirements definition phases as preceeding program design and coding. Since Ada is a programming language and the APSE is a programming support environment, they are primarily targeted to support program (code) development, tecting, and maintenance. The use of Ada based or Ada related specification languages (SLs) and program design languages (PDLs) can extend the use of Ada back into the software design phases of the life cycle. Recall that the standardization of the APSE as a programming support environment is only now happening after many years of evolutionary experience with diverse sets of programming support tools. Restricting consideration to one, or even a few chosen specification and design tools, could be a real mistake for an organization or a major project such as the Space Station, which will need to deal with an increasingly complex level of system problems. To require that everything be Ada-like, be implemented in Ada, run directly under the APSE, and fit into a rigid waterfall model of the life cycle would turn a promising support environment into a straight jacket for progress.

Inclusion of LCCA in Alaska flexible pavement design software manual.

DOT National Transportation Integrated Search

2012-10-01

Life cycle cost analysis is a key part for selecting materials and techniques that optimize the service life of a pavement in terms of cost and performance. While the Alaska : Flexible Pavement Design software has been in use since 2004, there is no ...

Software Development: A Product Life-Cycle Perspective

DTIC Science & Technology

1990-05-01

management came from these magazines and journals: Journal of Advertising Research , Business Marketing, Journal of Systems Manaament, nural Marketing...Johanna. "Price is More Sensitive." Software Magazine, March 1988, 44. Andrews, Kirby. "Communications Imperatives for New Products." Journal of Advertising Research , October

ENCOMPASS: A SAGA based environment for the compositon of programs and specifications, appendix A

NASA Technical Reports Server (NTRS)

Terwilliger, Robert B.; Campbell, Roy H.

1985-01-01

ENCOMPASS is an example integrated software engineering environment being constructed by the SAGA project. ENCOMPASS supports the specification, design, construction and maintenance of efficient, validated, and verified programs in a modular programming language. The life cycle paradigm, schema of software configurations, and hierarchical library structure used by ENCOMPASS is presented. In ENCOMPASS, the software life cycle is viewed as a sequence of developments, each of which reuses components from the previous ones. Each development proceeds through the phases planning, requirements definition, validation, design, implementation, and system integration. The components in a software system are modeled as entities which have relationships between them. An entity may have different versions and different views of the same project are allowed. The simple entities supported by ENCOMPASS may be combined into modules which may be collected into projects. ENCOMPASS supports multiple programmers and projects using a hierarchical library system containing a workspace for each programmer; a project library for each project, and a global library common to all projects.

The Robust Software Feedback Model: An Effective Waterfall Model Tailoring for Space SW

NASA Astrophysics Data System (ADS)

Tipaldi, Massimo; Gotz, Christoph; Ferraguto, Massimo; Troiano, Luigi; Bruenjes, Bernhard

2013-08-01

The selection of the most suitable software life cycle process is of paramount importance in any space SW project. Despite being the preferred choice, the waterfall model is often exposed to some criticism. As matter of fact, its main assumption of moving to a phase only when the preceding one is completed and perfected (and under the demanding SW schedule constraints) is not easily attainable. In this paper, a tailoring of the software waterfall model (named “Robust Software Feedback Model”) is presented. The proposed methodology sorts out these issues by combining a SW waterfall model with a SW prototyping approach. The former is aligned with the SW main production line and is based on the full ECSS-E-ST-40C life-cycle reviews, whereas the latter is carried out in advance versus the main SW streamline (so as to inject its lessons learnt into the main streamline) and is based on a lightweight approach.

Quasi-dynamic Material Flow Analysis applied to the Austrian Phosphorus cycle

NASA Astrophysics Data System (ADS)

Zoboli, Ottavia; Rechberger, Helmut

2013-04-01

Phosphorus (P) is one of the key elements that sustain life on earth and that allow achieving the current high levels of food production worldwide. It is a non-renewable resource, without any existing substitute. Because of its current dissipative use by mankind and to its very slow geochemical cycle, this resource is rapidly depleting and it is strongly connected to the problem of ensuring food security. Moreover P is also associated to important environmental problems. Its extraction often generates hazardous wastes, while its accumulation in water bodies can lead to eutrophication, with consequent severe ecological damages. It is therefore necessary to analyze and understand in detail the system of P, in regard to its use and management, to identify the processes that should be targeted in order to reduce the overall consumption of this resource. This work aims at establishing a generic quasi-dynamic model, which describes the Austrian P-budget and which allows investigating the trends of P use in the past, but also selected future scenarios. Given the importance of P throughout the whole anthropogenic metabolism, the model is based on a comprehensive system that encompasses several economic sectors, from agriculture and animal husbandry to industry, consumption and waste and wastewater treatment. Furthermore it includes the hydrosphere, to assess the losses of P into water bodies, due to the importance of eutrophication problems. The methodology applied is Material Flow Analysis (MFA), which is a systemic approach to assess and balance the stocks and flows of a material within a system defined in space and time. Moreover the model is integrated in the software STAN, a freeware tailor-made for MFA. Particular attention is paid to the characteristics and the quality of the data, in order to include data uncertainty and error propagation in the dynamic balance.

Computational Wear Simulation of Patellofemoral Articular Cartilage during In Vitro Testing

PubMed Central

Li, Lingmin; Patil, Shantanu; Steklov, Nick; Bae, Won; Temple-Wong, Michele; D'Lima, Darryl D.; Sah, Robert L.; Fregly, Benjamin J.

2011-01-01

Though changes in normal joint motions and loads (e.g., following anterior cruciate ligament injury) contribute to the development of knee osteoarthritis, the precise mechanism by which these changes induce osteoarthritis remains unknown. As a first step toward identifying this mechanism, this study evaluates computational wear simulations of a patellofemoral joint specimen wear tested on a knee simulator machine. A multi-body dynamic model of the specimen mounted in the simulator machine was constructed in commercial computer-aided engineering software. A custom elastic foundation contact model was used to calculate contact pressures and wear on the femoral and patellar articular surfaces using geometry created from laser scan and MR data. Two different wear simulation approaches were investigated – one that wore the surface geometries gradually over a sequence of 10 one-cycle dynamic simulations (termed the “progressive” approach), and one that wore the surface geometries abruptly using results from a single one-cycle dynamic simulation (termed the “non-progressive” approach). The progressive approach with laser scan geometry reproduced the experimentally measured wear depths and areas for both the femur and patella. The less costly non-progressive approach predicted deeper wear depths, especially on the patella, but had little influence on predicted wear areas. Use of MR data for creating the articular and subchondral bone geometry altered wear depth and area predictions by at most 13%. These results suggest that MR-derived geometry may be sufficient for simulating articular cartilage wear in vivo and that a progressive simulation approach may be needed for the patella and tibia since both remain in continuous contact with the femur. PMID:21453922

Computational wear simulation of patellofemoral articular cartilage during in vitro testing.

PubMed

Li, Lingmin; Patil, Shantanu; Steklov, Nick; Bae, Won; Temple-Wong, Michele; D'Lima, Darryl D; Sah, Robert L; Fregly, Benjamin J

2011-05-17

Though changes in normal joint motions and loads (e.g., following anterior cruciate ligament injury) contribute to the development of knee osteoarthritis, the precise mechanism by which these changes induce osteoarthritis remains unknown. As a first step toward identifying this mechanism, this study evaluates computational wear simulations of a patellofemoral joint specimen wear tested on a knee simulator machine. A multibody dynamic model of the specimen mounted in the simulator machine was constructed in commercial computer-aided engineering software. A custom elastic foundation contact model was used to calculate contact pressures and wear on the femoral and patellar articular surfaces using geometry created from laser scan and MR data. Two different wear simulation approaches were investigated--one that wore the surface geometries gradually over a sequence of 10 one-cycle dynamic simulations (termed the "progressive" approach), and one that wore the surface geometries abruptly using results from a single one-cycle dynamic simulation (termed the "non-progressive" approach). The progressive approach with laser scan geometry reproduced the experimentally measured wear depths and areas for both the femur and patella. The less costly non-progressive approach predicted deeper wear depths, especially on the patella, but had little influence on predicted wear areas. Use of MR data for creating the articular and subchondral bone geometry altered wear depth and area predictions by at most 13%. These results suggest that MR-derived geometry may be sufficient for simulating articular cartilage wear in vivo and that a progressive simulation approach may be needed for the patella and tibia since both remain in continuous contact with the femur. Copyright © 2011 Elsevier Ltd. All rights reserved.

The cinema LED lighting system design based on SCM

NASA Astrophysics Data System (ADS)

En, De; Wang, Xiaobin

2010-11-01

A LED lighting system in the modern theater and the corresponding control program is introduced. Studies show that moderate and mutative brightness in the space would attract audiences' attention on the screen easily. SCM controls LED dynamically by outputting PWM pulse in different duty cycle. That cinema dome lights' intensity can vary with the plot changed, make people get a better view of experience. This article expounds the architecture of hardware system in the schedule and the control flow of the host of the solution. Besides, it introduces the design of software as well. At last, the system which is proved energy-saving, reliable, good visual effect and having using value by means of producing a small-scale model, which reproduce the whole system and achieves the desired result.

Virtual acoustic environments for comprehensive evaluation of model-based hearing devices.

PubMed

Grimm, Giso; Luberadzka, Joanna; Hohmann, Volker

2018-06-01

Create virtual acoustic environments (VAEs) with interactive dynamic rendering for applications in audiology. A toolbox for creation and rendering of dynamic virtual acoustic environments (TASCAR) that allows direct user interaction was developed for application in hearing aid research and audiology. The software architecture and the simulation methods used to produce VAEs are outlined. Example environments are described and analysed. With the proposed software, a tool for simulation of VAEs is available. A set of VAEs rendered with the proposed software was described.

Closed-Cycle Engine Program Used to Study Brayton Power Conversion

NASA Technical Reports Server (NTRS)

Johnson, Paul K.

2005-01-01

One form of power conversion under consideration in NASA Glenn Research Center's Thermal Energy Conversion Branch is the closed-Brayton-cycle engine. In the tens-of-kilowatts to multimegawatt class, the Brayton engine lends itself to potential space nuclear power applications such as electric propulsion or surface power. The Thermal Energy Conversion Branch has most recently concentrated its Brayton studies on electric propulsion for Prometheus. One piece of software used for evaluating such designs over a limited tradeoff space has been the Closed Cycle Engine Program (CCEP). The CCEP originated in the mid-1980s from a Fortran aircraft engine code known as the Navy/NASA Engine Program (NNEP). Components such as a solar collector, heat exchangers, ducting, a pumped-loop radiator, a nuclear heat source, and radial turbomachinery were added to NNEP, transforming it into a high-fidelity design and performance tool for closed-Brayton-cycle power conversion and heat rejection. CCEP was used in the 1990s in conjunction with the Solar Dynamic Ground Test Demonstration conducted at Glenn. Over the past year, updates were made to CCEP to adapt it for an electric propulsion application. The pumped-loop radiator coolant can now be n-heptane, water, or sodium-potassium (NaK); liquid-metal pump design tables were added to accommodate the NaK fluid. For the reactor and shield, a user can now elect to calculate a higher fidelity mass estimate. In addition, helium-xenon working-fluid properties were recalculated and updated.

Exergy analysis and simulation of a 30MW cogeneration cycle

NASA Astrophysics Data System (ADS)

Dev, Nikhil; Samsher; Kachhwaha, S. S.; Attri, Rajesh

2013-06-01

Cogeneration cycle is an efficient mean to recover the waste heat from the flue gases coming out of gas turbine. With the help of computer simulation, design parameters may be selected for the best performance of cogeneration cycle. In the present work a program is executed in software EES on the basis of mathematical modelling described in paper to study cogeneration cycle performance for different parameters. Results obtained are compared with the results available in literature and are found in good agreement with them. Real gas and water properties are inbuilt in the software. Results show that enthalpy of air entering the combustion chamber is higher than that of the flue gases at combustion chamber outlet. For different operative conditions, energy and exergy efficiencies follow similar trends; although, exergy efficiency values are always lower than the corresponding energy efficiency ones. From the results it is found that turbine outlet temperature (TIT) of 524°C is uniquely suited to efficient cogeneration cycle because it enables the transfer of heat from exhaust gas to the steam cycle to take place over a minimal temperature difference. This temperature range results in the maximum thermodynamic availability while operating with highest temperature and highest efficiency cogeneration cycle. Effect of cycle pressure ratio (CR), inlet air temperature (IAT) and water pressure at heat recovery steam generator (HRSG) inlet on the 30MW cogeneration cycle is also studied.

USER'S GUIDE FOR THE MUNICIPAL SOLID WASTE LIFE-CYCLE DATABASE

EPA Science Inventory

The report describes how to use the municipal solid waste (MSW) life cycle database, a software application with Microsoft Access interfaces, that provides environmental data for energy production, materials production, and MSW management activities and equipment. The basic datab...

Monitoring software development through dynamic variables

NASA Technical Reports Server (NTRS)

Doerflinger, Carl W.; Basili, Victor R.

1983-01-01

Research conducted by the Software Engineering Laboratory (SEL) on the use of dynamic variables as a tool to monitor software development is described. Project independent measures which may be used in a management tool for monitoring software development are identified. Several FORTRAN projects with similar profiles are examined. The staff was experienced in developing these types of projects. The projects developed serve similar functions. Because these projects are similar some underlying relationships exist that are invariant between projects. These relationships, once well defined, may be used to compare the development of different projects to determine whether they are evolving the same way previous projects in this environment evolved.

AdapChem

NASA Technical Reports Server (NTRS)

Oluwole, Oluwayemisi O.; Wong, Hsi-Wu; Green, William

2012-01-01

AdapChem software enables high efficiency, low computational cost, and enhanced accuracy on computational fluid dynamics (CFD) numerical simulations used for combustion studies. The software dynamically allocates smaller, reduced chemical models instead of the larger, full chemistry models to evolve the calculation while ensuring the same accuracy to be obtained for steady-state CFD reacting flow simulations. The software enables detailed chemical kinetic modeling in combustion CFD simulations. AdapChem adapts the reaction mechanism used in the CFD to the local reaction conditions. Instead of a single, comprehensive reaction mechanism throughout the computation, a dynamic distribution of smaller, reduced models is used to capture accurately the chemical kinetics at a fraction of the cost of the traditional single-mechanism approach.

Mystic: Implementation of the Static Dynamic Optimal Control Algorithm for High-Fidelity, Low-Thrust Trajectory Design

NASA Technical Reports Server (NTRS)

Whiffen, Gregory J.

2006-01-01

Mystic software is designed to compute, analyze, and visualize optimal high-fidelity, low-thrust trajectories, The software can be used to analyze inter-planetary, planetocentric, and combination trajectories, Mystic also provides utilities to assist in the operation and navigation of low-thrust spacecraft. Mystic will be used to design and navigate the NASA's Dawn Discovery mission to orbit the two largest asteroids, The underlying optimization algorithm used in the Mystic software is called Static/Dynamic Optimal Control (SDC). SDC is a nonlinear optimal control method designed to optimize both 'static variables' (parameters) and dynamic variables (functions of time) simultaneously. SDC is a general nonlinear optimal control algorithm based on Bellman's principal.

Software analysis handbook: Software complexity analysis and software reliability estimation and prediction

NASA Technical Reports Server (NTRS)

Lee, Alice T.; Gunn, Todd; Pham, Tuan; Ricaldi, Ron

1994-01-01

This handbook documents the three software analysis processes the Space Station Software Analysis team uses to assess space station software, including their backgrounds, theories, tools, and analysis procedures. Potential applications of these analysis results are also presented. The first section describes how software complexity analysis provides quantitative information on code, such as code structure and risk areas, throughout the software life cycle. Software complexity analysis allows an analyst to understand the software structure, identify critical software components, assess risk areas within a software system, identify testing deficiencies, and recommend program improvements. Performing this type of analysis during the early design phases of software development can positively affect the process, and may prevent later, much larger, difficulties. The second section describes how software reliability estimation and prediction analysis, or software reliability, provides a quantitative means to measure the probability of failure-free operation of a computer program, and describes the two tools used by JSC to determine failure rates and design tradeoffs between reliability, costs, performance, and schedule.

PB-AM: An open-source, fully analytical linear poisson-boltzmann solver.

PubMed

Felberg, Lisa E; Brookes, David H; Yap, Eng-Hui; Jurrus, Elizabeth; Baker, Nathan A; Head-Gordon, Teresa

2017-06-05

We present the open source distributed software package Poisson-Boltzmann Analytical Method (PB-AM), a fully analytical solution to the linearized PB equation, for molecules represented as non-overlapping spherical cavities. The PB-AM software package includes the generation of outputs files appropriate for visualization using visual molecular dynamics, a Brownian dynamics scheme that uses periodic boundary conditions to simulate dynamics, the ability to specify docking criteria, and offers two different kinetics schemes to evaluate biomolecular association rate constants. Given that PB-AM defines mutual polarization completely and accurately, it can be refactored as a many-body expansion to explore 2- and 3-body polarization. Additionally, the software has been integrated into the Adaptive Poisson-Boltzmann Solver (APBS) software package to make it more accessible to a larger group of scientists, educators, and students that are more familiar with the APBS framework. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Software safety - A user's practical perspective

NASA Technical Reports Server (NTRS)

Dunn, William R.; Corliss, Lloyd D.

1990-01-01

Software safety assurance philosophy and practices at the NASA Ames are discussed. It is shown that, to be safe, software must be error-free. Software developments on two digital flight control systems and two ground facility systems are examined, including the overall system and software organization and function, the software-safety issues, and their resolution. The effectiveness of safety assurance methods is discussed, including conventional life-cycle practices, verification and validation testing, software safety analysis, and formal design methods. It is concluded (1) that a practical software safety technology does not yet exist, (2) that it is unlikely that a set of general-purpose analytical techniques can be developed for proving that software is safe, and (3) that successful software safety-assurance practices will have to take into account the detailed design processes employed and show that the software will execute correctly under all possible conditions.

Predicting Software Suitability Using a Bayesian Belief Network

NASA Technical Reports Server (NTRS)

Beaver, Justin M.; Schiavone, Guy A.; Berrios, Joseph S.

2005-01-01

The ability to reliably predict the end quality of software under development presents a significant advantage for a development team. It provides an opportunity to address high risk components earlier in the development life cycle, when their impact is minimized. This research proposes a model that captures the evolution of the quality of a software product, and provides reliable forecasts of the end quality of the software being developed in terms of product suitability. Development team skill, software process maturity, and software problem complexity are hypothesized as driving factors of software product quality. The cause-effect relationships between these factors and the elements of software suitability are modeled using Bayesian Belief Networks, a machine learning method. This research presents a Bayesian Network for software quality, and the techniques used to quantify the factors that influence and represent software quality. The developed model is found to be effective in predicting the end product quality of small-scale software development efforts.

Reuse-Driven Software Processes Guidebook. Version 02.00.03

DTIC Science & Technology

1993-11-01

a required sys - tem without unduly constraining the details of the solution. The Naval Research Laboratory Software Cost Reduction project developed...conventional manner. The emphasis is still on the development of "one-of-a-kind" sys - tems and the phased completion and review of corresponding...Application Engineering to improve the life-cycle productivity of Sy - 21 OVM ftrdauntals of Syatbes the total software development enterprise. The

Problem Solving in Calculus with Symbolic Geometry and CAS

ERIC Educational Resources Information Center

Todd, Philip; Wiechmann, James

2008-01-01

Computer algebra systems (CAS) have been around for a number of years, as has dynamic geometry. Symbolic geometry software is new. It bears a superficial similarity to dynamic geometry software, but differs in that problems may be set up involving symbolic variables and constants, and measurements are given as symbolic expressions. Mathematical…

Students Discovering Spherical Geometry Using Dynamic Geometry Software

ERIC Educational Resources Information Center

Guven, Bulent; Karatas, Ilhan

2009-01-01

Dynamic geometry software (DGS) such as Cabri and Geometers' Sketchpad has been regularly used worldwide for teaching and learning Euclidean geometry for a long time. The DGS with its inductive nature allows students to learn Euclidean geometry via explorations. However, with respect to non-Euclidean geometries, do we need to introduce them to…

Integrating Dynamic Mathematics Software into Cooperative Learning Environments in Mathematics

ERIC Educational Resources Information Center

Zengin, Yilmaz; Tatar, Enver

2017-01-01

The aim of this study was to evaluate the implementation of the cooperative learning model supported with dynamic mathematics software (DMS), that is a reflection of constructivist learning theory in the classroom environment, in the teaching of mathematics. For this purpose, a workshop was conducted with the volunteer teachers on the…

The Teaching of Polar Coordinates with Dynamic Mathematics Software

ERIC Educational Resources Information Center

Zengin, Yilmaz; Tatar, Enver

2015-01-01

The purpose of this study was to determine the effects of dynamic mathematics software on the achievement of pre-service mathematics teachers in the topic of polar coordinates and to solicit their opinions about computer-assisted instruction. The study was conducted for 11 weeks with 33 pre-service teachers in the Department of Mathematics…

A Decision Tool that Combines Discrete Event Software Process Models with System Dynamics Pieces for Software Development Cost Estimation and Analysis

NASA Technical Reports Server (NTRS)

Mizell, Carolyn Barrett; Malone, Linda

2007-01-01

The development process for a large software development project is very complex and dependent on many variables that are dynamic and interrelated. Factors such as size, productivity and defect injection rates will have substantial impact on the project in terms of cost and schedule. These factors can be affected by the intricacies of the process itself as well as human behavior because the process is very labor intensive. The complex nature of the development process can be investigated with software development process models that utilize discrete event simulation to analyze the effects of process changes. The organizational environment and its effects on the workforce can be analyzed with system dynamics that utilizes continuous simulation. Each has unique strengths and the benefits of both types can be exploited by combining a system dynamics model and a discrete event process model. This paper will demonstrate how the two types of models can be combined to investigate the impacts of human resource interactions on productivity and ultimately on cost and schedule.

A Language Translator for a Computer Aided Rapid Prototyping System.

DTIC Science & Technology

1988-03-01

PROBLEM ................... S B. THE TRADITIONAL "WATERFALL LIFE CYCLE" .. ............... 14 C. RAPID PROTOTYPING...feature of everyday life for almost the entire industrialized world. Few governments or businesses function without the aid of computer systems. Com...engineering. B. TIE TRADITIONAL "WATERFALL LIFE CYCLE" I. Characteristics The traditional method of software engineering is the "waterfall life cycle

Developing sustainable software solutions for bioinformatics by the “ Butterfly” paradigm

PubMed Central

Ahmed, Zeeshan; Zeeshan, Saman; Dandekar, Thomas

2014-01-01

Software design and sustainable software engineering are essential for the long-term development of bioinformatics software. Typical challenges in an academic environment are short-term contracts, island solutions, pragmatic approaches and loose documentation. Upcoming new challenges are big data, complex data sets, software compatibility and rapid changes in data representation. Our approach to cope with these challenges consists of iterative intertwined cycles of development (“ Butterfly” paradigm) for key steps in scientific software engineering. User feedback is valued as well as software planning in a sustainable and interoperable way. Tool usage should be easy and intuitive. A middleware supports a user-friendly Graphical User Interface (GUI) as well as a database/tool development independently. We validated the approach of our own software development and compared the different design paradigms in various software solutions. PMID:25383181

Software assurance standard

NASA Technical Reports Server (NTRS)

1992-01-01

This standard specifies the software assurance program for the provider of software. It also delineates the assurance activities for the provider and the assurance data that are to be furnished by the provider to the acquirer. In any software development effort, the provider is the entity or individual that actually designs, develops, and implements the software product, while the acquirer is the entity or individual who specifies the requirements and accepts the resulting products. This standard specifies at a high level an overall software assurance program for software developed for and by NASA. Assurance includes the disciplines of quality assurance, quality engineering, verification and validation, nonconformance reporting and corrective action, safety assurance, and security assurance. The application of these disciplines during a software development life cycle is called software assurance. Subsequent lower-level standards will specify the specific processes within these disciplines.

NASA Software Safety Standard

NASA Technical Reports Server (NTRS)

Rosenberg, Linda

1997-01-01

If software is a critical element in a safety critical system, it is imperative to implement a systematic approach to software safety as an integral part of the overall system safety programs. The NASA-STD-8719.13A, "NASA Software Safety Standard", describes the activities necessary to ensure that safety is designed into software that is acquired or developed by NASA, and that safety is maintained throughout the software life cycle. A PDF version, is available on the WWW from Lewis. A Guidebook that will assist in the implementation of the requirements in the Safety Standard is under development at the Lewis Research Center (LeRC). After completion, it will also be available on the WWW from Lewis.

GDSCalc: A Web-Based Application for Evaluating Discrete Graph Dynamical Systems

PubMed Central

Elmeligy Abdelhamid, Sherif H.; Kuhlman, Chris J.; Marathe, Madhav V.; Mortveit, Henning S.; Ravi, S. S.

2015-01-01

Discrete dynamical systems are used to model various realistic systems in network science, from social unrest in human populations to regulation in biological networks. A common approach is to model the agents of a system as vertices of a graph, and the pairwise interactions between agents as edges. Agents are in one of a finite set of states at each discrete time step and are assigned functions that describe how their states change based on neighborhood relations. Full characterization of state transitions of one system can give insights into fundamental behaviors of other dynamical systems. In this paper, we describe a discrete graph dynamical systems (GDSs) application called GDSCalc for computing and characterizing system dynamics. It is an open access system that is used through a web interface. We provide an overview of GDS theory. This theory is the basis of the web application; i.e., an understanding of GDS provides an understanding of the software features, while abstracting away implementation details. We present a set of illustrative examples to demonstrate its use in education and research. Finally, we compare GDSCalc with other discrete dynamical system software tools. Our perspective is that no single software tool will perform all computations that may be required by all users; tools typically have particular features that are more suitable for some tasks. We situate GDSCalc within this space of software tools. PMID:26263006

GDSCalc: A Web-Based Application for Evaluating Discrete Graph Dynamical Systems.

PubMed

Elmeligy Abdelhamid, Sherif H; Kuhlman, Chris J; Marathe, Madhav V; Mortveit, Henning S; Ravi, S S

2015-01-01

Discrete dynamical systems are used to model various realistic systems in network science, from social unrest in human populations to regulation in biological networks. A common approach is to model the agents of a system as vertices of a graph, and the pairwise interactions between agents as edges. Agents are in one of a finite set of states at each discrete time step and are assigned functions that describe how their states change based on neighborhood relations. Full characterization of state transitions of one system can give insights into fundamental behaviors of other dynamical systems. In this paper, we describe a discrete graph dynamical systems (GDSs) application called GDSCalc for computing and characterizing system dynamics. It is an open access system that is used through a web interface. We provide an overview of GDS theory. This theory is the basis of the web application; i.e., an understanding of GDS provides an understanding of the software features, while abstracting away implementation details. We present a set of illustrative examples to demonstrate its use in education and research. Finally, we compare GDSCalc with other discrete dynamical system software tools. Our perspective is that no single software tool will perform all computations that may be required by all users; tools typically have particular features that are more suitable for some tasks. We situate GDSCalc within this space of software tools.

Applying CASE Tools for On-Board Software Development

NASA Astrophysics Data System (ADS)

Brammer, U.; Hönle, A.

For many space projects the software development is facing great pressure with respect to quality, costs and schedule. One way to cope with these challenges is the application of CASE tools for automatic generation of code and documentation. This paper describes two CASE tools: Rhapsody (I-Logix) featuring UML and ISG (BSSE) that provides modeling of finite state machines. Both tools have been used at Kayser-Threde in different space projects for the development of on-board software. The tools are discussed with regard to the full software development cycle.

Rehabilitation R@D Progress Reports, 1992-1993. Volume 30-31

DTIC Science & Technology

1993-01-01

Transcripts of the videotape are being ana- lyzed on a hypertext database and also by qualitative data analysis software ( NUDIST ) to determine elements...number of videotapes have been transcribed and are being analyzed by the hypertext and NUDIST software. The first cycle is in progress, reflecting

A STUDY OF SOME SOFTWARE PARAMETERS IN TIME-SHARING SYSTEMS.

DTIC Science & Technology

A review is made of some existing time-sharing computer systems and an exploration of various software characteristics is conducted. This...of the various parameters upon the average response cycle time, the average number in the queue awaiting service , the average length of time a user is

Foreign Object Damage Identification in Turbine Engines

NASA Technical Reports Server (NTRS)

Strack, William; Zhang, Desheng; Turso, James; Pavlik, William; Lopez, Isaac

2005-01-01

This report summarizes the collective work of a five-person team from different organizations examining the problem of detecting foreign object damage (FOD) events in turbofan engines from gas path thermodynamic and bearing accelerometer sensors, and determining the severity of damage to each component (diagnosis). Several detection and diagnostic approaches were investigated and a software tool (FODID) was developed to assist researchers detect/diagnose FOD events. These approaches include (1) fan efficiency deviation computed from upstream and downstream temperature/ pressure measurements, (2) gas path weighted least squares estimation of component health parameter deficiencies, (3) Kalman filter estimation of component health parameters, and (4) use of structural vibration signal processing to detect both large and small FOD events. The last three of these approaches require a significant amount of computation in conjunction with a physics-based analytic model of the underlying phenomenon the NPSS thermodynamic cycle code for approaches 1 to 3 and the DyRoBeS reduced-order rotor dynamics code for approach 4. A potential application of the FODID software tool, in addition to its detection/diagnosis role, is using its sensitivity results to help identify the best types of sensors and their optimum locations within the gas path, and similarly for bearing accelerometers.

Certification of production-quality gLite Job Management components

NASA Astrophysics Data System (ADS)

Andreetto, P.; Bertocco, S.; Capannini, F.; Cecchi, M.; Dorigo, A.; Frizziero, E.; Giacomini, F.; Gianelle, A.; Mezzadri, M.; Molinari, E.; Monforte, S.; Prelz, F.; Rebatto, D.; Sgaravatto, M.; Zangrando, L.

2011-12-01

With the advent of the recent European Union (EU) funded projects aimed at achieving an open, coordinated and proactive collaboration among the European communities that provide distributed computing services, more strict requirements and quality standards will be asked to middleware providers. Such a highly competitive and dynamic environment, organized to comply a business-oriented model, has already started pursuing quality criteria, thus requiring to formally define rigorous procedures, interfaces and roles for each step of the software life-cycle. This will ensure quality-certified releases and updates of the Grid middleware. In the European Middleware Initiative (EMI), the release management for one or more components will be organized into Product Team (PT) units, fully responsible for delivering production ready, quality-certified software and for coordinating each other to contribute to the EMI release as a whole. This paper presents the certification process, with respect to integration, installation, configuration and testing, adopted at INFN by the Product Team responsible for the gLite Web-Service based Computing Element (CREAM CE) and for the Workload Management System (WMS). The used resources, the testbeds layout, the integration and deployment methods, the certification steps to provide feedback to developers and to grant quality results are described.

Making the Business Case for Software Assurance

DTIC Science & Technology

2009-04-01

and Capability dEtermination-SPICE, ISO /IEC 15504, 1998. [ ISO 2007] International Organization for Standardization. " ISO /IEC 27001 & 27002 ...Implementing the Process Areas 6.2.7 Differences Between the CMMI and Software CMM Process Areas 6.3 The CMMI Appraisal Process 6.4 Adapting ISO 15504 to...Secure Software Assurance 6.4.1 Assessment and the Secure Life Cycle 6.4.2 ISO 15504 Capability Levels 6.5 Adapting the ISOIIEC 21287 Standard Approach to

Database & information tools for transportation research management : Connecticut transportation research peer exchange report of a thematic peer exchange.

DOT National Transportation Integrated Search

2006-05-01

Specific objectives of the Peer Exchange were: : Discuss and exchange information about databases and other software : used to support the program-cycles managed by state transportation : research offices. Elements of the program cycle include: :...

Reproducibility of dynamic contrast-enhanced MRI and dynamic susceptibility contrast MRI in the study of brain gliomas: a comparison of data obtained using different commercial software.

PubMed

Conte, Gian Marco; Castellano, Antonella; Altabella, Luisa; Iadanza, Antonella; Cadioli, Marcello; Falini, Andrea; Anzalone, Nicoletta

2017-04-01

Dynamic susceptibility contrast MRI (DSC) and dynamic contrast-enhanced MRI (DCE) are useful tools in the diagnosis and follow-up of brain gliomas; nevertheless, both techniques leave the open issue of data reproducibility. We evaluated the reproducibility of data obtained using two different commercial software for perfusion maps calculation and analysis, as one of the potential sources of variability can be the software itself. DSC and DCE analyses from 20 patients with gliomas were tested for both the intrasoftware (as intraobserver and interobserver reproducibility) and the intersoftware reproducibility, as well as the impact of different postprocessing choices [vascular input function (VIF) selection and deconvolution algorithms] on the quantification of perfusion biomarkers plasma volume (Vp), volume transfer constant (K trans ) and rCBV. Data reproducibility was evaluated with the intraclass correlation coefficient (ICC) and Bland-Altman analysis. For all the biomarkers, the intra- and interobserver reproducibility resulted in almost perfect agreement in each software, whereas for the intersoftware reproducibility the value ranged from 0.311 to 0.577, suggesting fair to moderate agreement; Bland-Altman analysis showed high dispersion of data, thus confirming these findings. Comparisons of different VIF estimation methods for DCE biomarkers resulted in ICC of 0.636 for K trans and 0.662 for Vp; comparison of two deconvolution algorithms in DSC resulted in an ICC of 0.999. The use of single software ensures very good intraobserver and interobservers reproducibility. Caution should be taken when comparing data obtained using different software or different postprocessing within the same software, as reproducibility is not guaranteed anymore.

Dynamic Test Bed Analysis of Gas Energy Balance for a Diesel Exhaust System Fit with a Thermoelectric Generator

NASA Astrophysics Data System (ADS)

Fuc, Pawel; Lijewski, Piotr; Ziolkowski, Andrzej; Dobrzyński, Michal

2017-05-01

Analysis of the energy balance for an exhaust system of a diesel engine fit with an automotive thermoelectric generator (ATEG) of our own design has been carried out. A special measurement system and dedicated software were developed to measure the power generated by the modules. The research object was a 1.3-l small diesel engine with power output of 66 kW. The tests were carried out on a dynamic engine test bed that allows reproduction of an actual driving cycle expressed as a function V = f( t), simulating drivetrain (clutch, transmission) operating characteristics, vehicle geometrical parameters, and driver behavior. Measurements of exhaust gas thermodynamic parameters (temperature, pressure, and mass flow) as well as the voltage and current generated by the thermoelectric modules were performed during tests of our own design. Based on the results obtained, the flow of exhaust gas energy in the entire exhaust system was determined along with the ATEG power output. The ideal area of the exhaust system for location of the ATEG was defined to ensure the highest thermal energy recovery efficiency.

Static and Dynamic Verification of Critical Software for Space Applications

NASA Astrophysics Data System (ADS)

Moreira, F.; Maia, R.; Costa, D.; Duro, N.; Rodríguez-Dapena, P.; Hjortnaes, K.

Space technology is no longer used only for much specialised research activities or for sophisticated manned space missions. Modern society relies more and more on space technology and applications for every day activities. Worldwide telecommunications, Earth observation, navigation and remote sensing are only a few examples of space applications on which we rely daily. The European driven global navigation system Galileo and its associated applications, e.g. air traffic management, vessel and car navigation, will significantly expand the already stringent safety requirements for space based applications Apart from their usefulness and practical applications, every single piece of onboard software deployed into the space represents an enormous investment. With a long lifetime operation and being extremely difficult to maintain and upgrade, at least when comparing with "mainstream" software development, the importance of ensuring their correctness before deployment is immense. Verification &Validation techniques and technologies have a key role in ensuring that the onboard software is correct and error free, or at least free from errors that can potentially lead to catastrophic failures. Many RAMS techniques including both static criticality analysis and dynamic verification techniques have been used as a means to verify and validate critical software and to ensure its correctness. But, traditionally, these have been isolated applied. One of the main reasons is the immaturity of this field in what concerns to its application to the increasing software product(s) within space systems. This paper presents an innovative way of combining both static and dynamic techniques exploiting their synergy and complementarity for software fault removal. The methodology proposed is based on the combination of Software FMEA and FTA with Fault-injection techniques. The case study herein described is implemented with support from two tools: The SoftCare tool for the SFMEA and SFTA, and the Xception tool for fault-injection. Keywords: Verification &Validation, RAMS, Onboard software, SFMEA, STA, Fault-injection 1 This work is being performed under the project STADY Applied Static And Dynamic Verification Of Critical Software, ESA/ESTEC Contract Nr. 15751/02/NL/LvH.

Logic design for dynamic and interactive recovery.

NASA Technical Reports Server (NTRS)

Carter, W. C.; Jessep, D. C.; Wadia, A. B.; Schneider, P. R.; Bouricius, W. G.

1971-01-01

Recovery in a fault-tolerant computer means the continuation of system operation with data integrity after an error occurs. This paper delineates two parallel concepts embodied in the hardware and software functions required for recovery; detection, diagnosis, and reconfiguration for hardware, data integrity, checkpointing, and restart for the software. The hardware relies on the recovery variable set, checking circuits, and diagnostics, and the software relies on the recovery information set, audit, and reconstruct routines, to characterize the system state and assist in recovery when required. Of particular utility is a handware unit, the recovery control unit, which serves as an interface between error detection and software recovery programs in the supervisor and provides dynamic interactive recovery.

Dynamic 68Ga-DOTATOC PET/CT and static image in NET patients. Correlation of parameters during PRRT.

PubMed

Van Binnebeek, Sofie; Koole, Michel; Terwinghe, Christelle; Baete, Kristof; Vanbilloen, Bert; Haustermans, Karine; Clement, Paul M; Bogaerts, Kris; Verbruggen, Alfons; Nackaerts, Kris; Van Cutsem, Eric; Verslype, Chris; Mottaghy, Felix M; Deroose, Christophe M

2016-06-28

To investigate the relationship between the dynamic parameters (Ki) and static image-derived parameters of 68Ga-DOTATOC-PET, to determine which static parameter best reflects underlying somatostatin-receptor-expression (SSR) levels on neuroendocrine tumours (NETs). 20 patients with metastasized NETs underwent a dynamic and static 68Ga-DOTATOC-PET before PRRT and at 7 and 40 weeks after the first administration of 90Y-DOTATOC (in total 4 cycles were planned); 175 lesions were defined and analyzed on the dynamic as well as static scans. Quantitative analysis was performed using the software PMOD. One to five target lesions per patient were chosen and delineated manually on the baseline dynamic scan and further, on the corresponding static 68Ga-DOTATOC-PET and the dynamic and static 68Ga-DOTATOC-PET at the other time-points; SUVmax and SUVmean of the lesions was assessed on the other six scans. The input function was retrieved from the abdominal aorta on the images. Further on, Ki was calculated using the Patlak-Plot. At last, 5 reference regions for normalization of SUVtumour were delineated on the static scans resulting in 5 ratios (SUVratio). SUVmax and SUVmean of the tumoural lesions on the dynamic 68Ga-DOTATOC-PET had a very strong correlation with the corresponding parameters in the static scan (R²: 0.94 and 0.95 respectively). SUVmax, SUVmean and Ki of the lesions showed a good linear correlation; the SUVratios correlated poorly with Ki. A significantly better correlation was noticed between Ki and SUVtumour(max and mean) (p < 0.0001). As the dynamic parameter Ki correlates best with the absolute SUVtumour, SUVtumour best reflects underlying SSR-levels in NETs.

The Effect of Dynamic Software on Prospective Mathematics Teachers' Perceptions Regarding Information and Communication Technology

ERIC Educational Resources Information Center

Tatar, Enver

2013-01-01

The aim of this study was to determine the effect of dynamic software on prospective mathematics teachers' perception levels regarding information and communication technology (ICT). The study was conducted with senior prospective teachers studying in a department of secondary mathematics education. The data of the study used both quantitative and…

Teaching Locus with a Conserved Property by Integrating Mathematical Tools and Dynamic Geometric Software

ERIC Educational Resources Information Center

Stupel, Moshe; Segal, Ruti; Oxman, Victor

2016-01-01

In this article, we present investigative tasks that concern loci, which integrate the use of dynamic geometry software (DGS) with mathematics for proving the obtained figures. Additional conditions were added to the loci: ellipse, parabola and circle, which result in the emergence of new loci, similar in form to the original loci. The…

The Role of Dynamic Software in the Identification and Construction of Mathematical Relationships

ERIC Educational Resources Information Center

Santos-Trigo, Manuel

2004-01-01

What features of mathematical thinking do students exhibit when they use dynamic software in their problem solving approaches? To what extent does the systematic use of technology favour students' development of problem solving competences? What type of reasoning do students develop as a result of using a particular tool? This study documents…

Using Dynamic Software in Mathematics: The Case of Reflection Symmetry

ERIC Educational Resources Information Center

Tatar, Enver; Akkaya, Adnan; Kagizmanli, Türkan Berrin

2014-01-01

This study was carried out to examine the effects of computer-assisted instruction (CAI) using dynamic software on the achievement of students in mathematics in the topic of reflection symmetry. The study also aimed to ascertain the pre-service mathematics teachers' opinions on the use of CAI in mathematics lessons. In the study, a mixed research…

Cabri-Geometre: Does Dynamic Geometry Software (DGS) Change Geometry and Its Teaching and Learning?

ERIC Educational Resources Information Center

Straesser, Rudolf

2001-01-01

Discusses geometry and Dynamical Geometry Software (DGS). Analyses the way DGS-use influences traditional geometry. Highlights changes in the interactions between geometry, computers, and DGS and human users, focusing on changes in the teaching and learning of geometry. Concludes that DGS deeply changes geometry if it is taken as a human activity…

Software conversion history of the Flight Dynamics System (FDS)

NASA Technical Reports Server (NTRS)

Liu, K.

1984-01-01

This report summarizes the overall history of the Flight Dynamics System (FDS) applications software conversion project. It describes the background and nature of the project; traces the actual course of conversion; assesses the process, product, and personnel involved; and offers suggestions for future projects. It also contains lists of pertinent reference material and examples of supporting data.

Using Dynamic Geometry Software to Improve Eight Grade Students' Understanding of Transformation Geometry

ERIC Educational Resources Information Center

Guven, Bulent

2012-01-01

This study examines the effect of dynamic geometry software (DGS) on students' learning of transformation geometry. A pre- and post-test quasi-experimental design was used. Participants in the study were 68 eighth grade students (36 in the experimental group and 32 in the control group). While the experimental group students were studying the…

Salient Beliefs of Secondary School Mathematics Teachers Using Dynamic Geometry Software

ERIC Educational Resources Information Center

Chan, Kan Kan

2015-01-01

Even though dynamic geometry software (DGS) is becoming an emergent instructional tool for mathematics teachers, many teachers are still in the process of consideration about whether to use it. In order to encourage teachers to use DGS, this study seeks to discover mathematics teachers' salient beliefs about the use of DGS in mathematics class.…

Why Don't All Maths Teachers Use Dynamic Geometry Software in Their Classrooms?

ERIC Educational Resources Information Center

Stols, Gerrit; Kriek, Jeanne

2011-01-01

In this exploratory study, we sought to examine the influence of mathematics teachers' beliefs on their intended and actual usage of dynamic mathematics software in their classrooms. The theory of planned behaviour (TPB), the technology acceptance model (TAM) and the innovation diffusion theory (IDT) were used to examine the influence of teachers'…

Software Surface Modeling and Grid Generation Steering Committee

NASA Technical Reports Server (NTRS)

Smith, Robert E. (Editor)

1992-01-01

It is a NASA objective to promote improvements in the capability and efficiency of computational fluid dynamics. Grid generation, the creation of a discrete representation of the solution domain, is an essential part of computational fluid dynamics. However, grid generation about complex boundaries requires sophisticated surface-model descriptions of the boundaries. The surface modeling and the associated computation of surface grids consume an extremely large percentage of the total time required for volume grid generation. Efficient and user friendly software systems for surface modeling and grid generation are critical for computational fluid dynamics to reach its potential. The papers presented here represent the state-of-the-art in software systems for surface modeling and grid generation. Several papers describe improved techniques for grid generation.

Computational methods and software systems for dynamics and control of large space structures

NASA Technical Reports Server (NTRS)

Park, K. C.; Felippa, C. A.; Farhat, C.; Pramono, E.

1990-01-01

This final report on computational methods and software systems for dynamics and control of large space structures covers progress to date, projected developments in the final months of the grant, and conclusions. Pertinent reports and papers that have not appeared in scientific journals (or have not yet appeared in final form) are enclosed. The grant has supported research in two key areas of crucial importance to the computer-based simulation of large space structure. The first area involves multibody dynamics (MBD) of flexible space structures, with applications directed to deployment, construction, and maneuvering. The second area deals with advanced software systems, with emphasis on parallel processing. The latest research thrust in the second area, as reported here, involves massively parallel computers.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walker, La Tonya Nicole; Malczynski, Leonard A.

DYNAMO is a computer program for building and running 'continuous' simulation models. It was developed by the Industrial Dynamics Group at the Massachusetts Institute of Technology for simulating dynamic feedback models of business, economic, and social systems. The history of the system dynamics method since 1957 includes many classic models built in DYANMO. It was not until the late 1980s that software was built to take advantage of the rise of personal computers and graphical user interfaces that DYNAMO was supplanted. There is much learning and insight to be gained from examining the DYANMO models and their accompanying research papers.more » We believe that it is a worthwhile exercise to convert DYNAMO models to more recent software packages. We have made an attempt to make it easier to turn these models into a more current system dynamics software language, Powersim © Studio produced by Powersim AS 2 of Bergen, Norway. This guide shows how to convert DYNAMO syntax into Studio syntax.« less

Propulsive Reaction Control System Model

NASA Technical Reports Server (NTRS)

Brugarolas, Paul; Phan, Linh H.; Serricchio, Frederick; San Martin, Alejandro M.

2011-01-01

This software models a propulsive reaction control system (RCS) for guidance, navigation, and control simulation purposes. The model includes the drive electronics, the electromechanical valve dynamics, the combustion dynamics, and thrust. This innovation follows the Mars Science Laboratory entry reaction control system design, and has been created to meet the Mars Science Laboratory (MSL) entry, descent, and landing simulation needs. It has been built to be plug-and-play on multiple MSL testbeds [analysis, Monte Carlo, flight software development, hardware-in-the-loop, and ATLO (assembly, test and launch operations) testbeds]. This RCS model is a C language program. It contains two main functions: the RCS electronics model function that models the RCS FPGA (field-programmable-gate-array) processing and commanding of the RCS valve, and the RCS dynamic model function that models the valve and combustion dynamics. In addition, this software provides support functions to initialize the model states, set parameters, access model telemetry, and access calculated thruster forces.

Hardware for dynamic quantum computing.

PubMed

Ryan, Colm A; Johnson, Blake R; Ristè, Diego; Donovan, Brian; Ohki, Thomas A

2017-10-01

We describe the hardware, gateware, and software developed at Raytheon BBN Technologies for dynamic quantum information processing experiments on superconducting qubits. In dynamic experiments, real-time qubit state information is fed back or fed forward within a fraction of the qubits' coherence time to dynamically change the implemented sequence. The hardware presented here covers both control and readout of superconducting qubits. For readout, we created a custom signal processing gateware and software stack on commercial hardware to convert pulses in a heterodyne receiver into qubit state assignments with minimal latency, alongside data taking capability. For control, we developed custom hardware with gateware and software for pulse sequencing and steering information distribution that is capable of arbitrary control flow in a fraction of superconducting qubit coherence times. Both readout and control platforms make extensive use of field programmable gate arrays to enable tailored qubit control systems in a reconfigurable fabric suitable for iterative development.

LIMAO: Cross-platform software for simulating laser-induced alignment and orientation dynamics of linear-, symmetric- and asymmetric tops

NASA Astrophysics Data System (ADS)

Szidarovszky, Tamás; Jono, Maho; Yamanouchi, Kaoru

2018-07-01

A user-friendly and cross-platform software called Laser-Induced Molecular Alignment and Orientation simulator (LIMAO) has been developed. The program can be used to simulate within the rigid rotor approximation the rotational dynamics of gas phase molecules induced by linearly polarized intense laser fields at a given temperature. The software is implemented in the Java and Mathematica programming languages. The primary aim of LIMAO is to aid experimental scientists in predicting and analyzing experimental data representing laser-induced spatial alignment and orientation of molecules.

What's Happening in the Software Engineering Laboratory?

NASA Technical Reports Server (NTRS)

Pajerski, Rose; Green, Scott; Smith, Donald

1995-01-01

Since 1976 the Software Engineering Laboratory (SEL) has been dedicated to understanding and improving the way in which one NASA organization the Flight Dynamics Division (FDD) at Goddard Space Flight Center, develops, maintains, and manages complex flight dynamics systems. This paper presents an overview of recent activities and studies in SEL, using as a framework the SEL's organizational goals and experience based software improvement approach. It focuses on two SEL experience areas : (1) the evolution of the measurement program and (2) an analysis of three generations of Cleanroom experiments.

Novel Analysis Software for Detecting and Classifying Ca2+ Transient Abnormalities in Stem Cell-Derived Cardiomyocytes

PubMed Central

Penttinen, Kirsi; Siirtola, Harri; Àvalos-Salguero, Jorge; Vainio, Tiina; Juhola, Martti; Aalto-Setälä, Katriina

2015-01-01

Comprehensive functioning of Ca2+ cycling is crucial for excitation–contraction coupling of cardiomyocytes (CMs). Abnormal Ca2+ cycling is linked to arrhythmogenesis, which is associated with cardiac disorders and heart failure. Accordingly, we have generated spontaneously beating CMs from induced pluripotent stem cells (iPSC) derived from patients with catecholaminergic polymorphic ventricular tachycardia (CPVT), which is an inherited and severe cardiac disease. Ca2+ cycling studies have revealed substantial abnormalities in these CMs. Ca2+ transient analysis performed manually lacks accepted analysis criteria, and has both low throughput and high variability. To overcome these issues, we have developed a software tool, AnomalyExplorer based on interactive visualization, to assist in the classification of Ca2+ transient patterns detected in CMs. Here, we demonstrate the usability and capability of the software, and we also compare the analysis efficiency to manual analysis. We show that AnomalyExplorer is suitable for detecting normal and abnormal Ca2+ transients; furthermore, this method provides more defined and consistent information regarding the Ca2+ abnormality patterns and cell line specific differences when compared to manual analysis. This tool will facilitate and speed up the analysis of CM Ca2+ transients, making it both more accurate and user-independent. AnomalyExplorer can be exploited in Ca2+ cycling analysis to study basic disease pathology and the effects of different drugs. PMID:26308621

Novel Analysis Software for Detecting and Classifying Ca2+ Transient Abnormalities in Stem Cell-Derived Cardiomyocytes.

PubMed

Penttinen, Kirsi; Siirtola, Harri; Àvalos-Salguero, Jorge; Vainio, Tiina; Juhola, Martti; Aalto-Setälä, Katriina

2015-01-01

Comprehensive functioning of Ca2+ cycling is crucial for excitation-contraction coupling of cardiomyocytes (CMs). Abnormal Ca2+ cycling is linked to arrhythmogenesis, which is associated with cardiac disorders and heart failure. Accordingly, we have generated spontaneously beating CMs from induced pluripotent stem cells (iPSC) derived from patients with catecholaminergic polymorphic ventricular tachycardia (CPVT), which is an inherited and severe cardiac disease. Ca2+ cycling studies have revealed substantial abnormalities in these CMs. Ca2+ transient analysis performed manually lacks accepted analysis criteria, and has both low throughput and high variability. To overcome these issues, we have developed a software tool, AnomalyExplorer based on interactive visualization, to assist in the classification of Ca2+ transient patterns detected in CMs. Here, we demonstrate the usability and capability of the software, and we also compare the analysis efficiency to manual analysis. We show that AnomalyExplorer is suitable for detecting normal and abnormal Ca2+ transients; furthermore, this method provides more defined and consistent information regarding the Ca2+ abnormality patterns and cell line specific differences when compared to manual analysis. This tool will facilitate and speed up the analysis of CM Ca2+ transients, making it both more accurate and user-independent. AnomalyExplorer can be exploited in Ca2+ cycling analysis to study basic disease pathology and the effects of different drugs.

Evolutionary behaviour, trade-offs and cyclic and chaotic population dynamics.

PubMed

Hoyle, Andy; Bowers, Roger G; White, Andy

2011-05-01

Many studies of the evolution of life-history traits assume that the underlying population dynamical attractor is stable point equilibrium. However, evolutionary outcomes can change significantly in different circumstances. We present an analysis based on adaptive dynamics of a discrete-time demographic model involving a trade-off whose shape is also an important determinant of evolutionary behaviour. We derive an explicit expression for the fitness in the cyclic region and consequently present an adaptive dynamic analysis which is algebraic. We do this fully in the region of 2-cycles and (using a symbolic package) almost fully for 4-cycles. Simulations illustrate and verify our results. With equilibrium population dynamics, trade-offs with accelerating costs produce a continuously stable strategy (CSS) whereas trade-offs with decelerating costs produce a non-ES repellor. The transition to 2-cycles produces a discontinuous change: the appearance of an intermediate region in which branching points occur. The size of this region decreases as we move through the region of 2-cycles. There is a further discontinuous fall in the size of the branching region during the transition to 4-cycles. We extend our results numerically and with simulations to higher-period cycles and chaos. Simulations show that chaotic population dynamics can evolve from equilibrium and vice-versa.

Mining dynamic noteworthy functions in software execution sequences.

PubMed

Zhang, Bing; Huang, Guoyan; Wang, Yuqian; He, Haitao; Ren, Jiadong

2017-01-01

As the quality of crucial entities can directly affect that of software, their identification and protection become an important premise for effective software development, management, maintenance and testing, which thus contribute to improving the software quality and its attack-defending ability. Most analysis and evaluation on important entities like codes-based static structure analysis are on the destruction of the actual software running. In this paper, from the perspective of software execution process, we proposed an approach to mine dynamic noteworthy functions (DNFM)in software execution sequences. First, according to software decompiling and tracking stack changes, the execution traces composed of a series of function addresses were acquired. Then these traces were modeled as execution sequences and then simplified so as to get simplified sequences (SFS), followed by the extraction of patterns through pattern extraction (PE) algorithm from SFS. After that, evaluating indicators inner-importance and inter-importance were designed to measure the noteworthiness of functions in DNFM algorithm. Finally, these functions were sorted by their noteworthiness. Comparison and contrast were conducted on the experiment results from two traditional complex network-based node mining methods, namely PageRank and DegreeRank. The results show that the DNFM method can mine noteworthy functions in software effectively and precisely.

An NAFP Project: Use of Object Oriented Methodologies and Design Patterns to Refactor Software Design

NASA Technical Reports Server (NTRS)

Shaykhian, Gholam Ali; Baggs, Rhoda

2007-01-01

In the early problem-solution era of software programming, functional decompositions were mainly used to design and implement software solutions. In functional decompositions, functions and data are introduced as two separate entities during the design phase, and are followed as such in the implementation phase. Functional decompositions make use of refactoring through optimizing the algorithms, grouping similar functionalities into common reusable functions, and using abstract representations of data where possible; all these are done during the implementation phase. This paper advocates the usage of object-oriented methodologies and design patterns as the centerpieces of refactoring software solutions. Refactoring software is a method of changing software design while explicitly preserving its external functionalities. The combined usage of object-oriented methodologies and design patterns to refactor should also benefit the overall software life cycle cost with improved software.

Hierarchical Petascale Simulation Framework For Stress Corrosion Cracking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grama, Ananth

2013-12-18

A number of major accomplishments resulted from the project. These include: • Data Structures, Algorithms, and Numerical Methods for Reactive Molecular Dynamics. We have developed a range of novel data structures, algorithms, and solvers (amortized ILU, Spike) for use with ReaxFF and charge equilibration. • Parallel Formulations of ReactiveMD (Purdue ReactiveMolecular Dynamics Package, PuReMD, PuReMD-GPU, and PG-PuReMD) for Messaging, GPU, and GPU Cluster Platforms. We have developed efficient serial, parallel (MPI), GPU (Cuda), and GPU Cluster (MPI/Cuda) implementations. Our implementations have been demonstrated to be significantly better than the state of the art, both in terms of performance and scalability.more » • Comprehensive Validation in the Context of Diverse Applications. We have demonstrated the use of our software in diverse systems, including silica-water, silicon-germanium nanorods, and as part of other projects, extended it to applications ranging from explosives (RDX) to lipid bilayers (biomembranes under oxidative stress). • Open Source Software Packages for Reactive Molecular Dynamics. All versions of our soft- ware have been released over the public domain. There are over 100 major research groups worldwide using our software. • Implementation into the Department of Energy LAMMPS Software Package. We have also integrated our software into the Department of Energy LAMMPS software package.« less

Making Use of a Decade of Widely Varying Historical Data: SARP Project - "Full Life-Cycle Defect Management"

NASA Technical Reports Server (NTRS)

Shull, Forrest; Godfrey, Sally; Bechtel, Andre; Feldmann, Raimund L.; Regardie, Myrna; Seaman, Carolyn

2008-01-01

A viewgraph presentation describing the NASA Software Assurance Research Program (SARP) project, with a focus on full life-cycle defect management, is provided. The topics include: defect classification, data set and algorithm mapping, inspection guidelines, and tool support.

Power generation using sugar cane bagasse: A heat recovery analysis

NASA Astrophysics Data System (ADS)

Seguro, Jean Vittorio

The sugar industry is facing the need to improve its performance by increasing efficiency and developing profitable by-products. An important possibility is the production of electrical power for sale. Co-generation has been practiced in the sugar industry for a long time in a very inefficient way with the main purpose of getting rid of the bagasse. The goal of this research was to develop a software tool that could be used to improve the way that bagasse is used to generate power. Special focus was given to the heat recovery components of the co-generation plant (economizer, air pre-heater and bagasse dryer) to determine if one, or a combination, of them led to a more efficient co-generation cycle. An extensive review of the state of the art of power generation in the sugar industry was conducted and is summarized in this dissertation. Based on this models were developed. After testing the models and comparing the results with the data collected from the literature, a software application that integrated all these models was developed to simulate the complete co-generation plant. Seven different cycles, three different pressures, and sixty-eight distributions of the flue gas through the heat recovery components can be simulated. The software includes an economic analysis tool that can help the designer determine the economic feasibility of different options. Results from running the simulation are presented that demonstrate its effectiveness in evaluating and comparing the different heat recovery components and power generation cycles. These results indicate that the economizer is the most beneficial option for heat recovery and that the use of waste heat in a bagasse dryer is the least desirable option. Quantitative comparisons of several possible cycle options with the widely-used traditional back-pressure turbine cycle are given. These indicate that a double extraction condensing cycle is best for co-generation purposes. Power generation gains between 40 and 100% are predicted for some cycles with the addition of optimum heat recovery systems.

Case Study of the Space Shuttle Cockpit Avionics Upgrade Software

NASA Technical Reports Server (NTRS)

Ferguson, Roscoe C.; Thompson, Hiram C.

2005-01-01

The purpose of the Space Shuttle Cockpit Avionics Upgrade project was to reduce crew workload and improve situational awareness. The upgrade was to augment the Shuttle avionics system with new hardware and software. An early version of this system was used to gather human factor statistics in the Space Shuttle Motion Simulator of the Johnson Space Center for one month by multiple teams of astronauts. The results were compiled by NASA Ames Research Center and it was was determined that the system provided a better than expected increase in situational awareness and reduction in crew workload. Even with all of the benefits nf the system, NASA cancelled the project towards the end of the development cycle. A major success of this project was the validation of the hardware architecture and software design. This was significant because the project incorporated new technology and approaches for the development of human rated space software. This paper serves as a case study to document knowledge gained and techniques that can be applied for future space avionics development efforts. The major technological advances were the use of reflective memory concepts for data acquisition and the incorporation of Commercial off the Shelf (COTS) products in a human rated space avionics system. The infused COTS products included a real time operating system, a resident linker and loader, a display generation tool set, and a network data manager. Some of the successful design concepts were the engineering of identical outputs in multiple avionics boxes using an event driven approach and inter-computer communication, a reconfigurable data acquisition engine, the use of a dynamic bus bandwidth allocation algorithm. Other significant experiences captured were the use of prototyping to reduce risk, and the correct balance between Object Oriented and Functional based programming.

Moving Up the CMMI Capability and Maturity Levels Using Simulation

DTIC Science & Technology

2008-01-01

Alternative Process Tools, Including NPV and ROI 6 Figure 3: Top-Level View of the Full Life-Cycle Version of the IEEE 12207 PSIM, Including IV&V Layer 19...Figure 4: Screenshot of the Incremental Version Model 19 Figure 5: IEEE 12207 PSIM Showing the Top-Level Life-Cycle Phases 22 Figure 6: IEEE 12207 ...Software Detailed Design for the IEEE 12207 Life- Cycle Process 24 Figure 8: Incremental Life Cycle PSIM Configured for a Specific Project Using SEPG

A report on NASA software engineering and Ada training requirements

NASA Technical Reports Server (NTRS)

Legrand, Sue; Freedman, Glenn B.; Svabek, L.

1987-01-01

NASA's software engineering and Ada skill base are assessed and information that may result in new models for software engineering, Ada training plans, and curricula are provided. A quantitative assessment which reflects the requirements for software engineering and Ada training across NASA is provided. A recommended implementation plan including a suggested curriculum with associated duration per course and suggested means of delivery is also provided. The distinction between education and training is made. Although it was directed to focus on NASA's need for the latter, the key relationships to software engineering education are also identified. A rationale and strategy for implementing a life cycle education and training program are detailed in support of improved software engineering practices and the transition to Ada.

Prospective time-resolved LCA of fully electric supercap vehicles in Germany.

PubMed

Zimmermann, Benedikt M; Dura, Hanna; Baumann, Manuel J; Weil, Marcel R

2015-07-01

The ongoing transition of the German electricity supply toward a higher share of renewable and sustainable energy sources, called Energiewende in German, has led to dynamic changes in the environmental impact of electricity over the last few years. Prominent scenario studies predict that comparable dynamics will continue in the coming decades, which will further improve the environmental performance of Germany's electricity supply. Life cycle assessment (LCA) is the methodology commonly used to evaluate environmental performance. Previous LCA studies on electric vehicles have shown that the electricity supply for the vehicles' operation is responsible for the major part of their environmental impact. The core question of this study is how the prospective dynamic development of the German electricity mix will affect the impact of electric vehicles operated in Germany and how LCA can be adapted to analyze this impact in a more robust manner. The previously suggested approach of time-resolved LCA, which is located between static and dynamic LCA, is used in this study and compared with several static approaches. Furthermore, the uncertainty issue associated with scenario studies is addressed in general and in relation to time-resolved LCA. Two scenario studies relevant to policy making have been selected, but a moderate number of modifications have been necessary to adapt the data to the requirements of a life cycle inventory. A potential, fully electric vehicle powered by a supercapacitor energy storage system is used as a generic example. The results show that substantial improvements in the environmental repercussions of the electricity supply and, consequentially, of electric vehicles will be achieved between 2020 and 2031 on the basis of the energy mixes predicted in both studies. This study concludes that although scenarios might not be able to predict the future, they should nonetheless be used as data sources in prospective LCA studies, because in many cases historic data appears to be unsuitable for providing realistic information on the future. The time-resolved LCA approach improves the assessment's robustness substantially, especially when nonlinear developments are foreseen in the future scenarios. This allows for a reduction of bias in LCA-based decision making. However, a deeper integration of time-resolved data in the life cycle inventory and the implementation of a more suitable software framework are desirable. The study describes how life cycle assessment's (LCA) robustness can be improved by respecting prospective fluctuations, like the transition of the German electricity mix, in the modeling of the life cycle inventory. It presents a feasible and rather simple process to add time-resolved data to LCA. The study selects 2 different future scenarios from important German studies and processes their data systematically to make them compatible with the requirements of a life cycle inventory. The use of external scenarios as basis for future-oriented LCA is reflected critically. A case study on electric mobility is presented and used to compare historic, prospective static, and prospective time-resolved electricity mix modeling approaches. The case study emphasizes the benefits of time-resolved LCA in direct comparison with the currently used approaches. © 2015 SETAC.

Flight design system-1 system design. Volume 5: Data management and data base documentation support system. [for shuttle flight planning

NASA Technical Reports Server (NTRS)

1979-01-01

Application software intended to reduce the man-hours required per flight design cycle by producing major flight design documents with little or no manual typing is described. The documentation support software is divided into two separately executable processors. However, since both processors support the same overall functions, and most of the software contained in one is also contained in the other, both are collectively presented.

Automated quantification of lumbar vertebral kinematics from dynamic fluoroscopic sequences

NASA Astrophysics Data System (ADS)

Camp, Jon; Zhao, Kristin; Morel, Etienne; White, Dan; Magnuson, Dixon; Gay, Ralph; An, Kai-Nan; Robb, Richard

2009-02-01

We hypothesize that the vertebra-to-vertebra patterns of spinal flexion and extension motion of persons with lower back pain will differ from those of persons who are pain-free. Thus, it is our goal to measure the motion of individual lumbar vertebrae noninvasively from dynamic fluoroscopic sequences. Two-dimensional normalized mutual information-based image registration was used to track frame-to-frame motion. Software was developed that required the operator to identify each vertebra on the first frame of the sequence using a four-point "caliper" placed at the posterior and anterior edges of the inferior and superior end plates of the target vertebrae. The program then resolved the individual motions of each vertebra independently throughout the entire sequence. To validate the technique, 6 cadaveric lumbar spine specimens were potted in polymethylmethacrylate and instrumented with optoelectric sensors. The specimens were then placed in a custom dynamic spine simulator and moved through flexion-extension cycles while kinematic data and fluoroscopic sequences were simultaneously acquired. We found strong correlation between the absolute flexionextension range of motion of each vertebra as recorded by the optoelectric system and as determined from the fluoroscopic sequence via registration. We conclude that this method is a viable way of noninvasively assessing twodimensional vertebral motion.

Vestibular rehabilitation outcomes in chronic vertiginous patients through computerized dynamic visual acuity and Gaze stabilization test.

PubMed

Badaracco, Carlo; Labini, Francesca Sylos; Meli, Annalisa; De Angelis, Ezio; Tufarelli, Davide

2007-09-01

To evaluate the efficiency of the rehabilitative protocols in patients with labyrinthine hypofunction, focusing on computerized dynamic visual acuity test (DVAt) and Gaze stabilization test (GST) specifically evaluating the vestibulo-oculomotor reflex (VOR) changes due to vestibular rehabilitation. Consecutive sample study. Day hospital in Ears, Nose, and Throat Rehabilitation Unit. Thirty-two patients with chronic dizziness with a mean age of 60.74 years. Patients performed one cycle of 12 daily rehabilitation sessions (2 h each) consisting of exercises aimed at improving VOR gain. The rehabilitation program included substitutional and/or habitudinal exercises, exercises on a stability platform, and exercises on a moving footpath with rehabilitative software. Dizziness Handicap Inventory and Activities-specific Balance Confidence Scale. Computerized dynamic posturography, computerized DVAt, and GST. The patients significantly improved in all the tests. Vestibular rehabilitation improved the quality of life by reducing the handicap index and improving the ability in everyday tasks. The recovery of the vestibular-ocular reflex and vestibular-spinal reflex efficiency was objectively proven by instrumental testing. The DVAt and the GST allow to objectively quantify the fixation ability at higher frequencies and speeds (main VOR function). Moreover, these new parameters permit to completely evaluate vestibular rehabilitation outcomes, adding new information to the generally used tests that only assess vestibulospinal reflex.

Eddy current compensation for delta relaxation enhanced MR by dynamic reference phase modulation.

PubMed

Hoelscher, Uvo Christoph; Jakob, Peter M

2013-04-01

Eddy current compensation by dynamic reference phase modulation (eDREAM) is a compensation method for eddy current fields induced by B 0 field-cycling which occur in delta relaxation enhanced MR (dreMR) imaging. The presented method is based on a dynamic frequency adjustment and prevents eddy current related artifacts. It is easy to implement and can be completely realized in software for any imaging sequence. In this paper, the theory of eDREAM is derived and two applications are demonstrated. The theory describes how to model the behavior of the eddy currents and how to implement the compensation. Phantom and in vivo measurements are carried out and demonstrate the benefits of eDREAM. A comparison of images acquired with and without eDREAM shows a significant improvement in dreMR image quality. Images without eDREAM suffer from severe artifacts and do not allow proper interpretation while images with eDREAM are artifact free. In vivo experiments demonstrate that dreMR imaging without eDREAM is not feasible as artifacts completely change the image contrast. eDREAM is a flexible eddy current compensation for dreMR. It is capable of completely removing the influence of eddy currents such that the dreMR images do not suffer from artifacts.

Coleman performs VO2 Max PFS Software Calibrations and Instrument Check

NASA Image and Video Library

2011-02-24

ISS026-E-029180 (24 Feb. 2011) --- NASA astronaut Catherine (Cady) Coleman, Expedition 26 flight engineer, performs VO2max portable Pulmonary Function System (PFS) software calibrations and instrument check while using the Cycle Ergometer with Vibration Isolation System (CEVIS) in the Destiny laboratory of the International Space Station.

An Analysis of Related Software Cycles Among Organizations, People and the Software Industry

DTIC Science & Technology

2008-06-01

confirmatory, theory testing type of research. Miles and Huberman (1994) claim: Much qualitative research lies between these two extremes. Something is...either graphically or in narrative form, the main things to be studied” ( Miles and Huberman 1994). The “main things” mentioned here refer to the key

FloWave.US: validated, open-source, and flexible software for ultrasound blood flow analysis.

PubMed

Coolbaugh, Crystal L; Bush, Emily C; Caskey, Charles F; Damon, Bruce M; Towse, Theodore F

2016-10-01

Automated software improves the accuracy and reliability of blood velocity, vessel diameter, blood flow, and shear rate ultrasound measurements, but existing software offers limited flexibility to customize and validate analyses. We developed FloWave.US-open-source software to automate ultrasound blood flow analysis-and demonstrated the validity of its blood velocity (aggregate relative error, 4.32%) and vessel diameter (0.31%) measures with a skeletal muscle ultrasound flow phantom. Compared with a commercial, manual analysis software program, FloWave.US produced equivalent in vivo cardiac cycle time-averaged mean (TAMean) velocities at rest and following a 10-s muscle contraction (mean bias <1 pixel for both conditions). Automated analysis of ultrasound blood flow data was 9.8 times faster than the manual method. Finally, a case study of a lower extremity muscle contraction experiment highlighted the ability of FloWave.US to measure small fluctuations in TAMean velocity, vessel diameter, and mean blood flow at specific time points in the cardiac cycle. In summary, the collective features of our newly designed software-accuracy, reliability, reduced processing time, cost-effectiveness, and flexibility-offer advantages over existing proprietary options. Further, public distribution of FloWave.US allows researchers to easily access and customize code to adapt ultrasound blood flow analysis to a variety of vascular physiology applications. Copyright © 2016 the American Physiological Society.

Toward full life cycle control: Adding maintenance measurement to the SEL

NASA Technical Reports Server (NTRS)

Rombach, H. Dieter; Ulery, Bradford T.; Valett, Jon D.

1992-01-01

Organization-wide measurement of software products and processes is needed to establish full life cycle control over software products. The Software Engineering Laboratory (SEL)--a joint venture between NASA GSFC, the University of Maryland, and Computer Sciences Corporation--started measurement of software development more than 15 years ago. Recently, the measurement of maintenance was added to the scope of the SEL. In this article, the maintenance measurement program is presented as an addition to the already existing and well-established SEL development measurement program and evaluated in terms of its immediate benefits and long-term improvement potential. Immediate benefits of this program for the SEL include an increased understanding of the maintenance domain, the differences and commonalities between development and maintenance, and the cause-effect relationships between development and maintenance. Initial results from a sample maintenance study are presented to substantiate these benefits. The long-term potential of this program includes the use of maintenance baselines to better plan and manage future projects and to improve development and maintenance practices for future projects wherever warranted.

An information model for use in software management estimation and prediction

NASA Technical Reports Server (NTRS)

Li, Ningda R.; Zelkowitz, Marvin V.

1993-01-01

This paper describes the use of cluster analysis for determining the information model within collected software engineering development data at the NASA/GSFC Software Engineering Laboratory. We describe the Software Management Environment tool that allows managers to predict development attributes during early phases of a software project and the modifications we propose to allow it to develop dynamic models for better predictions of these attributes.

SIMA: Python software for analysis of dynamic fluorescence imaging data.

PubMed

Kaifosh, Patrick; Zaremba, Jeffrey D; Danielson, Nathan B; Losonczy, Attila

2014-01-01

Fluorescence imaging is a powerful method for monitoring dynamic signals in the nervous system. However, analysis of dynamic fluorescence imaging data remains burdensome, in part due to the shortage of available software tools. To address this need, we have developed SIMA, an open source Python package that facilitates common analysis tasks related to fluorescence imaging. Functionality of this package includes correction of motion artifacts occurring during in vivo imaging with laser-scanning microscopy, segmentation of imaged fields into regions of interest (ROIs), and extraction of signals from the segmented ROIs. We have also developed a graphical user interface (GUI) for manual editing of the automatically segmented ROIs and automated registration of ROIs across multiple imaging datasets. This software has been designed with flexibility in mind to allow for future extension with different analysis methods and potential integration with other packages. Software, documentation, and source code for the SIMA package and ROI Buddy GUI are freely available at http://www.losonczylab.org/sima/.

Viability of Cross-Flow Fan with Helical Blades for Vertical Take-off and Landing Aircraft

DTIC Science & Technology

2012-09-01

fluid dynamics (CFD) software, ANSYS - CFX , a three-dimensional (3-D) straight-bladed model was validated against previous study’s experimental results...computational fluid dynamics software (CFD), ANSYS - CFX , a three-dimensional (3-D) straight-bladed model was validated against previous study’s experimental...37 B. SIZING PARAMETERS AND ILLUSTRATION ................................. 37 APPENDIX B. ANSYS CFX PARAMETERS

Moving Target Techniques: Leveraging Uncertainty for Cyber Defense

DTIC Science & Technology

2015-08-24

vulnerability (a flaw or bug that an attacker can exploit to penetrate or disrupt a system) to successfully compromise systems. Defenders, however...device drivers, numerous software applications, and hardware components. Within the cyberspace, this imbalance between a simple, one- bug attack...parsing code itself could have security-relevant software bugs . Dynamic  Network   Techniques in the dynamic network domain change the properties

Using Dynamic Geometry Software GeoGebra in Developing Countries: A Case Study of Impressions of Mathematics Teachers in Nepal

ERIC Educational Resources Information Center

Mainali, Bhesh Raj; Key, Mary Beth

2012-01-01

This article describes a professional development initiative for fifteen mathematics teachers in the use of dynamic geometry software GeoGebra. A four-day introductory workshop was given in Nepal to provide an overview of GeoGebra and its possible integration in the teaching/learning of secondary school mathematics there. Teachers' impressions and…

The Role of Dynamic Geometry Software in High School Geometry Curricula: An Analysis of Proof Tasks

ERIC Educational Resources Information Center

Oner, Diler

2009-01-01

In this study, I examine the role of dynamic geometry software (DGS) in curricular proof tasks. I investigated seven US high school geometry textbooks that were categorised into three groups: technology-intensive, standards-based, and traditional curricula. I looked at the frequency and purpose of DGS use in these textbooks. In addition, I…

The Effect of Dynamic Geometry Software and Physical Manipulatives on Candidate Teachers' Transformational Geometry Success

ERIC Educational Resources Information Center

Yilmaz, Gül Kaleli

2015-01-01

This study aims to investigate the effects of using Dynamic Geometry Software (DGS) Cabri II Plus and physical manipulatives on the transformational geometry achievement of candidate teachers. In this study, the semi-experimental method was used, consisting of two experimental and one control groups. The samples of this study were 117 students. A…

Using Dynamic Geometry Software To Add Contrast to Geometric Situations--A Case Study.

ERIC Educational Resources Information Center

Holzl, Reinhard

2001-01-01

Uses of Dynamic Geometry Software (DGS) are often limited purely to a verifying role. Presents a case study that emerged from a project in which DGS formed an integral part of the pedagogical arrangement. The study demonstrates how the contrasting power of DGS might be utilized in a guided discovery setting. (Contains 17 references.) (Author/ASK)

The Effect of Using Dynamic Mathematics Software: Cross Section and Visualization

ERIC Educational Resources Information Center

Kösa, Temel

2016-01-01

The main purpose of this study is to determine the effects of using dynamic mathematics software on pre-service mathematics teachers' ability to infer the shape of a cross section of a three-dimensional solid, as well as on their spatial visualization skills. The study employed a quasi-experimental design with a control group; the Purdue Spatial…

Students' Learning Experiences When Using a Dynamic Geometry Software Tool in a Geometry Lesson at Secondary School in Ethiopia

ERIC Educational Resources Information Center

Denbel, Dejene Girma

2015-01-01

Students learning experiences were investigated in geometry lesson when using Dynamic Geometry Software (DGS) tool in geometry learning in 25 Ethiopian secondary students. The research data were drawn from the used worksheets, classroom observations, results of pre- and post-test, a questionnaire and interview responses. I used GeoGebra as a DGS…

Comet Gas and Dust Dynamics Modeling

NASA Technical Reports Server (NTRS)

Von Allmen, Paul A.; Lee, Seungwon

2010-01-01

This software models the gas and dust dynamics of comet coma (the head region of a comet) in order to support the Microwave Instrument for Rosetta Orbiter (MIRO) project. MIRO will study the evolution of the comet 67P/Churyumov-Gerasimenko's coma system. The instrument will measure surface temperature, gas-production rates and relative abundances, and velocity and excitation temperatures of each species along with their spatial temporal variability. This software will use these measurements to improve the understanding of coma dynamics. The modeling tool solves the equation of motion of a dust particle, the energy balance equation of the dust particle, the continuity equation for the dust and gas flow, and the dust and gas mixture energy equation. By solving these equations numerically, the software calculates the temperature and velocity of gas and dust as a function of time for a given initial gas and dust production rate, and a dust characteristic parameter that measures the ability of a dust particle to adjust its velocity to the local gas velocity. The software is written in a modular manner, thereby allowing the addition of more dynamics equations as needed. All of the numerical algorithms are added in-house and no third-party libraries are used.

Implementing Software Safety in the NASA Environment

NASA Technical Reports Server (NTRS)

Wetherholt, Martha S.; Radley, Charles F.

1994-01-01

Until recently, NASA did not consider allowing computers total control of flight systems. Human operators, via hardware, have constituted the ultimate safety control. In an attempt to reduce costs, NASA has come to rely more and more heavily on computers and software to control space missions. (For example. software is now planned to control most of the operational functions of the International Space Station.) Thus the need for systematic software safety programs has become crucial for mission success. Concurrent engineering principles dictate that safety should be designed into software up front, not tested into the software after the fact. 'Cost of Quality' studies have statistics and metrics to prove the value of building quality and safety into the development cycle. Unfortunately, most software engineers are not familiar with designing for safety, and most safety engineers are not software experts. Software written to specifications which have not been safety analyzed is a major source of computer related accidents. Safer software is achieved step by step throughout the system and software life cycle. It is a process that includes requirements definition, hazard analyses, formal software inspections, safety analyses, testing, and maintenance. The greatest emphasis is placed on clearly and completely defining system and software requirements, including safety and reliability requirements. Unfortunately, development and review of requirements are the weakest link in the process. While some of the more academic methods, e.g. mathematical models, may help bring about safer software, this paper proposes the use of currently approved software methodologies, and sound software and assurance practices to show how, to a large degree, safety can be designed into software from the start. NASA's approach today is to first conduct a preliminary system hazard analysis (PHA) during the concept and planning phase of a project. This determines the overall hazard potential of the system to be built. Shortly thereafter, as the system requirements are being defined, the second iteration of hazard analyses takes place, the systems hazard analysis (SHA). During the systems requirements phase, decisions are made as to what functions of the system will be the responsibility of software. This is the most critical time to affect the safety of the software. From this point, software safety analyses as well as software engineering practices are the main focus for assuring safe software. While many of the steps proposed in this paper seem like just sound engineering practices, they are the best technical and most cost effective means to assure safe software within a safe system.

Life Cycle Assessment Software for Product and Process Sustainability Analysis

ERIC Educational Resources Information Center

Vervaeke, Marina

2012-01-01

In recent years, life cycle assessment (LCA), a methodology for assessment of environmental impacts of products and services, has become increasingly important. This methodology is applied by decision makers in industry and policy, product developers, environmental managers, and other non-LCA specialists working on environmental issues in a wide…

Using Modified Fagan Inspections to Control Rapid System Development

NASA Technical Reports Server (NTRS)

Griesel, M. A.; Welz, L. L.

1994-01-01

The Jet Propulsion Laboratory (JPL) has been developing new approaches to software and system development to shorten life cycle time and reduce total life-cycle cost, while maintaining product quality. One such approach has been taken by the Just-In-Time (JIT) Materiel Acquisition System Development Project.

A "Rainmaker" Process for Developing Internet-Based Retail Businesses

ERIC Educational Resources Information Center

Abrahams, Alan S.; Singh, Tirna

2011-01-01

Various systems development life cycles and business development models have been popularized by information systems researchers and practitioners over a number of decades. In the case of systems development life cycles, these have been targeted at software development projects within an organization, typically involving analysis, design,…

Ontology for Life-Cycle Modeling of Water Distribution Systems: Model View Definition

DTIC Science & Technology

2013-06-01

Research and Development Center, Construction Engineering Research Laboratory (ERDC-CERL) to develop a life-cycle building model have resulted in the...Laboratory (ERDC-CERL) to develop a life-cycle building model have resulted in the definition of a “core” building information model that contains...developed experimental BIM models us- ing commercial off-the-shelf (COTS) software. Those models represent three types of typical low-rise Army

Automation software for a materials testing laboratory

NASA Technical Reports Server (NTRS)

Mcgaw, Michael A.; Bonacuse, Peter J.

1990-01-01

The software environment in use at the NASA-Lewis Research Center's High Temperature Fatigue and Structures Laboratory is reviewed. This software environment is aimed at supporting the tasks involved in performing materials behavior research. The features and capabilities of the approach to specifying a materials test include static and dynamic control mode switching, enabling multimode test control; dynamic alteration of the control waveform based upon events occurring in the response variables; precise control over the nature of both command waveform generation and data acquisition; and the nesting of waveform/data acquisition strategies so that material history dependencies may be explored. To eliminate repetitive tasks in the coventional research process, a communications network software system is established which provides file interchange and remote console capabilities.

Towards a software profession

NASA Technical Reports Server (NTRS)

Berard, Edward V.

1986-01-01

An increasing number of programmers have attempted to change their image. They have made it plain that they wish not only to be taken seriously, but they also wish to be regarded as professionals. Many programmers now wish to referred to as software engineers. If programmers wish to be considered professionals in every sense of the word, two obstacles must be overcome: the inability to think of software as a product, and the idea that little or no skill is required to create and handle software throughout its life cycle. The steps to be taken toward professionalization are outlined along with recommendations.

Deep space network software cost estimation model

NASA Technical Reports Server (NTRS)

Tausworthe, R. C.

1981-01-01

A parametric software cost estimation model prepared for Deep Space Network (DSN) Data Systems implementation tasks is presented. The resource estimation model incorporates principles and data from a number of existing models. The model calibrates task magnitude and difficulty, development environment, and software technology effects through prompted responses to a set of approximately 50 questions. Parameters in the model are adjusted to fit DSN software life cycle statistics. The estimation model output scales a standard DSN Work Breakdown Structure skeleton, which is then input into a PERT/CPM system, producing a detailed schedule and resource budget for the project being planned.

Development of a Unix/VME data acquisition system

NASA Astrophysics Data System (ADS)

Miller, M. C.; Ahern, S.; Clark, S. M.

1992-01-01

The current status of a Unix-based VME data acquisition development project is described. It is planned to use existing Fortran data collection software to drive the existing CAMAC electronics via a VME CAMAC branch driver card and associated Daresbury Unix driving software. The first usable Unix driver has been written and produces single-action CAMAC cycles from test software. The data acquisition code has been implemented in test mode under Unix with few problems and effort is now being directed toward finalizing calls to the CAMAC-driving software and ultimate evaluation of the complete system.

GEDAE-LaB: A Free Software to Calculate the Energy System Contributions during Exercise

PubMed Central

Bertuzzi, Rômulo; Melegati, Jorge; Bueno, Salomão; Ghiarone, Thaysa; Pasqua, Leonardo A.; Gáspari, Arthur Fernandes; Lima-Silva, Adriano E.; Goldman, Alfredo

2016-01-01

Purpose The aim of the current study is to describe the functionality of free software developed for energy system contributions and energy expenditure calculation during exercise, namely GEDAE-LaB. Methods Eleven participants performed the following tests: 1) a maximal cycling incremental test to measure the ventilatory threshold and maximal oxygen uptake (V˙O2max); 2) a cycling workload constant test at moderate domain (90% ventilatory threshold); 3) a cycling workload constant test at severe domain (110% V˙O2max). Oxygen uptake and plasma lactate were measured during the tests. The contributions of the aerobic (AMET), anaerobic lactic (LAMET), and anaerobic alactic (ALMET) systems were calculated based on the oxygen uptake during exercise, the oxygen energy equivalents provided by lactate accumulation, and the fast component of excess post-exercise oxygen consumption, respectively. In order to assess the intra-investigator variation, four different investigators performed the analyses independently using GEDAE-LaB. A direct comparison with commercial software was also provided. Results All subjects completed 10 min of exercise at moderate domain, while the time to exhaustion at severe domain was 144 ± 65 s. The AMET, LAMET, and ALMET contributions during moderate domain were about 93, 2, and 5%, respectively. The AMET, LAMET, and ALMET contributions during severe domain were about 66, 21, and 13%, respectively. No statistical differences were found between the energy system contributions and energy expenditure obtained by GEDAE-LaB and commercial software for both moderate and severe domains (P > 0.05). The ICC revealed that these estimates were highly reliable among the four investigators for both moderate and severe domains (all ICC ≥ 0.94). Conclusion These findings suggest that GEDAE-LaB is a free software easily comprehended by users minimally familiarized with adopted procedures for calculations of energetic profile using oxygen uptake and lactate accumulation during exercise. By providing availability of the software and its source code we hope to facilitate future related research. PMID:26727499

GEDAE-LaB: A Free Software to Calculate the Energy System Contributions during Exercise.

PubMed

Bertuzzi, Rômulo; Melegati, Jorge; Bueno, Salomão; Ghiarone, Thaysa; Pasqua, Leonardo A; Gáspari, Arthur Fernandes; Lima-Silva, Adriano E; Goldman, Alfredo

2016-01-01

The aim of the current study is to describe the functionality of free software developed for energy system contributions and energy expenditure calculation during exercise, namely GEDAE-LaB. Eleven participants performed the following tests: 1) a maximal cycling incremental test to measure the ventilatory threshold and maximal oxygen uptake (V̇O2max); 2) a cycling workload constant test at moderate domain (90% ventilatory threshold); 3) a cycling workload constant test at severe domain (110% V̇O2max). Oxygen uptake and plasma lactate were measured during the tests. The contributions of the aerobic (AMET), anaerobic lactic (LAMET), and anaerobic alactic (ALMET) systems were calculated based on the oxygen uptake during exercise, the oxygen energy equivalents provided by lactate accumulation, and the fast component of excess post-exercise oxygen consumption, respectively. In order to assess the intra-investigator variation, four different investigators performed the analyses independently using GEDAE-LaB. A direct comparison with commercial software was also provided. All subjects completed 10 min of exercise at moderate domain, while the time to exhaustion at severe domain was 144 ± 65 s. The AMET, LAMET, and ALMET contributions during moderate domain were about 93, 2, and 5%, respectively. The AMET, LAMET, and ALMET contributions during severe domain were about 66, 21, and 13%, respectively. No statistical differences were found between the energy system contributions and energy expenditure obtained by GEDAE-LaB and commercial software for both moderate and severe domains (P > 0.05). The ICC revealed that these estimates were highly reliable among the four investigators for both moderate and severe domains (all ICC ≥ 0.94). These findings suggest that GEDAE-LaB is a free software easily comprehended by users minimally familiarized with adopted procedures for calculations of energetic profile using oxygen uptake and lactate accumulation during exercise. By providing availability of the software and its source code we hope to facilitate future related research.

Flight dynamics software in a distributed network environment

NASA Technical Reports Server (NTRS)

Jeletic, J.; Weidow, D.; Boland, D.

1995-01-01

As with all NASA facilities, the announcement of reduced budgets, reduced staffing, and the desire to implement smaller/quicker/cheaper missions has required the Agency's organizations to become more efficient in what they do. To accomplish these objectives, the FDD has initiated the development of the Flight Dynamics Distributed System (FDDS). The underlying philosophy of FDDS is to build an integrated system that breaks down the traditional barriers of attitude, mission planning, and navigation support software to provide a uniform approach to flight dynamics applications. Through the application of open systems concepts and state-of-the-art technologies, including object-oriented specification concepts, object-oriented software, and common user interface, communications, data management, and executive services, the FDD will reengineer most of its six million lines of code.

ARC Software and Models

Science.gov Websites

produce software code and methodologies that are transferred to TARDEC and industry partners. These constraints", ASME Dynamic Systems and Control Conference, 2013, DOI:10.1115/DSCC2013-3935 Software Monitoring",IEEE Transactions on Control Systems Technology, DOI:10.1109/TCST.2012.2217143 Fast

DyNAMiC Workbench: an integrated development environment for dynamic DNA nanotechnology

PubMed Central

Grun, Casey; Werfel, Justin; Zhang, David Yu; Yin, Peng

2015-01-01

Dynamic DNA nanotechnology provides a promising avenue for implementing sophisticated assembly processes, mechanical behaviours, sensing and computation at the nanoscale. However, design of these systems is complex and error-prone, because the need to control the kinetic pathway of a system greatly increases the number of design constraints and possible failure modes for the system. Previous tools have automated some parts of the design workflow, but an integrated solution is lacking. Here, we present software implementing a three ‘tier’ design process: a high-level visual programming language is used to describe systems, a molecular compiler builds a DNA implementation and nucleotide sequences are generated and optimized. Additionally, our software includes tools for analysing and ‘debugging’ the designs in silico, and for importing/exporting designs to other commonly used software systems. The software we present is built on many existing pieces of software, but is integrated into a single package—accessible using a Web-based interface at http://molecular-systems.net/workbench. We hope that the deep integration between tools and the flexibility of this design process will lead to better experimental results, fewer experimental design iterations and the development of more complex DNA nanosystems. PMID:26423437

Automated Flight Dynamics Product Generation for the EOS AM-1 Spacecraft

NASA Technical Reports Server (NTRS)

Matusow, Carla

1999-01-01

As part of NASA's Earth Science Enterprise, the Earth Observing System (EOS) AM-1 spacecraft is designed to monitor long-term, global, environmental changes. Because of the complexity of the AM-1 spacecraft, the mission operations center requires more than 80 distinct flight dynamics products (reports). To create these products, the AM-1 Flight Dynamics Team (FDT) will use a combination of modified commercial software packages (e.g., Analytical Graphic's Satellite ToolKit) and NASA-developed software applications. While providing the most cost-effective solution to meeting the mission requirements, the integration of these software applications raises several operational concerns: (1) Routine product generation requires knowledge of multiple applications executing on variety of hardware platforms. (2) Generating products is a highly interactive process requiring a user to interact with each application multiple times to generate each product. (3) Routine product generation requires several hours to complete. (4) User interaction with each application introduces the potential for errors, since users are required to manually enter filenames and input parameters as well as run applications in the correct sequence. Generating products requires some level of flight dynamics expertise to determine the appropriate inputs and sequencing. To address these issues, the FDT developed an automation software tool called AutoProducts, which runs on a single hardware platform and provides all necessary coordination and communication among the various flight dynamics software applications. AutoProducts, autonomously retrieves necessary files, sequences and executes applications with correct input parameters, and deliver the final flight dynamics products to the appropriate customers. Although AutoProducts will normally generate pre-programmed sets of routine products, its graphical interface allows for easy configuration of customized and one-of-a-kind products. Additionally, AutoProducts has been designed as a mission-independent tool, and can be easily reconfigured to support other missions or incorporate new flight dynamics software packages. After the AM-1 launch, AutoProducts will run automatically at pre-determined time intervals . The AutoProducts tool reduces many of the concerns associated with the flight dynamics product generation. Although AutoProducts required a significant effort to develop because of the complexity of the interfaces involved, its use will provide significant cost savings through reduced operator time and maximum product reliability. In addition, user satisfaction is significantly improved and flight dynamics experts have more time to perform valuable analysis work. This paper will describe the evolution of the AutoProducts tool, highlighting the cost savings and customer satisfaction resulting from its development. It will also provide details about the tool including its graphical interface and operational capabilities.

A Categorization of Dynamic Analyzers

NASA Technical Reports Server (NTRS)

Lujan, Michelle R.

1997-01-01

Program analysis techniques and tools are essential to the development process because of the support they provide in detecting errors and deficiencies at different phases of development. The types of information rendered through analysis includes the following: statistical measurements of code, type checks, dataflow analysis, consistency checks, test data,verification of code, and debugging information. Analyzers can be broken into two major categories: dynamic and static. Static analyzers examine programs with respect to syntax errors and structural properties., This includes gathering statistical information on program content, such as the number of lines of executable code, source lines. and cyclomatic complexity. In addition, static analyzers provide the ability to check for the consistency of programs with respect to variables. Dynamic analyzers in contrast are dependent on input and the execution of a program providing the ability to find errors that cannot be detected through the use of static analysis alone. Dynamic analysis provides information on the behavior of a program rather than on the syntax. Both types of analysis detect errors in a program, but dynamic analyzers accomplish this through run-time behavior. This paper focuses on the following broad classification of dynamic analyzers: 1) Metrics; 2) Models; and 3) Monitors. Metrics are those analyzers that provide measurement. The next category, models, captures those analyzers that present the state of the program to the user at specified points in time. The last category, monitors, checks specified code based on some criteria. The paper discusses each classification and the techniques that are included under them. In addition, the role of each technique in the software life cycle is discussed. Familiarization with the tools that measure, model and monitor programs provides a framework for understanding the program's dynamic behavior from different, perspectives through analysis of the input/output data.

A methodology for testing fault-tolerant software

NASA Technical Reports Server (NTRS)

Andrews, D. M.; Mahmood, A.; Mccluskey, E. J.

1985-01-01

A methodology for testing fault tolerant software is presented. There are problems associated with testing fault tolerant software because many errors are masked or corrected by voters, limiter, or automatic channel synchronization. This methodology illustrates how the same strategies used for testing fault tolerant hardware can be applied to testing fault tolerant software. For example, one strategy used in testing fault tolerant hardware is to disable the redundancy during testing. A similar testing strategy is proposed for software, namely, to move the major emphasis on testing earlier in the development cycle (before the redundancy is in place) thus reducing the possibility that undetected errors will be masked when limiters and voters are added.

Challenges in horizontal model integration.

PubMed

Kolczyk, Katrin; Conradi, Carsten

2016-03-11

Systems Biology has motivated dynamic models of important intracellular processes at the pathway level, for example, in signal transduction and cell cycle control. To answer important biomedical questions, however, one has to go beyond the study of isolated pathways towards the joint study of interacting signaling pathways or the joint study of signal transduction and cell cycle control. Thereby the reuse of established models is preferable, as it will generally reduce the modeling effort and increase the acceptance of the combined model in the field. Obtaining a combined model can be challenging, especially if the submodels are large and/or come from different working groups (as is generally the case, when models stored in established repositories are used). To support this task, we describe a semi-automatic workflow based on established software tools. In particular, two frequent challenges are described: identification of the overlap and subsequent (re)parameterization of the integrated model. The reparameterization step is crucial, if the goal is to obtain a model that can reproduce the data explained by the individual models. For demonstration purposes we apply our workflow to integrate two signaling pathways (EGF and NGF) from the BioModels Database.

A sheet metal forming simulation of automotive outer panels considering the behavior of air in die cavity

NASA Astrophysics Data System (ADS)

Choi, Kwang Yong; Kim, Yun Chang; Choi, Hee Kwan; Kang, Chul Ho; Kim, Heon Young

2013-12-01

During a sheet metal forming process of automotive outer panels, the air trapped between a blank sheet and a die tool can become highly compressed, ultimately influencing the blank deformation and the press force. To prevent this problem, vent holes are drilled into die tools and needs several tens to hundreds according to the model size. The design and the drilling of vent holes are based on expert's experience and try-out result and thus the process can be one of reasons increasing development cycle. Therefore the study on the size, the number, and the position of vent holes is demanded for reducing development cycle, but there is no simulation technology for analyzing forming defects, making numerical sheet metal forming process simulations that incorporate the fluid dynamics of air. This study presents a sheet metal forming simulation of automotive outer panels (a roof and a body side outer) that simultaneously simulates the behavior of air in a die cavity. Through CAE results, the effect of air behavior and vent holes to blank deformation was analyzed. For this study, the commercial software PAM-STAMP{trade mark, serif} and PAM-SAFE{trade mark, serif} was used.

ReaDDy - A Software for Particle-Based Reaction-Diffusion Dynamics in Crowded Cellular Environments

PubMed Central

Schöneberg, Johannes; Noé, Frank

2013-01-01

We introduce the software package ReaDDy for simulation of detailed spatiotemporal mechanisms of dynamical processes in the cell, based on reaction-diffusion dynamics with particle resolution. In contrast to other particle-based reaction kinetics programs, ReaDDy supports particle interaction potentials. This permits effects such as space exclusion, molecular crowding and aggregation to be modeled. The biomolecules simulated can be represented as a sphere, or as a more complex geometry such as a domain structure or polymer chain. ReaDDy bridges the gap between small-scale but highly detailed molecular dynamics or Brownian dynamics simulations and large-scale but little-detailed reaction kinetics simulations. ReaDDy has a modular design that enables the exchange of the computing core by efficient platform-specific implementations or dynamical models that are different from Brownian dynamics. PMID:24040218

Modeling Tools Predict Flow in Fluid Dynamics

NASA Technical Reports Server (NTRS)

2010-01-01

"Because rocket engines operate under extreme temperature and pressure, they present a unique challenge to designers who must test and simulate the technology. To this end, CRAFT Tech Inc., of Pipersville, Pennsylvania, won Small Business Innovation Research (SBIR) contracts from Marshall Space Flight Center to develop software to simulate cryogenic fluid flows and related phenomena. CRAFT Tech enhanced its CRUNCH CFD (computational fluid dynamics) software to simulate phenomena in various liquid propulsion components and systems. Today, both government and industry clients in the aerospace, utilities, and petrochemical industries use the software for analyzing existing systems as well as designing new ones."

Modernization of software quality assurance

NASA Technical Reports Server (NTRS)

Bhaumik, Gokul

1988-01-01

The customers satisfaction depends not only on functional performance, it also depends on the quality characteristics of the software products. An examination of this quality aspect of software products will provide a clear, well defined framework for quality assurance functions, which improve the life-cycle activities of software development. Software developers must be aware of the following aspects which have been expressed by many quality experts: quality cannot be added on; the level of quality built into a program is a function of the quality attributes employed during the development process; and finally, quality must be managed. These concepts have guided our development of the following definition for a Software Quality Assurance function: Software Quality Assurance is a formal, planned approach of actions designed to evaluate the degree of an identifiable set of quality attributes present in all software systems and their products. This paper is an explanation of how this definition was developed and how it is used.

Automatic Parameter Tuning for the Morpheus Vehicle Using Particle Swarm Optimization

NASA Technical Reports Server (NTRS)

Birge, B.

2013-01-01

A high fidelity simulation using a PC based Trick framework has been developed for Johnson Space Center's Morpheus test bed flight vehicle. There is an iterative development loop of refining and testing the hardware, refining the software, comparing the software simulation to hardware performance and adjusting either or both the hardware and the simulation to extract the best performance from the hardware as well as the most realistic representation of the hardware from the software. A Particle Swarm Optimization (PSO) based technique has been developed that increases speed and accuracy of the iterative development cycle. Parameters in software can be automatically tuned to make the simulation match real world subsystem data from test flights. Special considerations for scale, linearity, discontinuities, can be all but ignored with this technique, allowing fast turnaround both for simulation tune up to match hardware changes as well as during the test and validation phase to help identify hardware issues. Software models with insufficient control authority to match hardware test data can be immediately identified and using this technique requires very little to no specialized knowledge of optimization, freeing model developers to concentrate on spacecraft engineering. Integration of the PSO into the Morpheus development cycle will be discussed as well as a case study highlighting the tool's effectiveness.

DynamO: a free O(N) general event-driven molecular dynamics simulator.

PubMed

Bannerman, M N; Sargant, R; Lue, L

2011-11-30

Molecular dynamics algorithms for systems of particles interacting through discrete or "hard" potentials are fundamentally different to the methods for continuous or "soft" potential systems. Although many software packages have been developed for continuous potential systems, software for discrete potential systems based on event-driven algorithms are relatively scarce and specialized. We present DynamO, a general event-driven simulation package, which displays the optimal O(N) asymptotic scaling of the computational cost with the number of particles N, rather than the O(N) scaling found in most standard algorithms. DynamO provides reference implementations of the best available event-driven algorithms. These techniques allow the rapid simulation of both complex and large (>10(6) particles) systems for long times. The performance of the program is benchmarked for elastic hard sphere systems, homogeneous cooling and sheared inelastic hard spheres, and equilibrium Lennard-Jones fluids. This software and its documentation are distributed under the GNU General Public license and can be freely downloaded from http://marcusbannerman.co.uk/dynamo. Copyright © 2011 Wiley Periodicals, Inc.

Three-Dimensional Water and Carbon Cycle Modeling at High Spatial-Temporal Resolutions

NASA Astrophysics Data System (ADS)

Liao, C.; Zhuang, Q.

2017-12-01

Terrestrial ecosystems in cryosphere are very sensitive to the global climate change due to the presence of snow covers, mountain glaciers and permafrost, especially when the increase in near surface air temperature is almost twice as large as the global average. However, few studies have investigated the water and carbon cycle dynamics using process-based hydrological and biogeochemistry modeling approach. In this study, we used three-dimensional modeling approach at high spatial-temporal resolutions to investigate the water and carbon cycle dynamics for the Tanana Flats Basin in interior Alaska with emphases on dissolved organic carbon (DOC) dynamics. The results have shown that: (1) lateral flow plays an important role in water and carbon cycle, especially in dissolved organic carbon (DOC) dynamics. (2) approximately 2.0 × 104 kg C yr-1 DOC is exported to the hydrological networks and it compromises 1% and 0.01% of total annual gross primary production (GPP) and total organic carbon stored in soil, respectively. This study has established an operational and flexible framework to investigate and predict the water and carbon cycle dynamics under the changing climate.

Impacts of software and its engineering on the carbon footprint of ICT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kern, Eva, E-mail: e.kern@umwelt-campus.de; Dick, Markus, E-mail: sustainablesoftwareblog@gmail.com; Naumann, Stefan, E-mail: s.naumann@umwelt-campus.de

2015-04-15

The energy consumption of information and communication technology (ICT) is still increasing. Even though several solutions regarding the hardware side of Green IT exist, the software contribution to Green IT is not well investigated. The carbon footprint is one way to rate the environmental impacts of ICT. In order to get an impression of the induced CO{sub 2} emissions of software, we will present a calculation method for the carbon footprint of a software product over its life cycle. We also offer an approach on how to integrate some aspects of carbon footprint calculation into software development processes and discussmore » impacts and tools regarding this calculation method. We thus show the relevance of energy measurements and the attention to impacts on the carbon footprint by software within Green Software Engineering.« less

Local disturbance cycles and the maintenance of heterogeneity across scales in marine metapopulations.

PubMed

Gouhier, Tarik C; Guichard, Frédéric

2007-03-01

In marine systems, the occurrence and implications of disturbance-recovery cycles have been revealed at the landscape level, but only in demographically open or closed systems where landscape-level dynamics are assumed to have no feedback effect on regional dynamics. We present a mussel metapopulation model to elucidate the role of landscape-level disturbance cycles for regional response of mussel populations to onshore productivity and larval transport. Landscape dynamics are generated through spatially explicit rules, and each landscape is connected to its neighbor through unidirectional larval dispersal. The role of landscape disturbance cycles in the regional system behavior is elucidated (1) in demographically open vs. demographically coupled systems, in relation to (2) onshore reproductive output and (3) the temporal scale of landscape disturbance dynamics. By controlling for spatial structure at the landscape and metapopulation levels, we first demonstrate the interaction between landscape and oceanographic connectivity. The temporal scale of disturbance cycles, as controlled by mussel colonization rate, plays a critical role in the regional behavior of the system. Indeed, fast disturbance cycles are responsible for regional synchrony in relation to onshore reproductive output. Slow disturbance cycles, however, lead to increased robustness to changes in productivity and to demographic coupling. These testable predictions indicate that the occurrence and temporal scale of local disturbance-recovery dynamics can drive large-scale variability in demographically open systems, and the response of metapopulations to changes in nearshore productivity.

Software Quality Assurance and Controls Standard

DTIC Science & Technology

2010-04-27

Software Quality Assurance d C t l St d dan on ro s an ar Sue Carroll Principal Software Quality Analyst, SAS John Wal z VP Technology and...for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that...Cycle (SLC) process? • What is in a SQA Process? • Where are SQA Controls? • What is the SQA standards history? Wh t i h i i SQA?• a s c ang ng n

Cyber security best practices for the nuclear industry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badr, I.

2012-07-01

When deploying software based systems, such as, digital instrumentation and controls for the nuclear industry, it is vital to include cyber security assessment as part of architecture and development process. When integrating and delivering software-intensive systems for the nuclear industry, engineering teams should make use of a secure, requirements driven, software development life cycle, ensuring security compliance and optimum return on investment. Reliability protections, data loss prevention, and privacy enforcement provide a strong case for installing strict cyber security policies. (authors)

Phase-amplitude reduction of transient dynamics far from attractors for limit-cycling systems

NASA Astrophysics Data System (ADS)

Shirasaka, Sho; Kurebayashi, Wataru; Nakao, Hiroya

2017-02-01

Phase reduction framework for limit-cycling systems based on isochrons has been used as a powerful tool for analyzing the rhythmic phenomena. Recently, the notion of isostables, which complements the isochrons by characterizing amplitudes of the system state, i.e., deviations from the limit-cycle attractor, has been introduced to describe the transient dynamics around the limit cycle [Wilson and Moehlis, Phys. Rev. E 94, 052213 (2016)]. In this study, we introduce a framework for a reduced phase-amplitude description of transient dynamics of stable limit-cycling systems. In contrast to the preceding study, the isostables are treated in a fully consistent way with the Koopman operator analysis, which enables us to avoid discontinuities of the isostables and to apply the framework to system states far from the limit cycle. We also propose a new, convenient bi-orthogonalization method to obtain the response functions of the amplitudes, which can be interpreted as an extension of the adjoint covariant Lyapunov vector to transient dynamics in limit-cycling systems. We illustrate the utility of the proposed reduction framework by estimating the optimal injection timing of external input that efficiently suppresses deviations of the system state from the limit cycle in a model of a biochemical oscillator.

Tethered satellite system dynamics and control review panel and related activities, phase 3

NASA Technical Reports Server (NTRS)

1991-01-01

Two major tests of the Tethered Satellite System (TSS) engineering and flight units were conducted to demonstrate the functionality of the hardware and software. Deficiencies in the hardware/software integration tests (HSIT) led to a recommendation for more testing to be performed. Selected problem areas of tether dynamics were analyzed, including verification of the severity of skip rope oscillations, verification or comparison runs to explore dynamic phenomena observed in other simulations, and data generation runs to explore the performance of the time domain and frequency domain skip rope observers.

Lean and Efficient Software: Whole-Program Optimization of Executables

DTIC Science & Technology

2015-09-30

libraries. Many levels of library interfaces—where some libraries are dynamically linked and some are provided in binary form only—significantly limit...software at build time. The opportunity: Our objective in this project is to substantially improve the performance, size, and robustness of binary ...executables by using static and dynamic binary program analysis techniques to perform whole-program optimization directly on compiled programs

Effects of Using Dynamic Mathematics Software on Preservice Mathematics Teachers' Spatial Visualization Skills: The Case of Spatial Analytic Geometry

ERIC Educational Resources Information Center

Kösa, Temel

2016-01-01

The purpose of this study was to investigate the effects of using dynamic geometry software on preservice mathematics teachers' spatial visualization skills and to determine whether spatial visualization skills can be a predictor of success in learning analytic geometry of space. The study used a quasi-experimental design with a control group.…

Computational methods and software systems for dynamics and control of large space structures

NASA Technical Reports Server (NTRS)

Park, K. C.; Felippa, C. A.; Farhat, C.; Pramono, E.

1990-01-01

Two key areas of crucial importance to the computer-based simulation of large space structures are discussed. The first area involves multibody dynamics (MBD) of flexible space structures, with applications directed to deployment, construction, and maneuvering. The second area deals with advanced software systems, with emphasis on parallel processing. The latest research thrust in the second area involves massively parallel computers.

Approaches and possible improvements in the area of multibody dynamics modeling

NASA Technical Reports Server (NTRS)

Lips, K. W.; Singh, R.

1987-01-01

A wide ranging look is taken at issues involved in the dynamic modeling of complex, multibodied orbiting space systems. Capabilities and limitations of two major codes (DISCOS, TREETOPS) are assessed and possible extensions to the CONTOPS software are outlined. In addition, recommendations are made concerning the direction future development should take in order to achieve higher fidelity, more computationally efficient multibody software solutions.

Automated respiratory cycles selection is highly specific and improves respiratory mechanics analysis.

PubMed

Rigo, Vincent; Graas, Estelle; Rigo, Jacques

2012-07-01

Selected optimal respiratory cycles should allow calculation of respiratory mechanic parameters focusing on patient-ventilator interaction. New computer software automatically selecting optimal breaths and respiratory mechanics derived from those cycles are evaluated. Retrospective study. University level III neonatal intensive care unit. Ten mins synchronized intermittent mandatory ventilation and assist/control ventilation recordings from ten newborns. The ventilator provided respiratory mechanic data (ventilator respiratory cycles) every 10 secs. Pressure, flow, and volume waves and pressure-volume, pressure-flow, and volume-flow loops were reconstructed from continuous pressure-volume recordings. Visual assessment determined assisted leak-free optimal respiratory cycles (selected respiratory cycles). New software graded the quality of cycles (automated respiratory cycles). Respiratory mechanic values were derived from both sets of optimal cycles. We evaluated quality selection and compared mean values and their variability according to ventilatory mode and respiratory mechanic provenance. To assess discriminating power, all 45 "t" values obtained from interpatient comparisons were compared for each respiratory mechanic parameter. A total of 11,724 breaths are evaluated. Automated respiratory cycle/selected respiratory cycle selections agreement is high: 88% of maximal κ with linear weighting. Specificity and positive predictive values are 0.98 and 0.96, respectively. Averaged values are similar between automated respiratory cycle and ventilator respiratory cycle. C20/C alone is markedly decreased in automated respiratory cycle (1.27 ± 0.37 vs. 1.81 ± 0.67). Tidal volume apparent similarity disappears in assist/control: automated respiratory cycle tidal volume (4.8 ± 1.0 mL/kg) is significantly lower than for ventilator respiratory cycle (5.6 ± 1.8 mL/kg). Coefficients of variation decrease for all automated respiratory cycle parameters in all infants. "t" values from ventilator respiratory cycle data are two to three times higher than ventilator respiratory cycles. Automated selection is highly specific. Automated respiratory cycle reflects most the interaction of both ventilator and patient. Improving discriminating power of ventilator monitoring will likely help in assessing disease status and following trends. Averaged parameters derived from automated respiratory cycles are more precise and could be displayed by ventilators to improve real-time fine tuning of ventilator settings.

Mining dynamic noteworthy functions in software execution sequences

PubMed Central

Huang, Guoyan; Wang, Yuqian; He, Haitao; Ren, Jiadong

2017-01-01

As the quality of crucial entities can directly affect that of software, their identification and protection become an important premise for effective software development, management, maintenance and testing, which thus contribute to improving the software quality and its attack-defending ability. Most analysis and evaluation on important entities like codes-based static structure analysis are on the destruction of the actual software running. In this paper, from the perspective of software execution process, we proposed an approach to mine dynamic noteworthy functions (DNFM)in software execution sequences. First, according to software decompiling and tracking stack changes, the execution traces composed of a series of function addresses were acquired. Then these traces were modeled as execution sequences and then simplified so as to get simplified sequences (SFS), followed by the extraction of patterns through pattern extraction (PE) algorithm from SFS. After that, evaluating indicators inner-importance and inter-importance were designed to measure the noteworthiness of functions in DNFM algorithm. Finally, these functions were sorted by their noteworthiness. Comparison and contrast were conducted on the experiment results from two traditional complex network-based node mining methods, namely PageRank and DegreeRank. The results show that the DNFM method can mine noteworthy functions in software effectively and precisely. PMID:28278276

Meeting the memory challenges of brain-scale network simulation.

PubMed

Kunkel, Susanne; Potjans, Tobias C; Eppler, Jochen M; Plesser, Hans Ekkehard; Morrison, Abigail; Diesmann, Markus

2011-01-01

The development of high-performance simulation software is crucial for studying the brain connectome. Using connectome data to generate neurocomputational models requires software capable of coping with models on a variety of scales: from the microscale, investigating plasticity, and dynamics of circuits in local networks, to the macroscale, investigating the interactions between distinct brain regions. Prior to any serious dynamical investigation, the first task of network simulations is to check the consistency of data integrated in the connectome and constrain ranges for yet unknown parameters. Thanks to distributed computing techniques, it is possible today to routinely simulate local cortical networks of around 10(5) neurons with up to 10(9) synapses on clusters and multi-processor shared-memory machines. However, brain-scale networks are orders of magnitude larger than such local networks, in terms of numbers of neurons and synapses as well as in terms of computational load. Such networks have been investigated in individual studies, but the underlying simulation technologies have neither been described in sufficient detail to be reproducible nor made publicly available. Here, we discover that as the network model sizes approach the regime of meso- and macroscale simulations, memory consumption on individual compute nodes becomes a critical bottleneck. This is especially relevant on modern supercomputers such as the Blue Gene/P architecture where the available working memory per CPU core is rather limited. We develop a simple linear model to analyze the memory consumption of the constituent components of neuronal simulators as a function of network size and the number of cores used. This approach has multiple benefits. The model enables identification of key contributing components to memory saturation and prediction of the effects of potential improvements to code before any implementation takes place. As a consequence, development cycles can be shorter and less expensive. Applying the model to our freely available Neural Simulation Tool (NEST), we identify the software components dominant at different scales, and develop general strategies for reducing the memory consumption, in particular by using data structures that exploit the sparseness of the local representation of the network. We show that these adaptations enable our simulation software to scale up to the order of 10,000 processors and beyond. As memory consumption issues are likely to be relevant for any software dealing with complex connectome data on such architectures, our approach and our findings should be useful for researchers developing novel neuroinformatics solutions to the challenges posed by the connectome project.

General object-oriented software development

NASA Technical Reports Server (NTRS)

Seidewitz, Edwin V.; Stark, Mike

1986-01-01

Object-oriented design techniques are gaining increasing popularity for use with the Ada programming language. A general approach to object-oriented design which synthesizes the principles of previous object-oriented methods into the overall software life-cycle, providing transitions from specification to design and from design to code. It therefore provides the basis for a general object-oriented development methodology.

Development and Evaluation of the Effectiveness of Computer-Assisted Physics Instruction

ERIC Educational Resources Information Center

Rahman, Mohd. Jasmy Abd; Ismail, Mohd. Arif. Hj.; Nasir, Muhammad

2014-01-01

This study aims to design and develop an interactive software for teaching and learning physics about motion and vectors analysis. This study also assesses its effectiveness in classroom and assesses the learning motivation of SMA Pekanbaru's students. The software is developed using ADDIE Model design and Life Cycle Model and built using the…

Integrating Software-Architecture-Centric Methods into the Rational Unified Process

DTIC Science & Technology

2004-07-01

Architecture Design ...................................................................................... 19...QAW in a life- cycle context. One issue that needs to be addressed is how scenarios produced in a QAW can be used by a software architecture design method...implementation testing. 18 CMU/SEI-2004-TR-011 CMU/SEI-2004-TR-011 19 4 Architecture Design The Attribute-Driven Design (ADD) method

Generalizing the extensibility of a dynamic geometry software

NASA Astrophysics Data System (ADS)

Herceg, Đorđe; Radaković, Davorka; Herceg, Dejana

2012-09-01

Plug-and-play visual components in a Dynamic Geometry Software (DGS) enable development of visually attractive, rich and highly interactive dynamic drawings. We are developing SLGeometry, a DGS that contains a custom programming language, a computer algebra system (CAS engine) and a graphics subsystem. The basic extensibility framework on SLGeometry supports dynamic addition of new functions from attribute annotated classes that implement runtime metadata registration in code. We present a general plug-in framework for dynamic importing of arbitrary Silverlight user interface (UI) controls into SLGeometry at runtime. The CAS engine maintains a metadata storage that describes each imported visual component and enables two-way communication between the expressions stored in the engine and the UI controls on the screen.

Atrioventricular junction (AVJ) motion tracking: a software tool with ITK/VTK/Qt.

PubMed

Pengdong Xiao; Shuang Leng; Xiaodan Zhao; Hua Zou; Ru San Tan; Wong, Philip; Liang Zhong

2016-08-01

The quantitative measurement of the Atrioventricular Junction (AVJ) motion is an important index for ventricular functions of one cardiac cycle including systole and diastole. In this paper, a software tool that can conduct AVJ motion tracking from cardiovascular magnetic resonance (CMR) images is presented by using Insight Segmentation and Registration Toolkit (ITK), The Visualization Toolkit (VTK) and Qt. The software tool is written in C++ by using Visual Studio Community 2013 integrated development environment (IDE) containing both an editor and a Microsoft complier. The software package has been successfully implemented. From the software engineering practice, it is concluded that ITK, VTK, and Qt are very handy software systems to implement automatic image analysis functions for CMR images such as quantitative measure of motion by visual tracking.

OpenSim: open-source software to create and analyze dynamic simulations of movement.

PubMed

Delp, Scott L; Anderson, Frank C; Arnold, Allison S; Loan, Peter; Habib, Ayman; John, Chand T; Guendelman, Eran; Thelen, Darryl G

2007-11-01

Dynamic simulations of movement allow one to study neuromuscular coordination, analyze athletic performance, and estimate internal loading of the musculoskeletal system. Simulations can also be used to identify the sources of pathological movement and establish a scientific basis for treatment planning. We have developed a freely available, open-source software system (OpenSim) that lets users develop models of musculoskeletal structures and create dynamic simulations of a wide variety of movements. We are using this system to simulate the dynamics of individuals with pathological gait and to explore the biomechanical effects of treatments. OpenSim provides a platform on which the biomechanics community can build a library of simulations that can be exchanged, tested, analyzed, and improved through a multi-institutional collaboration. Developing software that enables a concerted effort from many investigators poses technical and sociological challenges. Meeting those challenges will accelerate the discovery of principles that govern movement control and improve treatments for individuals with movement pathologies.

Analyzing Dynamics of Cooperating Spacecraft

NASA Technical Reports Server (NTRS)

Hughes, Stephen P.; Folta, David C.; Conway, Darrel J.

2004-01-01

A software library has been developed to enable high-fidelity computational simulation of the dynamics of multiple spacecraft distributed over a region of outer space and acting with a common purpose. All of the modeling capabilities afforded by this software are available independently in other, separate software systems, but have not previously been brought together in a single system. A user can choose among several dynamical models, many high-fidelity environment models, and several numerical-integration schemes. The user can select whether to use models that assume weak coupling between spacecraft, or strong coupling in the case of feedback control or tethering of spacecraft to each other. For weak coupling, spacecraft orbits are propagated independently, and are synchronized in time by controlling the step size of the integration. For strong coupling, the orbits are integrated simultaneously. Among the integration schemes that the user can choose are Runge-Kutta Verner, Prince-Dormand, Adams-Bashforth-Moulton, and Bulirsh- Stoer. Comparisons of performance are included for both the weak- and strongcoupling dynamical models for all of the numerical integrators.

Automated continuous quantitative measurement of proximal airways on dynamic ventilation CT: initial experience using an ex vivo porcine lung phantom.

PubMed

Yamashiro, Tsuneo; Tsubakimoto, Maho; Nagatani, Yukihiro; Moriya, Hiroshi; Sakuma, Kotaro; Tsukagoshi, Shinsuke; Inokawa, Hiroyasu; Kimoto, Tatsuya; Teramoto, Ryuichi; Murayama, Sadayuki

2015-01-01

The purpose of this study was to evaluate the feasibility of continuous quantitative measurement of the proximal airways, using dynamic ventilation computed tomography (CT) and our research software. A porcine lung that was removed during meat processing was ventilated inside a chest phantom by a negative pressure cylinder (eight times per minute). This chest phantom with imitated respiratory movement was scanned by a 320-row area-detector CT scanner for approximately 9 seconds as dynamic ventilatory scanning. Obtained volume data were reconstructed every 0.35 seconds (total 8.4 seconds with 24 frames) as three-dimensional images and stored in our research software. The software automatically traced a designated airway point in all frames and measured the cross-sectional luminal area and wall area percent (WA%). The cross-sectional luminal area and WA% of the trachea and right main bronchus (RMB) were measured for this study. Two radiologists evaluated the traceability of all measurable airway points of the trachea and RMB using a three-point scale. It was judged that the software satisfactorily traced airway points throughout the dynamic ventilation CT (mean score, 2.64 at the trachea and 2.84 at the RMB). From the maximum inspiratory frame to the maximum expiratory frame, the cross-sectional luminal area of the trachea decreased 17.7% and that of the RMB 29.0%, whereas the WA% of the trachea increased 6.6% and that of the RMB 11.1%. It is feasible to measure airway dimensions automatically at designated points on dynamic ventilation CT using research software. This technique can be applied to various airway and obstructive diseases.

Glossary of software engineering laboratory terms

NASA Technical Reports Server (NTRS)

1982-01-01

A glossary of terms used in the Software Engineering Laboratory (SEL) is presented. The terms are defined within the context of the software development environment for flight dynamics at Goddard Space Flight Center. A concise reference for clarifying and understanding the language employed in SEL documents and data collection forms is provided.

10 CFR 436.15 - Formatting cost data.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Procedures for Life Cycle Cost Analyses § 436.15 Formatting cost data. In establishing cost data under §§ 436.16 and 436.17 and measuring cost effectiveness by the modes of analysis described by § 436.19 through... software referenced in the Life Cycle Cost Manual for the Federal Energy Management Program. ...

Why and how Mastering an Incremental and Iterative Software Development Process

NASA Astrophysics Data System (ADS)

Dubuc, François; Guichoux, Bernard; Cormery, Patrick; Mescam, Jean Christophe

2004-06-01

One of the key issues regularly mentioned in the current software crisis of the space domain is related to the software development process that must be performed while the system definition is not yet frozen. This is especially true for complex systems like launchers or space vehicles.Several more or less mature solutions are under study by EADS SPACE Transportation and are going to be presented in this paper. The basic principle is to develop the software through an iterative and incremental process instead of the classical waterfall approach, with the following advantages:- It permits systematic management and incorporation of requirements changes over the development cycle with a minimal cost. As far as possible the most dimensioning requirements are analyzed and developed in priority for validating very early the architecture concept without the details.- A software prototype is very quickly available. It improves the communication between system and software teams, as it enables to check very early and efficiently the common understanding of the system requirements.- It allows the software team to complete a whole development cycle very early, and thus to become quickly familiar with the software development environment (methodology, technology, tools...). This is particularly important when the team is new, or when the environment has changed since the previous development. Anyhow, it improves a lot the learning curve of the software team.These advantages seem very attractive, but mastering efficiently an iterative development process is not so easy and induces a lot of difficulties such as:- How to freeze one configuration of the system definition as a development baseline, while most of thesystem requirements are completely and naturally unstable?- How to distinguish stable/unstable and dimensioning/standard requirements?- How to plan the development of each increment?- How to link classical waterfall development milestones with an iterative approach: when should theclassical reviews be performed: Software Specification Review? Preliminary Design Review? CriticalDesign Review? Code Review? Etc...Several solutions envisaged or already deployed by EADS SPACE Transportation will be presented, both from a methodological and technological point of view:- How the MELANIE EADS ST internal methodology improves the concurrent engineering activitiesbetween GNC, software and simulation teams in a very iterative and reactive way.- How the CMM approach can help by better formalizing Requirements Management and Planningprocesses.- How the Automatic Code Generation with "certified" tools (SCADE) can still dramatically shorten thedevelopment cycle.Then the presentation will conclude by showing an evaluation of the cost and planning reduction based on a pilot application by comparing figures on two similar projects: one with the classical waterfall process, the other one with an iterative and incremental approach.

Manager's handbook for software development, revision 1

NASA Technical Reports Server (NTRS)

1990-01-01

Methods and aids for the management of software development projects are presented. The recommendations are based on analyses and experiences of the Software Engineering Laboratory (SEL) with flight dynamics software development. The management aspects of the following subjects are described: organizing the project, producing a development plan, estimating costs, scheduling, staffing, preparing deliverable documents, using management tools, monitoring the project, conducting reviews, auditing, testing, and certifying.

Adaptive Integration of Nonsmooth Dynamical Systems

DTIC Science & Technology

2017-10-11

controlled time stepping method to interactively design running robots. [1] John Shepherd, Samuel Zapolsky, and Evan M. Drumwright, “Fast multi-body...software like this to test software running on my robots. Started working in simulation after attempting to use software like this to test software... running on my robots. The libraries that produce these beautiful results have failed at simulating robotic manipulation. Postulate: It is easier to

Glossary of Software Engineering Laboratory terms

NASA Technical Reports Server (NTRS)

1983-01-01

A glossary of terms used in the Software Engineering Laboratory (SEL) is given. The terms are defined within the context of the software development environment for flight dynamics at the Goddard Space Flight Center. A concise reference for clarifying the language employed in SEL documents and data collection forms is given. Basic software engineering concepts are explained and standard definitions for use by SEL personnel are established.

Oscillating-Flow Regenerator Test Rig: Hardware and Theory With Derived Correlations for Screens and Felts

NASA Technical Reports Server (NTRS)

Gedeon, D.; Wood, J. G.

1996-01-01

A number of wire mesh and metal felt test samples, with a range of porosities, yield generic correlations for friction factor, Nusselt number, enhanced axial conduction ratio, and overall heat flux ratio. This information is directed primarily toward stirling cycle regenerator modelers, but will be of use to anyone seeking to better model fluid flow through these porous materials. Behind these results lies an oscillating-flow test rig, which measures pumping dissipation and thermal energy transport in sample matrices, and several stages of data-reduction software, which correlate instantaneous values for the above dimensionless groups. Within the software, theoretical model reduces instantaneous quantifies from cycle-averaged measurables using standard parameter estimation techniques.

Characterization of chaotic dynamics in the human menstrual cycle

NASA Astrophysics Data System (ADS)

Derry, Gregory; Derry, Paula

2010-03-01

The human menstrual cycle exhibits much unexplained variability, which is typically dismissed as random variation. Given the many delayed nonlinear feedbacks in the reproductive endocrine system, however, the menstrual cycle might well be a nonlinear dynamical system in a chaotic trajectory, and that this instead accounts for the observed variability. Here, we test this hypothesis by performing a time series analysis on data for 7438 menstrual cycles from 38 women in the 20-40 year age range, using the database maintained by the Tremin Research Program on Women's Health. Using phase space reconstruction techniques with a maximum embedding dimension of 6, we find appropriate scaling behavior in the correlation sums for this data, indicating low dimensional deterministic dynamics. A correlation dimension of 2.6 is measured in this scaling regime, and this result is confirmed by recalculation using the Takens estimator. These results may be interpreted as offering an approximation to the fractal dimension of a strange attractor governing the chaotic dynamics of the menstrual cycle.

Update: Advancement of Contact Dynamics Modeling for Human Spaceflight Simulation Applications

NASA Technical Reports Server (NTRS)

Brain, Thomas A.; Kovel, Erik B.; MacLean, John R.; Quiocho, Leslie J.

2017-01-01

Pong is a new software tool developed at the NASA Johnson Space Center that advances interference-based geometric contact dynamics based on 3D graphics models. The Pong software consists of three parts: a set of scripts to extract geometric data from 3D graphics models, a contact dynamics engine that provides collision detection and force calculations based on the extracted geometric data, and a set of scripts for visualizing the dynamics response with the 3D graphics models. The contact dynamics engine can be linked with an external multibody dynamics engine to provide an integrated multibody contact dynamics simulation. This paper provides a detailed overview of Pong including the overall approach and modeling capabilities, which encompasses force generation from contact primitives and friction to computational performance. Two specific Pong-based examples of International Space Station applications are discussed, and the related verification and validation using this new tool are also addressed.

A Comparative Study of the Effects of Using Dynamic Geometry Software and Physical Manipulatives on the Spatial Visualisation Skills of Pre-Service Mathematics Teachers

ERIC Educational Resources Information Center

Baki, Adnan; Kosa, Temel; Guven, Bulent

2011-01-01

The study compared the effects of dynamic geometry software and physical manipulatives on the spatial visualisation skills of first-year pre-service mathematics teachers. A pre- and post-test quasi-experimental design was used. The Purdue Spatial Visualisation Test (PSVT) was used for the pre- and post-test. There were three treatment groups. The…

A Case Study on Specialised Content Knowledge Development with Dynamic Geometry Software: The Analysis of Influential Factors and Technology Beliefs of Three Pre-Service Middle Grades Mathematics Teachers

ERIC Educational Resources Information Center

Zambak, Vecihi S.; Tyminski, Andrew M.

2017-01-01

This study characterises the development of Specialised Content Knowledge (SCK) with dynamic geometry software (DGS) throughout a semester. The research employed a single-case study with the embedded units of three pre-service middle grades mathematics teachers. Qualitative data were collected, and factors affecting these three teachers' SCK…

Examining the Accuracy and Justification of Geometric Constructions Made by Pre-Service Teachers with Dynamic Geometry Software and the Awareness They Gained throughout the Process

ERIC Educational Resources Information Center

Bozkurt, Ali

2018-01-01

This study examined pre-service teachers' accuracy for geometric constructions with dynamic geometry software, their justification for the accuracy of geometric figures, and their awareness they gained throughout the process. The data come from a sample of 71 elementary grade pre-service teachers activity form completed as a part of geometry…

Thermalized Drude Oscillators with the LAMMPS Molecular Dynamics Simulator.

PubMed

Dequidt, Alain; Devémy, Julien; Pádua, Agílio A H

2016-01-25

LAMMPS is a very customizable molecular dynamics simulation software, which can be used to simulate a large diversity of systems. We introduce a new package for simulation of polarizable systems with LAMMPS using thermalized Drude oscillators. The implemented functionalities are described and are illustrated by examples. The implementation was validated by comparing simulation results with published data and using a reference software. Computational performance is also analyzed.

Visualization of fluid dynamics at NASA Ames

NASA Technical Reports Server (NTRS)

Watson, Val

1989-01-01

The hardware and software currently used for visualization of fluid dynamics at NASA Ames is described. The software includes programs to create scenes (for example particle traces representing the flow over an aircraft), programs to interactively view the scenes, and programs to control the creation of video tapes and 16mm movies. The hardware includes high performance graphics workstations, a high speed network, digital video equipment, and film recorders.

High-resolution mycorrhizal hyphae dynamics: temporal variation, biophysical controls, and global environmental change

NASA Astrophysics Data System (ADS)

Hernandez, R. R.; Allen, M. F.

2010-12-01

Soils are the largest terrestrial carbon (C) repository in the global C cycle, storing 4.5 times more C than aboveground vegetation. Mycorrhizal fungi are critical edaphic organisms that influence soil C dynamics at both microscopic and ecosystem scales. Understanding the production and turnover of these organisms is critical for accurate ecosystem C budgets and predictive models incorporating changes in climate. This study seeks to quantify high-resolution mycorrhizal hyphae dynamics at various temporal scales in a mixed conifer forest (UC James Reserve, CA) using novel technologies including automated minirhizotrons, embedded soil sensor networks, and environmental software (i.e., Rootfly). We found that hyphae elongation and dieback rates in May 2009 varied significantly across 6-h diel time intervals and were greatest between 12:00 pm and 6:00 pm, when soil temperature and modeled CO2 flux is maximum. Seasonal dynamics revealed peak hyphae biomass in mid-April and rapid hyphae length decline from mid-April through June. Seasonal hyphae dynamism is tightly coupled with biophysical controls, namely, soil water content, which is positively related to hyphae production, and soil temperature. Interestingly, 14 °C may be a threshold for hyphae growth in this system as soil temperatures exceeding this value are coupled with rapid hyphae mortality. This study suggests that human-mediated changes to biophysical controls may modulate seasonal hyphae growth regimes, possibly reducing growth season duration or initiating early mortality. In this scenario, mycorrhizal hyphae mortality may act as a positive feedback to increasing CO2 levels, by releasing large amounts of CO2 into the atmosphere.

A measurement system for large, complex software programs

NASA Technical Reports Server (NTRS)

Rone, Kyle Y.; Olson, Kitty M.; Davis, Nathan E.

1994-01-01

This paper describes measurement systems required to forecast, measure, and control activities for large, complex software development and support programs. Initial software cost and quality analysis provides the foundation for meaningful management decisions as a project evolves. In modeling the cost and quality of software systems, the relationship between the functionality, quality, cost, and schedule of the product must be considered. This explicit relationship is dictated by the criticality of the software being developed. This balance between cost and quality is a viable software engineering trade-off throughout the life cycle. Therefore, the ability to accurately estimate the cost and quality of software systems is essential to providing reliable software on time and within budget. Software cost models relate the product error rate to the percent of the project labor that is required for independent verification and validation. The criticality of the software determines which cost model is used to estimate the labor required to develop the software. Software quality models yield an expected error discovery rate based on the software size, criticality, software development environment, and the level of competence of the project and developers with respect to the processes being employed.

DbMap: improving database interoperability issues in medical software using a simple, Java-Xml based solution.

PubMed Central

Karadimas, H.; Hemery, F.; Roland, P.; Lepage, E.

2000-01-01

In medical software development, the use of databases plays a central role. However, most of the databases have heterogeneous encoding and data models. To deal with these variations in the application code directly is error-prone and reduces the potential reuse of the produced software. Several approaches to overcome these limitations have been proposed in the medical database literature, which will be presented. We present a simple solution, based on a Java library, and a central Metadata description file in XML. This development approach presents several benefits in software design and development cycles, the main one being the simplicity in maintenance. PMID:11079915

Dynamics of Self-Injurious Behaviors.

ERIC Educational Resources Information Center

Newell, Karl M.; Sprague, Robert L.; Pain, Matthew T.; Deutsch, Katherine M.; Meinhold, Patricia

1999-01-01

Self-injurious behavior was examined in a case study of head-banging by an 8-year-old girl with profound mental retardation and an autistic disorder. Trajectories of arm movements and impact forces were determined from dynamic analysis of videotapes. Cycle-to-cycle consistency in the qualitative dynamics of the limb motions and impact forces…

Statistics of software vulnerability detection in certification testing

NASA Astrophysics Data System (ADS)

Barabanov, A. V.; Markov, A. S.; Tsirlov, V. L.

2018-05-01

The paper discusses practical aspects of introduction of the methods to detect software vulnerability in the day-to-day activities of the accredited testing laboratory. It presents the approval results of the vulnerability detection methods as part of the study of the open source software and the software that is a test object of the certification tests under information security requirements, including software for communication networks. Results of the study showing the allocation of identified vulnerabilities by types of attacks, country of origin, programming languages used in the development, methods for detecting vulnerability, etc. are given. The experience of foreign information security certification systems related to the detection of certified software vulnerabilities is analyzed. The main conclusion based on the study is the need to implement practices for developing secure software in the development life cycle processes. The conclusions and recommendations for the testing laboratories on the implementation of the vulnerability analysis methods are laid down.

Quantitative Cell Cycle Analysis Based on an Endogenous All-in-One Reporter for Cell Tracking and Classification.

PubMed

Zerjatke, Thomas; Gak, Igor A; Kirova, Dilyana; Fuhrmann, Markus; Daniel, Katrin; Gonciarz, Magdalena; Müller, Doris; Glauche, Ingmar; Mansfeld, Jörg

2017-05-30

Cell cycle kinetics are crucial to cell fate decisions. Although live imaging has provided extensive insights into this relationship at the single-cell level, the limited number of fluorescent markers that can be used in a single experiment has hindered efforts to link the dynamics of individual proteins responsible for decision making directly to cell cycle progression. Here, we present fluorescently tagged endogenous proliferating cell nuclear antigen (PCNA) as an all-in-one cell cycle reporter that allows simultaneous analysis of cell cycle progression, including the transition into quiescence, and the dynamics of individual fate determinants. We also provide an image analysis pipeline for automated segmentation, tracking, and classification of all cell cycle phases. Combining the all-in-one reporter with labeled endogenous cyclin D1 and p21 as prime examples of cell-cycle-regulated fate determinants, we show how cell cycle and quantitative protein dynamics can be simultaneously extracted to gain insights into G1 phase regulation and responses to perturbations. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

DynamicRoots: A Software Platform for the Reconstruction and Analysis of Growing Plant Roots.

PubMed

Symonova, Olga; Topp, Christopher N; Edelsbrunner, Herbert

2015-01-01

We present a software platform for reconstructing and analyzing the growth of a plant root system from a time-series of 3D voxelized shapes. It aligns the shapes with each other, constructs a geometric graph representation together with the function that records the time of growth, and organizes the branches into a hierarchy that reflects the order of creation. The software includes the automatic computation of structural and dynamic traits for each root in the system enabling the quantification of growth on fine-scale. These are important advances in plant phenotyping with applications to the study of genetic and environmental influences on growth.

Further development of the dynamic gas temperature measurement system. Volume 2: Computer program user's manual

NASA Technical Reports Server (NTRS)

Stocks, Dana R.

1986-01-01

The Dynamic Gas Temperature Measurement System compensation software accepts digitized data from two different diameter thermocouples and computes a compensated frequency response spectrum for one of the thermocouples. Detailed discussions of the physical system, analytical model, and computer software are presented in this volume and in Volume 1 of this report under Task 3. Computer program software restrictions and test cases are also presented. Compensated and uncompensated data may be presented in either the time or frequency domain. Time domain data are presented as instantaneous temperature vs time. Frequency domain data may be presented in several forms such as power spectral density vs frequency.

Journal and Wave Bearing Impedance Calculation Software

NASA Technical Reports Server (NTRS)

Hanford, Amanda; Campbell, Robert

2012-01-01

The wave bearing software suite is a MALTA application that computes bearing properties for user-specified wave bearing conditions, as well as plain journal bearings. Wave bearings are fluid film journal bearings with multi-lobed wave patterns around the circumference of the bearing surface. In this software suite, the dynamic coefficients are outputted in a way for easy implementation in a finite element model used in rotor dynamics analysis. The software has a graphical user interface (GUI) for inputting bearing geometry parameters, and uses MATLAB s structure interface for ease of interpreting data. This innovation was developed to provide the stiffness and damping components of wave bearing impedances. The computational method for computing bearing coefficients was originally designed for plain journal bearings and tilting pad bearings. Modifications to include a wave bearing profile consisted of changing the film thickness profile given by an equation, and writing an algorithm to locate the integration limits for each fluid region. Careful consideration was needed to implement the correct integration limits while computing the dynamic coefficients, depending on the form of the input/output variables specified in the algorithm.

UltraTrack: Software for semi-automated tracking of muscle fascicles in sequences of B-mode ultrasound images.

PubMed

Farris, Dominic James; Lichtwark, Glen A

2016-05-01

Dynamic measurements of human muscle fascicle length from sequences of B-mode ultrasound images have become increasingly prevalent in biomedical research. Manual digitisation of these images is time consuming and algorithms for automating the process have been developed. Here we present a freely available software implementation of a previously validated algorithm for semi-automated tracking of muscle fascicle length in dynamic ultrasound image recordings, "UltraTrack". UltraTrack implements an affine extension to an optic flow algorithm to track movement of the muscle fascicle end-points throughout dynamically recorded sequences of images. The underlying algorithm has been previously described and its reliability tested, but here we present the software implementation with features for: tracking multiple fascicles in multiple muscles simultaneously; correcting temporal drift in measurements; manually adjusting tracking results; saving and re-loading of tracking results and loading a range of file formats. Two example runs of the software are presented detailing the tracking of fascicles from several lower limb muscles during a squatting and walking activity. We have presented a software implementation of a validated fascicle-tracking algorithm and made the source code and standalone versions freely available for download. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A Methodology for Cybercraft Requirement Definition and Initial System Design

DTIC Science & Technology

2008-06-01

the software development concepts of the SDLC , requirements, use cases and domain modeling . It ...collectively as Software Development 5 Life Cycle ( SDLC ) models . While there are numerous models that fit under the SDLC definition, all are based on... developed that provided expanded understanding of the domain, it is necessary to either update an existing domain model or create another domain

Control software for two dimensional airfoil tests using a self-streamlining flexible walled transonic test section

NASA Technical Reports Server (NTRS)

Wolf, S. W. D.; Goodyer, M. J.

1982-01-01

Operation of the Transonic Self-Streamlining Wind Tunnel (TSWT) involved on-line data acquisition with automatic wall adjustment. A tunnel run consisted of streamlining the walls from known starting contours in iterative steps and acquiring model data. Each run performs what is described as a streamlining cycle. The associated software is presented.

Assessing tropical rainforest growth traits: Data - Model fusion in the Congo basin and beyond.

NASA Astrophysics Data System (ADS)

Pietsch, S.

2016-12-01

Virgin forest ecosystems resemble the key reference level for natural tree growth dynamics. The mosaic cycle concept describes such dynamics as local disequilibria driven by patch level succession cycles of breakdown, regeneration, juvenescence and old growth. These cycles, however, may involve different traits of light demanding and shade tolerant species assemblies. In this work a data model fusion concept will be introduced to assess the differences in growth dynamics of the mosaic cycle of the Western Congolian Lowland Rainforest ecosystem. Field data from 34 forest patches located in an ice age forest refuge, recently pinpointed to the ground and still devoid of direct human impact up to today - resemble the data base. A 3D error assessment procedure versus BGC model simulations for the 34 patches revealed two different growth dynamics, consistent with observed growth traits of pioneer and late succession species assemblies of the Western Congolian Lowland rainforest. An application of the same procedure to Central American Pacific rainforests confirms the strength of the 3D error field data model fusion concept to assess different growth traits of the mosaic cycle of natural forest dynamics.

Managers Handbook for Software Development

NASA Technical Reports Server (NTRS)

Agresti, W.; Mcgarry, F.; Card, D.; Page, J.; Church, V.; Werking, R.

1984-01-01

Methods and aids for the management of software development projects are presented. The recommendations are based on analyses and experiences with flight dynamics software development. The management aspects of organizing the project, producing a development plan, estimation costs, scheduling, staffing, preparing deliverable documents, using management tools, monitoring the project, conducting reviews, auditing, testing, and certifying are described.

GeoGebra as an Artist's Paintbrush

ERIC Educational Resources Information Center

Aktümen, Muharrem; Yildiz, Avni

2016-01-01

One of the definitions of mathematics is that it is "a science of patterns and themes". Within the scope of this definition, the current software technology facilitates the creation of visuals and patterns. Thus, GeoGebra software was used. The study was carried out in two stages. In the first stage, the Dynamic Geometry Software and the…

A proven approach for more effective software development and maintenance

NASA Technical Reports Server (NTRS)

Pajerski, Rose; Hall, Dana; Sinclair, Craig

1994-01-01

Modern space flight mission operations and associated ground data systems are increasingly dependent upon reliable, quality software. Critical functions such as command load preparation, health and status monitoring, communications link scheduling and conflict resolution, and transparent gateway protocol conversion are routinely performed by software. Given budget constraints and the ever increasing capabilities of processor technology, the next generation of control centers and data systems will be even more dependent upon software across all aspects of performance. A key challenge now is to implement improved engineering, management, and assurance processes for the development and maintenance of that software; processes that cost less, yield higher quality products, and that self-correct for continual improvement evolution. The NASA Goddard Space Flight Center has a unique experience base that can be readily tapped to help solve the software challenge. Over the past eighteen years, the Software Engineering Laboratory within the code 500 Flight Dynamics Division has evolved a software development and maintenance methodology that accommodates the unique characteristics of an organization while optimizing and continually improving the organization's software capabilities. This methodology relies upon measurement, analysis, and feedback much analogous to that of control loop systems. It is an approach with a time-tested track record proven through repeated applications across a broad range of operational software development and maintenance projects. This paper describes the software improvement methodology employed by the Software Engineering Laboratory, and how it has been exploited within the Flight Dynamics Division with GSFC Code 500. Examples of specific improvement in the software itself and its processes are presented to illustrate the effectiveness of the methodology. Finally, the initial findings are given when this methodology was applied across the mission operations and ground data systems software domains throughout Code 500.

Combining High-Speed Cameras and Stop-Motion Animation Software to Support Students' Modeling of Human Body Movement

NASA Astrophysics Data System (ADS)

Lee, Victor R.

2015-04-01

Biomechanics, and specifically the biomechanics associated with human movement, is a potentially rich backdrop against which educators can design innovative science teaching and learning activities. Moreover, the use of technologies associated with biomechanics research, such as high-speed cameras that can produce high-quality slow-motion video, can be deployed in such a way to support students' participation in practices of scientific modeling. As participants in classroom design experiment, fifteen fifth-grade students worked with high-speed cameras and stop-motion animation software (SAM Animation) over several days to produce dynamic models of motion and body movement. The designed series of learning activities involved iterative cycles of animation creation and critique and use of various depictive materials. Subsequent analysis of flipbooks of human jumping movements created by the students at the beginning and end of the unit revealed a significant improvement in both the epistemic fidelity of students' representations. Excerpts from classroom observations highlight the role that the teacher plays in supporting students' thoughtful reflection of and attention to slow-motion video. In total, this design and research intervention demonstrates that the combination of technologies, activities, and teacher support can lead to improvements in some of the foundations associated with students' modeling.

Finite element for rotor/stator interactive forces in general engine dynamic simulation. Part 1: Development of bearing damper element

NASA Technical Reports Server (NTRS)

Adams, M. L.; Padovan, J.; Fertis, D. G.

1980-01-01

A general purpose squeeze-film damper interactive force element was developed, coded into a software package (module) and debugged. This software package was applied to nonliner dynamic analyses of some simple rotor systems. Results for pressure distributions show that the long bearing (end sealed) is a stronger bearing as compared to the short bearing as expected. Results of the nonlinear dynamic analysis, using a four degree of freedom simulation model, showed that the orbit of the rotating shaft increases nonlinearity to fill the bearing clearance as the unbalanced weight increases.

Pseudo-simple heteroclinic cycles in R4

NASA Astrophysics Data System (ADS)

Chossat, Pascal; Lohse, Alexander; Podvigina, Olga

2018-06-01

We study pseudo-simple heteroclinic cycles for a Γ-equivariant system in R4 with finite Γ ⊂ O(4) , and their nearby dynamics. In particular, in a first step towards a full classification - analogous to that which exists already for the class of simple cycles - we identify all finite subgroups of O(4) admitting pseudo-simple cycles. To this end we introduce a constructive method to build equivariant dynamical systems possessing a robust heteroclinic cycle. Extending a previous study we also investigate the existence of periodic orbits close to a pseudo-simple cycle, which depends on the symmetry groups of equilibria in the cycle. Moreover, we identify subgroups Γ ⊂ O(4) , Γ ⊄ SO(4) , admitting fragmentarily asymptotically stable pseudo-simple heteroclinic cycles. (It has been previously shown that for Γ ⊂ SO(4) pseudo-simple cycles generically are completely unstable.) Finally, we study a generalized heteroclinic cycle, which involves a pseudo-simple cycle as a subset.

Enhancement/upgrade of Engine Structures Technology Best Estimator (EST/BEST) Software System

NASA Technical Reports Server (NTRS)

Shah, Ashwin

2003-01-01

This report describes the work performed during the contract period and the capabilities included in the EST/BEST software system. The developed EST/BEST software system includes the integrated NESSUS, IPACS, COBSTRAN, and ALCCA computer codes required to perform the engine cycle mission and component structural analysis. Also, the interactive input generator for NESSUS, IPACS, and COBSTRAN computer codes have been developed and integrated with the EST/BEST software system. The input generator allows the user to create input from scratch as well as edit existing input files interactively. Since it has been integrated with the EST/BEST software system, it enables the user to modify EST/BEST generated files and perform the analysis to evaluate the benefits. Appendix A gives details of how to use the newly added features in the EST/BEST software system.

Solving the Software Legacy Problem with RISA

NASA Astrophysics Data System (ADS)

Ibarra, A.; Gabriel, C.

2012-09-01

Nowadays hardware and system infrastructure evolve on time scales much shorter than the typical duration of space astronomy missions. Data processing software capabilities have to evolve to preserve the scientific return during the entire experiment life time. Software preservation is a key issue that has to be tackled before the end of the project to keep the data usable over many years. We present RISA (Remote Interface to Science Analysis) as a solution to decouple data processing software and infrastructure life-cycles, using JAVA applications and web-services wrappers to existing software. This architecture employs embedded SAS in virtual machines assuring a homogeneous job execution environment. We will also present the first studies to reactivate the data processing software of the EXOSAT mission, the first ESA X-ray astronomy mission launched in 1983, using the generic RISA approach.

Overview of computational control research at UT Austin

NASA Technical Reports Server (NTRS)

Bong, Wie

1989-01-01

An overview of current research activities at UT Austin is presented to discuss certain technical issues in the following areas: (1) Computer-Aided Nonlinear Control Design: In this project, the describing function method is employed for the nonlinear control analysis and design of a flexible spacecraft equipped with pulse modulated reaction jets. INCA program has been enhanced to allow the numerical calculation of describing functions as well as the nonlinear limit cycle analysis capability in the frequency domain; (2) Robust Linear Quadratic Gaussian (LQG) Compensator Synthesis: Robust control design techniques and software tools are developed for flexible space structures with parameter uncertainty. In particular, an interactive, robust multivariable control design capability is being developed for INCA program; and (3) LQR-Based Autonomous Control System for the Space Station: In this project, real time implementation of LQR-based autonomous control system is investigated for the space station with time-varying inertias and with significant multibody dynamic interactions.

Dynamical analysis of the global business-cycle synchronization

PubMed Central

2018-01-01

This paper reports the dynamical analysis of the business cycles of 12 (developed and developing) countries over the last 56 years by applying computational techniques used for tackling complex systems. They reveal long-term convergence and country-level interconnections because of close contagion effects caused by bilateral networking exposure. Interconnectivity determines the magnitude of cross-border impacts. Local features and shock propagation complexity also may be true engines for local configuration of cycles. The algorithmic modeling proves to represent a solid approach to study the complex dynamics involved in the world economies. PMID:29408909

Endogenous Business Cycle Dynamics within Metzlers Inventory Model: Adding an Inventory Floor.

PubMed

Sushko, Irina; Wegener, Michael; Westerhoff, Frank; Zaklan, Georg

2009-04-01

Metzlers inventory model may produce dampened fluctuations in economic activity, thus contributing to our understanding of business cycle dynamics. For some parameter combinations, however, the model generates oscillations with increasing amplitude, implying that the inventory stock of firms eventually turns negative. Taking this observation into account, we reformulate Metzlers model by simply putting a floor to the inventory level. Within the new piecewise linear model, endogenous business cycle dynamics may now be triggered via a center bifurcation, i.e. for certain parameter combinations production changes are (quasi-)periodic.

Dynamical analysis of the global business-cycle synchronization.

PubMed

Lopes, António M; Tenreiro Machado, J A; Huffstot, John S; Mata, Maria Eugénia

2018-01-01

This paper reports the dynamical analysis of the business cycles of 12 (developed and developing) countries over the last 56 years by applying computational techniques used for tackling complex systems. They reveal long-term convergence and country-level interconnections because of close contagion effects caused by bilateral networking exposure. Interconnectivity determines the magnitude of cross-border impacts. Local features and shock propagation complexity also may be true engines for local configuration of cycles. The algorithmic modeling proves to represent a solid approach to study the complex dynamics involved in the world economies.

Information System Life-Cycle And Documentation Standards (SMAP DIDS)

NASA Technical Reports Server (NTRS)

1990-01-01

Although not computer program, SMAP DIDS written to provide systematic, NASA-wide structure for documenting information system development projects. Each DID (data item description) outlines document required for top-quality software development. When combined with management, assurance, and life cycle standards, Standards protect all parties who participate in design and operation of new information system.

Management plan documentation standard and Data Item Descriptions (DID). Volume of the information system life-cycle and documentation standards, volume 2

NASA Technical Reports Server (NTRS)

Callender, E. David; Steinbacher, Jody

1989-01-01

This is the second of five volumes of the Information System Life-Cycle and Documentation Standards. This volume provides a well-organized, easily used standard for management plans used in acquiring, assuring, and developing information systems and software, hardware, and operational procedures components, and related processes.

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Evaluating Managerial Styles for System Development Life Cycle Stages to Ensure Software Project Success

ERIC Educational Resources Information Center

Kocherla, Showry

2012-01-01

Information technology (IT) projects are considered successful if they are completed on time, within budget, and within scope. Even though, the required tools and methodologies are in place, IT projects continue to fail at a higher rate. Current literature lacks explanation for success within the stages of system development life-cycle (SDLC) such…

DDP - a tool for life-cycle risk management

NASA Technical Reports Server (NTRS)

Cornford, S. L.; Feather, M. S.; Hicks, K. A.

2001-01-01

At JPL we have developed, and implemented, a process for achieving life-cycle risk management. This process has been embodied in a software tool and is called Defect Detection and Prevention (DDP). The DDP process can be succinctly stated as: determine where we want to be, what could get in the way and how we will get there.

A Reference Model for Software and System Inspections. White Paper

NASA Technical Reports Server (NTRS)

He, Lulu; Shull, Forrest

2009-01-01

Software Quality Assurance (SQA) is an important component of the software development process. SQA processes provide assurance that the software products and processes in the project life cycle conform to their specified requirements by planning, enacting, and performing a set of activities to provide adequate confidence that quality is being built into the software. Typical techniques include: (1) Testing (2) Simulation (3) Model checking (4) Symbolic execution (5) Management reviews (6) Technical reviews (7) Inspections (8) Walk-throughs (9) Audits (10) Analysis (complexity analysis, control flow analysis, algorithmic analysis) (11) Formal method Our work over the last few years has resulted in substantial knowledge about SQA techniques, especially the areas of technical reviews and inspections. But can we apply the same QA techniques to the system development process? If yes, what kind of tailoring do we need before applying them in the system engineering context? If not, what types of QA techniques are actually used at system level? And, is there any room for improvement.) After a brief examination of the system engineering literature (especially focused on NASA and DoD guidance) we found that: (1) System and software development process interact with each other at different phases through development life cycle (2) Reviews are emphasized in both system and software development. (Figl.3). For some reviews (e.g. SRR, PDR, CDR), there are both system versions and software versions. (3) Analysis techniques are emphasized (e.g. Fault Tree Analysis, Preliminary Hazard Analysis) and some details are given about how to apply them. (4) Reviews are expected to use the outputs of the analysis techniques. In other words, these particular analyses are usually conducted in preparation for (before) reviews. The goal of our work is to explore the interaction between the Quality Assurance (QA) techniques at the system level and the software level.

Dynamics of Perceived Exertion in Constant-Power Cycling: Time- and Workload-Dependent Thresholds

ERIC Educational Resources Information Center

Balagué, Natàlia; Hristovski, Robert; García, Sergi; Aguirre, Cecilia; Vázquez, Pablo; Razon, Selen; Tenenbaum, Gershon

2015-01-01

Purpose: The purpose of this study was to test the dynamics of perceived exertion shifts (PES) as a function of time and workload during constant-power cycling. Method: Fifty-two participants assigned to 4 groups performed a cycling task at 4 different constant workloads corresponding to their individual rates of perceived exertion (RPEs = 13, 15,…

Cell cycle-regulated PLEIADE/AtMAP65-3 links membrane and microtubule dynamics during plant cytokinesis.

PubMed

Steiner, Alexander; Rybak, Katarzyna; Altmann, Melina; McFarlane, Heather E; Klaeger, Susan; Nguyen, Ngoc; Facher, Eva; Ivakov, Alexander; Wanner, Gerhard; Kuster, Bernhard; Persson, Staffan; Braun, Pascal; Hauser, Marie-Theres; Assaad, Farhah F

2016-11-01

Cytokinesis, the partitioning of the cytoplasm following nuclear division, requires extensive coordination between cell cycle cues, membrane trafficking and microtubule dynamics. Plant cytokinesis occurs within a transient membrane compartment known as the cell plate, to which vesicles are delivered by a plant-specific microtubule array, the phragmoplast. While membrane proteins required for cytokinesis are known, how these are coordinated with microtubule dynamics and regulated by cell cycle cues remains unclear. Here, we document physical and genetic interactions between Transport Protein Particle II (TRAPPII) tethering factors and microtubule-associated proteins of the PLEIADE/AtMAP65 family. These interactions do not specifically affect the recruitment of either TRAPPII or MAP65 proteins to the cell plate or midzone. Rather, and based on single versus double mutant phenotypes, it appears that they are required to coordinate cytokinesis with the nuclear division cycle. As MAP65 family members are known to be targets of cell cycle-regulated kinases, our results provide a conceptual framework for how membrane and microtubule dynamics may be coordinated with each other and with the nuclear cycle during plant cytokinesis. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Freeze-Thaw Durability of Air-Entrained Concrete

PubMed Central

Shang, Huai-Shuai; Yi, Ting-Hua

2013-01-01

One of the most damaging actions affecting concrete is the abrupt temperature change (freeze-thaw cycles). The types of deterioration of concrete structures by cyclic freeze-thaw can be largely classified into surface scaling (characterized by the weight loss) and internal crack growth (characterized by the loss of dynamic modulus of elasticity). The present study explored the durability of concrete made with air-entraining agent subjected to 0, 100, 200, 300, and 400 cycles of freeze-thaw. The experimental study of C20, C25, C30, C40, and C50 air-entrained concrete specimens was completed according to “the test method of long-term and durability on ordinary concrete” GB/T 50082-2009. The dynamic modulus of elasticity and weight loss of specimens were measured after different cycles of freeze-thaw. The influence of freeze-thaw cycles on the relative dynamic modulus of elasticity and weight loss was analyzed. The findings showed that the dynamic modulus of elasticity and weight decreased as the freeze-thaw cycles were repeated. They revealed that the C30, C40, and C50 air-entrained concrete was still durable after 300 cycles of freeze-thaw according to the experimental results. PMID:23576906

Freeze-thaw durability of air-entrained concrete.

PubMed

Shang, Huai-Shuai; Yi, Ting-Hua

2013-01-01

One of the most damaging actions affecting concrete is the abrupt temperature change (freeze-thaw cycles). The types of deterioration of concrete structures by cyclic freeze-thaw can be largely classified into surface scaling (characterized by the weight loss) and internal crack growth (characterized by the loss of dynamic modulus of elasticity). The present study explored the durability of concrete made with air-entraining agent subjected to 0, 100, 200, 300, and 400 cycles of freeze-thaw. The experimental study of C20, C25, C30, C40, and C50 air-entrained concrete specimens was completed according to "the test method of long-term and durability on ordinary concrete" GB/T 50082-2009. The dynamic modulus of elasticity and weight loss of specimens were measured after different cycles of freeze-thaw. The influence of freeze-thaw cycles on the relative dynamic modulus of elasticity and weight loss was analyzed. The findings showed that the dynamic modulus of elasticity and weight decreased as the freeze-thaw cycles were repeated. They revealed that the C30, C40, and C50 air-entrained concrete was still durable after 300 cycles of freeze-thaw according to the experimental results.

Dynamic optimization case studies in DYNOPT tool

NASA Astrophysics Data System (ADS)

Ozana, Stepan; Pies, Martin; Docekal, Tomas

2016-06-01

Dynamic programming is typically applied to optimization problems. As the analytical solutions are generally very difficult, chosen software tools are used widely. These software packages are often third-party products bound for standard simulation software tools on the market. As typical examples of such tools, TOMLAB and DYNOPT could be effectively applied for solution of problems of dynamic programming. DYNOPT will be presented in this paper due to its licensing policy (free product under GPL) and simplicity of use. DYNOPT is a set of MATLAB functions for determination of optimal control trajectory by given description of the process, the cost to be minimized, subject to equality and inequality constraints, using orthogonal collocation on finite elements method. The actual optimal control problem is solved by complete parameterization both the control and the state profile vector. It is assumed, that the optimized dynamic model may be described by a set of ordinary differential equations (ODEs) or differential-algebraic equations (DAEs). This collection of functions extends the capability of the MATLAB Optimization Tool-box. The paper will introduce use of DYNOPT in the field of dynamic optimization problems by means of case studies regarding chosen laboratory physical educational models.

Information systems analysis approach in hospitals: a national survey.

PubMed

Wong, B K; Sellaro, C L; Monaco, J A

1995-03-01

A survey of 216 hospitals reveals that some hospitals do not conduct cost-benefit analyses or analyze possible adverse effects in feasibility studies. In determining and analyzing system requirements, external factors that initiate the transaction are not examined, and computer-aided software engineering (CASE) tools are seldom used. Some hospitals do not investigate the advantages and disadvantages of using in-house-developed software versus purchased software packages in the evaluation of alternatives. The survey finds that, overall, most hospitals follow the traditional systems development life cycle (SDLC) approach in analyzing information systems.

3D graphics hardware accelerator programming methods for real-time visualization systems

NASA Astrophysics Data System (ADS)

Souetov, Andrew E.

2001-02-01

The paper deals with new approaches in software design for creating real-time applications that use modern graphics acceleration hardware. The growing complexity of such type of software compels programmers to use different types of CASE systems in design and development process. The subject under discussion is integration of such systems in a development process, their effective use, and the combination of these new methods with the necessity to produce optimal codes. A method of simulation integration and modeling tools in real-time software development cycle is described.

3D graphics hardware accelerator programming methods for real-time visualization systems

NASA Astrophysics Data System (ADS)

Souetov, Andrew E.

2000-02-01

The paper deals with new approaches in software design for creating real-time applications that use modern graphics acceleration hardware. The growing complexity of such type of software compels programmers to use different types of CASE systems in design and development process. The subject under discussion is integration of such systems in a development process, their effective use, and the combination of these new methods with the necessity to produce optimal codes. A method of simulation integration and modeling tools in real-time software development cycle is described.

Molecular Modeling, Docking, Dynamics and simulation of Gefitinib and its derivatives with EGFR in Non-Small Cell Lung Cancer.

PubMed

Reddy, Pulakuntla Swetha; Lokhande, Kiran Bharat; Nagar, Shuchi; Reddy, Vaddi Damodara; Murthy, P Sushma; Swamy, K Venkateswara

2018-02-27

Gefitinib (lressa) is the most prescribed drug, highly effective to treat of non-small cell lung cancer; primarily it was considered targeted therapy is a kinase inhibitor. The non-small cell lung cancer caused by the mutation in the Epithelial Growth Factor Receptor (EGFR) gene, Iressa works by blocking the EGFR protein that helps the cancer cell growth. EGFR protein has lead to the development of anticancer therapeutics directed against EGFR inhibitor including Gefitinib for non-small cell lung cancer. To explore research on Gefitinib and its derivatives interaction with crystal structure EGFR to understand the better molecular insights interaction strategies. Molecular modeling of ligands (Gefitinib and its derivatives) was carried out by Avogadro software till atomic angle stable confirmation obtained. The partial charges for the ligands were assigned as per standard protocol for molecular docking. All docking simulations were performed with AutoDockVina. Virtual screening carried out based on binding energy and hydrogen bonding affinity. Molecular dynamics (MD) and Simulation EGFR was done using GROMACS 5.1.1 software to explore the interaction stability in a cell. The stable conformation for EGFR protein trajectories were captured at various time intervals 0-20ns. Few compounds screen based on high affinity as the inhibitor for EGFR may inhibit the cell cycle signalling in non-small cell lung cancer. These result suggested that a computer aided screening approach of a Gefitinib derivatives compounds with regard to their binding to EGFR for identifying novel drugs for the treatment of non-small cell lung cancer. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Dynamic assertion testing of flight control software

NASA Technical Reports Server (NTRS)

Andrews, D. M.; Mahmood, A.; Mccluskey, E. J.

1985-01-01

An experiment in using assertions to dynamically test fault tolerant flight software is described. The experiment showed that 87% of typical errors introduced into the program would be detected by assertions. Detailed analysis of the test data showed that the number of assertions needed to detect those errors could be reduced to a minimal set. The analysis also revealed that the most effective assertions tested program parameters that provided greater indirect (collateral) testing of other parameters.

Software package for modeling spin-orbit motion in storage rings

NASA Astrophysics Data System (ADS)

Zyuzin, D. V.

2015-12-01

A software package providing a graphical user interface for computer experiments on the motion of charged particle beams in accelerators, as well as analysis of obtained data, is presented. The software package was tested in the framework of the international project on electric dipole moment measurement JEDI (Jülich Electric Dipole moment Investigations). The specific features of particle spin motion imply the requirement to use a cyclic accelerator (storage ring) consisting of electrostatic elements, which makes it possible to preserve horizontal polarization for a long time. Computer experiments study the dynamics of 106-109 particles in a beam during 109 turns in an accelerator (about 1012-1015 integration steps for the equations of motion). For designing an optimal accelerator structure, a large number of computer experiments on polarized beam dynamics are required. The numerical core of the package is COSY Infinity, a program for modeling spin-orbit dynamics.

Crystal MD: The massively parallel molecular dynamics software for metal with BCC structure

NASA Astrophysics Data System (ADS)

Hu, Changjun; Bai, He; He, Xinfu; Zhang, Boyao; Nie, Ningming; Wang, Xianmeng; Ren, Yingwen

2017-02-01

Material irradiation effect is one of the most important keys to use nuclear power. However, the lack of high-throughput irradiation facility and knowledge of evolution process, lead to little understanding of the addressed issues. With the help of high-performance computing, we could make a further understanding of micro-level-material. In this paper, a new data structure is proposed for the massively parallel simulation of the evolution of metal materials under irradiation environment. Based on the proposed data structure, we developed the new molecular dynamics software named Crystal MD. The simulation with Crystal MD achieved over 90% parallel efficiency in test cases, and it takes more than 25% less memory on multi-core clusters than LAMMPS and IMD, which are two popular molecular dynamics simulation software. Using Crystal MD, a two trillion particles simulation has been performed on Tianhe-2 cluster.

Tools for 3D scientific visualization in computational aerodynamics at NASA Ames Research Center

NASA Technical Reports Server (NTRS)

Bancroft, Gordon; Plessel, Todd; Merritt, Fergus; Watson, Val

1989-01-01

Hardware, software, and techniques used by the Fluid Dynamics Division (NASA) for performing visualization of computational aerodynamics, which can be applied to the visualization of flow fields from computer simulations of fluid dynamics about the Space Shuttle, are discussed. Three visualization techniques applied, post-processing, tracking, and steering, are described, as well as the post-processing software packages used, PLOT3D, SURF (Surface Modeller), GAS (Graphical Animation System), and FAST (Flow Analysis software Toolkit). Using post-processing methods a flow simulation was executed on a supercomputer and, after the simulation was complete, the results were processed for viewing. It is shown that the high-resolution, high-performance three-dimensional workstation combined with specially developed display and animation software provides a good tool for analyzing flow field solutions obtained from supercomputers.

PB-AM: An open-source, fully analytical linear poisson-boltzmann solver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Felberg, Lisa E.; Brookes, David H.; Yap, Eng-Hui

2016-11-02

We present the open source distributed software package Poisson-Boltzmann Analytical Method (PB-AM), a fully analytical solution to the linearized Poisson Boltzmann equation. The PB-AM software package includes the generation of outputs files appropriate for visualization using VMD, a Brownian dynamics scheme that uses periodic boundary conditions to simulate dynamics, the ability to specify docking criteria, and offers two different kinetics schemes to evaluate biomolecular association rate constants. Given that PB-AM defines mutual polarization completely and accurately, it can be refactored as a many-body expansion to explore 2- and 3-body polarization. Additionally, the software has been integrated into the Adaptive Poisson-Boltzmannmore » Solver (APBS) software package to make it more accessible to a larger group of scientists, educators and students that are more familiar with the APBS framework.« less

Theoretical and software considerations for general dynamic analysis using multilevel substructured models

NASA Technical Reports Server (NTRS)

Schmidt, R. J.; Dodds, R. H., Jr.

1985-01-01

The dynamic analysis of complex structural systems using the finite element method and multilevel substructured models is presented. The fixed-interface method is selected for substructure reduction because of its efficiency, accuracy, and adaptability to restart and reanalysis. This method is extended to reduction of substructures which are themselves composed of reduced substructures. The implementation and performance of the method in a general purpose software system is emphasized. Solution algorithms consistent with the chosen data structures are presented. It is demonstrated that successful finite element software requires the use of software executives to supplement the algorithmic language. The complexity of the implementation of restart and reanalysis porcedures illustrates the need for executive systems to support the noncomputational aspects of the software. It is shown that significant computational efficiencies can be achieved through proper use of substructuring and reduction technbiques without sacrificing solution accuracy. The restart and reanalysis capabilities and the flexible procedures for multilevel substructured modeling gives economical yet accurate analyses of complex structural systems.

Solar Activity Across the Scales: From Small-Scale Quiet-Sun Dynamics to Magnetic Activity Cycles

NASA Technical Reports Server (NTRS)

Kitiashvili, Irina N.; Collins, Nancy N.; Kosovichev, Alexander G.; Mansour, Nagi N.; Wray, Alan A.

2017-01-01

Observations as well as numerical and theoretical models show that solar dynamics is characterized by complicated interactions and energy exchanges among different temporal and spatial scales. It reveals magnetic self-organization processes from the smallest scale magnetized vortex tubes to the global activity variation known as the solar cycle. To understand these multiscale processes and their relationships, we use a two-fold approach: 1) realistic 3D radiative MHD simulations of local dynamics together with high resolution observations by IRIS, Hinode, and SDO; and 2) modeling of solar activity cycles by using simplified MHD dynamo models and mathematical data assimilation techniques. We present recent results of this approach, including the interpretation of observational results from NASA heliophysics missions and predictive capabilities. In particular, we discuss the links between small-scale dynamo processes in the convection zone and atmospheric dynamics, as well as an early prediction of Solar Cycle 25.

Solar activity across the scales: from small-scale quiet-Sun dynamics to magnetic activity cycles

NASA Astrophysics Data System (ADS)

Kitiashvili, I.; Collins, N.; Kosovichev, A. G.; Mansour, N. N.; Wray, A. A.

2017-12-01

Observations as well as numerical and theoretical models show that solar dynamics is characterized by complicated interactions and energy exchanges among different temporal and spatial scales. It reveals magnetic self-organization processes from the smallest scale magnetized vortex tubes to the global activity variation known as the solar cycle. To understand these multiscale processes and their relationships, we use a two-fold approach: 1) realistic 3D radiative MHD simulations of local dynamics together with high-resolution observations by IRIS, Hinode, and SDO; and 2) modeling of solar activity cycles by using simplified MHD dynamo models and mathematical data assimilation techniques. We present recent results of this approach, including the interpretation of observational results from NASA heliophysics missions and predictive capabilities. In particular, we discuss the links between small-scale dynamo processes in the convection zone and atmospheric dynamics, as well as an early prediction of Solar Cycle 25.

Application of industry-standard guidelines for the validation of avionics software

NASA Technical Reports Server (NTRS)

Hayhurst, Kelly J.; Shagnea, Anita M.

1990-01-01

The application of industry standards to the development of avionics software is discussed, focusing on verification and validation activities. It is pointed out that the procedures that guide the avionics software development and testing process are under increased scrutiny. The DO-178A guidelines, Software Considerations in Airborne Systems and Equipment Certification, are used by the FAA for certifying avionics software. To investigate the effectiveness of the DO-178A guidelines for improving the quality of avionics software, guidance and control software (GCS) is being developed according to the DO-178A development method. It is noted that, due to the extent of the data collection and configuration management procedures, any phase in the life cycle of a GCS implementation can be reconstructed. Hence, a fundamental development and testing platform has been established that is suitable for investigating the adequacy of various software development processes. In particular, the overall effectiveness and efficiency of the development method recommended by the DO-178A guidelines are being closely examined.

FAST Simulation Tool Containing Methods for Predicting the Dynamic Response of Wind Turbines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jonkman, Jason

2015-08-12

FAST is a simulation tool (computer software) for modeling tlie dynamic response of horizontal-axis wind turbines. FAST employs a combined modal and multibody structural-dynamics formulation in the time domain.

Data collection procedures for the Software Engineering Laboratory (SEL) database

NASA Technical Reports Server (NTRS)

Heller, Gerard; Valett, Jon; Wild, Mary

1992-01-01

This document is a guidebook to collecting software engineering data on software development and maintenance efforts, as practiced in the Software Engineering Laboratory (SEL). It supersedes the document entitled Data Collection Procedures for the Rehosted SEL Database, number SEL-87-008 in the SEL series, which was published in October 1987. It presents procedures to be followed on software development and maintenance projects in the Flight Dynamics Division (FDD) of Goddard Space Flight Center (GSFC) for collecting data in support of SEL software engineering research activities. These procedures include detailed instructions for the completion and submission of SEL data collection forms.

Software Management Environment (SME): Components and algorithms

NASA Technical Reports Server (NTRS)

Hendrick, Robert; Kistler, David; Valett, Jon

1994-01-01

This document presents the components and algorithms of the Software Management Environment (SME), a management tool developed for the Software Engineering Branch (Code 552) of the Flight Dynamics Division (FDD) of the Goddard Space Flight Center (GSFC). The SME provides an integrated set of visually oriented experienced-based tools that can assist software development managers in managing and planning software development projects. This document describes and illustrates the analysis functions that underlie the SME's project monitoring, estimation, and planning tools. 'SME Components and Algorithms' is a companion reference to 'SME Concepts and Architecture' and 'Software Engineering Laboratory (SEL) Relationships, Models, and Management Rules.'

Software Management Environment (SME) installation guide

NASA Technical Reports Server (NTRS)

Kistler, David; Jeletic, Kellyann

1992-01-01

This document contains installation information for the Software Management Environment (SME), developed for the Systems Development Branch (Code 552) of the Flight Dynamics Division of Goddard Space Flight Center (GSFC). The SME provides an integrated set of management tools that can be used by software development managers in their day-to-day management and planning activities. This document provides a list of hardware and software requirements as well as detailed installation instructions and trouble-shooting information.

Importance of Requirements Analysis & Traceability to Improve Software Quality and Reduce Cost and Risk

NASA Technical Reports Server (NTRS)

Kapoor, Manju M.; Mehta, Manju

2010-01-01

The goal of this paper is to emphasize the importance of developing complete and unambiguous requirements early in the project cycle (prior to Preliminary Design Phase). Having a complete set of requirements early in the project cycle allows sufficient time to generate a traceability matrix. Requirements traceability and analysis are the key elements in improving verification and validation process, and thus overall software quality. Traceability can be most beneficial when the system changes. If changes are made to high-level requirements it implies that low-level requirements need to be modified. Traceability ensures that requirements are appropriately and efficiently verified at various levels whereas analysis ensures that a rightly interpreted set of requirements is produced.

Systems Dynamic Modeling of the Stomatal Guard Cell Predicts Emergent Behaviors in Transport, Signaling, and Volume Control1[W][OA

PubMed Central

Chen, Zhong-Hua; Hills, Adrian; Bätz, Ulrike; Amtmann, Anna; Lew, Virgilio L.; Blatt, Michael R.

2012-01-01

The dynamics of stomatal movements and their consequences for photosynthesis and transpirational water loss have long been incorporated into mathematical models, but none have been developed from the bottom up that are widely applicable in predicting stomatal behavior at a cellular level. We previously established a systems dynamic model incorporating explicitly the wealth of biophysical and kinetic knowledge available for guard cell transport, signaling, and homeostasis. Here we describe the behavior of the model in response to experimentally documented changes in primary pump activities and malate (Mal) synthesis imposed over a diurnal cycle. We show that the model successfully recapitulates the cyclic variations in H+, K+, Cl−, and Mal concentrations in the cytosol and vacuole known for guard cells. It also yields a number of unexpected and counterintuitive outputs. Among these, we report a diurnal elevation in cytosolic-free Ca2+ concentration and an exchange of vacuolar Cl− with Mal, both of which find substantiation in the literature but had previously been suggested to require additional and complex levels of regulation. These findings highlight the true predictive power of the OnGuard model in providing a framework for systems analysis of stomatal guard cells, and they demonstrate the utility of the OnGuard software and HoTSig library in exploring fundamental problems in cellular physiology and homeostasis. PMID:22635112

An Adaptive INS-Aided PLL Tracking Method for GNSS Receivers in Harsh Environments.

PubMed

Cong, Li; Li, Xin; Jin, Tian; Yue, Song; Xue, Rui

2016-01-23

As the weak link in global navigation satellite system (GNSS) signal processing, the phase-locked loop (PLL) is easily influenced with frequent cycle slips and loss of lock as a result of higher vehicle dynamics and lower signal-to-noise ratios. With inertial navigation system (INS) aid, PLLs' tracking performance can be improved. However, for harsh environments with high dynamics and signal attenuation, the traditional INS-aided PLL with fixed loop parameters has some limitations to improve the tracking adaptability. In this paper, an adaptive INS-aided PLL capable of adjusting its noise bandwidth and coherent integration time has been proposed. Through theoretical analysis, the relation between INS-aided PLL phase tracking error and carrier to noise density ratio (C/N₀), vehicle dynamics, aiding information update time, noise bandwidth, and coherent integration time has been built. The relation formulae are used to choose the optimal integration time and bandwidth for a given application under the minimum tracking error criterion. Software and hardware simulation results verify the correctness of the theoretical analysis, and demonstrate that the adaptive tracking method can effectively improve the PLL tracking ability and integrated GNSS/INS navigation performance. For harsh environments, the tracking sensitivity is increased by 3 to 5 dB, velocity errors are decreased by 36% to 50% and position errors are decreased by 6% to 24% when compared with other INS-aided PLL methods.

An open source solution for an in-house built dynamic platform for the validation of stereotactic ablative body radiotherapy for VMAT and IMRT.

PubMed

Munoz, Luis; Ziebell, Amy; Morton, Jason; Bhat, Madhava

2016-12-01

An in-house solution for the verification of dose delivered to a moving phantom as required for the clinical implementation of lung stereotactic ablative body radiation therapy was developed. The superior-inferior movement required to simulate tumour motion during a normal breathing cycle was achieved via the novel use of an Arduino Uno™, a low-cost open-source microcontroller board connected to a high torque servo motor. Slow CT imaging was used to acquire the image set and a 4D cone beam CT (4D-CBCT) verified the efficacy of contoured margins before treatment on the moving phantom. Treatment fields were delivered to a section of a CIRS™ anthropomorphic phantom. Dose verification to the dynamic phantom with Gafchromic EBT3 film using 3 %-1 mm gamma analysis acceptance criteria registered an absolute dose pass rate for IMRT and VMAT of 98 and 96.6 %, respectively. It was verified that 100 % of the PTV received the prescribed dose of 12 Gy per fraction using the dynamic phantom, and no major discrepancy between planned and measured results due to interplay between multileaf collimator sequences and target motion was observed. This study confirmed that the use of an in-house solution using open source hardware and software with existing quality assurance equipment was appropriate in validating a new treatment technique.

Generic process design and control strategies used to develop a dynamic model and training software for an IGCC plant with CO2 sequestration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Provost, G.; Stone, H.; McClintock, M.

2008-01-01

To meet the growing demand for education and experience with the analysis, operation, and control of commercial-scale Integrated Gasification Combined Cycle (IGCC) plants, the Department of Energy’s (DOE) National Energy Technology Laboratory (NETL) is leading a collaborative R&D project with participants from government, academia, and industry. One of the goals of this project is to develop a generic, full-scope, real-time generic IGCC dynamic plant simulator for use in establishing a world-class research and training center, as well as to promote and demonstrate the technology to power industry personnel. The NETL IGCC dynamic plant simulator will combine for the first timemore » a process/gasification simulator and a power/combined-cycle simulator together in a single dynamic simulation framework for use in training applications as well as engineering studies. As envisioned, the simulator will have the following features and capabilities: A high-fidelity, real-time, dynamic model of process-side (gasification and gas cleaning with CO2 capture) and power-block-side (combined cycle) for a generic IGCC plant fueled by coal and/or petroleum coke Full-scope training simulator capabilities including startup, shutdown, load following and shedding, response to fuel and ambient condition variations, control strategy analysis (turbine vs. gasifier lead, etc.), representative malfunctions/trips, alarms, scenarios, trending, snapshots, data historian, and trainee performance monitoring The ability to enhance and modify the plant model to facilitate studies of changes in plant configuration and equipment and to support future R&D efforts To support this effort, process descriptions and control strategies were developed for key sections of the plant as part of the detailed functional specification, which will form the basis of the simulator development. These plant sections include: Slurry Preparation Air Separation Unit Gasifiers Syngas Scrubbers Shift Reactors Gas Cooling, Medium Pressure (MP) and Low Pressure (LP) Steam Generation, and Knockout Sour Water Stripper Mercury Removal Selexol™ Acid Gas Removal System CO2 Compression Syngas Reheat and Expansion Claus Plant Hydrogenation Reactor and Gas Cooler Combustion Turbine (CT)-Generator Assemblies Heat Recovery Steam Generators (HRSGs) and Steam Turbine (ST)-Generator In this paper, process descriptions, control strategies, and Process & Instrumentation Diagram (P&ID) drawings for key sections of the generic IGCC plant are presented, along with discussions of some of the operating procedures and representative faults that the simulator will cover. Some of the intended future applications for the simulator are discussed, including plant operation and control demonstrations as well as education and training services such as IGCC familiarization courses.« less

Influence of the respiratory cycle structure on the flow field in human nasal cavity at a fixed level of breath depth

NASA Astrophysics Data System (ADS)

Bosykh, L. Yu.; Ganimedov, V. L.; Muchnaya, M. I.; Sadovskii, A. S.

2016-10-01

The evolution of air flow field in the human nasal cavity has studied during the respiratory cycle. Real tomographic scans of the adult without abnormalities in the upper airway have been used to construct the geometric model. Quiet breathing mode is selected: the duration of the respiratory cycle is 4.3 sec and the depth of breathing is 600 ml, which provides pulmonary ventilation at 8.4 liters of air per minute. The system of Navier - Stokes equations was used to describe the flow. Laminar flow regime was postulated. The Lagrange approach was used for calculation of submicron particles motion. The numerical solution was built on the basis of gas-dynamic solver FLUENT of software package ANSYS 12. Calculations were made for two cases in which the same value of the integral characteristic (the depth of breathing) was reached, but which had different kind of boundary conditions on the exit. In the first case, the velocity was assumed symmetrical with respect to inhalation - exhalation and was approximated by sinusoid. In the second case, the velocity as a function of time is determined by processing of the real person spirogram. For the both variants the flow fields were obtained and compared. Analysis of the results showed that in non-stationary case the use of symmetric boundary condition leads to an underestimation of respiratory effort for the implementation of the required depth of breathing. In cyclic flow the flow fields in acceleration and deceleration phases are, basically, the same as in the corresponding steady flow. At the same time taking into account of non-symmetry of respiratory cycle influences on deposition pattern of particles significantly.

Model evaluation using a community benchmarking system for land surface models

NASA Astrophysics Data System (ADS)

Mu, M.; Hoffman, F. M.; Lawrence, D. M.; Riley, W. J.; Keppel-Aleks, G.; Kluzek, E. B.; Koven, C. D.; Randerson, J. T.

2014-12-01

Evaluation of atmosphere, ocean, sea ice, and land surface models is an important step in identifying deficiencies in Earth system models and developing improved estimates of future change. For the land surface and carbon cycle, the design of an open-source system has been an important objective of the International Land Model Benchmarking (ILAMB) project. Here we evaluated CMIP5 and CLM models using a benchmarking system that enables users to specify models, data sets, and scoring systems so that results can be tailored to specific model intercomparison projects. Our scoring system used information from four different aspects of global datasets, including climatological mean spatial patterns, seasonal cycle dynamics, interannual variability, and long-term trends. Variable-to-variable comparisons enable investigation of the mechanistic underpinnings of model behavior, and allow for some control of biases in model drivers. Graphics modules allow users to evaluate model performance at local, regional, and global scales. Use of modular structures makes it relatively easy for users to add new variables, diagnostic metrics, benchmarking datasets, or model simulations. Diagnostic results are automatically organized into HTML files, so users can conveniently share results with colleagues. We used this system to evaluate atmospheric carbon dioxide, burned area, global biomass and soil carbon stocks, net ecosystem exchange, gross primary production, ecosystem respiration, terrestrial water storage, evapotranspiration, and surface radiation from CMIP5 historical and ESM historical simulations. We found that the multi-model mean often performed better than many of the individual models for most variables. We plan to publicly release a stable version of the software during fall of 2014 that has land surface, carbon cycle, hydrology, radiation and energy cycle components.

Mitochondrial dynamics and the cell cycle

USDA-ARS?s Scientific Manuscript database

Nuclear-mitochondrial (NM) communication impacts many aspects of plant development including vigor, sterility and viability. Dynamic changes in mitochondrial number, shape, size, and cellular location takes place during the cell cycle possibly impacting the process itself and leading to distribution...

Techniques for Developing an Acquisition Strategy by Profiling Software Risks

DTIC Science & Technology

2006-08-01

Drivers...................................................................................... 13 Figure 8: BMW 745Li Software... BMW 745Li, shown in Figure 8, is a good illustration of the increasing software control of hardware systems in automobiles. Among the many features...roll stabilization, dynamic brake con- trol, coded drive-away protection, an adaptive automatic transmission, and iDrive systems. This list can be

Coevolution can reverse predator–prey cycles

PubMed Central

Cortez, Michael H.; Weitz, Joshua S.

2014-01-01

A hallmark of Lotka–Volterra models, and other ecological models of predator–prey interactions, is that in predator–prey cycles, peaks in prey abundance precede peaks in predator abundance. Such models typically assume that species life history traits are fixed over ecologically relevant time scales. However, the coevolution of predator and prey traits has been shown to alter the community dynamics of natural systems, leading to novel dynamics including antiphase and cryptic cycles. Here, using an eco-coevolutionary model, we show that predator–prey coevolution can also drive population cycles where the opposite of canonical Lotka–Volterra oscillations occurs: predator peaks precede prey peaks. These reversed cycles arise when selection favors extreme phenotypes, predator offense is costly, and prey defense is effective against low-offense predators. We present multiple datasets from phage–cholera, mink–muskrat, and gyrfalcon–rock ptarmigan systems that exhibit reversed-peak ordering. Our results suggest that such cycles are a potential signature of predator–prey coevolution and reveal unique ways in which predator–prey coevolution can shape, and possibly reverse, community dynamics. PMID:24799689

Coevolution can reverse predator-prey cycles.

PubMed

Cortez, Michael H; Weitz, Joshua S

2014-05-20

A hallmark of Lotka-Volterra models, and other ecological models of predator-prey interactions, is that in predator-prey cycles, peaks in prey abundance precede peaks in predator abundance. Such models typically assume that species life history traits are fixed over ecologically relevant time scales. However, the coevolution of predator and prey traits has been shown to alter the community dynamics of natural systems, leading to novel dynamics including antiphase and cryptic cycles. Here, using an eco-coevolutionary model, we show that predator-prey coevolution can also drive population cycles where the opposite of canonical Lotka-Volterra oscillations occurs: predator peaks precede prey peaks. These reversed cycles arise when selection favors extreme phenotypes, predator offense is costly, and prey defense is effective against low-offense predators. We present multiple datasets from phage-cholera, mink-muskrat, and gyrfalcon-rock ptarmigan systems that exhibit reversed-peak ordering. Our results suggest that such cycles are a potential signature of predator-prey coevolution and reveal unique ways in which predator-prey coevolution can shape, and possibly reverse, community dynamics.

Air Force Space Command. Space and Missile Systems Center Standard. Configuration Management

DTIC Science & Technology

2008-06-13

Aerospace Corporation report number TOR-2006( 8583 )-1. 3. Beneficial comments (recommendations, additions, deletions) and any pertinent data that...Engineering Drawing Practices IEEE STD 610.12 Glossary of Software Engineering Terminology, September 28,1990 ISO /IEC 12207 Software Life...item, regardless of media, formally designated and fixed at a specific time during the configuration item’s life cycle. (Source: ISO /IEC 12207

Product Definition Data Interface (PDDI) Product Specification

DTIC Science & Technology

1991-07-01

syntax of the language gives a precise specification of the data without interpretation of it. M - Constituent Read Block. CSECT - Control Section, the...to conform to the PDDI Access Software’s internal data representation so that it may be further processed. JCL - Job Control Language - IBM language...software development and life cycle * phases. OUALITY CONTROL - The planned and systematic application of all actions (management/technical) necessary to

Please Reduce Cycle Time

DTIC Science & Technology

2014-12-01

observed an ERP system implementation that encountered this exact model. The modified COTS software worked and passed the acceptance tests but never... software -intensive program. We decided to create a very detailed master sched- ule with multiple supporting subschedules that linked and Implementing ...processes in place as part of the COTS implementation . For hardware , COTS can also present some risks. Many pro- grams use COTS computers and servers

Process Improvement Should Link to Security: SEPG 2007 Security Track Recap

DTIC Science & Technology

2007-09-01

the Systems Security Engineering Capability Maturity Model (SSE- CMM / ISO 21827) and its use in system software developments ...software development life cycle ( SDLC )? 6. In what ways should process improvement support security in the SDLC ? 1.2 10BPANEL RESOURCES For each... project management, and support practices through the use of the capability maturity models including the CMMI and the Systems Security

Independent backup mode transfer and mechanism for digital control computers

NASA Technical Reports Server (NTRS)

Tulpule, Bhalchandra R. (Inventor); Oscarson, Edward M. (Inventor)

1992-01-01

An interrupt is provided to a signal processor having a non-maskable interrupt input, in response to the detection of a request for transfer to backup software. The signal processor provides a transfer signal to a transfer mechanism only after completion of the present machine cycle. Transfer to the backup software is initiated by the transfer mechanism only upon reception of the transfer signal.

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

An OpenStudio Measure is a script that can manipulate an OpenStudio model and associated data to apply energy conservation measures (ECMs), run supplemental simulations, or visualize simulation results. The OpenStudio software development kit (SDK) and accessibility of the Ruby scripting language makes measure authorship accessible to both software developers and energy modelers. This paper discusses the life cycle of an OpenStudio Measure from development, testing, and distribution, to application.

Integrated testing and verification system for research flight software design document

NASA Technical Reports Server (NTRS)

Taylor, R. N.; Merilatt, R. L.; Osterweil, L. J.

1979-01-01

The NASA Langley Research Center is developing the MUST (Multipurpose User-oriented Software Technology) program to cut the cost of producing research flight software through a system of software support tools. The HAL/S language is the primary subject of the design. Boeing Computer Services Company (BCS) has designed an integrated verification and testing capability as part of MUST. Documentation, verification and test options are provided with special attention on real time, multiprocessing issues. The needs of the entire software production cycle have been considered, with effective management and reduced lifecycle costs as foremost goals. Capabilities have been included in the design for static detection of data flow anomalies involving communicating concurrent processes. Some types of ill formed process synchronization and deadlock also are detected statically.

Software life cycle methodologies and environments

NASA Technical Reports Server (NTRS)

Fridge, Ernest

1991-01-01

Products of this project will significantly improve the quality and productivity of Space Station Freedom Program software processes by: improving software reliability and safety; and broadening the range of problems that can be solved with computational solutions. Projects brings in Computer Aided Software Engineering (CASE) technology for: Environments such as Engineering Script Language/Parts Composition System (ESL/PCS) application generator, Intelligent User Interface for cost avoidance in setting up operational computer runs, Framework programmable platform for defining process and software development work flow control, Process for bringing CASE technology into an organization's culture, and CLIPS/CLIPS Ada language for developing expert systems; and methodologies such as Method for developing fault tolerant, distributed systems and a method for developing systems for common sense reasoning and for solving expert systems problems when only approximate truths are known.

Knowledge-Based Aircraft Automation: Managers Guide on the use of Artificial Intelligence for Aircraft Automation and Verification and Validation Approach for a Neural-Based Flight Controller

NASA Technical Reports Server (NTRS)

Broderick, Ron

1997-01-01

The ultimate goal of this report was to integrate the powerful tools of artificial intelligence into the traditional process of software development. To maintain the US aerospace competitive advantage, traditional aerospace and software engineers need to more easily incorporate the technology of artificial intelligence into the advanced aerospace systems being designed today. The future goal was to transition artificial intelligence from an emerging technology to a standard technology that is considered early in the life cycle process to develop state-of-the-art aircraft automation systems. This report addressed the future goal in two ways. First, it provided a matrix that identified typical aircraft automation applications conducive to various artificial intelligence methods. The purpose of this matrix was to provide top-level guidance to managers contemplating the possible use of artificial intelligence in the development of aircraft automation. Second, the report provided a methodology to formally evaluate neural networks as part of the traditional process of software development. The matrix was developed by organizing the discipline of artificial intelligence into the following six methods: logical, object representation-based, distributed, uncertainty management, temporal and neurocomputing. Next, a study of existing aircraft automation applications that have been conducive to artificial intelligence implementation resulted in the following five categories: pilot-vehicle interface, system status and diagnosis, situation assessment, automatic flight planning, and aircraft flight control. The resulting matrix provided management guidance to understand artificial intelligence as it applied to aircraft automation. The approach taken to develop a methodology to formally evaluate neural networks as part of the software engineering life cycle was to start with the existing software quality assurance standards and to change these standards to include neural network development. The changes were to include evaluation tools that can be applied to neural networks at each phase of the software engineering life cycle. The result was a formal evaluation approach to increase the product quality of systems that use neural networks for their implementation.

An Evaluation of the Applicability of Damage Tolerance to Dynamic Systems

NASA Technical Reports Server (NTRS)

Forth, Scott C.; Le, Dy; Turnberg, Jay

2005-01-01

The Federal Aviation Administration, the National Aeronautics and Space Administration and the aircraft industry have teamed together to develop methods and guidance for the safe life-cycle management of dynamic systems. Based on the success of the United States Air Force damage tolerance initiative for airframe structure, a crack growth based damage tolerance approach is being examined for implementation into the design and management of dynamic systems. However, dynamic systems accumulate millions of vibratory cycles per flight hour, more than 12,000 times faster than an airframe system. If a detectable crack develops in a dynamic system, the time to failure is extremely short, less than 100 flight hours in most cases, leaving little room for error in the material characterization, life cycle analysis, nondestructive inspection and maintenance processes. In this paper, the authors review the damage tolerant design process focusing on uncertainties that affect dynamic systems and evaluate the applicability of damage tolerance on dynamic systems.

A digital flight control system verification laboratory

NASA Technical Reports Server (NTRS)

De Feo, P.; Saib, S.

1982-01-01

A NASA/FAA program has been established for the verification and validation of digital flight control systems (DFCS), with the primary objective being the development and analysis of automated verification tools. In order to enhance the capabilities, effectiveness, and ease of using the test environment, software verification tools can be applied. Tool design includes a static analyzer, an assertion generator, a symbolic executor, a dynamic analysis instrument, and an automated documentation generator. Static and dynamic tools are integrated with error detection capabilities, resulting in a facility which analyzes a representative testbed of DFCS software. Future investigations will ensue particularly in the areas of increase in the number of software test tools, and a cost effectiveness assessment.

Reducing Design Cycle Time and Cost Through Process Resequencing

NASA Technical Reports Server (NTRS)

Rogers, James L.

2004-01-01

In today's competitive environment, companies are under enormous pressure to reduce the time and cost of their design cycle. One method for reducing both time and cost is to develop an understanding of the flow of the design processes and the effects of the iterative subcycles that are found in complex design projects. Once these aspects are understood, the design manager can make decisions that take advantage of decomposition, concurrent engineering, and parallel processing techniques to reduce the total time and the total cost of the design cycle. One software tool that can aid in this decision-making process is the Design Manager's Aid for Intelligent Decomposition (DeMAID). The DeMAID software minimizes the feedback couplings that create iterative subcycles, groups processes into iterative subcycles, and decomposes the subcycles into a hierarchical structure. The real benefits of producing the best design in the least time and at a minimum cost are obtained from sequencing the processes in the subcycles.

The Australian Computational Earth Systems Simulator

NASA Astrophysics Data System (ADS)

Mora, P.; Muhlhaus, H.; Lister, G.; Dyskin, A.; Place, D.; Appelbe, B.; Nimmervoll, N.; Abramson, D.

2001-12-01

Numerical simulation of the physics and dynamics of the entire earth system offers an outstanding opportunity for advancing earth system science and technology but represents a major challenge due to the range of scales and physical processes involved, as well as the magnitude of the software engineering effort required. However, new simulation and computer technologies are bringing this objective within reach. Under a special competitive national funding scheme to establish new Major National Research Facilities (MNRF), the Australian government together with a consortium of Universities and research institutions have funded construction of the Australian Computational Earth Systems Simulator (ACcESS). The Simulator or computational virtual earth will provide the research infrastructure to the Australian earth systems science community required for simulations of dynamical earth processes at scales ranging from microscopic to global. It will consist of thematic supercomputer infrastructure and an earth systems simulation software system. The Simulator models and software will be constructed over a five year period by a multi-disciplinary team of computational scientists, mathematicians, earth scientists, civil engineers and software engineers. The construction team will integrate numerical simulation models (3D discrete elements/lattice solid model, particle-in-cell large deformation finite-element method, stress reconstruction models, multi-scale continuum models etc) with geophysical, geological and tectonic models, through advanced software engineering and visualization technologies. When fully constructed, the Simulator aims to provide the software and hardware infrastructure needed to model solid earth phenomena including global scale dynamics and mineralisation processes, crustal scale processes including plate tectonics, mountain building, interacting fault system dynamics, and micro-scale processes that control the geological, physical and dynamic behaviour of earth systems. ACcESS represents a part of Australia's contribution to the APEC Cooperation for Earthquake Simulation (ACES) international initiative. Together with other national earth systems science initiatives including the Japanese Earth Simulator and US General Earthquake Model projects, ACcESS aims to provide a driver for scientific advancement and technological breakthroughs including: quantum leaps in understanding of earth evolution at global, crustal, regional and microscopic scales; new knowledge of the physics of crustal fault systems required to underpin the grand challenge of earthquake prediction; new understanding and predictive capabilities of geological processes such as tectonics and mineralisation.

A performance improvement plan to increase nurse adherence to use of medication safety software.

PubMed

Gavriloff, Carrie

2012-08-01

Nurses can protect patients receiving intravenous (IV) medication by using medication safety software to program "smart" pumps to administer IV medications. After a patient safety event identified inconsistent use of medication safety software by nurses, a performance improvement team implemented the Deming Cycle performance improvement methodology. The combined use of improved direct care nurse communication, programming strategies, staff education, medication safety champions, adherence monitoring, and technology acquisition resulted in a statistically significant (p < .001) increase in nurse adherence to using medication safety software from 28% to above 85%, exceeding national benchmark adherence rates (Cohen, Cooke, Husch & Woodley, 2007; Carefusion, 2011). Copyright © 2012 Elsevier Inc. All rights reserved.

Dynamic CT myocardial perfusion imaging: performance of 3D semi-automated evaluation software.

PubMed

Ebersberger, Ullrich; Marcus, Roy P; Schoepf, U Joseph; Lo, Gladys G; Wang, Yining; Blanke, Philipp; Geyer, Lucas L; Gray, J Cranston; McQuiston, Andrew D; Cho, Young Jun; Scheuering, Michael; Canstein, Christian; Nikolaou, Konstantin; Hoffmann, Ellen; Bamberg, Fabian

2014-01-01

To evaluate the performance of three-dimensional semi-automated evaluation software for the assessment of myocardial blood flow (MBF) and blood volume (MBV) at dynamic myocardial perfusion computed tomography (CT). Volume-based software relying on marginal space learning and probabilistic boosting tree-based contour fitting was applied to CT myocardial perfusion imaging data of 37 subjects. In addition, all image data were analysed manually and both approaches were compared with SPECT findings. Study endpoints included time of analysis and conventional measures of diagnostic accuracy. Of 592 analysable segments, 42 showed perfusion defects on SPECT. Average analysis times for the manual and software-based approaches were 49.1 ± 11.2 and 16.5 ± 3.7 min respectively (P < 0.01). There was strong agreement between the two measures of interest (MBF, ICC = 0.91, and MBV, ICC = 0.88, both P < 0.01) and no significant difference in MBF/MBV with respect to diagnostic accuracy between the two approaches for both MBF and MBV for manual versus software-based approach; respectively; all comparisons P > 0.05. Three-dimensional semi-automated evaluation of dynamic myocardial perfusion CT data provides similar measures and diagnostic accuracy to manual evaluation, albeit with substantially reduced analysis times. This capability may aid the integration of this test into clinical workflows. • Myocardial perfusion CT is attractive for comprehensive coronary heart disease assessment. • Traditional image analysis methods are cumbersome and time-consuming. • Automated 3D perfusion software shortens analysis times. • Automated 3D perfusion software increases standardisation of myocardial perfusion CT. • Automated, standardised analysis fosters myocardial perfusion CT integration into clinical practice.

Nitrogen expander cycles for large capacity liquefaction of natural gas

NASA Astrophysics Data System (ADS)

Chang, Ho-Myung; Park, Jae Hoon; Gwak, Kyung Hyun; Choe, Kun Hyung

2014-01-01

Thermodynamic study is performed on nitrogen expander cycles for large capacity liquefaction of natural gas. In order to substantially increase the capacity, a Brayton refrigeration cycle with nitrogen expander was recently added to the cold end of the reputable propane pre-cooled mixed-refrigerant (C3-MR) process. Similar modifications with a nitrogen expander cycle are extensively investigated on a variety of cycle configurations. The existing and modified cycles are simulated with commercial process software (Aspen HYSYS) based on selected specifications. The results are compared in terms of thermodynamic efficiency, liquefaction capacity, and estimated size of heat exchangers. The combination of C3-MR with partial regeneration and pre-cooling of nitrogen expander cycle is recommended to have a great potential for high efficiency and large capacity.

CORONAL DYNAMIC ACTIVITIES IN THE DECLINING PHASE OF A SOLAR CYCLE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jang, Minhwan; Choe, G. S.; Woods, T. N.

2016-12-10

It has been known that some solar activity indicators show a double-peak feature in their evolution through a solar cycle, which is not conspicuous in sunspot number. In this Letter, we investigate the high solar dynamic activity in the declining phase of the sunspot cycle by examining the evolution of polar and low-latitude coronal hole (CH) areas, splitting and merging events of CHs, and coronal mass ejections (CMEs) detected by SOHO /LASCO C3 in solar cycle 23. Although the total CH area is at its maximum near the sunspot minimum, in which polar CHs prevail, it shows a comparable secondmore » maximum in the declining phase of the cycle, in which low-latitude CHs are dominant. The events of CH splitting or merging, which are attributed to surface motions of magnetic fluxes, are also mostly populated in the declining phase of the cycle. The far-reaching C3 CMEs are also overpopulated in the declining phase of the cycle. From these results we suggest that solar dynamic activities due to the horizontal surface motions of magnetic fluxes extend far in the declining phase of the sunspot cycle.« less

Dynamical diagnostics of the SST annual cycle in the eastern equatorial Pacific: part I a linear coupled framework

NASA Astrophysics Data System (ADS)

Chen, Ying-Ying; Jin, Fei-Fei

2018-03-01

The eastern equatorial Pacific has a pronounced westward propagating SST annual cycle resulting from ocean-atmosphere interactions with equatorial semiannual solar forcing and off-equatorial annual solar forcing conveyed to the equator. In this two-part paper, a simple linear coupled framework is proposed to quantify the internal dynamics and external forcing for a better understanding of the linear part of the dynamics annual cycle. It is shown that an essential internal dynamical factor is the SST damping rate which measures the coupled stability in a similar way as the Bjerknes instability index for the El Niño-Southern Oscillation. It comprises three major negative terms (dynamic damping due to the Ekman pumping feedback, mean circulation advection, and thermodynamic feedback) and two positive terms (thermocline feedback and zonal advection). Another dynamical factor is the westward-propagation speed that is mainly determined by the thermodynamic feedback, the Ekman pumping feedback, and the mean circulation. The external forcing is measured by the annual and semiannual forcing factors. These linear internal and external factors, which can be estimated from data, determine the amplitude of the annual cycle.

Overview of the GRC Stirling Convertor System Dynamic Model

NASA Technical Reports Server (NTRS)

Lewandowski, Edward J.; Regan, Timothy F.

2004-01-01

A Stirling Convertor System Dynamic Model has been developed at the Glenn Research Center for controls, dynamics, and systems development of free-piston convertor power systems. It models the Stirling cycle thermodynamics, heat flow, gas, mechanical, and mounting dynamics, the linear alternator, and the controller. The model's scope extends from the thermal energy input to thermal, mechanical dynamics, and electrical energy out, allowing one to study complex system interactions among subsystems. The model is a non-linear time-domain model containing sub-cycle dynamics, allowing it to simulate transient and dynamic phenomena that other models cannot. The model details and capability are discussed.

New device to measure dynamic intrusion/extrusion cycles of lyophobic heterogeneous systems.

PubMed

Guillemot, Ludivine; Galarneau, Anne; Vigier, Gérard; Abensur, Thierry; Charlaix, Élisabeth

2012-10-01

Lyophobic heterogeneous systems (LHS) are made of mesoporous materials immersed in a non-wetting liquid. One application of LHS is the nonlinear damping of high frequency vibrations. The behaviour of LHS is characterized by P - ΔV cycles, where P is the pressure applied to the system, and ΔV its volume change due to the intrusion of the liquid into the pores of the material, or its extrusion out of the pores. Very few dynamic studies of LHS have been performed until now. We describe here a new apparatus that allows us to carry out dynamic intrusion/extrusion cycles with various liquid/porous material systems, controlling the temperature from ambient to 120 °C and the frequency from 0.01 to 20 Hz. We show that for two LHS: water/MTS and Galinstan/CPG, the energy dissipated during one cycle depends very weakly on the cycle frequency, in strong contrast to conventional dampers.

Visualizing and understanding l'hopital's rule

NASA Astrophysics Data System (ADS)

Gordon, Sheldon P.

2017-11-01

This article uses dynamic software in Excel to demonstrate several ways in which graphical and numerical approaches can be introduced both to enhance student understanding of l'Hopital's Rule and to explain why the Rule actually works to give the 'right' answers. One of the approaches used is to visualize what is happening by examining the limits with both l'Hopital's Rule and the associated Taylor approximation to the function. The dynamic software allows students to experiment with the ideas.

Elan4/SPARC V9 Cross Loader and Dynamic Linker

DOE Office of Scientific and Technical Information (OSTI.GOV)

anf Fabien Lebaillif-Delamare, Fabrizio Petrini

2004-10-25

The Elan4/Sparc V9 Croos Loader and Liner is a part of the Linux system software that allows the dynamic loading and linking of user code in the network interface Quadrics QsNETII, also called as Elan4 Quadrics. Elan44 uses a thread processor that is based on the assembly instruction set of the Sparc V9. All this software is integrated as a Linux kernel module in the Linux 2.6.5 release.

Microprocessor based implementation of attitude and shape control of large space structures

NASA Technical Reports Server (NTRS)

Reddy, A. S. S. R.

1984-01-01

The feasibility of off the shelf eight bit and 16 bit microprocessors to implement linear state variable feedback control laws and assessing the real time response to spacecraft dynamics is studied. The complexity of the dynamic model is described along with the appropriate software. An experimental setup of a beam, microprocessor system for implementing the control laws and the needed generalized software to implement any state variable feedback control system is included.

Reuseable Objects Software Environment (ROSE): Introduction to Air Force Software Reuse Workshop

NASA Technical Reports Server (NTRS)

Cottrell, William L.

1994-01-01

The Reusable Objects Software Environment (ROSE) is a common, consistent, consolidated implementation of software functionality using modern object oriented software engineering including designed-in reuse and adaptable requirements. ROSE is designed to minimize abstraction and reduce complexity. A planning model for the reverse engineering of selected objects through object oriented analysis is depicted. Dynamic and functional modeling are used to develop a system design, the object design, the language, and a database management system. The return on investment for a ROSE pilot program and timelines are charted.

Economic Analysis of Complex Nuclear Fuel Cycles with NE-COST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganda, Francesco; Dixon, Brent; Hoffman, Edward

The purpose of this work is to present a new methodology, and associated computational tools, developed within the U.S. Department of Energy (U.S. DOE) Fuel Cycle Option Campaign to quantify the economic performance of complex nuclear fuel cycles. The levelized electricity cost at the busbar is generally chosen to quantify and compare the economic performance of different baseload generating technologies, including of nuclear: it is the cost of electricity which renders the risk-adjusted discounted net present value of the investment cash flow equal to zero. The work presented here is focused on the calculation of the levelized cost of electricitymore » of fuel cycles at mass balance equilibrium, which is termed LCAE (Levelized Cost of Electricity at Equilibrium). To alleviate the computational issues associated with the calculation of the LCAE for complex fuel cycles, a novel approach has been developed, which has been called the “island approach” because of its logical structure: a generic complex fuel cycle is subdivided into subsets of fuel cycle facilities, called islands, each containing one and only one type of reactor or blanket and an arbitrary number of fuel cycle facilities. A nuclear economic software tool, NE-COST, written in the commercial programming software MATLAB®, has been developed to calculate the LCAE of complex fuel cycles with the “island” computational approach. NE-COST has also been developed with the capability to handle uncertainty: the input parameters (both unit costs and fuel cycle characteristics) can have uncertainty distributions associated with them, and the output can be computed in terms of probability density functions of the LCAE. In this paper NE-COST will be used to quantify, as examples, the economic performance of (1) current Light Water Reactors (LWR) once-through systems; (2) continuous plutonium recycling in Fast Reactors (FR) with driver and blanket; (3) Recycling of plutonium bred in FR into LWR. For each fuel cycle, the contributions to the total LCAE of the main cost components will be identified.« less

AeroPropulsoServoElasticity: Dynamic Modeling of the Variable Cycle Propulsion System

NASA Technical Reports Server (NTRS)

Kopasakis, George

2012-01-01

This presentation was made at the 2012 Fundamental Aeronautics Program Technical Conference and it covers research work for the Dynamic Modeling of the Variable cycle Propulsion System that was done under the Supersonics Project, in the area of AeroPropulsoServoElasticity. The presentation covers the objective for the propulsion system dynamic modeling work, followed by the work that has been done so far to model the variable Cycle Engine, modeling of the inlet, the nozzle, the modeling that has been done to model the affects of flow distortion, and finally presenting some concluding remarks and future plans.

Federal Communications Commission (FCC) Transponder Loading Data Conversion Software. User's guide and software maintenance manual, version 1.2

NASA Technical Reports Server (NTRS)

Mallasch, Paul G.

1993-01-01

This volume contains the complete software system documentation for the Federal Communications Commission (FCC) Transponder Loading Data Conversion Software (FIX-FCC). This software was written to facilitate the formatting and conversion of FCC Transponder Occupancy (Loading) Data before it is loaded into the NASA Geosynchronous Satellite Orbital Statistics Database System (GSOSTATS). The information that FCC supplies NASA is in report form and must be converted into a form readable by the database management software used in the GSOSTATS application. Both the User's Guide and Software Maintenance Manual are contained in this document. This volume of documentation passed an independent quality assurance review and certification by the Product Assurance and Security Office of the Planning Research Corporation (PRC). The manuals were reviewed for format, content, and readability. The Software Management and Assurance Program (SMAP) life cycle and documentation standards were used in the development of this document. Accordingly, these standards were used in the review. Refer to the System/Software Test/Product Assurance Report for the Geosynchronous Satellite Orbital Statistics Database System (GSOSTATS) for additional information.