MATREX Simulation Architecture
2008-03-10
r e S u p p o r t M i n e s , C o u n t e r m i n e s U n m a n n e d S y s t e m s L o g...i s t i c s N e t w o r k e d E f f e c t s C o m m a n d & C o n t r o l C o n s i s t e n t & H i g h - R e s M i s s i l e M o d e...l i n g C o n s i s t
Systems Engineering Measurement Primer
1998-03-01
Schermerhorn , R ., “Determining metrics for...maintenance process. 12 S e l e c t a n d S p e c i f y M e a s u r e s a n d I n d i c a t o r s C o l l e c t D a t a C a l c u l a t e I n d i c a...t o r s A n a l y z e t h e M e a s u r e s o r I n d i c a t o r s R e p o r t a n d U s e t h e R e s u l t s Issues Goals Risks A
Department of Defense Youth Poll Wave 10 - December 2005. Overview Report
2006-07-01
Fishbein , M . & Ajzen , I . (1975). Belief, attitude, intention and behavior: An introduction to theory...a n d E x p e c t e d O u t c o m e s A s s o c ia t e d w it h M il i t a r y S e r v ic e I n f lu e n c e r s M i l i t a r y B e l ie...f s a n d Y o u t h M o t iv a t io n t o C o m p ly Y o u t h A t t i t u d e s N o r m s Y o u t h C o n f id e n c e in S u c c e s
��< h t m l x m l n s : v = " u r n : s c h e m a s - m i c r o s o f t - c o m : v m l " x m l n s : o = " u r n : s c h e m a s - m i c r o s o f t - c o m : o f f i c e : o f f i c e " x m l n s : w = " u r n : s c h e m a s - m i c r o s o f t - c o m : o f f i c e
High-Accuracy Global Time and Frequency Transfer with a Space-Borne Hydrogen Maser Clock
1982-12-01
of t h e s p a c e c l o c k is modu la t ed on t h e c l o c k downl ink car r ie r using PRN p h a s e modula- t i o n (5). The s p a...is t o a c c o u n t f o r r e la t i s t i c e f f e c t s w i t h i n a f r a c t i o n a l f r e q u e n c y error of 0 . T h i s r...Mockler , and J . M . R ichardson , Metrologia , 1, p. 114, 1965. ( 1 3 ) Glaze, D . J . , Helmut Hellwig, Steve J a r v i s , J r . , A
2010-11-01
for Education, for the American Council on Education S E R V I C E M E M B E R S I N S C H O O L Military Veterans’ Experiences Using the Post...69 Appendix E : Focus Group Demographic Information Sheet . . . . . . . . . . . . . . 71 Appendix F: Interview Protocol for Non...Student Survey . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77 S E R V I C E M E M B E R S I N S C H O O L i i i C
Deviatoric Constitutive Relationship for Anisotropic Materials
1987-06-01
SEFF = VMISES ICHECK (1) = 0 DEPSBP = 0. CALL XFORM (STR(I),STR(2),STR(3),STR(4),STR(5),STR(6), & SR2 ,SZ2 ,ST2 ,SZT2 ,SRT2 ,SRZ2,-TH) GO TO 310...END I F C c Yield h a s occured: D e t e r m i n e ALF, t h e f r a c t i o n of s t r a i n c t h a t is pre-y ie ld . C I F ( ICHECK ...c e l s e m u s t d e t e r m i n e e l a s t i c f r a c t i o n ( a l f ) (see V a v r i c k , J o h n s o n ) C ICHECK (1) = 1 TERM1 = 0
Bulletin of the American Astronomical Society. Volume 36, Number 1, 2004
2004-01-01
A. S., Van Malderen, R., Uytterhoeven, K., Davignon, G., Dunham, E. W., Olkin , C. B., Taylor, B. W., Wasserman, L. H., Clancy, K., Person, M. J...Leggett, S. K., Levine, S. E., Moon, D.-S., Olkin , C. B., Osip, D. J., Pasachoff, J. M., Penprase, B. E., Person, M. J., Qu, S., Rayner, J. T., Rob...Moon, D.-S., Buie, M. W., Dunham, E. W., Olkin , C. B., Taylor, B., Kern, S. D., Qu, S., Salyk, C. V., Leggett, S. K., Levine, S. E., and Stone, R. C
Statistical Reproducibility of the Dynamic and Static Fatigue Experiments.
1980-10-01
82171a no 3 a s d e te rm-,I n ed7 from t Ynamic ’ra-,4-e 2x oe r imen. Figure 2. T-he c oeffic 4e nt o - v arari an ( C . o f .4eib L’ sIatce --ar a-:e...e rc lecnnique to aeterr-ine zne v~iidit of the assumptions. - .2 Static Fatioue Static -aticue tests entai- , the reDeatec measuremen- c - azure ...ress -ance ncreased, anc- tec.-ease: zs n :El ~ c a -amet: -7 4creas2c. -o r a ze sac, nC~e 3Es3 ra-.<e ~ D 3 s ar, c a s n amD-e , s e : ) rrc uCb c 0
2004-11-01
s s a c h u s e t t s i n s t ...i t u t e o f t e c h n o l o g y, c a m b r i d g e , m a 0 2 1 3 9 u s a — w w w . c s a i l . m i t . e d u m a ss a c h u se t t s i n...st i t u t e o f t e c h n o l o g y — co m p u t e r sc i e n ce a n d a r t i f ic ia l i n t e l l ig e n ce l a b o ra t o r y
NASA Astrophysics Data System (ADS)
Voloshin, M. B.
2018-02-01
The production of heavy meson-antimeson pairs of the type S V and P A in e+e- annihilation is considered, with P and V being the ground-state JP=0- and JP=1- (anti)mesons from the (1 /2 )-doublet and S and A standing for the excited JP=0+ and JP=1+ (anti)mesons from the (1 /2 )+doublet. It is argued that the production amplitudes in these two channels should be equal up to a higher (than one) order in the heavy quark mass (ΛQCD/MQ ) expansion, A (e +e-→S V ¯ )=A (e+e-→A P ¯ ) , including both the S -wave and the D -wave amplitudes. Given that the S V and P A thresholds are extremely close, the production cross section in both channels should be the same to a high degree of accuracy. In practice, this behavior can be studied for the processes e+e-→Ds 0(2317 )D¯s *+c .c . and e+e-→Ds 1(2460 )D¯ s+c .c . in the charm sector and e+e-→Bs 0B¯s *+c .c . and e+e-→Bs 1B¯ s+c .c . in the B sector.
Understanding the Delay in Onset of Pagets Disease of Bone
2015-09-01
gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C K E E K A G S S G L MVP gene D N P G Q D R A T C K E...E K A G S S G L MVV gene agcaaaccatgcctctcagcaattggatcaactgaaggcggtgcacctcgcatccgcggt S K P C L S A I G S T E G G A P R...I R G MVP gene S K P C L S A I G S T E G G A P R I R G MVV gene
1976-09-01
UNCLASSIFIED St Cu* ITY C LA S S I F I C A T I O N OF tIllS PAGE (W~I. , 0.i. Ent.,.~d) REPODT rVW IIMEIITATIAII PACE READ INSTRUCTIONS...MEASUREMENTS 10 A. Ef fec t ive Channel Guide Width 10 13. Rid ge For mation St udies 10 C. Wave guide Loss Measurement s 10 D. Tape r Coup ling Eff...of less coup l ing e f f i c i e n c y at t h e t aper l e n g t h of 900 ~ rn . Ne l son 2 has c o n s i d e r e d the e f f i c i e n c y of
Analyzing the Telecommunications Equipment Sector Using a Qualitative Framework
2014-10-01
N C E & T E C H N O L O G Y P O L I C Y I N S T I T U T E...I E N C E & T E C H N O L O G Y P O L I C Y I N S T I T U T E IDA Document D-5346 Analyzing the Telecommunications Equipment Sector Using a...Opportunity In ve st m en ts , S m al l B us in es s In no va tio n R es ea rc h (S B IR ) C oo pe ra tiv e R es ea rc h an d Pr od uc tio n
DOT National Transportation Integrated Search
2014-01-01
This document provides the high-level system architecture for the Prototype Development and Demonstration of a R.E.S.C.U.M.E. system. The requirements addressed in this document are based upon those that can be found in previous R.E.S.C.U.M.E. report...
Molecular Connections between Arousal and Metabolic Disease: Orexin and Modafinil
2010-04-01
t r o l ( c - F o s I R c e l l s ) PVT c-Fos Expression Control Choc.-conditioned 0 100 200 300 400 500 * % o f C o...n t r o l ( c - F o s I R c e l l s ) VTA c-Fos Expression Control Choc.-conditio 0 100 200 300 * % o f C o n t r o l ( c - F o s I R c e...l l s ) NAcc c-Fos Expression Control
DOE Office of Scientific and Technical Information (OSTI.GOV)
VanderNoot, Victoria A.; Curtis, Deanna Joy; Koh, Chung-Yan
Monitor i ng in f ectio n s in v ect o rs su c h as m osquit o es, s a nd fl i es, tsetse fl i es, a nd ticks to i denti f y hu m a n path o gens m a y s e r v e as a n ear l y w arn i ng det e ction system t o dir e ct loc a l g o v er n ment dise a se pr e v en t i v e m easu r e s . Onemore » major hurdle i n de t ection is the abi l i t y to scre e n l arge n u mbers of v e c t ors for h uman patho g ens w i thout t h e u s e of ge n o t y pe - s p ecific m o lecu l ar tec h nique s . N e x t genera t ion s equ e nc i ng (NG S ) pr o v i des a n unbi a sed p latfo r m capab l e of identi f y i ng k n o w n a n d unk n o w n p ath o ge n s circula t ing w i thin a v e ctor p opul a tion, but utili z ing t h is te c h nolo g y i s tim e - con s u ming a n d cos t l y for v ecto r -b o rne disease su r v e illan c e pr o gra m s. T o addr e s s this w e d e v e lop e d cos t -eff e ct i v e Ilumina(r) R NA- S eq l i bra r y p r epara t ion m e thodol o gies i n con j u n ction w i t h an automa t ed c ompu t at i onal a n a l y sis pipel i n e to ch a racter i ze t h e microbial popula t ions c ircula t i n g in Cu l e x m o squit o e s (Cul e x qui n quef a s c iatu s , C ul e x quinq u efasc i atus / pip i ens co m pl e x h y bri d s, and C u l e x ta r salis ) t hroug h out Californ i a. W e assembled 2 0 n o vel a n d w e l l -do c ume n ted a r b o v i ruses repres e nting mem b e rs of B u n y a v ir i da e , F l a v i virid a e, If a virida e , Meson i v i rida e , Nid o v iri d ae, O rtho m y x o virid a e, Pa r v o v iri d ae, Re o virid a e, R h a b d o v i rid a e, T y m o v iri d ae, a s w ell as s e v e r al u n assi g n e d v irus e s . In addit i o n, w e m app e d mRNA s pecies to d i vergent s peci e s of t r y panos o ma a nd pl a s modium eu k a r yotic parasit e s and cha r a c terized t he p r oka r yot i c microb i al c o mposit i on to i d enti f y bacteri a l tran s c r ipts der i v ed from wolba c hia, clo s tridi u m, m y c oplas m a, fusoba c terium and c am p y l o bacter bac t er i al spec i e s . W e utilized the s e mic r obial transcri p tomes pre s e nt in g e ogra p hical l y defined Cul e x po p ul a tions to defi n e spatial and m osqui t o specie s -spec i fic ba r r iers of i n fecti o n. T he v i r ome and microbi o me c o mpos i tion id e ntified in e ach mosqui t o p o ol pr o v i ded suf f icient resolut i on to dete r m i ne both the mosq u ito species and the g e o graphic regi o n in Californ i a w h e re t h e mosqui t o po o l orig i n ated. T his d a ta pr o v i des ins i ght in t o the compl e x i t y of microb i al spec i es cir c ulati n g in med i cal l y i mport a nt Culex mosqui t oes a nd t h eir potent i al im p act o n t he tran s missi o n of v ector-b o rne human / veter i na r y p a t hogens in C a liforn i a.« less
The Operational Equations of State, 4: The Dulong-Petit Equation of State for Hydrocode
2012-07-01
1 1 , 2 2 ln T T T T V S S V S V S HHC C H V V E S V C C E E P VdE E E V d e CT e d V CT...71. 9. Grinfeld, M. A. Thermodynamic Methods in the Theory of Heterogeneous Systems , Longman, New York, 1991. NO. OF COPIES ORGANIZATION
Hybrid Scenario Development Methodology and Tool: An Arctic-Oriented Scenario Example
2011-07-01
T E N D S T A T E = S C E N A R I O T R I G G E R P O I N T SECURITY(INC DEFENCE) LEGAL ENVIRONMENTAL...SECURITY(INC DEFENCE) S C E N A R I O D E V E L O P M E N T E N D S T A T E = S C E N A R I O T R I G G E R P O I N T
2010-06-07
r i t y - S e r v i c e - E x c e l l e n c e 536 458 460 466 638 549 517 600 639 628 491 507 0 100 200 300 400...2008 through 1 August 2008. 4 I n t e g r i t y - S e r v i c e - E x c e l l e n c e Explosives Site Plans Received 0 200 400 600 800...measured on 1 June 2010. The current backlog is primarily ESPs awaiting MAJCOM response to review queries. 8 I n t e g r i t y - S e r v i c
Molecular Biology of STLV-III and HTLV-IV
1990-08-22
8217 AT( ACCA CTCAT.(3CA 5 Ci.T G,- .... ; . , P P, ( L D O S H s v H I -U" G r L "S " V " " , 3 E E 7 ’ T - ’ ’ ’ TJ - " t f? I f T G A- C-. C .T ’ CA8C P...R S N T V K N S D’ . Y S T m 2: G ! Y ’) V V G v I L L R 7 V T Y I’ ,9 M 3: i E F M C f7 E e I V C? iT C? e S . (N*’ 1 . Flist 5At(3CTAGC’’TAATGrAG
2005-01-18
r A L 1 3 3 4 1 4 ) w a s u s e d a s a re fe re n c e . D a s h e s in d ic a te id e n ti...le d th e tr a n s m e m b ra n e e xo n a s e xo n 7 in o rd e r to k e e p th e re la ti o n s h ip a m o n g K IR e xo n s in th e d if fe re n t...g e n e s c o n s is te n t. N u c le o ti d e p o s it io n s w e
An Experimental Investigation of Techniques to Suppress Edgetones from Perforated Wind Tunnel Walls
1975-08-01
s e e m i t t e d by the p e r f o r a t e d wa l l s h a s b e e n u n d e r s t udy f o r s e v e r a l y e a r s at AEDC. A r e c e...ld at low supe r son i c speeds . Actual s amples of pe r fo ra t ed walls f r o m the t h ree t r a n s o n i c tunnels were t es ted...c t i o n flow and wal l angle that gave a r e a s o n a b l y f la t axia l Mach n u m b e r d i s t r i b u t i o n t h roughou t the
Proceedings of Advanced Planning Briefing for Industry. Part 1
1965-12-01
t h e flow o f in format ion and i d e a s must be both t o you and from you. We thus welcome t h e oppo r tun i t y o f p r e sen t i...megawatt, l i g h t wa te r moderated and c o o l e d , h i g h l y e n r i c h e d uranium , the rmal t y p e t h a t i s c o n s t a n t l y...a l s . Our c u r r e n t programs i n b e r y l l i u m and i n uranium have n o t t h e e x t e n s i v e - n e s s o f t h e e a r l i
A Hybrid Approach for Fault Detection in Autonomous Physical Agents
2014-05-01
r l e c c f t d f a d c r r r t m e o i m s f U m d o s a u v c o t c r c t a c u n b S...escription e a set of attrib d, heading, pi et of values for alue assigned to t i s 1 l m a o p a r tr l c tr w o t n data H & ow detection mode roach is...dete Note that any ch can be used t e an autonomou e SFDD
Orlandi, Giorgio; Garavelli, Marco; Zerbetto, Francesco
2017-09-20
We analyze the highly resolved vibronic structure of the low energy (≤200 cm -1 ) region of the fluorescence and fluorescence excitation spectra of trans-stilbene in supersonic beams. In this spectral region the vibronic structure is associated mainly with vibrational levels of the C e -C e torsion (τ) and the a u combination of the two C e -C ph bond twisting (ϕ). We base this analysis on the well-established S 0 (τ, ϕ) two-dimensional potential energy surface (PES) and on a newly refined S 1 (τ, ϕ) PES. We obtain vibrational eigenvalues and eigenvectors of the anharmonic S 0 (τ, ϕ) and S 1 (τ, ϕ) PES using a numerical procedure based on the Meyer's flexible model [R. Meyer, J. Mol. Spectrosc., 1979, 76, 266]. Then we derive Franck-Condon factors and therefore intensities of the relevant vibronic bands for the S 0 → S 1 excitation and S 1 → S 0 fluorescence spectra. Furthermore, we assess the role of the b g combination of the two C e -C ph bond twisting (ν 48 ) in the structure of the S 1 → S 0 fluorescence spectra. By the use of these results we are able to assign most of the low energy vibrational levels of the S 0 → S 1 excitation spectra and of the fluorescence spectra of the emission from several low energy S 1 vibronic levels. The good agreement between the observed and the computed vibrational structure of the S 0 → S 1 and S 1 → S 0 spectra suggests that the proposed picture of the E 1 (τ, ϕ) and E 0 (τ, ϕ) PES, in particular along the coordinate τ governing trans-cis photo-isomerization in S 1 , is accurate. In S 0 , the barriers for the C e [double bond, length as m-dash]C e torsion and for the a u type C e -C ph bond twisting are 16 080 cm -1 and 3125 cm -1 , respectively, while in S 1 , where the bond orders of the C e [double bond, length as m-dash]C e and C e -C ph bonds are reversed, the two barriers become 1350 cm -1 and 8780 cm -1 , respectively.
Correlating Temporal Rules to Time-Series Data With Rule-Based Intuition
2010-03-01
t i m e o b j e c t and r e t u r n s True ( i n r u l e ) or F a l s e ( n o t i n r u l e ) . Des ign : r u l e l i s t − an a r r a y t h...e . d a t e o b j e c t s . ””” def i n i t ( s e l f , name , days , i g n o r e y e a r =True ) : s e l f . name = name s e l f . days = days 49 s...a l . tm wday == 6 r u l e l i s t . append ( Sunday ( ) ) c l a s s J a n u a r y ( TimeRule ) : ””” I s True i f i t i s January
Morale, Welfare, and Recreation: Nonappropriated Funds Personnel Policy
2002-04-01
Nonappropriated Fund Instrumentality established for the purpose of providing installation/community MWR activi- ties, including food and beverage , retail...2002 H i s t o r y . T h i s p r i n t i n g p u b l i s h e s a r e v i s i o n o f t h i s r e g u l a t i o n . B e c a u s e t h e p u b l i c...a t i o n h a s b e e n e x t e n s i v e l y r e v i s e d , t h e c h a n g e d p o r t i o n s h a v e n o t b e e n highlighted. Summary. This
High Fidelity Radar Stimulation For Distributed Hardware-in-the-Loop Simulations
2008-11-20
I L J C-Series Driver Embedded Test CNIP ( ISTC -1) J R E A P - C Strategic ADSI (MDIOC) Dashed Lines indicate passive monitoring by MDSE TCS and...External Sensors Lab Azusa GFC ESI-MP GMD ( ISTC -1) Huntsville ESI-DB • SBX • CD • UEWR • IFICS • CLE • GBI C - S e r i e s C - S e r i e s RDSIS Closed
Management: Department of the Army Productivity Improvement Program
1982-08-01
VEPs will submit semi-annually to HQDA ( DACA -MP) WASH DC 20310 a statistical summary of VE actions (RCS DD- I&L (SA&A) 1138) in the format shown in...A r m y c o m m a n d s / s e p a r a t e a g e n c i e s w i l l furnish one copy of each to the Comptrol- ler of the Army, HQDA, ATTN: DACA - MP...d e d C h a n g e s t o P u b l i c a t i o n s a n d Blank Forms) direct to HQDA ( DACA - RPM) WASH DC 20310. D i s t r i b u t i o n . A c t i v e A
Ito, Ryo; Yamakage, Hajime; Kotani, Kazuhiko; Wada, Hiromichi; Otani, Sumire; Yonezawa, Kazuya; Ogo, Atsushi; Okajima, Taiichiro; Adachi, Masahiro; Araki, Rika; Yoshida, Kazuro; Saito, Miho; Nagaoka, Tadasu; Toyonaga, Tetsushi; Tanaka, Tsuyoshi; Yamada, Tsutomu; Ota, Itsuro; Oishi, Mariko; Miyanaga, Fumiko; Shimatsu, Akira; Satoh-Asahara, Noriko
2015-01-01
The aim of this study is to determine which indicator of chronic kidney disease most closely correlates with 10-year Framingham coronary heart disease (CHD) risk among serum creatinine, serum cystatin C (S-CysC), urine albumin-creatinine ratio (UACR), estimated creatinine-based GFRs (eGFRcre), and estimated CysC-based GFRs (eGFRcys) in patients with obesity and diabetes. Serum creatinine, S-CysC, UACR, and cardio-ankle vascular index (CAVI) were examined in 468 outpatients with obesity and type 2 diabetes, free of severe renal dysfunction or previous history of cardiovascular disease, as a cross-sectional survey using baseline data from the multi-centered Japan Diabetes and Obesity Study. S-CysC and eGFRcys had significantly stronger correlations with the 10-year Framingham CHD risk than serum creatinine, eGFRcre, and UACR (creatinine, ρ = 0.318; S-CysC, ρ = 0.497; UACR, ρ = 0.174; eGFRcre, ρ = -0.291; eGFRcys, ρ = -0.521; P < 0.01 by Fisher's z-test). S-CysC and eGFRcys had significantly stronger correlations with CAVI than serum creatinine, eGFRcre, and UACR (creatinine, ρ = 0.198; S-CysC, ρ = 0.383; UACR, ρ = 0.183; eGFRcre, ρ = -0.302; eGFRcys, ρ = -0.444; P < 0.05 by Fisher's z-test). The receiver operating characteristic curves to distinguish the high-risk patients for CHD revealed significantly larger areas under the curve of S-CysC and eGFRcys than those of serum creatinine, UACR, and eGFRcre (serum creatinine, 0.64; S-CysC, 0.75; UACR, 0.56; eGFRcre, 0.63; eGFRcys, 0.76; P < 0.01). The data suggested that eGFRcys can be more predictive of the 10-year CHD risk than eGFRcre in Japanese patients with obesity and diabetes.
An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply
2007-05-01
Marcantonio , Ph.D. Research Associate Dorothy...SB *pɘ.05 0 2 0 4 0 6 0 8 0 5 :1 1 0 :1 20 :1 E:T Ratio % S p e c i f i c L y s i s 100 101 102 103 104 FL2-Height Human Endoglin C o u n t s A B...Fig3. Cytotoxicity assay of breast cancer specific CTL. 0 5000 10000 15000 F l u o r e s c e i n l e v e l s / g HuEGEmpty Vector SB * *pɘ.005 B
2010-08-01
I N S T I T U T E F O R D E F E N S E A N A LY S E S IDA Document D-4130 August 2010 Exercise “Dread Night”: Using Allied Medical Publication-8(C...scientific and technical expertise, and conduct related research on other national challenges. I N S T I T U T E F O R D E F E N S E A N A LY S E...insult can be simply postulated, but it can also be calculated using the methodology described in AMedP-8(C). The latter approach was the one taken in
Feasibility Studies of an Electrochemical Test Method for Nitrogen Tetroxide Compatibility Testing.
1978-11-01
I - fl i ght Density Acid ( HDA ) type systems (N204—HNO 3) in order to achieve t r a - s - ~t i r - i h s I e d e...id rich ph a s e w i l l r e s u l t in HDA type nitric acid corrosion in localized , s i t e s ( i . - . , c r e v t s~s , s - t c . ) . E l e
A Manual for the Prediction of Blast and Fragment Loadings on Structures
1981-08-15
ives , assembles exp los ives components i n t o assemblies , does more i n s p e c t i o n s , and f i n a l l y packages and s h i p s t h...4100, Los Alamos S c i e n t i f i c Laboratory, Un ive r s i ty of C a l i f o r n i a , Los Alamos , New Mexico, February 1970. 4.29 " I n t e...Massachusetts I n s t i t u t e of Technology, 1976. B- 7 Bdzi l , J. B. and Davis, W. C., "Time-Dependent Detonat ions," J.A-5926-MS, Los Alamos S c i
VizieR Online Data Catalog: Vela Junior (RX J0852.0-4622) HESS image (HESS+, 2018)
NASA Astrophysics Data System (ADS)
H. E. S. S. Collaboration; Abdalla, H.; Abramowski, A.; Aharonian, F.; Ait Benkhali, F.; Akhperjanian, A. G.; Andersson, T.; Anguener, E. O.; Arakawa, M.; Arrieta, M.; Aubert, P.; Backes, M.; Balzer, A.; Barnard, M.; Becherini, Y.; Becker Tjus, J.; Berge, D.; Bernhard, S.; Bernloehr, K.; Blackwell, R.; Boettcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Bregeon, J.; Brun, F.; Brun, P.; Bryan, M.; Buechele, M.; Bulik, T.; Capasso, M.; Carr, J.; Casanova, S.; Cerruti, M.; Chakraborty, N.; Chalme-Calvet, R.; Chaves, R. C. G.; Chen, A.; Chevalier, J.; Chretien, M.; Coffaro, M.; Colafrancesco, S.; Cologna, G.; Condon, B.; Conrad, J.; Cui, Y.; Davids, I. D.; Decock, J.; Degrange, B.; Deil, C.; Devin, J.; Dewilt, P.; Dirson, L.; Djannati-Atai, A.; Domainko, W.; Donath, A.; Drury, L. O'c.; Dutson, K.; Dyks, J.; Edwards, T.; Egberts, K.; Eger, P.; Ernenwein, J.-P.; Eschbach, S.; Farnier, C.; Fegan, S.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Foerster, A.; Funk, S.; Fuessling, M.; Gabici, S.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Gottschall, D.; Goyal, A.; Grondin, M.-H.; Hahn, J.; Haupt, M.; Hawkes, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hinton, J. A.; Hofmann, W.; Hoischen, C.; Holler, M.; Horns, D.; Ivascenko, A.; Iwasaki, H.; Jacholkowska, A.; Jamrozy, M.; Janiak, M.; Jankowsky, D.; Jankowsky, F.; Jingo, M.; Jogler, T.; Jouvin, L.; Jung-Richardt, I.; Kastendieck, M. A.; Katarzynski, K.; Katsuragawa, M.; Katz, U.; Kerszberg, D.; Khangulyan, D.; Khelifi, B.; Kieffer, M.; King, J.; Klepser, S.; Klochkov, D.; Kluzniak, W.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Kraus, M.; Krueger, P. P.; Laffon, H.; Lamanna, G.; Lau, J.; Lees, J.-P.; Lefaucheur, J.; Lefranc, V.; Lemiere, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Leser, E.; Lohse, T.; Lorentz, M.; Liu, R.; Lopez-Coto, R.; Lypova, I.; Marandon, V.; Marcowith, A.; Mariaud, C.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; Meintjes, P. J.; Meyer, M.; Mitchell, A. M. W.; Moderski, R.; Mohamed, M.; Mohrmann, L.; Mora, K.; Moulin, E.; Murach, T.; Nakashima, S.; de Naurois, M.; Niederwanger, F.; Niemiec J.; Oakes, L.; O'Brien, P.; Odaka, H.; Oettl, S.; Ohm, S.; Ostrowski, M.; Oya, I.; Padovani, M.; Panter, M.; Parsons, R. D.; Paz Arribas, M.; Pekeur, N. W.; Pelletier, G.; Perennes, C.; Petrucci, P.-O.; Peyaud, B.; Piel, Q.; Pita, S.; Poon, H.; Prokhorov, D.; Prokoph, H.; Puehlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Reimer, A.; Reimer, O.; Renaud, M.; de Los Reyes, R.; Richter, S.; Rieger, F.; Romoli, C.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Saito, S.; Salek, D.; Sanchez, D. A.; Santangelo, A.; Sasaki, M.; Schlickeiser, R.; Schuessler, F.; Schulz, A.; Schwanke, U.; Schwemmer, S.; Seglar-Arroyo, M.; Settimo, M.; Seyffert, A. S.; Shafi, N.; Shilon, I.; Simoni, R.; Sol, H.; Spanier, F.; Spengler, G.; Spies, F.; Stawarz, L.; Steenkamp, R.; Stegmann, C.; Stycz, K.; Sushch, I.; Takahashi, T.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tibaldo, L.; Tiziani, D.; Tluczykont, M.; Trichard, C.; Tsuji, N.; Tuffs, R.; Uchiyama, Y.; van der, Walt D. J.; van Eldik, C.; van Rensburg, C.; van Soelen, B.; Vasileiadis, G.; Veh, J.; Venter, C.; Viana, A.; Vincent, P.; Vink, J.; Voisin, F.; Voelk, H. J.; Vuillaume, T.; Wadiasingh, Z.; Wagner, S. J.; Wagner, P.; Wagner, R. M.; White, R.; Wierzcholska, A.; Willmann, P.; Woernlein, A.; Wouters, D.; Yang, R.; Zabalza, V.; Zaborov, D.; Zacharias, M.; Zanin, R.; Zdziarski, A. A.; Zech, A.; Zefi, F.; Ziegler, A.; Zywucka, N.
2018-03-01
skymap.fit: H.E.S.S. excess skymap in FITS format of the region comprising Vela Junior and its surroundings. The excess map has been corrected for the gradient of exposure and smoothed with a Gaussian function of width 0.08° to match the analysis point spread function, matching the procedure applied to derive the maps in Fig. 1. sp_stat.txt: H.E.S.S. spectral points and fit parameters for Vela Junior (H.E.S.S. data points in Fig. 3 and Tab. A.2 and H.E.S.S. spectral fit parameters in Tab. 4). The errors in this file represent statistical uncertainties at 1 sigma confidence level. The covariance matrix of the fit is also included in the format: c11 c12 c_13 c21 c22 c_23 c31 c32 c_33 where the subindices represent the following parameters of the power-law with exponential cut-off (ECPL) formula in Tab. 2: 1: flux normalization (Phi0) 2: spectral index (Gamma) 3: inverse of the cutoff energy (lambda=1/Ecut) The units for the covariance matrix are the same as for the fit parameters. Notice that, while the fit parameters section of the file shows E_cut as parameter, the fit was done in lambda=1/Ecut; hence the covariance matrix shows the values for lambda in TeV-1. sp_syst.txt: H.E.S.S. spectral points and fit parameters for Vela Junior (H.E.S.S. data points in Fig. 3 and Tab. A.2 and H.E.S.S. spectral fit parameters in Tab. 4). The errors in this file represent systematic uncertainties at 1 sigma confidence level. The integral fluxes for several energy ranges are also included. (4 data files).
A Study of the Jettisoning of JP-4 Fuel in the Atmosphere
1975-11-01
t e r m i n e d by m e a s u r i n g the s tagna t ion p r e s s u r e with a pitot probe , shown in Fig. 21, with the s p h e r i c a l t...ip. The rod loca ted to the r igh t of the pitot probe was loca ted in the s a m e photographic plane as the suspended J P - 4 drop- le t...of Atomiza t ion in C a r b u r e t o r s . " NACA TM 518, 1929. 13. Lapple , C. E . , Henry , J . P . , J r . , and Blake, D. E. " A t o
Momentum Flux Measurements from Under Expanded Orifices: Applications for Micropropulsion Systems
2001-01-11
S., Helvajian , H ., "Batch-Fabricated dA Microthrusters: Initial Results," AIAA paper 96-dpb c2988, July 1996. ,’ \\ 5. Kohler, J., Jonsson, M.,.Simu, U...experimental configuration, the accomplished at very !,v stagnation pmass flow meter operated in the continuuma c c o m p li s h e d ~ ~ ~ I t v e y k w...s a n i o n p r e s s u r er e i e t o u h t p s u e r a g , s d e . operation where the molecule mean free path is regime through the pressure r.ge
DOT National Transportation Integrated Search
2015-07-01
This report documents policy considerations for Response, Emergency Staging and Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E). R.E.S.C.U.M.E. comprises a "bundle" of mobility applications that use existing and new connected vehic...
DOT National Transportation Integrated Search
2014-04-01
This report documents the System Design Document (SDD) for the prototype development and demonstration of the Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) application bundle, with a focus on the Inc...
Automation of the Marine Corps Planning Process
2014-06-01
I & IV P ro b le m Fr am in g C h ap te r II JT C W C P O F IO Sv 1 C O A D e ve lo p m e n t C O A W ar -G am e C O A C o m p...S JA D IC S P SS -S O F St ri ke Li n k C ID N E IO Sv 2 IO Sv 3 M ar in e Li n k Command & Control C h ap te r II I
2010-11-01
o c © — r~ t-~ — oc O ir> r-^ TT ^t TJ-’ — o vc r» r- r-» t-~ r-- (•- vo flj c o •a c 3 — sO — ^O — vC — O^ O (N ro V...i o APPENDIX B 36 60 ON NO o o s. — Z : • PL E a. X r °- u f- — t t ^ E ^/j E. ° r * C^ o & rt ^— ; tO d | TD L c E- ° es t...8217 u. % APPENDIX B 54 H c S-m., -E ao "C ^-^ — ’-> 1 s. 0 c A X - u — li- „_ ra - Sfj Z. o o- _ c* c — 3 o TD : n
JPRS Report, Soviet Union, Military History Journal, No. 3, March 1988.
1988-06-28
S ) After its combat baptism at Sokolovo the Czechoslovak military unit blazed a glorious combat trail together with the Soviet Army. Kiev, Belaya...1988 15 L2 _Q • >> §§■ ocB La < e . ■ .!= SQ P4 cl so leg E < c . SO > c . SO •1 öS Q CL, . ’ S . *7 co 5< « « u o-a-5...o< CO ZQ 10 s.fc > a . z.fc a OS bs *,» . la V. C o n^E ■Sfi .5! E Ic.E ’ S . ^ O fc ’O £ £ -C T> o£«e CJ c- ü< Ub 5 Q o (L, a
Xie, Juan; Zhou, Jie; Zhang, Haifeng; Li, Yin
2011-07-01
Cyanobacteria have become attractive hosts for renewable chemicals production. The low productivity, however, prevents it from industrial application. Reductant NAD(P)H availability is a chief hurdle for the production of reductive metabolites in microbes. To increase NADPH content in Synechocystis sp. PCC 6803, PHB synthase encoding gene phaC and phaE in Synechocystis was inactivated by replacing phaC&E genes with chloromycetin resistance cassette via homologous recombination. PCR analysis showed that mutant S.delta phaC&E with complete genome segregation was generated. The comparison between growth curves of S.wt and S.delta phaC&E indicated the knockout of phaC & phaE genes did not affect obviously the cell growth. Gas chromatography analysis showed that the accumulation of PHB in wild type was about 2.3% of the dry cell weight, whereas no PHB was detected in the mutant S.delta phaC&E. The data indicated that inactivation of PHB synthase gene phaC and phaE interrupted the synthesis of PHB. Further comparative study of wild type and mutant demonstrated that NADPH content in S.delta phaC&E was obviously increased. On the third day, the NADPH content in S.delta phaC&E was up to 1.85 fold higher than that in wild type. These results indicated that deleting PHB synthase gene phaC and phaE not only can block the synthesis of PHB, but also can save NADPH to contribute reductant sink in cyanobacteria. Hence, the engineered cyanobacterial strain S.delta phaC&E, in which carbon flux was redirected and NADPH was increased, will be a potential host strain for chemicals production in cyanobacteria.
Nonlinear Burning Stability of Solid Propellants.
1983-12-31
de f()dO dX dO dX - dx d o d do d 20"--- - f( e ) 2- dX dX dX dX2 Therefore, the steady thermal profile for the same nondimensio- nal temperature...PF ,) C ( e ) de -H )-(1-r )Fo+q (0 gis 0 -C c o out s At the crossing of qg,s(P,R) with qg,s(P,Fo,®_ ), steady solutions R(P, Fo,1 ) vs qg,s are singled...PAGE (Wbrm Dets Entered) Is.-7 *0*" UNCLASSIFIED . " E C U R ITV C L A S S IF IC A T IO N O F T 0 IS P A G rwhI e D o ra E m, -- 20. Continued
2011-12-30
TD O £ c c ^ co — £ °> S5 o E r^ I— E o> ^ LO o 2 O c Q. £ g * CO O =3 CO E c CX) IT) <* CD Q_ C E _Q i_...fe co oo h- O I I I CO (D CO p CO c5 "S _c co o o CO _ TD 5 *> =3 CD -K Ö) s i- CO c 2 o) o .E o CO...CD •o O 0 -4—» CO CD E Ü Q. •D o TD ^ CO O O E CD •+—. CD O CD (D >> ^ >% •4—< *§ CD -•-• O) CD _Q _£Z C CD = < •o D)
DOT National Transportation Integrated Search
2014-01-01
This document provides the high-level functional and performance requirements for the Prototype Development and Demonstration of a R.E.S.C.U.M.E. system. The requirements included in this document are based upon those that can be found in previous R....
1987-04-05
IP o , I-S " M4.7 :" * AMIWILTON & U, .-- EALY(I969) : o H CARROLL(1966) HADLEY (19811 C . Figure 2. P and S-wave velocity structure for Pahute Mesa...8217; 0 .02 s wh ilIe S -. cI by C ) >, s) thIe kta i Is o f t he wav e for:7s are quite well modeled bot h ir tr~~e inversion nd in tefrad mod e Iin~ indi...ESTIMATION 7-Te source parameters determined through waveform inversion for the fo: s o r c ri i c e h v h s~ ahute Mesa events studied are sum.:rarited in
Status and Future of the Naval R&D Establishment
2010-09-23
Market mostly here C u w e s t c o s t Global Allies Quadrant...Becoming more important and threatening L o w Free Market • Requires new mechanisms to handle 17 Framework for Assessment Implications S li Bupp er ase...t c o s t B a s e Corner: • Use sparingly Other US military US H i g u s t o m e r B • Prioritize rigorously Government US Market C u
Dependently Typed Programming with Domain-Specific Logics
2011-02-28
van den Berg and Garner, 2010; Voevodsky, 2010). This work promises a new class of proof assistants that intrinsically support proof irrelevance, equal...InΣ (neuA⇐ neu ⊗ sem) neut : InΣ (semA⇐ neu) slam : InΣ (semA⇐ (∀6 neuC (sem ⊃ sem))) reifyenv : Vars Vars Type reifyenv Ψe Ψs = ([Ψs ] * (neuC...ϕ) = lam · reify (Ψe, , expC) (Ψs, , neuC) σ’ (ϕ [neuC ] ( neut · (. i0))) where σ’ : (reifyenv (Ψe, , expC) (Ψs, , neuC)) σ’ i0 = i0 σ’ (iS x) = iS
Severe Weather Guide - Mediterranean Ports. 2. Naples
1988-01-01
Include Security Classification) S^ere Weather Guide - Mediterranean Ports - 2. Naples (U) ? SONAi <^UTHOR(S) .■/ L,^glebretson, Ronald E. (LCDR...AN ( j. ) HIJ-H F’B (2i 040200 ■ CI ’ 3) (U) C A (b) o I..; i E W C E A F’ P L. IC A T.[ G N Ei IN ! E R N...threatened try actual or -forecast 51 r D n q w i n d s , n i g n a e a s , r s s t r i c t e d v i s i D1111 y o i- thunderstcjrms m the port
77 FR 18671 - Implementation of OMB Guidance on Nonprocurement Debarment and Suspension
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-28
....C. 1082, 1094, 1221e-3, and 3474, unless otherwise noted. Sec. 3485.12 What does this part do? (a)(1.... 2455, Pub. L. 103-355, 108 Stat. 3327 (31 U.S.C. 6101 note); 20 U.S.C. 1082, 1094, 1221e-3, and 3474.... 103-355, 108 Stat. 3327 (31 U.S.C. 6101 note); 20 U.S.C. 1082, 1094, 1221e-3, and 3474, unless...
Building Sustainability into the Air Force Remediation Process
2010-06-16
Phytoremediation Biobarrier Wrap-up Future Direction 2 I n t e g r i t y - S e r v i c e - E x c e l l e n c e AF Environmental Restoration...Bioreactor Phytoremediation Biobarrier I n t e g r i t y - S e r v i c e - E x c e l l e n c e GSR Demo Site: In situ Bioreactor Battery acid... Phytoremediation 24 ’ 98 1998 Nov 1999 Nov 2000 Nov 2001 Nov 2002 Nov 2003 Nov 2004 Nov 2005 Nov 2006 Nov 2007 Nov 2008 Nov 2009 Nov ’ 10 Follow-Up
Edge-to-Stem Variability in Wet-Canopy Evaporation From an Urban Tree Row
NASA Astrophysics Data System (ADS)
Van Stan, John T.; Norman, Zachary; Meghoo, Adrian; Friesen, Jan; Hildebrandt, Anke; Côté, Jean-François; Underwood, S. Jeffrey; Maldonado, Gustavo
2017-11-01
Evaporation from wet-canopy (E_C) and stem (E_S) surfaces during rainfall represents a significant portion of municipal-to-global scale hydrologic cycles. For urban ecosystems, E_C and E_S dynamics play valuable roles in stormwater management. Despite this, canopy-interception loss studies typically ignore crown-scale variability in E_C and assume (with few indirect data) that E_S is generally {<}2% of total wet-canopy evaporation. We test these common assumptions for the first time with a spatially-distributed network of in-canopy meteorological monitoring and 45 surface temperature sensors in an urban Pinus elliottii tree row to estimate E_C and E_S under the assumption that crown surfaces behave as "wet bulbs". From December 2015 through July 2016, 33 saturated crown periods (195 h of 5-min observations) were isolated from storms for determination of 5-min evaporation rates ranging from negligible to 0.67 mm h^{-1}. Mean E_S (0.10 mm h^{-1}) was significantly lower (p < 0.01) than mean E_C (0.16 mm h^{-1}). But, E_S values often equalled E_C and, when scaled to trunk area using terrestrial lidar, accounted for 8-13% (inter-quartile range) of total wet-crown evaporation (E_S+E_C scaled to surface area). E_S contributions to total wet-crown evaporation maximized at 33%, showing a general underestimate (by 2-17 times) of this quantity in the literature. Moreover, results suggest wet-crown evaporation from urban tree rows can be adequately estimated by simply assuming saturated tree surfaces behave as wet bulbs, avoiding problematic assumptions associated with other physically-based methods.
11 CFR 102.14 - Names of political committees (2 U.S.C. 432(e) (4) and (5)).
Code of Federal Regulations, 2010 CFR
2010-01-01
... 11 Federal Elections 1 2010-01-01 2010-01-01 false Names of political committees (2 U.S.C. 432(e... REGISTRATION, ORGANIZATION, AND RECORDKEEPING BY POLITICAL COMMITTEES (2 U.S.C. 433) § 102.14 Names of political committees (2 U.S.C. 432(e) (4) and (5)). (a) The name of each authorized committee shall include...
DOT National Transportation Integrated Search
2015-04-01
This document is the final project technical report for the development and field testing of the Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) application bundle, with a focus on the Incident Zone (I...
MRAPs, Irregular Warfare, and Pentagon Reform
2009-01-01
76 JFQ / issue 55, 4 th quarter 2009 ndupress .ndu.edu MRAPs, Irregular Warfare, and Pentagon Reform By C h r i s t o p h e r J . l a m b , m...a t t h e w J . s C h m i D t , and b e r i t g . F i t z s i m m o n s Mine resistant ambush protected (MRAP) vehicles offer an excellent...issue 55, 4 th quarter 2009 / JFQ 77 LAMB, SCHMIDT, and FITZSIMMONS By C h r i s t o p h e r J . l a m b , m a t t h e w J . s C h m i D t
2008-06-01
ir Fo rc e B as e, T en ne ss ee Fi gu re 1 -2 A er od yn am ic s A er op ro pu ls io n S pa ce & M is si le In fr as...lin es /te xt - fa ci lit ie s in s ta nd by o r m ot hb al le d st at us H ea lth , S af et y an d E nv ir on m en ta l M an ag em en t S ys...yp er so ni c C A er ot he rm al C A FC L La b H E AT -H 2 C C O S
1994-03-01
4- wi 01 (A I- s- 4-’ (A (4 m) 5- C - U 0 0 0 U) 01 0) U) d’ I V) V) ( 1 ) < (0 4S) L C 0 4-) 4) 01 _0 0 > c a) c L 4-) S 1 . - u U C -’ S.- CD 0 C 0 C...4J fo to - i’ Ca 0 cu -n0 C C Co (a IV Q) (n ’C ’C C ) C C E in 0) M) =4 5- L M1 -. 4- I ’ 3: t l) 01 c/) U) C En a) M- 4- .i 4- C C: < -M 44 ’ 1 , . U...0L.0 0) *’- (D M > to -.- - - 0 ’C to It SC a -’ C - = C 4 C ’ E m 4- o S- Li. U 1 :4- :j 4- 4-’ E a 0) 4.- C) 0 (D -- o -’- E C/) < 0 TE >% 4-’ 0- 4
NASA Astrophysics Data System (ADS)
Nadarajah, Saralees; Kotz, Samuel
2007-04-01
Various q-type distributions have appeared in the physics literature in the recent years, see e.g. L.C. Malacarne, R.S. Mendes, E. K. Lenzi, q-exponential distribution in urban agglomeration, Phys. Rev. E 65, (2002) 017106. S.M.D. Queiros, On a possible dynamical scenario leading to a generalised Gamma distribution, in xxx.lanl.gov-physics/0411111. U.M.S. Costa, V.N. Freire, L.C. Malacarne, R.S. Mendes, S. Picoli Jr., E.A. de Vasconcelos, E.F. da Silva Jr., An improved description of the dielectric breakdown in oxides based on a generalized Weibull distribution, Physica A 361, (2006) 215. S. Picoli, Jr., R.S. Mendes, L.C. Malacarne, q-exponential, Weibull, and q-Weibull distributions: an empirical analysis, Physica A 324 (2003) 678-688. A.M.C. de Souza, C. Tsallis, Student's t- and r- distributions: unified derivation from an entropic variational principle, Physica A 236 (1997) 52-57. It is pointed out in the paper that many of these are the same as or particular cases of what has been known in the statistics literature. Several of these statistical distributions are discussed and references provided. We feel that this paper could be of assistance for modeling problems of the type considered by L.C. Malacarne, R.S. Mendes, E. K. Lenzi, q-exponential distribution in urban agglomeration, Phys. Rev. E 65, (2002) 017106. S.M.D. Queiros, On a possible dynamical scenario leading to a generalised Gamma distribution, in xxx.lanl.gov-physics/0411111. U.M.S. Costa, V.N. Freire, L.C. Malacarne, R.S. Mendes, S. Picoli Jr., E.A. de Vasconcelos, E.F. da Silva Jr., An improved description of the dielectric breakdown in oxides based on a generalized Weibull distribution, Physica A 361, (2006) 215. S. Picoli, Jr., R.S. Mendes, L.C. Malacarne, q-exponential, Weibull, and q-Weibull distributions: an empirical analysis, Physica A 324 (2003) 678-688. A.M.C. de Souza, C. Tsallis, Student's t- and r- distributions: unified derivation from an entropic variational principle, Physica A 236 (1997) 52-57 and others.
Uddin, Md Nazim; Begum, Noorjahan; Hassan, Mohammad R; Hogarth, Graeme; Kabir, Shariff E; Miah, Md Arzu; Nordlander, Ebbe; Tocher, Derek A
2008-11-28
The synthesis and reactivity of the thiophyne and furyne clusters [Ru3(CO)7(mu-dppm)(mu3-eta2-C4H2E)(mu-P(C4H3E)2)(mu-H)] (E = S, O) is reported. Addition of P(C4H3E)3 to [Ru3(CO)10(mu-dppm)] (1) at room temperature in the presence of Me3NO gives simple substitution products [Ru3(CO)9(mu-dppm)(P(C4H3E)3)] (E = S, 2; E = O, 3). Mild thermolysis in the presence of further Me3NO affords the thiophyne and furyne complexes [Ru3(CO)7(mu-dppm)(mu3-eta2-C4H2E)(mu-P(C4H3E)2)(mu-H)] (E = S, 4; E = O, 6) resulting from both carbon-hydrogen and carbon-phosphorus bond activation. In each the C4H2E (E = S, O) ligand donates 4-electrons to the cluster and the rings are tilted with respect to the mu-dppm and the phosphido-bridged open triruthenium unit. Heating 4 at 80 degrees C leads to the formation of the ring-opened cluster [Ru3(CO)5(mu-CO)(mu-dppm)(mu3-eta3-SC4H3)(mu-P(C4H3S)2)] (5) resulting from carbon-sulfur bond scission and carbon-hydrogen bond formation and containing a ring-opened mu3-eta3-1-thia-1,3-butadiene ligand. In contrast, a similar thermolysis of 3 affords the phosphinidene cluster [Ru3(CO)7(mu-dppm)(mu3-eta2-C4H2O)(mu3-P(C4H3O))] (7) resulting from a second phosphorus-carbon bond cleavage and (presumably) elimination of furan. Treatment of 4 and 6 with PPh3 affords the simple phosphine-substituted products [Ru3(CO)6(PPh3)(mu-dppm)(mu3-eta2-C4H2E)(mu-P(C4H3E)2)(mu-H)] (E = S, 8; E = O, 9). Both thiophyne and furyne clusters 4 and 6 readily react with hydrogen bromide to give [Ru3(CO)6Br(mu-Br)(mu-dppm)(mu3-eta2-eta1-C4H2E)(mu-P(C4H3E)2)(mu-H)] (E = S, 10; E = O, 11) containing both terminal and bridging bromides. Here the alkynes bind in a highly unsymmetrical manner with one carbon acting as a bridging alkylidene and the second as a terminally bonded Fisher carbene. As far as we are aware, this binding mode has only previously been noted in ynamine complexes or those with metals in different oxidation states. The crystal structures of seven of these new triruthenium clusters have been carried out, allowing a detailed analysis of the relative orientations of coordinated ligands.
Metal-Arc Welded Ti-6Al-4V, Ti-4Al-4V, and Ti-5Al-2 and 1/2 SN Titanium Alloys
1959-05-01
x . 7 8 8 - x 2 . 1 2 i n c h ) V n o t c h Charpy i m p a c t spec imen . MATERIALS COHN* .25 . 2 3 The m a t e r i a l s u s e d d...i e d V n o t c h Charpy i m p a c t spec imen i n a s t a n d a r d i m p a c t machine w i th anvi l s modified so t h a t the center...of percussion of the pendulum coincided with the center of the impact specimen, This FIGURE 3: SUBSIZE T E N S I L E SPECIMEN FIGURE 4
Evaluation of Existing Structures
1974-12-01
13520 500 G0T0C530.S20*530*5*0). JENTRY 13S30C 135440C INPUT LOAD DATA 133S50 510 PRINT 68(P 13560 READDNPOINT.(TT(J) bPP (J).JO1DNPOINT) 13570 FACTOR*1.O...T’)IST(CCI’d0E4,5)) 710p0 ?J.A41-ý4E5T04eS"RTDIST TCl’J0)E-1b)/5) 71 0:0 Snl=S/l(S0Sf)T( CH 4 75( C 1 I0Ex- 15 /5)) 71040 Pl0-t~ fFA ’-1.2q32*SD 710
Socio-behavioral considerations in the role of militant extremism
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bernard, Michael Lewis; Backus, George A.; Beyeler, Walter E.
This paper discusses relevant findings and theories regarding the role of ideology, culture, and context in shaping the behaviors of individuals within violent social movements. Accordingly, this focus concerns the comparative weight placed on ideology and culture (expressed principles and motives) versus external factors as chief influencers for the propensity of individuals to act outside of the norms of society and politics by resorting to violent behaviors. In doing so, we have drawn upon theory from anthropology, behavioral economics, political science, psychology, and sociology to better understand how these variables give birth to and nurture militant social movements. F umore » r t h e r d i s s e m i n a t i o n o n l y a s a u t h o r i z e d t o U . S . G o v e r n m e n t a g e n c i e s a n d t h e i r c o n t r a c t o r s ; o t h e r r e q u e s t s s h a l l b e a p p r o v e d b y t h e o r i g i n a t i n g f a c i l i t y o r h i g h e r D O E p r o g r a m m a t i c a u t h o r i t y .« less
SOCIO-BEHAVIORALCONSIDERATIONS IN THE ROLE OF MILITANT EXTREMISM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bernard, Michael Lewis; Backus, George A.; Beyeler, Walter E.
This paper discusses relevant findings and theories regarding the role of ideology, culture, and context in shaping the behaviors of individuals within violent social movements. Accordingly, this focus concerns the comparative weight placed on ideology and culture (expressed principles and motives) versus external factors as chief influencers for the propensity of individuals to act outside of the norms of society and politics by resorting to violent behaviors. In doing so, we have drawn upon theory from anthropology, behavioral economics, political science, psychology, and sociology to better understand how these variables give birth to and nurture militant social movements. F umore » r t h e r d i s s e m i n a t i o n o n l y a s a u t h o r i z e d t o U . S . G o v e r n m e n t a g e n c i e s a n d t h e i r c o n t r a c t o r s ; o t h e r r e q u e s t s s h a l l b e a p p r o v e d b y t h e o r i g i n a t i n g f a c i l i t y o r h i g h e r D O E p r o g r a m m a t i c a u t h o r i t y .« less
Connor, E. A.; Parsons, R. L.
1984-01-01
Barium-induced alterations in fast excitatory postsynaptic currents (e.p.s.cs) have been studied in voltage-clamped bullfrog sympathetic ganglion B cells. In the presence of 2-8 mM barium, e.p.s.c. decay was prolonged and in many cells the e.p.s.c. decay phase deviated from a single exponential function. The decay phase in these cases was more accurately described as the sum of two exponential functions. The frequency of occurrence of a complex decay increased both with increasing barium concentration and with hyperpolarization. Miniature e.p.s.c. decay also was prolonged in barium-treated cells. E.p.s.c. amplitude was not markedly affected by barium (2-8 mM) in cells voltage-clamped to -50 mV whereas at -90 mV there was a progressive increase in peak size with increasing barium concentration. In control cells the e.p.s.c.-voltage relationship was linear between -20 and -100 mV; however, this relationship became progressively non-linear with membrane hyperpolarization in barium-treated cells. The e.p.s.c. reversal potential was shifted to a more negative value in the presence of barium. There was a voltage-dependent increase in charge movement during the e.p.s.c. in barium-treated cells which was not present in control cells. We conclude that the voltage-dependent alteration in e.p.s.c. decay time course, peak amplitude and charge movement in barium-treated cells is due to a direct postsynaptic action of barium on the kinetics of receptor-channel gating in postganglionic sympathetic neurones. PMID:6333261
77 FR 74472 - Application to Export Electric Energy; Energia Renovable S.C., LLC
Federal Register 2010, 2011, 2012, 2013, 2014
2012-12-14
... Renovable S.C., LLC AGENCY: Office of Electricity Delivery and Energy Reliability, DOE. ACTION: Notice of application. SUMMARY: Energia Renovable S.C., LLC (Energia Renovable) has applied for authority to transmit....C. 7151(b), 7172(f)) and require authorization under section 202(e) of the FPA (16 U.S.C.824a(e...
Pirat, Bahar; Korkmaz, Mehmet Emin; Eroğlu, Serpil; Tayfun, Egemen; Yildirir, Aylin; Uluçam, Melek; Ozin, Bülent; Müderrisoğlu, Haldun
2004-12-01
This study was designed to compare the effects of simvastatin versus a combination of simvastatin with vitamin C or E on serum lipid profile, particularly, high-density lipoprotein (HDL)-cholesterol (C) level, in patients with a low HDL-C level. Fifty-nine women and 49 men, who had a baseline HDL-C level equal to or lower than 40 mg/dl were randomized to one of the following study treatment groups: Group S (n=39) simvastatin 20 mg/day, Group S+C (n=33) simvastatin 20 mg/day + vitamin C 500 mg/day, and Group S+E (n=36) simvastatin 20 mg/day + vitamin E 400 IU/day. The groups' lipid profiles were obtained at baseline, 3rd and 6th months. Comparing with baseline values, total-C and low-density cholesterol (LDL-C) values significantly reduced (p<0.001) and HDL-C values significantly increased (Group S--33.9+/-3.9 mg/dl vs. 39.8+/-6.9 mg/dl, Group S+C--34.2+/-3.5 mg/dl vs. 38.1+/-6.1 mg/dl, Group S+E--33.1+/-3.6 mg/dl vs. 34.8+/-5.9 mg/dl, p<0.001) on therapy within the groups; however, there were no significant differences among the groups with regards to these parameters. The HDL-C levels increased from baseline by 14.0%, 11.7% and 10.2% in Group S, S+C, and S+E, respectively (p>0.05). A combination of simvastatin with antioxidant vitamins does not offer any beneficial effect over simvastatin alone. Particularly vitamin E seems to blunt the simvastatin induced HDL-C increase.
Evaluation of Data on Simple Turbulent Reacting Flows
1985-09-01
rates of reactant consumption, for adequate aspect ratios, in comparison to round jets. The test arrangemnt used by Kremer (1967) to study hydrocarbon...RH0$~qms N sog. a I Skew Kurt c (kg/,,-3) (kg/tr,3) 1.78 0.00 0.2E-01 1.60 0.11E-61 0.968E-02 ..590 -.182E#01E-01 3.08 0.06 0.200E-06 1.e6s e.842E-02...on, x/ra 36.00 C Bulk Jet Velocityy63 m/S, Jot Reynolds No.=8816 C Coflowing Air Violo¢itys9.5 m/s - C X/O Y/0 RMOnwen Fneen RIOrmv Frms I Skew Kurt U
Affordability of Defense Acquisition Programs
2015-02-01
I N S T I T U T E F O R D E F E N S E A N A L Y S E S IDA Paper P-5243 Redacted February 2015 Affordability of Defense Acquisition Programs...Gene H. Porter, Project Leader Kathleen M. Conley C. Vance Gordon R . Royce Kneece, Jr. Brian Q. Rieksts Alan H. Shaw David M. Tate INSTITUTE FOR DEFENSE...Kathleen M. Conley C. Vance Gordon R . Royce Kneece, Jr. Brian Q. Rieksts Alan H. Shaw David M. Tate I N S T I T U T E F O R D E F E N S E A N A L Y S E
China’s ASAT Test: Motivations and Implications
2007-01-01
h i l l i P c . S a u n D e r S and c h a r l e S D . l u t e S Dr. Phillip C. saunders and Colonel Charles D. Lutes, UsaF, are senior Research...at <www.aviationweek.com/aw/generic/story_generic. jsp?channel= awst &id=news/aw012207p2.xml>. 11 Chris Buckley, “China confirms satellite test, says
Editing Procedure for Anthropometric Survey Data
1978-07-01
prs. lli e er 21 A=S(I,1)/N, B=S(I,2)/N, C=S(I,3)/N, D=S(I,4)/N and, Mean = A + S(I,3) Standard Deviation = /B - A*A Veta I = (C - 3BA + 2A3...Aerospace Medical Research Laboratory (AMRL), Wright-Patterson Air Force Base. The authors wish to extend their thanks to C. E . Clauser, Sandra...W (-> u ɛ CO CT> a X! 0 +J rH C -H (U A! -P M-l • C 0 — •H CO CO u * a; x: QJ 0-.+J .p (0 C 0) — cu E +> TH 6
Study of Avalanche Discharge Lasers.
1983-09-30
tic a com ponents ued fosr . o sern tio of X e1 .~i fluorescence an l se S o u r cs wi t as o e r i r s p e s u r e s a n d c r r e n t obseT...R. P . Akins and S. C. Lin, Appl. Phys. Lett. 28, 221 (1976). A 4. C. P . Wang, H. Mirels, D. G. Sutton, and S. N . Suchard, Appl. Phys. Lett. 28 , 326...intensity at the output coupling mirror, Ia , which deter- mines the laser oscillator output power PL P viz., I + n [ exp(2. 303D)+ Raexp(-Z. 33D) f , (9
Advanced Wireless Integrated Navy Network (AWINN)
2006-09-30
AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) Office of Naval Research ONR 313 875 N . Randolph St. 11. SPONSORIMONITOR’S REPORT Arlington...UWB wireless with ESM crane for Sea Basing ap p licatio n s...LD 00) 0 CUU 0~cCCC~) _: a) _) a) <z "c 0C C:U 0cn a) 4- m n 0 C:,) 00 muamC0V 0 ) ~ u vC C - L 0).c - C 7) D E2)7Z CM >u 0-C *0 C ()Q 4-a E) 0 0) 0 0
2016-03-01
Anno vi Acknowledgments First, I would like to express my incredible gratitude...Earth-Moon and Sun-Earth systems in Table 1. 51 T a b le 1 . J a c o b i C o n st a n t V a lu e s a n d R o ta ti n g F ra m e C o o rd in a te s o...g C o o rd in a te s in S y st em E q u a l M a ss S y st em P o in t E a rt h -M o o n S y st em in J a co b i C o n st a n t
Research Apprenticeships for Disadvantaged High Schooler (RADHS)
1981-06-30
Maestas , Director 0 ~ -~ 0(A ea 0 m. 0 L) CL wa’ I.-- - 4...Le) - 4u. -j.. 0 ’ Lii -= L-(. S - u 0o (1) Q. ) 0. 4- Lai _ S .. c tu -L 0 a) 0I. ’ 1 - 4-) CL 0.i 0 4-) c e..j 00C - E CA m) ~ ’ C. a) r_. Mi C > (1...8217 to. L 4-3WC0a E Q) =CL. 0i ’ *1’- W- 0 faa . Xu 4-) *4c U CO C- 4-l Li 4J 10 .0 C 0 c S - 0-’- o w U) ~ 00 ’a (1) 0i 2 C> - CO ’’ 4). C04- 0 S .-
Wang, Ning; Wei, Xing; Zheng, An-Qi; Yang, Ting; Chen, Ming-Li; Wang, Jian-Hua
2017-03-24
A dual functional fluorescent core-shell Ag 2 S@Carbon nanostructure is prepared by a hydrothermally assisted multi-amino synthesis approach with folic acid (FA), polyethylenimine (PEI), and mannoses (Mans) as carbon and nitrogen sources (FA-PEI-Mans-Ag 2 S nanocomposite shortly as Ag 2 S@C). The nanostructure exhibits strong fluorescent emission at λ ex /λ em = 340/450 nm with a quantum yield of 12.57 ± 0.52%. Ag 2 S@C is bound to E. coli O157:H7 via strong interaction with the Mans moiety in Ag 2 S@C with FimH proteins on the fimbriae tip in E. coli O157:H7. Fluorescence emission from Ag 2 S@C/E. coli conjugate is closely related to the content of E. coli O157:H7. Thus, a novel procedure for fluorescence assay of E. coli O157:H7 is developed, offering a detection limit of 330 cfu mL -1 . Meanwhile, the Ag 2 S@C nanostructure exhibits excellent antibacterial performance against E. coli O157:H7. A 99.9% sterilization rate can be readily achieved for E. coli O157:H7 at a concentration of 10 6 -10 7 cfu mL -1 with 3.3 or 10 μg mL -1 of Ag 2 S@C with an interaction time of 5 or 0.5 min, respectively.
Optimization of Daily Flight Training Schedules
2014-03-01
iep iep ip X s e p Y i e p L i e p W...SOLO L CQ CQ | | 2 , | d d d iep iep ip p P p Pe e E e e E p P P Y L W i d i I (3) SOLO L CQ | | 2 , | d d iep ... iep p P p Pe e E e e E Y L i d i I (4) 1 , | , "CQ" o s sep s p p X s e e C e (5) 0 0 | 2 , s d s sep s e C p
24 CFR 16.15 - Specific exemptions.
Code of Federal Regulations, 2010 CFR
2010-04-01
...), (e)(1), (e)(4) (G), (H), (I), and (f). This exemption allows the Department to withhold records... under 5 U.S.C. 552(k)(5) from the requirements of 5 U.S.C. 552a (c)(3), (d), (e)(1), (e)(4), (G), (H... subsection (e)(1) because it is often impossible to determine relevance or necessity of information in pre...
Noninvasive Localization of Prostate Cancer via Diffusion Sensitive MRI
2007-03-01
16: 196-200, 2002. 13. Chan, I., Wells, W., 3rd, Mulkern, R. V., Haker , S., Zhang, J., Zou, K. H., Maier, S. E., and Tempany, C. M. Detection of...for Magnetic Resonance in Medicine, 13: 269, 2005. 31. Haker , S. J., Szot Barnes, A., Maier, S. E., Tempany, C. M., and Mulkern, R. V. Diffusion...Resonance in Medicine, 13: 2126, 2005. 32. Roebuck, J. R., Haker , S. J., Tempany, C. M., Rybicki, F. J., Maier, S. E., and Mulkern, R. V. Diffusion
Code of Federal Regulations, 2010 CFR
2010-10-01
... of the Secretary of Transportation by subsection (e)(1), (2), and (6)(A) of section 6 of the..., 20305, 20502-20505, 20901, 20902, and 80504, formerly codified at 49 App. U.S.C. 1655(e)(1), (2), and (6)(A)). 49 U.S.C. 20111 and 20109, formerly codified at 45 U.S.C. 437 (note) and 441(e). Those laws...
24 CFR 954.4 - Other Federal requirements.
Code of Federal Regulations, 2010 CFR
2010-04-01
... Section 7(b) of the Indian Self-Determination and Education Assistance Act (25 U.S.C. 450e(b)). Section 7...) Definitions. (i) The Indian Self-Determination and Education Assistance Act (25 U.S.C. 450e(b)) defines... Section 7(b) of the Indian Self-Determination and Education Assistance Act (25 U.S.C. 450e(b)) (Indian Act...
Handbook of Modeling for Circuit Analysis Including Radiation Effects
1979-05-01
appropriate chapter’s. ithis handbook is the Cuhlifnation of several years,’ eftort by many persons and orljan i’- la tions in modeliing of semi conductor...o . t ’ LA 4 - 11-13 ,* ’ C i0 S0 ,i i *e=S...S.. * * - a ’ta (a* * to LA - C 0 (a 0. 40 2Z - - - 0 * La C 0 40to E Ct, C C V to V * 5- - - 0% * .- * S * * C * a -, * 4 . V - * L
Planning, Programming, and Budgeting System (PPBS)/Multi-year Programming: Reading Guide
2010-09-01
51 B -4 Potter, Barry H ., and Jack Diamond. Guidelines for Public Expenditure...IS PA GE 1 9 b . TE LE P H ON E N U M B E R ( I n c l u d e A r e a C o d e ) U U U ...I N S T I T U T E F O R D E F E N S E A N A LY S E S IDA Document D-4057 Log: H 10-000982 September 2010 Planning, Programming, and Budgeting
2010-01-01
Academy, the Department of the Army, or any other agency of the U.s. Government. C o M B A T I n G T E R R o R I s M C E n T E R A T W E s T...p o I n T o B j E C T I V E . R E L E V A n T . R I G o R o U s CTC SeNTiNeL Usama bin Ladin explains why he declared jihad against the United...Taliban professed today by al- Qa`ida and its Pakistan-based allies— including the Haqqani network and Tehrik- i -Taliban Pakistan (TTP)—is more a
Design of a Persistence Server for the Relational Hypergraph Model
1999-12-01
HH C O o _CD u _D- CO CD...X c 2 II E 2 § o c >» C .3 .2 Q — "a O u >» 00 HH 1) Ü CJ > 00 O CO > PH S .2 .22 J 5 c -a zz O (50 to C "x ’S...X CS 3 X & O « 1 H < X X es es d d e e cj cj 3 3 o o E a 3 HH c CS e e o o 3 3 aa oa o o o <-. a o 3 — pa ^ tad
Empirical Characterization of Unconstrained Tape Spring Deployment Dynamics
2012-03-22
1 ) ∗ s (2 ) ∗c (3 ) , −s (1 ) ∗c (3 )+c (1 ) ∗ s (2 ) ∗ s (3 ) , c (1 ) ∗c (2 ) ; . . . ] ∗ ( data ’ ) ) ’ ; % o r i g i n a l f ormu la t ion : 1...data ’ ) ) ’ ; 756 % o r i g i n a l f ormu la t ion : 1−2−3 % the t a=ang l e s ; % gdata = ( ( [ 1 , 0 , 0 ; 0 , cos ( t h e t a (1) ) ,− s
The Effect of Strakes on Vortical Flows Applied to Aircraft.
1984-03-31
ORDONEZ 31 NRR 84 UNCLASSIFIED VK! PR-1983 22 EOARD-TR-94-14 RFOSR-83-8i26 F /G 2014 ML _mhhhhhmhhmml Iommomom Ilffffffffffff Big I. ’z.’ MICROCOPY...dS - f dS (1) ’A This equation does not take into account the effect of pressure gradients between the control surfaces. The total head formula is...000 E+0 C’_. 3C’’)C .r.,E+ 02 0, 15C’C’C ’E+ (2 - . 129704E-12 -C’. 120900E- 12 0. 250’)’OE+02 1’ 5 f ’ 0CCE+ 02 -0 176122E+02 -0. 194824E+00 0. 2rQCQ
Publications - RI 2015-6 | Alaska Division of Geological & Geophysical
., Schwab, C.E., Silva, S.R., Smith, T.E., and Zehner, R.E. Publication Date: Sep 2015 Publisher: Alaska , C.E., Silva, S.R., Smith, T.E., and Zehner, R.E., 2015, Geologic maps of the eastern Alaska Range
Lipid metabolites with free-radical scavenging activity from Euphorbia helioscopia L.
Cateni, F; Zilic, J; Altieri, T; Zacchigna, M; Procida, G; Gaggeri, R; Rossi, D; Collina, S
2014-07-01
The methanolic extract of the plant Euphorbia helioscopia L. exhibited an interesting free-radical scavenging activity. From the aerial parts of Euphorbia helioscopia L. (Euphorbiaceae), a complex mixture of seven cerebrosides together with glucoclionasterol, a digalactosyldiacylglycerol and a diacylmonogalactosylglycerol were identified. The structures of the cerebrosides were characterized as 1-O-β-D-glucosides of phytosphingosines, which comprised (2S, 3S, 4E, 8E)-2-amino-4(E),8(E)-octadecadiene-1,3-diol, (2S, 3S, 4E, 8Z)-2-amino-4(E),8(Z)-octadecadiene-1,3-diol, (2S, 3S, 4R, 8Z)-2-amino-8(Z)-octadecene-1,3,4-triol as long chain bases with seven 2-hydroxy fatty acids of varying chain lengths (C16, C24:1, C26:1, C24, C26, C28:1) linked to the amino group. The glycosylglycerides were characterized as (2S)-2,3-O-di-(9,12,15-octadecatrienoyl)-glyceryl-6-O-(α-D-galactopyranosyl)-β-D-galactopyranoside and (2S)-2,3-O-di-(9,12,15-octadecatrienoyl)-glyceryl-1-O-β-D-galactopyranoside. The structures were established on the basis of spectroscopic data and chemical reactions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
1989-03-01
e"-s tcc,: -e .- r reverse of necessary an., ice-tfy by bi.-:’ ru-’ce," 5uz"ou configuration management. Delphi method. Command and Control 19 Ac-s:’a...Aos!,ac: 21 Aostraczt Security Classitcator : R uncassf~’! i~e sa-e as renc- E 0orC users Unclassified 22a Na-e of Respon’s :e iro, v c a 22o Te’eo’one...i!r’ciule A’ea coce’ 22: C’" ce . Thomnas 1’. Mitchell (4081 646-2620 155k.11i DD FORI, 1473.6.: VAR 63 A-- R e-.!c- rnay be usec~ unti exhausted se
Investigation of a Cesium Raman Time/Frequency Standard
1991-12-01
0. 1 4 XZ E(r, t) = ’h/(El(r)exp(- iwlt ) + c.c.) 0 + ’/,(E 2(r)exp(- iw.2t) + c.c.). (2) - /2 eAll remaining notations are defined in Table 1. By...h P - P33 Rabi frequency for 3-2 transition 92 = 623 E2 )/h [ [r Rotating-wave (a~~012 = P12 exp(- iwlt ) S 0 0i 2Ra 1 1f2sRotating-wav e a,3 2 e p(-i
Dual RING E3 Architectures Regulate Multiubiquitination and Ubiquitin Chain Elongation by APC/C.
Brown, Nicholas G; VanderLinden, Ryan; Watson, Edmond R; Weissmann, Florian; Ordureau, Alban; Wu, Kuen-Phon; Zhang, Wei; Yu, Shanshan; Mercredi, Peter Y; Harrison, Joseph S; Davidson, Iain F; Qiao, Renping; Lu, Ying; Dube, Prakash; Brunner, Michael R; Grace, Christy R R; Miller, Darcie J; Haselbach, David; Jarvis, Marc A; Yamaguchi, Masaya; Yanishevski, David; Petzold, Georg; Sidhu, Sachdev S; Kuhlman, Brian; Kirschner, Marc W; Harper, J Wade; Peters, Jan-Michael; Stark, Holger; Schulman, Brenda A
2016-06-02
Protein ubiquitination involves E1, E2, and E3 trienzyme cascades. E2 and RING E3 enzymes often collaborate to first prime a substrate with a single ubiquitin (UB) and then achieve different forms of polyubiquitination: multiubiquitination of several sites and elongation of linkage-specific UB chains. Here, cryo-EM and biochemistry show that the human E3 anaphase-promoting complex/cyclosome (APC/C) and its two partner E2s, UBE2C (aka UBCH10) and UBE2S, adopt specialized catalytic architectures for these two distinct forms of polyubiquitination. The APC/C RING constrains UBE2C proximal to a substrate and simultaneously binds a substrate-linked UB to drive processive multiubiquitination. Alternatively, during UB chain elongation, the RING does not bind UBE2S but rather lures an evolving substrate-linked UB to UBE2S positioned through a cullin interaction to generate a Lys11-linked chain. Our findings define mechanisms of APC/C regulation, and establish principles by which specialized E3-E2-substrate-UB architectures control different forms of polyubiquitination. Copyright © 2016 Elsevier Inc. All rights reserved.
JAL (RH48) blood group antigen: serologic observations
Lomas-Francis, Christine; Alcantara, Denden; Westhoff, Connie; Uehlinger, Joan; Valvasori, Marilia; Castilho, Lillian; Reid, Marion E.
2009-01-01
BACKGROUND JAL (RH48) is a low-prevalence antigen in the Rh blood group system and anti-JAL has caused hemolytic disease of the newborn. JAL is associated with either a haplotype carrying depressed C and e antigens or one carrying depressed c and e antigens. Blood samples from JAL+ people were tested, published serologic findings were confirmed, serologic studies were extended to include expression of other Rh antigens, and the antibody specificities produced by three sensitized JAL+ probands are reported. STUDY DESIGN AND METHODS Red blood cell (RBC) samples from 17 (12 probands) JAL+ persons were tested by hemagglutination using standard methods. RESULTS RBCs from both the Caucasian JAL+ probands had the (C)(e) haplotype and weakened C, e, hrB, and hrS antigens. JAL+ samples from black persons had the (c)(e) haplotype and expressed weakened c, e, f, V, VS, hrB, and hrS antigens. Plasma from three sensitized c+e+ JAL+ probands contained alloanti-c, alloanti-e, or alloantibody of apparent anti-Rh17 specificity. This study shows that this alloanti-Rh17–like antibody recognizes the high-prevalence antigen antithetical to JAL that has been named CEST. CONCLUSIONS The presence of the JAL antigen has a quantitative (weakening) effect on the expression of C, e, hrB, and hrS antigens in Caucasian persons and of c, e, f, V, VS, hrB, and hrS antigens in people of black African ancestry. A qualitative effect also was demonstrated by the presence of alloanti-c or alloanti-e in the plasma of two transfused c+e+ patients and by an antibody (anti-CEST) that recognizes the high-prevalence antigen antithetical to JAL. PMID:19192256
Navy Nearshore Ocean Prediction Systems
2014-09-01
SYSTEMS B Y J AYA R A M V E E R A M O N Y, M A R K D . O R Z E C H , K A C E Y L . E D W A R D S , M I C H A E L G I L L I G A N , J E I K O O...tthor(s) Name(s) (FirstMl est), Code, Afliliation not NR,L / layaram Vet~ramony 7 Mark D 01’%ech 732 Kacey L...Edwards 732{ Michael Gilligan NAVO Eric Terrill Unlv. of CA- Soripp~ rony dePaolo Unlv. of CA. Scripps s intend~ d to offer this paper to the (Nt;~m& of
Occupational Survey Report AFSC 3E6X1; Operations Management
2004-02-01
Lt Bryan Pickett Feb 04 Occupational Survey Report AFSC 3E6X1 Operations Management I n t e g r i t y - S e r v i c e - E x c e l l e n c e...Report AFSC 3E6X1 Operations Management 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK...Nellis AFB NV (5) • Fairchild AFB WA (5) • Hurlburt Field FL (6) • Eglin AFB FL (4) • Ramstein AB (5) Operations Management 3E6X1 February 2004 (Approved
2012-04-01
y B e n e fi ts P h y s ic a l...J o b A ff e c ti v e C o m m it m e n t C o n ti n o u s C o m m it m e n t N o rm a ti v e C o m m it m e n t Pa y 1.00 Be ne fits 0.42 1.00...group is sometimes called the “ Millennial Group”. Research in the area of leading millennials at TACOM was completed by Pamela Demeulenaere
Evaluating the Effectiveness of Air Force Foundational Cyberspace Training
2012-06-14
fileticket=zAcDCP6H2T4%3d&tabid=56&mid=415 (accessed 25 May 2012). VIT .1 Vita . U N I T E D S T A T E S A I R F O R C E MAJOR APRIL...as of May 2012) VIT .2 . U N I T E D S T A T E S A I R F O R C E MAJOR APRIL L. WIMMER ASSIGNMENTS 1. September 2000
Antibody Contributes to Heterosubtypic Immunity In the Cotton Rat Model of Influenza
2010-09-29
K 1 e t c b l E v v R o M 0 d Vaccine...described in Section 2. accine 24 (2006) 6264–6271 6267 B i o ( r t A 3 v A g A t m ( g w p f i p h i s i m 9 n V h s i p k t c Table 2 Proportion of...5493. Epstein, S.L., C.Y. Lo, J.A. Misplon, C.M. Lawson, B.A. Hendrickson, E.E. Max, K . Subbarao . 1997. Mechanisms of heterosubtypic immunity
Motivation: A Seminar to Assist Charge Nurses in Understanding Motivation and Worker Behavior
1988-05-01
c . Growth needs - need for personal growth and development. 0 2. Alderfer - believes...H 0s 0. rj 4 a3Lr ()3 0 L) 0 -P E000 0) - - -O൱ =1 0 -j Ln - .0 03 0:44 U- 0 -a 6 .1-. c 41 0 c Ii - - u t- <I, LO0 E D, fn 441 0~-t 0 0~( 1-a-i-I...U -7- 0 Fi1aU 0C >. 0 s .0> 0 .0 -,~~L -.. 0~~a tn V wC co c 0 >4 u t4 _-.,d ~ ’ C OC)o E LL 0C) 4J. -H - C C ) -, E - E 00 Z C a 0 C )
Simulators Sustainment Management: Advanced Planning Information
2006-05-23
1M per year Competition Type: TSA II Small Business Set-A-Side, FFP Program Mgr : James H. Burks,507 ACSS/GFLC, (801) 586-1859; jim.burks...ACRONYM(S) 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12 . DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release; distribution unlimited 13...BEST O G D E N A I R L O G I S T I C S C E N T E R Training Systems Business Opportunities FY06-07 HC-130P Weapon System Trainer T-38C Aircrew
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-08
... 1966, as amended, 16 U.S.C. 469-469(c). 12. American Indian Religious Freedom Act, 42 U.S.C. 1996. 13... Populations; E.O. 11593, Protection and Enhancement of Cultural Resources; E.O. 13007, Indian Sacred Sites; E...
2004-08-01
sp ec if ic ra d io n u cl id es 9 0 0 S er ie s 3 2 In te ri m F in al – A u g u st 2 0 0 4 R E S...in je ct io n , h ea d sp ac e S ee M o d u le 4 A n a ly si s: G C /M S , G C , H P L C , L C -M S U n k n o w n in o rg an ic s 1 L...er f o r th e m et er o r k it u se d d u ri n g s
Increasing Regulatory Acceptance of Passive Samplers
2010-12-01
microextraction ( SPME ) • Accumulate freely-dissolved organic contaminants from surrounding water into a solid phase • Contaminant concentrations of the...based on SPME (pg/L) D i s s o l v e d C o n c e n t r a t i o n b a s e d o n M u s s e l s ( p g / L ) 4,4’-DDE 4,4’-DDD 4,4’-DDT 1:1 line
Observation of e+e-→ϕ χc 1 and ϕ χc 2 at √{s }=4.600 GeV
NASA Astrophysics Data System (ADS)
Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, P. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guo, A. Q.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuessner, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K. J.; Li, Kang; Li, Ke; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. M.; Liu, Huanhuan; Liu, Huihui; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Muchnoi, N. Yu.; Muramatsu, H.; Musiol, P.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Pitka, A.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, Meng; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wang, Zongyuan; Weber, T.; Wei, D. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhou, Y. X.; Zhu, J.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration
2018-02-01
Using a data sample collected with the BESIII detector operating at the BEPCII storage ring at a center-of-mass energy of √{s }=4.600 GeV , we search for the production of e+e-→ϕ χc 0 ,1 ,2 . A search is also performed for the charmonium-like state X (4140 ) in the radiative transition e+e-→γ X (4140 ) with X (4140 ) subsequently decaying into ϕ J /ψ . The processes e+e-→ϕ χc 1 and ϕ χc 2 are observed for the first time, each with a statistical significance of more than 10 σ , and the Born cross sections are measured to be (4. 2-1.0+1.7±0.3 ) and (6. 7-1.7+3.4±0.5 ) pb , respectively, where the first uncertainties are statistical and the second systematic. No significant signals are observed for e+e-→ϕ χc 0 and e+e-→γ X (4140 ) and upper limits on the Born cross sections at 90% C.L. are provided at √{s }=4.600 GeV .
Numerical Analysis of Turbulent Separated Subsonic Diffuser Flows
1977-02-01
the s u b l a y e r r eg ion when one a t t e m p t s to use a un i fo rm coord ina te s y s t e m to d e s c r i b e the p r o - f i l es ...s u m e d p ro f i l e in the v ic in i ty of s e p a r a t i o n is ques t ionable . C l e a r l y , an adequate solut ion r e q u i r e s...in an 8-dell conical diffuser. 7.15 m O ,o H l 01 O1 (O AEDC-TR-76-159 1 .0 u~ O k O 4~ eS r-4 a ~4 el 0 . 8 0 . 6 0 . 4
Tripolar Stability: The Future of Nuclear Relations Among the United States, Russia, and China
2002-09-01
I N S T I T U T E F O R D E F E N S E A N A L Y S E S D E F E N S E T H R E A T R E D U C T I O N A G E N C Y Tripolar Stability: The Future of... Tripolar Stability: The Future of Nuclear Relations Among the United States, Russia, and China Brad Roberts PREFACE Since the creation of the...here were first sketched out in a symposium convened at IDA on July 28 on nuclear tripolarity , where thoughtful presentations were made on facets
PLA Naval Aviation Training and Operations
2017-12-20
cr aft Ty p es,” Re n mi n H aij u n , 1 6 A pril 2 0 1 3, p. 3. 3 3 I bi d. 3 4 K o u Yo n g qi a n g, Li Yi mi n, a n d Li X u ef e n g, “ Ta k e...6 a e 4 d 0 d 6 c 1.s ht ml. C h e n Z h e, Z h u Weij u n, a n d Z h u Ya, “ Yo u n g Offi c ers a n d E nlist e d Pers o n n el i n a N ort h S e a...ct o b er 2 0 1 4 , p. 3. MI S SI O N S, O R G A NI Z A TI O N A L S T R U C T U R E, A N D T R AI NI N G ( 2 0 1 3- 1 5) 8 5 K o u Yo n g qi a n g
Sarén, Anne; Virkola, Ritva; Hacker, Jörg; Korhonen, Timo K.
1999-01-01
The adhesion of the S fimbriae of meningitis-associated Escherichia coli O18ac:K1:H7 to the cellular and the plasma forms of human fibronectin was studied. E. coli HB101(pAZZ50) expressing the complete S-fimbria II gene cluster of E. coli O18 adhered to cellular fibronectin (cFn) on glass but not to plasma fibronectin (pFn). Adhesion to cFn was specifically inhibited by neuraminidase treatment of cFn as well as by incubation of the bacteria with sialyl-α2-3-lactose, a receptor analog of the S fimbriae. No significant adhesion to cFn or pFn was detected with E. coli HB101(pAZZ50-67) expressing S fimbriae lacking the SfaS lectin subunit. Strain HB101(pAZZ50) also adhered to a human fibroblast cell culture known to be rich in cFn, and the adhesion was specifically inhibited in the presence of polyclonal antibodies to cFn. The results show that the SfaS lectin of the S fimbriae mediates the adherence of meningitis-associated E. coli to sialyl oligosaccharide chains of cFn. PMID:10225941
Optoelectronics Research Center
2012-01-03
Stone, A. Malcoci, R. E. Miles, and I . Camara Mayorga, Electron. Lett., 41, 128–129, (2005). 10S. D. Roh, T. S. Yeoh, R. B. Swint, A. E. Huber, C. Y...and K. A. Shore, Unlocking dynamical diversity, Wiley, 2005. 14F. Grillot, K. Veselinov, M. Gioannini, I . Montrosset, J. Even, R. Piron, E. Homeyer, S...Bimberg, IEEE J. Sel. Topics Quantum Electron., 8, pp. 984-991, (2002). 16M. A. Cataluna, D. I . Nikitichev, S. Mikroulis, H. Simos, C. Simos, C
Kawachi, Masanao; Matsunaga, Yugo; Tanaka, Takao; Hori, Yuko; Ito, Katsunori; Nagahama, Kenji; Ozaki, Tomoko; Inoue, Naonori; Toda, Ryoko; Yoshii, Kazuyoshi; Hirayama, Masamichi; Kawabata, Yoshihiro; Takei, Mineo
2011-09-01
In clinical trials, acotiamide hydrochloride (acotiamide: Z-338) has been reported to be useful in the treatment of functional dyspepsia. Here, we investigated the effects of acotiamide on gastric contraction and emptying activities in rats in comparison with itopride hydrochloride (itopride) and mosapride citrate (mosapride). We also examined in vitro the compound's inhibitory effect on acetylcholinesterase (AChE) activity derived from rat stomach. In in vivo studies, acotiamide (30 and 100mg/kg s.c.) and itopride (100mg/kg s.c.) markedly enhanced normal gastric antral motility in rats. In gastric motility dysfunction models, acotiamide (100mg/kg s.c.) and itopride (100mg/kg s.c.) improved both gastric antral hypomotility and the delayed gastric emptying induced by clonidine, an α(2)-adrenoceptor agonist. In contrast, mosapride (10mg/kg s.c.) had no effect on these models. Like the AChE inhibitors itopride (30 mg/kg s.c.) and neostigmine (10 μg/kg s.c.), acotiamide (10mg/kg s.c.) also clearly enhanced gastric body contractions induced by electrical stimulation of the vagus, which were abolished by atropine and hexamethonium, whereas mosapride (3 and 10mg/kg s.c.) did not. In in vitro studies, acotiamide concentration-dependently inhibited rat stomach-derived AChE activity (IC(50)=2.3 μmol/l). In addition, stomach tissue concentrations of acotiamide after administration at 10mg/kg s.c. were sufficient to produce inhibition of AChE activity in rat stomach. These results suggest that acotiamide stimulates gastric motility and improves gastric motility dysfunction in rats by inhibiting AChE activity, and may suggest a role for acotiamide in improving gastric motility dysfunction in patients with functional dyspepsia. Copyright © 2011 Elsevier B.V. All rights reserved.
Word Frequency Analysis. MOS: 51C. Skill Levels 1 & 2.
1981-05-01
FF-TCR1NG I RESTS 2 RESULT I RESJLTS I VETA I NS 3 it 0Up N I R~vERS-1L. I F E VtS ZNG I PEVELVIKG MOS WORDo LISTINGASCENDIIG SECUEME C.ATE 93259 t39...1 0 J CACCUPULATEG 1 J fiCID I * ?L4CoS 1 j & T.CrC$S 2 0 J tAnJUSTASLE I J rC.Ff ER 8 J E .11:-COflOITIOING 5 *J CALL 1 0 J LALLOM I J (A~LLOW~S 4 *J...ALCMj 3 *J &:.L" VS 1 0 3 12 0 j ...’Jo I *J W Git Z I ., 1 4 J fNVIL I ’ . lUV I J E C.PPEAJRS I I J E .*,PL! CATION 2 2 C. PPLY I 3 C.;PPPtovEo a 3
H.E.S.S. and ATOM detection of renewed activity of the FSRQ 3C 279
NASA Astrophysics Data System (ADS)
De Naurois, Mathieu
2018-06-01
H.E.S.S. observations at very-high energies (E > 100 GeV) of the flat spectrum radio quasar 3C 279 (reshift z=0.536, R.A.: 12h56m11.1665s, Dec: -05d47m21.523s (J2000)) have been carried out over the last 3 nights on the basis of another strong flare in the high-energy gamma-ray band (E > 100 MeV) detected with Fermi-LAT.
Evidence for e+e-→γ ηc(1 S ) at center-of-mass energies between 4.01 and 4.60 GeV
NASA Astrophysics Data System (ADS)
Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Alekseev, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dorjkhaidav, O.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garillon, B.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, S.; Gu, Y. T.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, S. H.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, K. J.; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J. B.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Morello, G.; Muchnoi, N. Yu.; Muramatsu, H.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Pitka, A.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qi, T. Y.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B. T.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, X. H.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration
2017-09-01
We present first evidence for the process e+e-→γ ηc(1 S ) at six center-of-mass energies between 4.01 and 4.60 GeV using data collected by the BESIII experiment operating at BEPCII. We measure the Born cross section at each energy using a combination of twelve ηc(1 S ) decay channels. We also combine all six energies under various assumptions for the energy-dependence of the cross section. If the process is assumed to proceed via the Y (4260 ), we measure a peak Born cross section σpeak(e+e-→γ ηc(1 S ))=2.11 ±0.49 (stat . )±0.36 (syst . ) pb with a statistical significance of 4.2 σ .
Fiscal Year 2010 Budget Request. Summary Justification
2009-05-01
FISCAL YEAR 2010 BUDGET REQUEST S U M M A R Y J U S T I F I C A T I O N • M A Y 2 0 0 9 U N I T E D S T A T E S D E P A R T M E N T O F D...E F E N S E Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting burden for the collection of information is estimated to average...Justification 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7
CHRIS. Response Methods Handbook.
1978-12-01
ssnrlc and a liIiqtiid porn pI to rc novc colicted material, t hereby convcert in ile wSNStcl ii ito a cOn tin iiooS proccss. Most vacuum i systemirs...cid50 PF FGE F G.E P G Forelelud40% P G.E E P Chromic: kcid Eon. P P,F C Foroalehyle G.E E C E P I Citric kid G.E E C E P C Formic kcid 10% F.C.C G.E
History of the Chaparral/FAAR Air Defense System
1977-05-31
i s t ed of t h e AN/DAW-1 guidance s e c t i o n ; t h e M817 t a r g e t d e t e c t i o n device (DIDO f u z e ) ; t h e M250 b l a s t...19n, 21-22, 25, 25n, 27-28, 30-32, 51, 88-89, 107-109, 175 Warhead Blast Fragmentation (BF), 92, 118 M250 (XM-250), 116, 119 continuous rod, 12
Publications - Plafker, George and Berg, H.C., 1994 | Alaska Division of
, M.S., Smith, T.E., Berg, H.C., Andersen, G.L., Chipp, E.R., Gaard, D.R., Burton, P.J., Dunbler, John ., Newberry, R.J., Rogers, R.K., Rubin, C.M., Swainbank, R.C., Smith, P.R., and Stephens, Jackie, 1994 , H.C., Brew, D.A., Grybeck, Donald, Robinson, M.S., Smith, T.E., and Yeend, Warren, 1994, Metallogenic
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-20
...-1996a]; Farmland Protection Policy Act (FPPA) [7 U.S.C. 4201- 4209]. 7. Wetlands and Water Resources... Recovery Act (RCRA), [42 U.S.C. 6901- 6992(k)]. 9. Executive Orders: E.O. 11990 Protection of Wetlands; E.O..., as amended [16 U.S.C. 470(f) et seq.]; Archeological Resources Protection Act of 1977 [16 U.S.C. 470...
Innovative Optoelectronic Materials and Structures Using OMVPE
1991-03-19
Leite. and S. P. S. of the GRIN region where the optical mode is most intense. Porto ( Flammarion , Paris. 1976), p. 656. The full-width at half...R. C. C. "N. Hooyak. Jr., D. W. Nan, W. E PIano E. I ’Visely, and K. C. Hsieh, Leite, and S. P. S. Porto ( Flammarion , Paris, 1976), p. 145. Appl
1975-07-01
pitot p robes . T e m p e r a - tu re probe TT 2 was 0.010 in. in d i a m e t e r and was used as the p r i m a r y i n s t r u m e n t . P...lower pitot probe , PPl , was c o n s t r u c t e d of 0. 0 2 0 - i n . - O D tubing t a p e r e d to 0 .014 in. at the t ip and had an ins ide...t ion in the model boundary l a y e r . The o the r pitot probe , PP2, was loca ted about 1.0 in. above PPl and was c o n s t r u c t e d of
Song, Heng; Hu, Wen; Naowarojna, Nathchar; Her, Ampon Sae; Wang, Shu; Desai, Rushil; Qin, Li; Chen, Xiaoping; Liu, Pinghua
2015-01-01
Ergothioneine is a histidine thio-derivative isolated in 1909. In ergothioneine biosynthesis, the combination of a mononuclear non-heme iron enzyme catalyzed oxidative C-S bond formation reaction and a PLP-mediated C-S lyase (EgtE) reaction results in a net sulfur transfer from cysteine to histidine side-chain. This demonstrates a new sulfur transfer strategy in the biosynthesis of sulfur-containing natural products. Due to difficulties associated with the overexpression of Mycobacterium smegmatis EgtE protein, the proposed EgtE functionality remained to be verified biochemically. In this study, we have successfully overexpressed and purified M. smegmatis EgtE enzyme and evaluated its activities under different in vitro conditions: C-S lyase reaction using either thioether or sulfoxide as a substrate in the presence or absence of reductants. Results from our biochemical characterizations support the assignment of sulfoxide 4 as the native EgtE substrate and the involvement of a sulfenic acid intermediate in the ergothioneine C-S lyase reaction. PMID:26149121
Pressures on DoD’s Budget Over the Next Decade
2016-11-16
Congressional Budget Office Pressures on DoD’s Budget Over the Next Decade Presentation at the Professional Services Council 2016 Vision Federal...E Outline • Fiscal Situation • Implications of Budget Control Act • Internal Pressures on DoD’s Budget 2C O N G R E S S I O N A L B U D G E T O F F...I C E Deficits or Surpluses Under CBO’s Baseline for FY 2016 CBO’s Baseline Projection Source: Congressional Budget Office, An Update to the
Application of Future State Decision Making in the Eagle Combat Model
1990-09-01
not reflect the official policy or position of the Department of Defense or the U.S. Government. 1 7 Cosati Codes 18 S:iDj,.ct Terms (continue on... cncd 30 40 co el C14N- LI)I E- . IC041 00 E E. C) CD 0 06. 4104 xd- .r - 1 w a S.CL U.~- 0 S.31 Cl- w cu N ~ ~ -.- - f Lin EEn LM 0f CCN. ’C4 0 4-it 0
Reforming the Joint Chiefs of Staff.
1983-08-01
i . 1. 1 e, * vJ. r ŗi. - .- F-S.., Ar;:it:d ’t i . i . A i r For -::. r ic c.r .m’, I 蟙 a...understandi rig of Lhe Is i ev c:i. tt i on c-f u?e i r -. i t L jon,, Wi thoh U t he benef it of a hi t:or i c.- 1 n-Ii :z I s, there i s a tendency...by criticez- of t. he JCS L i gl IDre t s or i . gi i al purpose& and 1 i mi tat i ons. e r
2016-03-16
whistleblower protection, please see the inside back cover. I N T E G R I T Y E F F I C I E N C Y A C C O U N T A B I L I T Y E X C E L L...USTRANSCOM United States Transportation Command Whistleblower Protection U.S. Department of Defense The Whistleblower Protection Enhancement Act of...2012 requires the Inspector General to designate a Whistleblower Protection Ombudsman to educate agency employees about prohibitions on retaliation
Observation of e + e → Φ χ c 1 and Φ χ c 2 at s = 4.600 GeV
Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...
2018-02-12
Using a data sample collected with the BESIII detector operating at the BEPCII storage ring at a centerof- mass energy of √s = 4.600 GeV, we search for the production of e +e - → φχ c0,1,2. A search is also performed for the charmonium-like state X(4140) in the radiative transition e +e - → γX(4140) with X(4140) subsequently decaying into φJ/ψ. The processes e +e - → φχ c1 and φχ c2 are observed for the first time, each with a statistical significance ofmore than 10σ, and the Born cross sections are measuredmore » to be (4.2+1.7 -1.0±0.3) pb and (6.7+3.4 -1.7 ± 0.5) pb, respectively, where the first uncertainties are statistical and the second systematic. No significant signals are observed for e +e - → φχ c0 and e +e - → γX(4140) and upper limits on the Born cross sections at 90% confidence level are provided at √s = 4.600 GeV.« less
Observation of e + e → Φ χ c 1 and Φ χ c 2 at s = 4.600 GeV
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ablikim, M.; Achasov, M. N.; Ahmed, S.
Using a data sample collected with the BESIII detector operating at the BEPCII storage ring at a centerof- mass energy of √s = 4.600 GeV, we search for the production of e +e - → φχ c0,1,2. A search is also performed for the charmonium-like state X(4140) in the radiative transition e +e - → γX(4140) with X(4140) subsequently decaying into φJ/ψ. The processes e +e - → φχ c1 and φχ c2 are observed for the first time, each with a statistical significance ofmore than 10σ, and the Born cross sections are measuredmore » to be (4.2+1.7 -1.0±0.3) pb and (6.7+3.4 -1.7 ± 0.5) pb, respectively, where the first uncertainties are statistical and the second systematic. No significant signals are observed for e +e - → φχ c0 and e +e - → γX(4140) and upper limits on the Born cross sections at 90% confidence level are provided at √s = 4.600 GeV.« less
Advanced Fuels and Combustion Processes for Propulsion
2010-09-01
Cycles CJ Detonation Cycle Humphrey Cycle Brayton Cycle 8000 6000 4000 2000 0 0 10 20 Mach Number E n g i n e S p e c i f i c I m p u l s e ( I...Ed. G. Roy. Taylor & Francis, 1998. 3. Gaseous and Heterogeneous Detonations: Science to Applications: Ed. G. Roy, S. Frolov, N. Smirnov, K
Determination of mass density, dielectric, elastic, and piezoelectric constants of bulk GaN crystal.
Soluch, Waldemar; Brzozowski, Ernest; Lysakowska, Magdalena; Sadura, Jolanta
2011-11-01
Mass density, dielectric, elastic, and piezoelectric constants of bulk GaN crystal were determined. Mass density was obtained from the measured ratio of mass to volume of a cuboid. The dielectric constants were determined from the measured capacitances of an interdigital transducer (IDT) deposited on a Z-cut plate and from a parallel plate capacitor fabricated from this plate. The elastic and piezoelectric constants were determined by comparing the measured and calculated SAW velocities and electromechanical coupling coefficients on the Z- and X-cut plates. The following new constants were obtained: mass density p = 5986 kg/m(3); relative dielectric constants (at constant strain S) ε(S)(11)/ε(0) = 8.6 and ε(S)(11)/ε(0) = 10.5, where ε(0) is a dielectric constant of free space; elastic constants (at constant electric field E) C(E)(11) = 349.7, C(E)(12) = 128.1, C(E)(13) = 129.4, C(E)(33) = 430.3, and C(E)(44) = 96.5 GPa; and piezoelectric constants e(33) = 0.84, e(31) = -0.47, and e(15) = -0.41 C/m(2).
Chiou, C.T.; Kile, D.E.
1998-01-01
A series of single-solute and binary-solute sorption data have been obtained on representative samples of polar compounds (substituted ureas and phenolic compounds) and of nonpolar compounds (e.g., EDB and TCE) on a peat soil and a mineral (Woodburn) soil; the data extend to low relative solute concentrations (C(e)/S(w)). At relatively low C(e)/S(w), both the nonpolar and the polar solutes exhibit nonlinear sorption. The sorption nonlinearity approaches apparent saturation at about C(e)/S(w) = 0.010-0.015 for the nonpolar solutes and at about C(e)/S(w) = 0.10-0.13 for the polar solutes; above these C(e)/S(w) regions, the isotherms are practically linear. The nonlinear sorption capacities are greater for polar solutes than for nonpolar solutes and the peat soil shows a greater effect than the Woodburn soil. The small nonlinear sorption capacity for a nonpolar solute is suppressed indiscriminately by either a nonpolar or a polar cosolute at relatively low C(e)/S(w) of the cosolute. By contrast, the abilities of different cosolutes to suppress the nonlinear capacity of a nominal polar solute differ drastically. For polar solutes, a nonpolar cosolute exhibits a limited suppression even at high cosolute C(e)/S(w); effective suppression occurs when the cosolute is relatively polar and at various C(e)/S(w). These differences suggest that more than a single mechanism is required to account for the nonlinear sorption of both nonpolar and polar compounds at low C(e)/S(w). Mechanistic processes consistent with these observations and with soil surface areas are discussed along with other suggested models. Some important consequences of the nonlinear competitive sorption to the behavior of contaminants in natural systems are discussed.A number of conceptual models was postulated to account for the nonlinear solute sorption on soils of significant soil organic matter. A series of single-solute and binary-route sorption data was obtained representing samples of polar compounds of substituted ureas and phenolic compounds, and of nonpolar compounds of EDB and trichloroethylene on a peat soil and a mineral on a Woodburn soil. The nonlinear sorption capacities are greater for polar solutes than for nonpolar solutes and the peat soil shows a greater effect than the Woodburn soil.
Publications D.C. Miller, E. Annigoni, A. Ballion, J.G. Bokria, L.S. Bruckman, D.M. Burns, X. Chen, L. Elliott , J. Feng, R.H. French, S. Fowler, C.C. Honeker, M.D. Kempe, H. Khonkar, M. Köhl, L.-E. Perret-Aebi , L. Elliott, L. Feng, R.H. French, S. Fowler, X. Gu, P.L. Hacke, C.C. Honeker, M.D. Kempe, H. Khonkar
De Lange, Willem J; Grimes, Adrian C; Hegge, Laura F; Spring, Alexander M; Brost, Taylor M; Ralphe, J Carter
2013-09-01
Mutations in cardiac myosin binding protein C (cMyBP-C) are prevalent causes of hypertrophic cardiomyopathy (HCM). Although HCM-causing truncation mutations in cMyBP-C are well studied, the growing number of disease-related cMyBP-C missense mutations remain poorly understood. Our objective was to define the primary contractile effect and molecular disease mechanisms of the prevalent cMyBP-C E258K HCM-causing mutation in nonremodeled murine engineered cardiac tissue (mECT). Wild-type and human E258K cMyBP-C were expressed in mECT lacking endogenous mouse cMyBP-C through adenoviral-mediated gene transfer. Expression of E258K cMyBP-C did not affect cardiac cell survival and was appropriately incorporated into the cardiac sarcomere. Functionally, expression of E258K cMyBP-C caused accelerated contractile kinetics and severely compromised twitch force amplitude in mECT. Yeast two-hybrid analysis revealed that E258K cMyBP-C abolished interaction between the N terminal of cMyBP-C and myosin heavy chain sub-fragment 2 (S2). Furthermore, this mutation increased the affinity between the N terminal of cMyBP-C and actin. Assessment of phosphorylation of three serine residues in cMyBP-C showed that aberrant phosphorylation of cMyBP-C is unlikely to be responsible for altering these interactions. We show that the E258K mutation in cMyBP-C abolishes interaction between N-terminal cMyBP-C and myosin S2 by directly disrupting the cMyBP-C-S2 interface, independent of cMyBP-C phosphorylation. Similar to cMyBP-C ablation or phosphorylation, abolition of this inhibitory interaction accelerates contractile kinetics. Additionally, the E258K mutation impaired force production of mECT, which suggests that in addition to the loss of physiological function, this mutation disrupts contractility possibly by tethering the thick and thin filament or acting as an internal load.
Evidence for e + e - → γ η c ( 1 S ) at center-of-mass energies between 4.01 and 4.60 GeV
Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...
2017-09-06
In this paper, we present first evidence for the process e +e - → γη c(1S) at six center-of-mass energies between 4.01 and 4.60 GeV using data collected by the BESIII experiment operating at BEPCII. We measure the Born cross section at each energy using a combination of twelve η c(1S) decay channels. We also combine all six energies under various assumptions for the energy-dependence of the cross section. Finally, if the process is assumed to proceed via the Y (4260), we measure a peak Born cross section σ peak (e +e - → γη c(1S)) = 2.11 ± 0.49(stat.)more » ± 0.36(syst.) pb with a statistical significance of 4.2σ.« less
Evidence for e + e - → γ η c ( 1 S ) at center-of-mass energies between 4.01 and 4.60 GeV
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ablikim, M.; Achasov, M. N.; Ahmed, S.
In this paper, we present first evidence for the process e +e - → γη c(1S) at six center-of-mass energies between 4.01 and 4.60 GeV using data collected by the BESIII experiment operating at BEPCII. We measure the Born cross section at each energy using a combination of twelve η c(1S) decay channels. We also combine all six energies under various assumptions for the energy-dependence of the cross section. Finally, if the process is assumed to proceed via the Y (4260), we measure a peak Born cross section σ peak (e +e - → γη c(1S)) = 2.11 ± 0.49(stat.)more » ± 0.36(syst.) pb with a statistical significance of 4.2σ.« less
Outcomes of Bacteremia in Burn Patients Involved in Combat Operations Overseas
2008-03-01
MD, Mark S Rasnake, MD, Duane R Hospenthal, MD, PhD, FACP, Steven E Wolf, MD, FACS BACKGROUND: Burn patients constitute approximately 5% of...GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Ressner R. A., Murray C. K., Griffith M. E., Rasnake M. S ., Hospenthal D. R., Wolf S . E...5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) United States Army Institute of Surgical
Novotny, Dalibor; Vaverkova, Helena; Karasek, David; Malina, Pavel
2014-08-01
The aim was to evaluate the relationships of the T-1131C (rs662799) polymorphism variants of apolipoprotein A5 (Apo A5) gene and variants of apolipoprotein E (Apo E) gene common polymorphism (rs429358, rs7412) to signs of metabolic syndrome (MetS). We examined 590 asymptomatic dyslipidemic patients divided into MetS+ (n=146) and MetS- (n=444) groups according to criteria of NCEP ATPIII Panel. We evaluated genotype frequencies and differences in MetS features between individual groups. Logistic regression analysis was used for the evaluation of Apo A5/Apo E variants as possible risk factors for MetS. We found no statistical differences between genotype and allele frequencies for both Apo A5 and Apo E polymorphisms between MetS+ and MetS- groups. In all subjects and MetS- group, we confirmed well-known association of the -1131C Apo A5 minor allele with elevated triglycerides (TG, p<0.001). The Apo E gene E2 and E4 variants were associated with higher levels of TG (p<0.01) in comparison to E33 common variant. However, no statistical differences were observed in MetS+ subjects, regardless of significantly higher TG levels in this group. Apo A5/Apo E variant analysis in all dyslipidemic patients revealed significant increase of TG levels in all subgroups in comparison to common -1131T/E3 variant carriers, the most in -1131C/E4 variant subgroup. Logistic regression analysis models showed no association of Apo A5, Apo E and all Apo A5/Apo E variants with metabolic syndrome, even after adjustment for age and sex. Our study refined the role of Apo A5 and Apo E genetic variants in the group of adult dyslipidemic patients. We demonstrate that except of TG, Apo A5 T-1131C (rs662799) and Apo E (rs429358, rs7412) polymorphisms have no remarkable effect on MetS characteristics. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Hemoglobin C, S-C, and E Diseases
... quickly than others, resulting in chronic anemia. Hemoglobin C disease Hemoglobin C disease occurs mostly in blacks. ... a common complication of hemoglobin C disease. Hemoglobin S-C disease Hemoglobin S-C disease occurs in people who ...
2016-06-01
UAV system but had a larger scope. The publishing timeline for the second UAV model and this thesis ...r l o g i c a l ) t h a t can be used t o d e s c r i b e a p a r t o f t h e model . < / d e s c r i p t i o n > 7 <h idden> f a l s e < / h idden...July). Program manager e -tool kit: Hierarchy of models and simulations . [Online]. Available: https://acc.dau.mil/CommunityBrowser.aspx?id= 294530
Supersaturated Self-Assembled Charge-Selective Interfacial Layers for Organic Solar Cells
2014-11-24
N. E.; Ratcliff, E. L.; Jenkins, J. L.; Armstrong, N. R.; Giordano, A. J.; Hotchkiss, P. J.; Marder, S. R.; Campbell, C. T.; Ginger , D. S. J. Phys...H. X.; Schlenker, C. W.; Giordano, A. J.; Garcia, A.; Smith, O. L.; Olson, D. C.; Marder, S. R.; Ginger , D. S. J. Phys. Chem. Lett. 2013, 4, 4038
1984-04-01
bladder 1 muscle, s k e l e t a l 5 bone marrow smear --- 3 nasal t u rb ina tes *ti ~ s u e masses ,- and any o the r t i ssues w i t h...Lymphoma, lymphocytic type .__ - __ __ ___ .____. . _ - --- Fibrosarcoma , me ta s t a t i c - __ .._._- _ __._ - - .- Granulosa-cell Carcinoma... Fibrosarcoma , m e t a s t a t i c . -- RENAL LYMPH NODE -- E ’ L - --.I- t Malignant Lymphoma, mixed type Malignant
Adaptive Correlation Concepts for Non-Compatible Imagery.
1981-10-31
5.4 Ohio Files 26 and 27 Image Segments . . . . 34 5.5 HSV Files 9 and 10 Image Segments ..... . 35 5.6 Scene 1 , Vertical Profiles Through Peak...Simulation Options Summary .e m "lch c .i a ir t.e j-r.-ct cross c t.e"P- lat absclut - differcr.ce a!a .u iy-i.cidd dif’err.c; - metrics. e 1 T0 1ff ct of...cdlf o spectral bands, di~ffe,-,-rurt tie f loy. "Ind d:;7o T hes’,-e -simu lat i onso ae 1 - s o2( 1 r 1 b- in th I s-,sI 31. / / s. ILI Z1.I I SO .& i
1997-06-01
W a% n% e’w-4T .0 3 C/2 W4 rýr- C~eJCN mCN Cým 0 Cn 14.4 000 0 en mnen~’ m - 00 a E- 000 0 0000 000 0 0a0 U 00 0 0 00 000 W a a000 00 C. wUn - 0 m( 0 4...3-; __- N__ I _ __ _ S~ it, CI a___QI S__ teD I Q__-___,________ v-i All measurernents in =fl~himeters R = E~rytherna * N/A =Not appUcaS[.e B = Edema
SABERS. Stand-Alone ADIC Binary Exploitation Resources System. Volume II.
1981-09-01
XXXQ S X3W3 w P-’ 00S00 z~ ML Z.14.J SM C . >C.> 3c Q . . . a.E.C HL 0 c Ccc4 z _,> 0o~. 0 0) "XI 8-4 zw0 Ŕ >e 0 - 0 SMK " CELh uw C WnI-EW e cm (A...Recognizer ----- TOINT ASCII to Integer Converter * - ACESS Access Control Word Recognizer "* -.. STRAIN Input Constraint Processor S----GETBND Input...exclude the screen cursor from these areas. The code for the routine is found in the file ACESS.FLX. STRAIN STRAIN recognizes the various forms of user
Canada’s First National Interoperability Baseline Assessment: CPRC 91052 Project Study
2012-03-01
Time and Leadership. 33 Y on ge S t ., S ui te 4 20 , T or on to , O nt ar io C an ad a, M 5E 1 G 4 #91052 T A B L E O F C O N T E N T ...28 Essential Guidance 30 #91052 L I S T O F F I G U R E S P 1 Demographics...30 #91052 1 I N T H I S S T U D Y M e t h o d o l o g y This study was based on a web survey of 105
Operation UPSHOT-KNOTHOLE, Radiological Safety Operations
1953-06-01
used for cloud tracking, one C-47 and b L-20’ s used for the low level terrain survey, and two helicopters to be used for on-site sui e^ All the... using the following form: MESSAGE FORM TERRAIN SURVEY (C47, L20’ s ) (Rag Mop) 1. Call Sign (Ever Ready) 2. Message No. RS 3. Position (Grid) 4...jS iS 0 0 oo » 5z; S5 * * w oo .2 « C C «) fl) 4-i s oo « E S 3 » o o B K o xi ä o o £ ca co ^ c4 co m us a» o CM
Pratley, Richard E.; Eldor, Roy; Raji, Annaswamy; Golm, Gregory; Huyck, Susan B.; Qiu, Yanping; Sunga, Sheila; Johnson, Jeremy; Terra, Steven G.; Mancuso, James P.; Engel, Samuel S.
2018-01-01
Aim To evaluate the efficacy and safety of ertugliflozin and sitagliptin co‐administration vs the individual agents in patients with type 2 diabetes who are inadequately controlled with metformin. Methods In this study (http://Clinicaltrials.gov NCT02099110), patients with glycated haemoglobin (HbA1c) ≥7.5% and ≤11.0% (≥58 and ≤97 mmol/mol) with metformin ≥1500 mg/d (n = 1233) were randomized to ertugliflozin 5 (E5) or 15 (E15) mg/d, sitagliptin 100 mg/d (S100) or to co‐administration of E5/S100 or E15/S100. The primary endpoint was change from baseline in HbA1c at Week 26. Results At Week 26, least squares mean HbA1c reductions from baseline were greater with E5/S100 (−1.5%) and E15/S100 (−1.5%) than with individual agents (−1.0%, −1.1% and −1.1% for E5, E15 and S100, respectively; P < .001 for all comparisons). HbA1c <7.0% (<53 mmol/mol) was achieved by 26.4%, 31.9%, 32.8%, 52.3% and 49.2% of patients in the E5, E15, S100, E5/S100 and E15/S100 groups, respectively. Fasting plasma glucose reductions were significantly greater with E5/S100 and E15/S100 compared with individual agents. Body weight and systolic blood pressure (SBP) significantly decreased with E5/S100 and E15/S100 vs S100 alone. Glycaemic control, body weight and SBP effects of ertugliflozin were maintained to Week 52. Genital mycotic infections were more common among ertugliflozin‐treated patients compared with those treated with S100. Incidences of symptomatic hypoglycaemia and adverse events related to hypovolaemia or urinary tract infection were similar among groups. Conclusions In patients with uncontrolled type 2 diabetes while using metformin, co‐administration of ertugliflozin and sitagliptin provided more effective glycaemic control through 52 weeks compared with the individual agents. PMID:29266675
Dynamics of Radiation and Atoms in Ultrahigh Intensity Laser Fields
2013-12-31
Rob Mitchell, N. Ekanayake, A. Watts, S. White , Rob Sauer, L. Howard, M. Videtto, C. Mancuso, S. Wells, T. Stanev, B. Wen, M. Decamp, B. Walker, Sasi...Chen, Z. Bond, A. Loether, L. E. Howard, Y. Gao, S. LeMar, S. White , A. Watts, B. C. Walker, M. F. DeCamp. Reconstructing longitudinal strain pulses...Ekanayake, A.M. Watts, S.L. White , Rob Sauer, L.E. Howard, M. Videtto, C. Mancuso, S.J. Wells, T. Stanev, B.L. Wen, M.F. Decamp, and B.C. Walker. Ionization
Three - Dimensional Image Generation from an Aerial Photograph.
1987-09-01
through 183 of the terrain model. To verify that this set of elevation points would appear like the desired reference image, a line drawing illustrated in...see iF. Fc -.:: ~e parameters PHV ~Anglea ir ratla-’s 1f: ~e2-a: :.s Ange i 8rramLiar t 7 :’aF the gec sctarg, Iar c~t-at2-s sLdstem. t" at -~2 S a C...d--ata p01nts. -a n1g .~tles -3. :a1 et ro~.tlnes -~ f.Pot-’-ie par-ameters ENCM: The dr-crn-at=7 cFf th7e aFfF --e ~.F-.rct icns perFforret Ccnst
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-18
... defined by 25 U.S.C. 1603(d); A Tribal organization as defined by 25 U.S.C. 1603(e); or an Urban Indian.... 25 U.S.C. 1603(d). Tribal organization means the elected governing body or any legally established.... 1603(e). [[Page 51085
Effects of Standard Extremity on Mixed Standard Scale Performance Ratings.
1983-03-01
e C co lude’d th bt Ih e mixed standard scal, f:rm.0l porf(, r ,t l J, wul I...levels. MSSI (hE) was con, posed c.f s t ;4tri 4 .rts re f I t i nq m a x I Iy extreme scal e Sva Iues for each c .,f th: f ur diicn s iorr rI, r so...8217rte on the appraisal i nstrum n . I I (ME) w . c ,.,pos d of stat..ment(. with mcderately ext- r ,?’, e sc I e val I.... IS I I I F) was co0. o e J
12 CFR 545.92 - Branch offices.
Code of Federal Regulations, 2012 CFR
2012-01-01
... United States and its territories unless the location would violate: (1) Section 5(r) of the HOLA (12 U.S.C. 1464(r)); (2) Section 10(e)(3) of the HOLA (12 U.S.C. 1467a(e)(3)); or (3) Section 13(k)(4) of the FDIA (12 U.S.C. 1823(k)(4)). (c) Preemption. This exercise of OTS authority is preemptive of any...
12 CFR 545.92 - Branch offices.
Code of Federal Regulations, 2011 CFR
2011-01-01
... United States and its territories unless the location would violate: (1) Section 5(r) of the HOLA (12 U.S.C. 1464(r)); (2) Section 10(e)(3) of the HOLA (12 U.S.C. 1467a(e)(3)); or (3) Section 13(k)(4) of the FDIA (12 U.S.C. 1823(k)(4)). (c) Preemption. This exercise of OTS authority is preemptive of any...
12 CFR 145.92 - Branch offices.
Code of Federal Regulations, 2012 CFR
2012-01-01
... United States and its territories unless the location would violate: (1) Section 5(r) of the HOLA (12 U.S.C. 1464(r)); (2) Section 10(e)(3) of the HOLA (12 U.S.C. 1467a(e)(3)); or (3) Section 13(k)(4) of the FDIA (12 U.S.C. 1823(k)(4)). (c) Preemption. This exercise of the OCC's authority is preemptive of...
12 CFR 145.92 - Branch offices.
Code of Federal Regulations, 2014 CFR
2014-01-01
... United States and its territories unless the location would violate: (1) Section 5(r) of the HOLA (12 U.S.C. 1464(r)); (2) Section 10(e)(3) of the HOLA (12 U.S.C. 1467a(e)(3)); or (3) Section 13(k)(4) of the FDIA (12 U.S.C. 1823(k)(4)). (c) Preemption. This exercise of the OCC's authority is preemptive of...
12 CFR 145.92 - Branch offices.
Code of Federal Regulations, 2013 CFR
2013-01-01
... United States and its territories unless the location would violate: (1) Section 5(r) of the HOLA (12 U.S.C. 1464(r)); (2) Section 10(e)(3) of the HOLA (12 U.S.C. 1467a(e)(3)); or (3) Section 13(k)(4) of the FDIA (12 U.S.C. 1823(k)(4)). (c) Preemption. This exercise of the OCC's authority is preemptive of...
12 CFR 545.92 - Branch offices.
Code of Federal Regulations, 2014 CFR
2014-01-01
... United States and its territories unless the location would violate: (1) Section 5(r) of the HOLA (12 U.S.C. 1464(r)); (2) Section 10(e)(3) of the HOLA (12 U.S.C. 1467a(e)(3)); or (3) Section 13(k)(4) of the FDIA (12 U.S.C. 1823(k)(4)). (c) Preemption. This exercise of OTS authority is preemptive of any...
12 CFR 545.92 - Branch offices.
Code of Federal Regulations, 2013 CFR
2013-01-01
... United States and its territories unless the location would violate: (1) Section 5(r) of the HOLA (12 U.S.C. 1464(r)); (2) Section 10(e)(3) of the HOLA (12 U.S.C. 1467a(e)(3)); or (3) Section 13(k)(4) of the FDIA (12 U.S.C. 1823(k)(4)). (c) Preemption. This exercise of OTS authority is preemptive of any...
19 CFR 356.8 - Continued suspension of liquidation.
Code of Federal Regulations, 2010 CFR
2010-04-01
...), (E), (F), or (G) of the Act (19 U.S.C. 1677(9)(C), (D), (E), (F) and (G)), may request continued... review that was a party to the proceeding, as described in section 771(9)(A) of the Act (19 U.S.C. 1677(9... Act (19 U.S.C. 1516a(a)(2)(B)(iii) and (vi)) and involving free trade area country merchandise, the...
19 CFR 356.8 - Continued suspension of liquidation.
Code of Federal Regulations, 2014 CFR
2014-04-01
...), (E), (F), or (G) of the Act (19 U.S.C. 1677(9)(C), (D), (E), (F) and (G)), may request continued... review that was a party to the proceeding, as described in section 771(9)(A) of the Act (19 U.S.C. 1677(9... Act (19 U.S.C. 1516a(a)(2)(B)(iii) and (vi)) and involving free trade area country merchandise, the...
19 CFR 356.8 - Continued suspension of liquidation.
Code of Federal Regulations, 2011 CFR
2011-04-01
...), (E), (F), or (G) of the Act (19 U.S.C. 1677(9)(C), (D), (E), (F) and (G)), may request continued... review that was a party to the proceeding, as described in section 771(9)(A) of the Act (19 U.S.C. 1677(9... Act (19 U.S.C. 1516a(a)(2)(B)(iii) and (vi)) and involving free trade area country merchandise, the...
Annual Report for Fiscal Year 1973-1974 of the Chief, National Guard Bureau
1974-01-01
El -jS C (« " u Ü ■= O Ct3 E03 >.3 O C 3 « m’ «g« am i^^ Q c. w 9Z IP ao re o c t re ui tn « c S re< u)£ ill- c rat ■ c 0! I n... el c c ro o rö o0- tl C31 in 0) sill E Q E ro 03 £ CO i m £ 0! QJ ■D C 03 3 o 5 oipo I 5^ 5 Q 0) (U 03 C •& JK...fit»« 0) « CO El <c^ ■en a _ 73 cö co Q sz c £ ~ b b OTi- cuO o II nil < %* co 2 5 co ’D s; o co £ O c i il llii t u. < Ü
Search for resonances decaying to etac pi pi- in two-photon interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lees, J.P.; Poireau, V.; Tisserand, V.
2012-06-18
We report a study of the process {gamma}{gamma} {yields} X {yields} {eta}{sub c}{pi}{sup +}{pi}{sup -}, where X stands for one of the resonances {chi}{sub c2}(1P), {eta}{sub c}(2S), X(3872), X(3915), or {chi}{sub c2}(2P). The analysis is performed with a data sample of 473.9 fb{sup -1} collected with the BABAR detector at the PEP-II asymmetric-energy electron-positron collider. We do not observe a significant signal for any channel, and calculate 90% confidence-level upper limits on the products of branching fractions and two-photon widths {Lambda}{sub X{yields}{gamma}{gamma}} {Beta}(X {yields} {eta}{sub c}{pi}{sup +}{pi}{sup -}): 15.7 eV for {chi}{sub c2}(1P), 133 eV for {eta}{sub c}(2S), 11.1 eVmore » for X(3872) (assuming it to be a spin-2 state), 16 eV for X(3915) (assuming it to be a spin-2 state), and 19 eV for {chi}{sub c2}(2P). We also report upper limits on the ratios of branching fractions {Beta}({eta}{sub c}(2S) {yields} {eta}{sub c}{pi}{sup +}{pi}{sup -})/{Beta}({eta}{sub c}(2S) {yields} K{sub S}{sup 0}K{sup +}{pi}{sup -}) < 10.0 and {Beta}({chi}{sub c2}(1P) {yields} {eta}{sub c}{pi}{sup +}{pi}{sup -})/{Beta}({chi}{sub c2}(1P) {yields} K{sub S}{sup 0}K{sup +}{pi}{sup -}) < 32.9 at the 90% confidence level.« less
1981-12-01
t e d Riemann Curvature Wnsor and R i s the Curva ture ~ c 2 l ) a r . I n 1917, Karl Schwarzschi ld s o l v e d t h e s e e q u a t i o n...tu re of time a l o n e . I t is t h e Schwarzschild met r ic t h a t leads t o the famous concept n f t h e black h o l e . This is a...01 Well, it can: 2 m - I - - - - - 0 r c 2 Figure 2 4 One calls t h i s va lue of r t h e Schwarzschild b d l u s and o f t e n
Influences on Group Productivity. 2. Factors Inherent in the Person
1983-07-15
r ~jIEb Copy - Th e c ~ *~ irr v .: t 0. 1 r , 1:"- C 7 ~ e ~rali~y t-ieciry anid Rver, (if we iriclude -.k iivl ’taiis... r t. ~so a’ý.-:D :v i cu s a ttrin ut es tf !- e s u ) 1e - t se q-. sex), n C wrc ra> Y u 1 1 ~tt 1 q anout whetner inrdeed the n ro q o w,-ksý ~t e ...rc- C - n iu-; C Iear1 Y. as trne attacrned synoo~sis ir"dicates. vie will havp teo be ~ far *’cir e 7:recise abci-t ou~ r co-ncrmots of
1983-09-20
on -- 1d. It --- . d id-er, c S, blck -.o~b.1) ’Trapped radiation Steady-state miodels Adiabatic invariants Empirical flux models Diffusion equations...Shell -splitting, Transport theory Nuclear detonations Wave-oarticle interactions Effects on microelectronics 20 ABSTRACT ( C -0- n OR e -~ d . It -~e-lay...olo -i t i os5 at 500 ke\\% live lrtI’m i s pt, eOI iS .1: litv, ,Ie It if 5)ht* stIweo f iul-’t, wi te thle hie av itk, i il - il v t’il 1 Ltt sI c a
Statistical Processing Methods for Polarimetric Imagery
2008-09-01
c ) G.G. Stokes portrait normalized bounds 5 10 15 20 0 0.2 0.4 0.6 0.8 1 N or m al iz ed v ar ia nc e Number of frames average...Bar target Stokes bounds 0 10 20 30 40 50 60 10 −2 10 0 10 2 10 4 10 6 N or m al iz ed v ar ia nc e Channel spacing S 0 S 1 S 2 ( c ) PC board...0.6 0.7 iteration N M S E multichannel single channel ( c ) S2 Figure 4.7: NMSE quartiles for the Simulated Stokes
Sensitivity Analysis of Empirical Parameters in the Ionosphere-Plasmasphere Model
2011-03-01
IFM output grid (Gardner , 2010). The longitudes have to be fit as well because the IPM flux tubes form a type of ‘ S ...n d 2 0 d a y ru n , a n d th e ri g h t p lo t is th e d iff e re n c e . A ft e r d a y fi v e , th e m o d e l o u tp u t h a s re a ch e d st e a ...lo c a ti o n s * . T h
Solid-State Quantum Refrigeration
2013-03-01
i n a l Te c h n... i c a l Re p o r t Name of Grantee: Northwestern University Grant Title: Solid-State Quantum Refrigeration Grant #: FA9550-09-1...200 -150 -100 -50 0 Anglewavelength b a c k c o u p lin g i n to th e w a v e g u id e l o s s ( d B ) Figure 8. results of a) percentage
Workshop on Hydrogen Storage and Generation for Medium-Power and -Energy Applications
1998-02-01
Vukovic , and B. E. Conway, J . Phys. Chem., 81, 2271(1977). [10].V. Lakshminarayanna, R...d O >ri O 1 O CM Ö CM O O +1 O O O 1 OO O O CO 0 Ö CO O ö s CO • 3 >-. BO _o ■3 c j = 0 i i ■c 3 8 1 09 Is... J ’o e < * g «-• s -.2 If CO «9 3 J3 E "c to U ’S o S es O ,<D c . 8^. 5 3 OS 3 60 - p v> 30 ŗ 8
Air Force Office of Scientific Research Technical Report Summaries.
1992-01-01
Wo N a*1 W.V. 4 4 1 z ? mO 4 1w~ 4 00~~~~~0 N14 000 N.J 014 N ~ Q u~ 0 Nb.)(sia 4S~ 4 4 W.. 66 r- IDS 4 ag - a"u r- ma- P I" Mj 0n 1V0 ’a V 4 VW L4 W...C!z E E P L 00 8 x z 0 M 4-. z 0 C’, Al S S Oslo, Eu 0 2*’ 0 01 C. 0 . 80 0.ŔN * .u *L-3 -* .8C at U C E M let- C- L t 00 I az L ag A 0!0 400 u0U L...8217 04a M 5 L0 39 0 L0 WIC a in ag n 31c L P4 L 0 L J * 2I. 3i CU s,; w ’ V) C) 3 - u &’W( C 0)C0 ~ Eq 50 w 0 ’.6 c4e Zn Cx N -m J’ SLQO O ’ o40 0 L-C V
ACOSS Fourteen (Active Control of Space Structures)
1983-03-01
M ^^^——^^^^ ACOSS FOURTEEN (ACTIVE CONTROL OF SPACE STRUCTURES) Robert J . Benhabib Henry K. Flashner Frank C. Tung Contractor: TRW...PMJILUIJIJ.IIJIIIJI’I.I J I ! ’i-’-ummwmwMu», "»,-’■ m «mpiiw WJPWI» on UJ <_) O cc Q- (_1 a o a. oo I 5 < 3 in ai c 0 in LU c...1 S- s_ a: 1^3 >+- c ■ ^—v O) 0) OJ >—< ( J M - C r? s- s- T3 OO 0 E ■f— a. O S- +.) i i. 0) 0 OJ 03 c _a OJ cn =3 O e 3 01
Word Frequency Analysis. MOS: 51N. Skill Levels 1 & 2.
1981-05-01
C.s~ss t C: 4i,40 16 CoD.J,1U 4 I CE s!Z 26 rCLL 9 CELL ! I CEAENf. 24 CFNT;R 3 C.J7’.1-T-CENTEft 2 CtNT?-AEr’ 4 Mf~ :aL.ZWE 2 e VrAL C ^’f4 t...GOJ4LTy214I7G 27~~~Z r.4MrL2 JN 7fE43ING 26 PUT?e- CELL 26 4126 pPZPING 2 ~76 Pr, ’S U~R 26S*5INh2 P8!P(NTq25 P-.crsS 25 P.AT8 25 INCI 25 PTSVRE 15 u 5...rL 2 CPAL 11? .1 ’G 2 C IrIL2:", I DE I L 2 CIRZCJLL-, 2 CIE!Nv, 2 C~LrFCJLC LJD 2 CUA*.Ll 2 ccCoVM4UICATION 2 CELL ; A S 2 :(LLZkS 2 CO4 It~TIOE
Enzyme-linked immunosorbent assays for Z-DNA.
Thomas, M J; Strobl, J S
1988-10-01
Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e.l.i.s.a. was conducted in 48-well culture dishes at 37 degrees C using a rabbit polyclonal antiserum developed against Br-poly(dG-dC).poly(dG-dC), an alkaline phosphatase-conjugated second antibody, and p-nitrophenol as the substrate. Under conditions where antibody concentrations were not limiting, alkaline phosphatase activity was linear for 2 h. Dot blot e.l.i.s.a. conditions are described which allow quantification of Z-DNA [Br-poly(dG-dC).poly(dG-dC)] within the range 5-250 ng. Dot blot and transblot horseradish peroxidase e.l.i.s.a. are described that detect Z-DNA within supercoiled plasmid DNAs immobilized on diazophenylthioether (DPT) paper. In the transblot e.l.i.s.a., plasmid pUC8 derivatives containing 16, 24, or 32 residues of Z-DNA were electrophoresed in agarose gels and electrophoretically transferred to DPT paper. Z-DNA-antibody complexes were detected by the horseradish peroxidase-catalysed conversion of 4-chloro-1-naphthol to a coloured product that was covalently bound to the DPT paper. Z-DNA antibody reactivity was specific for supercoiled Z-DNA containing plasmids after removal of the antibodies cross-reactive with B-DNA by absorption onto native DNA-cellulose. The transblot e.l.i.s.a. was sensitive enough to detect 16 base pairs of alternating G-C residues in 100 ng of pUC8 DNA.
{{\\rm{\\Lambda }}}_{c}^{+} physics at BESIII
NASA Astrophysics Data System (ADS)
Wang, Weiping; BESIII collaboration
2018-05-01
Based on the data sets collected by the BESIII detector near the {{{Λ }}}c+{\\bar{{{Λ }}}}c- production threshold, i.e. at \\sqrt{s}=4574.5,4580.0,4590.0, and 4599.5 MeV, we report the preliminary study of the production behaviour of {e}+{e}-\\to {{{Λ }}}c+{\\bar{{{Λ }}}}c- process, including the Born cross section and electromagnetic form factor ratios. Using the large statistic data at \\sqrt{s}=4599.5 {{MeV}}, we measured the absolute branching fractions of Cabibbo-favored hadronic decays of {{{Λ }}}c+ baryon with a double-tag technique. The branching fractions for 12 hadronic decay modes are significantly improved. We also report the model-independent measurement of the branching fraction of {{{Λ }}}c+\\to {{Λ }}{e}+{v}e and {{{Λ }}}c+\\to {{Λ }}{μ }+{v}μ semi-leptonic decays.
Chambers, Mark; Rehfeldt, Ruth Anne
2003-01-01
The purpose of this study was to determine whether manual sign or the Picture Exchange Communication System (P.E.C.S.) (Frost and Bondy, 1994) would be more effective in teaching mand skills to adults with mental retardation in the severe and profound range. Four participants were taught to mand for four reinforcing items using both communication modalities, in an alternating treatments design. Three of four participants demonstrated criterion performance across all four mands using P.E.C.S. first. Two of those three participants later demonstrated criterion performance for the mands using manual sign. The fourth participant was removed from the study during training due to illness, but her progress indicated greater acquisition with P.E.C.S. Generalization probes conducted at participants' respective residences showed that three participants demonstrated generalization across settings using P.E.C.S., and two participants demonstrated generalization across settings using manual sign. Participants were also more likely to mand for reinforcing items not present using P.E.C.S. than using manual sign.
Li, Yan; Blacque, Olivier; Fox, Thomas; Luber, Sandra; Polit, Walther; Winter, Rainer F; Venkatesan, Koushik; Berke, Heinz
2016-04-07
The mononuclear rhenium carbyne complex trans-[Re(C[triple bond, length as m-dash]CSiMe3)([triple bond, length as m-dash]C-Me)(PMe3)4][PF6] (2) was prepared in 90% yield by heating a mixture of the dinitrogen complex trans-[ReCl(N2)(PMe3)4] (1), TlPF6, and an excess of HC[triple bond, length as m-dash]CSiMe3. 2 could be deprotonated with KOtBu to the vinylidene complex trans-[Re(C[triple bond, length as m-dash]CSiMe3)([double bond, length as m-dash]C[double bond, length as m-dash]CH2)(PMe3)4] (3) in 98% yield. Oxidation of 3 with 1.2 equiv. of [Cp2Fe][PF6] at -78 °C gave the Cβ-C'β coupled dinuclear rhenium biscarbyne complex trans-[(Me3SiC[triple bond, length as m-dash]C)(PMe3)4Re[triple bond, length as m-dash]C-CH2-CH2-C[triple bond, length as m-dash]Re(PMe3)4(C[triple bond, length as m-dash]CSiMe3)][PF6]2 (5) in 92% yield. Deprotonation of 5 with an excess of KOtBu in THF produced the diamagnetic trans-[(Me3SiC[triple bond, length as m-dash]C)(PMe3)4Re[double bond, length as m-dash]C[double bond, length as m-dash]CH-CH[double bond, length as m-dash]C[double bond, length as m-dash]Re(PMe3)4(C[triple bond, length as m-dash]CSiMe3)] complex (E-6(S)) in 87% yield with an E-butadienediylidene bridge. Density functional theory (DFT) calculations of E-6(S) confirmed its singlet ground state. The Z-form of 6 (Z-6(S)) could not be observed, which is in accord with its DFT calculated 17.8 kJ mol(-1) higher energy. Oxidation of E-6 with 2 equiv. of [Cp2Fe][PF6] resulted in the stable diamagnetic dicationic trans-[(Me3SiC[triple bond, length as m-dash]C)(PMe3)4Re[triple bond, length as m-dash]C-CH[double bond, length as m-dash]CH-C[triple bond, length as m-dash]Re(PMe3)4(C[triple bond, length as m-dash]CSiMe3)][PF6]2 complex (E-6[PF6]2) with an ethylenylidene dicarbyne structure of the bridge. The paramagnetic mixed-valence (MV) complex E-6[PF6] was obtained by comproportionation of E-6(S) and E-6[PF6]2 or by oxidation of E-6(S) with 1 equiv. of [Cp2Fe][PF6]. The dicationic trans-[(Me3SiC[triple bond, length as m-dash]C)(PMe3)4Re[triple bond, length as m-dash]C-C[triple bond, length as m-dash]C-C[triple bond, length as m-dash]Re(PMe3)4(C[triple bond, length as m-dash]CSiMe3)][PF6]2 (7[PF6]2) complex, attributed a butynedi(triyl) bridge structure, was obtained by deprotonation of E-6[PF6]2 with KOtBu followed by oxidation with 2 equiv. of [Cp2Fe][PF6]. The neutral complex 7 could be accessed best by reduction of 7[PF6]2 with KH in the presence of 18-crown-6. According to DFT calculations 7 possesses two equilibrating electronic states: diamagnetic 7(S) and triplet 7(F) with ferromagnetically coupled spins. The latter is calculated to be 5.2 kcal mol(-1) lower in energy than 7(S). There is experimental evidence that 7(S) prevails in solution. 7 could not be isolated in the crystalline state and is unstable transforming mainly by H-abstraction to give E-6(S). UV-Vis-NIR spectroscopy for the dinuclear rhenium complexes E-6(S), E-6[PF6] and E-6[PF6]2, as well as EPR spectroscopic and variable-temperature magnetization measurements for the MV complex E-6[PF6] were also conducted. Spectro-electrochemical reduction studies on 7[PF6]2 allowed the characterization of the mono- and direduced forms of 7(+) and 7 by means of IR- and UV-Vis-NIR-spectroscopy and revealed the chemical fate of the higher reduced form.
1968-06-01
Jt CO 11 I- « — i *- N «S.S IS 2 S b COM o S. u Q, *■ c ic www u £ o w $ *J S in e :|| « n n td ki u < « 60 ii 2...s flJ -’ O W 4J atiii«» a c J c a « £ i 5 2 -o •4 >ML: a...ae ü C - E 3 W *. - a — *J »J i© £ 5 • S a ■5 » 5 U td b - u — s "o w w eg u- £ £ r c £ c li* 5^35 s» ’ . 2 li (A i D X i .S Si
2011-04-14
... "~-' ;c-+:cns 1 .... ._""- .. u,-_ u~c ~ack~~Lbers or ~ace ru~~e~~ ~ce ~l;es, ~'lX 1 :uart "~r 4 ~a!lQ~s . ) .". trJt1on. :_1~:; ~a': ~e ~~e:;el !~e~ cr ...
1980-04-01
4 C X 0Z C X - . -0 a m -- L ( U -. W 0 t a - a L 0 r 0 5 U w ( U f i C 0 -a- .. s -an 21.Z IZ W 0 *1 0 0 5 a . - C o ag CL W3 Iz, go, Cc’s "X i -J...50 4- a o r.) LU 0 . A9 0 A (A0 - -VZ % AG 0n W.- C-C- ’-O CL N. L) a D > ) InS r -a 0a C 4 C065 E- 04- 0j cv c I- 0 L U) a -- C GD - - L -z Cd ~J C 1...0 0 -C 041 a OC 0. CW0 McL (n. C/C w. &U - 0. a) O : 0 JC O V EW( W WC -’ - C’. 2 0. L U 0- U 0 10---id - ’D 4)c C(C C’d 0. E- aG do il- W WCD C E L C
Kudlacek, Stephan T; Premkumar, Lakshmanane; Metz, Stefan W; Tripathy, Ashutosh; Bobkov, Andrey A; Payne, Alexander Matthew; Graham, Stephen; Brackbill, James A; Miley, Michael J; de Silva, Aravinda M; Kuhlman, Brian
2018-06-08
The spread of dengue (DENV) and Zika virus (ZIKV) is a major public health concern. The primary target of antibodies that neutralize DENV and ZIKV is the envelope (E) glycoprotein, and there is interest in using soluble recombinant E (sRecE) proteins as subunit vaccines. However, the most potent neutralizing antibodies against DENV and ZIKV recognize epitopes on the virion surface that span two or more E proteins. Therefore, to create effective DENV and ZIKV vaccines, presentation of these quaternary epitopes may be necessary. The sRecE proteins from DENV and ZIKV crystallize as native-like dimers, but studies in solution suggest that these dimers are marginally stable. To better understand the challenges associated with creating stable sRecE dimers, we characterized the thermostability of sRecE proteins from ZIKV and three DENV serotypes, DENV2-4. All four proteins irreversibly unfolded at moderate temperatures (46-53 °C). At 23 °C and low micromolar concentrations, DENV2 and ZIKV were primarily dimeric, and DENV3-4 were primarily monomeric, whereas at 37 °C, all four proteins were predominantly monomeric. We further show that the dissociation constant for DENV2 dimerization is very temperature-sensitive, ranging from <1 μm at 25 °C to 50 μm at 41 °C, due to a large exothermic enthalpy of binding of -79 kcal/mol. We also found that quaternary epitope antibody binding to DENV2-4 and ZIKV sRecE is reduced at 37 °C. Our observation of reduced sRecE dimerization at physiological temperature highlights the need for stabilizing the dimer as part of its development as a subunit vaccine. © 2018 Kudlacek et al.
1979-10-01
wnat is natural Page ix nu. transparency c. Dractici1 4Pproacn to unierstarndIng language le Si;PDIiClty in desi j e. facilitate exDervfmental use :e...iC’, TP -SIZe ~f t iic ,e t Vci1ca 11y i n trie real v o r I: c r t ’ le ot-oer ’ieflu, intorliation system rndnajers are relv~ct-rt to~()I t...witl a r4iven data rS P it r e t v- -ic )a ron le ,.s or nteciritv if ,.l tirple copies r)t it. tVe t o ep , Cs’ q S C- Of i n co rr Ojt i ,i Ii tYv re t
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roach, Dennis P.; Rice, Thomas M.; Paquette, Joshua
Wind turbine blades pose a unique set of inspection challenges that span from very thick and attentive spar cap structures to porous bond lines, varying core material and a multitude of manufacturing defects of interest. The need for viable, accurate nondestructive inspection (NDI) technology becomes more important as the cost per blade, and lost revenue from downtime, grows. NDI methods must not only be able to contend with the challenges associated with inspecting extremely thick composite laminates and subsurface bond lines, but must also address new inspection requirements stemming from the growing understanding of blade structural aging phenomena. Under itsmore » Blade Reliability Collaborative program, Sandia Labs quantitatively assessed the performance of a wide range of NDI methods that are candidates for wind blade inspections. Custom wind turbine blade test specimens, containing engineered defects, were used to determine critical aspects of NDI performance including sensitivity, accuracy, repeatability, speed of inspection coverage, and ease of equipment deployment. The detection of fabrication defects helps enhance plant reliability and increase blade life while improved inspection of operating blades can result in efficient blade maintenance, facilitate repairs before critical damage levels are reached and minimize turbine downtime. The Sandia Wind Blade Flaw Detection Experiment was completed to evaluate different NDI methods that have demonstrated promise for interrogating wind blades for manufacturing flaws or in-service damage. These tests provided the Probability of Detection information needed to generate industry-wide performance curves that quantify: 1) how well current inspection techniques are able to reliably find flaws in wind turbine blades (industry baseline) and 2) the degree of improvements possible through integrating more advanced NDI techniques and procedures. _____________ S a n d i a N a t i o n a l L a b o r a t o r i e s i s a m u l t i m i s s i o n l a b o r a t o r y m a n a g e d a n d o p e r a t e d b y N a t i o n a l T e c h n o l o g y a n d E n g i n e e r i n g S o l u t i o n s o f S a n d i a , L L C , a w h o l l y o w n e d s u b s i d i a r y o f H o n e y w e l l I n t e r n a t i o n a l , I n c . , f o r t h e U . S . D e p a r t m e n t o f E n e r g y ' s N a t i o n a l N u c l e a r S e c u r i t y A d m i n i s t r a t i o n u n d e r c o n t r a c t D E - N A 0 0 0 3 5 2 5 .« less
Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R
2013-09-23
Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.
Analysis of a Probabilistic Model of Redundancy in Unsupervised Information Extraction
2010-08-25
5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS( ES ) University of Washington,Department of Computer Science and Engineering...Box 352350,Seattle,WA,98195 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS( ES ) 10. SPONSOR/MONITOR’S...approximation, with algebra we have: PUSC(x ∈ C|x appears k times inndraws) ≈ 1 1 + |E||C| ( pE pC )ken(pC−pE) . (2) In general, we expect the extraction
1979-10-01
D CD I- l M C’ m (’-01 V-~ "r c ml C- 00 0 v ~ ~ v V. v vCvq; o LO tol vo oo Co Lo 0 tD CI C CO U) 0 -4 l m1C’ .4oC cn z m’N t’l - ccC l m Z o .- 4C t...00013 IrTA 11 F j~)f~, I)~ l53 t.l .. AsOOM lf DATA CJ-3.(to S.1)sCODE(29 591)vCO0E(3s 5o11/ 49 b#ZOOOB/ 00013 DATA COJE(A. 69l)oC30E(29 691)*CCDE-(39...nn~i-,, ~.2 2-LCJM - 1 A, A -AI .DREfr Td ~ 92It 61 - ff~ *CTABLEW(16).CSTART(16).STBUF(1728JSrRUN(1728) 00004i C0MMOC4.E4iAY /ERROR S( 25001 00004
NASA Technical Reports Server (NTRS)
Broeze, R. J.; Pope, D. H.
1978-01-01
The inhibition of translation which is observed after shifting Escherichia coli to low temperature was investigated. 70 S ribosomes were isolated from E. coli 8 hours after a shift to 5 C synthesized protein in the absence of added mRNA (i.e., endogenous protein synthesis by 70 S monosomes) at a rate which was three times greater than the rate of endogenous protein synthesis by 70 S ribosomes which were isolated at the time of the shift to 5 C. Calculations based on the rates of endogenous protein synthesis and polyphenylalanine synthesis indicate that 70 S monosomes comprise only 0.1% of the total E. coli 70 S ribosome population after 8 hours at 5 c. Experiments designed to test initiation complex formation on ApUpG or formaldehyde treated MS-2 viral RNA demonstrated that, although the rate of formation of 30 S initiation complexes was not inhibited, the rate of formation of active 70 S initiation complexes, able to react with puromycin, was inhibited to a great extent at 5 C. A model depicting the effects of low temperature on the E. coli translation system is proposed.
75 FR 62182 - Notice of Final Federal Agency Actions on Proposed Highway in North Carolina
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-07
... Indian Religious Freedom Act [42 U.S.C. 1996]; Farmland Protection Policy Act (FPPA) [7 U.S.C. 4201-4209... Populations; E.O. 11593 Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O...
75 FR 28317 - Notice of Final Federal Agency Actions on Proposed Highways in Michigan
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-20
... 1964 [42 U.S.C 2000(d)-2000(d)(1)]; American Indians Religious Freedom Act [42 U.S.C. 1996]; Farmland... Populations; E.O. 11593, Protection and Enhancement of Cultural Resources; E.O. 13007, Indian Sacred Sites; E...
BIA AND DOD SCHOOLS: Student Achievement and Other Characteristics Often Differ from Public Schools
2001-09-01
access GAO reports on the Internet, send an e - mail message with “info” in the body to: Info@www.gao.gov or visit GAO’s World Wide Web home page at...may have more than one school. A F R I C A E U R O P E A T L A N T I C O C E A N Page 8 GAO-01-934 BIA and DOD Schools Figure 3: Locations of DOD...A S I A P A C I F I C O C E A N Page 9 GAO-01-934 BIA and DOD Schools Figure 4: Locations of DOD Domestic and Cuba Schools in School Year 1999–2000
1988-08-18
CONTENTS (cont.) C. Daily Average Nitrate Nitrogen, Upper Neutralization Basin .................................. 44 D . Daily Average Temperature (°C...PLANr WASTEWATER TREATMENT FACILITY, JANUARY 1985 THROUGH AUGUST 1986 W. DICKINSON BURROWS, Ph.D., P.E. in- T C ELIZABetH T. PAULSONS D ROBERT P...CARNAHAN, Ph.D., P.E.:.EL E C-T E FEB 0 6 1990. D Prepared for U.S. ARMY TOXIC AND PAZARDOUS MATERIALS AGENCY ABERDEEN PROVING GROUND, D ) 21010-5401 by U S
Two-Center/Three-Electron Sigma Half-Bonds in Main Group and Transition Metal Chemistry.
Berry, John F
2016-01-19
First proposed in a classic Linus Pauling paper, the two-center/three-electron (2c/3e) σ half-bond challenges the extremes of what may or may not be considered a chemical bond. Two electrons occupying a σ bonding orbital and one electron occupying the antibonding σ* orbital results in bond orders of ∼0.5 that are characteristic of metastable and exotic species, epitomized in the fleetingly stable He2(+) ion. In this Account, I describe the use of coordination chemistry to stabilize such fugacious three-electron bonded species at disparate ends of the periodic table. A recent emphasis in the chemistry of metal-metal bonds has been to prepare compounds with extremely short metal-metal distances and high metal-metal bond orders. But similar chemistry can be used to explore metal-metal bond orders less than one, including 2c/3e half-bonds. Bimetallic compounds in the Ni2(II,III) and Pd2(II,III) oxidation states were originally examined in the 1980s, but the evidence collected at that time suggested that they did not contain 2c/3e σ bonds. Both classes of compounds have been re-examined using EPR spectroscopy and modern computational methods that show the unpaired electron of each compound to occupy a M-M σ* orbital, consistent with 2c/3e Ni-Ni and Pd-Pd σ half-bonds. Elsewhere on the periodic table, a seemingly unrelated compound containing a trigonal bipyramidal Cu3S2 core caused a stir, leaving prominent theorists at odds with one another as to whether the compound contains a S-S bond. Due to my previous experience with 2c/3e metal-metal bonds, I suggested that the Cu3S2 compound could contain a 2c/3e S-S σ half-bond in the previously unknown oxidation state of S2(3-). By use of the Cambridge Database, a number of other known compounds were identified as potentially containing S2(3-) ligands, including a noteworthy set of cyclopentadienyl-supported compounds possessing diamond-shaped Ni2E2 units with E = S, Se, and Te. These compounds were subjected to extensive studies using X-ray absorption spectroscopy, X-ray photoelectron spectroscopy, density functional theory, and wave function-based computational methods, as well as chemical oxidation and reduction. The compounds contain E-E 2c/3e σ half-bonds and unprecedented E2(3-) "subchalcogenide" ligands, ushering in a new oxidation state paradigm for transition metal-chalcogen chemistry.
The Opposing Roles of Nucleophosmin and the ARF Tumor Suppressor in Breast Cancer
2007-04-01
P ., R. K. Busch, B. C. Valdez, and H. Busch. 1996 . C23 interacts with B23, a putative nucleolar...beneficial anti-cancer activity of peptides in vivo. Injection of a peptide from the von Hippel -Lindau (VHL) tumor suppressor inhibited the growth and... 240 WT Arf -/- 1 2 3 4 5 0 C y to s o lic 3 H -M e th y l M e th io n in e c p m ( x 1 0 3 ) A 28S 18S WT chase (min): Arf -/- 120 240 120 240 N
Staffing Cyber Operations (Briefing Charts)
2015-05-01
Ti tle 1 0 m is si on s N o tim e to b ui ld th is re qu ire m en t i n th e P O M – R eq ui re m...o r f ro m a co or di na te d m ili ta ry o pe ra tio n of w hi ch th at a ct c on st itu te s an in te gr al p ar t B el lig er en t...U se d C A P E F C oM To ol ; a dj us te d so m e fa ct or s S ub st itu
From Titan’s tholins to Titan’s aerosols: Isotopic study and chemical evolution at Titan’s surface
NASA Astrophysics Data System (ADS)
Nguyen, Mai-Julie; Raulin, François; Coll, Patrice; Derenne, Sylvie; Szopa, Cyril; Cernogora, Guy; Israël, Guy; Bernard, Jean-Michel
2008-07-01
In the present work, we focused on the possible isotopic fractionation of carbon during the processes involved in the formation of Titan’s tholins. We present the first results obtained on the 12C/13C isotopic ratios measured on Titan’s tholins synthesized in laboratory with cold plasma discharges. Measurements of isotopic ratio 12C/13C, done both on tholins and on the initial gas mixture (N2:CH4 (98:2)) used to produce them, do not show any evident deficit or enrichment in 13C relatively to 12C in the synthesized tholins, compared to the initial gas mixture. This observation allows to go further in the analyses of the ACP experiment data, including part of the Cassini Huygens mission. We also focused on the chemical evolution of the aerosols at Titan surface by studying species coming from acid hydrolysis treatment of Titan’s tholins. Preliminary results show a wide diversity of chemical families, going from carboxylic acids to amino acids. Advanced studies could bring at short-term clues on the still unidentified mixture that induces the decrease of the reflectivity as measure by the DISR instrument [Tomasko, M.G., Archinal, B., Becker, T., Bézard, B., Bushroe, M., Combes, M., Cook, D., Coustenis, A., de Bergh, C., Dafoe, L.E., Doose, L., Douté, S., Eibl, A., Engel, S., Gliem, F., Grieger, B., Holso, K., Howington-Kraus, E., Karkoschka, E., Keller, H.U., Kirk, R., Kramm, R., Küppers, M., Lanagan, P., Lellouch, E., Lemmon, M., Lunine, J., McFarlane, E., Moores, J., Prout, G.M., Rizk, B., Rosiek, M., Rueffer, P., Schröder, S.E., Schmitt, B., See, C., Smith, P., Soderblom, L., Thomas, N., West, R. Rain, winds and haze during the Huygens probe’s descent to Titan’s surface. Nature 438(7069), 765 778, 2005]. At longer-term it could allow to better understand the possible chemical evolution of the Titan’s aerosols after falling down at the surface when brought into contact with water.
E A R T H - S C I E N C E S L I N K S
TSUNAMI! NOAA TSUNAMI Project TSUNAMI Web Site TSUNAMIS in the circum-Pacific Ring of Fire The TSUNAMI DINOSAURS PLATE TECTONICS The Dinosaur Web Pages DINOSAURIA ON-LINE Fossils & Dinosaurs Earth Through opportunities in the earth sciences Geologic Time USGS Learning Web Geoscience Information Center National
A Vulnerability Assessment of the U.S. Small Business B2C E-Commerce Network Systems
ERIC Educational Resources Information Center
Zhao, Jensen J.; Truell, Allen D.; Alexander, Melody W.; Woosley, Sherry A.
2011-01-01
Objective: This study assessed the security vulnerability of the U.S. small companies' business-to-consumer (B2C) e-commerce network systems. Background: As the Internet technologies have been changing the way business is conducted, the U.S. small businesses are investing in such technologies and taking advantage of e-commerce to access global…
The Analysis Phase of MITHRAS.
1986-06-23
o •% •% • " + ". " . _.% .+. + , + •’. .’ .’ % ..’ ,’ -. • + , .... "...."....................-.. . % - . - rr.tr-e. n-.,~,.-~ w w X- C W- W, WU- I...v- 1? HLI 12 HL T ~ ~~0 a. .- - cc cc CD u 8 A DC Cj 0NJ o’u o .21 0 S cDc 00 CO LU Z. -j z4 CD - cow m 0 /~~ W "~~ ZZ~ C w Nŕ*\\ co Li. 46~ Between...electrons. 75 1,6’ S 2 - =0 N E’ 0 z CD (D z 0 D E C E -z 2 ZO -U.1’ C4 Euc CD o LJo E
Design of Computer-Related Workstations in Relation to Job Functions and Productivity.
1984-12-01
I nadequat e Neut ra I Adequat e Mana,’,ement 36.6% 17. 3 46.2 C Compiter Prog. 45.1 25.3 29.7 Syst ems Analyst 44.6 20.0 35.4 FPmctional Analyst...2~ der md prJgrvTm~r C S 4 0 6 I 0 I S I S g tS * Ar . ± " S . l _ - ---- ,E- , ! ---- - -.-- _EA E L 2 . ... .. __., ____ I - / 1: - i - - " I...there ;ire lrina van :ibl -e; which .0 tect fati I I ty desi gn and l ayout. In a professional * oputr-rlatd ’vi ronimInt , sat i stact 110 with
Code of Federal Regulations, 2013 CFR
2013-04-01
... 41403(6) of the Violence Against Women Act of 1994 (42 U.S.C. 14043e-2(6)), section 330(h)(5)(A) of the... Start Act (42 U.S.C. 9832), section 41403 of the Violence Against Women Act of 1994 (42 U.S.C. 14043e-2...; histories of domestic violence or childhood abuse (including neglect); the presence of a child or youth with...
Code of Federal Regulations, 2014 CFR
2014-04-01
... 41403(6) of the Violence Against Women Act of 1994 (42 U.S.C. 14043e-2(6)), section 330(h)(5)(A) of the... Start Act (42 U.S.C. 9832), section 41403 of the Violence Against Women Act of 1994 (42 U.S.C. 14043e-2...; histories of domestic violence or childhood abuse (including neglect); the presence of a child or youth with...
Single Electron Delivery to Lewis Pairs: An Avenue to Anions by Small Molecule Activation.
Liu, Liu Leo; Cao, Levy L; Shao, Yue; Stephan, Douglas W
2017-07-26
Single electron transfer (SET) reactions are effected by the combination of a Lewis acid (e.g., E(C 6 F 5 ) 3 E = B or Al) with a small molecule substrate and decamethylferrocene (Cp* 2 Fe). Initially, the corresponding reactions of (PhS) 2 and (PhTe) 2 were shown to give the species [Cp* 2 Fe][PhSB(C 6 F 5 ) 3 ] 1 and [Cp* 2 Fe][(μ-PhS)(Al(C 6 F 5 ) 3 ) 2 ] 2 and [Cp* 2 Fe][(μ-PhTe)(Al(C 6 F 5 ) 3 ) 2 ] 3, respectively. Analogous reactions with di-tert-butyl peroxide yielded [Cp* 2 Fe][(μ-HO)(B(C 6 F 5 ) 3 ) 2 ] 4 with isobutene while with benzoyl peroxide afforded [Cp* 2 Fe][PhC(O)OE(C 6 F 5 ) 3 ] (E = B 5, Al 6). Evidence for a radical pathway was provided by the reaction of Ph 3 SnH and p-quinone afforded [Cp* 2 Fe][HB(C 6 F 5 ) 3 ] 7 and [Cp* 2 Fe] 2 [(μ-O 2 C 6 H 4 )(E(C 6 F 5 ) 3 ) 2 ] (E = B 8, Al 9). In addition, the reaction of TEMPO with Lewis acid and Cp* 2 Fe afforded [Cp* 2 Fe][(C 5 H 6 Me 4 NOE(C 6 F 5 ) 3 ] (E = B 10, Al 11). Finally, reactions with O 2 , Se, Te and S 8 gave [Cp* 2 Fe] 2 [((C 6 F 5 ) 2 Al(μ-O)Al(C 6 F 5 ) 3 ) 2 ] 2 12, [Cp* 2 Fe] 2 [((C 6 F 5 ) 2 Al(μ-Se)Al(C 6 F 5 ) 3 ) 2 ] 2 13, [Cp* 2 Fe][(μ-Te) 2 (Al(C 6 F 5 ) 2 ) 3 ] 14 and [Cp* 2 Fe] 2 [(μ-S 7 )B(C 6 F 5 ) 3 ) 2 ] 15, respectively. The mechanisms of these SET reactions are discussed, and the ramifications are considered.
Corrosion-Control (CC) Program: Pilot Powder Coating Station Service Test.
1986-03-14
o CL oU C4 CL00 z ;,S Go 0 m~ CL - C9 uj4 U..~D o . ZC.F Go zz 2 0 I- - c t < m U, cc V V4 cg c ~ D GD...Spray Booth# Curing Oven and A2-58 UNIT TOTAL is_18 A2-1 1WOW - o 0 -1 Q S re. 10 U c Z. 2E E. a.E 8 tE 20 4AU ==- %A a 4 $AO - Lo 48 0 w 0 -IL .. 0.... 0...Laa 00 3-r Q’ IA E zo 0..0 -< 4o C a) Ia - o x c bi. l c *4 ’a a~~* coLo. 0V Ua- 41 w - a V 2 2 .8 h A a U to bo co i ac
1993-04-01
Co -ag a 9LiC o 4 L ma o ~ %an -cc 4nm a- .& el 1 ’AU) -j mat ma -- C2~. q.ýIL1g 9L maa-. 0 IFm ma cn "ij 4A ~ ~ ~ ~ ~ ~ ~ ~ r.. It C m;R .4IOa iec...am E n E n a- I E n C a g enS at ao on ~ 1 4a -w ;=- Lu -s I. LIMEn Lu d4 V. a a U a - aMC igS re aa- a-m n En - El In cc Ena LM am IL. l-S kCa En...In I! N.! cIn () n (0 a CD 0 IInl 0C el -i ca af. Ca’. C-)rJ 1 . a" r- a ý i an a’ I- a a* * aina - S~ ~~~ In ~ I’ N. - U I n InnI al f I’f InI- 5
Joint Force Quarterly. Number 21, Spring 1999
1999-03-01
T H E J O I N T W O R L D 113 Doctrine ■ O F F T H E S H E L F 115 Mahan’s Blindness and Brilliance: A Review Essay...er ) U . S . A ir Fo rc e (J oe B el a) 2d M ar in e D iv is io n, C om ba t C am er a (J ac ob A . F ul le r) Marines in Norway for Battle...98. 2d M ar in e D iv is
NASA Astrophysics Data System (ADS)
Beretta, Gian Paolo; Rivadossi, Luca; Janbozorgi, Mohammad
2018-04-01
Rate-Controlled Constrained-Equilibrium (RCCE) modeling of complex chemical kinetics provides acceptable accuracies with much fewer differential equations than for the fully Detailed Kinetic Model (DKM). Since its introduction by James C. Keck, a drawback of the RCCE scheme has been the absence of an automatable, systematic procedure to identify the constraints that most effectively warrant a desired level of approximation for a given range of initial, boundary, and thermodynamic conditions. An optimal constraint identification has been recently proposed. Given a DKM with S species, E elements, and R reactions, the procedure starts by running a probe DKM simulation to compute an S-vector that we call overall degree of disequilibrium (ODoD) because its scalar product with the S-vector formed by the stoichiometric coefficients of any reaction yields its degree of disequilibrium (DoD). The ODoD vector evolves in the same (S-E)-dimensional stoichiometric subspace spanned by the R stoichiometric S-vectors. Next we construct the rank-(S-E) matrix of ODoD traces obtained from the probe DKM numerical simulation and compute its singular value decomposition (SVD). By retaining only the first C largest singular values of the SVD and setting to zero all the others we obtain the best rank-C approximation of the matrix of ODoD traces whereby its columns span a C-dimensional subspace of the stoichiometric subspace. This in turn yields the best approximation of the evolution of the ODoD vector in terms of only C parameters that we call the constraint potentials. The resulting order-C RCCE approximate model reduces the number of independent differential equations related to species, mass, and energy balances from S+2 to C+E+2, with substantial computational savings when C ≪ S-E.
2001-10-01
Douglas, H. Murphey, B.A. Muggenburg, S. Zicker , and N.W. Milgram. The effects of experience and antioxidants on size discrimination learning in the dog...submission: Appendix F. N.W. Milgram, S.C. Zicker , E. Head, B.A. Muggenburg, H. Murphey, C. Ikeda-Douglas, and C.W. Cotman. Dietary enrichment...dysfunction in canines N.W. Milgram,1* S.C. Zicker ,2 E. Head,3 B. A.Muggenburg,4 H. Murphey,4 C. Ikeda-Douglas’, and C.W. Cotman 3 ’Life Science Division
Editorial: Focus on Laser- and Beam-Driven Plasma Accelerators
NASA Astrophysics Data System (ADS)
Joshi, Chan; Malka, Victor
2010-04-01
The ability of short but intense laser pulses to generate high-energy electrons and ions from gaseous and solid targets has been well known since the early days of the laser fusion program. However, during the past decade there has been an explosion of experimental and theoretical activity in this area of laser-matter interaction, driven by the prospect of realizing table-top plasma accelerators for research, medical and industrial uses, and also relatively small and inexpensive plasma accelerators for high-energy physics at the frontier of particle physics. In this focus issue on laser- and beam-driven plasma accelerators, the latest advances in this field are described. Focus on Laser- and Beam-Driven Plasma Accelerators Contents Slow wave plasma structures for direct electron acceleration B D Layer, J P Palastro, A G York, T M Antonsen and H M Milchberg Cold injection for electron wakefield acceleration X Davoine, A Beck, A Lifschitz, V Malka and E Lefebvre Enhanced proton flux in the MeV range by defocused laser irradiation J S Green, D C Carroll, C Brenner, B Dromey, P S Foster, S Kar, Y T Li, K Markey, P McKenna, D Neely, A P L Robinson, M J V Streeter, M Tolley, C-G Wahlström, M H Xu and M Zepf Dose-dependent biological damage of tumour cells by laser-accelerated proton beams S D Kraft, C Richter, K Zeil, M Baumann, E Beyreuther, S Bock, M Bussmann, T E Cowan, Y Dammene, W Enghardt, U Helbig, L Karsch, T Kluge, L Laschinsky, E Lessmann, J Metzkes, D Naumburger, R Sauerbrey, M. Scḧrer, M Sobiella, J Woithe, U Schramm and J Pawelke The optimum plasma density for plasma wakefield excitation in the blowout regime W Lu, W An, M Zhou, C Joshi, C Huang and W B Mori Plasma wakefield acceleration experiments at FACET M J Hogan, T O Raubenheimer, A Seryi, P Muggli, T Katsouleas, C Huang, W Lu, W An, K A Marsh, W B Mori, C E Clayton and C Joshi Electron trapping and acceleration on a downward density ramp: a two-stage approach R M G M Trines, R Bingham, Z Najmudin, S Mangles, L O Silva, R Fonseca and P A Norreys Electro-optic shocks from blowout laser wakefields D F Gordon, A Ting, M H Helle, D Kaganovich and B Hafizi Onset of self-steepening of intense laser pulses in plasmas J Vieira, F Fiúza, L O Silva, M Tzoufras and W B Mori Analysis of laser wakefield dynamics in capillary tubes N E Andreev, K Cassou, F Wojda, G Genoud, M Burza, O Lundh, A Persson, B Cros, V E Fortov and C-G Wahlstrom Characterization of the beam loading effects in a laser plasma accelerator C Rechatin, J Faure, X Davoine, O Lundh, J Lim, A Ben-Ismaïl, F Burgy, A Tafzi, A Lifschitz, E Lefebvre and V Malka Energy gain scaling with plasma length and density in the plasma wakefield accelerator P Muggli, I Blumenfeld, C E Clayton, F J Decker, M J Hogan, C Huang, R Ischebeck, R H Iverson, C Joshi, T Katsouleas, N Kirby, W Lu, K A Marsh, W B Mori, E Oz, R H Siemann, D R Walz and M Zhou Generation of tens of GeV quasi-monoenergetic proton beams from a moving double layer formed by ultraintense lasers at intensity 1021-1023Wcm-2 Lu-Le Yu, Han Xu, Wei-Min Wang, Zheng-Ming Sheng, Bai-Fei Shen, Wei Yu and Jie Zhang Carbon ion acceleration from thin foil targets irradiated by ultrahigh-contrast, ultraintense laser pulses D C Carroll, O Tresca, R Prasad, L Romagnani, P S Foster, P Gallegos, S Ter-Avetisyan, J S Green, M J V Streeter, N Dover, C A J Palmer, C M Brenner, F H Cameron, K E Quinn, J Schreiber, A P L Robinson, T Baeva, M N Quinn, X H Yuan, Z Najmudin, M Zepf, D Neely, M Borghesi and P McKenna Numerical modelling of a 10-cm-long multi-GeV laser wakefield accelerator driven by a self-guided petawatt pulse S Y Kalmykov, S A Yi, A Beck, A F Lifschitz, X Davoine, E Lefebvre, A Pukhov, V Khudik, G Shvets, S A Reed, P Dong, X Wang, D Du, S Bedacht, R Zgadzaj, W Henderson, A Bernstein, G Dyer, M Martinez, E Gaul, T Ditmire and M C Downer Effects of laser prepulses on laser-induced proton generation D Batani, R Jafer, M Veltcheva, R Dezulian, O Lundh, F Lindau, A Persson, K Osvay, C-G Wahlström, D C Carroll, P McKenna, A Flacco and V Malka Proton acceleration by moderately relativistic laser pulses interacting with solid density targets Erik Lefebvre, Laurent Gremillet, Anna Lévy, Rachel Nuter, Patrizio Antici, Michaël Carrié, Tiberio Ceccotti, Mathieu Drouin, Julien Fuchs, Victor Malka and David Neely Holographic visualization of laser wakefields P Dong, S A Reed, S A Yi, S Kalmykov, Z Y Li, G Shvets, N H Matlis, C McGuffey, S S Bulanov, V Chvykov, G Kalintchenko, K Krushelnick, A Maksimchuk, T Matsuoka, A G R Thomas, V Yanovsky and M C Downer The scaling of proton energies in ultrashort pulse laser plasma acceleration K Zeil, S D Kraft, S Bock, M Bussmann, T E Cowan, T Kluge, J Metzkes, T Richter, R Sauerbrey and U Schramm Plasma cavitation in ultraintense laser interactions with underdense helium plasmas P M Nilson, S P D Mangles, L Willingale, M C Kaluza, A G R Thomas, M Tatarakis, R J Clarke, K L Lancaster, S Karsch, J Schreiber, Z Najmudin, A E Dangor and K Krushelnick Radiation pressure acceleration of ultrathin foils Andrea Macchi, Silvia Veghini, Tatyana V Liseykina and Francesco Pegoraro Target normal sheath acceleration: theory, comparison with experiments and future perspectives Matteo Passoni, Luca Bertagna and Alessandro Zani Generation of a highly collimated, mono-energetic electron beam from laser-driven plasma-based acceleration Sanyasi Rao Bobbili, Anand Moorti, Prasad Anant Naik and Parshotam Dass Gupta Controlled electron acceleration in the bubble regime by optimizing plasma density Meng Wen, Baifei Shen, Xiaomei Zhang, Fengchao Wang, Zhangying Jin, Liangliang Ji, Wenpeng Wang, Jiancai Xu and Kazuhisa Nakajima A multidimensional theory for electron trapping by a plasma wake generated in the bubble regime I Kostyukov, E Nerush, A Pukhov and V Seredov Investigation of the role of plasma channels as waveguides for laser-wakefield accelerators T P A Ibbotson, N Bourgeois, T P Rowlands-Rees, L S Caballero, S I Bajlekov, P A Walker, S Kneip, S P D Mangles, S R Nagel, C A J Palmer, N Delerue, G Doucas, D Urner, O Chekhlov, R J Clarke, E Divall, K Ertel, P Foster, S J Hawkes, C J Hooker, B Parry, P P Rajeev, M J V Streeter and S M Hooker Divergence of fast ions generated by interaction of intense ultra-high contrast laser pulses with thin foils A Andreev, T Ceccotti, A Levy, K Platonov and Ph Martin The application of laser-driven proton beams to the radiography of intense laser-hohlraum interactions G Sarri, C A Cecchetti, L Romagnani, C M Brown, D J Hoarty, S James, J Morton, M E Dieckmann, R Jung, O Willi, S V Bulanov, F Pegoraro and M Borghesi Laser-driven particle and photon beams and some applications K W D Ledingham and W Galster Target shape effects on monoenergetic GeV proton acceleration Min Chen, Tong-Pu Yu, Alexander Pukhov and Zheng-Ming Sheng
77 FR 26355 - Notice of Final Federal Agency Actions on Avenida Rio Salado/Broadway Road
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-03
...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indian Religious Freedom Act [42 U.S.C... of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America; E.O. 13175...
75 FR 59325 - Notice of Final Federal Agency Actions on Proposed Highway in North Carolina
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-27
...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indian Religious Freedom Act [42 U.S.C... of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America; E.O. 13175...
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-07
... 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indians Religious Freedom Act [42 U.S.C. 1996]; Farmland...; E.O. 11593, Protection and Enhancement of Cultural Resources; E.O. 13007, Indian Sacred Sites; E.O...
77 FR 531 - Notice of Limitation on Claims Against a Proposed Transportation Project
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-05
...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)); American Indian Religious Freedom Act [42 U.S.C... Populations; E.O. 11593 Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O...
DOT National Transportation Integrated Search
2012-10-31
This zip file contains 45 files of data to support FHWA-JPO-13-063 Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) : Concept of Operations. Zip size is 9.9 MB. The files have been uploaded as-is; no fu...
C 1 s ionization in C sub 2 H sub 2 studied by asymmetric ( e ,2 e ) experiments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Avaldi, L.; Camilloni, R.; Stefani, G.
1990-01-01
The dynamics of core ionization by electron impact is investigated through the measurement of the triply differential cross section of the C {sigma}1{ital s} orbital in the molecule C{sub 2}H{sub 2}. The ({ital e},2{ital e}) experiments have been performed under asymmetric conditions and at small scattering angles, with a scattered electron energy of 1500 eV and low energies of the ejected electrons (9.6 and 41.0 eV). The measured angular distributions are characterized by large-size recoil lobes, breaking of the symmetry around the momentum-transfer direction, and unusual deviations of the maxima of the recoil peaks towards smaller deflection angles. In themore » ({ital e},2{ital e}) energy spectrum a shift is observed in the position of the C {sigma}1{ital s} peak with respect to the expected value as measured by x-ray photoelectron spectroscopy. The amplitude of the shift amounts to 0.46{plus minus}0.23 eV at 9.6 eV excess energy, and it is too large to be explained only in terms of postcollision interactions.« less
Wind-Tunnel Tests of Air Inlet and Outlet Openings on a Streamline Body
1940-11-01
e. , ko :3,%me 9_s +h.o stat- e -orossu_re of _’ ._c%_rn:zl "".: ._ ,_.ac o ,., zio;7 in the vicinit?r of the 0ooni_=.o _._., _.c.di _’:,._.......] ch...m!ine b,-’,,.d’_; were carr’.ed to 4:50 nJ.!es _qer Ko -Qr. ’_he t __%_ O? %x.:(" 0. .... __ _S were gtu o_:. ,-r:: oil _ _r miles per b.c_ro Th:’s...8217c,.’_u41:L:’zc; bo a’_ dis- - trib_._tion,, 0_0..-.,:.5_ ts.e :.7o:_’.:r,_:,r& . ........ :-or of ’ sko >qd::" zo r_orc- _’_C;.,’_.D0C]’"̂ .. _3
P-wave excited {B}_{c}^{* * } meson photoproduction at the LHeC
NASA Astrophysics Data System (ADS)
Kai, He; Huan-Yu, Bi; Ren-You, Zhang; Xiao-Zhou, Li; Wen-Gan, Ma
2018-05-01
As an important sequential work of the S-wave {B}c(* ) ({}1{S}0({}3{S}1) ) meson production at the large hadron electron collider (LHeC), we investigate the production of the P-wave excited {B}c* * states (1 P 1 and 3 P J with J = 0, 1, 2) via photoproduction mechanism within the framework of nonrelativistic QCD at the LHeC. Generally, the {e}-+P\\to γ +g\\to {B}c* * +b+\\bar{c} process is considered as the main production mechanism at an electron–proton collider due to the large luminosity of the gluon. However, according to our experience on the S-wave {B}c(* ) meson production at the LHeC, the extrinsic production mechanism, i.e., {e}-+P\\to γ +c\\to {B}c* * +b and {e}-+P\\to γ +\\bar{b} \\to {B}c* * +\\bar{c}, could also provide dominating contributions at low p T region. A careful treatment between these channels is performed and the results on total and differential cross sections, together with main uncertainties are discussed. Taking the quark masses m b = 4.90 ± 0.40 GeV and m c = 1.50 ± 0.20 GeV into account and summing up all the production channels, we expect to accumulate ({2.48}-1.75+3.55)× {10}4 {B}c* * ({}1{P}1), ({1.14}-0.82+1.49)× {10}4 {B}c* * ({}3{P}0),({2.38}-1.74+3.39)× {10}4 {B}c* * ({}3{P}1) and ({5.59}-3.93+7.84)× {10}4 {B}c* * ({}3{P}2) events at the \\sqrt{S}=1.30 {{T}}{{e}}{{V}} LHeC in one operation year with luminosity { \\mathcal L }={10}33 cm‑2 s‑1. With such sizable events, it is worth studying the properties of excited P-wave {B}c* * states at the LHeC.
1978-06-01
computer systems is their continual i n c o r p o r a t i o n o f a d d i t i o n a l f u n c t i o n s . Figure 2 represents this... o u t t h i s , on ly pa r t i a l ad hoc so lu t ions can be found. ( R e f e r e n c e 8 )- 4 3 WORLIMIDE SHIPBUILDING COMPUTER SYSTEMS ARE...and which i s ine f f i c i en t to support manually. Before in tegra t ion , th i s da ta f low requ i res manua l ( o r pe rhaps
Observation of a narrow meson decaying to D+sπ0γ at a mass of 2.458 GeV/c2
NASA Astrophysics Data System (ADS)
Aubert, B.; Barate, R.; Boutigny, D.; Gaillard, J.-M.; Hicheur, A.; Karyotakis, Y.; Lees, J. P.; Robbe, P.; Tisserand, V.; Zghiche, A.; Palano, A.; Pompili, A.; Chen, J. C.; Qi, N. D.; Rong, G.; Wang, P.; Zhu, Y. S.; Eigen, G.; Ofte, I.; Stugu, B.; Abrams, G. S.; Borgland, A. W.; Breon, A. B.; Brown, D. N.; Button-Shafer, J.; Cahn, R. N.; Charles, E.; Day, C. T.; Gill, M. S.; Gritsan, A. V.; Groysman, Y.; Jacobsen, R. G.; Kadel, R. W.; Kadyk, J.; Kerth, L. T.; Kolomensky, Yu. G.; Kukartsev, G.; Leclerc, C.; Levi, M. E.; Lynch, G.; Mir, L. M.; Oddone, P. J.; Orimoto, T. J.; Pripstein, M.; Roe, N. A.; Romosan, A.; Ronan, M. T.; Shelkov, V. G.; Telnov, A. V.; Wenzel, W. A.; Ford, K.; Harrison, T. J.; Hawkes, C. M.; Knowles, D. J.; Morgan, S. E.; Penny, R. C.; Watson, A. T.; Watson, N. K.; Goetzen, K.; Held, T.; Koch, H.; Lewandowski, B.; Pelizaeus, M.; Peters, K.; Schmuecker, H.; Steinke, M.; Boyd, J. T.; Chevalier, N.; Cottingham, W. N.; Kelly, M. P.; Latham, T. E.; Mackay, C.; Wilson, F. F.; Abe, K.; Cuhadar-Donszelmann, T.; Hearty, C.; Mattison, T. S.; McKenna, J. A.; Thiessen, D.; Kyberd, P.; McKemey, A. K.; Teodorescu, L.; Blinov, V. E.; Bukin, A. D.; Golubev, V. B.; Ivanchenko, V. N.; Kravchenko, E. A.; Onuchin, A. P.; Serednyakov, S. I.; Skovpen, Yu. I.; Solodov, E. P.; Yushkov, A. N.; Best, D.; Bruinsma, M.; Chao, M.; Kirkby, D.; Lankford, A. J.; Mandelkern, M.; Mommsen, R. K.; Roethel, W.; Stoker, D. P.; Buchanan, C.; Hartfiel, B. L.; Gary, J. W.; Layter, J.; Shen, B. C.; Wang, K.; del Re, D.; Hadavand, H. K.; Hill, E. J.; Macfarlane, D. B.; Paar, H. P.; Rahatlou, Sh.; Sharma, V.; Berryhill, J. W.; Campagnari, C.; Dahmes, B.; Kuznetsova, N.; Levy, S. L.; Long, O.; Lu, A.; Mazur, M. A.; Richman, J. D.; Verkerke, W.; Beck, T. W.; Beringer, J.; Eisner, A. M.; Heusch, C. A.; Lockman, W. S.; Schalk, T.; Schmitz, R. E.; Schumm, B. A.; Seiden, A.; Turri, M.; Walkowiak, W.; Williams, D. C.; Wilson, M. G.; Albert, J.; Chen, E.; Dubois-Felsmann, G. P.; Dvoretskii, A.; Erwin, R. J.; Hitlin, D. G.; Narsky, I.; Piatenko, T.; Porter, F. C.; Ryd, A.; Samuel, A.; Yang, S.; Jayatilleke, S.; Mancinelli, G.; Meadows, B. T.; Sokoloff, M. D.; Abe, T.; Blanc, F.; Bloom, P.; Chen, S.; Clark, P. J.; Ford, W. T.; Nauenberg, U.; Olivas, A.; Rankin, P.; Roy, J.; Smith, J. G.; van Hoek, W. C.; Zhang, L.; Harton, J. L.; Hu, T.; Soffer, A.; Toki, W. H.; Wilson, R. J.; Zhang, J.; Altenburg, D.; Brandt, T.; Brose, J.; Colberg, T.; Dickopp, M.; Dubitzky, R. S.; Hauke, A.; Lacker, H. M.; Maly, E.; Müller-Pfefferkorn, R.; Nogowski, R.; Otto, S.; Schubert, J.; Schubert, K. R.; Schwierz, R.; Spaan, B.; Wilden, L.; Bernard, D.; Bonneaud, G. R.; Brochard, F.; Cohen-Tanugi, J.; Grenier, P.; Thiebaux, Ch.; Vasileiadis, G.; Verderi, M.; Khan, A.; Lavin, D.; Muheim, F.; Playfer, S.; Swain, J. E.; Andreotti, M.; Azzolini, V.; Bettoni, D.; Bozzi, C.; Calabrese, R.; Cibinetto, G.; Luppi, E.; Negrini, M.; Piemontese, L.; Sarti, A.; Treadwell, E.; Anulli, F.; Baldini-Ferroli, R.; Biasini, M.; Calcaterra, A.; de Sangro, R.; Falciai, D.; Finocchiaro, G.; Patteri, P.; Peruzzi, I. M.; Piccolo, M.; Pioppi, M.; Zallo, A.; Buzzo, A.; Capra, R.; Contri, R.; Crosetti, G.; Lo Vetere, M.; Macri, M.; Monge, M. R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Santroni, A.; Tosi, S.; Bailey, S.; Morii, M.; Won, E.; Bhimji, W.; Bowerman, D. A.; Dauncey, P. D.; Egede, U.; Eschrich, I.; Gaillard, J. R.; Morton, G. W.; Nash, J. A.; Sanders, P.; Taylor, G. P.; Grenier, G. J.; Lee, S.-J.; Mallik, U.; Cochran, J.; Crawley, H. B.; Lamsa, J.; Meyer, W. T.; Prell, S.; Rosenberg, E. I.; Yi, J.; Davier, M.; Grosdidier, G.; Höcker, A.; Laplace, S.; Le Diberder, F.; Lepeltier, V.; Lutz, A. M.; Petersen, T. C.; Plaszczynski, S.; Schune, M. H.; Tantot, L.; Wormser, G.; Brigljević, V.; Cheng, C. H.; Lange, D. J.; Simani, M. C.; Wright, D. M.; Bevan, A. J.; Coleman, J. P.; Fry, J. R.; Gabathuler, E.; Gamet, R.; Kay, M.; Parry, R. J.; Payne, D. J.; Sloane, R. J.; Touramanis, C.; Back, J. J.; Harrison, P. F.; Shorthouse, H. W.; Vidal, P. B.; Brown, C. L.; Cowan, G.; Flack, R. L.; Flaecher, H. U.; George, S.; Green, M. G.; Kurup, A.; Marker, C. E.; McMahon, T. R.; Ricciardi, S.; Salvatore, F.; Vaitsas, G.; Winter, M. A.; Brown, D.; Davis, C. L.; Allison, J.; Barlow, N. R.; Barlow, R. J.; Hart, P. A.; Hodgkinson, M. C.; Jackson, F.; Lafferty, G. D.; Lyon, A. J.; Weatherall, J. H.; Williams, J. C.; Farbin, A.; Jawahery, A.; Kovalskyi, D.; Lae, C. K.; Lillard, V.; Roberts, D. A.; Blaylock, G.; Dallapiccola, C.; Flood, K. T.; Hertzbach, S. S.; Kofler, R.; Koptchev, V. B.; Moore, T. B.; Saremi, S.; Staengle, H.; Willocq, S.; Cowan, R.; Sciolla, G.; Taylor, F.; Yamamoto, R. K.; Mangeol, D. J.; Patel, P. M.; Robertson, S. H.; Lazzaro, A.; Palombo, F.; Bauer, J. M.; Cremaldi, L.; Eschenburg, V.; Godang, R.; Kroeger, R.; Reidy, J.; Sanders, D. A.; Summers, D. J.; Zhao, H. W.; Brunet, S.; Cote-Ahern, D.; Taras, P.; Nicholson, H.; Cartaro, C.; Cavallo, N.; de Nardo, G.; Fabozzi, F.; Gatto, C.; Lista, L.; Paolucci, P.; Piccolo, D.; Sciacca, C.; Baak, M. A.; Raven, G.; Losecco, J. M.; Gabriel, T. A.; Brau, B.; Gan, K. K.; Honscheid, K.; Hufnagel, D.; Kagan, H.; Kass, R.; Pulliam, T.; Wong, Q. K.; Brau, J.; Frey, R.; Potter, C. T.; Sinev, N. B.; Strom, D.; Torrence, E.; Colecchia, F.; Dorigo, A.; Galeazzi, F.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Tiozzo, G.; Voci, C.; Benayoun, M.; Briand, H.; Chauveau, J.; David, P.; de La Vaissière, Ch.; del Buono, L.; Hamon, O.; John, M. J.; Leruste, Ph.; Ocariz, J.; Pivk, M.; Roos, L.; Stark, J.; T'jampens, S.; Therin, G.; Manfredi, P. F.; Re, V.; Behera, P. K.; Gladney, L.; Guo, Q. H.; Panetta, J.; Angelini, C.; Batignani, G.; Bettarini, S.; Bondioli, M.; Bucci, F.; Calderini, G.; Carpinelli, M.; del Gamba, V.; Forti, F.; Giorgi, M. A.; Lusiani, A.; Marchiori, G.; Martinez-Vidal, F.; Morganti, M.; Neri, N.; Paoloni, E.; Rama, M.; Rizzo, G.; Sandrelli, F.; Walsh, J.; Haire, M.; Judd, D.; Paick, K.; Wagoner, D. E.; Danielson, N.; Elmer, P.; Lu, C.; Miftakov, V.; Olsen, J.; Smith, A. J.; Tanaka, H. A.; Varnes, E. W.; Bellini, F.; Cavoto, G.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Gaspero, M.; Mazzoni, M. A.; Morganti, S.; Pierini, M.; Piredda, G.; Safai Tehrani, F.; Voena, C.; Christ, S.; Wagner, G.; Waldi, R.; Adye, T.; de Groot, N.; Franek, B.; Geddes, N. I.; Gopal, G. P.; Olaiya, E. O.; Xella, S. M.; Aleksan, R.; Emery, S.; Gaidot, A.; Ganzhur, S. F.; Giraud, P.-F.; Hamel de Monchenault, G.; Kozanecki, W.; Langer, M.; Legendre, M.; London, G. W.; Mayer, B.; Schott, G.; Vasseur, G.; Yeche, Ch.; Zito, M.; Purohit, M. V.; Weidemann, A. W.; Yumiceva, F. X.; Aston, D.; Bartelt, J.; Bartoldus, R.; Berger, N.; Boyarski, A. M.; Buchmueller, O. L.; Convery, M. R.; Coupal, D. P.; Dong, D.; Dorfan, J.; Dujmic, D.; Dunwoodie, W.; Field, R. C.; Glanzman, T.; Gowdy, S. J.; Grauges-Pous, E.; Hadig, T.; Halyo, V.; Hryn'ova, T.; Innes, W. R.; Jessop, C. P.; Kelsey, M. H.; Kim, P.; Kocian, M. L.; Langenegger, U.; Leith, D. W.; Libby, J.; Luitz, S.; Luth, V.; Lynch, H. L.; Marsiske, H.; Messner, R.; Muller, D. R.; O'Grady, C. P.; Ozcan, V. E.; Perazzo, A.; Perl, M.; Petrak, S.; Ratcliff, B. N.; Roodman, A.; Salnikov, A. A.; Schindler, R. H.; Schwiening, J.; Simi, G.; Snyder, A.; Soha, A.; Stelzer, J.; Su, D.; Sullivan, M. K.; Va'Vra, J.; Wagner, S. R.; Weaver, M.; Weinstein, A. J.; Wisniewski, W. J.; Wright, D. H.; Young, C. C.; Burchat, P. R.; Edwards, A. J.; Meyer, T. I.; Petersen, B. A.; Roat, C.; Ahmed, M.; Ahmed, S.; Alam, M. S.; Ernst, J. A.; Saeed, M. A.; Saleem, M.; Wappler, F. R.; Bugg, W.; Krishnamurthy, M.; Spanier, S. M.; Eckmann, R.; Kim, H.; Ritchie, J. L.; Schwitters, R. F.; Izen, J. M.; Kitayama, I.; Lou, X. C.; Ye, S.; Bianchi, F.; Bona, M.; Gallo, F.; Gamba, D.; Borean, C.; Bosisio, L.; della Ricca, G.; Dittongo, S.; Grancagnolo, S.; Lanceri, L.; Poropat, P.; Vitale, L.; Vuagnin, G.; Panvini, R. S.; Banerjee, Sw.; Brown, C. M.; Fortin, D.; Jackson, P. D.; Kowalewski, R.; Roney, J. M.; Band, H. R.; Dasu, S.; Datta, M.; Eichenbaum, A. M.; Johnson, J. R.; Kutter, P. E.; Li, H.; Liu, R.; di Lodovico, F.; Mihalyi, A.; Mohapatra, A. K.; Pan, Y.; Prepost, R.; Sekula, S. J.; von Wimmersperg-Toeller, J. H.; Wu, J.; Wu, S. L.; Yu, Z.; Neal, H.
2004-02-01
A narrow state, which we label DsJ(2458)+, with a mass 2458.0±1.0 (stat)±1.0 (syst) MeV/c2, is observed in the inclusive D+sπ0γ mass distribution in 91 fb-1 of e+e- annihilation data recorded by the BABAR detector at the SLAC PEP-II asymmetric-energy e+e- storage ring. The observed width is consistent with the experimental resolution. The data favor decay through D*s(2112)+π0 rather than through D*sJ(2317)+γ. An analysis of D+sπ0 data accounting for the influence of the DsJ(2458)+ produces a D*sJ(2317)+ mass of 2317.3±0.4 (stat)±0.8 (syst) MeV/c2.
Search for the decays B_{(s)};{0} --> e;{+} micro;{-} and B_{(s)};{0} --> e;{+} e;{-} in CDF run II.
Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Griso, S Pagan; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Peiffer, T; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Renz, M; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Rutherford, B; Saarikko, H; Safonov, A; Sakumoto, W K; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sforza, F; Sfyrla, A; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shiraishi, S; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Stuart, D; Suh, J S; Sukhanov, A; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Ttito-Guzmán, P; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Tourneur, S; Trovato, M; Tsai, S-Y; Tu, Y; Turini, N; Ukegawa, F; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wagner-Kuhr, J; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Weinelt, J; Wenzel, H; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Würthwein, F; Xie, S; Yagil, A; Yamamoto, K; Yamaoka, J; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zhang, X; Zheng, Y; Zucchelli, S
2009-05-22
We report results from a search for the lepton flavor violating decays B_{s};{0} --> e;{+} micro;{-} and B;{0} --> e;{+} micro;{-}, and the flavor-changing neutral-current decays B_{s};{0} --> e;{+} e;{-} and B;{0} --> e;{+} e;{-}. The analysis uses data corresponding to 2 fb;{-1} of integrated luminosity of pp[over ] collisions at sqrt[s] = 1.96 TeV collected with the upgraded Collider Detector (CDF II) at the Fermilab Tevatron. The observed number of B0 and B_{s};{0} candidates is consistent with background expectations. The resulting Bayesian upper limits on the branching ratios at 90% credibility level are B(B_{s};{0} --> e;{+} micro;{-}) < 2.0 x 10;{-7}, B(B;{0} --> e;{+} micro;{-}) < 6.4 x 10;{-8}, B(B_{s};{0} --> e;{+} e;{-}) < 2.8 x 10;{-7}, and B(B;{0} --> e;{+} e;{-}) < 8.3 x 10;{-8}. From the limits on B(B_{(s)};{0} --> e;{+} micro;{-}), the following lower bounds on the Pati-Salam leptoquark masses are also derived: M_{LQ}(B_{s};{0} --> e;{+} micro;{-}) > 47.8 TeV/c;{2}, and M_{LQ}(B;{0} --> e;{+} micro;{-}) > 59.3 TeV / c;{2}, at 90% credibility level.
17 CFR Appendix B to Part 190 - Special Bankruptcy Distributions
Code of Federal Regulations, 2010 CFR
2010-04-01
... €50 U.K. C €100 U.K., Germany, or Japan Location Actual asset balance U.S. $50 U.K. €100 Germany €50.... C $20 U.S. C €50 Germany D $100. U.S. D £300 U.K. D €100 U.K., Germany, or Japan E $80 U.S. E ¥10,000 Japan Location Actual asset balance U.S. $200 U.K. £200 U.K. €100 Germany €50 Japan ¥10,000...
1994-09-30
DE LME NDO G E R A R D O MAR I GZA A I R F O R C E D E LMUNDO L I LY F E D E R I S NAVY D E LOACH B O B B Y D E A N A I R F ORCE D E LOGE B...YAN LAMON EAR LE JAME S ARTHUR EAR LEY KEN W EAR LEY R OB E R T WI L L IAM J R EAR LS M I CHAE L G EAR LS OMAR DALE EAR LY BE N JAMIN J R...8 9 B R OOK LYN E 0 4 2 2 F e b 8 2 KEN TON E 0 7 14 D e c 9 1 R OCKH I L L 0 0 2 1 4 J u l 8 1 T E XAS C I T Y E 0 6 24 Oc t 7 9
Algorithm for Surface of Translation Attached Radiators (A-STAR). Volume III. Computer Codes.
1982-05-01
SEGMENT ARRAYS* C2075 CCPMCN /83jTI 44DDFNPTNBAND C2080 COM MCN IBDT21 N’,RL.YR(831, yS(83)eYS1(82).XB1(82) C2085 COMMON /GOT?/ 14(82)PSVt .12).CVt82 C2090...i a.4 ZZaZ lti 12 )-ZCI CI 10 RH020 . XNXX +VV*VV*ZZ*ZZ 2’ REaS REINZ 4 A3mA IUC 49CEXPI-U*SK*ER R14.IP I RR 8 CEDGE(SOT j-E(OOE(CA IMPEOANCE ELEMENTS...FvAv.S~%Lt IAXpSIIs PINER) 57*f ?C ********* ************* i5?C COM ~PLEX SIFIPSON INTEGRATION RflUTINE.j7 i N E.x,!& pSvsIPK Il~~i Agj:;)2c.19v20 5ON
1987-05-01
am a01 a a 4 a amaa am s as. sae . a s s m ma m a in in I. c-n g ., Onu g n u U g a , u r(D E O n , in E rE n a L n n i a n a n a ug n n i an En a u g...08 C a C 0 w4 4*44* 4 >,06U66b.01.4.. C614 000 00 0L*C0 0@I. 00.- 0 10 CCC -1CC CC C -.4 014.1 " 0 4-A I a.~~’- ~’~4---- 4140 . 14 ~C 0ac30OOOO 4904 a.
Knowledge Based Concepts and Artificial Intelligence: Applications to Guidance and Control.
1987-08-01
S tC* I it t r,, h syste t reason bout te aa lbe t m orsm l Ai, , eptW*- iip - Iil" n tI , and the n ob ain th "est s lut on co sis en wih ht a~a la ...f CE C- flEcflCE co0 m E ’?- MCD.- CD . -V E .UEE M4)c > 1 1 > * EO- EN >’? CI-E ’k EC Cw 0?0 0C O C -5? M’ D- W La LEE JOC -EE) C LEV . 3 -C 3LE3UmV...while he is, troublehoomig the circuit I)F-)AI I is a winking proiotrrlt’ Iha will be esreided \\,i hln the IMR( -\\l I icril S,,csln- ctlop ilnt en
1983-07-01
SECURITY CLASSIFICATION OF THIS PAGEMten. Deae Eneered; WILIM . ANMEER . . A .- M P D t JIG3.9) 0D O R E P O S E.O AHL N R M YC A N D I N C L I N I R...ESA C A N S H AWE V E L L E PT O R N AH ANes, Iowa 5A0011 AF ROCTE AD HROIC SEOSRE TAN TIONETES ( U.S. ARY ANNAL RSUARY RN EO NTCMMN Fort Detrick...supramaximal antidromic ventral root stimulation (fig. 23a-f), with less effect on frequency of the discharge. As seen in figure 23 (a,b,c, cf. d, e ,f
2014-11-01
H , El-Kholy AG, Madkour AA, Kaplan EL. 1996. Rheumatic fever prophylaxis using benzathine...by N A V A L H E A LT H R E S E A R C H C T R http://aac.asm .org/ D ow nloaded from received in the study. On day 1, which was sample 1, we...2015 by N A V A L H E A LT H R E S E A R C H C T R http://aac.asm .org/ D ow nloaded from mean of 0.006 g/ml for the other subjects.
Hentati, Olfa; Oliveira, Vanessa; Sena, Clara; Bouji, Mohamed Seddik Mahmoud; Wali, Ahmed; Ksibi, Mohamed
2016-10-01
The aim of the present study was to evaluate the ecotoxicological effects of olive mill waste (OMW) on soil habitat function. To this end, soil samples from OMW evaporating ponds (S1-S5) located at Agareb (Sfax, Tunisia) and a reference soil (R) were collected. The effects of OMW on the springtails Folsomia candida (F.c.), the earthworm species Eisenia fetida (E.f.), Enchytraeus crypticus (E.c.) reproduction and on the soil living microbial communities were investigated. E.f. reproduction and tomato growth assays were performed in the reference soil amended with 0.43 to 7.60 % (w OMW /w ref-soil ) mass ratios of dried OMW. Changes in microbial function diversity were explored using sole-carbon-source utilization profiles (BiologEcoPlates ® ). E.f. absolutely avoided (100 %) the most polluted soil (S4) while the F.c. moderately avoided (37.5 ± 7.5 %) the same soil. E.c. reproduction in S4 was significantly lower than in S1, S2, S3 and S5, and was the highest in R soil. Estimated effect concentration EC 50 for juveniles' production by E.f., and for tomato fresh weight and chlorophyll content were 0.138, 0.6 and 1.13 %, respectively. Community level physiological profiles (CLPPs) were remarkably different in R and S4 and a higher similarity was observed between soils S1, S2, S3 and S5. Principal component analysis (PCA) revealed that differences between soil microbial functional diversity were mainly due to high polyphenol concentrations, while the salinity negatively affected E.c. reproduction in OMW contaminated soils. These results clearly reflect the high toxicity of dried OMW when added to agricultural soils, causing severe threats to terrestrial ecosystem functions and services provided by invertebrates and microbial communities.
1983-11-01
C )a IaI Ř aa 36 14 14 o* f iAt NJ *. 4 I E .3 .4 .4 C4 CE .4.4CE @ . ev 13.4 *0 a 4**m r m...NA C 0407 / /1 N 0 E ,. E hh IDETEhEEhE L.6 1.8:(1111_25 JllO MICROCOPY RESOLUTION TEST CHART NATIONAL SuRfAL) PA ,JANDARD t A PERSONNEL TECHNOLOGY 00...A MEANS OF CONFIRMING CULTURAL DIFFERENCES H. C . Triandis, Y. Kashima, E . Shimada & M. Villareal Technical Report ONR-27 NAVY RECRUIT’S
Electron Collision Shift of the Lyman-Alpha Line in H and He+
1988-09-09
K ’ O iA ONA ’F’ )E i CE ’ O...ViDshing ton, DC 20375-5000 ’,.- K ..r, ’ 5 SO/I Ni, Sr. O (c), S VBO 9 ""Cl( ’/ N S’$ , N’ Dr. (A -i N VhF ()R(,A l ,’A 0ON (if apph(able) Office of...defined by c ~n C k CL SI~p ppkpppp, a n e k C L S p p pkp p p p S kp ( k ) momentum of the colliding electron before (after) the collision, L S =
Federal Agency Satellite Requirements.
1985-07-01
and data from DCPs within 20 minutes of ground station reception. 3. Weather Modification Proiect ( Morocco ) The goal of this project is to assist the...Government of Morocco " .’ in establishing a scientifically based weather modification pro- gram, especially for long-term precipitation enhancement. A...066J rl N -- m 0 ~ ~ ~ * VL. N~~E U E EE E E C C ~ E~W I ~~ S or. cc H O-0 3 q id IQ r.~ 0 w ni 0 633 ~.-.~ -1-, >’ %i~9 -9~S -- cSr .- t*~’* - ~- .nm
1984-03-01
and Laguna Madre , Texas, and the results of an office study of avatiabLe ,4. field data at the channel from construction in 1957 to 1975. GITI 13...E *.I.* M I SBU R E i , lE’, P J< 1:f W 0 RE * S ’ CH NOL!R:.I: I*IM E N I ; G OI. 0 M( R IPH I.(O ,0 G ;I COi-,S ; S MASA ’ i; S VT C; ;I :C 1::L
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-15
... Indian Religious Freedom Act [42 U.S.C. 1996]; Farmland Protection Policy Act (FPPA) [7 U.S.C. 4201-4209... and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America; E...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-09-06
...: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; American Indian Religious Freedom Act [42 U.S.C... Populations; E.O. 11593 Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O...
Annual Trauma Anesthesia and Critical Care Symposium (6th) Held in Baltimore, MD on 20-23 May 1993
1993-10-01
increasing intracranial pressure, and increased metabolic demand (e.g. seizures or fever ), however, may be attenuated with appropriate care. In...Dyspnea C. Cyanosis D. Headache E. Irritability F. Confusion G. Tachycardia S H. Pyrexia I. Petechial Rash VII. Clinical Findings (Severe F.E.S.) A...Frank Pulmonary Edema B. Convulsions/Coma C. ECG Showing Right Heart Strain D. Pyrexia E. Petechial Hemorrhage F. Jaundice G. Renal Impairment S O
Counterinsurgency in Somalia: Lessons Learned from the African Union Mission in Somalia, 2007-2013
2014-09-01
J S O U R e p o rt 1 4 -5 C o u n te rin s u rg e n c y in S o m a lia B ru to n / W illia m s Counterinsurgency...REPORT unclassified b. ABSTRACT unclassified c . THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 Joint...Force Ret., Resident Senior Fellows Anna-Marie Wyant, M.A., English, JSOU Press Editor Editorial Advisory Board Roby C . Barrett Ph.D., Middle
1979-02-01
A 0 ’A099 7 1 3 tAU N A E R O S P A C E C O R P B E T H P A G E N Y F / 6 ~ ~ i DEVELOPMENT OF ENVIRONMENTAL. PROFILES FOR TESTING EQUIPMENT...IHIlia- ’ -Q IIIII.L25 MICROCOPY RESOLUTION’ TEST CHART C RMS-9-R-1 DEVELOPMENT OF ENVIRONMENTAL PROFILES FOR TESTING EQUIPMENT INSTALLED IN NAVAL... Development of Environmental Profiles for Testing ,’~ Final j quipment Installed in Naval Aircraft (Fixed Wing), e 7- e* 8 S. PERFORMING ORGANIZATION
NASA Astrophysics Data System (ADS)
Nagaraju, G.; Ravindranatha Reddy, K.; Rajagopal Reddy, V.
2017-11-01
The electrical and current transport properties of rapidly annealed Dy/p-GaN SBD are probed by I-V and C-V techniques. The estimated barrier heights (BH) of as-deposited and 200 °C annealed SBDs are 0.80 eV ( I-V)/0.93 eV (C-V) and 0.87 eV (I-V)/1.03 eV (C-V). However, the BH rises to 0.99 eV (I-V)/ 1.18 eV(C-V) and then slightly deceases to 0.92 eV (I-V)/1.03 eV (C-V) after annealing at 300 °C and 400 °C. The utmost BH is attained after annealing at 300 °C and thus the optimum annealing for SBD is 300 °C. By applying Cheung’s functions, the series resistance of the SBD is estimated. The BHs estimated by I-V, Cheung’s and Ψ S-V plot are closely matched; hence the techniques used here are consistency and validity. The interface state density of the as-deposited and annealed contacts are calculated and we found that the N SS decreases up to 300 °C annealing and then slightly increases after annealing at 400 °C. Analysis indicates that ohmic and space charge limited conduction mechanisms are found at low and higher voltages in forward-bias irrespective of annealing temperatures. Our experimental results demonstrate that the Poole-Frenkel emission is leading under the reverse bias of Dy/p-GaN SBD at all annealing temperatures.
7 CFR 356.1 - Property subject to forfeiture procedures.
Code of Federal Regulations, 2010 CFR
2010-01-01
... conveyance or other property 1 seized under the Endangered Species Act of 1973, as amended, (16 U.S.C. 1531 et seq.) or the Lacey Act Amendments of 1981 (16 U.S.C. 3371 et seq.), 2 in possession (actual or.... 1 Under section 11(e)(4) of the Endangered Species Act (“Act”; 16 U.S.C. 1540(e)(4)) any such...
7 CFR 356.1 - Property subject to forfeiture procedures.
Code of Federal Regulations, 2013 CFR
2013-01-01
... conveyance or other property 1 seized under the Endangered Species Act of 1973, as amended, (16 U.S.C. 1531 et seq.) or the Lacey Act Amendments of 1981 (16 U.S.C. 3371 et seq.), 2 in possession (actual or.... 1 Under section 11(e)(4) of the Endangered Species Act (“Act”; 16 U.S.C. 1540(e)(4)) any such...
7 CFR 356.1 - Property subject to forfeiture procedures.
Code of Federal Regulations, 2014 CFR
2014-01-01
... conveyance or other property 1 seized under the Endangered Species Act of 1973, as amended, (16 U.S.C. 1531 et seq.) or the Lacey Act Amendments of 1981 (16 U.S.C. 3371 et seq.), 2 in possession (actual or.... 1 Under section 11(e)(4) of the Endangered Species Act (“Act”; 16 U.S.C. 1540(e)(4)) any such...
7 CFR 356.1 - Property subject to forfeiture procedures.
Code of Federal Regulations, 2011 CFR
2011-01-01
... conveyance or other property 1 seized under the Endangered Species Act of 1973, as amended, (16 U.S.C. 1531 et seq.) or the Lacey Act Amendments of 1981 (16 U.S.C. 3371 et seq.), 2 in possession (actual or.... 1 Under section 11(e)(4) of the Endangered Species Act (“Act”; 16 U.S.C. 1540(e)(4)) any such...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-06-08
... intertribal consortia or urban Indian organizations as defined by 25 U.S.C. 1603(e) may be eligible for a TEC... provided by the United States to Indians because of their status as Indians. 25 U.S.C. 1603 (d). Tribal... which includes the maximum participation of Indians in all phases of its activities. 25 U.S.C. 1603(e...
Automated M55 Detonator Production Equipment. Volume 1
1987-05-01
i 41 •8 e o C u 01 o « v 01 & u a e. e < < •^ ec GO PI t^ r » fs o> ^ « •* ■ff w ■H cc...cl 4J C m e e u (0 0 9 e u « r o 4J u u 0 O CO X z e 09 I 1 6C 0) 4J c 09 C U •H •* 0 m •w W 0B U 01 IH 09 ■HOC...00 2 O CO 3 u -»^< r > 5 Q QTZQ + i m ^- ro 3ZtO O o ^ ’ O o UJO < Q: ui _i ou. M 0 s 0 u 01 T5 « M R « •? A s 3 9 IT»
The Army’s Wireless Communications Programs
2009-02-11
20Plans%20First%20AEHF% 20Launch%20Early%20Next%20Year&channel= awst .9 CBO Other Strategic Wireless Communications Programs The Army invests in a number...O N G R E SS O F T H E U N IT E D ST AT E S C O N G R E SSIO N A L B U D G E T O FFIC E W A SH IN G T O N , D C 20515
1994-03-01
ge %- -- -- $.-. %- fa -- .- o C~ V!E M 6P UZ OC0 to w E E 0 a ’ Cu C C Cu c c C oO c com 0 " 0 c M c (a .0 ivUC 13 0 :E< C0-6 41 U’aC - - -- VU...C - 0 . >1 x1 >4 N *,IM - (a >4CC (a0a0o 00) I >i L-.-0 *-.->tU)0 c0C e COM 0 .- *- - >1(A00 I - *>%c LL ) . UL t1e- L)--U-L0 c1- 0 3 U UX1 i...W (I04 W* ’-ൌ fZ 4 ɜ 1-0La. OZ1- << W C OW < X: " U W ccrU ccO.. -. 4 k Z (0ZZ 0 Ui Z1- Z4I (0.ri X4 XW 0a X--- WZx xnxx 0n CLLLLL M L gn WW
Precision Measurement of the e^{+}e^{-}→Λ_{c}^{+}Λ[over ¯]_{c}^{-} Cross Section Near Threshold.
Ablikim, M; Achasov, M N; Ahmed, S; Albrecht, M; Alekseev, M; Amoroso, A; An, F F; An, Q; Bai, J Z; Bai, Y; Bakina, O; Baldini Ferroli, R; Ban, Y; Begzsuren, K; Bennett, D W; Bennett, J V; Berger, N; Bertani, M; Bettoni, D; Bianchi, F; Boger, E; Boyko, I; Briere, R A; Cai, H; Cai, X; Cakir, O; Calcaterra, A; Cao, G F; Cetin, S A; Chai, J; Chang, J F; Chelkov, G; Chen, G; Chen, H S; Chen, J C; Chen, M L; Chen, P L; Chen, S J; Chen, X R; Chen, Y B; Chu, X K; Cibinetto, G; Cossio, F; Dai, H L; Dai, J P; Dbeyssi, A; Dedovich, D; Deng, Z Y; Denig, A; Denysenko, I; Destefanis, M; De Mori, F; Ding, Y; Dong, C; Dong, J; Dong, L Y; Dong, M Y; Dou, Z L; Du, S X; Duan, P F; Fang, J; Fang, S S; Fang, Y; Farinelli, R; Fava, L; Fegan, S; Feldbauer, F; Felici, G; Feng, C Q; Fioravanti, E; Fritsch, M; Fu, C D; Gao, Q; Gao, X L; Gao, Y; Gao, Y G; Gao, Z; Garillon, B; Garzia, I; Gilman, A; Goetzen, K; Gong, L; Gong, W X; Gradl, W; Greco, M; Gu, M H; Gu, Y T; Guo, A Q; Guo, R P; Guo, Y P; Guskov, A; Haddadi, Z; Han, S; Hao, X Q; Harris, F A; He, K L; He, X Q; Heinsius, F H; Held, T; Heng, Y K; Holtmann, T; Hou, Z L; Hu, H M; Hu, J F; Hu, T; Hu, Y; Huang, G S; Huang, J S; Huang, X T; Huang, X Z; Huang, Z L; Hussain, T; Ikegami Andersson, W; Ji, Q; Ji, Q P; Ji, X B; Ji, X L; Jiang, X S; Jiang, X Y; Jiao, J B; Jiao, Z; Jin, D P; Jin, S; Jin, Y; Johansson, T; Julin, A; Kalantar-Nayestanaki, N; Kang, X S; Kavatsyuk, M; Ke, B C; Khan, T; Khoukaz, A; Kiese, P; Kliemt, R; Koch, L; Kolcu, O B; Kopf, B; Kornicer, M; Kuemmel, M; Kuhlmann, M; Kupsc, A; Kühn, W; Lange, J S; Lara, M; Larin, P; Lavezzi, L; Leithoff, H; Li, C; Li, Cheng; Li, D M; Li, F; Li, F Y; Li, G; Li, H B; Li, H J; Li, J C; Li, J W; Li, Jin; Li, K J; Li, Kang; Li, Ke; Li, Lei; Li, P L; Li, P R; Li, Q Y; Li, W D; Li, W G; Li, X L; Li, X N; Li, X Q; Li, Z B; Liang, H; Liang, Y F; Liang, Y T; Liao, G R; Libby, J; Lin, C X; Lin, D X; Liu, B; Liu, B J; Liu, C X; Liu, D; Liu, F H; Liu, Fang; Liu, Feng; Liu, H B; Liu, H L; Liu, H M; Liu, Huanhuan; Liu, Huihui; Liu, J B; Liu, J Y; Liu, K; Liu, K Y; Liu, Ke; Liu, L D; Liu, Q; Liu, S B; Liu, X; Liu, Y B; Liu, Z A; Liu, Zhiqing; Long, Y F; Lou, X C; Lu, H J; Lu, J G; Lu, Y; Lu, Y P; Luo, C L; Luo, M X; Luo, X L; Lusso, S; Lyu, X R; Ma, F C; Ma, H L; Ma, L L; Ma, M M; Ma, Q M; Ma, T; Ma, X N; Ma, X Y; Ma, Y M; Maas, F E; Maggiora, M; Malik, Q A; Mao, Y J; Mao, Z P; Marcello, S; Meng, Z X; Messchendorp, J G; Mezzadri, G; Min, J; Mitchell, R E; Mo, X H; Mo, Y J; Morales Morales, C; Muchnoi, N Yu; Muramatsu, H; Mustafa, A; Nefedov, Y; Nerling, F; Nikolaev, I B; Ning, Z; Nisar, S; Niu, S L; Niu, X Y; Olsen, S L; Ouyang, Q; Pacetti, S; Pan, Y; Papenbrock, M; Patteri, P; Pelizaeus, M; Pellegrino, J; Peng, H P; Peng, Z Y; Peters, K; Pettersson, J; Ping, J L; Ping, R G; Pitka, A; Poling, R; Prasad, V; Qi, H R; Qi, M; Qi, T Y; Qian, S; Qiao, C F; Qin, N; Qin, X S; Qin, Z H; Qiu, J F; Rashid, K H; Redmer, C F; Richter, M; Ripka, M; Rolo, M; Rong, G; Rosner, Ch; Sarantsev, A; Savrié, M; Schnier, C; Schoenning, K; Shan, W; Shan, X Y; Shao, M; Shen, C P; Shen, P X; Shen, X Y; Sheng, H Y; Shi, X; Song, J J; Song, W M; Song, X Y; Sosio, S; Sowa, C; Spataro, S; Sun, G X; Sun, J F; Sun, L; Sun, S S; Sun, X H; Sun, Y J; Sun, Y K; Sun, Y Z; Sun, Z J; Sun, Z T; Tan, Y T; Tang, C J; Tang, G Y; Tang, X; Tapan, I; Tiemens, M; Tsednee, B; Uman, I; Varner, G S; Wang, B; Wang, B L; Wang, D; Wang, D Y; Wang, Dan; Wang, K; Wang, L L; Wang, L S; Wang, M; Wang, Meng; Wang, P; Wang, P L; Wang, W P; Wang, X F; Wang, Y; Wang, Y D; Wang, Y F; Wang, Y Q; Wang, Z; Wang, Z G; Wang, Z Y; Wang, Zongyuan; Weber, T; Wei, D H; Wei, J H; Weidenkaff, P; Wen, S P; Wiedner, U; Wolke, M; Wu, L H; Wu, L J; Wu, Z; Xia, L; Xia, Y; Xiao, D; Xiao, Y J; Xiao, Z J; Xie, Y G; Xie, Y H; Xiong, X A; Xiu, Q L; Xu, G F; Xu, J J; Xu, L; Xu, Q J; Xu, Q N; Xu, X P; Yan, F; Yan, L; Yan, W B; Yan, W C; Yan, Y H; Yang, H J; Yang, H X; Yang, L; Yang, Y H; Yang, Y X; Yang, Yifan; Ye, M; Ye, M H; Yin, J H; You, Z Y; Yu, B X; Yu, C X; Yu, J S; Yuan, C Z; Yuan, Y; Yuncu, A; Zafar, A A; Zeng, Y; Zeng, Z; Zhang, B X; Zhang, B Y; Zhang, C C; Zhang, D H; Zhang, H H; Zhang, H Y; Zhang, J; Zhang, J L; Zhang, J Q; Zhang, J W; Zhang, J Y; Zhang, J Z; Zhang, K; Zhang, L; Zhang, S Q; Zhang, X Y; Zhang, Y; Zhang, Y H; Zhang, Y T; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z H; Zhang, Z P; Zhang, Z Y; Zhao, G; Zhao, J W; Zhao, J Y; Zhao, J Z; Zhao, Lei; Zhao, Ling; Zhao, M G; Zhao, Q; Zhao, S J; Zhao, T C; Zhao, Y B; Zhao, Z G; Zhemchugov, A; Zheng, B; Zheng, J P; Zheng, Y H; Zhong, B; Zhou, L; Zhou, Q; Zhou, X; Zhou, X K; Zhou, X R; Zhou, X Y; Zhu, A N; Zhu, J; Zhu, K; Zhu, K J; Zhu, S; Zhu, S H; Zhu, X L; Zhu, Y C; Zhu, Y S; Zhu, Z A; Zhuang, J; Zou, B S; Zou, J H
2018-03-30
The cross section of the e^{+}e^{-}→Λ_{c}^{+}Λ[over ¯]_{c}^{-} process is measured with unprecedented precision using data collected with the BESIII detector at sqrt[s]=4574.5, 4580.0, 4590.0 and 4599.5 MeV. The nonzero cross section near the Λ_{c}^{+}Λ[over ¯]_{c}^{-} production threshold is cleared. At center-of-mass energies sqrt[s]=4574.5 and 4599.5 MeV, the higher statistics data enable us to measure the Λ_{c} polar angle distributions. From these, the Λ_{c} electric over magnetic form-factor ratios (|G_{E}/G_{M}|) are measured for the first time. They are found to be 1.14±0.14±0.07 and 1.23±0.05±0.03, respectively, where the first uncertainties are statistical and the second are systematic.
Remotely Manned Undersea Work Systems at Naval Ocean Systems Center (NOSC).
1978-04-15
is applied to provide the most e t’t icient operations by best combining the coiupk-I mentar y characteristics of each of the subsystems. The tasks de ...i n de ’ s~ ~1 ~‘i s\\ s t e m s am cbo U o~% ~: SI •~R t I I ‘ to f ind lost it em s , locate wor k s i t C s , and sur\\ e\\ 5 e , t f l O t Ii , I...t l e i f l isis i t h i .i ‘se ’. l r c hl ‘.d l l i , i i , it will p m ism de ’ t a r ge ’t it le ’ i i t u f i ea — t i on , ,IS would a t e
A Lightweight TwiddleNet Portal
2008-03-01
MAC PHY Media Independent Handover Function (Network)ES CS IS 802 Interface Client Station 802 Networks 3GPP 3 GPP 2 Network MIH Network...Entity ( . e g ). MIH Server Controller Media Independent Handover Function (Client) Information Service over L2 Transport Remote MIH Events over L2...Co-located with MIH MGMTMGMT E v e n t s E S C S IS E v e n t s E v e n t s E v e n t s Media Independent Handover User Media
77 FR 7946 - Regulatory Agenda
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-13
... for Infusion Pumps. 344 Requirements for the 0910-AG59 Testing and Reporting of Tobacco Product... Infusion Pumps Legal Authority: 21 U.S.C. 351; 21 U.S.C. 360; 21 U.S.C. 360c; 21 U.S.C. 360e; 21 U.S.C... infusion pumps. An analysis of the reports reveals that a majority of the recalls and failures were caused...
Implementing the Army NetCentric Data Strategy in a ServiceOriented Environment
2009-04-23
a Data Subscriptionc c e s s Federated Search Data Search D a t a A b s t r a c t i o n Adapter Configuration Adapter Data Service D a t a S e r...across t e enterpr se. • Patterns • Search • Status • Receive – Services • Federated Search • Artifact Discovery • Data Discovery 17 Data Discovery
ERIC Educational Resources Information Center
Tufte, Robert B., Jr.
2005-01-01
P.A.C.E.S. stands for Participation, Appearance, Cleanup, Engineering, and Safety. The author has traditionally used design briefs to set the limits on processes and materials to solve a given problem. The design brief brings out all kinds of "out of the box" thinking, with many correct answers to solve the problem. The P.A.C.E.S. rubric ties the…
Development of Thermoplastic Structural Adhesives
1977-03-01
v. Q a u (J «a: 0) ,— 3: o ! < o r- <" •t— •r— c o QJ +J i u- ! -C E N E S- S- u •r- •r— tD O UJ on OL 3 -r...r— 1- •o • t>. 3: CO oc 0) o 3 C7> o U. ^ <a in >- (ISd) Hi9N3MiS aV3HS dVl 70 1 ■■V’jiWi- • fcia,-- j^e^a^^^^ jaj ^^^jjM^t^j^t
Hematopoietic Responses to Lipopolysaccharide in C57BL/10Sn and C57BL/10ScN Strain Mice
1982-12-01
Responses of endogenous (E-CFU) stem cells as well as bone marrow and spleen-derived exogenous (CFU-s) stem cells, granulocyte-macrophage (GM;-CFC... endogenous (E-CFU) stem cells as well as bone marrow and spleen-derived exogenous (CFU-s) stem cells, granulocyte-macrophage (GM-CFC) and macrophage (M...IOScN in comparison to the normal C57BL/1OSn strain mice, as measured by endogenous (E-CFU) and exogenous (CFU-s) stem cells and committed granulocyte
2008 Evaluation of the DoD Voting Assistance Program
2009-04-30
tion reports fro~ VAOs and t he NVAP Web site . We a lso conside red arti cles, NAVADMINs , e;nails fro:n the Navy Vot~ng Act ion Of ficer (NVAOl...a nce. (DODD 133. 1 3) Response : Sixty o f s i xty-seven (83\\) r e cruitme nt o ff ice vo ting personne l c o mp l ete d requ i red training, a s...e: Per OPNAVINST 1 742. 18, VAOs are requ: red to conduct t r ainin-g at t he unit level. Ma n y c ommands c ov e r absen t ee reg i s trat ion and
Vdovenko, Sergey I; Gerus, Igor I; Pagacz-Kostrzewa, Magdalena; Wierzejewska, Maria; Zhuk, Yuri I; Kukhar, Valery P
2018-06-15
Although it is well known that reactivity of α,β-unsaturated enaminoketones is closely associated with spatial and electronic structure but until now little attention was devoted to quantitative investigation of interconversion of different stereoisomeric forms of enaminoketones. In present work we studied peculiarities of kinetics of Z⇌E isomerization of enaminoketone 4-(N-methylamino)-1,1,1-trifluorobut-3-en-2-one F 3 C-COCHCHNH(CH 3 ) (1) in Ar-matrix exposed to UV-radiation (λ=340nm) with IR Fourier and 2D correlation spectroscopy and we found that Z-s-Z-s-trans isomer transforms primarily into two E-isomers, E-s-E-s-trans and E-s-Z-s-trans which further turn into the E-s-E-s-cis and E-s-Z-s-cis conformers all interconversion rate constants being comparable in magnitude. Along with this process long-term exposure to the UV-radiation results in proton transfer from nitrogen of methylamino group to carbonyl oxygen with simultaneous isomerization of 'cyclic' iminoenol form into 'linear'one. In solution of enaminoketone 4-(N-methylamino)-1,1,1-trifluoro-3-methylbut-3-en-2-one F 3 C-CO-C(CH 3 )CH-NH(CH 3 ) (2) we observed reversed process, namely, spontaneous interconversion of the E-s-E-s-trans and E-s-Z-s-trans conformers into the Z-s-Z-trans isomer. It was found that rate constants of the dimeric forms of the E-s-E-s-trans and E-s-Z-s-trans conformers are higher than those of the monomers and are independent on total enaminoketone concentration. Addition of highly polar HMPA promotes proton transfer from nitrogen to oxygen in the Z-s-Z-s-trans isomer of 2 with subsequent isomerization into the linear imino-enol product but the rate constant of this transformation is ten-fold smaller than that for 1 in the Ar matrix exposed to UV radiation. Copyright © 2018 Elsevier B.V. All rights reserved.
Hayashi, Satoko; Tsubomoto, Yutaka; Nakanishi, Waro
2018-02-17
The nature of the E-E' bonds (E, E' = S and Se) in glutathione disulfide ( 1 ) and derivatives 2 - 3 , respectively, was elucidated by applying quantum theory of atoms-in-molecules (QTAIM) dual functional analysis (QTAIM-DFA), to clarify the basic contribution of E-E' in the biological redox process, such as the glutathione peroxidase process. Five most stable conformers a - e were obtained, after applying the Monte-Carlo method then structural optimizations. In QTAIM-DFA, total electron energy densities H b ( r c ) are plotted versus H b ( r c ) - V b ( r c )/2 at bond critical points (BCPs), where V b ( r c ) are potential energy densities at BCPs. Data from the fully optimized structures correspond to the static nature. Those containing perturbed structures around the fully optimized one in the plot represent the dynamic nature of interactions. The behavior of E-E' was examined carefully. Whereas E-E' in 1a - 3e were all predicted to have the weak covalent nature of the shared shell interactions, two different types of S-S were detected in 1 , depending on the conformational properties. Contributions from the intramolecular non-covalent interactions to stabilize the conformers were evaluated. An inverse relationship was observed between the stability of a conformer and the strength of E-E' in the conformer, of which reason was discussed.
2011-04-21
... [ .... EEO PL"',lI.', Pl:>1S:. .. · nAG.',EEJ A€~f)EA~''''ETTlE RE::'f-o':'::l P,G'.H:JR;)S",lhPEt. ... ','.! Pf" g':-'" iI~~~ 2.- ~~. I.~r 0" S' l_t e I.l'l ~aM;: .I.,. ...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-11-02
.... Applicability to Construction Comment: One respondent was concerned that the prescription at FAR 25.1103, which.... 121(c); 10 U.S.C. chapter 137; and 42 U.S.C. 2473(c). 0 2. Amend section 25.1103 by revising paragraph (e) to read as follows: 25.1103 Other provisions and clauses. * * * * * (e) The contracting officer...
U.S. EPA, Pesticide Product Label, AATREX 4L HERBICIDE, 03/27/1986
2011-04-13
... "d-~f'\\! I "'''.d' ill' (,fes,"1 ill iI[:';'Cill,Of' fel"'l:> .. e t"e"" .. ·t" iI s .. eep t>.() . 0' O!"ef 5",: .. 0 '...,p .• I"'1."! ., ilpp"cat.c'" Of ... s •• " .op,o .. ed CO"laC! ...
Fu, Jing; Sadgrove, Matthew; Marson, Lesley; Jay, Michael
2016-08-01
The penta-ethyl ester prodrug of the chelating agent diethylene triamine pentaacetic acid (DTPA), referred to as C2E5, effectively accelerated clearance of americium after transdermal delivery. Carboxylesterases (CESs) play important roles in facilitating C2E5 hydrolysis. However, whether CESs in human skin hydrolyze C2E5 remains unknown. We evaluated the gene and protein expression of CESs in distinctive human epidermal cell lines: HEKa, HEKn, HaCaT, and A431. The substrates p-nitrophenyl acetate (pNPA) and 4-nitrophenyl valerate (4-NPV) were used to access esterase and CES activity. C2E5 hydrolysis was measured by radiometric high-performance liquid chromatography after incubation of [(14)C]C2E5 with supernatant fractions after centrifugation at 9000g (S9) prepared from skin cell lines. CES-specific inhibitors were used to access metabolism in human skin S9 fractions with analysis by liquid chromatography-tandem mass spectrometry. We identified the human carboxylesterase 1 and 2 (CES1 and CES2) bands in a Western blot. The gene expression of these enzymes was supported by a real-time polymerase chain reaction (qPCR). pNPA and 4-NPV assays demonstrated esterase and CES activity in all the cell lines that were comparable to human skin S9 fractions. The prodrug C2E5 was hydrolyzed by skin S9 fractions, resulting in a primary metabolite, C2E4. In human skin S9 fractions, inhibition of C2E5 hydrolysis was greatest with a pan-CES inhibitor (benzil). CES1 inhibition (troglitazone) was greater than CES2 (loperamide), suggesting a primary metabolic role for CES1. These results indicate that human keratinocyte cell lines are useful for the evaluation of human cutaneous metabolism and absorption of ester-based prodrugs. However, keratinocytes from skin provide a small contribution to the overall metabolism of C2E5. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Final Environmental Impact Statement for the Strategic Target System. Volume III
1992-05-01
HH e . = - - A. H -O , ai ^ V-w;^M3J ^3 c +*’’ Q in tn a in ’■*5i iii +> jB ^f* TT-P...a a « HH -IUOJ m •£ a HŔ JJ • rH»J JJ-H « O B c u a H OJJ «^ w-i c s s a a Ö H a JJ fto BBC -H u^ U "W BUBO 0££ ɠ O...3 <§ E"S"§ « ö •S<S 00« gŖ O n> ■ £ a * BO 1 > I B JB S « - £ B 8 ^ O C O tj K I- O D, =« ° ° "O "P^MO’C S « S -S *" «
Structural basis for the neutralization and genotype specificity of hepatitis E virus.
Tang, Xuhua; Yang, Chunyan; Gu, Ying; Song, Cuiling; Zhang, Xiao; Wang, Yingbin; Zhang, Jun; Hew, Choy Leong; Li, Shaowei; Xia, Ningshao; Sivaraman, J
2011-06-21
Hepatitis E virus (HEV) causes acute hepatitis in humans, predominantly by contamination of food and water, and is characterized by jaundice and flu-like aches and pains. To date, no vaccines are commercially available to prevent the disease caused by HEV. Previously, we showed that a monoclonal antibody, 8C11, specifically recognizes a neutralizing conformational epitope on HEV genotype I. The antibody 8C11 blocks the virus-like particle from binding to and penetrating the host cell. Here, we report the complex crystal structure of 8C11 Fab with HEV E2s(I) domain at 1.9 Å resolution. The 8C11 epitopes on E2s(I) were identified at Asp(496)-Thr(499), Val(510)-Leu(514), and Asn(573)-Arg(578). Mutations and cell-model assays identified Arg(512) as the most crucial residue for 8C11 interaction with and neutralization of HEV. Interestingly, 8C11 specifically neutralizes HEV genotype I, but not the other genotypes. Because HEV type I and IV are the most abundant genotypes, to understand this specificity further we determined the structure of E2s(IV) at 1.79 Å resolution and an E2s(IV) complex with 8C11 model was generated. The comparison between the 8C11 complexes with type I and IV revealed the key residues that distinguish these two genotypes. Of particular interest, the residue at amino acid position 497 at the 8C11 epitope region of E2s is distinct among these two genotypes. Swapping this residue from one genotype to another inversed the 8C11 reactivity, demonstrating the essential role played by amino acid 497 in the genotype recognition. These studies may lead to the development of antibody-based drugs for the specific treatment against HEV.
Reexamination of strong subadditivity: A quantum-correlation approach
NASA Astrophysics Data System (ADS)
Taghiabadi, Razieh; Akhtarshenas, Seyed Javad; Sarbishaei, Mohsen
2017-03-01
The strong subadditivity inequality of von Neumann entropy relates the entropy of subsystems of a tripartite state ρA B C to that of the composite system. Here, we define T(a )(ρA B C) as the extent to which ρA B C fails to satisfy the strong subadditivity inequality S (ρB) +S (ρC) ≤S (ρA B) +S (ρA C) with equality and investigate its properties. In particular, by introducing auxiliary subsystem E , we consider any purification | ψA B C E> of ρA B C and formulate T(a )(ρA B C) as the extent to which the bipartite quantum correlations of ρA B and ρA C, measured by entanglement of formation and quantum discord, change under the transformation B →B E and C →C E . Invariance of quantum correlations of ρA B and ρA C under such transformation is shown to be a necessary and sufficient condition for vanishing T(a )(ρA B C) . Our approach allows one to characterize, intuitively, the structure of states for which the strong subadditivity is saturated. Moreover, along with providing a conservation law for quantum correlations of states for which the strong subadditivity inequality is satisfied with equality, we find that such states coincide with those that the Koashi-Winter monogamy relation is saturated.
Zhang, Limeng; Zhang, Hua; Fan, Ziyao; Zhou, Xue; Yu, Liquan; Sun, Hunan; Wu, Zhijun; Yu, Yongzhong; Song, Baifen; Ma, Jinzhu; Tong, Chunyu; Zhu, Zhanbo; Cui, Yudong
2015-02-01
Streptococcus dysgalactiae (S. dysgalactiae) GapC protein is a protective antigen that induces partial immunity against S. dysgalactiae infection in animals. To identify the conserved B-cell epitope of S. dysgalactiae GapC, a mouse monoclonal antibody 1E11 (mAb1E11) against GapC was generated and used to screen a phage-displayed 12-mer random peptide library (Ph.D.-12). Eleven positive clones recognized by mAb1E11 were identified, most of which matched the consensus motif TGFFAKK. Sequence of the motif exactly matched amino acids 97-103 of the S. dysgalactiae GapC. In addition, the epitope (97)TGFFAKK(103) showed high homology among different streptococcus species. Site-directed mutagenic analysis further confirmed that residues G98, F99, F100 and K103 formed the core of (97)TGFFAKK(103), and this core motif was the minimal determinant of the B-cell epitope recognized by the mAb1E11. Collectively, the identification of conserved B-cell epitope within S. dysgalactiae GapC highlights the possibility of developing the epitope-based vaccine. Copyright © 2014 Elsevier Ltd. All rights reserved.
Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J-F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chu, M L; Chuang, S; Chung, J Y; Chung, W-H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; de Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernandez, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Frisch, H; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Guenther, M; da Costa, J Guimaraes; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T; Kamon, T; Kang, J; Karagoz Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; Lecompte, T; Lee, J; Lee, J; Lee, S W; Lefevre, R; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A-S; Nigmanov, T; Nodulman, L; Norniella, O; Oesterberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Palmonari, F; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; St Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sanchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sisakyan, A; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stefanini, A; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, S; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tönnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A; Varganov, A; Vataga, E; Vejcik, S; Velev, G; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobouev, I; von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S
2005-03-18
We present a search for excited and exotic electrons (e(*)) decaying to an electron and a photon, both with high transverse momentum. We use 202 pb(-1) of data collected in pp collisions at sqrt[s] = 1.96 TeV with the Collider Detector at Fermilab II detector. No signal above standard model expectation is seen for associated ee(*) production. We discuss the e(*) sensitivity in the parameter space of the excited electron mass M(e(*)) and the compositeness energy scale Lambda. In the contact interaction model, we exclude 132 GeV/c(2)
A Model to Predict Retention and Attrition of Hispanic-Americans in the Navy.
1980-10-01
N0001-79- C -0850 UNCLASSIFIED 77C-i-i I, umuu..i..nn.I, E -EEEEEEElllEE EE~lEllEEllEEE IIIEIIIII SECURITY CLASIFICATION OF THI1S PA D-1(W. e F., ’s REPORT...Brislin, R ., Lonner, W., & Thorndike, R . Cross-cultural research methods. New York: John Wiley and Sons, 1973. Browning, H. L., Lopreato, S. C ...Doctoral dissertation, University of Houston, 1976) University Microfilm 77-1502. Chandler, C . R . Value orientations among Mexican Americans in a
Light, rest mass and electric charge quanta all formed by neutrinos?
NASA Astrophysics Data System (ADS)
Chen, Shao-Guang
In high energy physics experiments the electric charge and rest mass of particles can commonly transform into the photons, vice versa. Its reason QFT can only give a vague answer: based on the particle creation and annihilation operators. There are not more clear answers or conjecture? At least, light, electric charge and rest mass should have a collective structure component, if not, the transformation is unable understanding. An elementary answer is that neutrino and antineutrino as their collective structure component. In the paper ‘Chen Qiliang & Wang Bin, The formation and characteristics of Chen Shaoguang's formula, China Science &Technology Overview 127101-103 (2011)’, the lowest energy state vertical polarized left spin 1/2 neutrino and right spin 1/2 antineutrino are just the left, right advance unit quanta la _{0}nuυ, ra nuυ _{0} and left, right back unit quanta lb (0) nuυ, rb nuυ (0) , it again compose into spin 1 unit photon la-ra _{0}nuυnuυ _{0} and back-photon lb-rb (0) nuυnuυ (0) , spin 0 unit rest mass ra-rb nuυ _{0}nuυ (0) and anti-mass la-lb _{0}nuυ (0) nuυ, spin 0 unit positive charge la-rb _{0}nuυnuυ (0) and negative charge ra-lb nuυ _{0} (0) nuυ. The physical vacuum is the even collocation of non-combinational nuυ _{0} or _{0}nuυ. It accord to the high energy physics experimental results of the transformation among the photons, masses quanta and charges quanta. In my paper ‘Quanta turn-advance ism, China Science && Technology Overview 131 192-210 (2011)’, QFT four-dimensional uncertainty principle and momentum-energy conservation law had been generalized as a five-dimensional equations: de Broglie wavelength as a position vector \\underline{q}= (i c t, r, s), momentum \\underline{P} = (i E / c, P, U c), \\underline{q} = i h / \\underline{P}, \\underline{q} \\underline{q} = 0, \\underline{P} \\underline{P} = 0, Sigma∑ \\underline{P} = \\underline{P} (0) . The five-dimensional time-space-spin had been quantized as a non-dot model basic cell. QFT is no longer with divergence difficulty by the non-dot model. It is mathematically easy that from five-dimensional equations deduce out the Dirac, Klein-Gordan, Maxwell equations and Lorentz force formula, but appear some new results. The interactions between _{0}nuυ, nuυ _{0}, (0) nuυ, nuυ (0) , i.e., force f = ± ( h c / 2 r (3) ) r cos thetaθ for r not equal to 0 and f = 0 for r = 0, f as the magnetic force makes the photons, rest mass and charge quanta automatically come into being and stabilize. CMB photon can be produced from many spin 1 unit photons by its statistical attraction. The explanation of abnormal magnetic moment and Lamb shift is more natural and simple only with the spin — the conjunction between turn and advance. Many testable results had been obtained. The la, ra, lb, rb exist on each direction of i, j, k, its mathematical describe is with five-dimension unit place vector \\underline{q} = (i c t, r, s) and momentum \\underline{P} = (i E t /c, P, U c). The left spin s is real number and right spin s is imaginary number, positive direction advance r is i (or j, k) and back direction advance r is -i (or -j, -k). For four la, ra, lb, rb the t and E are all the same, but P only absolute value are the same and turn- quantity U with the external interaction has the difference of left turn U = e and right turn U = \\underline{e}. Such as in i direction we get that la: \\underline{q} = (i c t, r, 0, 0, s ), \\underline{P} = (i E/c, P, 0, 0 , e c); ra: \\underline{q} = (i c t, r, 0, 0, i s), \\underline{P} = (i E/c, P, 0, 0, \\underline{e} c); lb: \\underline{q}=(i c t, - r, 0, 0, -s), \\underline{P} = (i E/c, -P, 0, 0, -e c); {rb}: \\underline{q} = (i c t, - r, 0, 0, - i s), \\underline{P} = (i E/c, -P, 0, 0, - \\underline{e} c); la-ra : \\underline{q} = (i 2 c t, 2 r, (1+i) s), \\underline{P} = ( i 2 E/c, 2 P, (e + \\underline{e}) c); lb-rb : \\underline{q} = (i 2 c t,-2 r, -(1 + i) s), \\underline{P} = (i 2 E/c, -2 P, -(e + \\underline{e}) c); ra-rb: \\underline{q} = (i c 2 t, 0, (i - i) s ), \\underline{P} = (i 2 E/c, 0, (\\underline{e} - \\underline{e}) c); la-lb: \\underline{q} = (i 2 c t, 0, (s - s)), \\underline{P} = (i 2 E/c, 0, (e - e) c); la-rb : \\underline{q} = (i c 2 t, 0, ( 1 - i ) s), \\underline{P} = (i 2 E/c, 0 , (e - \\underline{e}) c); ra-lb: \\underline{q} = (i 2 c t, 0, (i - 1 ) s), \\underline{P} = (i 2 E/c, 0, (\\underline{e} - e) c). Because of the vertical polarization of neutrinos, when momentum in reverse the turn-quantity also from left to right or from right to left, we get: \\underline{e} = - e. The turn-quantity U of la-rb or ra-lb equal to 2 e or -2 e, so that the turn-quantity U is just the electric quantity q, also is the reason that it call as the positive or negative charge quantum. The ra-rb or la-lb to be called the rest mass or the anti-mass quantum for its momentum and turn-quantity all equal to zero, it is at the absolute rest and absolute non-external-interaction (the gravitation caused by the ra or la inside bodies). The la-ra or lb-rb has the momentum 2 P or - 2 P and turn-quantity (e + \\underline{e}) or - (e + \\underline{e}) and is a pure momentum without external-interaction (the ra or la is the momentum with external-interaction), so to be called as the photon or back-photon. In the right turn Milky Way the number of right turn ra-rb much exceed the number of left turn la-lb, so ra-rb as the rest mass and la-lb as the anti-mass, and the physical vacuum is composed by right turn ra. But the number of la-rb and ra-lb at the same, who call as negative charge all ok, I take ra-lb as the negative charge. In a simple model the fifth-dimensional turn-quantity U c with the momentum P average share the general energy for ra , la, la-ra and lb-rb, but for the charge quanta la-rb and ra-lb the general energy all in the electric quantity q. For ra-rb quantum though the external-interaction of ra and rb to be counteracted and leads to its turn-quantity U = (e - e) = 0, but the general energy unable vanish and corresponding to the absolute values of turn-quantity [ e ] + [ - e ]= [ U ]. So the absolute value of turn-quantity [ U ] is called as the rest mass. The recombination: la-ra + lb-rb = la+ ra + lb + rb = la-lb + ra-rb = la+ ra +lb + rb = la-rb +ra-lb accord to the transformation among the photons, masses quanta and charges quanta. Furthermore, we get the light, charge and rest mass all come from the same ‘non-dot model’ basic cell turn-advance quanta. From \\underline{P} • \\underline{P} = 0 we get the rest mass of la or ra: m (0) = [ e ] = [ P/c ] = ±± (1/2 (1/2) ) E/c (2) ; the electric quantity of unit charge quanta la-rb or ra-lb q _{0} = 2 (1/2) 2 q (0) , q (0) is the electric quantity of unit turn-advance quanta. The ±± symbol shows that when m (0) to take positive value then the neutrinos and antineutrinos all have positive and negative energy level, when the energy E to take positive value then e to take positive value then \\underline{e} must take negative value. In the quantized inconsecutive time-space-spin with momentum and turn-quantity as the coordinates drawing the momentum-turn graphics are some points with certain distance. The rest mass m _{0} is the lowest energy state advance-back neutrinos pair ra-rb, when j direction have 2n ra or rb the i , k directions must have (2n-1), (2n+1) ra or rb for i, j, k three directions all matching into pair to eliminate the external interaction of electric quantity q (0) in ra. The spatial rest mass is: (n) m _{0} = (2n-1) 2n (2n+1) m (0) = 6, 60, 210, 504, 990 and 1716 m (0) . According to the uncertainty principle n large rest mass layer is more little and at the inside layer of particle. The spatial unit charge quanta e or \\underline{e} are composed by nine one-dimensional unit charge quanta la-rb or ra-lb because of the vertical polarization at each spatial direction there is only three states: the left, the right and the middle of left-right balance.
Accretion-powered Compact Binaries
NASA Astrophysics Data System (ADS)
Mauche, Christopher W.
2003-12-01
Preface; The workshop logo; A short history of the CV workshop F. A. Córdova; Part I. Observations: 1. Low mass x-ray binaries A. P. Cowley, P. C. Schmidtke, D. Crampton, J. B. Hutchings, C. A. Haswell, E. L. Robinson, K. D. Horne, H. M. Johnston, S. R. Kulkarni, S. Kitamoto, X. Han, R. M. Hjellming, R. M. Wagner, S. L. Morris, P. Hertz, A. N. Parmar, L. Stella, P. Giommi, P. J. Callanan, T. Naylor, P. A. Charles, C. D. Bailyn, J. N. Imamura, T. Steiman-Cameron, J. Kristian, J. Middleditch, L. Angelini and J. P. Noris; 2. Nonmagnetic cataclysmic variables R. S. Polidan, C. W. Mauche, R. A. Wade, R. H. Kaitchuck, E. M. Schlegel, P. A. Hantzios, R. C. Smith, J. H. Wood, F. Hessman, A. Fiedler, D. H. P. Jones, J. Casares, P. A. Charles, J. van Paradijs, E. Harlaftis, T. Naylor, G. Sonneborn, B. J. M. Hassall, K. Horne, C. A. la Dous, A. W. Shafter, N. A. Hawkins, D. A. H. Buckley, D. J. Sullivan, F. V. Hessman, V. S. Dhillon, T. R. Marsh, J. Singh, S. Seetha, F. Giovannelli, A. Bianchini, E. M. Sion, D. J. Mullan, H. L. Shipman, G. Machin, P. J. Callanan, S. B. Howell, P. Szkody, E. M. Schlegel and R. F. Webbink; 3. Magnetic cataclysmic variables C. Hellier, K. O. Mason, C. W. Mauche, G. S. Miller, J. C. Raymond, F. K. Lamb, J. Patterson, A. J. Norton, M. G. Watson, A. R. King, I. M. McHardy, H. Lehto, J. P. Osborne, E. L. Robinson, A. W. Shafter, S. Balachandran, S. R. Rosen, J. Krautter, W. Buchholz, D. A. H. Buckley, I. R. Tuoly, D. Crampton, B. Warner, R. M. Prestage, B. N. Ashoka, M. Mouchet, J. M. Bonnet-Bidaud, J. M. Hameury, P. Szkody, P. Garnavich, S. Howell, T. Kii, M. Cropper, K. Mason, J. Bailey, D. T. Wickramasinghe, L. Ferrario, K. Beuermann, A. D. Schwope, H.-C. Thomas, S. Jordan, J. Schachter, A. V. Filippenko, S. M. Kahn, F. B. S. Paerels, K. Mukai, M. L. Edgar, S. Larsson, R. F. Jameson, A. R. King, A. Silber, R. Remillard, H. Bradt, M. Ishida, T. Ohashi and G. D. Schmidt; Part II. Accretion Theory: 4. Nonmagnetic W. Kley, F. Geyer, H. Herold, H. Ruder, R. Whitehurst, A. King, J. C. Wheeler, S. Mineshige, M. Huang, S. W. Kim, Y. Tuchman, T. R. Kallman and J. A. Woods; 5. Magnetic M. T. Wolff, J. N. Imamura, K. S. Wood, J. H. Gardner, S. J. Litchfield, J. J. Brainerd, G. Chanmugan, K. Wu, J. Frank, T. Hanawa, K. Hirotani and N. Kawai; Part III. Novae S. Starrfield, R. M. Hjellming, A. B. Tomaney, A. W. Shafter, A. Cassatella, P. L. Selvelli, R. Gilmozzi, A. Bianchini, M. Friedjung, H. Ritter, M. J. Politano, M. Livio, R. F. Webbink, K. Horne, W. F. Welsh, R. A. Wade, J. Krauttler, M. A. J. Snijders, N. Vogt, L. H. Barrera, H. Barwig, K.-H Mantel, R. Gilmozzi, A. Shankar, A. Burkert, J. W. Truran and J. Hayes: Part IV. Evolution I. Iben Jr, M. S. Hjellming, R. E. Taam, M. Politano, F. D'Antona, I. Mazzitelli, H. Ritter, J. M. Hameury, A. R. King, J. P. Lasota, R. Popham, R. Narayan, J. Isern, J. Laybay, R. Canal, D. García, A. S. Fruchter, S. R. Kulkarni, R. W. Romani, A. Ray, W. Kluzniak, S. Miyaji and G. Chanmugam; Subject index; Star index.
Code of Federal Regulations, 2010 CFR
2010-07-01
... procedure means the simplified procedures described at 5 U.S.C. 552b(d)(4) for announcing and closing...: (a) The deliberations required or permitted under §§ 2203.4(d) and 2203.5, e.g., a discussion of... include matters that are the responsibility of the Commission's Chairman. See, e.g., 29 U.S.C. 661(e...
75 FR 29601 - Notice of Final Federal Agency Actions on a Proposed Highway Project in California
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-26
... Act (RCRA) [42 U.S.C. 6901-6992(k)]. 9. Executive Orders: E.O. 11990 Protection of Wetlands; E.O... Preservation Act of 1966, as amended [16 U.S.C. 470(aa)-11]; Archeological Resources Protection Act of 1977 [16... and Economic: Civil Rights Act of 1964 [42 U.S.C. 2000(d)-2000(d)(1)]; Farmland Protection Policy Act...
Code of Federal Regulations, 2010 CFR
2010-10-01
... Federal Motor Carrier Safety Regulations? (a) General. As provided by 49 U.S.C. 31151(d), a law.... Pursuant to 49 U.S.C. 31151(e)(1), unless otherwise provided in paragraph (b)(2) of this section, a State... determinations—(i) In general. Pursuant to 49 U.S.C. 31151(e)(2), and notwithstanding paragraph (a) of this...
27 CFR 44.32 - Rate of special tax.
Code of Federal Regulations, 2012 CFR
2012-04-01
... OF THE TREASURY (CONTINUED) TOBACCO EXPORTATION OF TOBACCO PRODUCTS AND CIGARETTE PAPERS AND TUBES... 26 U.S.C. 5061(e)(3) shall be treated as one taxpayer for the purpose of determining gross receipts... U.S.C. 448(c)(3). (e) Returns and allowances. Gross receipts for any taxable year shall be reduced...
27 CFR 40.32 - Rates of special tax.
Code of Federal Regulations, 2011 CFR
2011-04-01
..., DEPARTMENT OF THE TREASURY (CONTINUED) TOBACCO MANUFACTURE OF TOBACCO PRODUCTS, CIGARETTE PAPERS AND TUBES... 26 U.S.C. 5061(e)(3) shall be treated as one taxpayer for the purpose of determining gross receipts... U.S.C. 448(c)(3). (e) Returns and allowances. Gross receipts for any taxable year shall be reduced...
27 CFR 40.32 - Rates of special tax.
Code of Federal Regulations, 2013 CFR
2013-04-01
..., DEPARTMENT OF THE TREASURY (CONTINUED) TOBACCO MANUFACTURE OF TOBACCO PRODUCTS, CIGARETTE PAPERS AND TUBES... 26 U.S.C. 5061(e)(3) shall be treated as one taxpayer for the purpose of determining gross receipts... U.S.C. 448(c)(3). (e) Returns and allowances. Gross receipts for any taxable year shall be reduced...
27 CFR 44.32 - Rate of special tax.
Code of Federal Regulations, 2014 CFR
2014-04-01
... OF THE TREASURY (CONTINUED) TOBACCO EXPORTATION OF TOBACCO PRODUCTS AND CIGARETTE PAPERS AND TUBES... 26 U.S.C. 5061(e)(3) shall be treated as one taxpayer for the purpose of determining gross receipts... U.S.C. 448(c)(3). (e) Returns and allowances. Gross receipts for any taxable year shall be reduced...
27 CFR 44.32 - Rate of special tax.
Code of Federal Regulations, 2013 CFR
2013-04-01
... OF THE TREASURY (CONTINUED) TOBACCO EXPORTATION OF TOBACCO PRODUCTS AND CIGARETTE PAPERS AND TUBES... 26 U.S.C. 5061(e)(3) shall be treated as one taxpayer for the purpose of determining gross receipts... U.S.C. 448(c)(3). (e) Returns and allowances. Gross receipts for any taxable year shall be reduced...
27 CFR 40.32 - Rates of special tax.
Code of Federal Regulations, 2014 CFR
2014-04-01
..., DEPARTMENT OF THE TREASURY (CONTINUED) TOBACCO MANUFACTURE OF TOBACCO PRODUCTS, CIGARETTE PAPERS AND TUBES... 26 U.S.C. 5061(e)(3) shall be treated as one taxpayer for the purpose of determining gross receipts... U.S.C. 448(c)(3). (e) Returns and allowances. Gross receipts for any taxable year shall be reduced...
27 CFR 44.32 - Rate of special tax.
Code of Federal Regulations, 2011 CFR
2011-04-01
... OF THE TREASURY (CONTINUED) TOBACCO EXPORTATION OF TOBACCO PRODUCTS AND CIGARETTE PAPERS AND TUBES... 26 U.S.C. 5061(e)(3) shall be treated as one taxpayer for the purpose of determining gross receipts... U.S.C. 448(c)(3). (e) Returns and allowances. Gross receipts for any taxable year shall be reduced...
Wendlandt, Sarah; Kadlec, Kristina; Feßler, Andrea T; Schwarz, Stefan
2015-06-12
The aim of this study was to investigate the genetic basis of combined pleuromutilin-lincosamide-streptogramin A resistance in 26 unrelated methicillin-resistant Staphylococcus aureus (MRSA) and coagulase-negative staphylococci (CoNS) from dairy cows suffering from mastitis. The 26 pleuromutilin-resistant staphylococcal isolates were screened for the presence of the genes vga(A), vga(B), vga(C), vga(E), vga(E) variant, sal(A), vmlR, cfr, lsa(A), lsa(B), lsa(C), and lsa(E) by PCR. None of the 26 isolates carried the genes vga(B), vga(C), vga(E), vga(E) variant, vmlR, cfr, lsa(A), lsa(B), or lsa(C). Two Staphylococcus haemolyticus and single Staphylococcus xylosus, Staphylococcus lentus, and Staphylococcus hominis were vga(A)-positive. Twelve S. aureus, two Staphylococcus warneri, as well as single S. lentus and S. xylosus carried the lsa(E) gene. Moreover, single S. aureus, S. haemolyticus, S. xylosus, and Staphylococcus epidermidis were positive for both genes, vga(A) and lsa(E). The sal(A) gene was found in a single Staphylococcus sciuri. All ABC transporter genes were located in the chromosomal DNA, except for a plasmid-borne vga(A) gene in the S. epidermidis isolate. The genetic environment of the lsa(E)-positive isolates was analyzed using previously described PCR assays. Except for the S. warneri and S. xylosus, all lsa(E)-positive isolates harbored a part of the previously described enterococcal multiresistance gene cluster. This is the first report of the novel lsa(E) gene in the aforementioned bovine CoNS species. This is also the first identification of the sal(A) gene in a S. sciuri from a case of bovine mastitis. Moreover, the sal(A) gene was shown to also confer pleuromutilin resistance. Copyright © 2015 Elsevier B.V. All rights reserved.
The Small Alternatively Spliced Amelogenin LRAP Modulates Early Stage Ameloblast Differentiation
2014-01-30
Nguyen, V., Somogyi-Ganss, E., Snead, M.L., White, S.N., Paine , M.L., and Ganss, B. (2012). Targeted overexpression of amelotin disrupts the...microstructure of dental enamel. PloS one 7, e35200. Lacruz, R.S., Smith, C.E., Kurtz, I., Hubbard, M.J., and Paine , M.L. (2013). New paradigms on the...restorative dentistry 24, 326-333. Shapiro, J.L., Wen, X., Okamoto, C.T., Wang, H.J., Lyngstadaas, S.P., Goldberg, M., Snead, M.L., and Paine , M.L. (2007
Applications of Known Quantitative Techniques for Developing Airborne ASW Crew Performance Criteria,
1967-07-01
environmental foot tunnel enable’s accurate tests to be conducted under specifications, controlled conditions, MA Ch I N E ( ‘OMI ’l ’F t T ION SERVICES C...ph~- 51 olo gical nioni tur ing equ ip— cc i dt’ a r t e ’t~ cci C ~~ii ’ ri iue ’nt s can hi’ ~‘onc1ui-ted u ndc r V a t t e s t s nie ’ni ; I
Summary of Results, Chief Joseph Dam Cultural Resources Project, Washington.
1985-01-01
Cmpbll, . R S*CONTRACT OR GRANT NUMUER(a) S. ambeled. with V.CazoR Dalai" P. Davis, D. Hibbert, S. Key, L.L. and L.A. Leeds, DACW67-78-C-0106 -: E ...Leopold, E . Lohse, S. Livingston, C. Miss, R. Nickmann. L. Salo, 0. Sammons-Lohse, (cont.) ~.s SPERFORMING ORGANIZATION NAME AND0 ADDRESS 10...Dat Eneed V 7 •,- "Mop-, e ~~l . - , ., - . W~PY OF REStALTS. 041 EF JOSEPH DAN CUtlJRAL RESOURCES PROECT, WASHINGTON edited by Sarah K. Campbell
Economical Development of Complex Computer Systems
1992-08-15
margins typically encountered in the ........ beginning of a product’s life cycle, and shorten the payback period.4 leS D ~~~~LC~~~ Jr4.tt L~s.c...recurring, and other related costsincurred, or estimated to be incurr in the design, research and development (R& D ), investment, operation, maintenance...on the basis of cost. D E C R ’Item I E Incorporatento A-ml S .... .. EF D Y ..... S F R Technology& : Recnser 0 N P T Item N A -- Y E -- B N ’’A D
The STRONG STAR Multidisciplinary PTSD Research Consortium
2012-09-01
used to determine GR levels. The A450 values for each t h d a a b t ( T g b a c c u r p c i e t s e a c F C b l p r p C r a a i M. K. Green et al...Neuropsychology 9:118–125. Valle M, Mayo W, Dellu F, Moal ML, Simon H, Maccari S (1997) Prenatal stress induces high anxiety and postnatal handling in- duces...June 2012 Accepted 16 July 2012 Keywords: PTSD Stress Coping style Anxiety HPA-axis a b s t r a c t Exposure to psychological
2004-09-28
01101011 84 N4 108 6C 01101100 250 R 109 6D 01101101 133 s128 110 6E 01101110 61 S64 111 6F 01101111 186 n64 112 70 01110000 43 m 113 71 01110001 121...109 6D 01101101 133 s128 183 B7 10110111 134 C128 194 C2 11000010 135 T 128 93 5D 01011101 136 α8 231 E7 11100111 137 g128 50 32 00110010 138 N128 86
2005-05-17
6A 01101010 40 r8 107 6B 01101011 84 N4 108 6C 01101100 250 R 109 6D 01101101 133 s128 110 6E 01101110 61 S64 111 6F 01101111 186 n64 112 70 01110000...210 D2 11010010 132 l128 109 6D 01101101 133 s128 183 B7 10110111 134 C128 194 C2 11000010 135 T 128 93 5D 01011101 136 α8 231 E7 11100111 137 g128
Field Demonstration Test Report for the AN/TRN-41 TACAN Navigational Set
1977-01-14
8217■- ’-■-»’-’■«"-"»« ^■„„„^»m.^, i IT imiiiriiMii mmmm mmvt.mMimvti\\i\\. „Muummmmmmm - i 8 x ♦- c c e& III us Ul Q. > D- <N o <- ♦* c ■n * 11 > x a < S ... op C V E * E 3 C E in m > x c a < 1? o z 00 > X a < CM > X ■a I a < x ɘ E c E a 10 < a c a> a a
Climate and Conflict: A Comment on Hsiang et al.’s Reply to Buhaug et al
2014-01-01
Jonas Nordkvelle 106011 c . THIS PAGE The public reporting burden for this collection of information is estimated to average 1 hour per response, including...conflict relationship. D e sign : M e d icin eh e ad s.co m E d ito r: A gn e te Sch jø n sb y C o ve r p h o to P atrick Sicco li / G am m a-R...odds with the assumption of causal homogeneity. c ) For reasons explained in b), we believe a meta-analysis of the empirical climate- conflict
Electron and Nuclear Spin Interactions in the Optical Spectra of Single GaAs Quantum Dots
2001-05-28
VOLUME 86, NUMBER 22 P H Y S I C A L R E V I E W L E T T E R S 28 MAY 2001 5 Electron and Nuclear Spin Interactions in the Optical Spectra of Single...GaAs Quantum Dots D. Gammon, Al. L. Efros, T. A. Kennedy, M. Rosen, D. S . Katzer, and D. Park Naval Research Laboratory, Washington, D.C. 20375 S . W...Brown NIST, Gaithersburg, Maryland V. L. Korenev and I. A. Merkulov A. F. Ioffe Institute, St. Petersburg, Russia (Received 18 December 2000) Fine and
Lake Ladora and Lake Mary Phase 2 Data Addendum Site 2-17 Task No. 20 - Lower Lakes Version 3.1.
1988-10-01
4 E4 1>E 0 0 m 41 a l 0 0 1. 1-0 0. A 0a L I 0a c0 C4 LI C S .-4 ItI * M 1 0 0C41 C4 0 .4 .1 L E- .0 C 5 L I4 I10L d 0 0 0 000 0 ii 0 0 8 000 0d 0kI 4...L N L S 0L 4)4N L? 4C 0) 0C 0 P) 4?10-0 0 L E- n’ 4 0 O W L IL 0 0 3, 0 CJ -i J- tD >.nx i I 009H t98 )-)I- , 00 *I080000 *000- 00 888 0 00088 00000
75 FR 74624 - Approval and Promulgation of Implementation Plans; Georgia: Stage II Vapor Recovery
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-01
... public health and welfare, respectively. 75 FR 2938. Initially, EPA expected these NAAQS to become final... the fueling of motor vehicles. 42 U.S.C. 7511a(b)(3). Sections 182(c), 182(d) and 182(e) of the CAA... as well. 42 U.S.C. Sec. 7511a(c), (d), and (e). Accordingly, as a serious ozone nonattainment area...
2009-09-17
bone morphogenetic protein ) Bone regeneration Drug delivery In vivo test Polyurethane a b s t r a c t Scaffolds prepared from biodegradable...Toshitaka Yoshii b, c ,2, Andrea E. Hafeman a,b,3, Jeffry S. Nyman b, c ,d,4, Joseph C . Wenke e,5, Scott A. Guelcher a,b,* aDepartment of Chemical and...Houston, TX, USA a r t i c l e i n f o Article history: Received 18 June 2009 Accepted 26 August 2009 Available online 17 September 2009 Keywords: BMP
Robust Path Tracking of Autonomous Underwater Vehicles Using Sliding Modes
1990-12-01
MDB REAL MQN , MWN ,MDSN REAL QHADOTQHAT,THADOT,THAT C C YAW HYDRODYNAMIC COEFFICIENTS C REAL NPDOT,NRDOTNPQ , NQR REAL NVDOT , NP ,NR ,NVQ REAL NWP...NRDOT--3.4E-3-,NPQ .s-2.1E-2 , NQR .s2.7E-3, & NVDOT-1.2E-3 , NP --8.4E-4 ,NR --1.6E-2 ,NVQ - -1.E-2, -& NWP --1.75-2 , NWR -7.4E-3 ,NV -.-7.4E-3 ,NVW... NQR *Q*R)- +(RHO/2)*L**4*(NP*U*P+ & NR*U*R + NVQ*V*Q-+NWP*W*P + NWR*W*R) +(RHO/2)*L**3*(NV* & -U*V + NVW*V*W +-NDR*U**2*D R) +-YAW + (XG*WEIGHT- &XB
An Introduction to a Reliability Shorthand.
1981-03-01
II 00r.nt m 0 e@et IS. SUPPLEMENTARy NOTES It. KEY WORDS (CeMMle soewe" ad s it meomE, d aienf Iyp M mumbw) reliability system survival survival...function systems reliability shorthand redundant systems 20. ASISTRAGT (C411M en .MVm ideS if m I O 1411011010 IV N au11 l) -The determination of a system’s...OF TWOS IS 1 (Uim Urn. lincrl nqqi fi Pd "MTV C P06 L&a TIO 0 To oe 0S S e s O" M ef. Item 20, continued: Simple examples show the convenience of this
NASA Astrophysics Data System (ADS)
Bagenal, Fran; Dowling, Timothy E.; McKinnon, William B.
2007-03-01
Preface; 1. Introduction F. Bagenal, T. E. Dowling and W. B. McKinnon; 2. The origin of Jupiter J. I. Lunine, A. Corandini, D. Gautier, T. C. Owen and G. Wuchterl; 3. The interior of Jupiter T. Guillot, D. J. Stevenson, W. B. Hubbard and D. Saumon; 4. The composition of the atmosphere of Jupiter F. W. Taylor, S. K. Atreya, Th. Encrenaz, D. M. Hunten, P. G. J. Irwin and T. C. Owen; 5. Jovian clouds and haze R. A. West, K. H. Baines, A. J. Friedson, D. Banfield, B. Ragent and F. W. Taylor; 6. Dynamics of Jupiter's atmosphere A. P. Ingersoll, T. E. Dowling, P. J. Gierasch, G. S. Orton, P. L. Read, A. Sánchez-Lavega, A. P. Showman, A. A. Simon-Miller and A. R. Vasavada; 7. The stratosphere of Jupiter J. I. Moses, T. Fouchet, R. V. Yelle, A. J. Friedson, G. S. Orton, B. Bézard, P. Drossart, G. R. Gladstone, T. Kostiuk and T. A. Livengood; 8. Lessons from Shoemaker-Levy 9 about Jupiter and planetary impacts J. Harrington, I. de Pater, S. H. Brecht, D. Deming, V. Meadows, K. Zahnle and P. D. Nicholson; 9. Jupiter's thermosphere and ionosphere R. V. Yelle and S. Miller; 10. Jovian dust: streams, clouds and rings H. Krüger, M. Horányi, A. V. Krivov and A. L. Graps; 11. Jupiter's ring-moon system J. A. Burns, D. P. Simonelli, M. R. Showalter, D. P. Hamilton, C. C. Porco, H. Throop and L. W. Esposito; 12. Jupiter's outer satellites and trojans D. C. Jewitt, S. Sheppard and C. Porco; 13. Interior composition, structure and dynamics of the Galilean satellites G. Schubert, J. D. Anderson, T. Spohn and W. B. McKinnon; 14. The lithosphere and surface of Io A. S. McEwen, L. P. Keszthelyi, R. Lopes, P. M. Schenk and J. R. Spencer; 15. Geology of Europa R. Greeley, C. F. Chyba, J. W. Head III, T. B. McCord, W. B. McKinnon, R. T. Pappalardo and P. Figueredo; 16. Geology of Ganymede R. T. Pappalardo, G. C. Collins, J. W. Head III, P. Helfenstein, T. B. McCord, J. M. Moore, L. M. Procktor, P. M. Shenk and J. R. Spencer; 17. Callisto J. M. Moore, C. R. Chapman. E. B. Bierhaus, R. Greeley, F. C. Chuang, J. Klemaszewski, R. N. Clark, J. B. Dalton, C. A. Hibbitts, P. M. Schenk, J. R. Spencer and R. Wagner; 18. Ages and interiors: the cratering record of the Galilean satellites P. M. Schenk, C. R. Chapman, K. Zahnle and J. M. Moore; 19. Satellite atmospheres M. A. McGrath, E. Lellouch, D. F. Strobel, P. D. Feldman and R. E. Johnson; 20. Radiation effects on the surfaces of the Galilean satellites R. E. Johnson, R. W. Carlson, J. F. Cooper, C. Paranicas, M. H. Moore and M. C. Wong; 21. Magnetospheric interactions with satellites M. G. Kivelson, F. Bagenal, W. S. Kurth, F. M. Neubauer, C. Paranicas and J. Saur; 22. Plasma interactions of Io with its plasma torus J. Saur, F. M. Neubauer, J. E. P. Connerney, P. Zarka and M. G. Kivelson; 23. The Io neutral clouds and plasma torus N. Thomas, F. Bagenal, T. W. Hill and J. K. Wilson; 24. The configuration of Jupiter's magnetosphere K. K. Khurana, M. G. Kivelson, V. M. Vasyliunas, N. Krupp, J. Woch, A. Lagg, B. H. Mauk and W. S. Kurth; 25. Dynamics of the Jovian magnetosphere N. Krupp, V. M. Vasyliunas, J. Woch, A. Lagg, K. K. Khurana, M. G. Kivelson, B. H. Mauk, E. C. Roelof, D. J. Williams, S. M. Krimigis, W. S. Kurth, L. A. Frank and W. R. Paterson; 26. Jupiter's Aurora J. T. Clarke, D. Grodent, S. W. H. Cowley, E. J. Bunce, P. Zarka, J. E. P. Connerney and T. Satoh; 27. Jupiter's inner radiation belts S. J. Bolton, R. M. Thorne, S. Bourdarie, I. de Pater and B. Mauk; Appendix 1. Maps and spectra of Jupiter and the Galilean satellites J. R. Spencer, R. W. Carlson, T. L. Becker and J. S. Blue; Appendix 2. Planetary parameters J. W. Weiss; Index.
Carbonneau, Leah; Bhattacharya, Dipankar; Sheridan, David C.; Coronado, Roberto
2005-01-01
Understanding which cytosolic domains of the dihydropyridine receptor participate in excitation-contraction (EC) coupling is critical to validate current structural models. Here we quantified the contribution to skeletal-type EC coupling of the α1S (CaV1.1) II-III loop when alone or in combination with the rest of the cytosolic domains of α1S. Chimeras consisting of α1C (CaV1.2) with α1S substitutions at each of the interrepeat loops (I-II, II-III, and III-IV loops) and N- and C-terminal domains were evaluated in dysgenic (α1S-null) myotubes for phenotypic expression of skeletal-type EC coupling. Myotubes were voltage-clamped, and Ca2+ transients were measured by confocal line-scan imaging of fluo-4 fluorescence. In agreement with previous results, the α1C/α1S II-III loop chimera, but none of the other single-loop chimeras, recovered a sigmoidal fluorescence-voltage curve indicative of skeletal-type EC coupling. To quantify Ca2+ transients in the absence of inward Ca2+ current, but without changing the external solution, a mutation, E736K, was introduced into the P-loop of repeat II of α1C. The Ca2+ transients expressed by the α1C(E736K)/α1S II-III loop chimera were ∼70% smaller than those expressed by the Ca2+-conducting α1C/α1S II-III variant. The low skeletal-type EC coupling expressed by the α1C/α1S II-III loop chimera was confirmed in the Ca2+-conducting α1C/α1S II-III loop variant using Cd2+ (10−4 M) as the Ca2+ current blocker. In contrast to the behavior of the II-III loop chimera, Ca2+ transients expressed by an α1C/α1S chimera carrying all tested skeletal α1S domains (all α1S interrepeat loops, N- and C-terminus) were similar in shape and amplitude to wild-type α1S, and did not change in the presence of the E736K mutation or in the presence of 10−4 M Cd2+. Controls indicated that similar dihydropyridine receptor charge movements were expressed by the non-Ca2+ permeant α1S(E1014K) variant, the α1C(E736K)/α1S II-III loop chimera, and the α1C(E736K)/α1S chimera carrying all tested α1S domains. The data indicate that the functional recovery produced by the α1S II-III loop is incomplete and that multiple cytosolic domains of α1S are necessary for a quantitative recovery of the EC-coupling phenotype of skeletal myotubes. Thus, despite the importance of the II-III loop there may be other critical determinants in α1S that influence the efficiency of EC coupling. PMID:15849247
Van Do, Thien; Elsayed, Said; Florvaag, Erik; Hordvik, Ivar; Endresen, Curt
2005-12-01
Fish-hypersensitive patients can probably tolerate some fish species while being allergic to others. To determine the allergenic cross-reactivity between 9 commonly edible fish: cod, salmon, pollack, mackerel, tuna, herring, wolffish, halibut, and flounder. Sera from 10 patients allergic to fish and rabbit antisera against 3 parvalbumins (Gad c 1, Sal s 1, and The c 1) were used. Cross-reactivity was investigated by SDS/PAGE and IgE immunoblotting, IgG ELISA, IgE ELISA inhibition, and skin prick test (SPT). Cod (Gad c 1), salmon (Sal s 1), pollack (The c 1), herring, and wolffish share antigenic and allergenic determinants as shown by immunoblots and IgE ELISA, whereas halibut, flounder, tuna, and mackerel displayed lowest cross-reactivities. The highest mean IgE ELISA inhibition percent of 10 sera was obtained by Gad c 1, followed by The c 1, herring, Sal s 1, wolffish, halibut, flounder, tuna, and mackerel with the least inhibition. Nine of the 10 patients showed positive SPT to cod, salmon, and pollack; 8 patients reacted to recombinant (r) Sal s 1. Positive SPTs to rGad c 1 and rThe c 1 were demonstrated in 1 patient. Gad c 1, Sal s 1, The c 1, herring, and wolffish contained the most potent cross-reacting allergens, whereas halibut, flounder, tuna, and mackerel were the least allergenic in the current study. The latter could probably be tolerated by some of the tested patients.
2012-01-01
Charles E . Wade, PhD; Lorne H. Blackbourne, MD; Philip C. Spinella, MD Trauma remains one of the most common causes of death in all age groups...the U.S. Government. The authors have not disclosed any potential conflicts of interest. For information regarding this article, E -mail: Jpatregnani...ELEMENT NUMBER 6. AUTHOR(S) Patregnani J. T., Borgman M. A., Maegele M., Wade C. E ., Blackbourne L. H., Spinella P. C., 5d. PROJECT NUMBER 5e. TASK
Non-Singular Modeling of Rigid Manipulators.
1986-12-01
SOJQCE 09 FONDING NoMBERS PROG-RAM PRO,ECT -ASK v1 W K .. Ni ELEMEFNT NO NO NO I ACCES;C)1 NO N ON:-zlVTLvIP ’"fPFILINC OFPTRCI1) TAIT rT( Q ; E RSO...AUTHORIS r eamrred. khavvq’_ .33 " t0 QFOQ 13t)’ E COIRED TO4 DATE OF REPORT lYcir MonfhP Day) S P.%t~r (,),%T S I ; . - A T 0 N& (C)SAI. CODES I i...tr he po--,nt of singul -ar-ity. One solution is to s:e:-, a --,mmamu: t me at r oosit:ocn or to avoid t>i:c’ . alt :- e ::.: n t-.te r *solution is to
DOE Research and Development Accomplishments Site Index (A-Z)
dropdown arrow Site Map A-Z Index Menu Synopsis A - Z Index A B C D E F G H I J K L M N O P Q R S T U V W X Buckminsterfullerene Curl Smalley Buckyball Curl Smalley TOP A B C D E F G H I J K L M N O P Q R S T U V W X Y Z C transcription Dresselhaus, Mildred (Millie) Drosophila dynamics TOP A B C D E F G H I J K L M N O P Q R S T U V
CrossTalk: The Journal of Defense Software Engineering. Volume 19, Number 3
2006-03-01
Humphreys & Associates, Inc., 2002. 3. Humphrey , Watts S . PSP : A Self- Improvement Process for...sanderfer.html>. 5. Humphrey , Watts S . A Discipline for Software Engineering. Addison- Wesley, 1995. 6. Tuma, David, and David R. Webb. “Personal Earned Value: Why...o u r c e li n e s o f c o d e ) Figure 3: Differences for Highest Degree Attained PSP /TSP 12 CROSSTALK The Journal of Defense Software
1981-10-09
N. Camarcat (Centre d’Etudes de Valduc ) noted that the French were new in this field and presented the results of the experiments on LIB production...Beam Production on Low Impedance Generators" N. Camarcat et al. C.E.A.-D.A.M.-S.E.C.R. Centre d’Etudes de Valduc , France 7...Acceleration on the Thalie Generator" J. Cortella et al. C.E.A.-D.A.M.-S.E.C.R. Centre d’Etudes de Valduc , France ION PRODUCTION II "The Work on High
It’s Your Career - Get Involved and Give It all You Got,
1985-04-01
SSS) the z-, 1 1 e,es of FtiE. s- ... t+ P23. c’-aCJ. s ,-u f, r - arc t- rt .I th sI.r I ar r, th,- -ds F ac’rri 1 -shmen t . Ser or Is-Ts s. r...Fcrn’ "I F- f 7r , I nll :j H-r-ni In ’ 1 Pci Ia leq- pc +’ N-’’i rl + rfre Z, aca r Plec ,eP P’,,.al s r-sr c ,zr C,-. l qe ,-, P-ir I -’rn a._r ,-sj-aF...who enters his/her current base three times. That’s where the officer is’ Checking the box "Desire to remain at current station" will let the
Validation of the Military Entrance Physical Strength Capacity Test
1984-01-01
Differences The following sections give an overview of the differences between men and women on the MEPSCAT, CPTs, and Physical Proficiency Tests. Hotellings T2...Ca 0 0 I Smm C C a C. * C a C a.* I S S& me * me m S emme a * Cme a me a a -e - a a em * U C me * 6*mem Ct 0 em* S a C.m C * S aaN me a I % ma cc
2007-05-01
4 1e+5 1e+ 6 1000MPa... 6 1e-5 1e- 4 1e-3 1e-2 1e-1 1e-1 1e+0 1e+1 1e+2 1e+3 1e+ 4 1e+5 1e+ 6 1000MPa 900MPa 800MPa C re ep R at e (/s ) Creep Time (s) 0% Prestrain, 650°C...increase in strain rate. The change in deformation response is significant even for small plastic strains. 1e-9 1e-8 1e-7 1e- 6 1e-5 1e- 4 1e-3
NASA Astrophysics Data System (ADS)
Arjunan, V.; Anitha, R.; Thenmozhi, S.; Marchewka, M. K.; Mohan, S.
2016-06-01
The stable conformers of trans-2-methoxycinnamic acid (trans-2MCA) are determined by potential energy profile analysis. The energies of the s-cis and s-trans conformers of trans-2MCA determined by B3LYP/cc-pVTZ method are -612.9788331 Hartrees and -612.9780953 Hartrees, respectively. The vibrational and electronic investigations of the stable s-cis and s-trans conformers of trans-2-methoxycinnamic acid have been carried out extensively with FTIR and FT-Raman spectral techniques. The s-cis conformer (I) with a (C16-C17-C18-O19) dihedral angle equal to 0° is found to be more favoured relative to the one s-trans (II) with (C16-C17-C18-O19) = 180°, possibly due to delocalization, hydrogen bonding and steric repulsion effects between the methoxy and acrylic acid groups. The DFT studies are performed with B3LYP method by utilizing 6-311++G** and cc-pVTZ basis sets to determine the structure, thermodynamic properties, vibrational characteristics and chemical shifts of the compound. The total dipole moments of the conformers determined by B3LYP/cc-pVTZ method are 3.35 D and 4.87 D for s-cis and s-trans, respectively. It reveals the higher polarity of s-trans conformer of trans-2MCA molecule. The electronic and steric influence of the methoxy group on the skeletal frequencies has been analysed. The energies of the frontier molecular orbitals and the LUMO-HOMO energy gap have been determined. The MEP of s-cis conformer lie in the range +1.374e × 10-2 to -1.374e × 10-2 while for s-trans it is +1.591e × 10-2 to -1.591e × 10-2. The total electron density of s-cis conformer lie in the range +5.273e × 10-2 to -5.273e × 10-2 while for s-trans it is +5.403e × 10-2 to -5.403e × 10-2. The MEP and total electron density shows that the s-cis conformer is less polar, less reactive and more stable than the s-trans conformer. All the reactivity descriptors of the molecule have been discussed. Intramolecular electronic interactions and their stabilisation energies have analysed by NBO method.
Electrically Tunable g Factors in Quantum Dot Molecular Spin States
2006-11-10
Electrically Tunable g Factors in Quantum Dot Molecular Spin States M. F. Doty,1,* M. Scheibner,1 I. V. Ponomarev,1 E. A. Stinaff,1 A. S . Bracker,1 V...L. Korenev ,2 T. L. Reinecke,1 and D. Gammon1 1Naval Research Laboratory, Washington, D.C. 20375, USA 2A.F. Ioffe Physical Technical Institute, St...on the applied electric field (F). PRL 97, 197202 (2006) P H Y S I C A L R E V I E W L E T T E R S week ending 10 NOVEMBER 2006 0031-9007=06=97(19
A Strategic Market Game with Transactions Costs,
1983-03-30
On(S)) with pj(s) E Y for s E S . Such a map is called a market mechanism and defines a strategic market game : th(pj(s) is the j trader’s outcome...modified game r in which an (n+l)st player places a fixed bid of c > 0 and a fixed offer of E > 0 in each of the m markets . The strategy sets of the original...10 1983 D , . A STRATEGIC MARKET GAME WITH TRANSACTIONS COI rS C-, LLJ J. Rogawski and M. Shubik LL- March 30, 1983 D3RJM ff IS.TATEKENTA I 0 25 0ൖ
An Analysis of Water-to-Air Heat Pump Systems for Use in Government Facilities.
1980-09-01
factories , businesses, and homes could have a significant impact on total energy con- sumption. Various methods to reduce energy consumption include...MODEL GROUND WATER HEAT PUMP 95 ECOsOioIC: EVALUATION OF 4E i Il/C 0"C". 5InULATI -’ (S 4.’V;F, TEAx3 EC3OO, tC ANALISIS -ARlE7ERS E’NNtNG Yf. OF S:h
17 CFR 200.30-3 - Delegation of authority to Director of Division of Trading and Markets.
Code of Federal Regulations, 2011 CFR
2011-04-01
...(h) (§§ 240.14e-4(c), 240.14e-5(d), and 240.15c2-11(h) of this chapter), and Rules 101(d), 102(e...)(1)(viii)(G), § 240.15c3-1e(a)(1)(ix)(C), § 240.15c3-1e(a)(4), § 240.15c3-1g(b)(1)(i)(H), and § 240... Commission pursuant to sections 5318A(a)(4), 5318A(e)(2) and 5318(h)(2) of the Bank Secrecy Act (31 U.S.C...
Optical Pumping of the Electronic and Nuclear Spin of Single Charge-Tunable Quantum Dots
2005-02-02
Optical Pumping of the Electronic and Nuclear Spin of Single Charge-Tunable Quantum Dots A. S . Bracker,1 E. A. Stinaff,1 D. Gammon,1 M. E. Ware,1 J...G. Tischler,1 A. Shabaev,1 Al. L. Efros,1 D. Park,1 D. Gershoni,2 V. L. Korenev ,3 and I. A. Merkulov3 1Naval Research Laboratory, Washington, D.C...intensity (open circles), the PRL 94, 047402 (2005) P H Y S I C A L R E V I E W L E T T E R S week ending 4 FEBRUARY 2005 0031-9007=05=94(4)=047402(4
A Trapped Mercury 199 Ion Frequency Standard
1981-12-01
ing resul t t h a t could possibly be explained by a for tu i t ious cancel la t ion of t w o e f f ec t s : t h e second order doppler...h a t t h e helium cooling is e f f ec t ive . O the r e f f e c t s of t he helium include nar rower l ines and a la rger s ignal indicat...Desaintfuscien, K. Barjllet, J . Viennet, P. Pet i t , and C. Audoin, Appl. Phys. 24, 107 (1981). 4. R, Ifflaender and G. Werth; Metrologia 13, 167 (1977
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-29
... submissions by the parties may be submitted via the Board's e-filing format or in the traditional paper format. Any person using e-filing should attach a document and otherwise comply with the instructions at the E... proceeding under 49 U.S.C. 721 and 5 U.S.C. 554(e). Petitioners request that the Board declare that specific...
ERIC Educational Resources Information Center
Bird, William A.
Research has shown that optimistic and pessimistic outcome expectancy evaluations are associated with adaptive and maladaptive levels of psychological functioning, physical wellness, and health recovery issues. The research of M. F. Scheier, C. S. Carver, M. E. P. Seligman, and C. R. Snyder supports the hypothesis that elevated optimism or…
75 FR 18833 - Agency Information Collection Activities: Existing Collection; Emergency Extension
Federal Register 2010, 2011, 2012, 2013, 2014
2010-04-13
.... Abstract: Section 709(c) of Title VII of the Civil Rights Act of 1964, as amended, 42 U.S.C. 2000e-8(c... minorities and women. The data are shared with several other Federal agencies. Pursuant to section 709(d) of Title VII of the Civil Rights Act of 1964, U.S.C. 2000e-8(d), as amended, EEO-4 data is shared with...
NRL (Naval Research Laboratory) Plasma Formulary. Revised.
1987-01-01
ac)- 1 Resistance 4 7r o /Ar (Co//1o ) 1/2 Time 1 c Velocity Ck c- 18 MAXWELL’S EQUATIONS Name or Description SI f Gaussian OB 1lOB Faraday’s law V...x E -- V x E =- D t c Ot OD 1OD 4 -r Ampere’s law V x H = 6 +J x H = -+-J t c Ot c Poisson equation V • D = p V • D = 41rp [Absence of magnetic V...force/gravitational or V/NL buoyancy force) 1/ 2 Gay- Lussac Ga 1/1AT Inverse of relative change in volume during heating Grashof Gr gL S AT/ v
77 FR 55896 - Notice of Final Federal Agency Actions on Loop 1 in Texas
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-11
... Indian Religious Freedom Act [42 U.S.C. 1996]; Farmland Protection Policy Act (FPPA) [7 U.S.C. 4201- 4209... Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America...
77 FR 26601 - Notice of Final Federal Agency Actions on Proposed Highway in Connecticut
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-04
... Indian Religious Freedom Act [42 U.S.C. 1996]; Farmland Protection Policy Act (FPPA) [7 U.S.C. 4201-4209... Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred Sites; E.O. 13287 Preserve America...
1982-10-01
CR !PT Jr,4 CF THE FUPEP ELiAEN5 + f ,, 4, S**444444**44*4*4*444++ 44 4.+414++++++4++ + +++4+++44 f 44*4* ++ +444. + 172 FILE: IdES!’ GEN FC4TRAN Al...CLCC-(-"II e(1) 21...X’) STE’T ST’ICT *SSICT 179 FILE: PESI- GEN FCRTPAN Al NAVNL POSTGRAOLATE SCHO 70C CCITTNJUE P~lUPN C *****+*+*+4*+ *.4+..*4.4...PEtC IN fCCiNFC7Iv1TY IPATP:X, Lr..%L NdCDE NLVhJ3E S STAPT AT ELVEPTIS i.;PIi iR!G~e r~ fANC LC,.% IND) TAV -QSi Mih. C REIC IN 11-E FLEPOENT TypE
Selective Chemosensitization of Rb Mutant Cells
2001-07-01
MA). pLPC-12S coexpresses an E1A 12S cDNA with puromycin phosphotransferase (puro) and pWZL-12S coexpresses E1A with hygromycin phospho...expressing puromycin phosphotransferase (puro); LPC-12S, a 12S El A cDNA in LPC (McCurrach et al. 1997); LPC-12S.AN and LPC-12S.ACR2, El A mutants that...2, -3, conserved regions 1, 2, and 3; MEF, mouse embryonic fibroblast; puro, puromycin; hygro, hygromycin . To whom reprint requests should be
MicroRNAs in Tamoxifen Resistance of Breast Cancer
2009-08-01
Giorda, E., Massalini, S., Frajese, G. V., Ciafre, S. A., and Farace , M. G. (2007) J. Biol. Chem. 282, 23716–23724 27. le Sage, C., Nagel, R., Egan...D. A., Schrier, M., Mesman, E., Mangiola, A., Anile, C., Maira, G.,Mercatelli, N., Ciafre, S. A., Farace ,M. G., and Agami, R. (2007) EMBO J. 26, 3699
Precision Measurement of the e+e-→Λc+Λ¯c - Cross Section Near Threshold
NASA Astrophysics Data System (ADS)
Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Alekseev, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Begzsuren, K.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, P. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Cossio, F.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garillon, B.; Garzia, I.; Gilman, A.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guo, A. Q.; Guo, R. P.; Guo, Y. P.; Guskov, A.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, J. W.; Li, Jin; Li, K. J.; Li, Kang; Li, Ke; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Libby, J.; Lin, C. X.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. L.; Liu, H. M.; Liu, Huanhuan; Liu, Huihui; Liu, J. B.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lusso, S.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Muchnoi, N. Yu.; Muramatsu, H.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peng, Z. Y.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Pitka, A.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qi, T. Y.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shan, X. Y.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shi, X.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tan, Y. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, Meng; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wang, Zongyuan; Weber, T.; Wei, D. H.; Wei, J. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, F.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Yang, Yifan; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, Q.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, A. N.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration
2018-03-01
The cross section of the e+e-→Λc+Λ¯c - process is measured with unprecedented precision using data collected with the BESIII detector at √{s }=4574.5 , 4580.0, 4590.0 and 4599.5 MeV. The nonzero cross section near the Λc+Λ¯c- production threshold is cleared. At center-of-mass energies √{s }=4574.5 and 4599.5 MeV, the higher statistics data enable us to measure the Λc polar angle distributions. From these, the Λc electric over magnetic form-factor ratios (|GE/GM|) are measured for the first time. They are found to be 1.14 ±0.14 ±0.07 and 1.23 ±0.05 ±0.03 , respectively, where the first uncertainties are statistical and the second are systematic.
Precision Measurement of the e + e - → Λ c + Λ ¯ c - Cross Section Near Threshold
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ablikim, M.; Achasov, M. N.; Ahmed, S.
The cross section of the e +e - →more » $$Λ_c^+$$$\\bar{Λ}$$$_c^-$$ process is measured with unprecedented precision using data collected with the BESIII detector at √s = 4574.5, 4580.0, 4590.0 and 4599.5 MeV. The non-zero cross section near the $$Λ_c^+$$$\\bar{Λ}$$$_c^-$$ production threshold is cleared. At center-of-mass energies √s = 4574.5 and 4599.5 MeV, the higher statistics data enable us to measure the Λ c polar angle distributions. From these, the Λ c electric over magnetic form factor ratios (|GE/GM|) are measured for the first time. They are found to be 1.14±0.14±0.07 and 1.23±0.05±0.03 respectively, where the first uncertainties are statistical and the second are systematic.« less
Precision Measurement of the e + e - → Λ c + Λ ¯ c - Cross Section Near Threshold
Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...
2018-03-29
The cross section of the e +e - →more » $$Λ_c^+$$$\\bar{Λ}$$$_c^-$$ process is measured with unprecedented precision using data collected with the BESIII detector at √s = 4574.5, 4580.0, 4590.0 and 4599.5 MeV. The non-zero cross section near the $$Λ_c^+$$$\\bar{Λ}$$$_c^-$$ production threshold is cleared. At center-of-mass energies √s = 4574.5 and 4599.5 MeV, the higher statistics data enable us to measure the Λ c polar angle distributions. From these, the Λ c electric over magnetic form factor ratios (|GE/GM|) are measured for the first time. They are found to be 1.14±0.14±0.07 and 1.23±0.05±0.03 respectively, where the first uncertainties are statistical and the second are systematic.« less
2014-10-09
I N T E G R I T Y E F F I C I E N C Y A C C O U N TA B I L I T Y E XC E L L E N C E Inspector General U.S. Department of Defense Report...No. DODIG-2015-006 O C T O B E R 9 , 2 0 1 4 Policy Changes Needed at Defense Contract Management Agency to Ensure Forward Pricing Rates Result...recognized as leaders in our field. For more information about whistleblower protection, please see the inside back cover. I N T E G R I T Y E F F I C
Computer Center Reference Manual
1988-06-20
Compiler options, separated by colons (default: A-:B?-:BREG-8:BT-:C-:D+:H2:A H+24:L+:O+:P-:+:RV-:S4:S+4:A ST-:T+: TREG -8:U-:V+:A-:Z+) CPU- - Cray to execute...4 a 0~ 0 -. C 6 0 _ .0’ 63 r C 6 0 C .. 60 0 6 .- 6 ILC A L U 00 00 IL C 6 1 6j 0 1.- U 0 E L 14. E Lc C0 a 60. LL 1 0’. . - 66 6 0 DL C 6 a 4
Code of Federal Regulations, 2011 CFR
2011-04-01
... records only where appropriate from the following provisions: sections (c)(3); (d); (e)(1); (e)(4)(G), (e)(4)(H), and (e)(4)(I); and (f) of 5 U.S.C. 552a. (c) Reasons for claimed exemptions: (1) The Privacy Act of 1974 creates several methods by which individuals may learn of and obtain records containing...
Measurements of e + e - pairs from open heavy flavor in p + p and d + A collisions at s NN = 200 GeV
Adare, A.; Afanasiev, S.; Aidala, C.; ...
2017-08-18
In this paper, we report a measurement of e +e - pairs from semileptonic heavy-flavor decays in p + p collisions at √sNN = 200 GeV. The e +e - pair yield frommore » $$b\\overline{b}$$ and $$c\\overline{c}$$ is separated by exploiting a double differential fit done simultaneously in dielectron invariant mass and p T. We used three different event generators, pythia, mc@nlo, and powheg, to simulate the e +e - spectra from $$c\\overline{c}$$ and $$b\\overline{b}$$ production. The data can be well described by all three generators within the detector acceptance. However, when using the generators to extrapolate to 4π, significant differences are observed for the total cross section. These difference are less pronounced for $$b\\overline{b}$$ than for $$c\\overline{c}$$. The same model dependence was observed in already published d + A data. Lastly, the p + p data are also directly compared with d + A data in mass and p T, and within the statistical accuracy no nuclear modification is seen.« less
Measurements of e + e - pairs from open heavy flavor in p + p and d + A collisions at s NN = 200 GeV
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adare, A.; Afanasiev, S.; Aidala, C.
In this paper, we report a measurement of e +e - pairs from semileptonic heavy-flavor decays in p + p collisions at √sNN = 200 GeV. The e +e - pair yield frommore » $$b\\overline{b}$$ and $$c\\overline{c}$$ is separated by exploiting a double differential fit done simultaneously in dielectron invariant mass and p T. We used three different event generators, pythia, mc@nlo, and powheg, to simulate the e +e - spectra from $$c\\overline{c}$$ and $$b\\overline{b}$$ production. The data can be well described by all three generators within the detector acceptance. However, when using the generators to extrapolate to 4π, significant differences are observed for the total cross section. These difference are less pronounced for $$b\\overline{b}$$ than for $$c\\overline{c}$$. The same model dependence was observed in already published d + A data. Lastly, the p + p data are also directly compared with d + A data in mass and p T, and within the statistical accuracy no nuclear modification is seen.« less
Measurements of e+e- pairs from open heavy flavor in p +p and d +A collisions at √{sNN}=200 GeV
NASA Astrophysics Data System (ADS)
Adare, A.; Afanasiev, S.; Aidala, C.; Ajitanand, N. N.; Akiba, Y.; Al-Bataineh, H.; Alexander, J.; Alfred, M.; Aoki, K.; Apadula, N.; Aphecetche, L.; Asai, J.; Atomssa, E. T.; Averbeck, R.; Awes, T. C.; Ayuso, C.; Azmoun, B.; Babintsev, V.; Bagoly, A.; Bai, M.; Baksay, G.; Baksay, L.; Baldisseri, A.; Barish, K. N.; Barnes, P. D.; Bassalleck, B.; Basye, A. T.; Bathe, S.; Batsouli, S.; Baublis, V.; Baumann, C.; Bazilevsky, A.; Belikov, S.; Belmont, R.; Bennett, R.; Berdnikov, A.; Berdnikov, Y.; Bickley, A. A.; Blau, D. S.; Boer, M.; Boissevain, J. G.; Bok, J. S.; Borel, H.; Boyle, K.; Brooks, M. L.; Bryslawskyj, J.; Buesching, H.; Bumazhnov, V.; Bunce, G.; Butler, C.; Butsyk, S.; Camacho, C. M.; Campbell, S.; Canoa Roman, V.; Chang, B. S.; Chang, W. C.; Charvet, J.-L.; Chernichenko, S.; Chi, C. Y.; Chiu, M.; Choi, I. J.; Choudhury, R. K.; Chujo, T.; Chung, P.; Churyn, A.; Cianciolo, V.; Citron, Z.; Cole, B. A.; Connors, M.; Constantin, P.; Csanád, M.; Csörgő, T.; Dahms, T.; Dairaku, S.; Danley, T. W.; Das, K.; David, G.; Deblasio, K.; Dehmelt, K.; Denisov, A.; D'Enterria, D.; Deshpande, A.; Desmond, E. J.; Dietzsch, O.; Dion, A.; Do, J. H.; Donadelli, M.; Drapier, O.; Drees, A.; Drees, K. A.; Dubey, A. K.; Dumancic, M.; Durham, J. M.; Durum, A.; Dutta, D.; Dzhordzhadze, V.; Efremenko, Y. V.; Elder, T.; Ellinghaus, F.; Engelmore, T.; Enokizono, A.; En'yo, H.; Esumi, S.; Eyser, K. O.; Fadem, B.; Fan, W.; Feege, N.; Fields, D. E.; Finger, M.; Finger, M.; Fleuret, F.; Fokin, S. L.; Fraenkel, Z.; Frantz, J. E.; Franz, A.; Frawley, A. D.; Fujiwara, K.; Fukao, Y.; Fukuda, Y.; Fusayasu, T.; Gal, C.; Garishvili, I.; Ge, H.; Glenn, A.; Gong, H.; Gonin, M.; Gosset, J.; Goto, Y.; Granier de Cassagnac, R.; Grau, N.; Greene, S. V.; Grosse Perdekamp, M.; Gunji, T.; Gustafsson, H.-Å.; Hachiya, T.; Hadj Henni, A.; Haggerty, J. S.; Hahn, K. I.; Hamagaki, H.; Han, R.; Han, S. Y.; Hartouni, E. P.; Haruna, K.; Hasegawa, S.; Haseler, T. O. S.; Haslum, E.; Hayano, R.; He, X.; Heffner, M.; Hemmick, T. K.; Hester, T.; Hill, J. C.; Hill, K.; Hohlmann, M.; Holzmann, W.; Homma, K.; Hong, B.; Horaguchi, T.; Hornback, D.; Hoshino, T.; Hotvedt, N.; Huang, J.; Huang, S.; Ichihara, T.; Ichimiya, R.; Iinuma, H.; Ikeda, Y.; Imai, K.; Imrek, J.; Inaba, M.; Isenhower, D.; Ishihara, M.; Isobe, T.; Issah, M.; Isupov, A.; Ito, Y.; Ivanishchev, D.; Jacak, B. V.; Ji, Z.; Jia, J.; Jin, J.; Johnson, B. M.; Joo, K. S.; Jorjadze, V.; Jouan, D.; Jumper, D. S.; Kajihara, F.; Kametani, S.; Kamihara, N.; Kamin, J.; Kang, J. H.; Kapukchyan, D.; Kapustinsky, J.; Karthas, S.; Kawall, D.; Kazantsev, A. V.; Kempel, T.; Khachatryan, V.; Khanzadeev, A.; Kijima, K. M.; Kikuchi, J.; Kim, B. I.; Kim, C.; Kim, D. H.; Kim, D. J.; Kim, E.; Kim, E.-J.; Kim, M.; Kim, M. H.; Kim, S. H.; Kincses, D.; Kinney, E.; Kiriluk, K.; Kiss, Á.; Kistenev, E.; Klay, J.; Klein-Boesing, C.; Koblesky, T.; Kochenda, L.; Komkov, B.; Konno, M.; Koster, J.; Kotov, D.; Kozlov, A.; Král, A.; Kravitz, A.; Kudo, S.; Kunde, G. J.; Kurita, K.; Kurosawa, M.; Kweon, M. J.; Kwon, Y.; Kyle, G. S.; Lacey, R.; Lai, Y. S.; Lajoie, J. G.; Lallow, E. O.; Layton, D.; Lebedev, A.; Lee, D. M.; Lee, K. B.; Lee, T.; Leitch, M. J.; Leite, M. A. L.; Lenzi, B.; Leung, Y. H.; Lewis, N. A.; Li, X.; Li, X.; Liebing, P.; Lim, S. H.; Liška, T.; Litvinenko, A.; Liu, H.; Liu, L. D.; Liu, M. X.; Loggins, V.-R.; Lokos, S.; Love, B.; Lynch, D.; Maguire, C. F.; Majoros, T.; Makdisi, Y. I.; Makek, M.; Malakhov, A.; Malik, M. D.; Manko, V. I.; Mannel, E.; Mao, Y.; Mašek, L.; Masui, H.; Matathias, F.; McCumber, M.; McGaughey, P. L.; McGlinchey, D.; Means, N.; Meredith, B.; Miake, Y.; Mignerey, A. C.; Mihalik, D. E.; Mikeš, P.; Miki, K.; Milov, A.; Mishra, M.; Mitchell, J. T.; Mitsuka, G.; Mohanty, A. K.; Moon, T.; Morino, Y.; Morreale, A.; Morrison, D. P.; Morrow, S. I. M.; Moukhanova, T. V.; Mukhopadhyay, D.; Murakami, T.; Murata, J.; Nagai, K.; Nagamiya, S.; Nagashima, K.; Nagashima, T.; Nagle, J. L.; Naglis, M.; Nagy, M. I.; Nakagawa, I.; Nakagomi, H.; Nakamiya, Y.; Nakamura, T.; Nakano, K.; Nattrass, C.; Newby, J.; Nguyen, M.; Niida, T.; Nouicer, R.; Novák, T.; Novitzky, N.; Novotny, R.; Nyanin, A. S.; O'Brien, E.; Oda, S. X.; Ogilvie, C. A.; Oka, M.; Okada, K.; Onuki, Y.; Orjuela Koop, J. D.; Osborn, J. D.; Oskarsson, A.; Ouchida, M.; Ozawa, K.; Pak, R.; Palounek, A. P. T.; Pantuev, V.; Papavassiliou, V.; Park, J.; Park, J. S.; Park, S.; Park, W. J.; Pate, S. F.; Patel, M.; Pei, H.; Peng, J.-C.; Peng, W.; Pereira, H.; Perepelitsa, D. V.; Perera, G. D. N.; Peresedov, V.; Peressounko, D. Yu.; Perezlara, C. E.; Petti, R.; Phipps, M.; Pinkenburg, C.; Pun, A.; Purschke, M. L.; Purwar, A. K.; Qu, H.; Radzevich, P. V.; Rak, J.; Rakotozafindrabe, A.; Ravinovich, I.; Read, K. F.; Rembeczki, S.; Reygers, K.; Riabov, V.; Riabov, Y.; Richford, D.; Rinn, T.; Roach, D.; Roche, G.; Rolnick, S. D.; Rosati, M.; Rosendahl, S. S. E.; Rosnet, P.; Rowan, Z.; Rukoyatkin, P.; Runchey, J.; Ružička, P.; Rykov, V. L.; Sahlmueller, B.; Saito, N.; Sakaguchi, T.; Sakai, S.; Sakashita, K.; Sako, H.; Samsonov, V.; Sarsour, M.; Sato, K.; Sato, S.; Sato, T.; Sawada, S.; Schaefer, B.; Schmoll, B. K.; Schmoll, B. K.; Sedgwick, K.; Seele, J.; Seidl, R.; Semenov, A. Yu.; Semenov, V.; Sen, A.; Seto, R.; Sexton, A.; Sharma, D.; Shein, I.; Shibata, T.-A.; Shigaki, K.; Shimomura, M.; Shoji, K.; Shukla, P.; Sickles, A.; Silva, C. L.; Silvermyr, D.; Silvestre, C.; Sim, K. S.; Singh, B. K.; Singh, C. P.; Singh, V.; Skoby, M. J.; Slunečka, M.; Smith, K. L.; Soldatov, A.; Soltz, R. A.; Sondheim, W. E.; Sorensen, S. P.; Sourikova, I. V.; Staley, F.; Stankus, P. W.; Stenlund, E.; Stepanov, M.; Ster, A.; Stoll, S. P.; Sugitate, T.; Suire, C.; Sukhanov, A.; Syed, S.; Sziklai, J.; Takagui, E. M.; Taketani, A.; Tanabe, R.; Tanaka, Y.; Tanida, K.; Tannenbaum, M. J.; Tarafdar, S.; Taranenko, A.; Tarján, P.; Tarnai, G.; Themann, H.; Thomas, T. L.; Tieulent, R.; Timilsina, A.; Togawa, M.; Toia, A.; Tomášek, L.; Tomášek, M.; Tomita, Y.; Torii, H.; Towell, C. L.; Towell, R. S.; Tram, V.-N.; Tserruya, I.; Tsuchimoto, Y.; Ueda, Y.; Ujvari, B.; Vale, C.; Valle, H.; van Hecke, H. W.; Vazquez-Carson, S.; Veicht, A.; Velkovska, J.; Vértesi, R.; Vinogradov, A. A.; Virius, M.; Vrba, V.; Vznuzdaev, E.; Wang, X. R.; Wang, Z.; Watanabe, Y.; Wei, F.; Wessels, J.; White, S. N.; Winter, D.; Wong, C. P.; Woody, C. L.; Wysocki, M.; Xie, W.; Xu, C.; Xu, Q.; Yamaguchi, Y. L.; Yamaura, K.; Yang, R.; Yanovich, A.; Yin, P.; Ying, J.; Yokkaichi, S.; Yoo, J. H.; Yoon, I.; Young, G. R.; Younus, I.; Yu, H.; Yushmanov, I. E.; Zajc, W. A.; Zaudtke, O.; Zhang, C.; Zharko, S.; Zhou, S.; Zolin, L.; Zou, L.; Phenix Collaboration
2017-08-01
We report a measurement of e+e- pairs from semileptonic heavy-flavor decays in p +p collisions at √{s NN}=200 GeV. The e+e- pair yield from b b ¯ and c c ¯ is separated by exploiting a double differential fit done simultaneously in dielectron invariant mass and pT. We used three different event generators, pythia, mc@nlo, and powheg, to simulate the e+e- spectra from c c ¯ and b b ¯ production. The data can be well described by all three generators within the detector acceptance. However, when using the generators to extrapolate to 4 π , significant differences are observed for the total cross section. These difference are less pronounced for b b ¯ than for c c ¯ . The same model dependence was observed in already published d +A data. The p +p data are also directly compared with d +A data in mass and pT, and within the statistical accuracy no nuclear modification is seen.
Implementing the Army NetCentric Data Strategy in a ServiceOriented Environment
2009-04-23
D a t a D i s c o v e r y Data Retrieval Data Subscription Data Discovery D a t a A c c e s s Artifact Discovery Federated Search Data Search Data...define common interfaces to search and retrieve data across the enterprise. • Patterns • Search • Status • Receive – Services • Federated Search • Artifact
Role Perceptions of Hispanic and Mainstream Navy Recruits.
1982-12-01
ACCESSION NO- 3. R9C’PI’NT’S CATALOG NUMBER 4. TITLE (and Subttl.e) S . TYPE of REPORT & PERIOO COVERED Role Perceptions of Hispanic and M4ainstream Interim...Technical Report Navy Recruits *. PERFORMING ORG. REPORT NUMBER 7. AUTHOR( s ) 6. CONTRACT OR GRANT NUMUER(a) Harry C. Triandis Judith Li3ansky Gerardo...T NU M E R S A Department of Psycholog~y University of Illinois NR 170-906 603 E. Daniel, Chamva.;vn, IL 6182__ II. CONTROLLING OFFICE NAME AND
Imputing forest carbon stock estimates from inventory plots to a nationally continuous coverage
2013-01-01
The U.S. has been providing national-scale estimates of forest carbon (C) stocks and stock change to meet United Nations Framework Convention on Climate Change (UNFCCC) reporting requirements for years. Although these currently are provided as national estimates by pool and year to meet greenhouse gas monitoring requirements, there is growing need to disaggregate these estimates to finer scales to enable strategic forest management and monitoring activities focused on various ecosystem services such as C storage enhancement. Through application of a nearest-neighbor imputation approach, spatially extant estimates of forest C density were developed for the conterminous U.S. using the U.S.’s annual forest inventory. Results suggest that an existing forest inventory plot imputation approach can be readily modified to provide raster maps of C density across a range of pools (e.g., live tree to soil organic carbon) and spatial scales (e.g., sub-county to biome). Comparisons among imputed maps indicate strong regional differences across C pools. The C density of pools closely related to detrital input (e.g., dead wood) is often highest in forests suffering from recent mortality events such as those in the northern Rocky Mountains (e.g., beetle infestations). In contrast, live tree carbon density is often highest on the highest quality forest sites such as those found in the Pacific Northwest. Validation results suggest strong agreement between the estimates produced from the forest inventory plots and those from the imputed maps, particularly when the C pool is closely associated with the imputation model (e.g., aboveground live biomass and live tree basal area), with weaker agreement for detrital pools (e.g., standing dead trees). Forest inventory imputed plot maps provide an efficient and flexible approach to monitoring diverse C pools at national (e.g., UNFCCC) and regional scales (e.g., Reducing Emissions from Deforestation and Forest Degradation projects) while allowing timely incorporation of empirical data (e.g., annual forest inventory). PMID:23305341
1989-12-15
ORDER NO. 1 BOOK 2 OF 5 DATABASE DOCUMENTATION BOOK 00-ALC MANPRA *(C5 MAIN LANDING GEAR- WCD’S) CONTRACT SUMMARY REPORT , 15 DECEMBER 1989 ’.1 - CONTRACT...ORIQ 1 . T A 1~4 M E* X C I" El 1 -:11 E:XCE:EI:IIE:U RE:CORI’ RFiS CvAUiS FOREXE IN REWORK LI[MITS Ill FINAL DESTINATION 22. COOROINATION/INITIATING MCC
Lytic and transforming functions of individual products of the adenovirus E1A gene.
Moran, E; Grodzicker, T; Roberts, R J; Mathews, M B; Zerler, B
1986-01-01
To distinguish the individual roles of the 13S, 12S, and 9S adenovirus E1A gene products, we isolated the corresponding cDNA clones and recombined them into both plasmids and viruses. Only the expected E1A mRNA products were made from the corresponding 12S and 13S viruses. The 9S mRNA was detected when the 9S virus was coinfected with the 13S virus but not when either virus was infected alone. The 13S virus formed plaques equally well in 293 cells, HeLa cells, and A549 cells, a human lung oat cell carcinoma line. Plaque titers of the 12S virus were much reduced in HeLa and A549 cells compared with 293 cells, although the 12S virus is multiplicity-dependent leaky in both HeLa and A549 cells. A549 cells were significantly more permissive than HeLa cells for growth of the 12S virus. In A549 cells even at low multiplicities of infection the final yield of 12S virus eventually approached the maximum yield from 293 cells. Expression from the adenovirus early region 2 and early region 3 promoters in HeLa cells was activated in the presence of a 13S cDNA E1A region but not in the presence of a 12S E1A cDNA region. Although defective for lytic growth in HeLa cells, the 12S virus immortalized BRK cells at very high efficiency, whereas infection of these cells with 13S virus, as with wild-type E1A virus, resulted mainly in cell death. The 13S product does have an immortalization function, however, revealed in the absence of adenovirus lytic functions when a plasmid containing the E1A 13S cDNA region was transfected into BRK cells. The 9S virus failed to immortalize infected BRK cells or to interfere with focus formation when coinfected with the 12S virus. Images PMID:2936898
Synergistic inhibition of the APC/C by the removal of APC15 in HCT116 cells lacking UBE2C.
Garvanska, Dimitriya H; Larsen, Marie Sofie Yoo; Nilsson, Jakob
2016-10-15
The spindle assembly checkpoint (SAC) inhibits the anaphase-promoting complex/cyclosome (APC/C) in response to unattached kinetochores by generating a diffusible inhibitor termed the mitotic checkpoint complex (MCC). At metaphase, rapid activation of the APC/C requires removal of the MCC, a process that has been shown to depend on the APC/C E2 enzymes, UBE2C and UBE2S. Here we investigate the in vivo role of the APC/C E2 enzymes in SAC silencing using CRISPR/Cas9 genetically engineered HCT116 UBE2C or UBE2S null cell lines. Using live cell assays, we show that UBE2C and UBE2S make a minor contribution to SAC silencing in HCT116 cells. Strikingly, in cells specifically lacking UBE2C, we observe a strong synergistic inhibition of mitotic progression when we stabilize the MCC on the APC/C by depleting APC15, potentially reflecting increased competition between the MCC and the remaining initiating E2 enzyme UBE2D. In conclusion, we provide in vivo insight into the APC/C E2 module and its interplay with SAC silencing components. © 2016. Published by The Company of Biologists Ltd.
Dynamics of δ-dopant redistribution during heterostructure growth
NASA Astrophysics Data System (ADS)
Pankratov, E. L.
2007-06-01
It has recently been shown that growth of a multilayer structure with one or more delta-layers at high temperature leads to spreading and asymmetrization of the dopant distribution [see, for example, E.F.J. Schubert, Vac. Sci. Technol. A. 8, 2980 (1990), A.M. Nazmul, S. Sugahara, M. Tanaka, J. Crystal Growth 251, 303 (2003); R.C. Newman, M.J. Ashwin, M.R. Fahy, L. Hart, S.N. Holmes, C. Roberts, X. Zhang, Phys. Rev. B 54, 8769 (1996); E.F. Schubert, J.M. Kuo, R.F. Kopf, H.S. Luftman, L.C. Hopkins, N.J. Sauer, J. Appl. Phys. 67, 1969 (1990); P.M. Zagwijn, J.F. van der Veen, E. Vlieg, A.H. Reader, D.J. Gravesteijn, J. Appl. Phys. 78, 4933 (1995); W.S. Hobson, S.J. Pearton, E.F. Schubert, G. Cabaniss, Appl. Phys. Lett. 55, 1546 (1989); Delta Doping of Semiconductors, edited by E.F. Schubert (Cambridge University Press, Cambridge, 1996); Yu.N. Drozdov, N.B. Baidus', B.N. Zvonkov, M.N. Drozdov, O.I. Khrykin, V.I. Shashkin, Semiconductors 37, 194 (2003); E. Skuras, A.R. Long, B. Vogele, M.C. Holland, C.R. Stanley, E.A. Johnson, M. van der Burgt, H. Yaguchi, J. Singleton, Phys. Rev. B 59, 10712 (1999); G. Li, C. Jagadish, Solid-State Electronics 41, 1207 (1997)]. In this work analytical and numerical analysis of dopant dynamics in a delta-doped area of a multilayer structure has been accomplished using Fick's second law. Some reasons for asymmetrization of a delta-dopant distribution are illustrated. The spreading of a delta-layer has been estimated using example materials of a multilayer structure, a delta-layer and an overlayer.
Pletzer, Daniel; Schweizer, Gabriel
2014-01-01
Transcriptional regulators of the AraC/XylS family have been associated with multidrug resistance, organic solvent tolerance, oxidative stress, and virulence in clinically relevant enterobacteria. In the present study, we identified four homologous AraC/XylS regulators, Rob, SoxS, PliA, and OpiA, from the fire blight pathogen Erwinia amylovora Ea1189. Previous studies have shown that the regulators MarA, Rob, and SoxS from Escherichia coli mediate multiple-antibiotic resistance, primarily by upregulating the AcrAB-TolC efflux system. However, none of the four AraC/XylS regulators from E. amylovora was able to induce a multidrug resistance phenotype in the plant pathogen. Overexpression of rob led to a 2-fold increased expression of the acrA gene. However, the rob-overexpressing strain showed increased resistance to only a limited number of antibiotics. Furthermore, Rob was able to induce tolerance to organic solvents in E. amylovora by mechanisms other than efflux. We demonstrated that SoxS from E. amylovora is involved in superoxide resistance. A soxS-deficient mutant of Ea1189 was not able to grow on agar plates supplemented with the superoxide-generating agent paraquat. Furthermore, expression of soxS was induced by redox cycling agents. We identified two novel members of the AraC/XylS family in E. amylovora. PliA was highly upregulated during the early infection phase in apple rootstock and immature pear fruits. Multiple compounds were able to induce the expression of pliA, including apple leaf extracts, phenolic compounds, redox cycling agents, heavy metals, and decanoate. OpiA was shown to play a role in the regulation of osmotic and alkaline pH stress responses. PMID:24936054
1992-09-09
Q ^ C. DESIGN COST £|0*7o) j O .?>?, D. ENERGY CREDIT CALC (1A+1B+1CJX.9 j 3 3j / Lf C. SALVAGE VALUE OF EXISTING EQUIPMENT...BY INVESTMFNT COSTS A. CONSTRUCTION COST ß. SIOH CS-S^O C. DESIGN COST £ 10*7»^ Ü. ENERGY CREDIT CALC (1A*1B+1C)X.9 E. SALVAGE VALUE OF...COST B. SIOH CS-S^O C. DESIGN COST ( lo7o") Ü. ENERGY CREDIT CALC (1A+IB+1C)X.9 E. SALVAGE VALUE OF EXISTING EQUIPMENT F. TOTAL INVESTMENT (ID-IE
Extremes of Moving Averages of Stable Processes.
1976-10-01
for -::~e contiriuous-tir e case, a result on sa~ n1e :-~~t~i continuity of stable ~rccess~s is obtained. J~.I3 1°70 subject classification: Prinary C...we let ~(x,y) = ~~~~ 6~(x,y) where 6~(x,y) = min(l/3, h(c ~ x,c1y)) and h(c.x~c~y) is the quantity given on p. 113- 115 of Lindvall’s paper, modified...that ~~~~~ < for all k1. The latter part of the condition perhaps needs some motivation. Suppose that a(X) is continuously differentiable , except
History of the Field Army Ballistic Missile Defense System Project, 1959-1962
1963-01-01
design and/or development. The t o t a l funding of t he program under con- t r a c t a s of November 1959 was $4,984,000, An immediate te rmina t...p a b i l i t y of defending a g a i n s t a n a l l - a l t i t u d e , a i r - suppor t ed t h r e a t . Under t he se i n s t r u c t i o...ion of t he development phase i n t he . fol lowing f i s c a l year were t o be pro- grammed under t he l i n e i tem F i e l d Army B a l
Arsenic and 17-β-estradiol bind to each other and neutralize each other’s signaling effects
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Sukhdeep; Mukherjee, Tapan K.; Guptasarma, Purnananda, E-mail: guptasarma@iisermohali.ac.in
We report that arsenic trioxide (ATO) and 17-beta-estradiol (E2) abolish each other’s independent cell signaling effects in respect of cell survival and proliferation/migration of breast cancer (MCF-7) cells. The possibility that this is due to binding of ATO to E2 was confirmed through difference absorption spectroscopy, chromatography-coupled voltammometry and 1-D {sup 1}H and {sup 13}C NMR spectroscopy. Binding leads to attenuation of E2’s hydroxyl {sup 1}H peaks at its C17 and C3 carbon positions. The results suggest that ATO and E2 can titrate each other’s levels, potentially explaining why sustained arsenic exposure tends to be associated with delays in agemore » of menarche, advanced age of menopause, poorer sperm quality, higher overall morbidity in men, and lower incidences of breast cancer in women in some arsenic-contaminated areas. - Highlights: • Difference absorption spectroscopy suggests that arsenic binds to estradiol. • Interaction with arsenic alters {sup 1}H and {sup 13}C NMR spectra of estradiol at positions C3 and C17. • Estradiol traps arsenic on C{sub 18} reverse-phase columns. • Estradiol and arsenic neutralize each other’s ability to stimulate scratch wound healing. • Arsenic appears to form pnictogen bonds with hydroxyls on estradiol.« less
Observation of e+e-→ω χc 1 ,2 near √{s }=4.42 and 4.6 GeV
NASA Astrophysics Data System (ADS)
Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Eren, E. E.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fedorov, O.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, X. Y.; Gao, Y.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. W.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kiese, P.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuehn, W.; Kupsc, A.; Lange, J. S.; Lara, M.; Larin, P.; Leng, C.; Li, C.; Li, C. H.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, Lei; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ripka, M.; Rong, G.; Rosner, Ch.; Ruan, X. D.; Santoro, V.; Sarantsev, A.; Savrié, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, S. G.; Wang, W.; Wang, W. P.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, Z.; Xia, L.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. N.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.; Besiii Collaboration
2016-01-01
Based on data samples collected with the BESIII detector operating at the BEPCII storage ring at center-of-mass energies √{s }>4.4 GeV , the processes e+e-→ω χc 1 ,2 are observed for the first time. With an integrated luminosity of 1074 pb-1 near √{s }=4.42 GeV , a significant ω χc 2 signal is found, and the cross section is measured to be (20.9 ±3.2 ±2.5 ) pb . With 567 pb-1 near √{s }=4.6 GeV , a clear ω χc 1 signal is seen, and the cross section is measured to be (9.5 ±2.1 ±1.3 ) pb , while evidence is found for an ω χc 2 signal. The first errors are statistical, and the second are systematic. Due to low luminosity or low cross section at other energies, no significant signals are observed. In the ω χc 2 cross section, an enhancement is seen around √{s }=4.42 GeV . Fitting the cross section with a coherent sum of the ψ (4415 ) Breit-Wigner function and a phase-space term, the branching fraction B (ψ (4415 )→ω χc 2) is obtained to be of the order of 1 0-3.
Mansfield, Jillian M; Herrmann, Paul; Jesionowski, Amy M; Vickerman, M Margaret
2017-11-01
Streptococcus gordonii produces a pheromone heptapeptide, s.g.cAM373, which induces a conjugative mating response in Enterococcus faecalis cells carrying the responsive plasmid, pAM373. We investigated the extent of this intergeneric signaling on DNA acquisition by streptococcal species likely to cohabit oral biofilms. E. faecalis/pAM373/pAMS470 cells were incubated with synthetic s.g.cAM373, reverse peptide s.g.cAM373-R, or peptide-free medium and examined for their abilities to transfer plasmid DNA to streptococcal species in the presence of DNase. Preinduction of E. faecalis donors with s.g.cAM373 resulted in transconjugation frequencies in non-pheromone producing strains of Streptococcus mutans, Streptococcus sanguinis, Streptococcus anginosus, and Streptococcus suis that were significantly higher than frequencies when donors were preincubated with s.g.cAM373-R or medium alone. Peptide-mediated communication between commensal streptococci and E. faecalis carrying pheromone-responsive plasmids may facilitate conjugative DNA transfer to bystander species, and influence the reservoir of antibiotic resistance determinants of enterococcal origin in the oral metagenome.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-25
... National Trails System Act, 16 U.S.C. 1247(d). Ballard also seeks the right to provide common carrier rail... use negotiations under 16 U.S.C. 1247(d).\\2\\ The Board seeks comments from interested persons on... submitted either via the Board's e-filing format or in the traditional paper format. Any person using e...
10 CFR 719.33 - What categories of costs are unallowable?
Code of Federal Regulations, 2012 CFR
2012-01-01
... 970.31. See also 41 U.S.C. 256(e). (b) The Department does not consider for reimbursement any costs incurred for entertainment or alcoholic beverages. See 48 CFR (FAR) 31.205-14 and 31.205-51 and 41 U.S.C. 256(e). (c) Costs that are customarily or already included in billed hourly rates are not separately...
10 CFR 719.33 - What categories of costs are unallowable?
Code of Federal Regulations, 2010 CFR
2010-01-01
... 970.31. See also 41 U.S.C. 256(e). (b) The Department does not consider for reimbursement any costs incurred for entertainment or alcoholic beverages. See 48 CFR (FAR) 31.205-14 and 31.205-51 and 41 U.S.C. 256(e). (c) Costs that are customarily or already included in billed hourly rates are not separately...
10 CFR 719.33 - What categories of costs are unallowable?
Code of Federal Regulations, 2011 CFR
2011-01-01
... 970.31. See also 41 U.S.C. 256(e). (b) The Department does not consider for reimbursement any costs incurred for entertainment or alcoholic beverages. See 48 CFR (FAR) 31.205-14 and 31.205-51 and 41 U.S.C. 256(e). (c) Costs that are customarily or already included in billed hourly rates are not separately...
10 CFR 719.33 - What categories of costs are unallowable?
Code of Federal Regulations, 2013 CFR
2013-01-01
... 970.31. See also 41 U.S.C. 256(e). (b) The Department does not consider for reimbursement any costs incurred for entertainment or alcoholic beverages. See 48 CFR (FAR) 31.205-14 and 31.205-51 and 41 U.S.C. 256(e). (c) Costs that are customarily or already included in billed hourly rates are not separately...
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-24
..., [email protected] . SUPPLEMENTARY INFORMATION: In compliance with 44 U.S.C. 3507, FDA has... of the Federal Food, Drug, and Cosmetic Act (the act) (21 U.S.C. 360e) sets forth the requirements... necessary to meet this requirement is 20 hours. Application in Sec. 814.20(a) through (c) and (e) The...
Pro-lipogenic Action of Lysophosphatidic Acid in Ovarian Cancer
2014-04-01
Function. IUBMB Life. 2008. 60: 347-354. 11. Tse C, Shoemaker AR, Adickes J, Anderson MG, Chen J, Jin S, Johnson EF, Marsh KC , Mitten MJ, Nimmer P...Ann. Oncol. 9, 437–442 14. Choi, J. W., Herr, D. R., Noguchi, K., Yung, Y. C., Lee, C. W., Mutoh, T., Lin, M. E., Teo , S. T., Park, K. E., Mosley, A
Results of Field Survey to Evaluate an Experimental Set of Officer Duty Modules
1974-01-01
s. -3 </. — ■A Ci o ». ^ < v. h c c ■/. t. C o c n G U 0 i/. x-i fc . c ■^ 1 tfl 1. .. r; ^ 4^ < *-» -^ »J tfi...J fc . "J (A m* o (1 «1 13 M U ’." s IRI LJ li 1: * -£ O «4 •- i; -j a. 1 ŗ D c IA • I "C-S b £ O fc O -I...O 3 M M O — IC. ^. fc .— .. C > -.. >- .’ o c: r— 3 ■ V 5; a _J I ■ ■ e I’ 7 i- o 1 ^ fl «J • g r rf n r c H ♦^ e 0
42 CFR 52a.1 - To which programs do these regulations apply?
Code of Federal Regulations, 2011 CFR
2011-10-01
.... 285d-6); (9) Alzheimer's disease centers, as authorized by section 445 of the Act (42 U.S.C. 285e-2... (42 U.S.C. 285e-3); (11) Centers of excellence in Alzheimer's disease research and treatment, as...
75 FR 75721 - Notice of Final Federal Agency Actions on Proposed Highway in Wisconsin
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-06
...: Civil Rights Act of 1964 [42 U.S.C. 2000(d) et. seq.]; American Indian Religious Freedom Act [42 U.S.C... Income Populations; E.O. 11593 Protection and Enhancement of Cultural Resources; E.O. 13007 Indian Sacred...
Flight Problems, Problems in Starting Service,
1977-01-03
h i l e a t the same time preserving hi gh f l i g h t r egu la r i t~ l e a d s to t h e fa c t t h a t the t e c h n i cal s t a r t i n g... assembl ies and pa r t s of the a i r c r a f t d~ein the previous flight (R R ), the p r o b a b i l i t y of4pr esence in the landing airport of an...of the assemblies , sets and blocks /P.- can be exchange d in a single hour in case of defects. Furthermore , in the newly constructed L-lOll
Helicopter Flying Qualities Characteristics-CH-46E. Volume 4.
1983-10-03
AUSI I&N r- oLnC N.rW UN .- i"e 9- cm ca q -. in 40f IWc %’c .a w - S. %.* *% p" .. . . . . . . . . . . . . . . . . . . . .. * N M . 7 - 7 -- 7 NADC-81 118...09l1 ’. 0:0 a.o 100 a.W*0, CD N %r 001’lIN cm N %0I~C .41 L 0..J" a . 0 . N CLCL v o N40 7 Zu E.a.. N U.be"-a ~N O n 1- -OIn-4 LLU0Dw a cI 1 & 6% tN o" K...Helicopter Flying Qualities Final Report ~iaaerscs-6. PERFORMING ORG. REPORT HUMMER Volume 4______________ 7 .- AUTHOR() S. CONTRACT OR GRANT NUMUER1(s) 9
NASA Astrophysics Data System (ADS)
Vdovenko, Sergey I.; Gerus, Igor I.; Pagacz-Kostrzewa, Magdalena; Wierzejewska, Maria; Zhuk, Yuri I.; Kukhar, Valery P.
2018-06-01
Although it is well known that reactivity of α,β-unsaturated enaminoketones is closely associated with spatial and electronic structure but until now little attention was devoted to quantitative investigation of interconversion of different stereoisomeric forms of enaminoketones. In present work we studied peculiarities of kinetics of Z ⇌ E isomerization of enaminoketone 4-(N-methylamino)-1,1,1-trifluorobut-3-en-2-one F3C-COsbnd CHdbnd CHsbnd NH(CH3) (1) in Ar-matrix exposed to UV-radiation (λ = 340 nm) with IR Fourier and 2D correlation spectroscopy and we found that Z-s-Z-s-trans isomer transforms primarily into two E-isomers, E-s-E-s-trans and E-s-Z-s-trans which further turn into the E-s-E-s-cis and E-s-Z-s-cis conformers all interconversion rate constants being comparable in magnitude. Along with this process long-term exposure to the UV-radiation results in proton transfer from nitrogen of methylamino group to carbonyl oxygen with simultaneous isomerization of 'cyclic' iminoenol form into 'linear'one. In solution of enaminoketone 4-(N-methylamino)-1,1,1-trifluoro-3-methylbut-3-en-2-one F3C-CO-C(CH3)dbnd CH-NH(CH3) (2) we observed reversed process, namely, spontaneous interconversion of the E-s-E-s-trans and E-s-Z-s-trans conformers into the Z-s-Z-trans isomer. It was found that rate constants of the dimeric forms of the E-s-E-s-trans and E-s-Z-s-trans conformers are higher than those of the monomers and are independent on total enaminoketone concentration. Addition of highly polar HMPA promotes proton transfer from nitrogen to oxygen in the Z-s-Z-s-trans isomer of 2 with subsequent isomerization into the linear imino-enol product but the rate constant of this transformation is ten-fold smaller than that for 1 in the Ar matrix exposed to UV radiation. Special feature of kinetics of Z ⇌ E isomerization of β-N-methylaminovinyl trifluoromethyl ketone in Ar matrix exposed to UV radiation and spontaneous E ⇌ Z isomerization of α-Methyl-, β-N-methylaminovinyl trifluoromethyl ketone. Sergey I. Vdovenko, Igor I. Gerus, Magdalena Pagacz-Kostrzewa, Maria Wierzejewska, Yuri I. Zhuk and Valery P. Kukhar.
Determination of the In Vitro and In Vivo Activity of Compounds Tested Against Punta Toro Virus
1988-12-20
2 = C CC 0 E-3 o S- EU E 0. o- coq 0 0 a)U- c 2n t 0’ E iNn~ * 00C C~J c E 0 r CE 76 .I *ý 0’E-.-..- EUE -E Z5 0 - c ~c ZN’J"- to LO U)-C E cm :- ~U...suspended in 10 mM phosphate buffer, pH 6.5. Each compound was incubated with enzyme (50:1, compound to enzyme ) at 250 C for 1 hour. Development and Detection...including adenosine, guanosine, 2,6-diaminopurne(2’-deoxy)riboside, and 6-methoxypurine. Therefore, adenosine deaminase was chosen as the likely enzyme
Stereocontrolled reduction of alpha- and beta-keto esters with micro green algae, Chlorella strains.
Ishihara, K; Yamaguchi, H; Adachi, N; Hamada, H; Nakajima, N
2000-10-01
The stereocontrolled reduction of alpha- and beta-keto esters using micro green algae was accomplished by a combination of the cultivation method and the introduction of an additive. The reduction of ethyl pyruvate and ethyl benzoylformate by the photoautotrophically cultivated Chlorella sorokiniana gave the corresponding alcohol in high e.e. (>99% e.e. (S) and >99% e.e. (R), respectively). In the presence of glucose as an additive, the reduction of ethyl 3-methyl-2-oxobutanoate by the heterotrophically cultivated C. sorokiniana afforded the corresponding (R)-alcohol. On the other hand, the reduction in the presence of ethyl propionate gave the (S)-alcohol. Ethyl 2-methyl-3-oxobutanoate was reduced in the presence of glycerol by the photoautotrophically cultivated C. sorokiniana or the heterotrophically cultivated C. sorokiniana to the corresponding syn-(2R,3S)-hydroxy ester with high diastereo- and enantiomeric excess (e.e.). Some additives altered the stereochemical course in the reduction of alpha- and beta-keto esters.
The Solar Mass Ejection Imager (SMEI) Space Experiment
2015-01-30
Price, S., Radick, R. R., Sagalyn, R., Sinclair, D., Simnett, G. M., Eyles, C. J ., Cooke, M. P., Tappin, S. J ., Kuchar, T ., Mizuno, D. R., Webb, D. F...207. [3] Kaiser, M. L., Kucera, T . A., Davila, J . M., St. Cyr, O. C., Guhathakurta, M., and Christian, E., “The STEREO Mission: An Introduction...D. F., Mizuno, D. R., Buffington, A., Cooke, M. P., Eyles, C. J ., Fry, C. D., Gentile, L. C., Hick, P. P., Holladay, P. E., Howard, T . A., Hewitt
Indirect-Cost Management Guide: Navigating the Sea of Overhead
2001-10-01
This is very advantageous to both the contractor and the government be- cause it enables each to become more effi- cient by capitalizing on significant...They are accumulated and then transferred for allocation as an indirect expense. T R A N S F E R R E D T O G & A I N D I R E C T C O S T D I R E C T C O ...463 173 1,773 FICA Taxes 14,804 17,488 8,327 1,943 3,049 925 1,851 694 1,578 Unempl Taxes 1,851 2,186 1,041 243 381 116 231 87 1,064 Retirement Plan
High Resolution Transmission Measurements of the Atmosphere in the Infrared.
1978-04-28
modifications to the various spect rorn et r ic installations , cu r r en t l y operated to obtain very hi g h resolution solar spectra in the in f r a...record the solar spectrum in the ~‘. 3000 to ~ 10 , 000 A reg ion , has also been equipped with an InSb detector to recorc various series of spectra near...in~ s c o n c e r n i n & HF , HC 1, also met hy l-ch lor ide (CH 3C1), e t c . . . L t h e r s tudies oased on our i n f r a r e d solar ou se
The Coast Artillery Journal. Volume 73, Number 2, August 1930
1930-08-01
lieu- tenant, C. A. C. Clark Neil Piper, graduate U. S . Military Academy, appointed second lieu- tenant, C. A. C. James S . Sutton , graduate U. S ...THE COAST ARTILLERY JOURNAL Published as th.e Jowrnal U. S . Artillery from 1892 to 1922 MAJ. STEWART S . GIFFIN, C. A. C mm •• h mm m mm .. m...ontispiece JOINT ARMY AND NAVY ACTION IN COAST DEFENSE By CAPT. W. D. PULESTON,U. S . N. 101 MORE ABOUT PROBABLE ERROR By 1ST LIEUT. PHILIP SCHWARTZ
Evaluating the effect of conservation motivations on residential water demand.
Maas, Alexander; Goemans, Christopher; Manning, Dale; Kroll, Stephan; Arabi, Mazdak; Rodriguez-McGoffin, Mariana
2017-07-01
Utilities and water suppliers in the southwestern United States have used education and conservation programs over the past two decades in an attempt to ameliorate the pressures of increasing water scarcity. This paper builds on a long history of water demand and environmental psychology literature and attempts to answer a simple question: do households primarily motivated by environmental and social (E&S) considerations consume water differently than households motivated primarily by cost and convenience (C&C)? We find that E&S consumers use less water than C&C consumers on average. We also find that there is no statistical difference between E&S and C&C consumers in their consumption responses to changing prices, temperature, and precipitation. This implies that targeting future conservation efforts to self-reported consumer groups may not improve policy effectiveness. Copyright © 2017 Elsevier Ltd. All rights reserved.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-11-02
....\\4\\ \\1\\ 15 U.S.C. 78s(b)(1). \\2\\ 17 CFR 240.19b-4. \\3\\ Securities Exchange Act Release No. 67835...\\ 12 U.S.C. 5465(e)(1)(H). The Commission finds it is appropriate to extend the review period for the... for OTC S&P 500 Index options. Accordingly, the Commission, pursuant to 806(e)(1)(H) of the Clearing...
Effects of natural honey on polymicrobial culture of various human pathogens
Al-Waili, Faiza S.; Akmal, Mohammed; Ali, Amjed; Salom, Khelod Y.; Al Ghamdi, Ahmad A.
2012-01-01
Introduction Honey has a wide range of antimicrobial activity. All previous studies have considered honey's effect on a single microbe. The present study investigated activity of honey towards a high dose of single or polymicrobial culture. Material and methods 10 µl specimens of Staphylococcus aureus (S. aureus), Streptococcus pyogenes (S. pyogenes), Escherichia coli (E. coli) and Candida albicans (C. albicans) were cultured in 10 ml of 10-100% (wt/v) honey diluted in broth. Six types of polymicrobial microbial cultures were prepared by culturing the isolates with each other onto broth (control) and broth containing various concentrations of honey (10-100% wt/v). Microbial growth was assessed on solid plate media after 24 h incubation. Results Honey (30-70%) prevents growth of 10 µl specimens of all the isolates. Greater reduction in growth of E. coli was observed when cultured with S. aureus. Culturing of S. aureus with S. pyogenes, C. albicans, or E. coli increased its sensitivity to honey. S. aureus and S. pyogenes increased sensitivity of C. albicans to honey while E. coli and C. albicans decreased sensitivity of S. pyogenes. Conclusions It might be concluded that honey prevents and inhibits growth of single and polymicrobial pathogenic cultures. Polymicrobial culture affects growth of the isolates and increases their sensitivity to honey. PMID:24904656
Effects of natural honey on polymicrobial culture of various human pathogens.
Al-Waili, Noori S; Al-Waili, Faiza S; Akmal, Mohammed; Ali, Amjed; Salom, Khelod Y; Al Ghamdi, Ahmad A
2014-05-12
Honey has a wide range of antimicrobial activity. All previous studies have considered honey's effect on a single microbe. The present study investigated activity of honey towards a high dose of single or polymicrobial culture. 10 µl specimens of Staphylococcus aureus (S. aureus), Streptococcus pyogenes (S. pyogenes), Escherichia coli (E. coli) and Candida albicans (C. albicans) were cultured in 10 ml of 10-100% (wt/v) honey diluted in broth. Six types of polymicrobial microbial cultures were prepared by culturing the isolates with each other onto broth (control) and broth containing various concentrations of honey (10-100% wt/v). Microbial growth was assessed on solid plate media after 24 h incubation. Honey (30-70%) prevents growth of 10 µl specimens of all the isolates. Greater reduction in growth of E. coli was observed when cultured with S. aureus. Culturing of S. aureus with S. pyogenes, C. albicans, or E. coli increased its sensitivity to honey. S. aureus and S. pyogenes increased sensitivity of C. albicans to honey while E. coli and C. albicans decreased sensitivity of S. pyogenes. It might be concluded that honey prevents and inhibits growth of single and polymicrobial pathogenic cultures. Polymicrobial culture affects growth of the isolates and increases their sensitivity to honey.
Research on Fire-Resistant Diesel Fuel.
1981-12-01
1[ >1 1? 1F RESEARCH ON FIRE-RESISTANT DIESEL FUEL INTERIM REPORT AFLRL No. 145 By W.D. Weatherford, Jr. G.E. Fodor M.D. Kanakia D.W. Naegeli B.R...GRANT NUMBER(S) W.D. Weatherford, Jr., G.E. Fodor, DAAK7O-80-C-OOO1 M.D. Kanakia, D.W. Naegeli , B.R. Wright (AFLRL) DAAK7O-82-C-OOO1 andF.W...Filters in Fuel Systems of U.S. Army Vehicles I:I , i , , , =- 111 REFERENCES 1. Weatherford, W.D., Jr. Fodor, G.E., Naegeli , D.W., Owens, E.C., Wright
HasF, a TolC-homolog of Serratia marcescens, is involved in energy-dependent efflux.
Kumar, Ayush; Worobec, Elizabeth A
2005-06-01
A tolC-like gene (hasF) was identified upon scanning the incomplete database of the S. marcescens genome. This gene was amplified using PCR and cloned in the pUC18 vector to yield pUCHF. Sequencing of the S. marcescens tolC-like hasF gene and subsequent amino acid sequence prediction revealed approximately 80% amino acid homology with the Escherichia coli TolC. A tolC-deficient strain of E. coli (BL923) containing pUCHF/hasF was analyzed for susceptibility to fluoroquinolones (ciprofloxacin, norfloxacin, and ofloxacin), chloramphenicol, sodium dodecyl sulfate (SDS), and ethidium bromide. Antibiotic susceptibility assays of the E. coli tolC-deficient mutant BL923 demonstrated a 64-fold increase in resistance to SDS and ethidium bromide upon introduction of the S. marcescens tolC-like hasF gene. No change was observed for susceptibility to fluoroquinolones and chloramphenicol. Ethidium bromide accumulation assays performed using E. coli BL923:pUCHF established the role of the S. marcescens hasF gene product in proton gradient-dependent efflux.
Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.
Hutsul, J A; Worobec, E
1994-02-01
An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.
Mechanisms of Polymer Curing and Thermal Degradation
1979-12-01
respectively. 29 0)- Fi . J . IR S e t u f i ( - 3 E hy y p e o y Ph n l S f n .30 z Iii 41 rI2P6i4000 3500 3000 42500 §200010 6010 2010 0 0 0 0...Polymer X Obs.6(_pm) Obs.(ppmA H 7.9,8.0 g,h 7.8 g,h 7.5 I ,e 7.5 i ,c,2 7.3 b,e 6.0-7.2 b,d,f,j,=CH 7.2 d 7.0 f,j 3.1 a HC C =- T O" 7.9 g 7.9 g 7.3 b...e 7.4 b,e 7.1 d 6.0-7.1 c,d,f,=CH 7.0 f,c 3.1 a 3.1 a aFor X 0 H, ggh, f= i b Based on first-order analysis of multiplets. 37 t TABLE 4. SUMMARY OF 13C
A Genetic Interaction Screen for Breast Cancer Progression Driver Genes
2014-08-01
M D A -M B -2 3 1 M D A -M B -4 3 6 N o rm a l p r im a ry B re a s t C e lls P r im a ry T N B C KEY RESEARCH ACCOMPLISHMENTS: • Screening PB...GRANT NUMBER W81XWH-12-1-0082 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER Tian Xu, PhD 5d. PROJECT NUMBER 5e. TASK NUMBER E-Mail...tian.xu@yale.edu 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER Yale
Ebrahim, Hassan Y; Mohyeldin, Mohamed M; Hailat, Mohammad M; El Sayed, Khalid A
2016-11-15
(1S,2E,4S,6R,7E,11E)-2,7,11-Cembratriene-4,6-diol (1) and its 4-epi-analog (2) are the cembranoid precursors to several key flavor ingredients in most Nicotiana (tobacco) species. Nearly 40-60% of 1 and 2 are purposely degraded during the commercial tobacco fermentation. However, 1 and 2 display promising bioactivities, including anticancer. Breast cancer is the most diagnosed cancer in women and ranked second female disease killer. The receptor tyrosine kinase c-Met correlates with aggressiveness of certain breast cancer phenotypes and thus considered a valid therapeutic target. This study reports the discovery and optimization of the tobacco-based cembranoid 1 as a novel c-Met inhibitory scaffold using combined structure- and ligand-based approaches. 1 displayed antiproliferative, anti-migratory and anti-invasive effects against the c-Met overexpressing MDA-MB-231 breast cancer cells at moderate μM concentrations. The Z'-LYTE kinase platform and Western blot analysis identified c-Met as a potential macromolecular target. Rationally designed carbamate analogs were proposed to probe additional targeted c-Met interactions and improve the cellular potency. The 6-phenyl carbamate 3 showed enhanced c-Met inhibitory activity. Structure-activity relationships of different substituents on the 3's phenyl moiety were studied. The most active analog 20 showed potent in vitro anticancer activity against the MDA-MB-231 breast cancer cells at low μM concentrations, with minimal toxicity on the non-tumorigenic MCF-10A mammary epithelial cells. Cembranoid 20 potently inhibited the c-Met catalytic activity in Z'-LYTE kinase assay and various cellular c-Met-driven signaling pathways. Furthermore, 20 displayed a robust antitumor activity in a breast cancer xenograft athymic mouse model and thus promoted to the lead rank. Cembranoids are novel c-Met inhibitors appropriate for future use to control c-Met dependent malignancies. Copyright © 2016 Elsevier Ltd. All rights reserved.
1982-09-01
of pervious sand and gravel overlying impervious clay till in the botton with the exception at the toe of the left abutment where there are 25 feet...34 or t~ POS C."Dnsymi.p Vst. .0 aft cofl*US. c oils Ip ~ c le O lot / 0 0 0’ U S ARMY .ION MOTION Tam alaimon 1300 r?5 *CMe Om ,.,6E.o.M-06 0 EVe.**a...joml 3S9ipt ? Noo ,m.S -W00 re -$Sopgf . .? m*.t c .0271s C -0 pm,~ -TO4pet fr osum I1 Slo aW ow)e ofoos o ft ws -om aUw"M - 5:C: 1W * .0601.0 "#O ,W
Use of Two-Way Time Transfer Measurements to Improve Geostationary Satellite Navigation
2007-03-01
lo ck E rro r ( m et er s...clock measurement blackouts. 2 4 6 8 10 12 14 16 18 20 22 -100 -50 0 50 100 GEO Clock Bias Error Time (hours) C lo ck E rro r ( m et er s...20 GEO Clock Bias Error Time (hours) C lo ck E rro r ( m et er s) Filter-Computed Covariance 0 5 10 15 20 -20 -15 -10 -5 0 5 10 15 20 GEO
Blocking of Person Information in Small Social Groupings: The Information of Person Categories.
1983-12-20
Anderson, R . C ., & Watts, G. H. Bidirectional associations in multi-trial free recall. Psychonomic Science, 1969, 15, 288-9. Asch, S. E . Forming...categories Technical Report s. PERFORMING ORG. REPORT NUMBER _RF 762498/713444 7. AUTHOR( e ) S. CONTRACT ON GRANT NUMER(.) C . D. McCann, T.M. Ostrom, M.L...the structure of person impressions unless it has been cognitively organized along with the [ ’ e ~v’-’ ,,’ ’ ’ ¢J . J,’,,’ ’ ? : _ 7, ’ r
Identifying and Managing Environmental Health Threats in the AOR
2011-01-24
Considered over 150 ICD-9s, including respiratory/cardiovascular disease, sleep apnea , rheumatoid arthritis, lupus, birth defects 2011 MHS Conference 16...Soil S a m p l e s C o l l e c t e d Type of Media 2003 2004 2005 2006 2007 2008 2009 2010 2011 MHS Conference 5 5 Death, incapacitating, or...longitudinal exposure records in the new Electronic Health Record – ICD 9 CODES 800-899 Injury and Poisoning • 980-989 Toxic Effects Of Substances
La Marca, Valeria; Spagnuolo, Maria Stefania; Cigliano, Luisa; Marasco, Daniela; Abrescia, Paolo
2014-07-01
Cholesterol is mostly removed from the CNS by its conversion to cerebrosterol (24(S)-hydroxycholesterol, 24(S)OH-C), which is transported to the circulation for bile formation in liver. A neurotoxic role of this oxysterol was previously demonstrated in cell culture. Here, we provide evidence that the enzyme lecithin-cholesterol acyltransferase, long known to esterify cholesterol, also produces monoesters of 24(S)OH-C. Proteoliposomes containing apolipoprotein A-I or apolipoprotein E were used to stimulate the enzyme activity and entrap the formed esters. Proteoliposomes with apolipoprotein A-I were found to be more active than those with apolipoprotein E in stimulating the production of oxysteryl esters. Cholesterol and 24(S)OH-C were found to compete for enzyme activity. High levels of haptoglobin, as those circulating during the acute inflammatory phase, inhibited 24(S)OH-C esterification. When highly neurotoxic 24(S)OH-C was treated with enzyme and proteoliposomes before incubation with differentiated SH-SY5Y cells, the neuron survival improved. The esters of 24(S)OH-C, embedded into proteoliposomes by the enzyme and isolated from unesterified 24(S)OH-C by gel filtration chromatography, did not enter the neurons in culture. These results suggest that the enzyme, in the presence of the apolipoproteins, converts 24(S)OH-C into esters restricted to the extracellular environment, thus preventing or limiting oxysterol-induced neurotoxic injuries to neurons in culture. 24-hydroxycholesterol (24(S)OH-C) is neurotoxic. The enzyme lecithin-cholesterol acyltransferase (LCAT) synthesizes monoesters of 24(S)OH-C in reaction mixtures with proteoliposomes containing phospholipids and apolipoprotein A-I or apolipoprotein E. The esters, also produced by incubation of cerebrospinal fluid only with tritiated 24(S)OH-C, are embedded into lipoproteins that do not enter neurons in culture. The enzyme activity limits the toxicity of 24-hydroxycholesterol in neuron culture. © 2014 International Society for Neurochemistry.
Toward a Global 1/25 deg HYCOM Ocean Prediction System with Tides
2011-09-30
Wallcraft, C. Lozano, H. L.Tolman, A. Srinivasan, S. Hankin, P. Cornillon, R. Weisberg, A. Barth, R. He, C. Werner, and J. Wilkin , 2009. U.S. GODAE...United States. Climate Dynamics, doi:10.1007/s00382-010-0988-7. Xu, X., W.J. Schmitz Jr., H.E. Hurlburt, P.J. Hogan , and E.P. Chassignet, 2010. Transport
Code of Federal Regulations, 2012 CFR
2012-01-01
...)(E)(I); 212.83(c)(2)(iii)(E)(II); 212.83(c)(2)(iii); “Fi t”; 212.83(i); 212.93(a); 212.93(b)(4)(iii... Amarillo, TX. Midway Oil Co Rock Island, IL. Midwest Industrial Fuels, Inc La Crosse, WI. Mississippi River..., TX. U.S. Compressed Gas Company King of Prussia, PA. U.S. Oil Company Combined Locks, WI. U.S.A...
Code of Federal Regulations, 2013 CFR
2013-01-01
...)(E)(I); 212.83(c)(2)(iii)(E)(II); 212.83(c)(2)(iii); “Fi t”; 212.83(i); 212.93(a); 212.93(b)(4)(iii... Amarillo, TX. Midway Oil Co Rock Island, IL. Midwest Industrial Fuels, Inc La Crosse, WI. Mississippi River..., TX. U.S. Compressed Gas Company King of Prussia, PA. U.S. Oil Company Combined Locks, WI. U.S.A...
Code of Federal Regulations, 2011 CFR
2011-01-01
...)(E)(I); 212.83(c)(2)(iii)(E)(II); 212.83(c)(2)(iii); “Fi t”; 212.83(i); 212.93(a); 212.93(b)(4)(iii... Amarillo, TX. Midway Oil Co Rock Island, IL. Midwest Industrial Fuels, Inc La Crosse, WI. Mississippi River..., TX. U.S. Compressed Gas Company King of Prussia, PA. U.S. Oil Company Combined Locks, WI. U.S.A...
Code of Federal Regulations, 2010 CFR
2010-01-01
...)(E)(I); 212.83(c)(2)(iii)(E)(II); 212.83(c)(2)(iii); “Fi t”; 212.83(i); 212.93(a); 212.93(b)(4)(iii... Amarillo, TX. Midway Oil Co Rock Island, IL. Midwest Industrial Fuels, Inc La Crosse, WI. Mississippi River..., TX. U.S. Compressed Gas Company King of Prussia, PA. U.S. Oil Company Combined Locks, WI. U.S.A...
Code of Federal Regulations, 2014 CFR
2014-01-01
...)(E)(I); 212.83(c)(2)(iii)(E)(II); 212.83(c)(2)(iii); “Fi t”; 212.83(i); 212.93(a); 212.93(b)(4)(iii... Amarillo, TX. Midway Oil Co Rock Island, IL. Midwest Industrial Fuels, Inc La Crosse, WI. Mississippi River..., TX. U.S. Compressed Gas Company King of Prussia, PA. U.S. Oil Company Combined Locks, WI. U.S.A...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-23
... Religious Freedom Act (42 U.S.C. 1996); Farmland Protection Policy Act (7 U.S.C. 4201-4209); the Uniform... Indian Sacred Sites; E.O. 13287 Preserve America; E.O. 13175 Consultation and Coordination with Indian...
Surface Currents. East Central Indian Ocean Including the East Indian Archipelago (Indonesia)
1977-08-01
AKAX EXPLORATION INC. FOREIGN HYDROGRAPHER/R, A. N. DEPT. TRANSPORTATIO&AUSTRLIA RKAD hi TRUC"TONSREPORT DOCUMENTATION PAGE aRo E COMPLITMG PORN 20...thirties... DO Io+.u 1473 boI o O ovc ois LCZ S/4 1 32-a 0145 01 S C UR IT Y CL A SSIFIC AT IO N O f H IS P AG E (34.44 4 8 0 0R C S A OSE[CURIlTY cLAS
1984-05-31
MARK %C-, S UNCLASSIFIED 2o SEC. - l R Y C.-ASSF.CAT’ION...1971). 31. C. S . Lakshminarasimha and J. Lucas, J. Phys D 10,313 (1977). 32. R. W. Crompton, L. G. H. Huxley and D. J. Sutton , Proc. R. Soc. London...APR EDITION OF I.AN 73 S OBSOLE’E SECURITY CLASSIFICATION I1F THIS PAI,E %.. % %% " -6 % * U ,4 % 4 SECURITY CLASSIFICATION OF THIS PAGE 11.
Foundations of Isomer Physics for Energy Applications
2008-10-16
demon.eo.iik/ fitzpcak.htm), 2005 TV, Institute of Nuclear Physics, University of Cologne. Germany. www.ikp.uni-koeln.de/~ fitz /. 2003 Efficiency...14] Boston. D. T. Joss, E. S. Paul , A. T. Semple, N. J. O’Brien, C. M. Parry, A. V. Afanasjev, and I. Ragnarsson, Phys. Rev. C 60,024307(1999). [15...19] and M. Ishii, Z. Phys. A 347. 41 (1993). A. J. Boston. E. S. Paul , C. J. Chiara, M. Devlin. D. B. Fossan. S. J. Freeman. D. R. LaFosse
Indigenous Police Forces in Counterinsurgency
2010-05-27
A ppr oved for Public R elease; Distr ibution is Unlimited Indigenous P olice F orces in C ounterins urgenc y A Monograph by Major Timothy...Std. Z39.18 iv S C HOOL OF ADV ANC E D MIL IT AR Y S T UDIE S MONOG R AP H AP P R OV AL Major Timothy R. Mungie Title of Monograph...research. T he Organization of Indigenous P olic e in C ounterins urgenc y Operations To explore what makes for indigenous police
Research on Fire-Resistant Diesel Fuel Flammability Mitigation Mechanisms
1982-12-01
Naegeli U.S. Army Fuels and Lubricants Research Laboratory Southwest Research Institute San Antonio, Texas Under Contract to U.S. Army Mobility Equipment...David Naegeli DAAK70-80-C-0001 DAAK70-82-C-0001 9. PERFORMING ORGANIZATION NAME AND ADDRESSES 10. PROGRAM ELEMENT, PROJECT. TASK U.S. Army Fuels and...water-containing diesel fuel blends. 43 VI. LIST OF REFERENCES 1. Weatherford, W.D., Jr., Fodor, G.E., Naegeli , D.W., Wright, B.R., Owens, E.C., and
Code of Federal Regulations, 2010 CFR
2010-07-01
...) National Security Agency/Central Security Service records, unless the records are exempt according to 50 U.S.C. 402. (c) Defense Intelligence Agency, National Reconnaissance Office, and National Geospatial-Intelligence Agency records, unless the records are exempt according to 50 U.S.C. 403-5e, 10 U.S.C. 424 and 455...
Heat Transfer and Thermal Stability of Alternative Aircraft Fuels. Volume 2. Appendices.
1983-11-01
eoea a aS mOOaeO 0OO eoO eoo oee I:pp ’D ed.V 5 0-4 * ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ OC Cd Fr .04F-V4,FFq.CdSIF0ddF-0-.VW4 o0 F- 01 w* .40 v A4F -C 4...oo a oft oees 0 e s sD1 .ees,, a r . .4.%44Zci.4 por.. 0 -~~~C vi 9 1oN,.ee~ * 0 0 a 0a a g 0l as e Cc,. a aa C. Ca 0 C, 0 c,0 c 00 0 011a 00 I 0 .0
MRAPs, Irregular Warfare, and Pentagon Reform
2009-06-01
U P R E S S S TA F F COLONEL DAVID H. GURNEY, USMC (RET.) Director DR. JEFFREY D. SMOTHERMAN Executive Editor GEORGE C. MAERZ Supervisory Editor...LISA M. YAMBRICK Writer-Editor CALVIN B. KELLEY Writer-Editor MARTIN J. PETERS Production Supervisor TARA J. PAREKH Visual Design Editor O T H E R T I T ...L E S I N T H E S E R I E S Choosing War: The Decision to Invade Iraq and Its Aftermath Occasional Paper 5, April 2008 China’s Global Activism
Thweatt, Jennifer L; Ferlez, Bryan H; Golbeck, John H; Bryant, Donald A
2017-01-27
Green bacteria are chlorophotorophs that synthesize bacteriochlorophyll (BChl) c, d, or e, which assemble into supramolecular, nanotubular structures in large light-harvesting structures called chlorosomes. The biosynthetic pathways of these chlorophylls are known except for one reaction. Null mutants of bciD, which encodes a putative radical S-adenosyl-l-methionine (SAM) protein, are unable to synthesize BChl e but accumulate BChl c; however, it is unknown whether BciD is sufficient to convert BChl c (or its precursor, bacteriochlorophyllide (BChlide) c) into BChl e (or BChlide e). To determine the function of BciD, we expressed the bciD gene of Chlorobaculum limnaeum strain DSMZ 1677 T in Escherichia coli and purified the enzyme under anoxic conditions. Electron paramagnetic resonance spectroscopy of BciD indicated that it contains a single [4Fe-4S] cluster. In assays containing SAM, BChlide c or d, and sodium dithionite, BciD catalyzed the conversion of SAM into 5'-deoxyadenosine and BChlide c or d into BChlide e or f, respectively. Our analyses also identified intermediates that are proposed to be 7 1 -OH-BChlide c and d Thus, BciD is a radical SAM enzyme that converts the methyl group of BChlide c or d into the formyl group of BChlide e or f This probably occurs by a mechanism involving consecutive hydroxylation reactions of the C-7 methyl group to form a geminal diol intermediate, which spontaneously dehydrates to produce the final products, BChlide e or BChlide f The demonstration that BciD is sufficient to catalyze the conversion of BChlide c into BChlide e completes the biosynthetic pathways for all "Chlorobium chlorophylls." © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Magnetogenesis and magnetothermal equilibria in turbulent galaxy-cluster plasmas
NASA Astrophysics Data System (ADS)
Schekochihin, Alexander
2011-04-01
We do not know the exact mechanism of magnetic field generation in magnetised weakly collisional (or collisionless) turbulent plasma. We do know that large-scale MHD motions in such plasmas are subject to fast small-scale kinetic instabilities (mirror and firehose) triggered (at high beta) by pressure anisotropies and that these anisotropies will always arise in a turbulent plasma. Therefore, standard MHD equations cannot be used to describe the turbulent dynamo. I will argue that the likely scenario in such plasmas is explosively fast growth of magnetic fluctuations to dynamical levels. I will further argue that if an efficient turbulent dynamo is assumed, radiative cooling in such plasmas can be balanced in a thermally stable way by turbulent heating, whose rate is set by the condition that plasma locally remains in a marginal state with respect to the mirror and firehose instabilities. This thermal stability suggests that a cooling catastrophe is not inevitable, although whether this old problem is thus resolved depends on whether a number of assumptions about the nonlinear behaviour of the instabilities, strength of turbulence and efficiency of the dynamo are borne out by first- principles microphysical theory, simulations or plasma experiments.References:A. A. Schekochihin, M. Brueggen, L. Feretti, M. W. Kunz, and L. Rudnick, Space Sci. Rev., in preparation (2011)M. W. Kunz, A. A. Schekochihin, S. C. Cowley, J. J. Binney, and J. S. Sanders, Mon. Not. R. Astron. Soc., in press (2011) [e-print arXiv:1003.2719]M. S. Rosin, A. A. Schekochihin, F. Rincon, and S. C. Cowley, Mon. Not. R. Astron. Soc., in press (2011) [e-print arXiv:1002.4017]A. A. Schekochihin, S. C. Cowley, F. Rincon, and M. S. Rosin, Mon. Not. R. Astron. Soc. 405, 291 (2010) [e-print arXiv:0912.1359]A. A. Schekochihin, S. C. Cowley, R. M. Kulsrud, M. S. Rosin, and T. Heinemann, Phys. Rev. Lett. 100, 081301 (2008) [e-print arXiv:0709.3828]A. A. Schekochihin and S. C. Cowley, Phys. Plasmas 13, 056501 (2006) [e-print astro-ph/0601246]A. A. Schekochihin, S. C. Cowley, R. M. Kulsrud, G. W. Hammett, and P. Sharma, Astrophys. J. 629, 139 (2005) [e-print astro-ph/0501362
Lieb, Veronika M; Kerfers, Margarete R; Kronmüller, Amrei; Esquivel, Patricia; Alvarado, Amancio; Jiménez, Víctor M; Schmarr, Hans-Georg; Carle, Reinhold; Schweiggert, Ralf M; Steingass, Christof B
2017-05-10
Morphological traits, total lipid contents, and fatty acid profiles were assessed in fruits of several accessions of Elaeis oleifera [Kunth] Cortés, Elaeis guineensis Jacq., and their interspecific hybrids. The latter featured the highest mesocarp-to-fruit ratios (77.9-78.2%). The total lipid contents of both E. guineensis mesocarp and kernel were significantly higher than for E. oleifera accessions. Main fatty acids comprised C16:0, C18:1n9, and C18:2n6 in mesocarp and C12:0, C14:0, and C18:1n9 in kernels. E. oleifera samples were characterized by higher proportions of unsaturated long-chain fatty acids. Saturated medium-chain fatty acids supported the clustering of E. guineensis kernels in multivariate statistics. Hybrid mesocarp lipids had an intermediate fatty acid composition, whereas their kernel lipids resembled those of E. oleifera genotypes. Principal component analysis based on lipid contents and proportions of individual fatty acids permitted clear-cut distinction of E. oleifera, E. guineensis, and their hybrids.
2013-06-01
neurodevelopmental disorders 3(2): 132-143. Buyske, S., T. A. Williams, A. E. Mars, E. S. Stenroos, S. X. Ming, R. Wang, M. Sreenath, M. F. Factura , C. Reddy, G. H...Gastroenterol Nutr. Williams, T. A., A. E. Mars, S. G. Buyske, E. S. Stenroos, R. Wang, M. F. Factura -Santiago, G. H. Lambert and W. G. Johnson (2007
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Ziyu; Hooker, Brian S.; Anderson, Daniel B.
Optimization of Acidothermus cellulolyticus endoglucanase (E1) gene expression in transgenic potato (Solanum tuberosum L.) was examined in this study, where the E1 coding sequence was transcribed under control of a leaf specific promoter (tomato RbcS-3C) or the Mac promoter (a hybrid promoter of mannopine synthase promoter and cauliflower mosaic virus 35S promoter enhancer region). Average E1 activity in leaf extracts of potato transformants, in which E1 protein was targeted by a chloroplast signal peptide and an apoplast signal peptide were much higher than those by an E1 native signal peptide and a vacuole signal peptide. E1 protein accumulated up tomore » 2.6% of total leaf soluble protein, where E1 gene was under control of the RbcS-3C promoter, alfalfa mosaic virus 5-untranslated leader, and RbcS-2A signal peptide. E1 protein production, based on average E1 activity and E1 protein accumulation in leaf extracts, is higher in potato than those measured previously in transgenic tobacco bearing the same transgene constructs. Comparisons of E1 activity, protein accumulation, and relative mRNA levels showed that E1 expression under control of tomato RbcS-3C promoter was specifically localized in leaf tissues, while E1 gene was expressed in both leaf and tuber tissues under control of Mac promoter. This suggests dual-crop applications in which potato vines serve as enzyme production `bioreactors' while tubers are preserved for culinary applications.« less
Kumsiri, Ratchanok; Troye-Blomberg, Marita; Pattanapanyasat, Kovit; Krudsood, Srivicha; Maneerat, Yaowapa
2016-02-01
Previous studies have suggested that Plasmodium falciparum (P. falciparum) specific IgE in the form of immune complexes crosslinking the low-affinity receptor (CD23) on monocyte results in tumor necrosis factor (TNF)-α and nitric oxide (NO) production. However, the roles of these parameters in severity and immune protection are still unclear. This study aimed to determine the association between CD23 expression on monocytes, plasma soluble CD23 (sCD23), total IgE, malaria-specific IgE and IgG, and TNF-α levels in P. falciparum infected patients. We evaluated 64 uncomplicated (UC) and 25 severe patients (S), admitted at the Hospital for Tropical Diseases, Mahidol University, and 34 healthy controls (C) enrolled in 2001. Flow cytometry and enzyme linked immunosorbent assays (ELISA) demonstrated that trends of the CD23 expression, levels of sCD23 and specific IgE were higher in the S group as compared to those in the UC and C groups. Plasma levels of P. falciparum specific IgE in the UC (p=0.011) and S groups (p=0.025) were significantly higher than those in C group. In contrast the TNF-α levels tended to be higher in the UC than those in the S (p=0.343) and significantly higher than those in C (p=0.004) groups. The specific IgG levels in UC were significantly higher than those in S and C (p<0.001) groups. At admission, a strong significant negative correlation was found between specific IgG and sCD23 (r=-0.762, p=0.028), and TNF-α and IgE-IgG complexes (r=-0.715, p=0.002). Significant positive correlations between levels of specific IgE and TNF-α (r=0.575, p=0.010); and sCD23 (r=0.597, p=0.000) were also observed. In conclusion, our data suggest that CD23 expression and malaria-specific IgE levels may be involved in the severity of the disease while TNF-α and the malaria-specific IgG may correlate with protection against falciparum malaria. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Crystal structure of N-deacetyllappaconitine
Shi, Xin-Wei; Lu, Qiang-Qiang; Zhou, Jun-Hui; Cui, Xin-Ai
2015-01-01
The title compound, C30H42N2O7 [systematic name: (1S,4S,5S,7S,8S,9S,10S,11S,13R,14S,16S,17R)-20-ethyl-4,8,9-trihydroxy-1,14,16-trimethoxyaconitan-4-yl 2-aminobenzoate], isolated from roots of Aconitum sinomontanum Nakai, is a typical aconitane-type C19-diterpenoid alkaloid, which crystallizes with two independent molecules in the asymmetric unit. The conformations of the two independent molecules are closely similar. Each molecule comprises four six-membered rings (A, B, D and E) including one six-membered N-containing heterocyclic ring (E), and two five-membered rings (C and F). Rings A, B and E adopt chair conformations, while ring D displays a boat conformation. Five-membered rings C and F exhibit envelope conformations. IntramolecularN—H⋯O hydrogen bonds between the amino group and carbonyl O atom help to stabilize molecular structure. In the crystal, O—H⋯O hydrogen bonds link the molecules into zigzag chains propagating in [010]. PMID:26396805
Code of Federal Regulations, 2010 CFR
2010-04-01
... tribal laws or custom; (e) Contracts or agreements that do not convey exclusive or nearly exclusive... Indian Gaming Commission under the Indian Gaming Regulatory Act, 25 U.S.C. 2701 et seq., and the...) FERC has made the finding under section 4(e) of the FPA (16 U.S.C. 797(e)) that the license or...
Environmental Aspects of Aircraft and Airfield Deicing - An Air Force Perspective
2010-11-01
e l l e n c e COD of Aircraft Deicers ADF Kg O2/Kg compd Ethylene glycol 1.14 T Propylene glycol 1.47 T Isopropyl alcohol 2.11 T Neopentyl glycol ...showed that commercial airports use about 25 million gallons of Aircraft Deicing Fluid (ADF) annually, of which 22.1 M (88%) is Propylene Glycol (PG...S e r v i c e - E x c e l l e n c e AF Aircraft Deicing Overview 70% (107) of bases reported using aircraft deicers Propylene Glycol (PG), AMS 1424
Gamma Imaging using Rotational Modulation Collimation
2014-01-01
c © Commonwealth of...in Table A1. 4 UNCLASSIFIED UNCLASSIFIED DSTO–TR–2946 0 50 100 150 200 250 300 350 0 20 40 60 80 100 120 140 160 C O U N T S...P E R S E C O N D MASK ROTATION ANGLE (DEGREES) Co-60 shielded by lead 44 mm Cs-137 in storage container (lead 59 mm) Figure 3.2: RMC
Understanding and Targeting Cell Growth Networks in Breast Cancer
2013-04-01
Threonine 198...Winkeler C.L., Toso E.A., Gwinn A.S., Pelletier C.L. and Weber J.D. (2009). Threonine ...Toso E.A., Gwinn A.S., Pelletier C.L. and Weber J.D. (2009). Threonine
The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis
Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert
2015-01-01
During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414
Frequency Comb Spectroscopy - From IR to XUV
2015-06-09
time resolution of 25 s. Publications: [1] A. Cingöz, Yost, D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J...J. , Eikema, K. S. E. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Full phase stabilization of a Yb:fiber femtosecond frequency comb via high...D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Direct frequency comb spectroscopy in the extreme ultraviolet”, Nature
Personality and Politics: The Untold Story of Robert S. McNamara and Curtis E. Lemay
2012-06-01
James H. Douglas, Jr . F.F. Everest William C. Garland Harry E. Goldsworthy Brian S. Gunderson Ernest C. Hardin, Jr . Michael J. Ingelido Leon W...Schriever Alton D. Slay Frederick H. Smith F.H. Smith, Jr . Guyford H. Steven Maxwell D. Taylor John W. Vogt Adriel N. Williams E.M. Zuckert...of Oahu, Hawaii. 22 Curtis E. LeMay Oral History Interview conducted by Edgar F. Puryear, Jr . 17
29 CFR 2584.8477(e)-6 - Definitions.
Code of Federal Regulations, 2011 CFR
2011-07-01
...; (c) Common Stock Index Investment Fund means the fund established under 5 U.S.C. 8438(b)(1)(C); (d... Savings Fund; (f) Fixed Income Investment Fund means the fund established under 5 U.S.C. 8438(b)(1)(B); (g) Government Securities Investment Fund means the fund established under 5 U.S.C. 8438(b)(1)(A); (h...
29 CFR 2584.8477(e)-6 - Definitions.
Code of Federal Regulations, 2010 CFR
2010-07-01
...; (c) Common Stock Index Investment Fund means the fund established under 5 U.S.C. 8438(b)(1)(C); (d... Savings Fund; (f) Fixed Income Investment Fund means the fund established under 5 U.S.C. 8438(b)(1)(B); (g) Government Securities Investment Fund means the fund established under 5 U.S.C. 8438(b)(1)(A); (h...
Modeling Sorption and Degradation of 17β-Estradiol-17-Sulfate in Agricultural Soils
NASA Astrophysics Data System (ADS)
Bai, X.; Casey, F. X.; Hakk, H.; Shrestha, S. L.; DeSutter, T.; Khan, E.; Oduor, P. G.
2011-12-01
The natural steroid hormone, 17β-estradiol (E2), can be an endocrine disruptor at part-per trillion levels. Laboratory studies indicate a low potential for E2 persistence and mobility in the environment; however, field studies consistently indicate the presence of E2 and its primary metabolite, estrone, at levels sufficiently high to impact water quality. To facilitate urine excretion, animals may release E2 as a sulfated conjugate, which would have a higher aqueous solubility than the parent compound. We hypothesize that E2 conjugates contribute to the detection of free estrogens in the environment. The objective of this study was to determine the sorption, degradation, and mobility of a model conjugate, 17β-estradiol-17-sulfate (E2-17S), in agricultural soils. Radiolabeled E2-17S ([14C]E2-17S) was chemically synthesized in a three-step process, and then batch experiments were conducted in natural and sterile soils. Additionally, soil organic carbon (OC) was varied (1.29 and 0.26%) to investigate its effect on the fate of [14C]E2-17S. Liquid scintillation counting (LSC) was used in concert with high performance liquid chromatography (HPLC) to detect and quantitate parent compound and metabolites of E2-17S in the aqueous and bound phases. Residual soil was combusted to determine non-extractable levels of 14C. The E2-17S was relatively stable in the aqueous phase for natural and sterile soils. Mono- and di- hydroxyl E2-17S were detected as metabolites of E2-17S in the aqueous phase above both sterile and natural soil. Deconjugation to form E2 was not observed in aqueous phase; however, E2 and estrone were extracted from both natural and sterile soils. A conceptual model was developed to simulate and identify the fate and transport processes of E2-17S. Organic carbon was found to be an important factor affecting the sorption and degradation of E2-17S in soils.
Word Frequency Analysis MOS: 15E. Skill Levels 1 and 2.
1982-05-01
AR 34 ARE I I AREA1 L 5 15 ARM 1 .: A’FNT 3 AROL D 25 AS 12 ASSEI 3LE 12 ASSEPALED11 iES b8 ASSEMBLY 4 ASSISTA CE27 ASSISTANT13 1’A T . SSISTED 29 ...CABLE31 CA3Lr.P 2, C.ABLES . . 1 L.BLI"IG I CAM C>; 4 CA’"UT 2 CANvA S 29 CAP2 CYPSCRE ,S 4 CAPTIVE A , L I AR o,7 CAREFiULLY .... CARRY IG 2 LA.TELL 1...1 (l. 5 1 jS I E (f r I FR I 5 IP E V PEET ~ (F I 4 3 E X P N A WL S q 6 XPL11S VE E EXPIUSIVS I z~ SE 17 *.!GU I 5 EXTE nrEC 3 WI’S1. lltj 3 29 ~Il
1987-04-30
El C4E)0 0W:C 1 (D ~ ~ ~ ~ ~ IN C D mMc/i 44- c C-4 v- en q 44 C; 4 n 0- z ! -L Ch4, mO M 0 0 0 m 0o 0o x IN >zW 4 4 . U L 4U 0 UL...wTwA~ Fl Fu~~wjr wjilwvK~l.Wvv 0l 000 Ll.I 0 0 4- LL 4- &n G) CL&.I 0 a C4 -j N 0A- 4- La - E 0. 0 S- If 0 0 C LO EF *( . S Eu IL EEuS-t S-to) en ...002.5W 5 /8 1 .0 C=1000 0.8 C=300 ~0.6 C-) 00 0 00030405 VETCL EOIY)msc La .. N378 1 1 1115(f i 0.2 I11 Su INTERSTITIAL SMOKE (g/cm**3) 60 min 7 6 5 EN
Munitions Operations AFSC 465X0
1991-03-01
ul MIO 4P ~ d r V-LO 4 & #A M-.0 > > 090 L 00M- 41C 40up0$. C- VI cE 10.0 41 S S E- 5- 3, CL0. #A 4 $- L to L 4 0 0 V0 0 004-)0U 4 V> L . L 5CL.U C...AFSC may be somewhat outdated even asthis OSR is printed. Great caution should be used in applying the computer-oriented tasks to career field
Frederick National Lab Aids Liberian Hospitals Through Project C.U.R.E. | FNLCR Staging
When Project C.U.R.E.'s much-needed medical supplies and equipment arrive in Liberia, the Frederick National Lab’s Kathryn Kynvin is there to receive and distribute the donations to hospitals who continue to treat survivors of the most recent Ebola
Federal Register 2010, 2011, 2012, 2013, 2014
2011-03-28
... section 515(d)(4) and (e)(2) of the Federal Food, Drug, and Cosmetic Act (the FD&C Act) (21 U.S.C. 360e(d......... Dako Denmark A/S..... HercepTest kit Approved October 20, 2010. P080009 Ethicon Endo-Surgery, SEDASYS...
Microcircuit Device Reliability Digital Detailed Data
1976-01-01
TYPE s No. FUNCTION A LASS PINS TEMP. TYPE CLASS LEVEL I eFAILED 8 NO. CHIP TEST APPL. TEST PAR1 t T AGATES PROTECT. DATE E:V. D TYPE HOURST :708 FLIP...LEVEL # EFAILED s a NO. t CHIP i TEST 3 APPL. a TEST I PAR! 3 a GATES s PROTECT. a DATE 3 ENV. t TYPE I 3 -OUHb s 354H0( 3 GATE C-I CDIP 14 150C :11.A
NASA Astrophysics Data System (ADS)
Eroglu, Ela; Haniff Wahid, M.; Boulos, Ramiz A.; Chen, Xianjue; Eggers, Paul K.; Toster, Jeremiah; D'Alonzo, Nicholas J.; Smith, Steven M.; Raston, Colin L.
2014-05-01
Within our research group, various types of nanofabrication processes have been applied for creating novel nanohybrid materials, including the immobilization of some microorganisms with electrospun nanofibres1, laminar nanomaterials (i.e. graphene and graphene oxide)2,3, microfibers of human hair4, and magnetic nanoparticles impregnated in polymer5. These approaches afford nanohybrid materials with microalgal cells1-5 or diatom frustules6 for the removal of waste pollutants, mainly nitrate and phosphate ions, while establishing a new paradigm in the field. Aside from these immobilization studies, we also investigated the improvement of nitrate removal with exfoliated graphene sheets in the presence of p-phosphonic acid calix[8]arene molecules.7 Various material characterization techniques such as scanning electron microscopy, transmission electron microscopy, atomic force microscopy, and Raman spectroscopy were used for the characterization of the novel nanohybrid materials, while fluorescence microscopy and chlorophyll content analysis were mainly used for monitoring the viability and growth pattern of the microalgal cells. Nitrate and phosphate analyses were carried out by following HACH® standard methods. In this talk, a brief overview of the fabrication processes of these nanohybrid materials and their application for wastewater treatment will be highlighted. 1. E. Eroglu, V. Agarwal, M. Bradshaw, X. Chen, S.M. Smith, C.L. Raston and K.S. Iyer, Green Chemistry, 2012, 14(10), 2682 - 2685. 2. M.H. Wahid, E. Eroglu, X. Chen, S.M. Smith and C.L. Raston, Green Chemistry, 2013, 15(3), 650-655. 3. M.H. Wahid, E. Eroglu, X. Chen, S.M. Smith and C.L. Raston, RSC Advances, 2013, 3(22), 8180-8183. 4. R.A. Boulos, E. Eroglu, X. Chen, A. Scaffidi, J. Toster, B. Edwards and C.L. Raston, Green Chemistry, 2013, 15(5), 1268-1273. 5. E. Eroglu, N.J. D'Alonzo, S.M. Smith and C.L. Raston, Nanoscale, 2013, 5(7), 2627-2631. 6. J. Toster, I. Kusumawardani, E. Eroglu, K.S. Iyer, F. Rosei and C.L. Raston, Green Chemistry, 2014, 16(1), 82-85. 7. E. Eroglu, W. Zang, P.K. Eggers, X. Chen, R.A. Boulos, M.H. Wahid, S.M. Smith and C.L. Raston, Chemical Communications, 2013, 49 (74): 8172-8174.
NASA Astrophysics Data System (ADS)
Kaushalya; Patel, S. L.; Purohit, A.; Chander, S.; Dhaka, M. S.
2018-07-01
The conventional CdS window layer in solar cells is found to be hazardous for the environment due to toxic nature of the cadmium. Therefore, in order to seek an alternative, a study on effect of post-annealing treatment on physical properties of e-beam evaporated ZnS thin films has been carried out where films of thickness 150 nm were deposited on glass and indium tin oxide (ITO) substrates. The post annealing treatment was performed in air atmosphere within the temperature range from 100 °C to 500 °C. X-ray diffraction analysis reveals that the films on glass substrate are found to be amorphous at low temperature annealing (≤300 °C) while have α-ZnS hexagonal phase (wurtzite structure) at higher annealing. The patterns also show that the possibility of oxidation is increased significantly at temperature 500 °C which leads to decrease in direct band gap from 3.28 eV to 3.18 eV except films annealed at 300 °C (i.e. 3.39 eV). The maximum transmittance is found about 95% as a result of Doppler blue shift while electrical analysis indicated almost ohmic behavior between current and voltage and surface roughness is increased with post-annealing treatment.
Anything, Anywhere, Any Time: Combat Cargo in the Korean War
2000-01-01
War 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7...Anything, Anywhere, Any Time Combat Cargo in the Korean War William M. Leary A I R F O R C E H I S T O R Y A N D M U S E U M S P R O G R A M 2000... War II had been marked by a series of draconian cuts in the military budget by President Harry S Truman, culminating in a spending cap of $14.3
Kilian, Yvonne; Engel, Florian; Wahl, Patrick; Achtzehn, Silvia; Sperlich, Billy; Mester, Joachim
2016-12-01
The aim of the present study was to compare the effects of high-intensity interval training (HIIT) vs high-volume training (HVT) on salivary stress markers [cortisol (sC), testosterone (sT), alpha-amylase (sAA)], metabolic and cardiorespiratory response in young athletes. Twelve young male cyclists (14 ± 1 years; 57.9 ± 9.4 mL min -1 kg -1 peak oxygen uptake) performed one session of HIIT (4 × 4 min intervals at 90-95 % peak power output separated by 3 min of active rest) and one session of HVT (90 min constant load at 60 % peak power output). The levels of sC, sT, their ratio (sT/sC) and sAA were determined before and 0, 30, 60, 180 min after each intervention. Metabolic and cardiorespiratory stress was characterized by blood lactate, blood pH, respiratory exchange ratio (RER) and heart rate (HR), oxygen uptake ([Formula: see text]), ventilation (V E ) and ventilatory equivalent (V E /[Formula: see text]). sC increased 30 and 60 min after HIIT. However, 180 min post exercise, sC decreased below baseline levels in both conditions. sT increased 0 and 30 min after HIIT and 0 min after HVT. sAA and sT/sC ratio did not change significantly over time in HIIT nor HVT. Metabolic and cardiorespiratory stress, evidenced by blood lactate, HR, [Formula: see text], V E , and V E /[Formula: see text] was higher during HIIT compared to HVT. The metabolic and cardiorespiratory stress during HIIT was higher compared to HVT, but based on salivary analyses (cortisol, testosterone, alpha-amylase), we conclude no strong acute catabolic effects neither by HIIT nor by HVT.
Cleveland Harbor, Ohio. Section 3. Study. Termination Report.
1983-04-01
dot’ t-I p ModC’ 00 b Y^AIefs V S~jx7 4 rI e I2L wt 9?,j 100 y~Ii eea -Ss c sww.../5v- rLI r /. d V 7 c P...pJAf~ 1 ,, Alr~’ Wd4b IS~4 (0s~e A0 (4- . 4", . 1w ",o 6/4 c. ~* h ’.JS 4E. /0, 0,C.4 6-sr-- t9CeA. /11 x to f. C-,. o iv, jt, Is~T~- eea ~r H - tIT...of the clamshell grab were placed in a clean, plastic bucket. After thorough homogenization, approximately one quart of material from each ;ite was
Ablikim, M; Achasov, M N; Ai, X C; Albayrak, O; Albrecht, M; Ambrose, D J; Amoroso, A; An, F F; An, Q; Bai, J Z; Ferroli, R Baldini; Ban, Y; Bennett, D W; Bennett, J V; Bertani, M; Bettoni, D; Bian, J M; Bianchi, F; Boger, E; Boyko, I; Briere, R A; Cai, H; Cai, X; Cakir, O; Calcaterra, A; Cao, G F; Cetin, S A; Chang, J F; Chelkov, G; Chen, G; Chen, H S; Chen, H Y; Chen, J C; Chen, M L; Chen, S Chen; Chen, S J; Chen, X; Chen, X R; Chen, Y B; Cheng, H P; Chu, X K; Cibinetto, G; Dai, H L; Dai, J P; Dbeyssi, A; Dedovich, D; Deng, Z Y; Denig, A; Denysenko, I; Destefanis, M; De Mori, F; Ding, Y; Dong, C; Dong, J; Dong, L Y; Dong, M Y; Du, S X; Duan, P F; Fan, J Z; Fang, J; Fang, S S; Fang, X; Fang, Y; Fava, L; Feldbauer, F; Felici, G; Feng, C Q; Fioravanti, E; Fritsch, M; Fu, C D; Gao, Q; Gao, X L; Gao, X Y; Gao, Y; Gao, Z; Garzia, I; Goetzen, K; Gong, W X; Gradl, W; Greco, M; Gu, M H; Gu, Y T; Guan, Y H; Guo, A Q; Guo, L B; Guo, R P; Guo, Y; Guo, Y P; Haddadi, Z; Hafner, A; Han, S; Hao, X Q; Harris, F A; He, K L; He, X Q; Held, T; Heng, Y K; Hou, Z L; Hu, C; Hu, H M; Hu, J F; Hu, T; Hu, Y; Huang, G M; Huang, G S; Huang, J S; Huang, X T; Huang, Y; Hussain, T; Ji, Q; Ji, Q P; Ji, X B; Ji, X L; Jiang, L W; Jiang, X S; Jiang, X Y; Jiao, J B; Jiao, Z; Jin, D P; Jin, S; Johansson, T; Julin, A; Kalantar-Nayestanaki, N; Kang, X L; Kang, X S; Kavatsyuk, M; Ke, B C; Kiese, P; Kliemt, R; Kloss, B; Kolcu, O B; Kopf, B; Kornicer, M; Kühn, W; Kupsc, A; Lange, J S; Lara, M; Larin, P; Leng, C; Li, C; Li, Cheng; Li, D M; Li, F; Li, F Y; Li, G; Li, H B; Li, H J; Li, J C; Li, Jin; Li, K; Li, K; Li, Lei; Li, P R; Li, T; Li, W D; Li, W G; Li, X L; Li, X M; Li, X N; Li, X Q; Li, Z B; Liang, H; Liang, J J; Liang, Y F; Liang, Y T; Liao, G R; Lin, D X; Liu, B J; Liu, C X; Liu, D; Liu, F H; Liu, Fang; Liu, Feng; Liu, H B; Liu, H H; Liu, H H; Liu, H M; Liu, J; Liu, J B; Liu, J P; Liu, J Y; Liu, K; Liu, K Y; Liu, L D; Liu, P L; Liu, Q; Liu, S B; Liu, X; Liu, Y B; Liu, Z A; Liu, Zhiqing; Loehner, H; Lou, X C; Lu, H J; Lu, J G; Lu, Y; Lu, Y P; Luo, C L; Luo, M X; Luo, T; Luo, X L; Lyu, X R; Ma, F C; Ma, H L; Ma, L L; Ma, M M; Ma, Q M; Ma, T; Ma, X N; Ma, X Y; Maas, F E; Maggiora, M; Mao, Y J; Mao, Z P; Marcello, S; Messchendorp, J G; Min, J; Mitchell, R E; Mo, X H; Mo, Y J; Morales, C Morales; Moriya, K; Muchnoi, N Yu; Muramatsu, H; Nefedov, Y; Nerling, F; Nikolaev, I B; Ning, Z; Nisar, S; Niu, S L; Niu, X Y; Olsen, S L; Ouyang, Q; Pacetti, S; Pan, Y; Patteri, P; Pelizaeus, M; Peng, H P; Peters, K; Pettersson, J; Ping, J L; Ping, R G; Poling, R; Prasad, V; Qi, M; Qian, S; Qiao, C F; Qin, L Q; Qin, N; Qin, X S; Qin, Z H; Qiu, J F; Rashid, K H; Redmer, C F; Ripka, M; Rong, G; Rosner, Ch; Ruan, X D; Sarantsev, A; Savrié, M; Schoenning, K; Schumann, S; Shan, W; Shao, M; Shen, C P; Shen, P X; Shen, X Y; Sheng, H Y; Shi, M; Song, W M; Song, X Y; Sosio, S; Spataro, S; Sun, G X; Sun, J F; Sun, S S; Sun, X H; Sun, Y J; Sun, Y Z; Sun, Z J; Sun, Z T; Tang, C J; Tang, X; Tapan, I; Thorndike, E H; Tiemens, M; Ullrich, M; Uman, I; Varner, G S; Wang, B; Wang, D; Wang, D Y; Wang, K; Wang, L L; Wang, L S; Wang, M; Wang, P; Wang, P L; Wang, S G; Wang, W; Wang, W P; Wang, X F; Wang, Y D; Wang, Y F; Wang, Y Q; Wang, Z; Wang, Z G; Wang, Z H; Wang, Z Y; Wang, Z Y; Weber, T; Wei, D H; Wei, J B; Weidenkaff, P; Wen, S P; Wiedner, U; Wolke, M; Wu, L H; Wu, L J; Wu, Z; Xia, L; Xia, L G; Xia, Y; Xiao, D; Xiao, H; Xiao, Z J; Xie, Y G; Xiu, Q L; Xu, G F; Xu, J J; Xu, L; Xu, Q J; Xu, X P; Yan, L; Yan, W B; Yan, W C; Yan, Y H; Yang, H J; Yang, H X; Yang, L; Yang, Y; Yang, Y X; Ye, M; Ye, M H; Yin, J H; Yu, B X; Yu, C X; Yu, J S; Yuan, C Z; Yuan, W L; Yuan, Y; Yuncu, A; Zafar, A A; Zallo, A; Zeng, Y; Zeng, Z; Zhang, B X; Zhang, B Y; Zhang, C; Zhang, C C; Zhang, D H; Zhang, H H; Zhang, H Y; Zhang, J; Zhang, J J; Zhang, J L; Zhang, J Q; Zhang, J W; Zhang, J Y; Zhang, J Z; Zhang, K; Zhang, L; Zhang, X Y; Zhang, Y; Zhang, Y N; Zhang, Y H; Zhang, Y T; Zhang, Yu; Zhang, Z H; Zhang, Z P; Zhang, Z Y; Zhao, G; Zhao, J W; Zhao, J Y; Zhao, J Z; Zhao, Lei; Zhao, Ling; Zhao, M G; Zhao, Q; Zhao, Q W; Zhao, S J; Zhao, T C; Zhao, Y B; Zhao, Z G; Zhemchugov, A; Zheng, B; Zheng, J P; Zheng, W J; Zheng, Y H; Zhong, B; Zhou, L; Zhou, X; Zhou, X K; Zhou, X R; Zhou, X Y; Zhu, K; Zhu, K J; Zhu, S; Zhu, S H; Zhu, X L; Zhu, Y C; Zhu, Y S; Zhu, Z A; Zhuang, J; Zotti, L; Zou, B S; Zou, J H
2015-11-27
A neutral structure in the DD[over ¯]^{*} system around the DD[over ¯]^{*} mass threshold is observed with a statistical significance greater than 10σ in the processes e^{+}e^{-}→D^{+}D^{*-}π^{0}+c.c. and e^{+}e^{-}→D^{0}D[over ¯]^{*0}π^{0}+c.c. at sqrt[s]=4.226 and 4.257 GeV in the BESIII experiment. The structure is denoted as Z_{c}(3885)^{0}. Assuming the presence of a resonance, its pole mass and width are determined to be [3885.7_{-5.7}^{+4.3}(stat)±8.4(syst)] MeV/c^{2} and [35_{-12}^{+11}(stat)±15(syst)] MeV, respectively. The Born cross sections are measured to be σ[e^{+}e^{-}→Z_{c}(3885)^{0}π^{0},Z_{c}(3885)^{0}→DD[over ¯]^{*}]=[77±13(stat)±17(syst)] pb at 4.226 GeV and [47±9(stat)±10(syst)] pb at 4.257 GeV. The ratio of decay rates B[Z_{c}(3885)^{0}→D^{+}D^{*-}+c.c.]/B[Z_{c}(3885)^{0}→D^{0}D[over ¯]^{*0}+c.c.] is determined to be 0.96±0.18(stat)±0.12(syst), consistent with no isospin violation in the process, Z_{c}(3885)^{0}→DD[over ¯]^{*}.
32 CFR 643.27 - Policy-Environmental considerations.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Act of 1973 (16 U.S.C. 1531 et seq.). (e) Coastal Zone Management Act of 1972 (16 U.S.C. 1451). (f) Clean Air Act of 1970, as amended, (42 U.S.C. 1857), (AR 200-1, chapter 4). (g) Marine Protection...
32 CFR 643.27 - Policy-Environmental considerations.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Act of 1973 (16 U.S.C. 1531 et seq.). (e) Coastal Zone Management Act of 1972 (16 U.S.C. 1451). (f) Clean Air Act of 1970, as amended, (42 U.S.C. 1857), (AR 200-1, chapter 4). (g) Marine Protection...
2006-08-01
ADAPTIVE IMMUNITY TO S. pneumoniae IN IL-1R1/ MICE 23. Malley, R., P. Henneke, S. C. Morse, M. J. Cieslewicz, M. Lipsitch, C.M. Thompson, E. Kurt ...1555–1560. 41. Kurt -Jones, E. A., S. Hamberg, J. Ohara, W. E. Paul, and A. K. Abbas. 1987. Heterogeneity of helper/inducer T lymphocytes. I...12. J. Immunol. 154: 5832–5841. 59. Hultner, L., S. Kolsch, M. Stassen, U. Kaspers, J. P. Kremer , R. Mailhammer, J. Moeller, H. Broszeit, and E
1998-10-01
0 00 012 IIOTI -- 00 0 Z 0 0 REFERENCES 1. McGann, E. F., Winchester, M. I., Carter, D . P ., Martin, J. N., Jr., Bass, D ., Morrison, J. C. Factors...Women: 1982-1992. 0a014 14. Magann, E. F., Winchester, M. I., Carter, D . P ., Martin, J. N., Jr., Bass, D ., and Morrison, J. C. Factors adversely...D ZHI CE) 10T CD ZC I eC-) 3Z co 00 000 CD CD) z_ < zll CD 1a 1 1 S C) I 1 icD=---I i !! Iz .i 3, z6 z,- !0 D Iz~=3 S--I_ 11001D The current C
An Experimental Study of Dropwise Condensation on Vertical Discs.
1979-12-01
Tested--------------------- 45 Table II. Summary of Heat Transfer Results ---------------- 46 Table III. Thermophysical Properties of Pertinent Materials...flow for selected speci- ments. The values obtained for heat flux agreed within 22 per- cent. Using the values for heat flux, surface temperature and...4 n.* V- 4 n- C\\) *.- --t ~C m, z, C E-1 E-4 E-0 E4 46 N 4) ) Cd 4~ ~ C)4 S ) 0) 4- C) 4 0 4)0 .4E-4 UU I~ U 47 Thermophysical Properties 1. Thermal
1981-09-21
00 a0l 2 i K~~~~W 0 0 11 - 00 0 0: 3000. 0 000 #4IL .4 4 00. II O (0 4 2 0 4 O0NI. * 1.414 6 1 * 01% w 0-3 0 ft a KO na a’ aVNi *~~~~- 0- 4 1000 .00...S USO S ft# 6-31@@~1~eN~iS~l0540-31 140 31 srn 0500 4- U 0-C S U S E S C J C #If skO - S U S 4 0 Ow .U -, sa s4* a. 04 , m .4Va aP.9aI 0. 00ee s es
2003-09-02
TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE Dragon Drone UAV System 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER...ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 A E R O S Y S T E M S BAI’s Dragon Drone ...the hundreds. BAI’s Dragon Drone system is the result of combining new ideas and emerging technologies with the in-depth knowl- edge gained from real
2014-07-02
Tuesday Morning • March 18 S A G E E P 2 01 1 T E C H N IC A L P R O G R A M B orehole G eophysics C hair: Jam es LoC oco C o-C hair: D aryl Tw...ssib ilities in th e R eservo ir E n g in eerin g , Leo n id A n isim ov, LU K O IL-E n g in eerin g G eo p hysical Flow A n alysis o f A n iso
23 CFR 450.324 - Development and content of the transportation improvement program (TIP).
Code of Federal Regulations, 2014 CFR
2014-04-01
... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Metropolitan Transportation Planning and...), 49 U.S.C. 5305(d), and 49 U.S.C. 5339; (3) State planning and research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the discretion of the State and MPO, State planning and research...
23 CFR 450.324 - Development and content of the transportation improvement program (TIP).
Code of Federal Regulations, 2012 CFR
2012-04-01
... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Metropolitan Transportation Planning and...), 49 U.S.C. 5305(d), and 49 U.S.C. 5339; (3) State planning and research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the discretion of the State and MPO, State planning and research...
23 CFR 450.324 - Development and content of the transportation improvement program (TIP).
Code of Federal Regulations, 2010 CFR
2010-04-01
... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Metropolitan Transportation Planning and...), 49 U.S.C. 5305(d), and 49 U.S.C. 5339; (3) State planning and research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the discretion of the State and MPO, State planning and research...
23 CFR 450.324 - Development and content of the transportation improvement program (TIP).
Code of Federal Regulations, 2011 CFR
2011-04-01
... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Metropolitan Transportation Planning and...), 49 U.S.C. 5305(d), and 49 U.S.C. 5339; (3) State planning and research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the discretion of the State and MPO, State planning and research...
23 CFR 450.324 - Development and content of the transportation improvement program (TIP).
Code of Federal Regulations, 2013 CFR
2013-04-01
... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Metropolitan Transportation Planning and...), 49 U.S.C. 5305(d), and 49 U.S.C. 5339; (3) State planning and research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the discretion of the State and MPO, State planning and research...
Latent heat loss of dairy cows in an equatorial semi-arid environment
NASA Astrophysics Data System (ADS)
da Silva, Roberto Gomes; Maia, Alex Sandro Campos; de Macedo Costa, Leonardo Lelis; de Queiroz, João Paulo A. Fernandes
2012-09-01
The present study aimed to evaluate evaporative heat transfer of dairy cows bred in a hot semi-arid environment. Cutaneous ( E S) and respiratory ( E R) evaporation were measured (810 observations) in 177 purebred and crossbred Holstein cows from five herds located in the equatorial semi-arid region, and one herd in the subtropical region of Brazil. Rectal temperature ( T R), hair coat surface temperature ( T S) and respiratory rate ( F R) were also measured. Observations were made in the subtropical region from August to December, and in the semi-arid region from April to July. Measurements were done from 1100 to 1600 hours, after cows remained in a pen exposed to the sun. Environmental variables measured in the same locations as the animals were black globe temperature ( T G), air temperature ( T A), wind speed ( U), and partial air vapour pressure ( P V). Data were analysed by mixed models, using the least squares method. Results showed that average E S and E R were higher in the semi-arid region (117.2 W m-2 and 44.0 W m-2, respectively) than in the subtropical region (85.2 W m-2 and 30.2 W m-2, respectively). Herds and individual cows were significant effects ( P < 0.01) for all traits in the semi-arid region. Body parts did not affect T S and E S in the subtropical region, but was a significant effect ( P < 0.01) in the semi-arid region. The average flank T S (42.8°C) was higher than that of the neck and hindquarters (39.8°C and 41.6°C, respectively). Average E S was higher in the neck (133.3 W m-2) than in the flank (116.2 W m-2) and hindquarters (98.6 W m-2). Coat colour affected significantly both T S and E S ( P < 0.01). Black coats had higher T S and E S in the semi-arid region (41.7°C and 117.2 W m-2, respectively) than white coats (37.2°C and 106.7 W m-2, respectively). Rectal temperatures were almost the same in both subtropical and semi-arid regions. The results highlight the need for improved management methods specific for semi-arid regions.
2006-10-26
tte r M r. D ea n C ar ic o TR AC K 1 Sy st em s En gi ne er in g Ef fe ct iv en es s M r. Al B ro...FS S) T oo ls - PG M M Ca se S tu dy M r. D ou gl as S to rs ve d Pa tte rn L ib ra ry fo r Us e in W ea po ns S ys te m E ng in ee...Sensors Sensors Sensors Sensors Air, Land or Sea Undersea or from the Sea (C3) (C2)( ) Sensors Sensors
Inelastic Proton Scattering on 21Na in Inverse Kinematics
NASA Astrophysics Data System (ADS)
Austin, Roby
2009-10-01
R.A.E. Austin, R. Kanungo, S. Reeve, Saint Mary's University; D.G. Jenkins, C.Aa.Diget, A. Robinson, A.G. Tuff, O. Roberts, University of York, UK; P.J. Woods, T. Davinson, G. J. Lotay, University of Edinburgh; C.-Y. Wu, Lawrence Livermore National Laboratory; H. Al Falou, G.C. Ball, M. Djongolov, A. Garnsworthy, G. Hackman, J.N. Orce, C.J. Pearson, S. Triambak, S.J. Williams, TRIUMF; C. Andreiou, D.S. Cross, N. Galinski, R. Kshetri, Simon Fraser University; C. Sumithrarachchi, M.A. Schumaker, University of Guelph; M.P. Jones, S.V. Rigby, University of Liverpool; D. Cline, A. Hayes, University of Rochester; T.E. Drake, University of Toronto; We describe an experiment and associated technique [1] to measure resonances of interest in astrophysical reactions. At the TRIUMF ISAC-II radioactive beam accelerator facility in Canada, particles inelastically scattered in inverse kinematics are detected with Bambino, a δE-E silicon telescope spanning 15-40 degrees in the lab. We use the TIGRESS to detect gamma rays in coincidence with the charged particles to cleanly select inelastic scattering events. We measured resonances above the alpha threshold in ^22Mg of relevance to the rate of break-out from the hot-CNO cycle via the reaction ^ 18Ne(α,p)^21Na. [1] PJ Woods et al. Rex-ISOLDE proposal 424 Cern (2003).
Functional Analysis of Frequent Lung Cancer Amplicons Under Current Genome Annotation
2015-12-01
Gingeras, T. R ., Rosenbloom, K. R ., Sloan, C. A., Learned, K., Malladi , V. S., Wong, M. C., Barber, G. P., Cline, M. S., Dreszer, T. R ., Heitner, S...Epstein, C. B., Frietze, S., Harrow, J., Kaul, R ., Khatun, J., Lajoie, B. R ., Landt, S. G., Lee, B. K., Pauli, F., Rosenbloom, K. R ., Sabo, P...Safi, A., Sanyal, A., Shoresh, N., Simon, J. M., Song, L., Trinklein, N. D., Altshuler, R . C., Birney, E., Brown, J. B., Cheng, C., Djebali, S., Dong
1983-09-13
4 T .. . 7 8 , -t I j: S" VA 4 ~ 0 7 C ) I* C S. 0 7 W-ei 9It 9. 0 T./COEF 0. 1333 C) 13:: 0 121) 0 5 3-: 0...a: ,-’:, .uIr.re’.l I ,:, !, IIF,,;r.,:’,e~ f cc,,trllir A R : i,:, of -,ny ot.le-r Media t’-di~ a 1-, or, 2 3 4 5 6. 7 8 3 0 S-.r OEF 0. O’° ).-. 0...F - - COMMOD I TY (U’ 1TS- ) (UilT .3.) f % L ATED ORMP’eFT. At.ITY r; :- - - FALT F:. 4 E-: - 4 7 402 5 8 . 5 3413. 1 7 A ’C EL 2n -, -- ". . ’
Prime Contract Awards by Region and State, Fiscal Years 1980, 1981, 1982.
1982-01-01
40 C c 0 0) M .0.6 co L t2 CD ; : -j .S0 9 - t o) 0 m LL * 2 c M 0 r- E-0C 13 0U) c CL 0 &OO a) U. 0 a. c (0 c C CL E 0.0 C* o... 0 L:,e 0 c o4 Cl...0’ C, CL~ -0 .0 E 0 0 Mo~ U)o 0~ . .~ 4) m (D L)04 3 L> 0 0L _0 C_ - - Z m v ( _. ,’. (D. >~ 40 0 ob 0 0 c M 0 00 - 4-0 Cc Or M U)0 E a) U- CL 9 ...fO4) oE - 4 0. 0 0 i E . _c 0 M O-~ d -E - _ 0 0 0)0 000 0 C 0U0 0 0 >. EL 4) 4) 0 D - or 5 >. o- 0 0c & :Co( *4) r CD 0.00-. , ) 0> 0 0 0 0)O = - 0 9
Cesena, Fernando Henpin Yue; Laurinavicius, Antonio Gabriele; Valente, Viviane A; Conceição, Raquel D; Santos, Raul D; Bittencourt, Marcio S
2017-06-01
There is controversy whether management of blood cholesterol should be based or not on LDL-cholesterol (LDL-c) target concentrations. To compare the estimated impact of different lipid-lowering strategies, based or not on LDL-c targets, on the risk of major cardiovascular events in a population with higher cardiovascular risk. We included consecutive individuals undergoing a routine health screening in a single center who had a 10-year risk for atherosclerotic cardiovascular disease (ASCVD) ≥ 7.5% (pooled cohort equations, ACC/AHA, 2013). For each individual, we simulated two strategies based on LDL-c target (≤ 100 mg/dL [Starget-100] or ≤ 70 mg/dL [Starget-70]) and two strategies based on percent LDL-c reduction (30% [S30%] or 50% [S50%]). In 1,897 subjects (57 ± 7 years, 96% men, 10-year ASCVD risk 13.7 ± 7.1%), LDL-c would be lowered from 141 ± 33 mg/dL to 99 ± 23 mg/dL in S30%, 71 ± 16 mg/dL in S50%, 98 ± 9 mg/dL in Starget-100, and 70 ± 2 mg/dL in Starget-70. Ten-year ASCVD risk would be reduced to 8.8 ± 4.8% in S50% and 8.9 ± 5.2 in Starget-70. The number of major cardiovascular events prevented in 10 years per 1,000 individuals would be 32 in S30%, 31 in Starget-100, 49 in S50%, and 48 in Starget-70. Compared with Starget-70, S50% would prevent more events in the lower LDL-c tertile and fewer events in the higher LDL-c tertile. The more aggressive lipid-lowering approaches simulated in this study, based on LDL-c target or percent reduction, may potentially prevent approximately 50% more hard cardiovascular events in the population compared with the less intensive treatments. Baseline LDL-c determines which strategy (based or not on LDL-c target) is more appropriate at the individual level. Há controvérsias sobre se o controle do colesterol plasmático deve ou não se basear em metas de concentração de colesterol LDL (LDL-c). Comparar o impacto estimado de diferentes estratégias hipolipemiantes, baseadas ou não em metas de LDL-c, sobre o risco de eventos cardiovasculares maiores em uma população de risco cardiovascular mais elevado. Foram incluídos indivíduos consecutivamente submetidos a uma avaliação rotineira de saúde em um único centro e que apresentavam um risco em 10 anos de doença cardiovascular aterosclerótica (DCVAS) ≥ 7,5% ("pooled cohort equations", ACC/AHA, 2013). Para cada indivíduo, foram simuladas duas estratégias baseadas em meta de LDL-c (≤ 100 mg/dL [Emeta-100] ou ≤ 70 mg/dL [Emeta-70]) e duas estratégias baseadas em redução percentual do LDL-c (30% [E30%] ou 50% [E50%]). Em 1.897 indivíduos (57 ± 7 anos, 96% homens, risco em 10 anos de DCVAS 13,7 ± 7,1%), o LDL-c seria reduzido de 141 ± 33 mg/dL para 99 ± 23 mg/dL na E30%, 71 ± 16 mg/dL na E50%, 98 ± 9 mg/dL na Emeta-100 e 70 ± 2 mg/dL na Emeta-70. O risco em 10 anos de DCVAS seria reduzido para 8,8 ± 4,8% na E50% e para 8,9 ± 5,2 na Emeta-70. O número de eventos cardiovasculares maiores prevenidos em 10 anos por 1.000 indivíduos seria de 32 na E30%, 31 na Emeta-100, 49 na E50% e 48 na Emeta-70. Em comparação com a Emeta-70, a E50% evitaria mais eventos no tercil inferior de LDL-c e menos eventos no tercil superior de LDL-c. As abordagens hipolipemiantes mais agressivas simuladas neste estudo, com base em meta de LDL-c ou redução percentual, podem potencialmente prevenir cerca de 50% mais eventos cardiovasculares graves na população em comparação com os tratamentos menos intensivos. Os níveis basais de LDL-c determinam qual estratégia (baseada ou não em meta de LDL-c) é mais apropriada para cada indivíduo.
Cosmic Explosions in Three Dimensions
NASA Astrophysics Data System (ADS)
Höflich, Peter; Kumar, Pawan; Wheeler, J. Craig
2011-08-01
Introduction: 3-D Explosions: a meditation on rotation (and magnetic fields) J. C. Wheeler; Part I. Supernovae: Observations Today: 1. Supernova explosions: lessons from spectropolarimetry L. Wang; 2. Spectropolarimetric observations of Supernovae A. Filippenko and D. C. Leonard; 3. Observed and physical properties of type II plateau supernovae M. Hamuy; 4. SN1997B and the different types of Type Ic Supernovae A. Clocchiatti, B. Leibundgut, J. Spyromilio, S. Benetti, E. Cappelaro, M. Turatto and M. Phillips; 5. Near-infrared spectroscopy of stripped-envelope Supernovae C. L. Gerardy, R. A. Fesen, G. H. Marion, P. Hoeflich and J. C. Wheeler; 6. Morphology of Supernovae remnants R. Fesen; 7. The evolution of Supernova remnants in the winds of massive stars V. Dwarkadas; 8. Types for the galactic Supernovae B. E. Schaefer; Part II. Theory of Thermonuclear Supernovae: 9. Semi-steady burning evolutionary sequences for CAL 83 and CAL 87: supersoft X-ray binaries are Supernovae Ia progenitors S. Starrfield, F. X. Timmes, W. R. Hix, E. M. Sion, W. M. Sparks and S. Dwyer; 10. Type Ia Supernovae progenitors: effects of the spin-up of the white dwarfs S.-C. Yoon and N. Langer; 11. Terrestrial combustion: feedback to the stars E. S. Oran; 12. Non-spherical delayed detonations E. Livne; 13. Numerical simulations of Type Ia Supernovae: deflagrations and detonations V. N. Gamezo, A. M. Khokhlov and E. S. Oran; 14. Type Ia Supernovae: spectroscopic surprises D. Branch; 15. Aspherity effects in Supernovae P. Hoeflich, C. Gerardy and R. Quimby; 16. Broad light curve SneIa: asphericity or something else? A. Howell and P. Nugent; 17. Synthetic spectrum methods for 3-D SN models R. Thomas; 18. A hole in Ia' spectroscopic and polarimetric signatures of SN Ia asymmetry due to a companion star D. Kasen; 19. Hunting for the signatures of 3-D explosions with 1-D synthetic spectra E. Lentz, E. Baron and P. H. Hauschildt; 20. On the variation of the peak luminosity of Type Ia J. W. Truran, E. X. Timmes and E. F. Brown; Part III. Theory of Core Collapse Supernovae: 21. Rotation of core collapse progenitors: single and binary stars N. Langer; 22. Large scale convection and the convective Supernova mechanism S. Colgate and M. E. Herant; 23. Topics in core-collapse Supernova A. Burrows, C. D. Ott and C. Meakin; 24. MHD Supernova jets: the missing link D. Meier and M. Nakamura; 25. Effects of super strong magnetic fields in core collapse Supernovae I. S. Akiyama; 26. Non radial instability of stalled accretion shocks advective-acoustic cycle T. Foglizzo and P. Galletti; 27. Asymmetry effects in Hypernovae K. Maeda, K. Nomoto, J. Deng and P.A. Mazzali; 28. Turbulent MHD jet collimation and thermal driving P. T. Williams; Part IV. Magnetars, N-Stars, Pulsars: 29. Supernova remnants and pulsar wind nebulae R. Chevalier; 30. X-Ray signatures of Supernovae D. Swartz; 31. Asymmetric Supernovae and Neutron Star Kicks D. Lai and D. Q. Lamb; 32. Triggers of magnetar outbursts R. Duncan; 33. Turbulent MHD Jet Collimation and Thermal Driving P. Williams; 34. The interplay between nuclear electron capture and fluid dynamics in core collapse Supernovae W. R. Hix, O. E. B. Messer and A. Mezzacappa; Part V. Gamma-Ray Bursts: 35. GRB 021004 and Gamma-ray burst distances B. E. Schaefer; 36. Gamma-ray bursts as a laboratory for the study of Type Ic Supernovae D. Q. Lamb, T. Q. Donaghy and C. Graziani; 37. The diversity of cosmic explosions: Gamma-ray bursts and Type Ib/c Supernovae E. Berger; 38. A GRB simulation using 3D relativistic hydrodynamics J. Cannizo, N. Gehrels and E. T. Vishniac; 39. The first direct link in the Supernova/GRB connection: GRB 030329 and SN 2003dh T. Matheson; Part VI. Summary: 40. Three-dimensional explosions C. Wheeler.
Analysis of the Effects of Fixed Costs on Learning Curve Calculations
1994-09-01
Gansler, Jacques S . The Defense Industry. Cambridge MA: MIT Press, 1980. 11. Horngren , Charles T. and George Foster. Cost Accounting : A Managerial...Incorrect Total Cost Estimates and Comparison to Correct/Correct Total C o st E stim a te s ...7 1 12. Incorrect/Correct Total Cost Estimates and Comparison to Correct/Correct Total C o st E stim a te s
Self-Passivation of POSS-Kapton-Polyimides in the Presence of Atomic Oxygen (Preprint)
2007-10-29
3. Koontz , S. L., Leger, L. J., Visentine, J. T., Hunton, D. E., Cross, J. B., and Hakes, C. L., “EOIM-III Mass Spectroscopy and Polymer Chemistry...1983. 88(A12): p. 170-188. 14. Koontz , S.L., Leger, L. J., Rickman, S. L., Hakes, C. L., Bui, D. T., Hunton, D. E. and Cross, J.B., "Oxygen
Comprehensive High School Bilingual Program. E.S.E.A. Title VII Final Evaluation Report, 1980-1981.
ERIC Educational Resources Information Center
Shore, Rima, Ed.; And Others
This report describes, provides demographic data for, and evaluates the effectiveness of the Comprehensive High School Bilingual Program (C.H.S.B.P.), which provided staff and material resources to five high school Spanish, Chinese, and Italian bilingual programs in New York City. In 1980-81, C.H.S.B.P. served 468 students of limited English…
40 CFR 16.12 - Specific exemptions.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 1974 § 16.12 Specific exemptions. (a) Exemption under 5 U.S.C. 552a(k)(2)—(1) Systems of records... Personnel Security Files. EPA-46OCEFT/NEIC Master Tracking System. (2) Authority. Under 5 U.S.C. 552a(k)(2... U.S.C. 552a(k)(2): 5 U.S.C. 552a(c)(3); (d); (e)(1), (4)(G) and (4)(H); and (f)(2) through (5). EPA...
40 CFR 16.12 - Specific exemptions.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 1974 § 16.12 Specific exemptions. (a) Exemption under 5 U.S.C. 552a(k)(2)—(1) Systems of records... Personnel Security Files. EPA-46OCEFT/NEIC Master Tracking System. (2) Authority. Under 5 U.S.C. 552a(k)(2... U.S.C. 552a(k)(2): 5 U.S.C. 552a(c)(3); (d); (e)(1), (4)(G) and (4)(H); and (f)(2) through (5). EPA...
40 CFR 16.12 - Specific exemptions.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 1974 § 16.12 Specific exemptions. (a) Exemption under 5 U.S.C. 552a(k)(2)—(1) Systems of records... Personnel Security Files. EPA-46OCEFT/NEIC Master Tracking System. (2) Authority. Under 5 U.S.C. 552a(k)(2... U.S.C. 552a(k)(2): 5 U.S.C. 552a(c)(3); (d); (e)(1), (4)(G) and (4)(H); and (f)(2) through (5). EPA...
40 CFR 16.12 - Specific exemptions.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 1974 § 16.12 Specific exemptions. (a) Exemption under 5 U.S.C. 552a(k)(2)—(1) Systems of records... Personnel Security Files. EPA-46OCEFT/NEIC Master Tracking System. (2) Authority. Under 5 U.S.C. 552a(k)(2... U.S.C. 552a(k)(2): 5 U.S.C. 552a(c)(3); (d); (e)(1), (4)(G) and (4)(H); and (f)(2) through (5). EPA...
40 CFR 16.12 - Specific exemptions.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 1974 § 16.12 Specific exemptions. (a) Exemption under 5 U.S.C. 552a(k)(2)—(1) Systems of records... Personnel Security Files. EPA-46OCEFT/NEIC Master Tracking System. (2) Authority. Under 5 U.S.C. 552a(k)(2... U.S.C. 552a(k)(2): 5 U.S.C. 552a(c)(3); (d); (e)(1), (4)(G) and (4)(H); and (f)(2) through (5). EPA...
1985-01-01
cO c C.-4 a cO CO c 0 _ co 3 0 0 0 0 0 0 0 0 0 0 0 0 0In m )EN ENC ~ E- ENC ENl E -4 ENC1 E .4 ENC ENC1 ENC E ENC ’ CL 0I I...4 g 1U I 4 cv)C() Cl) -4 C14-4 eNC C’) .04 6- us 511 ZOI CD nmos a.C woo 10S c mm m m i o.-.*In~mn V L nL L nL L n * -c I 0 0 0 0 00 0 0 0 0 $i Ml 0...NNNNNNNNNNNNN0) 00) Mooɘ I E000) E to E 4 Ec,) ENc , E a E 0 -0 E - - - v-* v -*v 4 -e -N E N I- < I I< w0 l 0 w04 L7C, mO <n mO .O .n . . .NNNN NN-14< I-I 00 00
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-22
... promulgated under section 408(e)(1)(C) which authorizes EPA to establish ``general procedures and requirements to implement [section 408].'' 21 U.S.C. 346a(e)(1)(C). C. Does this action apply to me? You may be.... Potentially affected entities may include, but are not limited to: Crop production (NAICS code 111), e.g...
DOD Weapon Systems Software Management Study
1975-06-01
AUTHOR(s) 8. CONTRACT OR GRANT NUMBER(s) A. Kossiakoff, T. P. Sleight, E. C. Prettyman, J. M . Park, ane P. L. Hazan N00017-C-72-4401 9. PERFORMING...number) - This report to the Office of the Secretary of Defense surmarizes the findings of a Weapon Sys te m Softwa"r-e Lnncg _en - St,,dy__ a-il...report was prepared by A. Kossiakoff, T. P. Sleight, E. C. Prettyman, J. M . Park, and P. L. Hazan with assistance from T. J. Keen and K. R. Wander. The
NASA Astrophysics Data System (ADS)
Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Ferroli, R. Baldini; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. Chen; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Duan, P. F.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Fava, L.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, X. Y.; Gao, Y.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. M.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. W.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kiese, P.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kühn, W.; Kupsc, A.; Lange, J. S.; Lara, M.; Larin, P.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, Lei; Li, P. R.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, J. J.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Maas, F. E.; Maggiora, M.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales, C. Morales; Moriya, K.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ripka, M.; Rong, G.; Rosner, Ch.; Ruan, X. D.; Sarantsev, A.; Savrié, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shi, M.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, S. G.; Wang, W.; Wang, W. P.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. N.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.; Besiii Collaboration
2015-11-01
A neutral structure in the D D¯* system around the D D¯* mass threshold is observed with a statistical significance greater than 10 σ in the processes e+e-→D+D*-π0+c . c . and e+e-→D0D¯ *0π0+c . c . at √{s }=4.226 and 4.257 GeV in the BESIII experiment. The structure is denoted as Zc(3885 )0. Assuming the presence of a resonance, its pole mass and width are determined to be [3885. 7-5.7+4.3 (stat )±8.4 (syst )] MeV /c2 and [3 5-12+11(stat )±15 (syst )] MeV , respectively. The Born cross sections are measured to be σ [e+e-→Zc(3885 )0π0,Zc(3885 )0→D D¯ *]=[77 ±13 (stat )±17 (syst )] pb at 4.226 GeV and [47 ±9 (stat )±10 (syst )] pb at 4.257 GeV. The ratio of decay rates B [Zc(3885 )0→D+D*-+c .c .] /B [Zc(3885 )0→D0D¯ *0+c .c .] is determined to be 0.96 ±0.18 (stat )±0.12 (syst ) , consistent with no isospin violation in the process, Zc(3885 )0→D D¯*.
United States Air Force Statistical Digest, Fiscal Year 1961. Sixteenth Edition
1961-09-30
E __ _ SUBJECT: Public Release Approval Request I...for 1945-2005 (Please include page count) A UTHORIORGANIZA TION: ____ ----"""SA’-"F’-’-~""M"-’-"C~ E __ _ PRESENTATION TO: General Public DATE: As...34"C t=€~dC( 16 (Print Reviewer’S Name/duty title/phone numbyr) ;::" - e -. (fv ~ 1\\ :;’" e c ŕ-0 I"’ rt ~ D5 I\\P/I-+O (:c, 17 -5 GOO .J REPl:Y
A Bacterial Pathogen Displaying Temperature-Enhanced Virulence of the Microalga Emiliania huxleyi
Mayers, Teaghan J.; Bramucci, Anna R.; Yakimovich, Kurt M.; Case, Rebecca J.
2016-01-01
Emiliania huxleyi is a globally abundant microalga that plays a significant role in biogeochemical cycles. Over the next century, sea surface temperatures are predicted to increase drastically, which will likely have significant effects on the survival and ecology of E. huxleyi. In a warming ocean, this microalga may become increasingly vulnerable to pathogens, particularly those with temperature-dependent virulence. Ruegeria is a genus of Rhodobacteraceae whose population size tracks that of E. huxleyi throughout the alga’s bloom–bust lifecycle. A representative of this genus, Ruegeria sp. R11, is known to cause bleaching disease in a red macroalga at elevated temperatures. To investigate if the pathogenicity of R11 extends to microalgae, it was co-cultured with several cell types of E. huxleyi near the alga’s optimum (18°C), and at an elevated temperature (25°C) known to induce virulence in R11. The algal populations were monitored using flow cytometry and pulse-amplitude modulated fluorometry. Cultures of algae without bacteria remained healthy at 18°C, but lower cell counts in control cultures at 25°C indicated some stress at the elevated temperature. Both the C (coccolith-bearing) and S (scale-bearing swarming) cell types of E. huxleyi experienced a rapid decline resulting in apparent death when co-cultured with R11 at 25°C, but had no effect on N (naked) cell type at either temperature. R11 had no initial negative impact on C and S type E. huxleyi population size or health at 18°C, but caused death in older co-cultures. This differential effect of R11 on its host at 18 and 25°C suggest it is a temperature-enhanced opportunistic pathogen of E. huxleyi. We also detected caspase-like activity in dying C type cells co-cultured with R11, which suggests that programmed cell death plays a role in the death of E. huxleyi triggered by R11 – a mechanism induced by viruses (EhVs) and implicated in E. huxleyi bloom collapse. Given that E. huxleyi has recently been shown to have acquired resistance against EhVs at elevated temperature, bacterial pathogens with temperature-dependent virulence, such as R11, may become much more important in the ecology of E. huxleyi in a warming climate. PMID:27379036
Beraud, Mélanie; Kolb, Annie; Monteil, Véronique; D'Alayer, Jacques; Norel, Françoise
2010-01-01
The stationary phase sigma factor σS (RpoS) controls a regulon required for general stress resistance of the closely related enterobacteria Salmonella and Escherichia coli. The σS-dependent yncC gene encodes a putative DNA binding regulatory protein. Application of the surface-enhanced laser desorption/ionization-time of flight (SELDI-TOF) ProteinChip technology for proteome profiling of wild-type and mutant strains of Salmonella enterica serovar Typhimurium revealed potential protein targets for YncC regulation, which were identified by mass spectrometry, and subsequently validated. These proteins are encoded by the σS-dependent operon yciGFEkatN and regulation of their expression by YncC operates at the transcriptional level, as demonstrated by gene fusion analyses and by in vitro transcription and DNase I footprinting experiments with purified YncC. The yciGFE genes are present (without katN) in E. coli K-12 but are poorly expressed, compared with the situation in Salmonella. We report that the yciGFE(katN) locus is silenced by the histone-like protein H-NS in both species, but that σS efficiently relieves silencing in Salmonella but not in E. coli K-12. In Salmonella, YncC acts in concert with σS to activate transcription at the yciG promoter (pyciG). When overproduced, YncC also activated σS-dependent transcription at pyciG in E. coli K-12, but solely by countering the negative effect of H-NS. Our results indicate that differences between Salmonella and E. coli K-12, in the architecture of cis-acting regulatory sequences upstream of pyciG, contribute to the differential regulation of the yciGFE(katN) genes by H-NS and YncC in these two enterobacteria. In E. coli, this locus is subject to gene rearrangements and also likely to horizontal gene transfer, consistent with its repression by the xenogeneic silencer H-NS. PMID:20713450
25-KVA Amorphous Metal-Core Transformer Developmental Test Report
1989-08-01
N-1801 August 1989 By G.V. Urata and J.O. Franchi Sponsored By Naval Facilites Engineering Command Technical Note and Office of Naval Research 25-kVA...wt’c.i,,., di.shtr tlion iswilm ihed 89 11 1.3 108 C4C E .0>. .4) C L ’TU m ’D ’s n C w o o en o’ 0. 1 0 4 = ~ E 0 0 -~CI u 0 44 E N N M Cn E E E~ E EE...REPRODUCE LEGIBLY. REPORT DOCUMENTATION PAGE OM No. o70-o , Pub €ic r o t r b e to jhm, t o ,im io n of Anf rflut,O . m e, o .e, *. du .a. e o ., nte tve
Validity, Reliability, and Inertia of Four Different Temperature Capsule Systems.
Bongers, Coen C W G; Daanen, Hein A M; Bogerd, Cornelis P; Hopman, Maria T E; Eijsvogels, Thijs M H
2018-01-01
Telemetric temperature capsule systems are wireless, relatively noninvasive, and easily applicable in field conditions and have therefore great advantages for monitoring core body temperature. However, the accuracy and responsiveness of available capsule systems have not been compared previously. Therefore, the aim of this study was to examine the validity, reliability, and inertia characteristics of four ingestible temperature capsule systems (i.e., CorTemp, e-Celsius, myTemp, and VitalSense). Ten temperature capsules were examined for each system in a temperature-controlled water bath during three trials. The water bath temperature gradually increased from 33°C to 44°C in trials 1 and 2 to assess the validity and reliability, and from 36°C to 42°C in trial 3 to assess the inertia characteristics of the temperature capsules. A systematic difference between capsule and water bath temperature was found for CorTemp (0.077°C ± 0.040°C), e-Celsius (-0.081°C ± 0.055°C), myTemp (-0.003°C ± 0.006°C), and VitalSense (-0.017°C ± 0.023°C; P < 0.010), with the lowest bias for the myTemp system (P < 0.001). A systematic difference was found between trial 1 and trial 2 for CorTemp (0.017°C ± 0.083°C; P = 0.030) and e-Celsius (-0.007°C ± 0.033°C; P = 0.019), whereas temperature values of myTemp (0.001°C ± 0.008°C) and VitalSense (0.002°C ± 0.014°C) did not differ (P > 0.05). Comparable inertia characteristics were found for CorTemp (25 ± 4 s), e-Celsius (21 ± 13 s), and myTemp (19 ± 2 s), whereas the VitalSense system responded more slowly (39 ± 6 s) to changes in water bath temperature (P < 0.001). Although differences in temperature and inertia were observed between capsule systems, an excellent validity, test-retest reliability, and inertia was found for each system between 36°C and 44°C after removal of outliers.
Surface free energy of TiC layers deposited by electrophoretic deposition (EPD)
NASA Astrophysics Data System (ADS)
Gorji, Mohammad Reza; Sanjabi, Sohrab
2018-01-01
In this study porous structure coatings of bare TiC (i.e. 20 nm, 0.7 µm and 5/45 µm) and core-shell structures of TiC/NiP synthesized through electroless plating were deposited by EPD. Room temperature surface free energy (i.e. γs) of TiC and TiC/NiP coatings were determined via measuring contact angles of distilled water and diiodemethane liquids. The effect of Ni-P shell on spreading behavior of pure copper on porous EPD structures was also investigated by high temperature wetting experiments. According to the results existence of a Ni-P layer around the TiC particles has led to roughness (i.e. at least 0.1 µm), and porosity mean length (i.e. at least 1 µm) increase. This might be related to various sizes of TiC agglomerates formed during electroless plating. It has been observed that room temperature γs changed from 44.49 to 54.12 mJ.m-2 as a consequence of particle size enlargement for TiC. The highest and lowest (67.25 and 44.49 mJ.m-2) γs were measured for TiC nanoparticles which showed 1.5 times increase in surface free energy after being plated with Ni-P. It was also observed that plating Ni-P altered non-spreading (θs > 100 o) behavior of TiC to full-spreading ((θs 0o)) which can be useful for preparation of hard coatings by infiltration sintering phenomenon. Zeta potential of EPD suspensions, morphology, phase structure and topography of as-EPD layers were investigated through Zetasizer, field emission scanning electron microscopy (FESEM), X-ray diffraction (XRD) and atomic force microscopy (AFM) instruments respectively.
Amplification of Anti-Tumor Immunity Without Autoimmune Complications
2007-05-01
penicillin, and 100 Ag/mL streptomycin. Generation of Her-2–expressing EL4 /E2 cells was described previously (29), and the cells were maintained in...was used to deliver eight pulses at 100 V for 25 ms/pulse. To measure tumor growth, mice were challenged s.c. with 2 105 EL4 /E2 cells in the flank...vaccinated with pE2TM and pGM-CSF, and then inoculated s.c. with EL4 /E2 cells 2 weeks after the last immunization. EL4 /E2 tumors developed and
Verification of Production Hole Quality. Volume 1
1977-11-01
good metallurgical quality in that the surfaces...V < -< .. w / / ^1 -! .. 2 tf / / M O D E : A X IA F R E Q U E N C Y O R IE N T A T IO T E M P E R A T U n/ OJ / in o r | / / 0/ 0...i H / I 2 < 1. 1 u « 1 L Y S IS - O P - A X IA L S C • .0. u ^ 1 1 ^ 1 H 1 M 1 -1 1 n 1 1 0 <-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, K.-F.; Hou, W.-S.; Chang, P.
2010-11-01
We measure the production cross sections for e{sup +}e{sup -}{yields}{Upsilon}(1S){pi}{sup +}{pi}{sup -}, {Upsilon}(2S){pi}{sup +}{pi}{sup -}, and {Upsilon}(3S){pi}{sup +}{pi}{sup -} as a function of {radical}(s) between 10.83 GeV and 11.02 GeV. The data consist of 8.1 fb{sup -1} collected with the Belle detector at the KEKB e{sup +}e{sup -} collider. We observe enhanced production in all three final states that does not agree well with the conventional {Upsilon}(10860) line shape. A fit using a Breit-Wigner resonance shape yields a peak mass of [10 888.4{sub -2.6}{sup +2.7}(stat){+-}1.2(syst)] MeV/c{sup 2} and a width of [30.7{sub -7.0}{sup +8.3}(stat){+-}3.1(syst)] MeV/c{sup 2}.
1989-12-15
0cQa 0 0 c 3oc 0040 - a ’A 9 . 1.. 1. Xew ft Mft OW so P% ^ t W%ft44 #4 A5 fW 0UA4N PA5 pml p" vq PI 0% P, PS t~00aa cacao 0 0310 a a 0 aC a a a 0 cc...e POVW4 /7. 411A4FI(I M6IC 6f w A24p az of CeIMS! &F /We/~ TO M&,f S/RZ-J /’ 1.1. NAZIS 7e P6’s’I r#e L ,?CZ-A%’ de Z.eCf 1S 4/ DO AV07R/AA~flS1~ dE ...aT Des siD F/m r IT /al was £141 Z AIII:. ?DEV UUOVCl ME? 74D OW 3PERVOCrA? $ Adz 7rNS7L OFF/CE Z~t ict,. A cAW IeAO of*’ wMM j#ft’ff NIrAZr Mra X4FF
Effectiveness of Incendiary Ammunition Against Aircraft Fuel Tanks
1948-10-05
r ker~e::le fillei ranks, Fer lhese figures, aU funcUoning t>Srf:Jraticne were c.;:mstdered for projectiles :m- pcting en previot :.Sly ur.Car.::aged... weight in u:-.fts of lCOJ grair.s wf"’ filler weight in units C: 100 grains As a typical example 3f the use of the formula, ccmsider the T36E2" CaL...0,60 rouaC str!k!ng at 2100 f:.jsec. ?:J.e p:-cjectile weight is l: 50 grair.s and t~e fUler weight is 92 grains. Tte !::•:-mula yidds ".80 The
System Synthesis for Polymorphous Computing Architectures
2002-02-01
G H F Proc 5 : 4 : 3 11 1 Figure 3. Self-timed execution. D C B F G H E D B H EA CG F D C B F G H E D B H EA CG F AProc 1 Proc 2...first-iteration actors denoted by T. D B H E CG F D C B F G H E D B H EA CG F A 18 T T T T Proc 3 Proc 4 Proc 5 Proc 1 Proc 2 1 T⁄ T trmin30 ture-mirror...Phase1Algo( , ) = transientReduction( ) Output T G S′ S G T S′ S S′ Figure 11. Pseudocode to find
Pan, Ying H; Bahnson, Brian J
2010-07-01
The properties of three discrete premicellar complexes (E1#, E2#, E3#) of pig pancreatic group-IB secreted phospholipase A2 (sPLA2) with monodisperse alkyl sulfates have been characterized [Berg, O. G. et al., Biochemistry 43, 7999-8013, 2004]. Here we have solved the 2.7 A crystal structure of group-IB sPLA2 complexed with 12 molecules of octyl sulfate (C8S) in a form consistent with a tetrameric oligomeric that exists during the E1# phase of premicellar complexes. The alkyl tails of the C8S molecules are centered in the middle of the tetrameric cluster of sPLA2 subunits. Three of the four sPLA2 subunits also contain a C8S molecule in the active site pocket. The sulfate oxygen of a C8S ligand is complexed to the active site calcium in three of the four protein active sites. The interactions of the alkyl sulfate head group with Arg-6 and Lys-10, as well as the backbone amide of Met-20, are analogous to those observed in the previously solved sPLA2 crystal structures with bound phosphate and sulfate anions. The cluster of three anions found in the present structure is postulated to be the site for nucleating the binding of anionic amphiphiles to the interfacial surface of the protein, and therefore this binding interaction has implications for interfacial activation of the enzyme. Copyright (c) 2010 Elsevier B.V. All rights reserved.
1992-09-01
commercial products. rFnn APWn.,W REPORT DOCUMENTATION PAGE oJ_ NO_ o____ PUNK GOPo m=for ta.meuarnca €4 rwmton It "s to "Wuqe I a"oW a•. ama, Wmusma e tune...soa No.. W Q:- .i0 -0. 0d ~ C. m to 0 .9.0 . ~ n e a IV to a * e * a C . c Pop *e * * * . . ci .,e a e ON:O Cm. 40C -a.’ a . . w a. .W o . t. ftl mn
2007-01-01
C ., Gray, M. D., Humphreys, E. M. L ., Braithwaite, M. F ., & Field, D. 1995, A & A , 302, 797 Feast, M. W., Glass, I. S., Whitelock, P. A ., & Catchpole... C ., Bester, M., Degiacomi, C . G., Greenhill, L . J., & Townes, C . H. 1994, AJ, 107, 1469 Desmurs, J. F ., Bujarrabal, V., Colomer, F ., & Alcolea, J...2003, Proc. SPIE, 4838, 89 Gray, M. D., & Humphreys, E. M. L . 2000, New Astron., 5, 155 Haniff, C . A ., Scholz, M., & Tuthill,
Contributions of Severe Burn and Disuse to Bone Structure and Strength in Rats
2013-01-01
Johnson d, S.E. Wolf a,e, C.E. Wade a,b a US Army Institute of Surgical Research, 3611 Rawley E Chambers, Fort Sam Houston, TX 78234, USA b The...of Surgical Research, JBSA Fort Sam Houston, TX 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10...Miner Res 1991;6:759-66. [13] Laib A, Barou O, Vico L, Lafage-Proust MH, Alexandre C, Rugsegger P. 3D micro- computed tomography of trabecular and
Critical Manifolds, Travelling Waves and an Example from Population Genetics.
1980-11-01
sko ). in fact, If e seo0 k E [ zk 0 , k1 ] and u c N(k), then whenever Izj = k, z l < 0 and whenever Iwj = k, Iw 1 0. -6- Proof. The last sentence...s .k Let cI be aboundfor JZJ and JWJ forall u E N(k’l) and e :s F0 . Choose k 0 so that ko (2 + cl) is a lower bound for the quadratic forms -Z (x...7- Now since k E [sk0 , kl] - ko k+ s50. Also, because k I /cok O , - ko + kc 0 :_ 0. Furthermore at least one of these terms is negative, so (Z < 0. If
Casualty Estimates for Contingencies. Volume 2. Appendices.
1985-11-15
r .( E 4) C 0C0C O.C L - 0 1-L-0 3.14 >0 0C) m>1,-. c4 00(00 4 co 0 uk Cr C0 m a0 0c 4)5V) NU) 4)) 3UV ) 0 4 LL . .- C4),u %0) c :3 W 0) 1O00ZC 4) C 0...4) .) .) L -L4a) -4 c r - C(C0.Z.-4 -) 6EE>i-L> o V) L. VLLUS- )-4 ) 4) LCUL. 4o) - -4 r- 0C M C.-4 0 0 M aL. w 4) - r- V CO 4)0*- tD V) N X, V) U M0...34 , . . -- ," - " % t- a, -~ U 4-) 1 . 1 _0 S- %V - a) (V % S-~ ~ -4_ _ _ _ _ 1..I l c 0 S 0~L -0 CU4 E~a 4- c0 CD" 0 .- 4 - ra.- 3 oo -4 tD 41 ( A V
20. 'Erection Plan, Renewal of Bridge 210 C over Sacramento ...
20. 'Erection Plan, Renewal of Bridge 210 C over Sacramento River near Tehama, Calif., 3 140'-0' S. T. Riveted Thru Truss Spans, 17'-9' C. to C. Trusses, 31'-0' C. To C. Chords. U.S.S. P. Co. Pacific Coast Dept., Order No. SF 604, Southern Pacific Co., Order No. 51168-P-38428, 1925 Specifications, Scale in. ft., American Bridge Co., Ambridge Plant, Dwgs. made at Ambridge No. 5 in charge of Reehl, Detailed by W.F.R., Date, Checked by L.A.E., Date 1/5/29, Fld. conn. chk. by ENN, Date 3/9/29, Order No. F5659, Sheet No. E3.' - Southern Pacific Railroad Shasta Route, Bridge No. 210.52, Milepost 210.52, Tehama, Tehama County, CA
H.E.S.S. detection of a strong VHE activity from the blazar 3C 279
NASA Astrophysics Data System (ADS)
Naurois, Mathieu
2018-01-01
H.E.S.S. observations of the flat spectrum radio quasar 3C 279 (redshift z=0.536, R.A.: 12h56m11.1665s, Dec: -05d47m21.523s (J2000)) have been carried out during the past 2 weeks, on the basis of the detection of flaring activity in the gamma-ray band with Fermi-LAT (ATel #11189) and AGILE (ATel #11200), as well as in the optical band (ATels #11190, #11196, #11202, #11216).
33 CFR 335.6 - Related laws and Executive Orders.
Code of Federal Regulations, 2012 CFR
2012-07-01
... U.S.C. 1531 et seq.), as amended. (d) The Estuary Protection Act (16 U.S.C. 1221). (e) The Fish and... amended. (h) Section 307(c) of the Coastal Zone Management Act of 1976 (16 U.S.C. 1456 (c)), as amended..., Protection and Enhancement of the Cultural Environment, May 13, 1971, (36 FR 8921, May 15, 1971). (k...
33 CFR 335.6 - Related laws and Executive Orders.
Code of Federal Regulations, 2011 CFR
2011-07-01
... U.S.C. 1531 et seq.), as amended. (d) The Estuary Protection Act (16 U.S.C. 1221). (e) The Fish and... amended. (h) Section 307(c) of the Coastal Zone Management Act of 1976 (16 U.S.C. 1456 (c)), as amended..., Protection and Enhancement of the Cultural Environment, May 13, 1971, (36 FR 8921, May 15, 1971). (k...
33 CFR 335.6 - Related laws and Executive Orders.
Code of Federal Regulations, 2014 CFR
2014-07-01
... U.S.C. 1531 et seq.), as amended. (d) The Estuary Protection Act (16 U.S.C. 1221). (e) The Fish and... amended. (h) Section 307(c) of the Coastal Zone Management Act of 1976 (16 U.S.C. 1456 (c)), as amended..., Protection and Enhancement of the Cultural Environment, May 13, 1971, (36 FR 8921, May 15, 1971). (k...
33 CFR 335.6 - Related laws and Executive Orders.
Code of Federal Regulations, 2013 CFR
2013-07-01
... U.S.C. 1531 et seq.), as amended. (d) The Estuary Protection Act (16 U.S.C. 1221). (e) The Fish and... amended. (h) Section 307(c) of the Coastal Zone Management Act of 1976 (16 U.S.C. 1456 (c)), as amended..., Protection and Enhancement of the Cultural Environment, May 13, 1971, (36 FR 8921, May 15, 1971). (k...
33 CFR 335.6 - Related laws and Executive Orders.
Code of Federal Regulations, 2010 CFR
2010-07-01
... U.S.C. 1531 et seq.), as amended. (d) The Estuary Protection Act (16 U.S.C. 1221). (e) The Fish and... amended. (h) Section 307(c) of the Coastal Zone Management Act of 1976 (16 U.S.C. 1456 (c)), as amended..., Protection and Enhancement of the Cultural Environment, May 13, 1971, (36 FR 8921, May 15, 1971). (k...
T Cell Lipid Rafts and Complement Ligands for Diagnosis and Monitoring of SLE
2011-05-01
including complete blood count, erythrocyte sedimentation rate , serum levels of C3 and C4, antinuclear autoantibodies (ANA), and anti-dsDNA level. Tests... sedimentation rate , serum levels of C3 and C4, antinuclear autoantibody (ANA) and anti-dsDNA antibody levels. In addition, each patient underwent history...6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER E-Mail: 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES
1977-01-01
area is limited to that 1.97 mile portion of Leith Creek between Gill Street and the L & S Railroad just above State Road . 1645 ( Fertilizer Plant...yj0 U.L e QC e kt V C S L-Co L. U’L -Lb’L r C, CL :, IUI -j.’ y( auo intcet -Ui p o v Id ia q ’:F cc~ Lc s ;It uet ’c C 4 a ’iC 0 dis"tLssed the Le~f...34 - Sites and Methods of more fill due to the access required than the Disposal proposed action. Pumping of the excavated mate- rial is possible
2007-01-01
1215 Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law , no...β/α3 (h̄c)−1 Resistance 4πǫ0/α (ǫ0/µ0) 1/2 Time 1 c Velocity α c−1 18 MAXWELL’S EQUATIONS Name or Description SI Gaussian Faraday’s law ∇ × E = −∂B...t ∇ × E = − 1 c ∂B ∂t Ampere’s law ∇ × H = ∂D ∂t + J ∇ × H = 1 c ∂D ∂t + 4π c J Poisson equation ∇ · D = ρ ∇ · D = 4πρ [Absence of magnetic ∇ · B = 0
2004-12-01
Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law , no person...Pressure β/α3 (h̄c)−1 Resistance 4π0/α (0/µ0) 1/2 Time 1 c Velocity α c−1 19 MAXWELL’S EQUATIONS Name or Description SI Gaussian Faraday’s law ∇ × E = −∂B...t ∇ × E = − 1 c ∂B ∂t Ampere’s law ∇ × H = ∂D ∂t + J ∇ × H = 1 c ∂D ∂t + 4π c J Poisson equation ∇ · D = ρ ∇ · D = 4πρ [Absence of magnetic ∇ · B = 0
75 FR 52060 - Qualification of Drivers; Exemption Renewals; Vision
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-24
...., Delmas C. Bergdoll, Kenneth J. Bernard, Allen G. Bors, Brad T. Braegger, Michael C. Branham, John E. Breslin, Trixie L. Brown, Raymond L. Brush, Scott F. Chalfant, Leroy A. Chambers, Harvis P. Cosby, Rodney... L. Tysseling, Kenneth E. Walker and Richard G. Wendt. In accordance with 49 U.S.C. 31136(e) and...
Molecular Dynamics Simulations of Hugoniot Relations for Poly[methyl methacrylate
2011-11-01
A Method for Atomistic Simulations of Shocked Materials. Physical Review E 2000, 63, 016121. 5. Plimpton , S . Fast Parallel Algorithms for Short...5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Tanya L. Chantawansri, Edward F. C. Byrd, Betsy M. Rice, and Jan W. Andzelm 5d. PROJECT NUMBER 5e. TASK...NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) U.S. Army Research Laboratory ATTN: RDRL-WMM-G Aberdeen
Wu, Na; Du, Xuqin; Wang, Dixin; Hao, Fengtong
2011-03-01
To study myocardial and lung injuries initiated by hydrogen sulfide, and evaluate the role and effectiveness of normobaric and hyperbaric oxygen (HBO) treatment in rats. One hundred healthy male Wistar rats were randomly divided into five groups: A: Normal control group (no H2S); B: H2S-exposed group; C: H2S+33% oxygen treatment group; D: H2S+50% oxygen treatment group; E: H2S+HBO group. The rats in groups C, D and E were exposed to H2S in an exposure chamber (1 m3) and were made to inhale 300 ppm hydrogen sulfide for 60 min, and then they were subjected to normobaric or HBO therapy. Normobaric oxygen was at concentrations of 33% or 50%, HBO was for 100 min including compression and decompression; the rats in group A inhaled air under the same conditions. Blood was sampled immediately after the experiment for analysis of arterial blood gases, myocardial enzymes and cardiac troponin I. Lung was rapidly removed to be made into tissue homogenates and then cytochrome c oxidase activity was measured; myocardial and lung ultrastructural changes were observed by electron microscopy. Arterial blood gases: partial pressure of O2 (mmHg) (Group A, 97.6 ± 8.38; B, 76.5 ± 6.95*; C, 83.2 ± 2.66*; D, 86.20 ± 10.75*; E, 93.50 ± 4.97: *p < 0.01 compared to group A) was significantly lower than that in group in all but HBO rats. For myocardial enzymes and cardiac troponin I every parameter in groups B and C was significantly higher than that in group A (p<0.01),with no difference in D and E. Cytochrome c oxidase activity (u/mg) of lung tissue was reduced compared to group A after all treatments (A, 1.76 ± 0.02; B, 0.36 ± 0.04; C, 0.50 ± 0.12; D, 0.56 ± 0.07; E, 0.68 ± 0.05 (A vs. B p < 0.01; B vs. C,D,E p < 0.05 or p < 0.01), with a graded effect of oxygen dose in C, D and E. Pathological changes: (1) Myocardium - Mitochondrial swelling and autolysis with blurred or broken cristae was observed in the myocardium of H2S-exposed group; in group E, mitochondrial structure was basically normal, and clear cristae were found. (2) Lung tissue - In H2S-exposed group, alveolar epithelial cells disappeared, vacuolization of the organelle occurred, nuclear membrane was irregular and marginal condensation of heterochromatin was present; nucleus showed relatively normal morphology in group E, although some vacuoles still persisted within them. HBO therapy can effectively improve arterial oxygen partial pressure, and significantly reduce myocardial damage, as well as potentially relieve lung injury in this model. Further work in humans appears warranted.
2009-05-01
Information Literacy – Oral Communication – Written Communication – Critical Thinking – Decision Making – Stamina – Courage – Discipline...Emory 8 I n t e g r i t y - S e r v i c e - E x c e l l e n c e Supporting “ information literacy ” - Provide right type of help near “point of...plays central role in supporting “ information literacy ” Columbia University •Computer Lab •Center for New Media in Teaching and Learning
10 CFR 1015.204 - Reporting debts.
Code of Federal Regulations, 2010 CFR
2010-01-01
... ensure that all of the rights and protections afforded to the debtor under 31 U.S.C. 3711(e) have been... Administrative Collection of Claims § 1015.204 Reporting debts. (a) DOE may disclose delinquent debts to consumer reporting agencies in accordance with 31 U.S.C. 3711(e), the DCIA, the revised Federal Claims Collection...
11 CFR 101.1 - Candidate designations (2 U.S.C. 432(e)(1)).
Code of Federal Regulations, 2010 CFR
2010-01-01
... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate designations (2 U.S.C. 432(e)(1)). 101.1 Section 101.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL CANDIDATE STATUS AND... and address, party affiliation, and office sought, the District and State in which Federal office is...
When Project C.U.R.E.'s much-needed medical supplies and equipment arrive in Liberia, the Frederick National Lab’s Kathryn Kynvin is there to receive and distribute the donations to hospitals who continue to treat survivors of the most recent Ebola
38 CFR 21.5835 - Specific discontinuance dates.
Code of Federal Regulations, 2010 CFR
2010-07-01
... attendance. (Authority: 10 U.S.C. 2143) (e) False claim. VA will discontinue educational assistance and... assistance will end on the effective date of the revocation. See § 21.5743(e). (Authority: 10 U.S.C. 2147) (j... institution of higher learning approved by the Secretary of Defense or the Secretary of Education, as the case...
75 FR 59741 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease COC69113
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-28
... the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR 3108.2-3(a) and (b), the Bureau of Land... Section 31(d) and (e) of the Mineral Lands Leasing Act of 1920 (30 U.S.C. 188), and the BLM is proposing...
76 FR 28450 - Notice of Proposed Reinstatement of Terminated Oil and Gas Lease; Nevada
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-17
... terminated oil and gas lease. SUMMARY: Pursuant to the provisions of 30 U.S.C. 188(d) and (e), and 43 CFR... of the lease as set out in Section 31(d) and (e) of the Mineral Leasing Act of 1920 (30 U.S.C. 188...
Thin-ice Arctic Acoustic Window (THAAW)
2014-09-30
NewYork), pp. 11–37. Mikhalevsky, P. N., Sagen, H., Worcester, P. F., Baggeroer, A. B., Orcutt, J. A., Moore, S. E., Lee, C. M., Vigness -Raposa, K. J...P. F., Baggeroer, A. B., Orcutt, J. A., Moore, S. E., Lee, C. M., Vigness -Raposa, K. J., Freitag, L., Arrott, M., Atakan, K., Beszczynska-Moeller, A
Taking Proof based Verified Computation a Few Steps Closer to Practicality (extended version)
2012-06-27
general s2 + s, in general V’s per-instance CPU costs Issue commit queries (e + 2c) · n/β (e + 2c) · n/β Process commit responses d d Issue PCP...size (# of instances) (§2.3) e: cost of encrypting an element in F d : cost of decrypting an encrypted element f : cost of multiplying in F h: cost of...domain D (such as the integers, Z, or the rationals, Q) to equivalent constraints over a finite field, the programmer or compiler performs 3We suspect
Naval Postgraduate School Research. Volume 10, Number 2, June 2000
2000-06-01
Associate Provost and Dean of Research Dr. David W. Netzer R E S E A R C H N A V A L P O S T G R A D U A T E S C H O O L Introduction The past two...capture during the execution phase of Fleet Battle Experiment Golf (FBE- G ). Fleet Battle Experiment Golf was conducted by Sixth Fleet and the Maritime...in FBE- G . The National Security Telecommunications and Information Systems Security Committee (NSTISSC) and the National Security Agency has certified
1985-12-01
Styrene monomer 2055 B Sulphuric acid 1830 C " Sulphuric acid, spent 1832 C - Sulphurous acid 1633 (C) Sunflover oil D...anhydrides (e.g. formic, acetic); .3 halogenated carboxylic acids (e.g. chloracetic); .4 sulpnonic acids (e.g. benzene sulphonic); .5 caustic alkalis...acetic); (iii) halogenated carboxylic acids (e.g. cbloracetic); (iv) sulphonic acids (e.g. benzene sulphonic);II (v) caustic alkalis (e.g. sodium
Chemically Resolved Interface Structure of Epitaxial Graphene on SiC(0001)
2013-11-19
Phys. Rev. B 76, 235416 (2007). [22] W . Chen, H. Xu, L. Liu, X.Y. Gao, D. C. Qi, G.W. Peng, S. C. Tan, Y. P. Feng, K. P. Loh, and A. T. S. Wee, Surf...J. Hass, J. E. Millan-Otoya, P. N. First, and E.H. Conrad, Phys. Rev. B 78, 205424 (2008). [27] J. Borysiuk, R. Bozek, W . Strupinski, A. Wysmolek, K...to the X-ray polarization FIG. S1: Experimental geometries for both (a) conventional XPS (α ~78°) used for survey scans and ( b ) highly surface
ACTIVE: Activity Concept Transitions in Video Event Classification (Open Access)
2014-03-03
responses are listed under each event. [2] R.- E . Fan, K.-W. Chang, C.-J. Hsieh, X.-R. Wang, and C.-J. Lin. LIBLINEAR: A library for large linear...Laptev, M. Marszalek, C. Schmid, and B. Rozenfeld. Learning realistic human actions from movies. In CVPR, 2008. 1 [11] L.-J. Li, H. Su, E . P. Xing, and F...invariant keypoints. IJCV, 60(2):91–110, 2004. 1, 2 [14] P. Natarajan, S. Vitaladevuni, U. Park, S. Wu, V. Manohar, X. Zhuang, S. Tsakalidis , R. Prasad, and P