Parkinson disease: α-synuclein mutational screening and new clinical insight into the p.E46K mutation.

PubMed

Pimentel, Márcia M G; Rodrigues, Fabíola C; Leite, Marco Antônio A; Campos Júnior, Mário; Rosso, Ana Lucia; Nicaretta, Denise H; Pereira, João S; Silva, Delson José; Della Coletta, Marcus V; Vasconcellos, Luiz Felipe R; Abreu, Gabriella M; Dos Santos, Jussara M; Santos-Rebouças, Cíntia B

2015-06-01

Amongst Parkinson's disease-causing genetic factors, missense mutations and genomic multiplications in the gene encoding α-synuclein are well established causes of the disease, although genetic data in populations with a high degree of admixture, such as the Brazilian one, are still scarce. In this study, we conducted a molecular screening of α-synuclein point mutations and copy number variation in the largest cohort of Brazilian patients with Parkinson's disease (n = 549) and also in twelve Portuguese and one Bolivian immigrants. Genomic DNA was isolated from peripheral blood leukocytes or saliva, and the mutational screening was performed by quantitative and qualitative real-time PCR. The only alteration identified was the p.E46K mutation in a 60-year-old man, born in Bolivia, with a familial history of autosomal dominant Parkinson's disease. This is the second family ever reported, in which this rare pathogenic mutation is segregating. The same mutation was firstly described ten years ago in a Spanish family with a neurodegenerative syndrome combining parkinsonism, dementia and visual hallucinations. The clinical condition of our proband reveals a less aggressive phenotype than previously described and reinforces that marked phenotypic heterogeneity is common among patients with Parkinson's disease, even among those carriers sharing the same mutation. Our findings add new insight into the preexisting information about α-synuclein p.E46K, improving our understanding about the endophenotypes associated to this mutation and corroborate that missense alterations and multiplications in α-synuclein are uncommon among Brazilian patients with Parkinson's disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

Phenotypic characterization of nevus and tumor patterns in MITF E318K mutation carrier melanoma patients.

PubMed

Sturm, Richard A; Fox, Carly; McClenahan, Phil; Jagirdar, Kasturee; Ibarrola-Villava, Maider; Banan, Parastoo; Abbott, Nicola C; Ribas, Gloria; Gabrielli, Brian; Duffy, David L; Peter Soyer, H

2014-01-01

A germline polymorphism of the microphthalmia transcription factor (MITF) gene encoding a SUMOylation-deficient E318K-mutated protein has recently been described as a medium-penetrance melanoma gene. In a clinical assessment of nevi from 301 volunteers taken from Queensland, we identified six individuals as MITF E318K mutation carriers. The phenotype for 5 of these individuals showed a commonality of fair skin, body freckling that varied over a wide range, and total nevus count between 46 and 430; in addition, all were multiple primary melanoma patients. The predominant dermoscopic signature pattern of nevi was reticular, and the frequency of globular nevi in carriers varied, which does not suggest that the MITF E318K mutation acts to force the continuous growth of nevi. Excised melanocytic lesions were available for four MITF E318K carrier patients and were compared with a matched range of wild-type (WT) melanocytic lesions. The MITF staining pattern showed a predominant nuclear signal in all sections, with no significant difference in the nuclear/cytoplasmic ratio between mutation-positive or -negative samples. A high incidence of amelanotic melanomas was found within the group, with three of the five melanomas from one patient suggesting a genetic interaction between the MITF E318K allele and an MC1R homozygous red hair color (RHC) variant genotype.

Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene.

PubMed

Yang, Qing; Zhang, Sihuan; Liu, Liangliang; Cao, Xiukai; Lei, Chuzhao; Qi, Xinglei; Lin, Fengpeng; Qu, Weidong; Qi, Xingshan; Liu, Jiming; Wang, Rongmin; Chen, Hong; Lan, Xianyong

2016-09-02

The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3' untranslated region (3' UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.

Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene

PubMed Central

Yang, Qing; Zhang, Sihuan; Liu, Liangliang; Cao, Xiukai; Lei, Chuzhao; Qi, Xinglei; Lin, Fengpeng; Qu, Weidong; Qi, Xingshan; Liu, Jiming; Wang, Rongmin; Chen, Hong; Lan, Xianyong

2016-01-01

ABSTRACT The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle. PMID:27580010

Effect of a myosin regulatory light chain mutation K104E on actin-myosin interactions.

PubMed

Duggal, D; Nagwekar, J; Rich, R; Huang, W; Midde, K; Fudala, R; Das, H; Gryczynski, I; Szczesna-Cordary, D; Borejdo, J

2015-05-15

Familial hypertrophic cardiomyopathy (FHC) is the most common cause of sudden cardiac death in young individuals. Molecular mechanisms underlying this disorder are largely unknown; this study aims at revealing how disruptions in actin-myosin interactions can play a role in this disorder. Cross-bridge (XB) kinetics and the degree of order were examined in contracting myofibrils from the ex vivo left ventricles of transgenic (Tg) mice expressing FHC regulatory light chain (RLC) mutation K104E. Because the degree of order and the kinetics are best studied when an individual XB makes a significant contribution to the overall signal, the number of observed XBs in an ex vivo ventricle was minimized to ∼20. Autofluorescence and photobleaching were minimized by labeling the myosin lever arm with a relatively long-lived red-emitting dye containing a chromophore system encapsulated in a cyclic macromolecule. Mutated XBs were significantly better ordered during steady-state contraction and during rigor, but the mutation had no effect on the degree of order in relaxed myofibrils. The K104E mutation increased the rate of XB binding to thin filaments and the rate of execution of the power stroke. The stopped-flow experiments revealed a significantly faster observed dissociation rate in Tg-K104E vs. Tg-wild-type (WT) myosin and a smaller second-order ATP-binding rate for the K104E compared with WT myosin. Collectively, our data indicate that the mutation-induced changes in the interaction of myosin with actin during the contraction-relaxation cycle may contribute to altered contractility and the development of FHC. Copyright © 2015 the American Physiological Society.

Accurate detection of low prevalence AKT1 E17K mutation in tissue or plasma from advanced cancer patients

PubMed Central

de Bruin, Elza C.; Whiteley, Jessica L.; Corcoran, Claire; Kirk, Pauline M.; Fox, Jayne C.; Armisen, Javier; Lindemann, Justin P. O.; Schiavon, Gaia; Ambrose, Helen J.; Kohlmann, Alexander

2017-01-01

Personalized healthcare relies on accurate companion diagnostic assays that enable the most appropriate treatment decision for cancer patients. Extensive assay validation prior to use in a clinical setting is essential for providing a reliable test result. This poses a challenge for low prevalence mutations with limited availability of appropriate clinical samples harboring the mutation. To enable prospective screening for the low prevalence AKT1 E17K mutation, we have developed and validated a competitive allele-specific TaqMan® PCR (castPCR™) assay for mutation detection in formalin-fixed paraffin-embedded (FFPE) tumor tissue. Analysis parameters of the castPCR™ assay were established using an FFPE DNA reference standard and its analytical performance was assessed using 338 breast cancer and gynecological cancer FFPE samples. With recent technical advances for minimally invasive mutation detection in circulating tumor DNA (ctDNA), we subsequently also evaluated the OncoBEAM™ assay to enable plasma specimens as additional diagnostic opportunity for AKT1 E17K mutation testing. The analysis performance of the OncoBEAM™ test was evaluated using a novel AKT1 E17K ctDNA reference standard consisting of sheared genomic DNA spiked into human plasma. Both assays are employed at centralized testing laboratories operating according to quality standards for prospective identification of the AKT1 E17K mutation in ER+ breast cancer patients in the context of a clinical trial evaluating the AKT inhibitor AZD5363 in combination with endocrine (fulvestrant) therapy. PMID:28472036

A HRM assay for identification of low level BRAF V600E and V600K mutations using the CADMA principle in FFPE specimens.

PubMed

Huebner, Claudia; Weber, Remeny; Lloydd, Richard

2017-12-01

Melanoma patients with BRAF V600E and V600K mutations show complete or partial response to vemurafenib. Detection assays often scan for the common V600E mutation rather than the rare V600K variant, although this mutation can be found in a high proportion of melanoma patients in the South Pacific. Herein, we describe a BRAF high resolution melting (HRM) assay that can differentiate low level of V600E and V600K mutations using formalin fixed, paraffin embedded (FFPE) reference standards for assay validation. The assay is based on the competitive amplification of differentially melting amplicons (CADMA principle) and has a limit of detection of 0.8% mutant allele for V600K and 1.4% mutant allele for V600E. A differentiation between the two mutations based on the melting profile is possible even at low mutation level. Sixty FFPE specimens were scanned and mutations could be scored correctly as confirmed by castPCR. In summary, the developed HRM assay is suitable for detection of V600K and V600E mutations and proved to be reliable and cost effective in a diagnostic environment. Copyright © 2017 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.

Phosphatidyl inositol-3 kinase (PIK3CA) E545K mutation confers cisplatin resistance and a migratory phenotype in cervical cancer cells.

PubMed

Arjumand, Wani; Merry, Cole D; Wang, Chen; Saba, Elias; McIntyre, John B; Fang, Shujuan; Kornaga, Elizabeth; Ghatage, Prafull; Doll, Corinne M; Lees-Miller, Susan P

2016-12-13

The phosphatidylinositol-3 kinase (PI3K)/Akt/mTOR signaling pathway is activated in many human cancers. Previously, we reported that patients with early stage cervical cancer whose tumours harbour PIK3CA exon 9 or 20 mutations have worse overall survival in response to treatment with radiation and cisplatin than patients with wild-type PIK3CA. The purpose of this study was to determine whether PIK3CA-E545K mutation renders cervical cancer cells more resistant to cisplatin and/or radiation, and whether PI3K inhibition reverses the phenotype. We found that CaSki cells that are heterozygous for the PIK3CA-E545K mutation are more resistant to cisplatin or cisplatin plus radiation than either HeLa or SiHa cells that express only wild-type PIK3CA. Similarly, HeLa cells engineered to stably express PIK3CA-E545K were more resistant to cisplatin or cisplatin plus radiation than cells expressing only wild-type PIK3CA or with PIK3CA depleted. Cells expressing the PIK3CA-E545K mutation also had constitutive PI3K pathway activation and increased cellular migration and each of these phenotypes was reversed by treatment with the PI3K inhibitor GDC-0941/Pictilisib. Our results suggests that cervical cancer patients whose tumours are positive for the PIK3CA-E545K mutation may benefit from PI3K inhibitor therapy in concert with standard cisplatin and radiation therapy.

p110α Hot Spot Mutations E545K and H1047R Exert Metabolic Reprogramming Independently of p110α Kinase Activity.

PubMed

Chaudhari, Aditi; Krumlinde, Daniel; Lundqvist, Annika; Akyürek, Levent M; Bandaru, Sashidhar; Skålén, Kristina; Ståhlman, Marcus; Borén, Jan; Wettergren, Yvonne; Ejeskär, Katarina; Rotter Sopasakis, Victoria

2015-10-01

The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) catalytic subunit p110α is the most frequently mutated kinase in human cancer, and the hot spot mutations E542K, E545K, and H1047R are the most common mutations in p110α. Very little is known about the metabolic consequences of the hot spot mutations of p110α in vivo. In this study, we used adenoviral gene transfer in mice to investigate the effects of the E545K and H1047R mutations on hepatic and whole-body glucose metabolism. We show that hepatic expression of these hot spot mutations results in rapid hepatic steatosis, paradoxically accompanied by increased glucose tolerance, and marked glycogen accumulation. In contrast, wild-type p110α expression does not lead to hepatic accumulation of lipids or glycogen despite similar degrees of upregulated glycolysis and expression of lipogenic genes. The reprogrammed metabolism of the E545K and H1047R p110α mutants was surprisingly not dependent on altered p110α lipid kinase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

Sex and PRNP genotype determination in preimplantation caprine embryos.

PubMed

Guignot, F; Perreau, C; Cavarroc, C; Touzé, J-L; Pougnard, J-L; Dupont, F; Beckers, J-F; Rémy, B; Babilliot, J-M; Bed'Hom, B; Lamorinière, J M; Mermillod, P; Baril, G

2011-08-01

The objective of this study was to test the accuracy of genotype diagnosis after whole amplification of DNA extracted from biopsies obtained by trimming goat embryos and to evaluate the viability of biopsied embryos after vitrification/warming and transfer. Whole genome amplification (WGA) was performed using Multiple Displacement Amplification (MDA). Sex and prion protein (PRNP) genotypes were determined. Sex diagnosis was carried out by PCR amplification of ZFX/ZFY and Y chromosome-specific sequences. Prion protein genotype determination was performed on codons 142, 154, 211, 222 and 240. Embryos were collected at day 7 after oestrus and biopsied either immediately after collection (blastocysts and expanded blastocysts) or after 24 h of in vitro culture (compacted morulae). Biopsied embryos were frozen by vitrification. Vitrified whole embryos were kept as control. DNA of biopsies was extracted and amplified using MDA. Sex diagnosis was efficient for 97.4% of biopsies and PRNP genotyping was determined in 78.7% of biopsies. After embryo transfer, no significant difference was observed in kidding rate between biopsied and vitrified control embryos, whereas embryo survival rate was different between biopsied and whole vitrified embryos (p = 0.032). At birth, 100% of diagnosed sex and 98.2% of predetermined codons were correct. Offspring PRNP profiles were in agreement with parental genotype. Whole genome amplification with MDA kit coupled with sex diagnosis and PRNP genotype predetermination are very accurate techniques to genotype goat embryos before transfer. These novel results allow us to plan selection of scrapie-resistant genotypes and kid sex before transfer of cryopreserved embryo. © 2010 Blackwell Verlag GmbH.

Corin mutations K317E and S472G from preeclamptic patients alter zymogen activation and cell surface targeting. [Corrected].

PubMed

Dong, Ningzheng; Zhou, Tiantian; Zhang, Yue; Liu, Meng; Li, Hui; Huang, Xiaoyi; Liu, Zhenzhen; Wu, Yi; Fukuda, Koichi; Qin, Jun; Wu, Qingyu

2014-06-20

Corin is a membrane-bound serine protease that acts as the atrial natriuretic peptide (ANP) convertase in the heart. Recent studies show that corin also activates ANP in the pregnant uterus to promote spiral artery remodeling and prevent pregnancy-induced hypertension. Two CORIN gene mutations, K317E and S472G, were identified in preeclamptic patients and shown to have reduced activity in vitro. In this study, we carried out molecular modeling and biochemical experiments to understand how these mutations impair corin function. By molecular modeling, the mutation K317E was predicted to alter corin LDL receptor-2 module conformation. Western blot analysis of K317E mutant in HEK293 cells showed that the mutation did not block corin expression on the cell surface but inhibited corin zymogen activation. In contrast, the mutation S472G was predicted to abolish a β-sheet critical for corin frizzled-2 module structure. In Western blot analysis and flow cytometry, S472G mutant was not detected on the cell surface in transfected HEK293 cells. By immunostaining, the S472G mutant was found in the ER, indicating that the mutation S472G disrupted the β-sheet, causing corin misfolding and ER retention. Thus, these results show that mutations in the CORIN gene may impair corin function by entirely different mechanisms. Together, our data provide important insights into the molecular basis underlying corin mutations that may contribute to preeclampsia in patients. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Bison PRNP genotyping and potential association with Brucella spp. seroprevalence

USGS Publications Warehouse

Seabury, C.M.; Halbert, N.D.; Gogan, P.J.P.; Templeton, J.W.; Derr, J.N.

2005-01-01

The implication that host cellular prion protein (PrPC) may function as a cell surface receptor and/or portal protein for Brucella abortus in mice prompted an evaluation of nucleotide and amino acid variation within exon 3 of the prion protein gene (PRNP) for six US bison populations. A non-synonymous single nucleotide polymorphism (T50C), resulting in the predicted amino acid replacement M17T (Met ??? Thr), was identified in each population. To date, no variation (T50: Met) has been detected at the corresponding exon 3 nucleotide and/or amino acid position for domestic cattle. Notably, 80% (20 of 25) of the Yellowstone National Park bison possessing the C/C genotype were Brucella spp. seropositive, representing a significant (P = 0.021) association between seropositivity and the C/C genotypic class. Moreover, significant differences in the distribution of PRNP exon 3 alleles and genotypes were detected between Yellowstone National Park bison and three bison populations that were either founded from seronegative stock or previously subjected to test-and-slaughter management to eradicate brucellosis. Unlike domestic cattle, no indel polymorphisms were detected within the corresponding regions of the putative bison PRNP promoter, intron 1, octapeptide repeat region or 3???-untranslated region for any population examined. This study provides the first evidence of a potential association between nucleotide variation within PRNP exon 3 and the presence of Brucella spp. antibodies in bison, implicating PrPC in the natural resistance of bison to brucellosis infection. ?? 2005 International Society for Animal Genetics.

Nitrative and oxidative DNA damage caused by K-ras mutation in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohnishi, Shiho; Saito, Hiromitsu; Suzuki, Noboru

2011-09-23

Highlights: {yields} Mutated K-ras in transgenic mice caused nitrative DNA damage, 8-nitroguanine. {yields} The mutagenic 8-nitroguanine seemed to be generated by iNOS via Ras-MAPK signal. {yields} Mutated K-ras produces additional mutagenic lesions, as a new oncogenic role. -- Abstract: Ras mutation is important for carcinogenesis. Carcinogenesis consists of multi-step process with mutations in several genes. We investigated the role of DNA damage in carcinogenesis initiated by K-ras mutation, using conditional transgenic mice. Immunohistochemical analysis revealed that mutagenic 8-nitroguanine and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) were apparently formed in adenocarcinoma caused by mutated K-ras. 8-Nitroguanine was co-localized with iNOS, eNOS, NF-{kappa}B, IKK, MAPK, MEK,more » and mutated K-ras, suggesting that oncogenic K-ras causes additional DNA damage via signaling pathway involving these molecules. It is noteworthy that K-ras mutation mediates not only cell over-proliferation but also the accumulation of mutagenic DNA lesions, leading to carcinogenesis.« less

A comparison of classical and H-type bovine spongiform encephalopathy associated with E211K prion protein polymorphism in wild type and EK211 cattle following intracranial inoculation

USDA-ARS?s Scientific Manuscript database

In 2006, a case of H-type bovine spongiform encephalopathy (BSE-H) was diagnosed in a cow that was associated with a heritable polymorphism in the bovine prion protein gene (PRNP) resulting in a lysine for glutamine amino acid substitution at codon 211 (called E211K) of the prion protein. Although t...

Mutation E169K in junctophilin-2 causes atrial fibrillation due to impaired RyR2 stabilization.

PubMed

Beavers, David L; Wang, Wei; Ather, Sameer; Voigt, Niels; Garbino, Alejandro; Dixit, Sayali S; Landstrom, Andrew P; Li, Na; Wang, Qiongling; Olivotto, Iacopo; Dobrev, Dobromir; Ackerman, Michael J; Wehrens, Xander H T

2013-11-19

This study sought to study the role of junctophilin-2 (JPH2) in atrial fibrillation (AF). JPH2 is believed to have an important role in sarcoplasmic reticulum (SR) Ca(2+) handling and modulation of ryanodine receptor Ca(2+) channels (RyR2). Whereas defective RyR2-mediated Ca(2+) release contributes to the pathogenesis of AF, nothing is known about the potential role of JPH2 in atrial arrhythmias. Screening 203 unrelated hypertrophic cardiomyopathy patients uncovered a novel JPH2 missense mutation (E169K) in 2 patients with juvenile-onset paroxysmal AF (pAF). Pseudoknock-in (PKI) mouse models were generated to determine the molecular defects underlying the development of AF caused by this JPH2 mutation. PKI mice expressing E169K mutant JPH2 exhibited a higher incidence of inducible AF than wild type (WT)-PKI mice, whereas A399S-PKI mice expressing a hypertrophic cardiomyopathy-linked JPH2 mutation not associated with atrial arrhythmias were not significantly different from WT-PKI. E169K-PKI but not A399A-PKI atrial cardiomyocytes showed an increased incidence of abnormal SR Ca(2+) release events. These changes were attributed to reduced binding of E169K-JPH2 to RyR2. Atrial JPH2 levels in WT-JPH2 transgenic, nontransgenic, and JPH2 knockdown mice correlated negatively with the incidence of pacing-induced AF. Ca(2+) spark frequency in atrial myocytes and the open probability of single RyR2 channels from JPH2 knockdown mice was significantly reduced by a small JPH2-mimicking oligopeptide. Moreover, patients with pAF had reduced atrial JPH2 levels per RyR2 channel compared to sinus rhythm patients and an increased frequency of spontaneous Ca(2+) release events. Our data suggest a novel mechanism by which reduced JPH2-mediated stabilization of RyR2 due to loss-of-function mutation or reduced JPH2/RyR2 ratios can promote SR Ca(2+) leak and atrial arrhythmias, representing a potential novel therapeutic target for AF. Copyright © 2013. Published by Elsevier Inc.

The complete CDS of the prion protein (PRNP) gene of African lion (Panthera leo).

PubMed

Maj, Andrzej; Spellman, Garth M; Sarver, Shane K

2008-04-01

We provide the complete PRNP CDS sequence for the African lion, which is different from the previously published sequence and more similar to other carnivore sequences. The newly obtained prion protein sequence differs from the domestic cat sequence at three amino acid positions and contains only four octapeptide repeats. We recommend that this sequence be used as the reference sequence for future studies of the PRNP gene for this species.

Mutation E169K in junctophilin-2 causes atrial fibrillation due to impaired RyR2 stabilization

PubMed Central

Voigt, Niels; Garbino, Alejandro; Dixit, Sayali S.; Landstrom, Andrew P.; Li, Na; Wang, Qiongling; Olivotto, Iacopo; Dobrev, Dobromir; Ackerman, Michael J.; Wehrens, Xander H.T.

2013-01-01

Objectives To study the role of junctophilin 2 (JPH2) in atrial fibrillation (AF). Background JPH2 is believed to have an important role in sarcoplasmic reticulum (SR) Ca2+ handling and modulation of ryanodine receptor Ca2+ channels (RyR2). Whereas defective RyR2-mediated Ca2+ release contributes to the pathogenesis of AF, nothing is known about the potential role of JPH2 in atrial arrhythmias. Methods Screening 203 unrelated hypertrophic cardiomyopathy patients uncovered a novel JPH2 missense mutation (E169K) in 2 patients with juvenile-onset paroxysmal AF (pAF). Pseudo-knockin (PKI) mouse models were generated to determine the molecular defects underlying the development of AF caused by this JPH2 mutation. Results PKI mice expressing E169K mutant JPH2 exhibited a higher incidence of inducible AF compared with wildtype (WT)-PKI mice, while A399S-PKI mice expressing a HCM-linked JPH2 mutation not associated with atrial arrhythmias were not significantly different from WT-PKI. E169K-PKI but not A399A-PKI atrial cardiomyocytes showed an increased incidence of abnormal SR Ca2+ release events. These changes were attributed to reduced binding of E169KJPH2 to RyR2. Atrial JPH2 levels in WT-JPH2 transgenic, nontransgenic, and JPH2 knockdown mice correlated negatively with the incidence of pacing-induced AF. Ca2+ spark frequency in atrial myocytes and the open probability of single RyR2 channels from JPH2 knockdown mice was significantly reduced by a small JPH2-mimicking oligopeptide. Moreover, patients with pAF had reduced atrial JPH2 levels per RyR2 channel compared to sinus rhythm patients, and an increased frequency of spontaneous Ca2+ release events. Conclusions Our data suggest a novel mechanism by which reduced JPH2-mediated stabilization of RyR2 due to loss-of-function mutation or reduced JPH2:RyR2 ratios can promote SR Ca2+ leak and atrial arrhythmias, representing a potential novel therapeutic target for AF. PMID:23973696

24 CFR 200.192 - Removal of 203(k) consultant.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 24 Housing and Urban Development 2 2012-04-01 2012-04-01 false Removal of 203(k) consultant. 200.192 Section 200.192 Housing and Urban Development Regulations Relating to Housing and Urban... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.192 Removal of 203(k...

24 CFR 200.192 - Removal of 203(k) consultant.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Removal of 203(k) consultant. 200.192 Section 200.192 Housing and Urban Development Regulations Relating to Housing and Urban... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.192 Removal of 203(k...

24 CFR 200.192 - Removal of 203(k) consultant.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 24 Housing and Urban Development 2 2014-04-01 2014-04-01 false Removal of 203(k) consultant. 200.192 Section 200.192 Housing and Urban Development Regulations Relating to Housing and Urban... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.192 Removal of 203(k...

24 CFR 200.192 - Removal of 203(k) consultant.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 2 2011-04-01 2011-04-01 false Removal of 203(k) consultant. 200.192 Section 200.192 Housing and Urban Development Regulations Relating to Housing and Urban... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.192 Removal of 203(k...

24 CFR 200.192 - Removal of 203(k) consultant.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 24 Housing and Urban Development 2 2013-04-01 2013-04-01 false Removal of 203(k) consultant. 200.192 Section 200.192 Housing and Urban Development Regulations Relating to Housing and Urban... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.192 Removal of 203(k...

The E1784K mutation in SCN5A is associated with mixed clinical phenotype of type 3 long QT syndrome

PubMed Central

Makita, Naomasa; Behr, Elijah; Shimizu, Wataru; Horie, Minoru; Sunami, Akihiko; Crotti, Lia; Schulze-Bahr, Eric; Fukuhara, Shigetomo; Mochizuki, Naoki; Makiyama, Takeru; Itoh, Hideki; Christiansen, Michael; McKeown, Pascal; Miyamoto, Koji; Kamakura, Shiro; Tsutsui, Hiroyuki; Schwartz, Peter J.; George, Alfred L.; Roden, Dan M.

2008-01-01

Phenotypic overlap of type 3 long QT syndrome (LQT3) with Brugada syndrome (BrS) is observed in some carriers of mutations in the Na channel SCN5A. While this overlap is important for patient management, the clinical features, prevalence, and mechanisms underlying such overlap have not been fully elucidated. To investigate the basis for this overlap, we genotyped a cohort of 44 LQT3 families of multiple ethnicities from 7 referral centers and found a high prevalence of the E1784K mutation in SCN5A. Of 41 E1784K carriers, 93% had LQT3, 22% had BrS, and 39% had sinus node dysfunction. Heterologously expressed E1784K channels showed a 15.0-mV negative shift in the voltage dependence of Na channel inactivation and a 7.5-fold increase in flecainide affinity for resting-state channels, properties also seen with other LQT3 mutations associated with a mixed clinical phenotype. Furthermore, these properties were absent in Na channels harboring the T1304M mutation, which is associated with LQT3 without a mixed clinical phenotype. These results suggest that a negative shift of steady-state Na channel inactivation and enhanced tonic block by class IC drugs represent common biophysical mechanisms underlying the phenotypic overlap of LQT3 and BrS and further indicate that class IC drugs should be avoided in patients with Na channels displaying these behaviors. PMID:18451998

Comparative study between REAP 200 and FEP171 CAR with 50-kV raster e-beam system for sub-100-nm technology

NASA Astrophysics Data System (ADS)

Baik, Ki-Ho; Lem, Homer Y.; Dean, Robert L.; Osborne, Stephen; Mueller, Mark; Abboud, Frank E.

2003-08-01

In this paper, a process established with a positive-tone chemically amplified resist (CAR) from TOK REAP200 and Fujifilm Arch FEP171 and 50kV MEBES system is discussed. This TOK resist is developed for raster scan 50 kV e-beam systems. It has high contrast, good coating characteristics, good dry etch selectivity, and high environmental stability. In the mask industries, the most popular positive tone CAR is FEP171, which is a high activation energy type CAR. REAP (Raster E-beam Advanced Process) 200 is low activation energy type and new acetal protecting polymer. In this study, we compared to these different type resists in terms of contrast, PAB and PEB latitude, resist profile, footing, T-topping, PED stability, LER, Global CDU (Critical Dimension Uniformity) and resolution. The REAP200 Resist obtained 75nm isolated lines and spaces, 90nm dense patterns with vertical profile, and a good stability of delay time.

A protein-targeting strategy used to develop a selective inhibitor of the E17K point mutation in the PH domain of Akt1

NASA Astrophysics Data System (ADS)

Deyle, Kaycie M.; Farrow, Blake; Qiao Hee, Ying; Work, Jeremy; Wong, Michelle; Lai, Bert; Umeda, Aiko; Millward, Steven W.; Nag, Arundhati; Das, Samir; Heath, James R.

2015-05-01

Ligands that can bind selectively to proteins with single amino-acid point mutations offer the potential to detect or treat an abnormal protein in the presence of the wild type (WT). However, it is difficult to develop a selective ligand if the point mutation is not associated with an addressable location, such as a binding pocket. Here we report an all-chemical synthetic epitope-targeting strategy that we used to discover a 5-mer peptide with selectivity for the E17K-transforming point mutation in the pleckstrin homology domain of the Akt1 oncoprotein. A fragment of Akt1 that contained the E17K mutation and an I19[propargylglycine] substitution was synthesized to form an addressable synthetic epitope. Azide-presenting peptides that clicked covalently onto this alkyne-presenting epitope were selected from a library using in situ screening. One peptide exhibits a 10:1 in vitro selectivity for the oncoprotein relative to the WT, with a similar selectivity in cells. This 5-mer peptide was expanded into a larger ligand that selectively blocks the E17K Akt1 interaction with its PIP3 (phosphatidylinositol (3,4,5)-trisphosphate) substrate.

E258K HCM-causing mutation in cardiac MyBP-C reduces contractile force and accelerates twitch kinetics by disrupting the cMyBP-C and myosin S2 interaction.

PubMed

De Lange, Willem J; Grimes, Adrian C; Hegge, Laura F; Spring, Alexander M; Brost, Taylor M; Ralphe, J Carter

2013-09-01

Mutations in cardiac myosin binding protein C (cMyBP-C) are prevalent causes of hypertrophic cardiomyopathy (HCM). Although HCM-causing truncation mutations in cMyBP-C are well studied, the growing number of disease-related cMyBP-C missense mutations remain poorly understood. Our objective was to define the primary contractile effect and molecular disease mechanisms of the prevalent cMyBP-C E258K HCM-causing mutation in nonremodeled murine engineered cardiac tissue (mECT). Wild-type and human E258K cMyBP-C were expressed in mECT lacking endogenous mouse cMyBP-C through adenoviral-mediated gene transfer. Expression of E258K cMyBP-C did not affect cardiac cell survival and was appropriately incorporated into the cardiac sarcomere. Functionally, expression of E258K cMyBP-C caused accelerated contractile kinetics and severely compromised twitch force amplitude in mECT. Yeast two-hybrid analysis revealed that E258K cMyBP-C abolished interaction between the N terminal of cMyBP-C and myosin heavy chain sub-fragment 2 (S2). Furthermore, this mutation increased the affinity between the N terminal of cMyBP-C and actin. Assessment of phosphorylation of three serine residues in cMyBP-C showed that aberrant phosphorylation of cMyBP-C is unlikely to be responsible for altering these interactions. We show that the E258K mutation in cMyBP-C abolishes interaction between N-terminal cMyBP-C and myosin S2 by directly disrupting the cMyBP-C-S2 interface, independent of cMyBP-C phosphorylation. Similar to cMyBP-C ablation or phosphorylation, abolition of this inhibitory interaction accelerates contractile kinetics. Additionally, the E258K mutation impaired force production of mECT, which suggests that in addition to the loss of physiological function, this mutation disrupts contractility possibly by tethering the thick and thin filament or acting as an internal load.

K-ras mutation promotes ionizing radiation-induced invasion and migration of lung cancer in part via the Cathepsin L/CUX1 pathway.

PubMed

Wang, Long; Zhao, Yifan; Xiong, Yajie; Wang, Wenjuan; Fei, Yao; Tan, Caihong; Liang, Zhongqin

2018-01-15

K-ras mutation is involved in cancer progression including invasion and migration, but the underlying mechanism is not yet clear. Cathepsin L is a lysosomal cysteine protease and has recently been associated with invasion and migration in human cancers when it is overexpressed. Our recent studies have shown that ionizing radiation (IR) enhanced expression of cathepsin L and increased invasion and migration of tumor cells, but the molecular mechanism is still unclear. In the present study, the effects of K-ras mutation and IR induced invasion and migration of lung cancer as well as the underlying mechanisms were investigated both in vitro and in vivo. Firstly, the levels of cathepsin L and epithelial mesenchymal transition (EMT) marker proteins remarkably changed in A549 (K-ras mutant) after irradiation compared with H1299 (K-ras wild), thereby promoting invasion and migration. Additionally, cathepsin L and its downstream transcription factor CUX1/p110 were increased after irradiation in A549 transfected with CUX1/p200, and the proteolytic processing of CUX1 by cathepsin L was remarkably increased after co-transfection of CUX1/p200 and cathepsin L-lentivirus in H1299. In addition, delivery of a mutant K-ras (V12) into HEK 293 cells stimulated EMT after irradiation due to the accumulation of cathepsin L. Moreover, mutated K-ras was associated with IR-induced cathepsin L and EMT in BALB/c nude mice. Finally, the level of cathepsin L expression was higher in samples carrying a K-ras mutation than in wild-type K-ras samples and the mesenchymal markers were upregulated in the samples of mutant K-ras, whereas the epithelial marker E-cadherin was downregulated in non-small cell lung cancers tissues. In conclusion, the findings demonstrated that mutated K-ras promotes cathepsin L expression and plays a pivotal role in EMT of human lung cancer. The regulatory effect of IR-induced cathepsin L on lung cancer invasion and migration was partially attributed to the Cathepsin L

Somatic activating mutations in MAP2K1 cause melorheostosis.

PubMed

Kang, Heeseog; Jha, Smita; Deng, Zuoming; Fratzl-Zelman, Nadja; Cabral, Wayne A; Ivovic, Aleksandra; Meylan, Françoise; Hanson, Eric P; Lange, Eileen; Katz, James; Roschger, Paul; Klaushofer, Klaus; Cowen, Edward W; Siegel, Richard M; Marini, Joan C; Bhattacharyya, Timothy

2018-04-11

Melorheostosis is a sporadic disease of uncertain etiology characterized by asymmetric bone overgrowth and functional impairment. Using whole exome sequencing, we identify somatic mosaic MAP2K1 mutations in affected, but not unaffected, bone of eight unrelated patients with melorheostosis. The activating mutations (Q56P, K57E and K57N) cluster tightly in the MEK1 negative regulatory domain. Affected bone displays a mosaic pattern of increased p-ERK1/2 in osteoblast immunohistochemistry. Osteoblasts cultured from affected bone comprise two populations with distinct p-ERK1/2 levels by flow cytometry, enhanced ERK1/2 activation, and increased cell proliferation. However, these MAP2K1 mutations inhibit BMP2-mediated osteoblast mineralization and differentiation in vitro, underlying the markedly increased osteoid detected in affected bone histology. Mosaicism is also detected in the skin overlying bone lesions in four of five patients tested. Our data show that the MAP2K1 oncogene is important in human bone formation and implicate MEK1 inhibition as a potential treatment avenue for melorheostosis.

Ultraviolet-Sensitive Mutator Strain of Escherichia coli K-12

PubMed Central

Siegel, Eli C.

1973-01-01

An ultraviolet (UV)-sensitive mutator gene, mutU, was identified in Escherichia coli K-12. The mutation mutU4 is very close to uvrD, between metE and ilv, on the E. coli chromosome. It was recessive as a mutator and as a UV-sensitive mutation. The frequency of reversion of trpA46 on an F episome was increased by mutU4 on the chromosome. The mutator gene did not increase mutation frequencies in virulent phages or in lytically grown phage λ. The mutU4 mutation predominantly induced transitional base changes. Mutator strains were normal for recombination and host-cell reactivation of UV-irradiated phage T1. They were normally resistant to methyl methanesulfonate and were slightly more sensitive to gamma irradiation than Mut+ strains. UV irradiation induced mutations in a mutU4 strain, and phage λ was UV-inducible. Double mutants containing mutU4 and recA, B, or C were extremely sensitive to UV irradiation; a mutU4 uvrA6 double mutant was only slightly more sensitive than a uvrA6 strain. The mutU4 uvrA6 and mutU4 recA, B, or C double mutants had mutation rates similar to that of a mutU4 strain. Two UV-sensitive mutators, mut-9 and mut-10, isolated by Liberfarb and Bryson in E. coli B/UV, were found to be co-transducible with ilv in the same general region as mutU4. PMID:4345920

24 CFR 200.191 - Placement of 203(k) consultant.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 24 Housing and Urban Development 2 2013-04-01 2013-04-01 false Placement of 203(k) consultant. 200... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.191 Placement of 203(k... certify that it has read and fully understands the requirements of the HUD handbook on the 203(k) Program...

24 CFR 200.191 - Placement of 203(k) consultant.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Placement of 203(k) consultant. 200... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.191 Placement of 203(k... certify that it has read and fully understands the requirements of the HUD handbook on the 203(k) Program...

24 CFR 200.191 - Placement of 203(k) consultant.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 2 2011-04-01 2011-04-01 false Placement of 203(k) consultant. 200... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.191 Placement of 203(k... certify that it has read and fully understands the requirements of the HUD handbook on the 203(k) Program...

24 CFR 200.191 - Placement of 203(k) consultant.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 24 Housing and Urban Development 2 2012-04-01 2012-04-01 false Placement of 203(k) consultant. 200... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.191 Placement of 203(k... certify that it has read and fully understands the requirements of the HUD handbook on the 203(k) Program...

24 CFR 200.191 - Placement of 203(k) consultant.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 24 Housing and Urban Development 2 2014-04-01 2014-04-01 false Placement of 203(k) consultant. 200... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.191 Placement of 203(k... certify that it has read and fully understands the requirements of the HUD handbook on the 203(k) Program...

Hyperinsulinemic hypoglycemia evolving to gestational diabetes and diabetes mellitus in a family carrying the inactivating ABCC8 E1506K mutation.

PubMed

Vieira, Teresa C; Bergamin, Carla S; Gurgel, Lucimary C; Moisés, Regina S

2010-11-01

Congenital hyperinsulinism of infancy (CHI) is the most common cause of hypoglycemia in newborns and infants. Several molecular mechanisms are involved in the development of CHI, but the most common genetic defects are inactivating mutations of the ABCC8 or KCNJ11 genes. The classical treatment for CHI has been pancreatectomy that eventually leads to diabetes. More recently, conservative treatment has been attempted in some cases, with encouraging results. Whether or not the patients with heterozygous ABCC8 mutations submitted to conservative treatment may spontaneously develop type 2 diabetes in the long run, is a controversial issue. Here, we report a family carrying the dominant heterozygous germ line E1506K mutation in ABCC8 associated with persistent hypoglycemia in the newborn period and diabetes in adulthood. The mutation occurred as a de novo germ line mutation in the mother of the index patient. Her hypoglycemic symptoms as a child occurred after the fourth year of life and were very mild, but she developed glucose metabolism impairment in adulthood. On the other hand, in her daughter, the clinical manifestations of the disease occurred in the neonatal period and were more severe, leading to episodes of tonic-clonic seizures that were well controlled with octreotide or diazoxide. Our data corroborate the hypothesis that the dominant E1506K ABCC8 mutation, responsible for CHI, predisposes to the development of glucose intolerance and diabetes later in life. © 2009 John Wiley & Sons A/S.

Long-QT mutation p.K557E-Kv7.1: dominant-negative suppression of IKs, but preserved cAMP-dependent up-regulation.

PubMed

Spätjens, Roel L H M G; Bébarová, Markéta; Seyen, Sandrine R M; Lentink, Viola; Jongbloed, Roselie J; Arens, Yvonne H J M; Heijman, Jordi; Volders, Paul G A

2014-10-01

Mutations in KCNQ1, encoding for Kv7.1, the α-subunit of the IKs channel, cause long-QT syndrome type 1, potentially predisposing patients to ventricular tachyarrhythmias and sudden cardiac death, in particular, during elevated sympathetic tone. Here, we aim at characterizing the p.Lys557Glu (K557E) Kv7.1 mutation, identified in a Dutch kindred, at baseline and during (mimicked) increased adrenergic tone. K557E carriers had moderate QTc prolongation that augmented significantly during exercise. IKs characteristics were determined after co-expressing Kv7.1-wild-type (WT) and/or K557E with minK and Yotiao in Chinese hamster ovary cells. K557E caused IKs loss of function with slowing of the activation kinetics, acceleration of deactivation kinetics, and a rightward shift of voltage-dependent activation. Together, these contributed to a dominant-negative reduction in IKs density. Confocal microscopy and western blot indicated that trafficking of K557E channels was not impaired. Stimulation of WT IKs by 3'-5'-cyclic adenosine monophosphate (cAMP) generated strong current up-regulation that was preserved for K557E in both hetero- and homozygosis. Accumulation of IKs at fast rates occurred both in WT and in K557E, but was blunted in the latter. In a computational model, K557E showed a loss of action potential shortening during β-adrenergic stimulation, in accordance with the lack of QT shortening during exercise in patients. K557E causes IKs loss of function with reduced fast rate-dependent current accumulation. cAMP-dependent stimulation of mutant IKs is preserved, but incapable of fully compensating for the baseline current reduction, explaining the long QT intervals at baseline and the abnormal QT accommodation during exercise in affected patients. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

The PB2-K627E mutation attenuates H3N2 swine influenza virus in cultured cells and in mice.

PubMed

Gong, Xiao-Qian; Ruan, Bao-Yang; Liu, Xiao-Min; Zhang, Peng; Wang, Xiu-Hui; Wang, Qi; Shan, Tong-Ling; Tong, Wu; Zhou, Yan-Jun; Li, Guo-Xin; Zheng, Hao; Tong, Guang-Zhi; Yu, Hai

2018-04-01

PB2-627K is an important amino acid that determines the virulence of some influenza A viruses. However, it has not been experimentally investigated in the H3N2 swine influenza virus. To explore the potential role of PB2-K627E substitution in H3N2 swine influenza virus, the growth properties and pathogenicity between H3N2 swine influenza virus and its PB2-K627E mutant were compared. For the first time, our results showed that PB2-K627E mutation attenuates H3N2 swine influenza virus in mammalian cells and in mice, suggesting that PB2-627K is required for viral replication and pathogenicity of H3N2 swine influenza virus. Copyright © 2017 Elsevier Ltd. All rights reserved.

SSCP analysis and sequencing of the human prion protein gene (PRNP) detects two different 24 bp deletions in an atypical Alzheimer`s disease family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perry, R.T.; Go, R.C.P.; Harrell, L.E.

1995-02-27

Alzheimer`s disease (AD) is a progressive, degenerative neurological disorder of the central nervous system. AD is the fourth leading cause of death in elderly persons 65 years or older in Western industrialized societies. The etiology of AD is unknown, but clinical, pathological, epidemiological, and molecular investigations suggest it is etiologically heterogeneous. Mutations in the amyloid protein are rare and segregate with the disease in a few early-onset familial AD (FAD) families. Similarities between AD and the unconventional viral (UCV) diseases, and between the amyloid and prion proteins, implicate the human prion protein gene (PRNP) as another candidate gene. Single strandmore » conformation polymorphism (SSCP) analysis was used to screen for mutations at this locus in 82 AD patients from 54 families (30 FAD), vs. 39 age-matched controls. A 24-bp deletion around codon 68 that codes for one of five Gly-Pro rich octarepeats was identified in two affected sibs and one offspring of one late-onset FAD family. Two other affected sibs, three unaffected sibs, and three offspring from this family, in addition to one sporadic AD patient and three age-matched controls, were heterozygous for another octarepeat deletion located around codon 82. Two of the four affected sibs had features of PD, including one who was autopsy-verified AD and PD. Although these deletions were found infrequently in other AD patients and controls, they appear to be a rare polymorphism that is segregating in this FAD family. It does not appear that mutations at the PRNP locus are frequently associated with AD in this population. 54 refs., 4 figs.« less

RNA interference targeting E637K mutation rescues hERG channel currents and restores its kinetic properties.

PubMed

Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang

2013-01-01

Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.

MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms.

PubMed

Akpınar, Timur Selçuk; Hançer, Veysel Sabri; Nalçacı, Meliha; Diz-Küçükkaya, Reyhan

2013-03-01

The MPL gene encodes the thrombopoietin receptor. Recently MPL mutations (MPL W515L or MPL W515K) were described in patients with essential thrombocythemia (ET) and primary (idiopathic) myelofibrosis (PMF). The prevalence and the clinical importance of these mutations are not clear. In the present study, we aimed to investigate the frequency and clinical significance of MPL W515L/K mutations in our patients with ET and PMF. A total of 77 patients (66 were diagnosed with ET and 11 with PMF) and 42 healthy controls were included in the study. Using peripheral blood samples, the presence of MPL W515L/K mutations and JAK-2 V617F mutation were analyzed by real-time polymerase chain reaction. In our study, MPL W515L/K or JAK-2 V617F mutations were not observed in healthy controls. JAK-2 V617F mutation was present in 35 patients, of whom 29 had ET (43.9%, 29/66) and 6 had PMF (54.5%, 6/11). In the patient group, MPL W515L/K mutations were found in only 2 PMF cases, and these cases were negative for JAK-2 V617F mutation. The prevalence of MPL W515L/K mutations in the patient group was 2.6%, and the prevalence of MPL W515L/K mutations among the cases negative for the JAK-2 V617F mutation was found to be 4.8%. The 2 cases with MPL W515L/K mutations had long follow-up times (124 months and 71 months, respectively), had no thrombotic or hemorrhagic complications, and had no additional cytogenetic anomalies. MPL W515L/K mutations may be helpful for identifying clonal disease in MPN patients with no established Ph chromosome or JAK-2 V617F mutation. None declared.

Measurement of the e + e - → ηK + K - Cross Section by Means of the SND Detector

NASA Astrophysics Data System (ADS)

Achasov, M. N.; Barnyakov, A. Yu.; Barnyakov, M. Yu.; Beloborodov, K. I.; Berdyugin, A. V.; Bogdanchikov, A. G.; Botov, A. A.; Buzykaev, A. R.; Vasiljev, A. V.; Golubev, V. B.; Dimova, T. V.; Druzhinin, V. P.; Zemlyansky, I. M.; Kardapoltsev, L. V.; Kovrizhin, D. P.; Korol, A. A.; Koshuba, S. V.; Kravchenko, E. A.; Kupich, A. S.; Lysenko, A. P.; Martin, K. A.; Melnikova, N. A.; Obrazovsky, A. E.; Onuchin, A. P.; Pakhtusova, E. V.; Perevedentsev, E. A.; Pugachev, K. V.; Skrinsky, A. N.; Serednyakov, S. I.; Silagadze, Z. K.; Surin, A. V.; Tikhonov, Yu. A.; Usov, Yu. V.; Kharlamov, A. G.; Shatunov, P. Yu.; Shatunov, Yu. M.; Shtol, D. A.

2018-03-01

The cross section for the process e + e - → ηK + K - wasmeasured at c.m. energies in the range between 1.56 and 2.00 GeV in an experiment with the SND detector at the VEPP-2000 e + e - collider. The invariant-mass distribution of kaon pairs is consistent with the hypothesis that the transition through the ηφ intermediate state makes a dominant contribution to the transition in question.

VASIMR VX-200 thruster throttling optimization from 30 to 200 kW

NASA Astrophysics Data System (ADS)

Squire, Jared; Olsen, Chris; Chang-Diaz, Franklin; Longmier, Benjamin; Ballenger, Maxwell; Carter, Mark; Glover, Tim; McCaskill, Greg

2012-10-01

The VASIMR^ VX-200 experimental plasma thruster incorporates a 40 kW helicon plasma source with a 180 kW Ion Cyclotron Heating (ICH) acceleration stage integrated in a superconducting magnet. Argon propellant mass flow is injected up to 140 mg/s. Rapid plasma start up (< 100 ms) and high pumping speed (> 10^5 liters/s) in a 150 m^3 vacuum chamber achieve performance measurements with the charge exchange mean-free-path greater than 1 m in the background neutral gas (pressure < 10-5 Torr). The thruster efficiency at 200 kW total power is 72 ± 9%, the ratio of effective jet power to input RF power, with an Isp = 4900 ± 300 seconds (flow velocity of 49 km/s), and an ion flux of 1.7 ± 0.1 x 10^21/s. The thrust increases steadily with power to 5.8 ± 0.4 N until the power is maximized and there is no indication of saturation. The plasma density near the device exit exceeds 10^18 m-3 with a power density over 5 MW/m^2. An extensive study of thruster performance, efficiency and thrust-to-power ratio, as a function of Ar propellant flow rate and ICH-to-helicon RF power ratio has been carried out over a total power range of 30 to 200 kW. Optimized throttling set points are determined. The experimental configuration and results of this study are presented.

Mutations in the C-terminal fragment of DnaK affecting peptide binding.

PubMed Central

Burkholder, W F; Zhao, X; Zhu, X; Hendrickson, W A; Gragerov, A; Gottesman, M E

1996-01-01

Escherichia coli DnaK acts as a molecular chaperone through its ATP-regulated binding and release of polypeptide substrates. Overexpressing a C-terminal fragment (CTF) of DnaK (Gly-384 to Lys-638) containing the polypeptide substrate binding domain is lethal in wild-type E. coli. This dominant-negative phenotype may result from the nonproductive binding of CTF to cellular polypeptide targets of DnaK. Mutations affecting DnaK substrate binding were identified by selecting noncytotoxic CTF mutants followed by in vitro screening. The clustering of such mutations in the three-dimensional structure of CTF suggests the model that loops L1,2 and L4,5 form a rigid core structure critical for interactions with substrate. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855230

Detection of BRAF-V600E and V600K in melanoma circulating tumour cells by droplet digital PCR.

PubMed

Reid, Anna L; Freeman, James B; Millward, Michael; Ziman, Melanie; Gray, Elin S

2015-10-01

Defining the BRAF mutation status in metastatic melanoma patients is critical to selecting patients for therapeutic treatment with targeted therapies. Circulating tumour cells (CTCs) can provide an alternative source of contemporaneous tumour genetic material. However methodologies to analyse the presence of rare mutations in a background of wild-type DNA requires a detailed assessment. Here we evaluate the sensitivity of two technologies for cancer mutation detection and the suitability of whole genome amplified DNA as a template for the detection of BRAF-V600 mutations. Serial dilutions of mutant BRAF-V600E DNA in wild-type DNA were tested using both competitive allele-specific PCR (castPCR) and droplet digital PCR (ddPCR), with and without previous whole genome amplification (WGA). Using immunomagnetic beads, we partially enriched CTCs from blood obtained from metastatic melanoma patients with confirmed BRAF mutation positive tumours and extracted RNA and DNA from the CTCs. We used RT-PCR of RNA to confirm the presence of melanoma cells in the CTC fraction then the DNAs of CTC positive fractions were WGA and tested for BRAF V600E or V600K mutations by ddPCRs. WGA DNA produced lower than expected fractional abundances by castPCR analysis but not by ddPCR. Moreover, ddPCR was found to be 200 times more sensitive than castPCR and in combination with WGA produced the most concordant results, with a limit of detection of 0.0005%. BRAF-V600E or V600K mutated DNA was detected in 77% and 44%, respectively, of enriched CTC fractions from metastatic melanoma patients carrying the corresponding mutations. Our results demonstrate that using ddPCR in combination with WGA DNA allows the detection with high sensitivity of cancer mutations in partially enriched CTC fractions. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Association of GBA Mutations and the E326K Polymorphism With Motor and Cognitive Progression in Parkinson Disease

PubMed Central

Davis, Marie Y.; Johnson, Catherine O.; Leverenz, James B.; Weintraub, Daniel; Trojanowski, John Q.; Chen-Plotkin, Alice; Van Deerlin, Vivianna M.; Quinn, Joseph F.; Chung, Kathryn A.; Peterson-Hiller, Amie L.; Rosenthal, Liana S.; Dawson, Ted M.; Albert, Marilyn S.; Goldman, Jennifer G.; Stebbins, Glenn T.; Bernard, Bryan; Wszolek, Zbigniew K.; Ross, Owen A.; Dickson, Dennis W.; Eidelberg, David; Mattis, Paul J.; Niethammer, Martin; Yearout, Dora; Hu, Shu-Ching; Cholerton, Brenna A.; Smith, Megan; Mata, Ignacio F.; Montine, Thomas J.; Edwards, Karen L.; Zabetian, Cyrus P.

2016-01-01

IMPORTANCE Parkinson disease (PD) is heterogeneous in symptom manifestation and rate of progression. Identifying factors that influence disease progression could provide mechanistic insight, improve prognostic accuracy, and elucidate novel therapeutic targets. OBJECTIVE To determine whether GBA mutations and the E326K polymorphism modify PD symptom progression. DESIGN, SETTING, AND PARTICIPANTS The entire GBA coding region was screened for mutations and E326K in 740 patients with PD enrolled at 7 sites from the PD Cognitive Genetics Consortium. Detailed longitudinal motor and cognitive assessments were performed with patients in the on state. MAIN OUTCOMES AND MEASURES Linear regression was used to test for an association between GBA genotype and motor progression, with the Movement Disorder Society–sponsored version of the Unified Parkinson’s Disease Rating Scale Part III (MDS-UPDRS III) score at the last assessment as the outcome and GBA genotype as the independent variable, with adjustment for levodopa equivalent dose, sex, age, disease duration, MDS-UPDRS III score at the first assessment, duration of follow-up, and site. Similar methods were used to examine the association between genotype and tremor and postural instability and gait difficulty (PIGD) scores. To examine the effect of GBA genotype on cognitive progression, patients were classified into those with conversion to mild cognitive impairment or dementia during the study (progression) and those without progression. The association between GBA genotype and progression status was then tested using logistic regression, adjusting for sex, age, disease duration, duration of follow-up, years of education, and site. RESULTS Of the total sample of 733 patients who underwent successful genotyping, 226 (30.8%) were women and 507 (69.2%) were men (mean [SD] age, 68.1 [8.8] years). The mean (SD) duration of follow-up was 3.0 (1.7) years. GBA mutations (β = 4.65; 95% CI, 1.72–7.58; P = .002), E326K (β = 3

Prevailing PA Mutation K356R in Avian Influenza H9N2 Virus Increases Mammalian Replication and Pathogenicity.

PubMed

Xu, Guanlong; Zhang, Xuxiao; Gao, Weihua; Wang, Chenxi; Wang, Jinliang; Sun, Honglei; Sun, Yipeng; Guo, Lu; Zhang, Rui; Chang, Kin-Chow; Liu, Jinhua; Pu, Juan

2016-09-15

Adaptation of the viral polymerase complex comprising PB1, PB2, and PA is necessary for efficient influenza A virus replication in new host species. We found that PA mutation K356R (PA-K356R) has become predominant since 2014 in avian H9N2 viruses in China as with seasonal human H1N1 viruses. The same mutation is also found in most human isolates of emergent avian H7N9 and H10N8 viruses whose six internal gene segments are derived from the H9N2 virus. We further demonstrated the mammalian adaptive functionality of the PA-K356R mutation. Avian H9N2 virus with the PA-K356R mutation in human A549 cells showed increased nuclear accumulation of PA and increased viral polymerase activity that resulted in elevated levels of viral transcription and virus output. The same mutant virus in mice also enhanced virus replication and caused lethal infection. In addition, combined mutation of PA-K356R and PB2-E627K, a well-known mammalian adaptive marker, in the H9N2 virus showed further cooperative increases in virus production and severity of infection in vitro and in vivo In summary, PA-K356R behaves as a novel mammalian tropism mutation, which, along with other mutations such as PB2-E627K, might render avian H9N2 viruses adapted for human infection. Mutations of the polymerase complex (PB1, PB2, and PA) of influenza A virus are necessary for viral adaptation to new hosts. This study reports a novel and predominant mammalian adaptive mutation, PA-K356R, in avian H9N2 viruses and human isolates of emergent H7N9 and H10N8 viruses. We found that PA-356R in H9N2 viruses causes significant increases in virus replication and severity of infection in human cells and mice and that PA-K356R cooperates with the PB2-E627K mutation, a well-characterized human adaptive marker, to exacerbate mammalian infection in vitro and in vivo Therefore, the PA-K356R mutation is a significant adaptation in H9N2 viruses and related H7N9 and H10N8 reassortants toward human infectivity. Copyright © 2016

Prevailing PA Mutation K356R in Avian Influenza H9N2 Virus Increases Mammalian Replication and Pathogenicity

PubMed Central

Xu, Guanlong; Zhang, Xuxiao; Gao, Weihua; Wang, Chenxi; Wang, Jinliang; Sun, Honglei; Sun, Yipeng; Guo, Lu; Zhang, Rui; Chang, Kin-Chow; Liu, Jinhua

2016-01-01

ABSTRACT Adaptation of the viral polymerase complex comprising PB1, PB2, and PA is necessary for efficient influenza A virus replication in new host species. We found that PA mutation K356R (PA-K356R) has become predominant since 2014 in avian H9N2 viruses in China as with seasonal human H1N1 viruses. The same mutation is also found in most human isolates of emergent avian H7N9 and H10N8 viruses whose six internal gene segments are derived from the H9N2 virus. We further demonstrated the mammalian adaptive functionality of the PA-K356R mutation. Avian H9N2 virus with the PA-K356R mutation in human A549 cells showed increased nuclear accumulation of PA and increased viral polymerase activity that resulted in elevated levels of viral transcription and virus output. The same mutant virus in mice also enhanced virus replication and caused lethal infection. In addition, combined mutation of PA-K356R and PB2-E627K, a well-known mammalian adaptive marker, in the H9N2 virus showed further cooperative increases in virus production and severity of infection in vitro and in vivo. In summary, PA-K356R behaves as a novel mammalian tropism mutation, which, along with other mutations such as PB2-E627K, might render avian H9N2 viruses adapted for human infection. IMPORTANCE Mutations of the polymerase complex (PB1, PB2, and PA) of influenza A virus are necessary for viral adaptation to new hosts. This study reports a novel and predominant mammalian adaptive mutation, PA-K356R, in avian H9N2 viruses and human isolates of emergent H7N9 and H10N8 viruses. We found that PA-356R in H9N2 viruses causes significant increases in virus replication and severity of infection in human cells and mice and that PA-K356R cooperates with the PB2-E627K mutation, a well-characterized human adaptive marker, to exacerbate mammalian infection in vitro and in vivo. Therefore, the PA-K356R mutation is a significant adaptation in H9N2 viruses and related H7N9 and H10N8 reassortants toward human

Genetic Resistance to Scrapie Infection in Experimentally Challenged Goats

PubMed Central

Lacroux, Caroline; Perrin-Chauvineau, Cécile; Corbière, Fabien; Aron, Naima; Aguilar-Calvo, Patricia; Torres, Juan Maria; Costes, Pierrette; Brémaud, Isabelle; Lugan, Séverine; Schelcher, François; Barillet, Francis

2014-01-01

In goats, several field studies have identified coding mutations of the gene encoding the prion protein (I/M142, N/D146, S/D146, R/Q211, and Q/K222) that are associated with a lower risk of developing classical scrapie. However, the data related to the levels of resistance to transmissible spongiform encephalopathies (TSEs) of these different PRNP gene mutations are still considered insufficient for developing large-scale genetic selection against scrapie in this species. In this study, we inoculated wild-type (WT) PRNP (I142R154R211Q222) goats and homozygous and/or heterozygous I/M142, R/H154, R/Q211, and Q/K222 goats with a goat natural scrapie isolate by either the oral or the intracerebral (i.c.) route. Our results indicate that the I/M142 PRNP polymorphism does not provide substantial resistance to scrapie infection following intracerebral or oral inoculation. They also demonstrate that H154, Q211, and K222 PRNP allele carriers are all resistant to scrapie infection following oral exposure. However, in comparison to WT animals, the H154 and Q211 allele carriers displayed only moderate increases in the incubation period following i.c. challenge. After i.c. challenge, heterozygous K222 and a small proportion of homozygous K222 goats also developed the disease, but with incubation periods that were 4 to 5 times longer than those in WT animals. These results support the contention that the K222 goat prion protein variant provides a strong but not absolutely protective effect against classical scrapie. PMID:24284317

Genetic variation of the prion protein gene (PRNP) in alpaca (Vicugna pacos)

USDA-ARS?s Scientific Manuscript database

Transmissible spongiform encephalopathies (TSE) are caused by accumulation of a misfolded form of the prion protein (PrP). The normal cellular isoform of PrP is produced by the prion gene (PRNP) and is highly expressed in the central nervous system. Currently, there is an absence of information rega...

K-ras Mutations as the Earliest Driving Force in a Subset of Colorectal Carcinomas

PubMed Central

MARGETIS, NIKOLAOS; KOULOUKOUSSA, MYRSINI; PAVLOU, KYRIAKI; VRAKAS, SPYRIDON; MARIOLIS-SAPSAKOS, THEODOROS

2017-01-01

K-ras oncogene is a key factor in colorectal cancer. Based on published and our data we propose that K-ras could be the oncogene responsible for the inactivation of the tumor-suppressor gene APC, currently considered as the initial step in colorectal tumorigenesis. K-ras fulfills the criteria of the oncogene-induced DNA damage model, as it can provoke well- established causes for inactivating tumor-suppressors, i.e. DNA double-strand breaks (causing allele deletion) and ROS production (responsible for point mutation). The model we propose is a variation of the currently existing model and hypothesizes that, in a subgroup of colorectal carcinomas, K-ras mutation may precede APC inactivation, representing the earliest driving force and, probably, an early biomarker of colorectal carcinogenesis. This observation is clinically useful, since it may modify the preventive colorectal cancer strategy, restricting numerically patients undergoing colonoscopies to those bearing K-ras mutation in their colorectum, either in benign polyps or the normal accompanying mucosa. PMID:28652417

A cross-sectional study of PRNP gene in two native Sicilian goat populations in Italy: a relation between prion gene polymorphisms and scrapie incidence.

PubMed

Migliore, Sergio; Agnello, Stefano; D'Avola, Salvatore; Goldmann, Wilfred; Di Marco Lo Presti, Vincenzo; Vitale, Maria

2017-06-01

Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative diseases affecting humans and animals, and scrapie in small ruminants is considered the archetype of TSEs. Derivata di Siria is a native dairy goat of Sicily (south Italy), which is related to Syrian goat breeds. Scrapie disease is considered endemic in Sicily since 1997, following the administration of an infected vaccine.Derivata di Siria goatswere involved in six of 66 scrapie-infected flocks in Sicily. Prion protein gene (PRNP) analysis revealed that none of the scrapie cases carried the p.Gln222Lys variant. Sequencing of PRNP in this goat population showed a high frequency (15%) of p.Gln222Lys variant confirming its association with scrapie resistance. PRNP polymorphisms were also analysed in the population of Pantelleria, a small Sicilian Island, where scrapie has never been reported. The native goat breed 'Pantesca' was maintained up to almost 80 years and the size of the sheep population on this island has historically been very low. Currently, a crossbreed goat population of 253 heads is present on the island. PRNP genotyping of Pantelleria goats showed genetic variation, with low presence of wild-type goats and the lack of protective alleles. These data reinforce the association between PRNP polymorphisms in small ruminants and scrapie incidence.

Genetic Diversity in the Prion Protein Gene (PRNP) of Domestic Cattle and Water Buffaloes in Vietnam, Indonesia and Thailand

PubMed Central

UCHIDA, Leo; HERIYANTO, Agus; THONGCHAI, Chalermchaikit; HANH, Tran Thi; HORIUCHI, Motohiro; ISHIHARA, Kanako; TAMURA, Yutaka; MURAMATSU, Yasukazu

2014-01-01

ABSTRACT There has been an accumulation of information on frequencies of insertion/deletion (indel) polymorphisms within the bovine prion protein gene (PRNP) and on the number of octapeptide repeats and single nucleotide polymorphisms (SNPs) in the coding region of bovine PRNP related to bovine spongiform encephalopathy (BSE) susceptibility. We investigated the frequencies of 23-bp indel polymorphism in the promoter region (23indel) and 12-bp indel polymorphism in intron 1 region (12indel), octapeptide repeat polymorphisms and SNPs in the bovine PRNP of cattle and water buffaloes in Vietnam, Indonesia and Thailand. The frequency of the deletion allele in the 23indel site was significantly low in cattle of Indonesia and Thailand and water buffaloes. The deletion allele frequency in the 12indel site was significantly low in all of the cattle and buffaloes categorized in each subgroup. In both indel sites, the deletion allele has been reported to be associated with susceptibility to classical BSE. In some Indonesian local cattle breeds, the frequency of the allele with 5 octapeptide repeats was significantly high despite the fact that the allele with 6 octapeptide repeats has been reported to be most frequent in many breeds of cattle. Four SNPs observed in Indonesian local cattle have not been reported for domestic cattle. This study provided information on PRNP of livestock in these Southeast Asian countries. PMID:24705506

K-ras mutations and HLA-DR expression in large bowel adenomas.

PubMed Central

Norheim Andersen, S.; Breivik, J.; Løvig, T.; Meling, G. I.; Gaudernack, G.; Clausen, O. P.; Schjölberg, A.; Fausa, O.; Langmark, F.; Lund, E.; Rognum, T. O.

1996-01-01

A total of 72 sporadic colorectal adenomas in 56 patients were studied for the presence of point mutations in codons 12 and 13 of the K-ras gene and for HLA-DR antigen expression related to clinicopathological variables. Forty K-ras mutations in 39 adenomas were found (54%): 31 (77%) in codon 12 and nine (23%) in codon 13. There was a strong relationship between the incidence of K-ras mutations and adenoma type, degree of dysplasia and sex. The highest frequency of K-ras mutations was seen in large adenomas of the villous type with high-grade dysplasia. Fourteen out of 15 adenomas obtained from 14 women above 65 years of age carried mutations. HLA-DR positivity was found in 38% of the adenomas, large tumours and those with high-grade dysplasia having the strongest staining. Coexpression of K-ras mutations and HLA-DR was found significantly more frequently in large and highly dysplastic adenomas, although two-way analysis of variance showing size and grade of dysplasia to be the most important variable. None of the adenomas with low-grade dysplasia showed both K-ras mutation and HLA-DR positivity (P = 0.004). K-ras mutation is recognised as an early event in colorectal carcinogenesis. The mutation might give rise to peptides that may be presented on the tumour cell surface by class II molecules, and thereby induce immune responses against neoplastic cells. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8679466

K-ras mutation in colorectal cancer: relations to patient age, sex and tumour location.

PubMed Central

Breivik, J.; Meling, G. I.; Spurkland, A.; Rognum, T. O.; Gaudernack, G.

1994-01-01

DNA from 251 primary tumours obtained from 123 male and 125 female Norwegian patients with colorectal carcinoma was analysed for the presence of K-ras point mutations at codons 12 and 13. Mutations were found in 99 (39%) of the samples. The frequency of K-ras mutations was significantly related to age and sex of the patients, and to the location of the tumours (overall: P = 0.008). K-ras mutations were much less frequent in colonic tumours from male than female patients at younger ages (< 40 years, odds ratio < 0.014). The low frequency might indicate that a different, ras-independent, pathway to neoplasia is dominating in the colon of younger males. In contrast, older men had more mutations than older women (e.g. 90 years, odds ratio = 5.8). An inverse but less pronounced relationship was seen for rectal tumours. The type of mutation was found to be associated to sex of patient and location of tumour. G-->C transversions accounted for 35% of the mutations in rectal tumours from females, in contrast to only 2.5% in the rest of the material (P = 0.0005). This may indicate that there are specific carcinogens acting in this location. PMID:8297737

The Oral Secretion of Infectious Scrapie Prions Occurs in Preclinical Sheep with a Range of PRNP Genotypes

PubMed Central

Gough, Kevin C.; Baker, Claire A.; Rees, Helen C.; Terry, Linda A.; Spiropoulos, John; Thorne, Leigh

2012-01-01

Preclinical sheep with the highly scrapie-susceptible VRQ/VRQ PRNP genotype secrete prions from the oral cavity. In order to further understand the significance of orally available prions, buccal swabs were taken from sheep with a range of PRNP genotypes and analyzed by serial protein misfolding cyclic amplification (sPMCA). Prions were detected in buccal swabs from scrapie-exposed sheep of genotypes linked to high (VRQ/VRQ and ARQ/VRQ) and low (ARR/VRQ and AHQ/VRQ) lymphoreticular system involvement in scrapie pathogenesis. For both groups, the level of prion detection was significantly higher than that for scrapie-resistant ARR/ARR sheep which were kept in the same farm environment and acted as sentinel controls for prions derived from the environment which might contaminate the oral cavity. In addition, sheep with no exposure to the scrapie agent did not contain any measurable prions within the oral cavity. Furthermore, prions were detected in sheep over a wide age range representing various stages of preclinical disease. These data demonstrate that orally available scrapie prions may be a common feature in sheep incubating scrapie, regardless of the PRNP genotype and any associated high-level accumulation of PrPSc within lymphoreticular tissues. PrPSc was present in buccal swabs from a large proportion of sheep with PRNP genotypes associated with relatively low disease penetrance, indicating that subclinical scrapie infection is likely to be a common occurrence. The significance of positive sPMCA reactions was confirmed by the transmission of infectivity in buccal swab extracts to Tg338 mice, illustrating the likely importance of orally available prions in the horizontal transmission of scrapie. PMID:22013047

Comparative Susceptibility of Sheep of Different Origins, Breeds and PRNP Genotypes to Challenge with Bovine Spongiform Encephalopathy and Scrapie

PubMed Central

Houston, Fiona; Goldmann, Wilfred; Foster, James; González, Lorenzo; Jeffrey, Martin; Hunter, Nora

2015-01-01

Sheep are natural hosts of the prion disease, scrapie. They are also susceptible to experimental challenge with various scrapie strains and with bovine spongiform encephalopathy (BSE), which affects cattle and has been accidentally transmitted to a range of other species, including man. Incidence and incubation period of clinical disease in sheep following inoculation is controlled by the PRNP gene, which has different alleles defined on the basis of polymorphisms, particularly at codons 136, 154 and 171, although other codons are associated with survival time, and the exact responses of the sheep may be influenced by other breed-related differences. Here we report the results of a long term single study of experimental scrapie and BSE susceptibility of sheep of Cheviot, Poll Dorset and Suffolk breeds, originating from New Zealand and of a wide range of susceptible and resistant PRNP genotypes. Responses were compared with those of sheep from a closed Cheviot flock of UK origin (Roslin Cheviot flock). The unusually long observation period (6–8 years for most, but up to 12 years for others) allows us to draw robust conclusions about rates of survival of animals previously regarded as resistant to infection, particularly PRNP heterozygotes, and is the most comprehensive such study reported to date. BSE inoculation by an intracerebral route produced disease in all genotype groups with differing incubation periods, although M112T and L141F polymorphisms seemed to give some protection. Scrapie isolate SSBP/1, which has the shortest incubation period in sheep with at least one VRQ PRNP allele, also produced disease following sub-cutaneous inoculation in ARQ/ARQ animals of New Zealand origin, but ARQ/ARQ sheep from the Roslin flock survived the challenge. Our results demonstrate that the links between PRNP genotype and clinical prion disease in sheep are much less secure than previously thought, and may break down when, for example, a different breed of sheep is moved

Clinical resistance associated with a novel MAP2K1 mutation in a patient with Langerhans cell histiocytosis.

PubMed

Azorsa, David O; Lee, David W; Wai, Daniel H; Bista, Ranjan; Patel, Apurvi R; Aleem, Eiman; Henry, Michael M; Arceci, Robert J

2018-05-16

Patients with Langerhans cell histiocytosis (LCH) harbor BRAF V600E and activating mutations of MAP2K1/MEK1 in 50% and 25% of cases, respectively. We evaluated a patient with treatment-refractory LCH for mutations in the RAS-RAF-MEK-ERK pathway and identified a novel mutation in the MAP2K1 gene resulting in a p.L98_K104 > Q deletion and predicted to be auto-activating. During treatment with the MEK inhibitor trametinib, the patient's disease showed significant progression. In vitro characterization of the MAP2K1 p.L98_K104 > Q deletion confirmed its effect on cellular activation of the ERK pathway and drug resistance. © 2018 Wiley Periodicals, Inc.

Somatic mosaicism in a case of apparently sporadic Creutzfeldt-Jakob disease carrying a de novo D178N mutation in the PRNP gene.

PubMed

Alzualde, A; Moreno, F; Martínez-Lage, P; Ferrer, I; Gorostidi, A; Otaegui, D; Blázquez, L; Atares, B; Cardoso, S; Martínez de Pancorbo, M; Juste, R; Rodríguez-Martínez, A B; Indakoetxea, B; López de Munain, A

2010-10-05

Transmissible spongiform encephalopathies (TSEs) are a group of rare fatal neurodegenerative disorders. Creutzfeldt-Jakob disease (CJD) represents the most common form of TSE and can be classified into sporadic, genetic, iatrogenic and variant forms. Genetic cases are related to prion protein gene mutations but they only account for 10-20% of cases. Here we report an apparently sporadic CJD case with negative family history carrying a mutation at codon 178 of prion protein gene. This mutation is a de novo mutation as the parents of the case do not show it. Furthermore the presence of three different alleles (wild type 129M-178D and 129V-178D and mutated 129V-178N), confirmed by different methods, indicates that this de novo mutation is a post-zygotic mutation that produces somatic mosaicism. The proportion of mutated cells in peripheral blood cells and in brain tissue was similar and was estimated at approximately 97%, suggesting that the mutation occurred at an early stage of embryogenesis. Neuropathological examination disclosed spongiform change mainly involving the caudate and putamen, and the cerebral cortex, together with proteinase K-resistant PrP globular deposits in the cerebrum and cerebellum. PrP typing was characterized by a lower band of 21 kDa. This is the first case of mosaicism described in prion diseases and illustrates a potential etiology for apparently sporadic neurodegenerative diseases. In light of this case, genetic counseling for inherited and sporadic forms of transmissible encephalopathies should take into account this possibility for genetic screening procedures.

Experimental validation of the predicted binding site of Escherichia coli K1 outer membrane protein A to human brain microvascular endothelial cells: identification of critical mutations that prevent E. coli meningitis.

PubMed

Pascal, Tod A; Abrol, Ravinder; Mittal, Rahul; Wang, Ying; Prasadarao, Nemani V; Goddard, William A

2010-11-26

Escherichia coli K1, the most common cause of meningitis in neonates, has been shown to interact with GlcNAc1-4GlcNAc epitopes of Ecgp96 on human brain microvascular endothelial cells (HBMECs) via OmpA (outer membrane protein A). However, the precise domains of extracellular loops of OmpA interacting with the chitobiose epitopes have not been elucidated. We report the loop-barrel model of these OmpA interactions with the carbohydrate moieties of Ecgp96 predicted from molecular modeling. To test this model experimentally, we generated E. coli K1 strains expressing OmpA with mutations of residues predicted to be critical for interaction with the HBMEC and tested E. coli invasion efficiency. For these same mutations, we predicted the interaction free energies (including explicit calculation of the entropy) from molecular dynamics (MD), finding excellent correlation (R(2) = 90%) with experimental invasion efficiency. Particularly important is that mutating specific residues in loops 1, 2, and 4 to alanines resulted in significant inhibition of E. coli K1 invasion in HBMECs, which is consistent with the complete lack of binding found in the MD simulations for these two cases. These studies suggest that inhibition of the interactions of these residues of Loop 1, 2, and 4 with Ecgp96 could provide a therapeutic strategy to prevent neonatal meningitis due to E. coli K1.

[Relationship between electrocardiographic and genetic mutation (MYH7-H1717Q, MYLK2-K324E and KCNQ1-R190W) phenotype in patients with hypertrophic cardiomyopathy].

PubMed

Shao, Hong; Zhang, Yanmin; Liu, Liwen; Ma, Zhiling; Zuo, Lei; Ye, Chuang; Wei, Xiaomei; Sun, Chao; Tao, Ling

2016-01-01

To explore the relationship between electrocardiographic (ECG) and genetic mutations of patients with hypertrophic cardiomyopathy (HCM), and early ECG changes in HCM patients. Clinical, 12-lead ECG and echocardiographic examination as well as genetic examinations were made in a three-generation Chinses HCM pedigree with 8 family members (4 males). The clinical characterization and ECG parameters were analyzed and their relationship with genotypes in the family was explored. Four missense mutations (MYH7-H1717Q, MYLK2-K324E, KCNQ1-R190W, TMEM70-I147T) were detected in this pedigree. The proband carried all 4 mutations and 5 members carried 2 mutations. Corrected QTc interval of KCNQ1-H1717Q carriers was significantly prolonged and was consistent with the ECG characterization of long QT syndrome. MYLK2-K324E and KCNQ1-R190W carriers presented with Q wave and(or) depressed ST segment, as well as flatted or reversed T waves in leads from anterolateral and inferior ventricular walls. ECG results showed ST segment depression, flat and inverted T wave in the gene mutation carriers with normal echocardiographic examination results. ECG and echocardiographic results were normal in TMEM70-I147T mutation carrier. The combined mutations of the genes associated with cardiac ion channels and HCM are linked with the ECG phenotype changes in this HCM pedigree. The variations in ECG parameters due to the genetic mutation appear earlier than the echocardiography and clinical manifestations. Variation in ECG may become one of the indexes for early diagnostic screening and disease progression of the HCM gene mutation carriers.

Short-term differential adaptation to anaerobic stress via genomic mutations by Escherichia coli strains K-12 and B lacking alcohol dehydrogenase

PubMed Central

Kim, Hyun Ju; Jeong, Haeyoung; Hwang, Seungwoo; Lee, Moo-Seung; Lee, Yong-Jik; Lee, Dong-Woo; Lee, Sang Jun

2014-01-01

Microbial adaptations often occur via genomic mutations under adverse environmental conditions. This study used Escherichia coli ΔadhE cells as a model system to investigate adaptation to anaerobic conditions, which we then compared with the adaptive mechanisms of two closely related E. coli strains, K-12 and B. In contrast to K-12 ΔadhE cells, the E. coli B ΔadhE cells exhibited significantly delayed adaptive growth under anaerobic conditions. Adaptation by the K-12 and B strains mainly employed anaerobic lactate fermentation to restore cellular growth. Several mutations were identified in the pta or pflB genes of adapted K-12 cells, but mostly in the pta gene of the B strains. However, the types of mutation in the adapted K-12 and B strains were similar. Cellular viability was affected directly by severe redox imbalance in B ΔadhE cells, which also impaired their ability to adapt to anaerobic conditions. This study demonstrates that closely related microorganisms may undergo different adaptations under the same set of adverse conditions, which might be associated with the specific metabolic characteristics of each strain. This study provides new insights into short-term microbial adaptation to stressful conditions, which may reflect dynamic microbial population changes in nature. PMID:25250024

Short-term differential adaptation to anaerobic stress via genomic mutations by Escherichia coli strains K-12 and B lacking alcohol dehydrogenase.

PubMed

Kim, Hyun Ju; Jeong, Haeyoung; Hwang, Seungwoo; Lee, Moo-Seung; Lee, Yong-Jik; Lee, Dong-Woo; Lee, Sang Jun

2014-01-01

Microbial adaptations often occur via genomic mutations under adverse environmental conditions. This study used Escherichia coli ΔadhE cells as a model system to investigate adaptation to anaerobic conditions, which we then compared with the adaptive mechanisms of two closely related E. coli strains, K-12 and B. In contrast to K-12 ΔadhE cells, the E. coli B ΔadhE cells exhibited significantly delayed adaptive growth under anaerobic conditions. Adaptation by the K-12 and B strains mainly employed anaerobic lactate fermentation to restore cellular growth. Several mutations were identified in the pta or pflB genes of adapted K-12 cells, but mostly in the pta gene of the B strains. However, the types of mutation in the adapted K-12 and B strains were similar. Cellular viability was affected directly by severe redox imbalance in B ΔadhE cells, which also impaired their ability to adapt to anaerobic conditions. This study demonstrates that closely related microorganisms may undergo different adaptations under the same set of adverse conditions, which might be associated with the specific metabolic characteristics of each strain. This study provides new insights into short-term microbial adaptation to stressful conditions, which may reflect dynamic microbial population changes in nature.

Conditional Deletion of Prnp Rescues Behavioral and Synaptic Deficits after Disease Onset in Transgenic Alzheimer's Disease

PubMed Central

Kaufman, Adam C.; Herber, Charlotte S.; Haas, Laura T.; Robinson, Sophie; Lee, Michael K.

2017-01-01

Biochemical and genetic evidence implicate soluble oligomeric amyloid-β (Aβo) in triggering Alzheimer's disease (AD) pathophysiology. Moreover, constitutive deletion of the Aβo-binding cellular prion protein (PrPC) prevents development of memory deficits in APPswe/PS1ΔE9 mice, a model of familial AD. Here, we define the role of PrPC to rescue or halt established AD endophenotypes in a therapeutic disease-modifying time window after symptom onset. Deletion of Prnp at either 12 or 16 months of age fully reverses hippocampal synapse loss and completely rescues preexisting behavioral deficits by 17 months. In contrast, but consistent with a neuronal function for Aβo/PrPC signaling, plaque density, microgliosis, and astrocytosis are not altered. Degeneration of catecholaminergic neurons remains unchanged by PrPC reduction after disease onset. These results define the potential of targeting PrPC as a disease-modifying therapy for certain AD-related phenotypes after disease onset. SIGNIFICANCE STATEMENT The study presented here further elucidates our understanding of the soluble oligomeric amyloid-β–Aβo-binding cellular prion protein (PrPC) signaling pathway in a familial form of Alzheimer's disease (AD) by implicating PrPC as a potential therapeutic target for AD. In particular, genetic deletion of Prnp rescued several familial AD (FAD)-associated phenotypes after disease onset in a mouse model of FAD. This study underscores the therapeutic potential of PrPC deletion given that patients already present symptoms at the time of diagnosis. PMID:28842420

200 Deg C Demonstration Transformer Operates Efficiently at 50 kHz

NASA Technical Reports Server (NTRS)

Niedra, Janis M.; Schwarze, Gene E. (Technical Monitor)

2003-01-01

A compact, high temperature demonstration transformer was constructed, using a moly permalloy powder core and Teflon -insulated copper wire. At 50 kHz and 200 C, this 1:2 ratio transformer is capable of 98 percent efficiency when operating at a specific power of 6.1 kW/kg at 4 kW. This roughly 7 cm diameter transformer has a mass of 0.65 kg. Although Teflon is unstable above 200 C, about the same electrical performance was seen at 250 C. A plot of winding loss versus frequency illustrates the need to control these losses at high frequency.

Functional significance of co-occurring mutations in PIK3CA and MAP3K1 in breast cancer.

PubMed

Avivar-Valderas, Alvaro; McEwen, Robert; Taheri-Ghahfarokhi, Amir; Carnevalli, Larissa S; Hardaker, Elizabeth L; Maresca, Marcello; Hudson, Kevin; Harrington, Elizabeth A; Cruzalegui, Francisco

2018-04-20

The PI3Kα signaling pathway is frequently hyper-activated in breast cancer (BrCa), as a result of mutations/amplifications in oncogenes (e.g. HER2 ), decreased function in tumor suppressors (e.g. PTEN ) or activating mutations in key components of the pathway. In particular, activating mutations of PIK3CA (~45%) are frequently found in luminal A BrCa samples. Genomic studies have uncovered inactivating mutations in MAP3K1 (13-20%) and MAP2K4 (~8%), two upstream kinases of the JNK apoptotic pathway in luminal A BrCa samples. Further, simultaneous mutation of PIK3CA and MAP3K1 are found in ~11% of mutant PIK3CA tumors. How these two alterations may cooperate to elicit tumorigenesis and impact the sensitivity to PI3K and AKT inhibitors is currently unknown. Using CRISPR gene editing we have genetically disrupted MAP3K1 expression in mutant PIK3CA cell lines to specifically create in vitro models reflecting the mutational status of PIK3CA and MAP3K1 in BrCa patients. MAP3K1 deficient cell lines exhibited ~2.4-fold increased proliferation rate and decreased sensitivity to PI3Kα/δ(AZD8835) and AKT (AZD5363) inhibitors (~2.61 and ~5.23-fold IC 50 increases, respectively) compared with parental control cell lines. In addition, mechanistic analysis revealed that MAP3K1 disruption enhances AKT phosphorylation and downstream signaling and reduces sensitivity to AZD5363-mediated pathway inhibition. This appears to be a consequence of deficient MAP3K1-JNK signaling increasing IRS1 stability and therefore promoting IRS1 binding to p85, resulting in enhanced PI3Kα activity. Using 3D-MCF10A-PI3Kα H1047R models, we found that MAP3K1 depletion increased overall acinar volume and counteracted AZD5363-mediated reduction of acinar growth due to enhanced proliferation and reduced apoptosis. Furthermore, in vivo efficacy studies revealed that MAP3K1-deficient MCF7 tumors were less sensitive to AKT inhibitor treatment, compared with parental MCF7 tumors. Our study provides

Shadoo/PrP (Sprn0/0/Prnp0/0) double knockout mice

PubMed Central

Daude, Nathalie; Westaway, David

2012-01-01

Shadoo (Sho) is a brain glycoprotein with similarities to the unstructured region of PrPC. Frameshift alleles of the Sho gene, Sprn, are reported in variant Creutzfeldt-Jakob disease (vCJD) patients while Sprn mRNA knockdown in PrP-null (Prnp0/0) embryos produces lethality, advancing Sho as the hypothetical PrP-like “pi” protein. Also, Sho levels are reduced as misfolded PrP accumulates during prion infections. To penetrate these issues we created Sprn null alleles (Daude et al., Proc. Natl. Acad. Sci USA 2012; 109(23): 9035–40). Results from the challenge of Sprn null and TgSprn transgenic mice with rodent-adapted prions coalesce to define downregulation of Sho as a “tracer” for the formation of misfolded PrP. However, classical BSE and rodent-adapted BSE isolates may behave differently, as they do for other facets of the pathogenic process, and this intriguing variation warrants closer scrutiny. With regards to physiological function, double knockout mice (Sprn0/0/Prnp0/0) mice survived to over 600 d of age. This suggests that Sho is not pi, or, given the accumulating data for many activities for PrPC, that the pi hypothesis invoking a discrete signaling pathway to maintain neuronal viability is no longer tenable. PMID:22929230

Occult oncocytic papillary thyroid carcinoma with lymphoid stroma (Warthin-like tumor): report of a case with concomitant mutations of BRAF V600E and V600K.

PubMed

Han, Fei; Zhang, Long; Zhang, Suxia; Zhou, Hong; Yi, Xianghua

2015-01-01

Warthin-Like tumor of the thyroid is a recently described rare variant of papillary thyroid cancer. The distinct histological feature of this variant is papillary architecture lining oncocytic epithelial cells with nuclear characteristics of papillary carcinoma, accompanied by prominent lymphocytic infiltration in the papillary stalks. Here, we present a case of occult Warthin-like papillary thyroid carcinoma, 0.5-cm in maximum dimension, underwent left thyroid lobectomy in a 65 years old Chinese woman. In this case, there was no extrathyroid extension, vascular invasion and lymphatic metastasis, as well as no complication of lymphocytic thyroiditis. Immunohistochemistry staining revealed that the tumor cells were positive for Leu-M1, HBME-1, 34βE12, and MIB-1 labeling index was low. RET/PTC expression was absent in tumor cells. Furthermore, activated point mutations of BRAF V600E and V600K were concurrently detected by DNA sequencing. Further studies are needed to elucidate the prevalence and role of BRAF(V600K) mutation in papillary thyroid carcinoma, and long-term follow-up for the patient is needed to clarify the biological behavior of this variant with dual BRAF mutations.

Occult oncocytic papillary thyroid carcinoma with lymphoid stroma (Warthin-like tumor): report of a case with concomitant mutations of BRAF V600E and V600K

PubMed Central

Han, Fei; Zhang, Long; Zhang, Suxia; Zhou, Hong; Yi, Xianghua

2015-01-01

Warthin-Like tumor of the thyroid is a recently described rare variant of papillary thyroid cancer. The distinct histological feature of this variant is papillary architecture lining oncocytic epithelial cells with nuclear characteristics of papillary carcinoma, accompanied by prominent lymphocytic infiltration in the papillary stalks. Here, we present a case of occult Warthin-like papillary thyroid carcinoma, 0.5-cm in maximum dimension, underwent left thyroid lobectomy in a 65 years old Chinese woman. In this case, there was no extrathyroid extension, vascular invasion and lymphatic metastasis, as well as no complication of lymphocytic thyroiditis. Immunohistochemistry staining revealed that the tumor cells were positive for Leu-M1, HBME-1, 34βE12, and MIB-1 labeling index was low. RET/PTC expression was absent in tumor cells. Furthermore, activated point mutations of BRAF V600E and V600K were concurrently detected by DNA sequencing. Further studies are needed to elucidate the prevalence and role of BRAFV600K mutation in papillary thyroid carcinoma, and long-term follow-up for the patient is needed to clarify the biological behavior of this variant with dual BRAF mutations. PMID:26191315

Prion infectivity in the spleen of a PRNP heterozygous individual with subclinical variant Creutzfeldt–Jakob disease

PubMed Central

Bishop, Matthew T.; Diack, Abigail B.; Ritchie, Diane L.; Ironside, James W.; Will, Robert G.

2013-01-01

Blood transfusion has been identified as a source of human-to-human transmission of variant Creutzfeldt–Jakob disease. Three cases of variant Creutzfeldt–Jakob disease have been identified following red cell transfusions from donors who subsequently developed variant Creutzfeldt–Jakob disease and an asymptomatic red cell transfusion recipient, who did not die of variant Creutzfeldt–Jakob disease, has been identified with prion protein deposition in the spleen and a lymph node, but not the brain. This individual was heterozygous (MV) at codon 129 of the prion protein gene (PRNP), whereas all previous definite and probable cases of variant Creutzfeldt–Jakob disease have been methionine homozygotes (MM). A critical question for public health is whether the prion protein deposition reported in peripheral tissues from this MV individual correlates with infectivity. Additionally it is important to establish whether the PRNP codon 129 genotype has influenced the transmission characteristics of the infectious agent. Brain and spleen from the MV blood recipient were inoculated into murine strains that have consistently demonstrated transmission of the variant Creutzfeldt–Jakob disease agent. Mice were assessed for clinical and pathological signs of disease and transmission data were compared with other transmission studies in variant Creutzfeldt–Jakob disease, including those on the spleen and brain of the donor to the index case. Transmission of variant Creutzfeldt–Jakob disease was observed from the MV blood recipient spleen, but not from the brain, whereas there was transmission from both spleen and brain tissues from the red blood cell donor. Longer incubation times were observed for the blood donor spleen inoculum compared with the blood donor brain inoculum, suggesting lower titres of infectivity in the spleen. The distribution of vacuolar pathology and abnormal prion protein in infected mice were similar following inoculation with both donor and

"Atypical" chronic wasting disease in PRNP genotype 225FF mule deer.

PubMed

Wolfe, Lisa L; Fox, Karen A; Miller, Michael W

2014-07-01

We compared mule deer (Odocoileus hemionus) of two different PRNP genotypes (225SS, 225FF) for susceptibility to chronic wasting disease (CWD) in the face of environmental exposure to infectivity. All three 225SS deer had immunohistochemistry (IHC)-positive tonsil biopsies by 710 days postexposure (dpe), developed classic clinical signs by 723-1,200 dpe, and showed gross and microscopic pathology, enzyme-linked immunosorbent assay (ELISA) results, and IHC staining typical of prion disease in mule deer. In contrast, although all three 225FF deer also became infected, the two individuals surviving >720 dpe had consistently negative biopsies, developed more-subtle clinical signs of CWD, and died 924 or 1,783 dpe. The 225FF deer were "suspect" by ELISA postmortem but showed negative or equivocal IHC staining of lymphoid tissues; both clinically affected 225FF deer had spongiform encephalopathy in the absence of IHC staining in the brain tissue. The experimental cases resembled three cases encountered among five additional captive 225FF deer that were not part of our experiment but also died from CWD. Aside from differences in clinical disease presentation and detection, 225FF mule deer also showed other, more-subtle, atypical traits that may help to explain the rarity of this genotype in natural populations, even in the presence of enzootic CWD.

Development of a 1 kW, 200 C Mapham Inventor

NASA Technical Reports Server (NTRS)

Hammoud, Ahmad; Gerber, Scott; Bauman, Eric; Overton, Eric; Myers, Ira; Bercaw, Robert

1995-01-01

Electronic systems and components are often exposed to high temperature environment in space-based applications, nuclear power facilities, and geothermal energy extraction fields. A key requirement for these systems is, therefore, to withstand the high temperature exposure while maintaining efficient and reliable operation. Efforts were taken to design and develop a high temperature power inverter capable of 200 C operation. A 1 kW, 20 kHz Mapham inverter was designed and evaluated as a function of temperature at different load levels. The inverter system, excluding its input, control, and logic circuits, was characterized at temperatures from ambient to 200 C at 0%, 50%, and 100% resistive loading. With an applied input voltage of 75 VDC, the inverter produced an output of 250 VAC. The results obtained, which indicate good operational characteristics of the inverter up to 200 C, are presented and discussed.

Founder mutations characterise the mutation panorama in 200 Swedish index cases referred for Long QT syndrome genetic testing.

PubMed

Stattin, Eva-Lena; Boström, Ida Maria; Winbo, Annika; Cederquist, Kristina; Jonasson, Jenni; Jonsson, Björn-Anders; Diamant, Ulla-Britt; Jensen, Steen M; Rydberg, Annika; Norberg, Anna

2012-10-25

Long QT syndrome (LQTS) is an inherited arrhythmic disorder characterised by prolongation of the QT interval on ECG, presence of syncope and sudden death. The symptoms in LQTS patients are highly variable, and genotype influences the clinical course. This study aims to report the spectrum of LQTS mutations in a Swedish cohort. Between March 2006 and October 2009, two hundred, unrelated index cases were referred to the Department of Clinical Genetics, Umeå University Hospital, Sweden, for LQTS genetic testing. We scanned five of the LQTS-susceptibility genes (KCNQ1, KCNH2, SCN5A, KCNE1, and KCNE2) for mutations by DHPLC and/or sequencing. We applied MLPA to detect large deletions or duplications in the KCNQ1, KCNH2, SCN5A, KCNE1, and KCNE2 genes. Furthermore, the gene RYR2 was screened in 36 selected LQTS genotype-negative patients to detect cases with the clinically overlapping disease catecholaminergic polymorphic ventricular tachycardia (CPVT). In total, a disease-causing mutation was identified in 103 of the 200 (52%) index cases. Of these, altered exon copy numbers in the KCNH2 gene accounted for 2% of the mutations, whereas a RYR2 mutation accounted for 3% of the mutations. The genotype-positive cases stemmed from 64 distinct mutations, of which 28% were novel to this cohort. The majority of the distinct mutations were found in a single case (80%), whereas 20% of the mutations were observed more than once. Two founder mutations, KCNQ1 p.Y111C and KCNQ1 p.R518*, accounted for 25% of the genotype-positive index cases. Genetic cascade screening of 481 relatives to the 103 index cases with an identified mutation revealed 41% mutation carriers who were at risk of cardiac events such as syncope or sudden unexpected death. In this cohort of Swedish index cases with suspected LQTS, a disease-causing mutation was identified in 52% of the referred patients. Copy number variations explained 2% of the mutations and 3 of 36 selected cases (8%) harboured a mutation in the

Cancer Associated E17K Mutation Causes Rapid Conformational Drift in AKT1 Pleckstrin Homology (PH) Domain

PubMed Central

Kumar, Ambuj; Purohit, Rituraj

2013-01-01

Background AKT1 (v-akt murine thymoma viral oncogene homologue 1) kinase is one of the most frequently activated proliferated and survival pathway of cancer. Recently it has been shown that E17K mutation in the Pleckstrin Homology (PH) domain of AKT1 protein leads to cancer by amplifying the phosphorylation and membrane localization of protein. The mutant has shown resistance to AKT1/2 inhibitor VIII drug molecule. In this study we have demonstrated the detailed structural and molecular consequences associated with the activity regulation of mutant protein. Methods The docking score exhibited significant loss in the interaction affinity to AKT1/2 inhibitor VIII drug molecule. Furthermore, the molecular dynamics simulation studies presented an evidence of rapid conformational drift observed in mutant structure. Results There was no stability loss in mutant as compared to native structure and the major cation–π interactions were also shown to be retained. Moreover, the active residues involved in membrane localization of protein exhibited significant rise in NHbonds formation in mutant. The rise in NHbond formation in active residues accounts for the 4-fold increase in the membrane localization potential of protein. Conclusion The overall result suggested that, although the mutation did not induce any stability loss in structure, the associated pathological consequences might have occurred due to the rapid conformational drifts observed in the mutant AKT1 PH domain. General Significance The methodology implemented and the results obtained in this work will facilitate in determining the core molecular mechanisms of cancer-associated mutations and in designing their potential drug inhibitors. PMID:23741320

24 CFR 200.190 - HUD list of qualified 203(k) consultants.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 24 Housing and Urban Development 2 2012-04-01 2012-04-01 false HUD list of qualified 203(k... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.190 HUD list of qualified 203(k) consultants. (a) Qualified consultant list. HUD maintains a list of qualified consultants for use...

24 CFR 200.190 - HUD list of qualified 203(k) consultants.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false HUD list of qualified 203(k... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.190 HUD list of qualified 203(k) consultants. (a) Qualified consultant list. HUD maintains a list of qualified consultants for use...

24 CFR 200.190 - HUD list of qualified 203(k) consultants.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 24 Housing and Urban Development 2 2013-04-01 2013-04-01 false HUD list of qualified 203(k... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.190 HUD list of qualified 203(k) consultants. (a) Qualified consultant list. HUD maintains a list of qualified consultants for use...

24 CFR 200.190 - HUD list of qualified 203(k) consultants.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 2 2011-04-01 2011-04-01 false HUD list of qualified 203(k... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.190 HUD list of qualified 203(k) consultants. (a) Qualified consultant list. HUD maintains a list of qualified consultants for use...

24 CFR 200.190 - HUD list of qualified 203(k) consultants.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 24 Housing and Urban Development 2 2014-04-01 2014-04-01 false HUD list of qualified 203(k... Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.190 HUD list of qualified 203(k) consultants. (a) Qualified consultant list. HUD maintains a list of qualified consultants for use...

Mutation covariation of HIV-1 CRF07_BC reverse transcriptase during antiretroviral therapy.

PubMed

Li, Zhenpeng; Huang, Yang; Ouyang, Yabo; Xing, Hui; Liao, Lingjie; Jiang, Shibo; Shao, Yiming; Ma, Liying

2013-11-01

To understand the effect of HIV-1 drug resistance mutations in the context of antiretroviral therapy (ART), we compared the prevalence of protease (PR) and reverse transcriptase (RT) mutations in HIV-1 CRF07_BC sequences from blood samples of treatment-naive and ART-treated patients. Mutation covariation in the RT and PR of HIV-1 CRF07_BC viruses from 542 treatment-naive patients and 261 patients treated with lamivudine/zidovudine/nevirapine or lamivudine/zidovudine/efavirenz was analysed. Stratified networks were used to display the mutation covariation. Based on the comparison between treatment-naive and ART-treated patients, three types of featured mutations for RT and PR were initially identified: treatment-associated mutations, treatment-agonistic mutations and overlapping polymorphisms. Twelve significant covariation pairs were found between five treatment-associated mutations (K103N, M184V, Q197K, G190A and Y181C) and nine overlapping polymorphisms (A36E, D39N, Y121H, D123E, R135I, T200A, R277K, L283I and D291E). Meanwhile, three covariation pairs between three treatment-associated mutations (I132L and M184V for RT and I15V for PR) and three overlapping polymorphisms (L10I, L36M and A71V) for PR were also detected. Finally, the overlapping polymorphisms for RT and PR were both found to have significant correlations with treatment-associated mutations, indicating a possible association between polymorphisms and drug resistance. When compared with HIV-1 subtype B under the same regimens as CRF07_BC, the mutation covariations of CRF07_BC showed a distinct pattern of RT and PR mutation covariation. The role of polymorphisms in the development of drug resistance has been widely reported. Here, we found a significant correlation between overlapping polymorphisms for RT and PR and treatment-associated mutations, indicating that polymorphisms exert a global influence on treatment-associated mutations. Polymorphism mutations might therefore be considered before

Two Finnish USH1B patients with three novel mutations in myosin VIIA.

PubMed

Vastinsalo, Hanna; Isosomppi, Juha; Aittakorpi, Anne; Sankila, Eeva-Marja

2006-09-21

Usher syndrome (USH) is an autosomal recessive disorder resulting in retinal degeneration and sensorineural deafness caused by mutations in at least 10 gene loci. USH is divided into three main clinical types: USH1 (33-44%), USH2 (56-67%), and USH3. Worldwide, USH1 and USH2 account for most of the Usher syndrome cases with rare occurrence of USH3. In Finland, however, USH3 is the most common type (40%), explained by genetic and geographical isolation accompanied with a founder mutation, while USH1 is estimated to comprise 34% and USH2 12% of all USH cases. We examined two unrelated Finnish USH1 patients by sequencing. We found three new myosin VIIA (MYO7A) mutations: p.K923AfsX8, p.Q1896X, and p.E1349K. The p.K923AfsX8 mutation was present in both patients as well as in one of 200 Finnish control chromosomes. This is the first molecular genetic study of USH1 in Finland. We have found three new pathological mutations causing either premature termination of translation or replacement of an evolutionary conserved MYO7A amino acid.

Prion protein genotype survey confirms low frequency of scrapie-resistant K222 allele in British goat herds.

PubMed

Goldmann, W; Marier, E; Stewart, P; Konold, T; Street, S; Langeveld, J; Windl, O; Ortiz-Pelaez, A

2016-02-13

Scrapie in goats is a transmissible, fatal prion disease, which is endemic in the British goat population. The recent success in defining caprine PRNP gene variants that provide resistance to experimental and natural classical scrapie has prompted the authors to conduct a survey of PRNP genotypes in 10 goat breeds and 52 herds to find goats with the resistant K222 allele. They report here the frequencies in 1236 tested animals of the resistance-associated K222 and several other alleles by breed and herd. Eight animals were found to be heterozygous QK222 goats (0.64 per cent genotype frequency, 95 per cent CI 0.28 to 1.27 per cent) but no homozygous KK222 goats were detected. The K222 allele was found in Saanen, Toggenburg and Anglo-Nubian goats. The fact that only a few goats with the K222 allele have been identified does not preclude the possibility to design and implement successful breeding programmes at national level. British Veterinary Association.

24 CFR 200.193 - Responsibilities of 203(k) consultants on the list.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Responsibilities of 203(k... Removal Procedures for Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.193 Responsibilities of 203(k) consultants on the list. All consultants included on the list are...

24 CFR 200.193 - Responsibilities of 203(k) consultants on the list.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 2 2011-04-01 2011-04-01 false Responsibilities of 203(k... Removal Procedures for Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.193 Responsibilities of 203(k) consultants on the list. All consultants included on the list are...

24 CFR 200.193 - Responsibilities of 203(k) consultants on the list.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 24 Housing and Urban Development 2 2012-04-01 2012-04-01 false Responsibilities of 203(k... Removal Procedures for Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.193 Responsibilities of 203(k) consultants on the list. All consultants included on the list are...

24 CFR 200.193 - Responsibilities of 203(k) consultants on the list.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 24 Housing and Urban Development 2 2014-04-01 2014-04-01 false Responsibilities of 203(k... Removal Procedures for Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.193 Responsibilities of 203(k) consultants on the list. All consultants included on the list are...

24 CFR 200.193 - Responsibilities of 203(k) consultants on the list.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 24 Housing and Urban Development 2 2013-04-01 2013-04-01 false Responsibilities of 203(k... Removal Procedures for Participation in FHA Programs Section 203(k) Rehabilitation Loan Consultants § 200.193 Responsibilities of 203(k) consultants on the list. All consultants included on the list are...

Characteristics and clinical correlates of MPL 515W>L/K mutation in essential thrombocythemia.

PubMed

Vannucchi, Alessandro M; Antonioli, Elisabetta; Guglielmelli, Paola; Pancrazzi, Alessandro; Guerini, Vittoria; Barosi, Giovanni; Ruggeri, Marco; Specchia, Giorgina; Lo-Coco, Francesco; Delaini, Federica; Villani, Laura; Finotto, Silvia; Ammatuna, Emanuele; Alterini, Renato; Carrai, Valentina; Capaccioli, Gloria; Di Lollo, Simonetta; Liso, Vincenzo; Rambaldi, Alessandro; Bosi, Alberto; Barbui, Tiziano

2008-08-01

Among 994 patients with essential thrombocythemia (ET) who were genotyped for the MPLW515L/K mutation, 30 patients carrying the mutation were identified (3.0%), 8 of whom also displayed the JAK2V671F mutation. MPLW515L/K patients presented lower hemoglobin levels and higher platelet counts than did wild type (wt) MPL; these differences were highly significant compared with MPLwt/JAK2V617F-positive patients. Reduced hemoglobin and increased platelet levels were preferentially associated with the W515L and W515K alleles, respectively. MPL mutation was a significant risk factor for microvessel disturbances, suggesting platelet hyperreactivity associated with constitutively active MPL; arterial thromboses were increased only in comparison to MPLwt/JAK2wt patients. MPLW515L/K patients presented reduced total and erythroid bone marrow cellularity, whereas the numbers of megakaryocytes, megakaryocytic clusters, and small-sized megakaryocytes were all significantly increased. These data indicate that MPLW515L/K mutations do not define a distinct phenotype in ET, although some differences depended on the JAK2V617F mutational status of the counterpart.

Ascertainment Bias Causes False Signal of Anticipation in Genetic Prion Disease

PubMed Central

Minikel, Eric Vallabh; Zerr, Inga; Collins, Steven J.; Ponto, Claudia; Boyd, Alison; Klug, Genevieve; Karch, André; Kenny, Joanna; Collinge, John; Takada, Leonel T.; Forner, Sven; Fong, Jamie C.; Mead, Simon; Geschwind, Michael D.

2014-01-01

Anticipation is the phenomenon whereby age of onset in genetic disease decreases in successive generations. Three independent reports have claimed anticipation in Creutzfeldt-Jakob disease (CJD) caused by the c.598G>A mutation in PRNP encoding a p.Glu200Lys (E200K) substitution in the prion protein. If confirmed, this finding would carry clear implications for genetic counseling. We analyzed pedigrees with this mutation from four prion centers worldwide (n = 217 individuals with the mutation) to analyze age of onset and death in affected and censored individuals. We show through simulation that selective ascertainment of individuals whose onset falls within the historical window since the mutation’s 1989 discovery is sufficient to create robust false signals both of anticipation and of heritability of age of onset. In our data set, the number of years of anticipation observed depends upon how strictly the data are limited by the ascertainment window. Among individuals whose disease was directly observed at a study center, a 28-year difference between parent and child age of onset is observed (p = 0.002), but including individuals ascertained retrospectively through family history reduces this figure to 7 years (p = 0.005). Applying survival analysis to the most thoroughly ascertained subset of data eliminates the signal of anticipation. Moreover, even non-CJD deaths exhibit 16 years anticipation (p = 0.002), indicating that ascertainment bias can entirely explain observed anticipation. We suggest that reports of anticipation in genetic prion disease are driven entirely by ascertainment bias. Guidelines for future studies claiming statistical evidence for anticipation are suggested. PMID:25279981

Ascertainment bias causes false signal of anticipation in genetic prion disease.

PubMed

Minikel, Eric Vallabh; Zerr, Inga; Collins, Steven J; Ponto, Claudia; Boyd, Alison; Klug, Genevieve; Karch, André; Kenny, Joanna; Collinge, John; Takada, Leonel T; Forner, Sven; Fong, Jamie C; Mead, Simon; Geschwind, Michael D

2014-10-02

Anticipation is the phenomenon whereby age of onset in genetic disease decreases in successive generations. Three independent reports have claimed anticipation in Creutzfeldt-Jakob disease (CJD) caused by the c.598G > A mutation in PRNP encoding a p.Glu200Lys (E200K) substitution in the prion protein. If confirmed, this finding would carry clear implications for genetic counseling. We analyzed pedigrees with this mutation from four prion centers worldwide (n = 217 individuals with the mutation) to analyze age of onset and death in affected and censored individuals. We show through simulation that selective ascertainment of individuals whose onset falls within the historical window since the mutation's 1989 discovery is sufficient to create robust false signals both of anticipation and of heritability of age of onset. In our data set, the number of years of anticipation observed depends upon how strictly the data are limited by the ascertainment window. Among individuals whose disease was directly observed at a study center, a 28-year difference between parent and child age of onset is observed (p = 0.002), but including individuals ascertained retrospectively through family history reduces this figure to 7 years (p = 0.005). Applying survival analysis to the most thoroughly ascertained subset of data eliminates the signal of anticipation. Moreover, even non-CJD deaths exhibit 16 years anticipation (p = 0.002), indicating that ascertainment bias can entirely explain observed anticipation. We suggest that reports of anticipation in genetic prion disease are driven entirely by ascertainment bias. Guidelines for future studies claiming statistical evidence for anticipation are suggested. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

K-ras mutations in benzotrichloride-induced lung tumors of A/J mice.

PubMed

You, M; Wang, Y; Nash, B; Stoner, G D

1993-06-01

Benzotrichloride (BTC) is used extensively as a chemical intermediate in the synthesis of benzoyl chloride and benzoyl peroxide. Epidemiological data suggest that BTC is a human lung carcinogen. BTC is also a carcinogen in the A/J mouse lung tumor bioassay. Activated K-ras protooncogenes were detected in BTC-induced lung tumors from A/J mice. The polymerase chain reaction was used to amplify specific DNA segments likely to contain activating mutations, and the amplified DNAs were sequenced to identify the mutation. The activating mutation present in the K-ras gene from all BTC-induced lung tumors (24/24) was a GC-->AT transition in codon 12. Thus, BTC may exert its carcinogenic action by activation of the K-ras protooncogene through a genotoxic mechanism.

Low prevalence of transmitted K65R and other tenofovir resistance mutations across different HIV-1 subtypes: implications for pre-exposure prophylaxis.

PubMed

Chan, Philip A; Huang, Austin; Kantor, Rami

2012-10-15

Tenofovir-containing regimens have demonstrated potential efficacy as pre-exposure prophylaxis (PrEP) in preventing HIV-1 infection. Transmitted drug resistance mutations associated with tenofovir, specifically the reverse transcriptase (RT) mutation K65R, may impact the effectiveness of PrEP. The worldwide prevalence of transmitted tenofovir resistance in different HIV-1 subtypes is unknown. Sequences from treatment-naïve studies and databases were aggregated and analyzed by Stanford Database tools and as per the International AIDS Society (IAS-USA) resistance criteria. RT sequences were collected from GenBank, the Stanford HIV Sequence Database and the Los Alamos HIV Sequence Database. Sequences underwent rigorous quality control measures. Tenofovir-associated resistance mutations included K65R, K70E, T69-insertion and ≥3 thymidine analogue mutations (TAMs), inclusive of M41L or L210W. A total of 19,823 sequences were evaluated across diverse HIV-1 subtypes (Subtype A: 1549 sequences, B: 9783, C: 3198, D: 483, F: 372, G: 594, H: 41, J: 69, K: 239, CRF01_AE: 1797 and CRF02_AG: 1698). Overall, tenofovir resistance prevalence was 0.4% (n=77/19,823, 95% confidence interval or CI: 0.3 to 0.5). K65R was found in 20 sequences (0.1%, 95% CI: 0.06 to 0.15). Differences in the prevalence of K65R between HIV-1 subtypes were not statistically significant. K70E and ≥3 TAMs were found in 0.015% (95% CI: 0.004 to 0.04) and 0.27% (95% CI: 0.2 to 0.4) of sequences, respectively. Prevalence of transmitted K65R and other tenofovir resistance mutations across diverse HIV-1 subtypes and recombinants is low, suggesting minimal effect on tenofovir-containing PrEP regimens.

Genetic profile of scrapie codons 146, 211 and 222 in the PRNP gene locus in three breeds of dairy goats.

PubMed

Vouraki, Sotiria; Gelasakis, Athanasios I; Alexandri, Panoraia; Boukouvala, Evridiki; Ekateriniadou, Loukia V; Banos, Georgios; Arsenos, Georgios

2018-01-01

Polymorphisms at PRNP gene locus have been associated with resistance against classical scrapie in goats. Genetic selection on this gene within appropriate breeding programs may contribute to the control of the disease. The present study characterized the genetic profile of codons 146, 211 and 222 in three dairy goat breeds in Greece. A total of 766 dairy goats from seven farms were used. Animals belonged to two indigenous Greek, Eghoria (n = 264) and Skopelos (n = 287) and a foreign breed, Damascus (n = 215). Genomic DNA was extracted from blood samples from individual animals. Polymorphisms were detected in these codons using Real-Time PCR analysis and four different Custom TaqMan® SNP Genotyping Assays. Genotypic, allelic and haplotypic frequencies were calculated based on individual animal genotypes. Chi-square tests were used to examine Hardy-Weinberg equilibrium state and compare genotypic distribution across breeds. Genetic distances among the three breeds, and between these and 30 breeds reared in other countries were estimated based on haplotypic frequencies using fixation index FST with Arlequin v3.1 software; a Neighbor-Joining tree was created using PHYLIP package v3.695. Level of statistical significance was set at P = 0.01. All scrapie resistance-associated alleles (146S, 146D, 211Q and 222K) were detected in the studied population. Significant frequency differences were observed between the indigenous Greek and Damascus breeds. Alleles 222K and 146S had the highest frequency in the two indigenous and the Damascus breed, respectively (ca. 6.0%). The studied breeds shared similar haplotypic frequencies with most South Italian and Turkish breeds but differed significantly from North-Western European, Far East and some USA goat breeds. Results suggest there is adequate variation in the PRNP gene locus to support breeding programs for enhanced scrapie resistance in goats reared in Greece. Genetic comparisons among goat breeds indicate that separate

K13-propeller mutations confer artemisinin resistance in Plasmodium falciparum clinical isolates

PubMed Central

Straimer, Judith; Gnädig, Nina F.; Witkowski, Benoit; Amaratunga, Chanaki; Duru, Valentine; Ramadani, Arba Pramundita; Dacheux, Mélanie; Khim, Nimol; Zhang, Lei; Lam, Stephen; Gregory, Philip D.; Urnov, Fyodor D.; Mercereau-Puijalon, Odile; Benoit-Vical, Françoise; Fairhurst, Rick M.; Ménard, Didier; Fidock, David A.

2015-01-01

The emergence of artemisinin resistance in Southeast Asia imperils efforts to reduce the global malaria burden. We genetically modified the Plasmodium falciparum K13 locus using zinc-finger nucleases and measured ring-stage survival rates after drug exposure in vitro; these rates correlate with parasite clearance half-lives in artemisinin-treated patients. With isolates from Cambodia, where resistance first emerged, survival rates decreased from 13 to 49% to 0.3 to 2.4% after the removal of K13 mutations. Conversely, survival rates in wild-type parasites increased from ≤0.6% to 2 to 29% after the insertion of K13 mutations. These mutations conferred elevated resistance to recent Cambodian isolates compared with that of reference lines, suggesting a contemporary contribution of additional genetic factors. Our data provide a conclusive rationale for worldwide K13-propeller sequencing to identify and eliminate artemisinin-resistant parasites. PMID:25502314

Cross Sections for the Reactions e+e to K+ K- pi+pi-, K+ K- pi0pi0, and K+ K- K+ K- Measured Using Initial-State Radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lees, J.P.; Poireau, V.; Prencipe, E.

2011-08-19

We study the processes e{sup +}e{sup -} {yields} K{sup +}K{sup -}{pi}{sup +}{pi}-{gamma}, K{sup +}K{sup -}{pi}{sup 0}{pi}{sup 0}{gamma}, and K{sup +}K{sup -}K{sup +}K{sup -}{gamma}, where the photon is radiated from the initial state. About 84000, 8000, and 4200 fully reconstructed events, respectively, are selected from 454 fb{sup -1} of BABAR data. The invariant mass of the hadronic final state defines the e{sup +}e{sup -} center-of-mass energy, so that the K{sup +}K{sup -}{pi}{sup +}{pi}{sup -}{gamma} data can be compared with direct measurements of the e{sup +}e{sup -} {yields} K{sup +}K{sup -}{pi}{sup +}{pi}{sup -} reaction. No direct measurements exist for the e{sup +}e{supmore » -} {yields} K{sup +}K{sup -}{pi}{sup 0}{pi}{sup 0} or e{sup +}e{sup -} {yields} K{sup +}K{sup -}K{sup +}K{sup -} reactions, and we present an update of our previous result with doubled statistics. Studying the structure of these events, we find contributions from a number of intermediate states, and extract their cross sections. In particular, we perform a more detailed study of the e{sup +}e{sup -} {yields} {phi}(1020){pi}{pi}{gamma} reaction, and confirm the presence of the Y (2175) resonance in the {phi}(1020)f{sub 0}(980) and K{sup +}K{sup -} f{sub 0}(980) modes. In the charmonium region, we observe the J/{psi} in all three final states and in several intermediate states, as well as the {phi}(2S) in some modes, and measure the corresponding branching fractions.« less

Cross sections for the reactions e+e-→K+K-π+π-, K+K-π0π0, and K+K-K+K- measured using initial-state radiation events

NASA Astrophysics Data System (ADS)

Lees, J. P.; Poireau, V.; Prencipe, E.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Martinelli, M.; Milanes, D. A.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Brown, D. N.; Kerth, L. T.; Kolomensky, Yu. G.; Lynch, G.; Koch, H.; Schroeder, T.; Asgeirsson, D. J.; Hearty, C.; Mattison, T. S.; McKenna, J. A.; Khan, A.; Blinov, V. E.; Buzykaev, A. R.; Druzhinin, V. P.; Golubev, V. B.; Kravchenko, E. A.; Onuchin, A. P.; Serednyakov, S. I.; Skovpen, Yu. I.; Solodov, E. P.; Todyshev, K. Yu.; Yushkov, A. N.; Bondioli, M.; Curry, S.; Kirkby, D.; Lankford, A. J.; Mandelkern, M.; Stoker, D. P.; Atmacan, H.; Gary, J. W.; Liu, F.; Long, O.; Vitug, G. M.; Campagnari, C.; Hong, T. M.; Kovalskyi, D.; Richman, J. D.; West, C. A.; Eisner, A. M.; Kroseberg, J.; Lockman, W. S.; Martinez, A. J.; Schalk, T.; Schumm, B. A.; Seiden, A.; Cheng, C. H.; Doll, D. A.; Echenard, B.; Flood, K. T.; Hitlin, D. G.; Ongmongkolkul, P.; Porter, F. C.; Rakitin, A. Y.; Andreassen, R.; Dubrovin, M. S.; Meadows, B. T.; Sokoloff, M. D.; Bloom, P. C.; Ford, W. T.; Gaz, A.; Nagel, M.; Nauenberg, U.; Smith, J. G.; Wagner, S. R.; Ayad, R.; Toki, W. H.; Spaan, B.; Kobel, M. J.; Schubert, K. R.; Schwierz, R.; Bernard, D.; Verderi, M.; Clark, P. J.; Playfer, S.; Watson, J. E.; Bettoni, D.; Bozzi, C.; Calabrese, R.; Cibinetto, G.; Fioravanti, E.; Garzia, I.; Luppi, E.; Munerato, M.; Negrini, M.; Piemontese, L.; Baldini-Ferroli, R.; Calcaterra, A.; de Sangro, R.; Finocchiaro, G.; Nicolaci, M.; Pacetti, S.; Patteri, P.; Peruzzi, I. M.; Piccolo, M.; Rama, M.; Zallo, A.; Contri, R.; Guido, E.; Lo Vetere, M.; Monge, M. R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Bhuyan, B.; Prasad, V.; Lee, C. L.; Morii, M.; Edwards, A. J.; Adametz, A.; Marks, J.; Uwer, U.; Bernlochner, F. U.; Ebert, M.; Lacker, H. M.; Lueck, T.; Dauncey, P. D.; Tibbetts, M.; Behera, P. K.; Mallik, U.; Chen, C.; Cochran, J.; Crawley, H. B.; Meyer, W. T.; Prell, S.; Rosenberg, E. I.; Rubin, A. E.; Gritsan, A. V.; Guo, Z. J.; Arnaud, N.; Davier, M.; Derkach, D.; Grosdidier, G.; Le Diberder, F.; Lutz, A. M.; Malaescu, B.; Roudeau, P.; Schune, M. H.; Stocchi, A.; Wormser, G.; Lange, D. J.; Wright, D. M.; Bingham, I.; Chavez, C. A.; Coleman, J. P.; Fry, J. R.; Gabathuler, E.; Hutchcroft, D. E.; Payne, D. J.; Touramanis, C.; Bevan, A. J.; Di Lodovico, F.; Sacco, R.; Sigamani, M.; Cowan, G.; Paramesvaran, S.; Brown, D. N.; Davis, C. L.; Denig, A. G.; Fritsch, M.; Gradl, W.; Hafner, A.; Alwyn, K. E.; Bailey, D.; Barlow, R. J.; Jackson, G.; Lafferty, G. D.; Cenci, R.; Hamilton, B.; Jawahery, A.; Roberts, D. A.; Simi, G.; Dallapiccola, C.; Salvati, E.; Cowan, R.; Dujmic, D.; Sciolla, G.; Lindemann, D.; Patel, P. M.; Robertson, S. H.; Schram, M.; Biassoni, P.; Lazzaro, A.; Lombardo, V.; Palombo, F.; Stracka, S.; Cremaldi, L.; Godang, R.; Kroeger, R.; Sonnek, P.; Summers, D. J.; Nguyen, X.; Taras, P.; De Nardo, G.; Monorchio, D.; Onorato, G.; Sciacca, C.; Raven, G.; Snoek, H. L.; Jessop, C. P.; Knoepfel, K. J.; LoSecco, J. M.; Wang, W. F.; Honscheid, K.; Kass, R.; Brau, J.; Frey, R.; Sinev, N. B.; Strom, D.; Torrence, E.; Feltresi, E.; Gagliardi, N.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Ben-Haim, E.; Bomben, M.; Bonneaud, G. R.; Briand, H.; Calderini, G.; Chauveau, J.; Hamon, O.; Leruste, Ph.; Marchiori, G.; Ocariz, J.; Sitt, S.; Biasini, M.; Manoni, E.; Rossi, A.; Angelini, C.; Batignani, G.; Bettarini, S.; Carpinelli, M.; Casarosa, G.; Cervelli, A.; Forti, F.; Giorgi, M. A.; Lusiani, A.; Neri, N.; Oberhof, B.; Paoloni, E.; Perez, A.; Rizzo, G.; Walsh, J. J.; Lopes Pegna, D.; Lu, C.; Olsen, J.; Smith, A. J. S.; Telnov, A. V.; Anulli, F.; Cavoto, G.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Gaspero, M.; Li Gioi, L.; Mazzoni, M. A.; Piredda, G.; Bünger, C.; Hartmann, T.; Leddig, T.; Schröder, H.; Waldi, R.; Adye, T.; Olaiya, E. O.; Wilson, F. F.; Emery, S.; Hamel de Monchenault, G.; Vasseur, G.; Yèche, Ch.; Aston, D.; Bard, D. J.; Bartoldus, R.; Benitez, J. F.; Cartaro, C.; Convery, M. R.; Dorfan, J.; Dubois-Felsmann, G. P.; Dunwoodie, W.; Field, R. C.; Franco Sevilla, M.; Fulsom, B. G.; Gabareen, A. M.; Graham, M. T.; Grenier, P.; Hast, C.; Innes, W. R.; Kelsey, M. H.; Kim, H.; Kim, P.; Kocian, M. L.; Leith, D. W. G. S.; Lewis, P.; Li, S.; Lindquist, B.; Luitz, S.; Luth, V.; Lynch, H. L.; MacFarlane, D. B.; Muller, D. R.; Neal, H.; Nelson, S.; Ofte, I.; Perl, M.; Pulliam, T.; Ratcliff, B. N.; Roodman, A.; Salnikov, A. A.; Santoro, V.; Schindler, R. H.; Snyder, A.; Su, D.; Sullivan, M. K.; Va'vra, J.; Wagner, A. P.; Weaver, M.; Wisniewski, W. J.; Wittgen, M.; Wright, D. H.; Wulsin, H. W.; Yarritu, A. K.; Young, C. C.; Ziegler, V.; Park, W.; Purohit, M. V.; White, R. M.; Wilson, J. R.; Randle-Conde, A.; Sekula, S. J.; Bellis, M.; Burchat, P. R.; Miyashita, T. S.; Alam, M. S.; Ernst, J. A.; Gorodeisky, R.; Guttman, N.; Peimer, D. R.; Soffer, A.; Lund, P.; Spanier, S. M.; Eckmann, R.; Ritchie, J. L.; Ruland, A. M.; Schilling, C. J.; Schwitters, R. F.; Wray, B. C.; Izen, J. M.; Lou, X. C.; Bianchi, F.; Gamba, D.; Lanceri, L.; Vitale, L.; Lopez-March, N.; Martinez-Vidal, F.; Oyanguren, A.; Ahmed, H.; Albert, J.; Banerjee, Sw.; Choi, H. H. F.; King, G. J.; Kowalewski, R.; Lewczuk, M. J.; Lindsay, C.; Nugent, I. M.; Roney, J. M.; Sobie, R. J.; Gershon, T. J.; Harrison, P. F.; Latham, T. E.; Puccio, E. M. T.; Band, H. R.; Dasu, S.; Pan, Y.; Prepost, R.; Vuosalo, C. O.; Wu, S. L.

2012-07-01

We study the processes e+e-→K+K-π+π-γ, K+K-π0π0γ, and K+K-K+K-γ, where the photon is radiated from the initial state. About 84 000, 8000, and 4200 fully reconstructed events, respectively, are selected from 454fb-1 of BABAR data. The invariant mass of the hadronic final state defines the e+e- center-of-mass energy, so that the K+K-π+π-γ data can be compared with direct measurements of the e+e-→K+K-π+π- reaction. No direct measurements exist for the e+e-→K+K-π0π0 or e+e-→K+K-K+K- reactions, and we present an update of our previous result based on a data sample that is twice as large. Studying the structure of these events, we find contributions from a number of intermediate states and extract their cross sections. In particular, we perform a more detailed study of the e+e-→ϕ(1020)ππγ reaction and confirm the presence of the Y(2175) resonance in the ϕ(1020)f0(980) and K+K-f0(980) modes. In the charmonium region, we observe the J/ψ in all three final states and in several intermediate states, as well as the ψ(2S) in some modes, and measure the corresponding products of branching fraction and electron width.

A 200-kW wind turbine generator conceptual design study

NASA Technical Reports Server (NTRS)

1979-01-01

A conceptual design study was conducted to define a 200 kW wind turbine power system configuration for remote applications. The goal was to attain an energy cost of 1 to 2 cents per kilowatt-hour at a 14-mph site (mean average wind velocity at an altitude of 30 ft.) The costs of the Clayton, New Mexico, Mod-OA (200-kW) were used to identify the components, subsystems, and other factors that were high in cost and thus candidates for cost reduction. Efforts devoted to developing component and subsystem concepts and ideas resulted in a machine concept that is considerably simpler, lighter in weight, and lower in cost than the present Mod-OA wind turbines. In this report are described the various innovations that contributed to the lower cost and lighter weight design as well as the method used to calculate the cost of energy.

Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

PubMed

Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

2014-11-18

Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

Numerical Simulation of MIG for 42 GHz, 200 kW Gyrotron

NASA Astrophysics Data System (ADS)

Singh, Udaybir; Bera, Anirban; Kumar, Narendra; Purohit, L. P.; Sinha, Ashok K.

2010-06-01

A triode type magnetron injection gun (MIG) of a 42 GHz, 200 kW gyrotron for an Indian TOKAMAK system is designed by using the commercially available code EGUN. The operating voltages of the modulating anode and the accelerating anode are 29 kV and 65 kV respectively. The operating mode of the gyrotron is TE03 and it is operated in fundamental harmonic. The simulated results of MIG obtained with the EGUN code are validated with another trajectory code TRAK.

Overview of Air Liquide refrigeration systems between 1.8 K and 200 K

NASA Astrophysics Data System (ADS)

Gondrand, C.; Durand, F.; Delcayre, F.; Crispel, S.; Baguer, G. M. Gistau

2014-01-01

Cryogenic refrigeration systems are necessary for numerous applications. Gas purification and distillation require temperatures between 15 K and 200 K depending on the application, space simulation chambers down to 15 K, superconductivity between 1.8 K and up to 75 K (magnets, cavities or HTS devices like cables, FCL, SMES, etc), Cold Neutron Sources between 15 and 20 K, etc. Air Liquide Advanced Technologies is designing and manufacturing refrigerators since 60 years to satisfy those needs. The step by step developments achieved have led to machines with higher efficiency and reliability. In 1965, reciprocating compressors and Joule Thomson expansion valves were used. In 1969, centripetal expanders began to be used. In 1980, oil lubricated screw compressors took the place of reciprocating compressors and a standard range of Claude cycle refrigerators was developed: the HELIAL series. 1980 was also the time for cryogenic centrifugal compressor development. In 2011, driven by the need for lower operational cost (high efficiency and low maintenance), cycle oil free centrifugal compressors on magnetic bearings were introduced instead of screw compressors. The power extracted by centripetal expanders was recovered. Based on this technology, a range of Turbo-Brayton refrigerators has been designed for temperatures between 40 K and 150 K. On-going development will enable widening the range of Turbo-Brayton refrigerators to cryogenic temperatures down to 15 K.. Cryogenic centrifugal circulators have been developed in order to answer to an increasing demand of 4 K refrigerators able to distribute cold power.

Detection of K-ras gene mutation by liquid biopsy in patients with pancreatic cancer.

PubMed

Kinugasa, Hideaki; Nouso, Kazuhiro; Miyahara, Koji; Morimoto, Yuki; Dohi, Chihiro; Tsutsumi, Koichiro; Kato, Hironari; Matsubara, Takehiro; Okada, Hiroyuki; Yamamoto, Kazuhide

2015-07-01

Cell-free circulating tumor DNA (ctDNA) in serum has been considered to be a useful candidate for noninvasive cancer diagnosis. The current study was designed to estimate the clinical usefulness of genetic analysis for ctDNA by digital polymerase chain reaction in patients with pancreatic cancer. The authors compared K-ras mutations detected in endoscopic ultrasound-guided fine-needle aspiration biopsy tissue DNA and in ctDNA from 75 patients with pancreatic cancer. K-ras mutations in the serum of 66 independent, consecutive patients with pancreatic cancer were also analyzed and the authors compared the results with survival rates. The frequencies of the mutations in tissue samples at G12V, G12D, and G12R in codon 12 were 28 of 75 samples (37.3%), 22 of 75 samples (29.3%), and 6 of 75 samples (8.0%), respectively. Conversely, the rates of the mutations in ctDNA were 26 of 75 samples (34.6%), 29 of 75 samples (38.6%), and 4 of 75 samples (5.3%), respectively. Overall, the K-ras mutation rates in tissue and ctDNA were 74.7% and 62.6%, respectively, and the concordance rate between them was 58 of 75 samples (77.3%). Survival did not appear to differ by the presence of K-ras mutations in tissue DNA, but the survival of patients with K-ras mutations in ctDNA was significantly shorter than that of patients without mutations in both a development set (P = .006) and an independent validation set (P = .002). The difference was especially evident in cases with a G12V mutation. Analysis of ctDNA is a new useful procedure for detecting mutations in patients with pancreatic cancer. This noninvasive method may have great potential as a new strategy for the diagnosis of pancreatic cancer as well as for predicting survival. © 2015 American Cancer Society.

Lack of prion accumulation in lymphoid tissues of PRNP ARQ/ARR sheep intracranially inoculated with the agent of scrapie

USDA-ARS?s Scientific Manuscript database

Sheep scrapie is a transmissible spongiform encephalopathy that can be transmitted horizontally. The prion protein gene (PRNP) profoundly influences the susceptibility of sheep to the scrapie agent and the tissue levels and distribution of PrPSc in affected sheep. The purpose of this study was to co...

Ball Aerospace Advances in 35 K Cooling-The SB235E Cryocooler

NASA Astrophysics Data System (ADS)

Lock, J. S.; Glaister, D. S.; Gully, W.; Hendershott, P.; Marquardt, E.

2008-03-01

This paper describes the design, development, testing and performance of the Ball Aerospace & Technologies Corp. SB235E, a 2-stage long life space cryocooler optimized for 2 cooling loads. The SB235E model is designed to provide simultaneous cooling at 35 K (typically for HgCdTe detectors) and 85 K (typically for optics). The SB235E is a higher capacity model derivative of the SB235. Initial testing of the SB235E has shown performance of 2.13 W at 35 K and 8.14 W at 85 K for 200 W power at 289 K rejection temperature. These data equate to Carnot efficiency of 0.175 or nearly twice that of other published space cryocooler data. Qualification testing has been completed including full performance mapping and vibration export. Performance mapping with the cold-stage temperature varying from 20 K to 80 K and mid-stage temperature varying from 85 K to 175 K are presented. Two engineering models of the SB235E are currently in build.

Long-term follow-up of chronic pancreatitis patients with K-ras mutation in the pancreatic juice.

PubMed

Kamisawa, Terumi; Takuma, Kensuke; Tabata, Taku; Egawa, Naoto; Yamaguchi, Toshikazu

2011-01-01

Pancreatic cancer is known to occur during the course of chronic pancreatitis in some patients. This study aimed to identify a high risk group for developing pancreatic cancer associated with chronic pancreatitis, particularly the presence of K-ras mutations in the pancreatic juice. K-ras mutation was analyzed by enriched polymerase chain reaction-enzyme linked mini-sequence assay in endoscopically-collected pancreatic juice of 21 patients with chronic pancreatitis between 1995 and 2000. All of them were followed-up for 6.0 +/- 3.8 (mean +/- SD) years (range, 2.1-14.2 years). K-ras point mutation was observed in the pancreatic juice of 11 patients with chronic pancreatitis (2+, n=2; 1+, n=6; +/-, n=3). Of these, 2 chronic pancreatitis patients with 2+K-ras point mutation developed pancreatic cancer 4.5 and 10.8 years, respectively, after the examination. Two chronic pancreatitis patients with K-ras mutation developed pancreatic cancer 4.5 and 10.8 years later. Semiquantitative analysis of K-ras mutation in endoscopically-collected pancreatic juice appears to be a useful tool for identifying chronic pancreatitis patients at high risk for developing pancreatic cancer.

Relaxation peak near 200 K in NiTi alloy

NASA Astrophysics Data System (ADS)

Zhu, J. S.; Schaller, R.; Benoit, W.

1989-10-01

Internal friction (IF), frequency ( f), electrical resistance ( R) and zero point movement of the torsion pendulum (ɛ) have been measured in near equi-atomic NiTi alloy in order to clarify the mechanism for the relaxation peak near 200 K. The height of the relaxation peak decreases successively with thermal cycling and settles down to a lower stable value in running 15 cycles. However, the electrical resistance of the sample shows a variation in contrast with the internal friction. Both of them will return to the initial state after a single annealing at 773 K for 1 h. The probable mechanism of this relaxation peak was discussed.

The Frequency and Type of K-RAS Mutations in Mexican Patients With Colorectal Cancer: A National Study.

PubMed

Cárdenas-Ramos, Susana G; Alcázar-González, Gregorio; Reyes-Cortés, Luisa M; Torres-Grimaldo, Abdiel A; Calderón-Garcidueñas, Ana L; Morales-Casas, José; Flores-Sánchez, Patricia; De León-Escobedo, Raúl; Gómez-Díaz, Antonio; Moreno-Bringas, Carmen; Sánchez-Guillén, Jorge; Ramos-Salazar, Pedro; González-de León, César; Barrera-Saldaña, Hugo A

2017-06-01

Current metastatic colorectal cancer (mCRC) therapy uses monoclonal antibodies against the epidermal growth factor receptor. This treatment is only useful in the absence of K-RAS gene mutations; therefore the study of such mutations is part of a personalized treatment. The aim of this work is to determine the frequency and type of the most common K-RAS mutations in Mexican patients with metastatic disease by nucleotide sequencing. We studied 888 patients with mCRC from different regions of Mexico. The presence of mutations in exon 2, codons 12 and 13, of the K-RAS gene was determined by nucleotide sequencing. Patients exhibited K-RAS gene mutations in 35% (310/888) of cases. Mutation frequency of codons 12 and 13 was 71% (221/310) and 29% (89/310), respectively. The most common mutation (45.7%) in codon 12 was c.35G>A (p.G12D), whereas the one in codon 13 was c.38G>A (p.G13D) (78.7%). Given the frequency of K-RAS mutations in Mexicans, making a genetic study before deciding to treat mCRC patients with monoclonal antibodies is indispensable.

The role of polymerase III in conjugation between E. coli K12 donor and recipient strains carrying dnaE ts mutation.

PubMed

Blinkowa, A

1976-01-01

The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.

Overview of Air Liquide refrigeration systems between 1.8 K and 200 K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gondrand, C.; Durand, F.; Delcayre, F.

Cryogenic refrigeration systems are necessary for numerous applications. Gas purification and distillation require temperatures between 15 K and 200 K depending on the application, space simulation chambers down to 15 K, superconductivity between 1.8 K and up to 75 K (magnets, cavities or HTS devices like cables, FCL, SMES, etc), Cold Neutron Sources between 15 and 20 K, etc. Air Liquide Advanced Technologies is designing and manufacturing refrigerators since 60 years to satisfy those needs. The step by step developments achieved have led to machines with higher efficiency and reliability. In 1965, reciprocating compressors and Joule Thomson expansion valves weremore » used. In 1969, centripetal expanders began to be used. In 1980, oil lubricated screw compressors took the place of reciprocating compressors and a standard range of Claude cycle refrigerators was developed: the HELIAL series. 1980 was also the time for cryogenic centrifugal compressor development. In 2011, driven by the need for lower operational cost (high efficiency and low maintenance), cycle oil free centrifugal compressors on magnetic bearings were introduced instead of screw compressors. The power extracted by centripetal expanders was recovered. Based on this technology, a range of Turbo-Brayton refrigerators has been designed for temperatures between 40 K and 150 K. On-going development will enable widening the range of Turbo-Brayton refrigerators to cryogenic temperatures down to 15 K.. Cryogenic centrifugal circulators have been developed in order to answer to an increasing demand of 4 K refrigerators able to distribute cold power.« less

150K - 200K miniature pulse tube cooler for micro satellites

NASA Astrophysics Data System (ADS)

Chassaing, Clément; Butterworth, James; Aigouy, Gérald; Daniel, Christophe; Crespin, Maurice; Duvivier, Eric

2014-01-01

Air Liquide is working with the CNES and Steel électronique in 2013 to design, manufacture and test a Miniature Pulse Tube Cooler (MPTC) to cool infrared detectors for micro-satellite missions. The cooler will be particularly adapted to the needs of the CNES MICROCARB mission to study atmospheric Carbon Dioxide which presents absorption lines in the thermal near infrared, at 1.6 μm and 2.0 μm. The required cooler temperature is from 150 to 200K with cooling power between 1 and 3 watts. The overall electrical power budget including electronics is less than 20W with a 288-300K rejection temperature. Particular attention is therefore paid to optimizing overall system efficiency. The active micro vibration reduction system and thermal control systems already developed for the Air Liquide Large Pulse Tube Cooler (LPTC) are currently being implemented into a new high efficiency electronic architecture. The presented work concerns the new cold finger and electronic design. The cooler uses the compressor already developed for the 80K Miniature Pulse Tube Cryocooler. This Pulse Tube Cooler addresses the requirements of space missions where extended continuous operating life time (>5 years), low mass and low micro vibration levels are critical.

150K - 200K miniature pulse tube cooler for micro satellites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chassaing, Clément; Butterworth, James; Aigouy, Gérald

Air Liquide is working with the CNES and Steel électronique in 2013 to design, manufacture and test a Miniature Pulse Tube Cooler (MPTC) to cool infrared detectors for micro-satellite missions. The cooler will be particularly adapted to the needs of the CNES MICROCARB mission to study atmospheric Carbon Dioxide which presents absorption lines in the thermal near infrared, at 1.6 μm and 2.0 μm. The required cooler temperature is from 150 to 200K with cooling power between 1 and 3 watts. The overall electrical power budget including electronics is less than 20W with a 288-300K rejection temperature. Particular attention ismore » therefore paid to optimizing overall system efficiency. The active micro vibration reduction system and thermal control systems already developed for the Air Liquide Large Pulse Tube Cooler (LPTC) are currently being implemented into a new high efficiency electronic architecture. The presented work concerns the new cold finger and electronic design. The cooler uses the compressor already developed for the 80K Miniature Pulse Tube Cryocooler. This Pulse Tube Cooler addresses the requirements of space missions where extended continuous operating life time (>5 years), low mass and low micro vibration levels are critical.« less

Identification of an Enhancer That Increases miR-200b~200a~429 Gene Expression in Breast Cancer Cells

PubMed Central

Attema, Joanne L.; Bert, Andrew G.; Lim, Yat-Yuen; Kolesnikoff, Natasha; Lawrence, David M.; Pillman, Katherine A.; Smith, Eric; Drew, Paul A.; Khew-Goodall, Yeesim; Shannon, Frances; Goodall, Gregory J.

2013-01-01

The miR-200b~200a~429 gene cluster is a key regulator of EMT and cancer metastasis, however the transcription-based mechanisms controlling its expression during this process are not well understood. We have analyzed the miR-200b~200a~429 locus for epigenetic modifications in breast epithelial and mesenchymal cell lines using chromatin immunoprecipitation assays and DNA methylation analysis. We discovered a novel enhancer located approximately 5.1kb upstream of the miR-200b~200a~429 transcriptional start site. This region was associated with the active enhancer chromatin signature comprising H3K4me1, H3K27ac, RNA polymerase II and CpG dinucleotide hypomethylation. Luciferase reporter assays revealed the upstream enhancer stimulated the transcription of the miR-200b~200a~429 minimal promoter region approximately 27-fold in breast epithelial cells. Furthermore, we found that a region of the enhancer was transcribed, producing a short, GC-rich, mainly nuclear, non-polyadenylated RNA transcript designated miR-200b eRNA. Over-expression of miR-200b eRNA had little effect on miR-200b~200a~429 promoter activity and its production did not correlate with miR-200b~200a~429 gene expression. While additional investigations of miR-200b eRNA function will be necessary, it is possible that miR-200b eRNA may be involved in the regulation of miR-200b~200a~429 gene expression and silencing. Taken together, these findings reveal the presence of a novel enhancer, which contributes to miR-200b~200a~429 transcriptional regulation in epithelial cells. PMID:24086551

Oncogenic and RASopathy-associated K-RAS mutations relieve membrane-dependent occlusion of the effector-binding site.

PubMed

Mazhab-Jafari, Mohammad T; Marshall, Christopher B; Smith, Matthew J; Gasmi-Seabrook, Geneviève M C; Stathopulos, Peter B; Inagaki, Fuyuhiko; Kay, Lewis E; Neel, Benjamin G; Ikura, Mitsuhiko

2015-05-26

K-RAS4B (Kirsten rat sarcoma viral oncogene homolog 4B) is a prenylated, membrane-associated GTPase protein that is a critical switch for the propagation of growth factor signaling pathways to diverse effector proteins, including rapidly accelerated fibrosarcoma (RAF) kinases and RAS-related protein guanine nucleotide dissociation stimulator (RALGDS) proteins. Gain-of-function KRAS mutations occur frequently in human cancers and predict poor clinical outcome, whereas germ-line mutations are associated with developmental syndromes. However, it is not known how these mutations affect K-RAS association with biological membranes or whether this impacts signal transduction. Here, we used solution NMR studies of K-RAS4B tethered to nanodiscs to investigate lipid bilayer-anchored K-RAS4B and its interactions with effector protein RAS-binding domains (RBDs). Unexpectedly, we found that the effector-binding region of activated K-RAS4B is occluded by interaction with the membrane in one of the NMR-observable, and thus highly populated, conformational states. Binding of the RAF isoform ARAF and RALGDS RBDs induced marked reorientation of K-RAS4B from the occluded state to RBD-specific effector-bound states. Importantly, we found that two Noonan syndrome-associated mutations, K5N and D153V, which do not affect the GTPase cycle, relieve the occluded orientation by directly altering the electrostatics of two membrane interaction surfaces. Similarly, the most frequent KRAS oncogenic mutation G12D also drives K-RAS4B toward an exposed configuration. Further, the D153V and G12D mutations increase the rate of association of ARAF-RBD with lipid bilayer-tethered K-RAS4B. We revealed a mechanism of K-RAS4B autoinhibition by membrane sequestration of its effector-binding site, which can be disrupted by disease-associated mutations. Stabilizing the autoinhibitory interactions between K-RAS4B and the membrane could be an attractive target for anticancer drug discovery.

Genotyping of K-ras codons 12 and 13 mutations in colorectal cancer by capillary electrophoresis.

PubMed

Chen, Yen-Ling; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

2009-06-26

Point mutations of the K-ras gene located in codons 12 and 13 cause poor responses to the anti-epidermal growth factor receptor (anti-EGFR) therapy of colorectal cancer (CRC) patients. Besides, mutations of K-ras gene have also been proven to play an important role in human tumor progression. We established a simple and effective capillary electrophoresis (CE) method for simultaneous point mutation detection in codons 12 and 13 of K-ras gene. We combined one universal fluorescence-based nonhuman-sequence primer and two fragment-oriented primers in one tube, and performed this two-in-one polymerase chain reaction (PCR). PCR fragments included wild type and seven point mutations at codons 12 and 13 of K-ras gene. The amplicons were analyzed by single-strand conformation polymorphism (SSCP)-CE method. The CE analysis was performed by using a 1x Tris-borate-EDTA (TBE) buffer containing 1.5% (w/v) hydroxyethylcellulose (HEC) (MW 250,000) under reverse polarity with 15 degrees C and 30 degrees C. Ninety colorectal cancer patients were blindly genotyped using this developed method. The results showed good agreement with those of DNA sequencing method. The SSCP-CE was feasible for mutation screening of K-ras gene in populations.

A Single Mutation in K13 Predominates in Southern China and Is Associated With Delayed Clearance of Plasmodium falciparum Following Artemisinin Treatment.

PubMed

Huang, Fang; Takala-Harrison, Shannon; Jacob, Christopher G; Liu, Hui; Sun, Xiaodong; Yang, Henglin; Nyunt, Myaing M; Adams, Matthew; Zhou, Shuisen; Xia, Zhigui; Ringwald, Pascal; Bustos, Maria Dorina; Tang, Linhua; Plowe, Christopher V

2015-11-15

Artemisinin resistance in Plasmodium falciparum has emerged in Southeast Asia and poses a threat to malaria control and elimination. Mutations in a P. falciparum gene encoding a kelch protein on chromosome 13 have been associated with delayed parasite clearance following artemisinin treatment elsewhere in the region, but not yet in China. Therapeutic efficacy studies of artesunate and dihydroartemisinin-piperaquine were conducted from 2009 to 2012 in the Yunnan Province of China near the border with Myanmar. K13 mutations were genotyped by capillary sequencing of DNA extracted from dried blood spots collected in these clinical trials and in routine surveillance. Associations between K13 mutations and delayed parasite clearance were tested using regression models. Parasite clearance half-lives were prolonged after artemisinin treatment, with 44% of infections having half-lives >5 hours (n = 109). Fourteen mutations in K13 were observed, with an overall prevalence of 47.7% (n = 329). A single mutation, F446I, predominated, with a prevalence of 36.5%. Infections with F446I were significantly associated with parasitemia on day 3 following artemisinin treatment and with longer clearance half-lives. Plasmodium falciparum infections in southern China displayed markedly delayed clearance following artemisinin treatment. F446I was the predominant K13 mutation and was associated with delayed parasite clearance. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern

PubMed Central

Hafner, Christian; López-Knowles, Elena; Luis, Nuno M.; Toll, Agustí; Baselga, Eulàlia; Fernández-Casado, Alex; Hernández, Silvia; Ribé, Adriana; Mentzel, Thomas; Stoehr, Robert; Hofstaedter, Ferdinand; Landthaler, Michael; Vogt, Thomas; Pujol, Ramòn M.; Hartmann, Arndt; Real, Francisco X.

2007-01-01

Activating mutations of the p110 α subunit of PI3K (PIK3CA) oncogene have been identified in a broad spectrum of malignant tumors. However, their role in benign or preneoplastic conditions is unknown. Activating FGF receptor 3 (FGFR3) mutations are common in benign skin lesions, either as embryonic mutations in epidermal nevi (EN) or as somatic mutations in seborrheic keratoses (SK). FGFR3 mutations are also common in low-grade malignant bladder tumors, where they often occur in association with PIK3CA mutations. Therefore, we examined exons 9 and 20 of PIK3CA and FGFR3 hotspot mutations in EN (n = 33) and SK (n = 62), two proliferative skin lesions lacking malignant potential. Nine of 33 (27%) EN harbored PIK3CA mutations; all cases showed the E545G substitution, which is uncommon in cancers. In EN, R248C was the only FGFR3 mutation identified. By contrast, 10 of 62 (16%) SK revealed the typical cancer-associated PIK3CA mutations E542K, E545K, and H1047R. The same lesions displayed a wide range of FGFR3 mutations. Corresponding unaffected tissue was available for four EN and two mutant SK: all control samples displayed a WT sequence, confirming the somatic nature of the mutations found in lesional tissue. Forty of 95 (42%) lesions showed at least one mutation in either gene. PIK3CA and FGFR3 mutations displayed an independent distribution; 5/95 lesions harbored mutations in both genes. Our findings suggest that, in addition to their role in cancer, oncogenic PIK3CA mutations contribute to the pathogenesis of skin tumors lacking malignant potential. The remarkable genotype–phenotype correlation as observed in this study points to a distinct etiopathogenesis of the mutations in keratinocytes occuring either during fetal development or in adult life. PMID:17673550

Simultaneous detection of 19 K-ras mutations by free-solution conjugate electrophoresis of ligase detection reaction products on glass microchips

PubMed Central

Albrecht, Jennifer Coyne; Kotani, Akira; Lin, Jennifer S.; Soper, Steven A.; Barron, Annelise E.

2015-01-01

We demonstrate here the power and flexibility of free-solution conjugate electrophoresis (FSCE) as a method of separating DNA fragments by electrophoresis with no sieving polymer network. Previous work introduced the coupling of FSCE with ligase detection reaction (LDR) to detect point mutations, even at low abundance compared to the wild-type DNA. Here, four large drag-tags are used to achieve free-solution electrophoretic separation of 19 LDR products ranging in size from 42–66 nt that correspond to mutations in the K-ras oncogene. LDR-FSCE enabled electrophoretic resolution of these 19 LDR-FSCE products by CE in 13.5 minutes (E = 310 V/cm) and by microchip electrophoresis in 140 seconds (E = 350 V/cm). The power of FSCE is demonstrated in the unique characteristic of free-solution separations where the separation resolution is constant no matter the electric field strength. By microchip electrophoresis, the electric field was increased to the maximum of the power supply (E = 700 V/cm), and the 19 LDR-FSCE products were separated in < 70 seconds with almost identical resolution to the separation at E = 350 V/cm. These results will aid the goal of screening K-ras mutations on integrated “sample-in/answer-out” devices with amplification, LDR, and detection all on one platform. PMID:23192597

Mutations in repeating structural motifs of tropomyosin cause gain of function in skeletal muscle myopathy patients

PubMed Central

Marston, Steven; Memo, Massimiliano; Messer, Andrew; Papadaki, Maria; Nowak, Kristen; McNamara, Elyshia; Ong, Royston; El-Mezgueldi, Mohammed; Li, Xiaochuan; Lehman, William

2013-01-01

The congenital myopathies include a wide spectrum of clinically, histologically and genetically variable neuromuscular disorders many of which are caused by mutations in genes for sarcomeric proteins. Some congenital myopathy patients have a hypercontractile phenotype. Recent functional studies demonstrated that ACTA1 K326N and TPM2 ΔK7 mutations were associated with hypercontractility that could be explained by increased myofibrillar Ca2+ sensitivity. A recent structure of the complex of actin and tropomyosin in the relaxed state showed that both these mutations are located in the actin–tropomyosin interface. Tropomyosin is an elongated molecule with a 7-fold repeated motif of around 40 amino acids corresponding to the 7 actin monomers it interacts with. Actin binds to tropomyosin electrostatically at two points, through Asp25 and through a cluster of amino acids that includes Lys326, mutated in the gain-of-function mutation. Asp25 interacts with tropomyosin K6, next to K7 that was mutated in the other gain-of-function mutation. We identified four tropomyosin motifs interacting with Asp25 (K6-K7, K48-K49, R90-R91 and R167-K168) and three E-E/D-K/R motifs interacting with Lys326 (E139, E181 and E218), and we predicted that the known skeletal myopathy mutations ΔK7, ΔK49, R91G, ΔE139, K168E and E181K would cause a gain of function. Tests by an in vitro motility assay confirmed that these mutations increased Ca2+ sensitivity, while mutations not in these motifs (R167H, R244G) decreased Ca2+ sensitivity. The work reported here explains the molecular mechanism for 6 out of 49 known disease-causing mutations in the TPM2 and TPM3 genes, derived from structural data of the actin–tropomyosin interface. PMID:23886664

Drug resistance. K13-propeller mutations confer artemisinin resistance in Plasmodium falciparum clinical isolates.

PubMed

Straimer, Judith; Gnädig, Nina F; Witkowski, Benoit; Amaratunga, Chanaki; Duru, Valentine; Ramadani, Arba Pramundita; Dacheux, Mélanie; Khim, Nimol; Zhang, Lei; Lam, Stephen; Gregory, Philip D; Urnov, Fyodor D; Mercereau-Puijalon, Odile; Benoit-Vical, Françoise; Fairhurst, Rick M; Ménard, Didier; Fidock, David A

2015-01-23

The emergence of artemisinin resistance in Southeast Asia imperils efforts to reduce the global malaria burden. We genetically modified the Plasmodium falciparum K13 locus using zinc-finger nucleases and measured ring-stage survival rates after drug exposure in vitro; these rates correlate with parasite clearance half-lives in artemisinin-treated patients. With isolates from Cambodia, where resistance first emerged, survival rates decreased from 13 to 49% to 0.3 to 2.4% after the removal of K13 mutations. Conversely, survival rates in wild-type parasites increased from ≤0.6% to 2 to 29% after the insertion of K13 mutations. These mutations conferred elevated resistance to recent Cambodian isolates compared with that of reference lines, suggesting a contemporary contribution of additional genetic factors. Our data provide a conclusive rationale for worldwide K13-propeller sequencing to identify and eliminate artemisinin-resistant parasites. Copyright © 2015, American Association for the Advancement of Science.

Detection of K-ras gene mutations in feces by magnetic nanoprobe in patients with pancreatic cancer: A preliminary study.

PubMed

Wang, Xiaoguang; Wang, Jingshuai; Chen, Fei; Zhong, Zhengxiang; Qi, Lifeng

2018-01-01

The present study aimed to investigate the feasibility and effectiveness of detecting K-ras mutation by using magnetic nanoparticles in fecal samples of patients with pancreatic cancer at different stages. The novel methodology of K-ras mutation detection was compared to the existing methodology of cancer antigen (CA)19-9 examination. Patients with pancreatic cancer (n=88), pancreatic benign diseases who displayed chronic pancreatitis (n=35), pancreatic mucinous cyst neoplasms (n=10) and pancreatic serous cyst (n=9) admitted to the Department of Surgery, Jiaxing Second Hospital were enrolled in the present study. Fecal samples were collected from all patients, DNA was extracted and magnetic nanoprobe was then used to detect K-ras mutation. The results obtained using the novel magnetic nanoprobe detection technique showed a K-ras mutation rate of 81.8% (72/88) in the patients with pancreatic cancer and 18.5% (10/54) in patients with pancreatic benign diseases. In patients with pancreatic cancer, the K-ras mutation rate was comparable in stages I + IIA and IIB + III + IV (78.9 vs. 84.0%; P>0.05). The sensitivity and specificity of K-ras mutation for detection of pancreatic cancer was 81.8 and 81.5%, respectively. Sixty-eight pancreatic cancer patients had >37 U/ml CA99 with a sensitivity and specificity for pancreatic cancer detection of 77.3 and 77.8%, which was not significantly lower than detection by the fecal K-ras mutations (P>0.05). Combinational detection of fecal K-ras mutations and serum CA19-9 significantly increased the sensitivity regarding pancreatic cancer detection to 97.7% (P<0.05), while the specificity was not enhanced (80.9%; P>0.05) compared with fecal K-ras mutations or CA19-9 alone. The findings showed that the magnetic nanoprobe is able to detect fecal K-ras mutations in different stages of pancreatic cancer, with comparable sensitivity and specificity to CA19-9 examination for differentiating pancreatic cancer. Furthermore, combined detection

Protecting effect of PrP codons M142 and K222 in goats orally challenged with bovine spongiform encephalopathy prions.

PubMed

Fast, C; Goldmann, W; Berthon, P; Tauscher, K; Andréoletti, O; Lantier, I; Rossignol, C; Bossers, A; Jacobs, J G; Hunter, N; Groschup, M H; Lantier, F; Langeveld, J P M

2017-09-19

Breeding towards genetic resistance to prion disease is effective in eliminating scrapie. In sheep, classical forms of scrapie have been eradicated almost completely in several countries by breeding programs using a prion protein (PrP) gene (PRNP) amino acid polymorphism. For goats, field and experimental studies have provided evidence for several amino acid polymorphisms that are associated with resistance to scrapie, but only limited data are available concerning the susceptibility of caprine PRNP genotypes to BSE. In this study, goat kids representing five PRNP genotypes based on three polymorphisms (M142, Q211 and K222 and the wild type I142, R211 and Q222) were orally challenged with bovine or goat BSE. Wild type goats were killed with clinical signs between 24-28 months post inoculation (mpi) to both challenges, and goats with genotype R/Q211 succumbed between 29-36 mpi. I/M142 goats developed clinical signs at 44-45 mpi and M/M142 goats remained healthy until euthanasia at 48 mpi. None of the Q/K222 goats showed definite clinical signs. Taken together the highest attack ratios were seen in wild type and R/Q211 goats, and the lowest in I/M142, M/M142 and Q/K222. In all genotype groups, one or more goats remained healthy within the incubation period in both challenges and without detectable PrP deposition in the tissues. Our data show that both the K222 and M142 polymorphisms lengthen the incubation period significantly compared to wild type animals, but only K222 was associated with a significant increase in resistance to BSE infection after oral exposure to both BSE sources.

Gain of function AMP-activated protein kinase γ3 mutation (AMPKγ3R200Q) in pig muscle increases glycogen storage regardless of AMPK activation.

PubMed

Scheffler, Tracy L; Park, Sungkwon; Roach, Peter J; Gerrard, David E

2016-06-01

Chronic activation of AMP-activated protein kinase (AMPK) increases glycogen content in skeletal muscle. Previously, we demonstrated that a mutation in the ryanodine receptor (RyR1(R615C)) blunts AMPK phosphorylation in longissimus muscle of pigs with a gain of function mutation in the AMPKγ3 subunit (AMPKγ3(R200Q)); this may decrease the glycogen storage capacity of AMPKγ3(R200Q) + RyR1(R615C) muscle. Therefore, our aim in this study was to utilize our pig model to understand how AMPKγ3(R200Q) and AMPK activation contribute to glycogen storage and metabolism in muscle. We selected and bred pigs in order to generate offspring with naturally occurring AMPKγ3(R200Q), RyR1(R615C), and AMPKγ3(R200Q) + RyR1(R615C) mutations, and also retained wild-type littermates (control). We assessed glycogen content and parameters of glycogen metabolism in longissimus muscle. Regardless of RyR1(R615C), AMPKγ3(R200Q) increased the glycogen content by approximately 70%. Activity of glycogen synthase (GS) without the allosteric activator glucose 6-phosphate (G6P) was decreased in AMPKγ3(R200Q) relative to all other genotypes, whereas both AMPKγ3(R200Q) and AMPKγ3(R200Q) + RyR1(R615C) muscle exhibited increased GS activity with G6P. Increased activity of GS with G6P was not associated with increased abundance of GS or hexokinase 2. However, AMPKγ3(R200Q) enhanced UDP-glucose pyrophosphorylase 2 (UGP2) expression approximately threefold. Although UGP2 is not generally considered a rate-limiting enzyme for glycogen synthesis, our model suggests that UGP2 plays an important role in increasing flux to glycogen synthase. Moreover, we have shown that the capacity for glycogen storage is more closely related to the AMPKγ3(R200Q) mutation than activity. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Genetic susceptibility to chronic wasting disease in free-ranging white-tailed deer: complement component C1q and Prnp polymorphisms

USGS Publications Warehouse

Blanchong, Julie A.; Heisey, Dennis M.; Scribner, Kim T.; Libants, Scot V.; Johnson, Chad; Aiken, Judd M.; Langenberg, Julia A.; Samuel, Michael D.

2009-01-01

The genetic basis of susceptibility to chronic wasting disease (CWD) in free-ranging cervids is of great interest. Association studies of disease susceptibility in free-ranging populations, however, face considerable challenges including: the need for large sample sizes when disease is rare, animals of unknown pedigree create a risk of spurious results due to population admixture, and the inability to control disease exposure or dose. We used an innovative matched case–control design and conditional logistic regression to evaluate associations between polymorphisms of complement C1q and prion protein (Prnp) genes and CWD infection in white-tailed deer from the CWD endemic area in south-central Wisconsin. To reduce problems due to admixture or disease-risk confounding, we used neutral genetic (microsatellite) data to identify closely related CWD-positive (n = 68) and CWD-negative (n = 91) female deer to serve as matched cases and controls. Cases and controls were also matched on factors (sex, location, age) previously demonstrated to affect CWD infection risk. For Prnp, deer with at least one Serine (S) at amino acid 96 were significantly less likely to be CWD-positive relative to deer homozygous for Glycine (G). This is the first characterization of genes associated with the complement system in white-tailed deer. No tests for association between any C1q polymorphism and CWD infection were significant at p < 0.05. After controlling for Prnp, we found weak support for an elevated risk of CWD infection in deer with at least one Glycine (G) at amino acid 56 of the C1qC gene. While we documented numerous amino acid polymorphisms in C1q genes none appear to be strongly associated with CWD susceptibility.

Functional studies of p.R132C, p.R149C, p.M283V, p.E431K, and a novel c.652-2A>G mutations of the CYP21A2 gene.

PubMed

Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D; Buzzalino, Noemí; Stivel, Mirta; Ceballos, Nora R; Dain, Liliana

2014-01-01

Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90-95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream.

Functional Studies of p.R132C, p.R149C, p.M283V, p.E431K, and a Novel c.652-2A>G Mutations of the CYP21A2 Gene

PubMed Central

Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D.; Buzzalino, Noemí; Stivel, Mirta

2014-01-01

Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90–95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream. PMID:24667412

Design of 28 GHz, 200 kW Gyrotron for ECRH Applications

NASA Astrophysics Data System (ADS)

Yadav, Vivek; Singh, Udaybir; Kumar, Nitin; Kumar, Anil; Deorani, S. C.; Sinha, A. K.

2013-01-01

This paper presents the design of 28 GHz, 200 kW gyrotron for Indian TOKAMAK system. The paper reports the designs of interaction cavity, magnetron injection gun and RF window. EGUN code is used for the optimization of electron gun parameters. TE03 mode is selected as the operating mode by using the in-house developed code GCOMS. The simulation and optimization of the cavity parameters are carried out by using the Particle-in-cell, three dimensional (3-D)-electromagnetic simulation code MAGIC. The output power more than 250 kW is achieved.

PI3K pathway mutations are associated with longer time to local progression after radioembolization of colorectal liver metastases.

PubMed

Ziv, Etay; Bergen, Michael; Yarmohammadi, Hooman; Boas, F Ed; Petre, E Nadia; Sofocleous, Constantinos T; Yaeger, Rona; Solit, David B; Solomon, Stephen B; Erinjeri, Joseph P

2017-04-04

To establish the relationship between common mutations in the MAPK and PI3K signaling pathways and local progression after radioembolization. Retrospective review of a HIPAA-compliant institutional review-board approved database identified 40 patients with chemo-refractory colorectal liver metastases treated with radioembolization who underwent tumor genotyping for hotspot mutations in 6 key genes in the MAPK/PI3K pathways (KRAS, NRAS, BRAF, MEK1, PIK3CA, and AKT1). Mutation status as well as clinical, tumor, and treatment variables were recorded. These factors were evaluated in relation to time to local progression (TTLP), which was calculated from time of radioembolization to first radiographic evidence of local progression. Predictors of outcome were identified using a proportional hazards model for both univariate and multivariate analysis with death as a competing risk. Sixteen patients (40%) had no mutations in either pathway, eighteen patients (45%) had mutations in the MAPK pathway, ten patients (25%) had mutations in the PI3K pathway and four patients (10%) had mutations in both pathways. The cumulative incidence of progression at 6 and 12 months was 33% and 55% for the PI3K mutated group compared with 76% and 92% in the PI3K wild type group. Mutation in the PI3K pathway was a significant predictor of longer TTLP in both univariate (p=0.031, sHR 0.31, 95% CI: 0.11-0.90) and multivariate (p=0.015, sHR=0.27, 95% CI: 0.096-0.77) analysis. MAPK pathway alterations were not associated with TTLP. PI3K pathway mutation predicts longer time to local progression after radioembolization of colorectal liver metastases.

K13 mutations and pfmdr1 copy number variation in Plasmodium falciparum malaria in Myanmar.

PubMed

Win, Aye A; Imwong, Mallika; Kyaw, Myat P; Woodrow, Charles J; Chotivanich, Kesinee; Hanboonkunupakarn, Borimas; Pukrittayakamee, Sasithon

2016-02-24

Artemisinin-based combination therapy has been first-line treatment for falciparum malaria in Myanmar since 2005. The wide extent of artemisinin resistance in the Greater Mekong sub-region and the presence of mefloquine resistance at the Myanmar-Thailand border raise concerns over resistance patterns in Myanmar. The availability of molecular markers for resistance to both drugs enables assessment even in remote malaria-endemic areas. A total of 250 dried blood spot samples collected from patients with Plasmodium falciparum malarial infection in five malaria-endemic areas across Myanmar were analysed for kelch 13 sequence (k13) and pfmdr1 copy number variation. K13 mutations in the region corresponding to amino acids 210-726 (including the propeller region of the protein) were detected by nested PCR amplification and sequencing, and pfmdr1 copy number variation by real-time PCR. In two sites, a sub-set of patients were prospectively followed up for assessment of day-3 parasite clearance rates after a standard course of artemether-lumefantrine. K13 mutations and pfmdr1 amplification were successfully analysed in 206 and 218 samples, respectively. Sixty-nine isolates (33.5 %) had mutations within the k13 propeller region with 53 of these (76.8 %) having mutations already known to be associated with artemisinin resistance. F446I (32 isolates) and P574L (15 isolates) were the most common examples. K13 mutation was less common in sites in western border regions (29 of 155 isolates) compared to samples from the east and north (40 of 51 isolates; p < 0.0001). The overall proportion of parasites with multiple pfmdr1 copies (greater than 1.5) was 5.5 %. Seven samples showed both k13 mutation and multiple copies of pfmdr1. Only one of 36 patients followed up after artemether-lumefantrine treatment still had parasites at day 3; molecular analysis indicated wild-type k13 and single copy pfmdr1. The proportion of P. falciparum isolates with mutations in the propeller region of k

DISPLACEMENT CASCADE SIMULATION IN TUNGSTEN UP TO 200 KEV OF DAMAGE ENERGY AT 300, 1025, AND 2050 K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Setyawan, Wahyu; Nandipati, Giridhar; Roche, Kenneth J.

2015-09-22

We generated molecular dynamics database of primary defects that adequately covers the range of tungsten recoil energy imparted by 14-MeV neutrons. During this semi annual period, cascades at 150 and 200 keV at 300 and 1025 K were simulated. Overall, we included damage energy up to 200 keV at 300 and 1025 K, and up to 100 keV at 2050 K. We report the number of surviving Frenkel pairs (NF) and the size distribution of defect clusters. The slope of the NF curve versus cascade damage energy (EMD), on a log-log scale, changes at a transition energy (μ). For EMDmore » > μ, the cascade forms interconnected damage regions that facilitate the formation of large clusters of defects. At 300 K and EMD = 200 keV, the largest size of interstitial cluster and vacancy cluster is 266 and 335, respectively. Similarly, at 1025 K and EMD = 200 keV, the largest size of interstitial cluster and vacancy cluster is 296 and 338, respectively. At 2050 K, large interstitial clusters also routinely form, but practically no large vacancy clusters do« less

Silent mutations at codons 65 and 66 in reverse transcriptase alleviate indel formation and restore fitness in subtype B HIV-1 containing D67N and K70R drug resistance mutations

PubMed Central

Telwatte, Sushama; Hearps, Anna C.; Johnson, Adam; Latham, Catherine F.; Moore, Katie; Agius, Paul; Tachedjian, Mary; Sonza, Secondo; Sluis-Cremer, Nicolas; Harrigan, P. Richard; Tachedjian, Gilda

2015-01-01

Resistance to combined antiretroviral therapy (cART) in HIV-1-infected individuals is typically due to nonsynonymous mutations that change the protein sequence; however, the selection of synonymous or ‘silent’ mutations in the HIV-1 genome with cART has been reported. These silent K65K and K66K mutations in the HIV-1 reverse transcriptase (RT) occur in over 35% of drug-experienced individuals and are highly associated with the thymidine analog mutations D67N and K70R, which confer decreased susceptibility to most nucleoside and nucleotide RT inhibitors. However, the basis for selection of these silent mutations under selective drug pressure is unknown. Using Illumina next-generation sequencing, we demonstrate that the D67N/K70R substitutions in HIV-1 RT increase indel frequency by 100-fold at RT codons 65–67, consequently impairing viral fitness. Introduction of either K65K or K66K into HIV-1 containing D67N/K70R reversed the error-prone DNA synthesis at codons 65–67 in RT and improved viral replication fitness, but did not impact RT inhibitor drug susceptibility. These data provide new mechanistic insights into the role of silent mutations selected during antiretroviral therapy and have broader implications for the relevance of silent mutations in the evolution and fitness of RNA viruses. PMID:25765644

Up-regulation of mRNA ventricular PRNP prion protein gene expression in air pollution highly exposed young urbanites: endoplasmic reticulum stress, glucose regulated protein 78, and nanosized particles.

PubMed

Villarreal-Calderon, Rodolfo; Franco-Lira, Maricela; González-Maciel, Angélica; Reynoso-Robles, Rafael; Harritt, Lou; Pérez-Guillé, Beatriz; Ferreira-Azevedo, Lara; Drecktrah, Dan; Zhu, Hongtu; Sun, Qiang; Torres-Jardón, Ricardo; Aragón-Flores, Mariana; Calderón-Garcidueñas, Ana; Diaz, Philippe; Calderón-Garcidueñas, Lilian

2013-11-28

Mexico City Metropolitan Area children and young adults exposed to high concentrations of air pollutants including fine and ultrafine particulate matter (PM) vs. clean air controls, exhibit myocardial inflammation and inflammasome activation with a differential right and left ventricular expression of key inflammatory genes and inflammasomes. We investigated the mRNA expression levels of the prion protein gene PRNP, which plays an important role in the protection against oxidative stress and metal toxicity, and the glucose regulated protein 78, a key protein in endoplasmic reticulum (ER) stress signaling, in ventricular autopsy samples from 30 children and young adults age 19.97 ± 6.8 years with a lifetime of low (n:4) vs. high (n:26) air pollution exposures. Light microscopy and transmission electron microscopy studies were carried out in human ventricles, and electron microscopy studies were also done in 5 young, highly exposed Mexico City dogs. There was significant left ventricular PRNP and bi-ventricular GRP78 mRNA up-regulation in Mexico City young urbanites vs. controls. PRNP up-regulation in the left ventricle was significantly different from the right, p < 0.0001, and there was a strong left ventricular PRNP and GRP78 correlation (p = 0.0005). Marked abnormalities in capillary endothelial cells, numerous nanosized particles in myocardial ER and in abnormal mitochondria characterized the highly exposed ventricles. Early and sustained cardiac ER stress could result in detrimental irreversible consequences in urban children, and while highly complex systems maintain myocardial homeostasis, failure to compensate for chronic myocardial inflammation, oxidative and ER stress, and particles damaging myocardial organelles may prime the development of pathophysiological cardiovascular states in young urbanites. Nanosized PM could play a key cardiac myocyte toxicity role.

Up-Regulation of mRNA Ventricular PRNP Prion Protein Gene Expression in Air Pollution Highly Exposed Young Urbanites: Endoplasmic Reticulum Stress, Glucose Regulated Protein 78, and Nanosized Particles

PubMed Central

Villarreal-Calderon, Rodolfo; Franco-Lira, Maricela; González-Maciel, Angélica; Reynoso-Robles, Rafael; Harritt, Lou; Pérez-Guillé, Beatriz; Ferreira-Azevedo, Lara; Drecktrah, Dan; Zhu, Hongtu; Sun, Qiang; Torres-Jardón, Ricardo; Aragón-Flores, Mariana; Calderón-Garcidueñas, Ana; Diaz, Philippe; Calderón-Garcidueñas, Lilian

2013-01-01

Mexico City Metropolitan Area children and young adults exposed to high concentrations of air pollutants including fine and ultrafine particulate matter (PM) vs. clean air controls, exhibit myocardial inflammation and inflammasome activation with a differential right and left ventricular expression of key inflammatory genes and inflammasomes. We investigated the mRNA expression levels of the prion protein gene PRNP, which plays an important role in the protection against oxidative stress and metal toxicity, and the glucose regulated protein 78, a key protein in endoplasmic reticulum (ER) stress signaling, in ventricular autopsy samples from 30 children and young adults age 19.97 ± 6.8 years with a lifetime of low (n:4) vs. high (n:26) air pollution exposures. Light microscopy and transmission electron microscopy studies were carried out in human ventricles, and electron microscopy studies were also done in 5 young, highly exposed Mexico City dogs. There was significant left ventricular PRNP and bi-ventricular GRP78 mRNA up-regulation in Mexico City young urbanites vs. controls. PRNP up-regulation in the left ventricle was significantly different from the right, p < 0.0001, and there was a strong left ventricular PRNP and GRP78 correlation (p = 0.0005). Marked abnormalities in capillary endothelial cells, numerous nanosized particles in myocardial ER and in abnormal mitochondria characterized the highly exposed ventricles. Early and sustained cardiac ER stress could result in detrimental irreversible consequences in urban children, and while highly complex systems maintain myocardial homeostasis, failure to compensate for chronic myocardial inflammation, oxidative and ER stress, and particles damaging myocardial organelles may prime the development of pathophysiological cardiovascular states in young urbanites. Nanosized PM could play a key cardiac myocyte toxicity role. PMID:24287918

Pathoadaptive Mutations of Escherichia coli K1 in Experimental Neonatal Systemic Infection

PubMed Central

McCarthy, Alex J.; Negus, David; Martin, Patricia; Pechincha, Catarina; Oswald, Eric; Stabler, Richard A.; Taylor, Peter W.

2016-01-01

Although Escherichia coli K1 strains are benign commensals in adults, their acquisition at birth by the newborn may result in life-threatening systemic infections, most commonly sepsis and meningitis. Key features of these infections, including stable gastrointestinal (GI) colonization and age-dependent invasion of the bloodstream, can be replicated in the neonatal rat. We previously increased the capacity of a septicemia isolate of E. coli K1 to elicit systemic infection following colonization of the small intestine by serial passage through two-day-old (P2) rat pups. The passaged strain, A192PP (belonging to sequence type 95), induces lethal infection in all pups fed 2–6 x 106 CFU. Here we use whole-genome sequencing to identify mutations responsible for the threefold increase in lethality between the initial clinical isolate and the passaged derivative. Only four single nucleotide polymorphisms (SNPs), in genes (gloB, yjgV, tdcE) or promoters (thrA) involved in metabolic functions, were found: no changes were detected in genes encoding virulence determinants associated with the invasive potential of E. coli K1. The passaged strain differed in carbon source utilization in comparison to the clinical isolate, most notably its inability to metabolize glucose for growth. Deletion of each of the four genes from the E. coli A192PP chromosome altered the proteome, reduced the number of colonizing bacteria in the small intestine and increased the number of P2 survivors. This work indicates that changes in metabolic potential lead to increased colonization of the neonatal GI tract, increasing the potential for translocation across the GI epithelium into the systemic circulation. PMID:27861552

Pathoadaptive Mutations of Escherichia coli K1 in Experimental Neonatal Systemic Infection.

PubMed

McCarthy, Alex J; Negus, David; Martin, Patricia; Pechincha, Catarina; Oswald, Eric; Stabler, Richard A; Taylor, Peter W

2016-01-01

Although Escherichia coli K1 strains are benign commensals in adults, their acquisition at birth by the newborn may result in life-threatening systemic infections, most commonly sepsis and meningitis. Key features of these infections, including stable gastrointestinal (GI) colonization and age-dependent invasion of the bloodstream, can be replicated in the neonatal rat. We previously increased the capacity of a septicemia isolate of E. coli K1 to elicit systemic infection following colonization of the small intestine by serial passage through two-day-old (P2) rat pups. The passaged strain, A192PP (belonging to sequence type 95), induces lethal infection in all pups fed 2-6 x 106 CFU. Here we use whole-genome sequencing to identify mutations responsible for the threefold increase in lethality between the initial clinical isolate and the passaged derivative. Only four single nucleotide polymorphisms (SNPs), in genes (gloB, yjgV, tdcE) or promoters (thrA) involved in metabolic functions, were found: no changes were detected in genes encoding virulence determinants associated with the invasive potential of E. coli K1. The passaged strain differed in carbon source utilization in comparison to the clinical isolate, most notably its inability to metabolize glucose for growth. Deletion of each of the four genes from the E. coli A192PP chromosome altered the proteome, reduced the number of colonizing bacteria in the small intestine and increased the number of P2 survivors. This work indicates that changes in metabolic potential lead to increased colonization of the neonatal GI tract, increasing the potential for translocation across the GI epithelium into the systemic circulation.

Comparison of next-generation sequencing mutation profiling with BRAF and IDH1 mutation-specific immunohistochemistry.

PubMed

Jabbar, Kausar J; Luthra, Rajalakshmi; Patel, Keyur P; Singh, Rajesh R; Goswami, Rashmi; Aldape, Ken D; Medeiros, L Jeffrey; Routbort, Mark J

2015-04-01

Mutation-specific antibodies for BRAF V600E and IDH1 R132H offer convenient immunohistochemical (IHC) assays to detect these mutations in tumors. Previous studies using these antibodies have shown high sensitivity and specificity, but use in routine diagnosis with qualitative assessment has not been well studied. In this retrospective study, we reviewed BRAF and IDH1 mutation-specific IHC results compared with separately obtained clinical next-generation sequencing results. For 67 tumors with combined IDH1 IHC and mutation data, IHC was unequivocally reported as positive or negative in all cases. Sensitivity of IHC for IDH1 R132H was 98% and specificity was 100% compared with mutation status. Four IHC-negative samples showed non-R132H IDH1 mutations including R132C, R132G, and P127T. For 128 tumors with combined BRAF IHC and mutation data, IHC was positive in 33, negative in 82, and equivocal in 13 tumors. The sensitivity of IHC was 97% and specificity was 99% when including only unequivocally positive or negative results. If equivocal IHC cases were included in the analysis as negative, sensitivity fell to 81%. If equivocal cases were classified as positive, specificity dropped to 91%. Eight IHC-negative samples showed non-V600E BRAF mutations including V600K, N581I, V600M, and K601E. We conclude that IHC for BRAF V600E and IDH1 R132H is relatively sensitive and specific, but there is a discordance rate that is not trivial. In addition, a significant proportion of patients harbor BRAF non-V600E or IDH1 non-R132H mutations not detectable by IHC, potentially limiting utility of IHC screening for BRAF and IDH1 mutations.

Reconstruction of K*+/-(892) in Au +Au Collisions at √sNN = 200 GeV

NASA Astrophysics Data System (ADS)

Zheng, He; STAR Collaboration

2016-09-01

The Relativistic Heavy Ion Collider (RHIC) produces a hot, dense and deconfined Quantum ChromoDynamics (QCD) medium, called the quark-gluon plasma (QGP), with Au +Au collisions at √sNN = 200 GeV. The K*+/-(892) resonance is a short-lived particle with a lifetime shorter than the expected lifetime of the QGP. The K* production may provide an effective tool to probe the QGP properties, such as strangeness enhancement. Experimentally, K*+/- analysis is difficult and less studied previously because of large combinatorial background. In recent years, improvements in data sample statistics and particle identification capability promise better K*+/- measurements. In this presentation, we report the reconstruction of K*+/- resonance via the hadronic decay channel K*+/- (892) ->KS0π+/- as a function of transverse momentum (pT) up to 5 GeV/c for various collision centrality classes. The data are Au +Au collisions at √sNN = 200 GeV collected in the year 2011 run from the STAR experiment. Physics implications of our measurements will also be discussed. For the STAR collaboration.

A case report of adult cerebellar high-grade glioma with H3.1 K27M mutation: a rare example of an H3 K27M mutant cerebellar tumor.

PubMed

Funata, Nobuaki; Nobusawa, Sumihito; Nakata, Satoshi; Yamazaki, Tatsuya; Takabagake, Kazuhiko; Koike, Tsukasa; Maegawa, Tatsuya; Yamada, Ryoji; Shinoura, Nobusada; Mine, Yutaka

2018-01-01

Diffuse midline glioma, H3 K27M mutant, is newly recognized as a distinct category, which usually arises in the brain stem, thalamus or spinal cord of children, and young adults. The oncogenic H3 K27M mutation involves H3.3 (encoded by H3F3A) or H3.1 (encoded by HIST1H3B/HIST1H3C), and the incidence of each mutation differs among the primary sites. Recently, several papers have reported that cerebellar high-grade gliomas in both children and adults also harbor H3 K27 mutation. With the exception of one pediatric case, all of the cases carried the mutation in H3.3. We herein present the case of an adult cerebellar high-grade astrocytic tumor with H3.1 K27M mutation in a 45-year-old man, which also involvedTP53 mutation and was immunonegative for ATRX. Some groups have reported that H3.3 and H3.1 K27M mutations define subgroups of diffuse intrinsic pontine gliomas (DIPGs) with different phenotypes as well as genetic alterations. On comparing the findings of the present case, particularly TP53 mutation status and ATRX expression, to the findings of the previous studies on DIPGs, our case seems unusual among the H3.1 K27M mutant subgroup. Further studies are needed to clarify the exact frequency, clinicopathological characteristics, and genomic alterations of cerebellar gliomas harboring H3 K27M mutation.

A novel missense HGD gene mutation, K57N, in a patient with alkaptonuria.

PubMed

Grasko, Jonathan M; Hooper, Amanda J; Brown, Jeffrey W; McKnight, C James; Burnett, John R

2009-05-01

Alkaptonuria is a rare recessive disorder of phenylalanine/tyrosine metabolism due to a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) caused by mutations in the HGD gene. We report the case of a 38 year-old male with known alkaptonuria who was referred to an adult metabolic clinic after initially presenting to an emergency department with renal colic and subsequently passing black ureteric calculi. He complained of severe debilitating lower back pain, worsening over the last few years. A CT scan revealed marked degenerative changes and severe narrowing of the disc spaces along the entire lumbar spine. Sequencing of the HGD gene revealed that he was a compound heterozygote for a previously described missense mutation in exon 13 (G360R) and a novel missense mutation in exon 3 (K57N). Lys(57) is conserved among species and mutation of this residue is predicted to affect HGD protein function by interfering with substrate traffic at the active site. In summary, we describe an alkaptonuric patient and report a novel missense HGD mutation, K57N.

The cornerstone K-RAS mutation in pancreatic adenocarcinoma: From cell signaling network, target genes, biological processes to therapeutic targeting.

PubMed

Jonckheere, Nicolas; Vasseur, Romain; Van Seuningen, Isabelle

2017-03-01

RAS belongs to the super family of small G proteins and plays crucial roles in signal transduction from membrane receptors in the cell. Mutations of K-RAS oncogene lead to an accumulation of GTP-bound proteins that maintains an active conformation. In the pancreatic ductal adenocarcinoma (PDAC), one of the most deadly cancers in occidental countries, mutations of the K-RAS oncogene are nearly systematic (>90%). Moreover, K-RAS mutation is the earliest genetic alteration occurring during pancreatic carcinogenetic sequence. In this review, we discuss the central role of K-RAS mutations and their tremendous diversity of biological properties by the interconnected regulation of signaling pathways (MAPKs, NF-κB, PI3K, Ral…). In pancreatic ductal adenocarcinoma, transcriptome analysis and preclinical animal models showed that K-RAS mutation alters biological behavior of PDAC cells (promoting proliferation, migration and invasion, evading growth suppressors, regulating mucin pattern, and miRNA expression). K-RAS also impacts tumor microenvironment and PDAC metabolism reprogramming. Finally we discuss therapeutic targeting strategies of K-RAS that have been developed without significant clinical success so far. As K-RAS is considered as the undruggable target, targeting its multiple effectors and target genes should be considered as potential alternatives. Copyright © 2017 Elsevier B.V. All rights reserved.

Endometrial carcinomas with significant mucinous differentiation associated with higher frequency of k-ras mutations: a morphologic and molecular correlation study.

PubMed

Xiong, Jinjun; He, Mai; Jackson, Cynthia; Ou, Joyce J; Sung, C James; Breese, Virgina; Steinhoff, Margaret M; Quddus, M Ruhul; Tejada-Berges, Trevor; Lawrence, W Dwayne

2013-09-01

K-ras gene product in the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway is critical in the development of certain types of malignancies. K-ras mutation-associated pancreatic and ovarian carcinomas often display mucinous differentiation. Previous studies have shown that k-ras mutation is found in 10% to 30% of endometrial carcinomas. We investigated k-ras mutations in several morphologic subtypes of endometrial carcinomas with particular emphasis on various degrees of mucinous differentiation. Genomic DNA was extracted from formalin-fixed paraffin-embedded (FFPE) tissue sections. Polymerase chain reaction amplification for k-ras codons 12 and 13 were performed, followed by sequencing using capillary electrophoresis. The Fisher exact test is used to compare the prevalent difference of k-ras mutation among the groups. P < 0.05 was considered significant. K-ras mutations were detected in 8 (80%) of 10 mucinous carcinomas, 12 (67%) of 18 endometrioid carcinomas (ECs) with significant mucinous differentiation (ECMD), 4 (25%) of 16 ECs, and 1 (9%) of 11 serous carcinomas. The differences were statistically significant between mucinous carcinomas versus EC (P < 0.01) and ECMD versus EC (P < 0.05). The findings suggest that mucinous carcinoma and endometrioid carcinoma with significant mucinous component are more likely to be associated with k-ras mutation. Potential clinical implications of k-ras mutation lies in the management of recurrent or higher-stage endometrial mucinous tumors, which would not be responsive to treatment protocols containing epidermal growth factor receptor inhibitors.

GTP Binding and Oncogenic Mutations May Attenuate Hypervariable Region (HVR)-Catalytic Domain Interactions in Small GTPase K-Ras4B, Exposing the Effector Binding Site*

PubMed Central

Lu, Shaoyong; Banerjee, Avik; Jang, Hyunbum; Zhang, Jian; Gaponenko, Vadim; Nussinov, Ruth

2015-01-01

K-Ras4B, a frequently mutated oncogene in cancer, plays an essential role in cell growth, differentiation, and survival. Its C-terminal membrane-associated hypervariable region (HVR) is required for full biological activity. In the active GTP-bound state, the HVR interacts with acidic plasma membrane (PM) headgroups, whereas the farnesyl anchors in the membrane; in the inactive GDP-bound state, the HVR may interact with both the PM and the catalytic domain at the effector binding region, obstructing signaling and nucleotide exchange. Here, using molecular dynamics simulations and NMR, we aim to figure out the effects of nucleotides (GTP and GDP) and frequent (G12C, G12D, G12V, G13D, and Q61H) and infrequent (E37K and R164Q) oncogenic mutations on full-length K-Ras4B. The mutations are away from or directly at the HVR switch I/effector binding site. Our results suggest that full-length wild-type GDP-bound K-Ras4B (K-Ras4BWT-GDP) is in an intrinsically autoinhibited state via tight HVR-catalytic domain interactions. The looser association in K-Ras4BWT-GTP may release the HVR. Some of the oncogenic mutations weaken the HVR-catalytic domain association in the K-Ras4B-GDP/-GTP bound states, which may facilitate the HVR disassociation in a nucleotide-independent manner, thereby up-regulating oncogenic Ras signaling. Thus, our results suggest that mutations can exert their effects in more than one way, abolishing GTP hydrolysis and facilitating effector binding. PMID:26453300

Teicoplanin resistance in Staphylococcus haemolyticus is associated with mutations in histidine kinases VraS and WalK.

PubMed

Vimberg, Vladimir; Cavanagh, Jorunn Pauline; Benada, Oldřich; Kofroňová, Olga; Hjerde, Erik; Zieglerová, Leona; Balíková Novotná, Gabriela

2018-03-01

We investigated the genetic basis of glycopeptide resistance in laboratory-derived strains of S. haemolyticus with emphasis on differences between vancomycin and teicoplanin. The genomes of two stable teicoplanin-resistant laboratory mutants selected on vancomycin or teicoplanin were sequenced and compared to parental S. haemolyticus strain W2/124. Only the two non-synonymous mutations, VraS Q289K and WalK V550L were identified. No other mutations or genome rearrangements were detected. Increased cell wall thickness, resistance to lysostaphin-induced lysis and adaptation of cell growth rates specifically to teicoplanin were phenotypes observed in a sequenced strain with the VraS Q289K mutation. Neither of the VraS Q289K and WalK V550L mutations was present in the genomes of 121S. haemolyticus clinical isolates. However, all but two of the teicoplanin resistant strains carried non-synonymous SNPs in vraSRTU and walKR-YycHIJ operons pointing to their importance for the glycopeptide resistance. Copyright © 2017 Elsevier Inc. All rights reserved.

Diffuse high-grade gliomas with H3 K27M mutations carry a dismal prognosis independent of tumor location.

PubMed

Karremann, Michael; Gielen, Gerrit H; Hoffmann, Marion; Wiese, Maria; Colditz, Niclas; Warmuth-Metz, Monika; Bison, Brigitte; Claviez, Alexander; van Vuurden, Dannis G; von Bueren, André O; Gessi, Marco; Kühnle, Ingrid; Hans, Volkmar H; Benesch, Martin; Sturm, Dominik; Kortmann, Rolf-Dieter; Waha, Andreas; Pietsch, Torsten; Kramm, Christof M

2018-01-10

The novel entity of "diffuse midline glioma, H3 K27M-mutant" has been defined in the 2016 revision of the World Health Organization (WHO) classification of tumors of the central nervous system (CNS). Tumors of this entity arise in CNS midline structures of predominantly pediatric patients and are associated with an overall dismal prognosis. They are defined by K27M mutations in H3F3A or HIST1H3B/C, encoding for histone 3 variants H3.3 and H3.1, respectively, which are considered hallmark events driving gliomagenesis. Here, we characterized 85 centrally reviewed diffuse gliomas on midline locations enrolled in the nationwide pediatric German HIT-HGG registry regarding tumor site, histone 3 mutational status, WHO grade, age, sex, and extent of tumor resection. We found 56 H3.3 K27M-mutant tumors (66%), 6 H3.1 K27M-mutant tumors (7%), and 23 H3-wildtype tumors (27%). H3 K27M-mutant gliomas shared an aggressive clinical course independent of their anatomic location. Multivariate regression analysis confirmed the significant impact of the H3 K27M mutation as the only independent parameter predictive of overall survival (P = 0.009). In H3 K27M-mutant tumors, neither anatomic midline location nor histopathological grading nor extent of tumor resection had an influence on survival. These results substantiate the clinical significance of considering diffuse midline glioma, H3 K27M-mutant, as a distinct entity corresponding to WHO grade IV, carrying a universally fatal prognosis. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

A novel, de novo mutation in the PRKAG2 gene: infantile-onset phenotype and the signaling pathway involved.

PubMed

Xu, Yanchun; Gray, A; Hardie, D Grahame; Uzun, Alper; Shaw, Sunil; Padbury, James; Phornphutkul, Chanika; Tseng, Yi-Tang

2017-08-01

PRKAG2 encodes the γ 2 -subunit isoform of 5'-AMP-activated protein kinase (AMPK), a heterotrimeric enzyme with major roles in the regulation of energy metabolism in response to cellular stress. Mutations in PRKAG2 have been implicated in a unique hypertrophic cardiomyopathy (HCM) characterized by cardiac glycogen overload, ventricular preexcitation, and hypertrophy. We identified a novel, de novo PRKAG2 mutation (K475E) in a neonate with prenatal onset of HCM. We aimed to investigate the cellular impact, signaling pathways involved, and therapeutic options for K475E mutation using cells stably expressing human wild-type (WT) or the K475E mutant. In human embryonic kidney-293 cells, the K475E mutation induced a marked increase in the basal phosphorylation of T172 and AMPK activity, reduced sensitivity to AMP in allosteric activation, and a loss of response to phenformin. In H9c2 cardiomyocytes, the K475E mutation induced inhibition of AMPK and reduced the response to phenformin and increases in the phosphorylation of p70S6 kinase (p70S6K) and eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1). Primary fibroblasts from the patient with the K475E mutation also showed marked increases in the phosphorylation of p70S6K and 4E-BP1 compared with those from age-matched, nondiseased controls. Moreover, overexpression of K475E induced hypertrophy in H9c2 cells, which was effectively reversed by treatment with rapamycin. Taken together, we have identified a novel, de novo infantile-onset PRKAG2 mutation causing HCM. Our study suggests the K475E mutation induces alteration in basal AMPK activity and results in a hypertrophy phenotype involving the mechanistic target of rapamycin signaling pathway, which can be reversed with rapamycin. NEW & NOTEWORTHY We identified a novel, de novo PRKAG2 mutation (K475E) in the cystathionine β-synthase 3 repeat, a region critical for AMP binding but with no previous reported mutation. Our data suggest the mutation

Pathologic and biochemical characterization of PrPSc from elk with PRNP polymorphisms at codon 132 after experimental infection with the chronic wasting disease agent

USDA-ARS?s Scientific Manuscript database

The Rocky Mountain elk (Cervus elaphus nelsoni) prion protein gene (PRNP) is polymorphic at codon 132, with leucine (L132) and methionine (M132) allelic variants present in the population. In elk experimentally inoculated with the chronic wasting disease (CWD) agent, different incubation periods are...

HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

PubMed

Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

2013-09-23

Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

PB2-Q591K Mutation Determines the Pathogenicity of Avian H9N2 Influenza Viruses for Mammalian Species

PubMed Central

Wang, Congrong; Lee, Horace Hok Yeung; Yang, Zi Feng; Mok, Chris Ka Pun; Zhang, Zhi

2016-01-01

Background Influenza A subtype H9N2 is widespread and prevalent in poultry. It has repeatedly transmitted zoonotically to cause mild influenza-like illness in humans and is regarded as a potential pandemic candidate. In additon, the six internal genes of H7N9 and H10N8 viruses which caused infection in human in China as well as some of the highly pathogenic H5N1 strains are origined from H9N2. Previous studies have shown that the mammalian adaptation PB2-Q591K contributes to the pathogenicity of H5N1 and H7N9 viruses. However, the role of the PB2-Q591K mutation in H9N2 subtype is still not well understood. Methods To define and compare the individual role of PB2-Q591K substitution in the PB2 gene segment of H9N2 in relation to polymerase activity, replication competence and the pathogenicity using in vitro and in vivo models. Results The PB2-Q591K mutation in H9N2 virus enhanced the polymerase activity and virus replication in human NHBE cells when compared to the wild type strain. Mice infected with the PB2 mutant showed significant weight loss, higher virus replication and immune responses in the lungs. Conclusions Our evidences suggest that the PB2-Q591K, in addition to the -E627K mutation in H9N2 enhanced the pathogenicity in mammalian host. PMID:27684944

The H3.3 K27M mutation results in a poorer prognosis in brainstem gliomas than thalamic gliomas in adults.

PubMed

Feng, Jie; Hao, Shuyu; Pan, Changcun; Wang, Yu; Wu, Zhen; Zhang, Junting; Yan, Hai; Zhang, Liwei; Wan, Hong

2015-11-01

Brainstem and thalamic gliomas are rare, and they are poorly understood in adults. Genetic aberrations that occur in these tumors are still unknown. In this study, we investigated whether thalamic gliomas have different genetic aberrations and clinical outcomes compared with brainstem gliomas in adults. Forty-three glioma samples were selected, including 28 brainstem and 15 thalamic gliomas. The frequency of the K27M mutation in adult midline gliomas was 58.1%. High-grade gliomas in the thalamus were statistically significantly more numerous than brainstem gliomas. Patients with K27M mutant brainstem gliomas had a significantly shorter overall survival than patients with wild-type tumors (P = .020) by Cox regression after adjustment for other independent risk factors. However, there was no statistical tendency toward a poorer overall survival in thalamic gliomas containing the K27M mutation compared with wild-type tumors. The presence of the K27M mutation significantly corresponded with mutations in TP53 in thalamic gliomas. Interestingly, the K27M mutation was mutually exclusive with mutations in IDH1, which was detected only in brainstem gliomas. The microarray data identified 86 differentially expressed genes between brainstem and thalamic gliomas with the K27M mutation. The cyclin-dependent kinase 6 (CDK6) gene, which plays an important role in cancer pathways, was found to be differentially expressed between brainstem and thalamic gliomas with K27M mutations. Although the K27M mutation was frequently observed in adult brainstem and thalamic gliomas, this mutation tended to be associated with a poorer prognosis in brainstem gliomas but not in thalamic gliomas. Brainstem gliomas may present different genetic aberrations from thalamic gliomas. These differences may provide guidance for therapeutic decisions for the treatment of adult brainstem and thalamic gliomas, which may have different molecular targets. Copyright © 2015. Published by Elsevier Inc.

Efficient edition of the bovine PRNP prion gene in somatic cells and IVF embryos using the CRISPR/Cas9 system.

PubMed

Bevacqua, R J; Fernandez-Martín, R; Savy, V; Canel, N G; Gismondi, M I; Kues, W A; Carlson, D F; Fahrenkrug, S C; Niemann, H; Taboga, O A; Ferraris, S; Salamone, D F

2016-11-01

The recently developed engineered nucleases, such as zinc-finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated nuclease (Cas) 9, provide new opportunities for gene editing in a straightforward manner. However, few reports are available regarding CRISPR application and efficiency in cattle. Here, the CRISPR/Cas9 system was used with the aim of inducing knockout and knock-in alleles of the bovine PRNP gene, responsible for mad cow disease, both in bovine fetal fibroblasts and in IVF embryos. Five single-guide RNAs were designed to target 875 bp of PRNP exon 3, and all five were codelivered with Cas9. The feasibility of inducing homologous recombination (HR) was evaluated with a reporter vector carrying EGFP flanked by 1 kbp PRNP regions (pHRegfp). For somatic cells, plasmids coding for Cas9 and for each of the five single-guide RNAs (pCMVCas9 and pSPgRNAs) were transfected under two different conditions (1X and 2X). For IVF zygotes, cytoplasmic injection was conducted with either plasmids or mRNA. For plasmid injection groups, 1 pg pCMVCas9 + 0.1 pg of each pSPgRNA (DNA2X) was used per zygote. In the case of RNA, two amounts (RNA1X and RNA2X) were compared. To assess the occurrence of HR, a group additionally cotransfected or coinjected with pHRegfp plasmid was included. Somatic cell lysates were analyzed by polymerase chain reaction and surveyor assay. In the case of embryos, the in vitro development and the genotype of blastocysts were evaluated by polymerase chain reaction and sequencing. In somatic cells, 2X transfection resulted in indels and large deletions of the targeted PRNP region. Regarding embryo injection, higher blastocyst rates were obtained for RNA injected groups (46/103 [44.6%] and 55/116 [47.4%] for RNA1X and RNA2X) than for the DNA2X group (26/140 [18.6%], P < 0.05). In 46% (26/56) of the total sequenced blastocysts, specific gene editing was

The phenotype of polycythemia due to Croatian homozygous VHL (571C>G:H191D) mutation is different from that of Chuvash polycythemia (VHL 598C>T:R200W)

PubMed Central

Tomasic, Nikica Ljubas; Piterkova, Lucie; Huff, Chad; Bilic, Ernest; Yoon, Donghoon; Miasnikova, Galina Y.; Sergueeva, Adelina I.; Niu, Xiaomei; Nekhai, Sergei; Gordeuk, Victor; Prchal, Josef T.

2013-01-01

Mutations of VHL (a negative regulator of hypoxia-inducible factors) have position-dependent distinct cancer phenotypes. Only two known inherited homozygous VHL mutations exist and they cause polycythemia: Chuvash R200W and Croatian H191D. We report a second polycythemic Croatian H191D homozygote distantly related to the first propositus. Three generations of both families were genotyped for analysis of shared ancestry. Biochemical and molecular tests were performed to better define their phenotypes, with an emphasis on a comparison with Chuvash polycythemia. The VHL H191D mutation did not segregate in the family defined by the known common ancestors of the two subjects, suggesting a high prevalence in Croatians, but haplotype analysis indicated an undocumented common ancestor ∼six generations ago as the founder of this mutation. We show that erythropoietin levels in homozygous VHL H191D individuals are higher than in VHL R200W patients of similar ages, and their native erythroid progenitors, unlike Chuvash R200W, are not hypersensitive to erythropoietin. This observation contrasts with a report suggesting that polycythemia in VHL R200W and H191D homozygotes is due to the loss of JAK2 regulation from VHL R200W and H191D binding to SOCS1. In conclusion, our studies further define the hematologic phenotype of VHL H191D and provide additional evidence for phenotypic heterogeneity associated with the positional effects of VHL mutations. PMID:23403324

The phenotype of polycythemia due to Croatian homozygous VHL (571C>G:H191D) mutation is different from that of Chuvash polycythemia (VHL 598C>T:R200W).

PubMed

Tomasic, Nikica Ljubas; Piterkova, Lucie; Huff, Chad; Bilic, Ernest; Yoon, Donghoon; Miasnikova, Galina Y; Sergueeva, Adelina I; Niu, Xiaomei; Nekhai, Sergei; Gordeuk, Victor; Prchal, Josef T

2013-04-01

Mutations of VHL (a negative regulator of hypoxia-inducible factors) have position-dependent distinct cancer phenotypes. Only two known inherited homozygous VHL mutations exist and they cause polycythemia: Chuvash R200W and Croatian H191D. We report a second polycythemic Croatian H191D homozygote distantly related to the first propositus. Three generations of both families were genotyped for analysis of shared ancestry. Biochemical and molecular tests were performed to better define their phenotypes, with an emphasis on a comparison with Chuvash polycythemia. The VHL H191D mutation did not segregate in the family defined by the known common ancestors of the two subjects, suggesting a high prevalence in Croatians, but haplotype analysis indicated an undocumented common ancestor ∼six generations ago as the founder of this mutation. We show that erythropoietin levels in homozygous VHL H191D individuals are higher than in VHL R200W patients of similar ages, and their native erythroid progenitors, unlike Chuvash R200W, are not hypersensitive to erythropoietin. This observation contrasts with a report suggesting that polycythemia in VHL R200W and H191D homozygotes is due to the loss of JAK2 regulation from VHL R200W and H191D binding to SOCS1. In conclusion, our studies further define the hematologic phenotype of VHL H191D and provide additional evidence for phenotypic heterogeneity associated with the positional effects of VHL mutations.

Solubility of carbon monoxide in n-hexane between 293 and 473 K and CO pressures up to 200 bar

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koelliker, R.; Thies, H.

The solubility of carbon monoxide, CO, in n-hexane was measured at 293, 323, 373, 423, and 473 K for CO partial pressures up to 200 bar. The enthalpy of solution was calculated between 293 and 473 K. Using the Krichevsky-Ilinskaya equation of state, the solubility of CO in n-hexane can be calculated between 293 and 423 K for CO partial pressures up to 200 bar with an accuracy better than 5%.

Elucidation of the molecular mechanism of heat shock proteins and its correlation with K722Q mutations in Lon protease.

PubMed

Bhattacharjee, Sanchari; Dasgupta, Rakhi; Bagchi, Angshuman

2017-09-01

Cells withstand the effects of temperature change with the help of small heat shock proteins IbpA and IbpB. The IbpAB protein complex interacts with Lon protease in their free form and gets degraded at physiological temperature when there is no temperature stress. However, the proteolytic degradation of IbpAB is diminished when Lon is mutated. The mutation K722Q in Lon brings about some structural changes so that the proteolytic interactions between the heat shock proteins with that of the mutated Lon protease are lost. However, the detailed molecular aspects of the interactions are not yet fully understood. In the present, we made an attempt to analyze the biochemical aspects of the interactions between the small heat shock proteins IbpAB with wild type and mutant Lon protease. We for the first time deciphered the molecular details of the mechanism of interaction of small heat shock proteins with Lon protease bearing K722Q mutation i.e. the interaction pattern of heat shock proteins with mutant Lon protease at physiological temperature in absence of proteolytic machinery. Our study may therefore be useful to elucidate the mechanistic details of the correlation with IbpA, IbpB and Lon protease. Copyright © 2017 Elsevier B.V. All rights reserved.

IgE sensitization in relation to preschool eczema and filaggrin mutation.

PubMed

Johansson, Emma Kristin; Bergström, Anna; Kull, Inger; Lind, Tomas; Söderhäll, Cilla; van Hage, Marianne; Wickman, Magnus; Ballardini, Natalia; Wahlgren, Carl-Fredrik

2017-12-01

Eczema (atopic dermatitis) is associated with an increased risk of having IgE antibodies. IgE sensitization can occur through an impaired skin barrier. Filaggrin gene (FLG) mutation is associated with eczema and possibly also with IgE sensitization. We sought to explore the longitudinal relation between preschool eczema (PSE), FLG mutation, or both and IgE sensitization in childhood. A total of 3201 children from the BAMSE (Children Allergy Milieu Stockholm Epidemiology) birth cohort recruited from the general population were included. Regular parental questionnaires identified children with eczema. Blood samples were collected at 4, 8, and 16 years of age for analysis of specific IgE. FLG mutation analysis was performed on 1890 of the children. PSE was associated with IgE sensitization to both food allergens and aeroallergens up to age 16 years (overall adjusted odds ratio, 2.30; 95% CI, 2.00-2.66). This association was even stronger among children with persistent PSE. FLG mutation was associated with IgE sensitization to peanut at age 4 years (adjusted odds ratio, 1.88; 95% CI, 1.03-3.44) but not to other allergens up to age 16 years. FLG mutation and PSE were not effect modifiers for the association between IgE sensitization and PSE or FLG mutation, respectively. Sensitized children with PSE were characterized by means of polysensitization, but no other specific IgE sensitization patterns were found. PSE is associated with IgE sensitization to both food allergens and aeroallergens up to 16 years of age. FLG mutation is associated with IgE sensitization to peanut but not to other allergens. Sensitized children with preceding PSE are more often polysensitized. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Novel mutations target distinct subgroups of medulloblastoma

PubMed Central

Robinson, Giles; Parker, Matthew; Kranenburg, Tanya A.; Lu, Charles; Chen, Xiang; Ding, Li; Phoenix, Timothy N.; Hedlund, Erin; Wei, Lei; Zhu, Xiaoyan; Chalhoub, Nader; Baker, Suzanne J.; Huether, Robert; Kriwacki, Richard; Curley, Natasha; Thiruvenkatam, Radhika; Wang, Jianmin; Wu, Gang; Rusch, Michael; Hong, Xin; Beckford, Jared; Gupta, Pankaj; Ma, Jing; Easton, John; Vadodaria, Bhavin; Onar-Thomas, Arzu; Lin, Tong; Li, Shaoyi; Pounds, Stanley; Paugh, Steven; Zhao, David; Kawauchi, Daisuke; Roussel, Martine F.; Finkelstein, David; Ellison, David W.; Lau, Ching C.; Bouffet, Eric; Hassall, Tim; Gururangan, Sridharan; Cohn, Richard; Fulton, Robert S.; Fulton, Lucinda L.; Dooling, David J.; Ochoa, Kerri; Gajjar, Amar; Mardis, Elaine R.; Wilson, Richard K.; Downing, James R.; Zhang, Jinghui; Gilbertson, Richard J.

2012-01-01

Summary Medulloblastoma is a malignant childhood brain tumour comprising four discrete subgroups. To identify mutations that drive medulloblastoma we sequenced the entire genomes of 37 tumours and matched normal blood. One hundred and thirty-six genes harbouring somatic mutations in this discovery set were sequenced in an additional 56 medulloblastomas. Recurrent mutations were detected in 41 genes not yet implicated in medulloblastoma: several target distinct components of the epigenetic machinery in different disease subgroups, e.g., regulators of H3K27 and H3K4 trimethylation in subgroup-3 and 4 (e.g., KDM6A and ZMYM3), and CTNNB1-associated chromatin remodellers in WNT-subgroup tumours (e.g., SMARCA4 and CREBBP). Modelling of mutations in mouse lower rhombic lip progenitors that generate WNT-subgroup tumours, identified genes that maintain this cell lineage (DDX3X) as well as mutated genes that initiate (CDH1) or cooperate (PIK3CA) in tumourigenesis. These data provide important new insights into the pathogenesis of medulloblastoma subgroups and highlight targets for therapeutic development. PMID:22722829

Mutations of the EGFR, K-ras, EML4-ALK, and BRAF genes in resected pathological stage I lung adenocarcinoma.

PubMed

Ohba, Taro; Toyokawa, Gouji; Osoegawa, Atsushi; Hirai, Fumihiko; Yamaguchi, Masafumi; Taguchi, Ken-Ichi; Seto, Takashi; Takenoyama, Mitsuhiro; Ichinose, Yukito; Sugio, Kenji

2016-09-01

The EGFR, K-ras, EML4-ALK, and BRAF genes are oncogenic drivers of lung adenocarcinoma. We conducted this study to analyze the mutations of these genes in stage I adenocarcinoma. The subjects of this retrospective study were 256 patients with resected stage I lung adenocarcinoma. We analyzed mutations of the EGFR, K-ras, and BRAF genes, and the EML4-ALK fusion gene. We also assessed disease-free survival (DFS) to evaluate the prognostic value and overall survival (OS) to evaluate the predictive value of treatment after recurrence. Mutations of the EGFR, K-ras, EML4-ALK, and BRAF genes were detected in 120 (46.8 %), 14 (5.5 %), 6 (2.3 %), and 2 (0.8 %) of the 256 tumors. Two tumors had double mutations (0.8 %). The incidence of EGFR mutations was significantly higher in women than in men. The EML4-ALK fusion gene was detected only in younger patients. The DFS and OS of the K-ras mutant group were significantly worse than those of the EGFR mutant group, the EML4-ALK fusion gene group, and the wild-type group. Six of the seven patients with the EML4-ALK fusion gene are still alive without recurrent disease. In patients with stage I adenocarcinoma, mutation of the K-ras gene was a poor prognostic factor for recurrence. The presence of a mutation of the EGFR or EML4-ALK gene was not a prognostic factor.

The Structural Basis of Oncogenic Mutations G12, G13 and Q61 in Small GTPase K-Ras4B

NASA Astrophysics Data System (ADS)

Lu, Shaoyong; Jang, Hyunbum; Nussinov, Ruth; Zhang, Jian

2016-02-01

Ras mediates cell proliferation, survival and differentiation. Mutations in K-Ras4B are predominant at residues G12, G13 and Q61. Even though all impair GAP-assisted GTP → GDP hydrolysis, the mutation frequencies of K-Ras4B in human cancers vary. Here we aim to figure out their mechanisms and differential oncogenicity. In total, we performed 6.4 μs molecular dynamics simulations on the wild-type K-Ras4B (K-Ras4BWT-GTP/GDP) catalytic domain, the K-Ras4BWT-GTP-GAP complex, and the mutants (K-Ras4BG12C/G12D/G12V-GTP/GDP, K-Ras4BG13D-GTP/GDP, K-Ras4BQ61H-GTP/GDP) and their complexes with GAP. In addition, we simulated ‘exchanged’ nucleotide states. These comprehensive simulations reveal that in solution K-Ras4BWT-GTP exists in two, active and inactive, conformations. Oncogenic mutations differentially elicit an inactive-to-active conformational transition in K-Ras4B-GTP; in K-Ras4BG12C/G12D-GDP they expose the bound nucleotide which facilitates the GDP-to-GTP exchange. These mechanisms may help elucidate the differential mutational statistics in K-Ras4B-driven cancers. Exchanged nucleotide simulations reveal that the conformational transition is more accessible in the GTP-to-GDP than in the GDP-to-GTP exchange. Importantly, GAP not only donates its R789 arginine finger, but stabilizes the catalytically-competent conformation and pre-organizes catalytic residue Q61; mutations disturb the R789/Q61 organization, impairing GAP-mediated GTP hydrolysis. Together, our simulations help provide a mechanistic explanation of key mutational events in one of the most oncogenic proteins in cancer.

Continuous single pulse resolved measurement of beam diameters at 200 kHz using optical transmission filters

NASA Astrophysics Data System (ADS)

Fruechtenicht, Johannes; Letsch, Andreas; Voss, Andreas; Abdou Ahmed, Marwan; Graf, Thomas

2012-02-01

We present a novel laser beam measurement setup which allows the determination of the beam diameter for each single pulse of a pulsed laser beam at repetition rates of up to 200 kHz. This is useful for online process-parameter control e.g. in micromachining or for laser source characterization. Basically, the developed instrument combines spatial transmission filters specially designed for instantaneous optical determination of the second order moments of the lateral intensity distribution of the light beam and photodiodes coupled to customized electronics. The acquisition is computer-based, enabling real-time operation for online monitoring or control. It also allows data storage for a later analysis and visualization of the measurement results. The single-pulse resolved beam diameter can be measured and recorded without any interruption for an unlimited number of pulses. It is only limited by the capacity of the data storage means. In our setup a standard PC and hard-disk provided 2 hours uninterrupted operation and recording of varying beam diameters at 200 kHz. This is about three orders of magnitude faster than other systems. To calibrate our device we performed experiments in cw and pulsed regimes and the obtained results were compared to those obtained with a commercial camera based system. Only minor deviations of the beam diameter values between the two instruments were observed, proving the reliability of our approach.

PIK3CA Mutations in Mucinous Cystic Neoplasms of the Pancreas

PubMed Central

Garcia-Carracedo, Dario; Chen, Zong-Ming; Qiu, Wanglong; Huang, Alicia S.; Tang, Sophia M.; Hruban, Ralph H.; Su, Gloria H.

2014-01-01

Objectives Mucinous cystic neoplasms (MCNs) are rare, potentially curable, mucin-producing neoplasms of the pancreas. We have previously reported PIK3CA (phosphoinositide-3-kinase catalytic subunit, p110α) mutations in intraductal papillary mucinous neoplasms, another mucin-producing neoplasm of the pancreas. In this study, we analyzed the presence of PIK3CA and AKT1/PKB (V-akt murine thymoma viral oncogene homolog 1) hot-spot mutations in MCN specimens. Methods Using the genomic DNA sequencing of tumor tissues isolated by laser capture microdissection, we evaluated 15 well-characterized MCNs for the E542K, E545K(exon 9), and H1047R (exon 20) hot-spotmutations in the PIK3CA gene and the E17K mutation in the AKT1 gene. Results A hot-spotmutation (E545K) of the PIK3CA gene was detected in 1 of the 15 MCNs and further confirmed by a mutant-enriched method. Interestingly, this mutation was found to be present only in the high-grade but not in low-grade dysplastic epithelium obtained from this neoplasm and coexisted with a KRASG12D mutation. No mutations were identified in the AKT1 gene. Conclusions Our data, when combined with previous reports on intraductal papillary mucinous neoplasms, indicate that oncogenic activation of the PI3K pathway involving PIK3CA gene mutations can contribute to the progression of mucin-producing neoplasms but not pancreatic intraepithelial neoplasia. PIK3CA status could be useful for understanding their progression to malignancy. PMID:24518503

DETECTION OF K-RAS AND P53 MUTATIONS IN SPUTUM SAMPLES OF LUNG CANCER PATIENTS USING LASER CAPTURE MICRODISSECTION MICROSCOPE AND MUTATION ANALYSIS

EPA Science Inventory

Detection of K-ras and p53 Mutations in Sputum Samples of Lung Cancer Patients Using Laser Capture Microdissection Microscope and Mutation Analysis

Phouthone Keohavong a,*, Wei-Min Gao a, Kui-Cheng Zheng a, Hussam Mady b, Qing Lan c, Mona Melhem b, and Judy Mumford d.
<...

KIT amplification and gene mutations in acral/mucosal melanoma in Korea.

PubMed

Yun, Jina; Lee, Jeeyun; Jang, Jiryeon; Lee, Eui Jin; Jang, Kee Taek; Kim, Jung Han; Kim, Kyoung-Mee

2011-06-01

Mucosal and acral melanomas have demonstrated different genetic alterations and biological behavior compared with more common cutaneous melanomas. It was recently reported that gain-of-function KIT mutations and/or copy number increases are more common in mucosal and acral melanomas. Thus, we studied the frequency and pattern of KIT aberrations in mucosal and acral melanomas in Korea. We analyzed 97 patients who were pathologically confirmed with mucosal or acral melanoma between 1997 and 2010 at Samsung Medical Center. Of the 97 melanoma patients, 92 were screened for mutations in KIT exons 11, 13, 17, and 18, BRAF and NRAS genes. KIT copy number was assessed by quantitative, real-time PCR. Of the 97 patients, 55 (56.7%) were mucosal, 40 (41.2%) were acral melanoma, and two were of unknown primary origin. Among seven cases with KIT mutation, five (60.0%) occurred in exon 11, one (20.0%) in exon 17, and one (20.0%) in exon 13. Point mutations were the most common, resulting in substitutions in exon 11 (K558R, T574A, L576P, and V559A), exon 13 (N655K), and exon 17 (N822K). A novel Thr574Ala (c.1720A>G) KIT mutation, which has not been reported in melanoma or other tumor types, was identified in one genital melanoma case. Of the 97 mucosal or acral melanoma specimens, 49 were tested for KIT gene copy number changes using quantitative PCR. Increased KIT copy number was identified in 15 patients: seven (40%) of 20 acral melanomas and eight (31%) of 26 mucosal melanomas. Our study implicates that a significant proportion of acral and mucosal melanomas have KIT mutations in Asian population. © 2011 The Authors. APMIS © 2011 APMIS.

Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

PubMed

Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

2017-11-01

High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

AKT1E17K Is Oncogenic in Mouse Lung and Cooperates with Chemical Carcinogens in Inducing Lung Cancer

PubMed Central

Malanga, Donatella; Belmonte, Stefania; Colelli, Fabiana; Scarfò, Marzia; De Marco, Carmela; Oliveira, Duarte Mendes; Mirante, Teresa; Camastra, Caterina; Gagliardi, Monica; Rizzuto, Antonia; Mignogna, Chiara; Paciello, Orlando; Papparella, Serenella; Fagman, Henrik; Viglietto, Giuseppe

2016-01-01

The hotspot AKT1E17K mutation in the pleckstrin homology domain of AKT1 occurs in approximately 0.6–2% of human lung cancers. Recently, we have demonstrated that AKT1E17K transforms immortalized human bronchial cells. Here by use of a transgenic Cre-inducible murine strain in the wild type Rosa26 (R26) locus (R26-AKT1E17K mice) we demonstrate that AKT1E17K is a bona-fide oncogene and plays a role in the development of lung cancer in vivo. In fact, we report that mutant AKT1E17K induces bronchial and/or bronchiolar hyperplastic lesions in murine lung epithelium, which progress to frank carcinoma at very low frequency, and accelerates tumor formation induced by chemical carcinogens. In conclusion, AKT1E17K induces hyperplasia of mouse lung epithelium in vivo and cooperates with urethane to induce the fully malignant phenotype. PMID:26859676

[Clinical and genetic analysis for activated PI3K-δ syndrome by PIK3CD gene mutation].

PubMed

Liu, H; Tang, X L; Liu, J R; Li, H M; Zhao, S Y

2016-09-01

To analyze clinical and genetic features of activated PI3K-δ syndrome (APDS), a new form of immunodeficiency disease caused by PIK3CD gene mutation. Data of two patients diagnosed as APDS at Second Department of Respiratory Medicine of Beijing Children's Hospital Affiliated to Capital Medical University in 2015 were retrospectively reviewed. Pathogenetic genes were screened by whole exome sequencing, and identified by first generation sequencing. The identified pathogenetic genes were further verified in patients' parents. Then the gene sequencing results were analyzed. Both patients were females, aged 2 years and 4 months and 5 years respectively. The main clinical features of both cases were recurrent respiratory infections, enlargement of lymph node, hepatosplenomegaly, cytomegalovirus (CMV) or Epstein-Barr virus (EBV) viremia, decreased number of native CD4(+) T cell, inverted CD4(+) /CD8(+) T cell ratio and increased IgM. Patient 1 has decreased IgA and IgG. Patient 2 showed wide follicular hyperplasia of the airway mucosa. Both patients had de novo mutation in c. 3061G>A(E1021K)of PIK3CD gene, which was homozygous in patient 1 and heterozygous in patient 2. Both were treated with 500 mg/kg dose of gamma globulin intravenously at 4-weeks interval. Patient 1 started oral rapamycin therapy at the dose of 1 mg/(m(2)·d) and discontinued the treatment after 2 weeks. Patient 2 was given low dose of oral prednisone. The two patients were followed up for 2 months. The number of respiratory infection in both patients was decreased. Hepatosplenomegaly was subsided, while respiratory tract damage was not improved in patient 2. The clinical manifestations of APDS include recurrent respiratory tract infection, enlargement of lymph nodes, hepatosplenomegaly, and CMV or EBV infection. The immunophenotype is decreased native CD4(+) T cell, inverted CD4(+) /CD8(+) T cell ratio, increased IgM and decreased IgA/IgG for some patients. c. 3061G>A(E1021K)of PIK3CD gene is a

Analysis of the recE locus of Escherichia coli K-12 by use of polyclonal antibodies to exonuclease VIII.

PubMed Central

Luisi-DeLuca, C; Clark, A J; Kolodner, R D

1988-01-01

Exonuclease VIII (exoVIII) of Escherichia coli has been purified from a strain carrying a plasmid-encoded recE gene by using a new procedure. This procedure yielded 30 times more protein per gram of cells, and the protein had a twofold higher specific activity than the enzyme purified by the previously published procedure (J. W. Joseph and R. Kolodner, J. Biol. Chem. 258:10411-10417, 1983). The sequence of the 12 N-terminal amino acids was also obtained and found to correspond to one of the open reading frames predicted from the nucleic acid sequence of the recE region of Rac (C. Chu, A. Templin, and A. J. Clark, manuscript in preparation). Polyclonal antibodies directed against purified exoVIII were also prepared. Cell-free extracts prepared from strains containing a wide range of chromosomal- or plasmid-encoded point, insertion, and deletion mutations which result in expression of exoVIII were examined by Western blot (immunoblot) analysis. This analysis showed that two point sbcA mutations (sbcA5 and sbcA23) and the sbc insertion mutations led to the synthesis of the 140-kilodalton (kDa) polypeptide of wild-type exoVIII. Plasmid-encoded partial deletion mutations of recE reduced the size of the cross-reacting protein(s) in direct proportion to the size of the deletion, even though exonuclease activity was still present. The analysis suggests that 39 kDa of the 140-kDa exoVIII subunit is all that is essential for exonuclease activity. One of the truncated but functional exonucleases (the pRAC3 exonuclease) has been purified and confirmed to be a 41-kDa polypeptide. The first 18 amino acids from the N terminus of the 41-kDa pRAC3 exonuclease were sequenced and fond to correspond to one of the translational start signals predicted from the nucleotide sequence of radC (Chu et al., in preparation). Images PMID:3056915

Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

PubMed

Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

2009-07-01

Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

Mutation K42E in dehydrodolichol diphosphate synthase (DHDDS) causes recessive retinitis pigmentosa.

PubMed

Lam, Byron L; Züchner, Stephan L; Dallman, Julia; Wen, Rong; Alfonso, Eduardo C; Vance, Jeffery M; Peričak-Vance, Margaret A

2014-01-01

A single-nucleotide mutation in the gene that encodes DHDDS has been identified by whole exome sequencing as the cause of the non-syndromic recessive retinitis pigmentosa (RP) in a family of Ashkenazi Jewish origin in which three of the four siblings have early onset retinal degeneration. The peripheral retinal degeneration in the affected siblings was evident in the initial examination in 1992 and only one had detectable electroretinogram (ERG) that suggested cone-rod dysfunction. The pigmentary retinal degeneration subsequently progressed rapidly. The identified mutation changes the highly conserved residue Lys42 to Glu, resulting in lower catalytic efficiency. Patterns of plasma transferrin isoelectric focusing gel were normal in all family members, indicating no significant abnormality in protein glycosylation. Dolichols have been shown to influence the fluidity and of the membrane and promote vesicle fusion. Considering that photoreceptor outer segments contain stacks of membrane discs, we believe that the mutation may lead to low dolichol levels in photoreceptor outer segments, resulting in unstable membrane structure that leads to photoreceptor degeneration.

High frequency of TP53 but not K-ras gene mutations in Bolivian patients with gallbladder cancer.

PubMed

Asai, Takao; Loza, Ernesto; Roig, Guido Villa-Gomez; Ajioka, Yoichi; Tsuchiya, Yasuo; Yamamoto, Masaharu; Nakamura, Kazutoshi

2014-01-01

Although genetic characteristics are considered to be a factor influencing the geographic variation in the prevalence of gallbladder cancer (GBC), they have not been well studied in Bolivia, which has a high prevalence rate of GBC. The purpose of this study was to examine the frequency of TP53 and K-ras mutations in Bolivian patients with GBC and to compare them with our previous data obtained in other high-GBC-prevalence countries, namely Japan, Chile, and Hungary. DNA was extracted from cancer sites in paraffin-embedded tissue from 36 patients using a microdissection technique. TP53 mutations at exons 5 to 8 and K-ras mutations at codons 12, 13 and 61 were examined using direct sequencing techniques. The data obtained were compared with those in the other high-GBC-prevalence countries. Of the 36 patients, 18 (50.0%) had a TP53 mutation (one mutation in each of 17 patients and three mutations in one patient), and only one (2.8%) had a K-ras mutation. Of the 20 TP53 mutations, 12 were of the transition type (60.0%). This rate was significantly lower than that in Chile (12/12, P<0.05). In addition, three mutations were of the CpG transition type (15.0%), which is a feature of endogenous mutation. All three were found in the hot spot region of the TP53 gene. In contrast, G:C to T:A transversion was found in Bolivia, suggesting the presence of exogenous carcinogens. Our findings suggest that the development of GBC in Bolivia is associated with both exogenous carcinogens and endogenous mechanisms. The identification of an environmental risk factor for GBC is needed to confirm these findings.

BRAF V600E mutational status in bile duct adenomas and hamartomas.

PubMed

Pujals, Anaïs; Bioulac-Sage, Paulette; Castain, Claire; Charpy, Cécile; Zafrani, Elie Serge; Calderaro, Julien

2015-10-01

Bile duct adenomas (BDA) and bile duct hamartomas (BDH) are benign bile duct lesions considered neoplastic or secondary to ductal plate malformation, respectively. We have reported previously a high prevalence of BRAF V600E mutations detected by allele-specific polymerase chain reaction assay in BDA, and suggested that BDA may be precursors to a subset of intrahepatic cholangiocarcinomas harbouring V600E mutations. The aim of the present study was to assess the existence of BRAF V600E mutations, using immunohistochemical methods, in additional BDA as well as in BDH. Fifteen BDA and 35 BDH were retrieved from the archives of the pathology departments of two French university hospitals. All cases were reviewed by two pathologists specialized in liver diseases. BRAF V600E mutational status was investigated by immunohistochemistry. Mutated BRAF mutant protein was detected in 53% of the BDA and in none of the cases of BDH. Our findings suggest that BDA and BDH are different processes, and that BDA represent true benign neoplasms. They also support the hypothesis that mutated BDA might precede the development of the subset of intrahepatic cholangiocarcinomas harbouring BRAF V600E mutations. © 2015 John Wiley & Sons Ltd.

BRAFV600E mutation in the diagnosis of unicystic ameloblastoma.

PubMed

Pereira, Núbia Braga; Pereira, Karuza Maria Alves; Coura, Bruna Pizziolo; Diniz, Marina Gonçalves; de Castro, Wagner Henriques; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago

2016-11-01

Unicystic ameloblastoma, an odontogenic neoplasm, presents clinical and radiographic similarities with dentigerous and radicular cysts, non-neoplastic lesions. It is not always possible to reach a final diagnosis with the incisional biopsy, leading to inappropriate treatment. The BRAFV600E activating mutation has been reported in a high proportion of ameloblastomas. The purpose of the study was to assess the utility of the detection of the BRAFV600E mutation in the differential diagnosis of unicystic ameloblastoma with dentigerous and radicular cysts. Twenty-six archival samples were included, comprising eight unicystic ameloblastomas (UAs), nine dentigerous and nine radicular cysts. The mutation was assessed in all samples by anti-BRAFV600E (clone VE1) immunohistochemistry (IHC) and by TaqMan mutation detection qPCR assay. Sanger sequencing was further carried out when samples showed conflicting results in the IHC and qPCR. Although all UAs (8/8) showed positive uniform BRAFV600E staining along the epithelial lining length, the mutation was not confirmed by qPCR and Sanger sequencing in three samples. Positive staining for the BRAFV600E protein was observed in one dentigerous cyst, but it was not confirmed by the molecular methods. Furthermore, 2/9 dentigerous cysts and 2/9 radicular cysts showed non-specific immunostaining of the epithelium or plasma cells. None of the dentigerous or radicular cysts cases presented the BRAFV600E mutation in the qPCR assay. The BRAFV600E antibody (clone VE1) IHC may show non-specific staining, but molecular assays may be useful for the diagnosis of unicystic ameloblastoma, in conjunction with clinical, radiological and histopathological features. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

BRAF V600 Mutation Profile of Metastatic Melanoma in the Thrace Region of Turkey.

PubMed

Can, Nuray; Taştekin, Ebru; Deniz Yalta, Tülin; Süt, Necdet; Korkmaz, Selma; Usta, Ufuk; Öz Puyan, Fulya; Genç, Ezgi; Cezik, Mert; Binboğa Tutuğ, Busem; Köstek, Osman; Tozkir, Hilmi

2018-02-08

BRAF is the most common mutation in melanoma. The most common subtype is BRAF V600E, followed by V600K. Initially, the authors aimed to investigate whether clinicopathological features of melanoma are associated with BRAF mutations. We then aimed to present the relationships between the clinicopathological features and the mutated subtype (V600E vs V600K). 61 patients with metastatic malignant melanoma (affecting the lymph node or other distant sites) were selected. Patient data regarding age at the time of diagnosis, sex, metastatic site (lymph node, distant metastasis or both) and primary tumour site were obtained from the hospital's database. Tissue samples containing at least 30% tumour cells were isolated from the specimens of 61 patients (24 samples from primary tumours and 37 from metastatic foci) for BRAF analysis. Comparisons between the BRAF V600 mutation and clinicopathological and histopathological features were performed. BRAF V600 mutation was detected in 34 (55.7%) patients. The subtype was BRAF V600E in 22 (64.7%) patients, BRAF V600K in 11(32.4%) patients and BRAF V600R in 1(2.9%) patient. The crucial results of the present study may be summarized as follows: i) BRAF V600 mutation was more common in older patients and tumors with BRAF V600 mutation revealed necrosis and LVI more commonly than wild-type tumors, ii) BRAF V600K mutation was more common in older patients and BRAF V600K mutated tumors exhibited ulceration more commonly than tumors with BRAF V600E mutation (close to significant). The BRAF V600 mutation may have interactions with prognostic clinicoptahological features of melanoma including necrosis and lymphovascular invasion. V600K mutation may be more common than expected and may have different associations with properties of the tumor such as tumor ulceration and patient age. Investigation of the mutated subtype of the BRAF gene may therefore reveal more detailed data about the management of melanoma and may also prevent missing of

Photoabsorption cross sections of methane and ethane, 1380-1600 A, at T equals 295 K and T equals 200 K. [in Jupiter atmosphere

NASA Technical Reports Server (NTRS)

Mount, G. H.; Moos, H. W.

1978-01-01

Photoabsorption cross sections of methane and ethane have been determined in the wavelength range from 1380 to 1600 A at room (295 K) and dry-ice (200 K) temperatures. It is found that the room-temperature ethane data are in excellent agreement with the older measurements of Okabe and Becker (1963) rather than with more recent determinations and that a small systematic blueshift occurs at the foot of the molecular absorption edges of both gases as the gases are cooled from room temperature to 200 K, a value close to the actual temperature of the Jovian atmosphere. It is concluded that methane photoabsorption will dominate until its cross section is about 0.01 that of ethane, which occurs at about 1440 A, and that ethane should be the dominant photoabsorber in the Jovian atmosphere in the region from above 1440 A to not farther than 1575 A.

Artemisinin resistance at the China-Myanmar border and association with mutations in the K13 propeller gene.

PubMed

Wang, Zenglei; Wang, Yingna; Cabrera, Mynthia; Zhang, Yanmei; Gupta, Bhavna; Wu, Yanrui; Kemirembe, Karen; Hu, Yue; Liang, Xiaoying; Brashear, Awtum; Shrestha, Sony; Li, Xiaolian; Miao, Jun; Sun, Xiaodong; Yang, Zhaoqing; Cui, Liwang

2015-11-01

Artemisinin resistance in Plasmodium falciparum parasites in Southeast Asia is a major concern for malaria control. Its emergence at the China-Myanmar border, where there have been more than 3 decades of artemisinin use, has yet to be investigated. Here, we comprehensively evaluated the potential emergence of artemisinin resistance and antimalarial drug resistance status in P. falciparum using data and parasites from three previous efficacy studies in this region. These efficacy studies of dihydroartemisinin-piperaquine combination and artesunate monotherapy of uncomplicated falciparum malaria in 248 P. falciparum patients showed an overall 28-day adequate clinical and parasitological response of >95% and day 3 parasite-positive rates of 6.3 to 23.1%. Comparison of the 57 K13 sequences (24 and 33 from day 3 parasite-positive and -negative cases, respectively) identified nine point mutations in 38 (66.7%) samples, of which F446I (49.1%) and an N-terminal NN insertion (86.0%) were predominant. K13 propeller mutations collectively, the F446I mutation alone, and the NN insertion all were significantly associated with day 3 parasite positivity. Increased ring-stage survival determined using the ring-stage survival assay (RSA) was highly associated with the K13 mutant genotype. Day 3 parasite-positive isolates had ∼10 times higher ring survival rates than day 3 parasite-negative isolates. Divergent K13 mutations suggested independent evolution of artemisinin resistance. Taken together, this study confirmed multidrug resistance and emergence of artemisinin resistance in P. falciparum at the China-Myanmar border. RSA and K13 mutations are useful phenotypic and molecular markers for monitoring artemisinin resistance. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

[Expression of JAK2V617F and MPLW515L/K mutation in 30 suspected cases of early myeloproliferative disorders].

PubMed

Fan, Zheng; Zhang, Ri; Shen, Yi-Min; Fei, Hai-Rong; Zhu, Zi-Ling; Cen, Jian-Nong

2008-09-01

To investigate the prevalence of JAK2V617F and MPLW515L/K mutation in patients with slightly elevated platelets (BPC) or hemoglobin (Hb) not meeting the criteria of polycythemia vera (PV) or essential thrombocythemia (ET). Genomic DNA from bone marrow or blood mononuclear cells was screened with allele specific polymerase chain reaction (AS-PCR) for JAK2V617F and MPLW515L/K mutation. The history of thrombosis was assessed retrospectively by patients files. Of 30 patients, 14 (46.7%) were positive for the JAK2V617F mutation, none of them had the MPLW515L/ K. Five of these 14 patients had a history of thrombosis. Follow-up results were available in 22 patients. Among them, 12 patients with JAK2V617F mutation turned out to be MPD in 6-24 months; only 2 out of 10 patients without this mutation evolved to MPD. JAK2V617F mutation could be one of the diagnosis criteria of early MPD. No MPLW515L/K expression was found in early MPD.

Evaluation of Cathode Heater Assembly for 42 GHz, 200 kW Gyrotron

NASA Astrophysics Data System (ADS)

Sharma, S. K.; Singh, Narendra Kumar; Singh, Udaybir; Khatun, Hasina; Kumar, Nitin; Alaria, M. K.; Raju, R. S.; Jain, P. K.; Sinha, A. K.

2014-09-01

In this paper, the evaluation of cathode-heater assembly of magnetron injection gun (MIG) for 42 GHz, 200 kW gyrotron is presented. The cathode-heater assembly is purchased from M/S SEMICON.The cathode-heater assembly is experimentally studied in three different conditions; in a belljar system, during vacuum processing of MIG and during MIG testing to ensure the required rise of cathode surface temperature for pre-set heater power.

In Japanese patients with papillary thyroid carcinoma, TERT promoter mutation is associated with poor prognosis, in contrast to BRAF V600E mutation.

PubMed

Nasirden, Almira; Saito, Tsuyoshi; Fukumura, Yuki; Hara, Kieko; Akaike, Keisuke; Kurisaki-Arakawa, Aiko; Asahina, Miki; Yamashita, Atsushi; Tomomasa, Ran; Hayashi, Takuo; Arakawa, Atsushi; Yao, Takashi

2016-12-01

The prognostic value of BRAF V600E and TERT promoter mutation in papillary thyroid carcinoma (PTC) is controversial. We examined alterations in BRAF V600E and TERT promoter by PCR-direct sequencing in PTC of 144 Japanese patients. Alternative lengthening of telomeres was examined as another mechanism of telomere maintenance by immunohistochemical staining for ATRX and DAXX. Of the clinicopathological characteristics, regional lymph node metastasis, extra-thyroid extension, multifocality/intrathyroidal spread, and advanced stage (III/V) were associated with shorter disease-free survival rate (DFSR). TERT promoter mutation was found in eight patients (6 %), and this was significantly associated with total thyroidectomy, multifocality/intrathyroidal spread, lymph node metastasis and advanced stage. The BRAF V600E mutation was found in 53 patients (38.2 %) but was not associated with any clinicopathological factors. TERT mutations were not correlated with BRAF V600E mutation status. TERT mutation-positive tumors (TERT+) showed lower DFSR than BRAF V600E -mutation-positive tumors (BRAF V600E +), and TERT+/BRAF V600E + tumors showed lower DFSR than BRAF V600E + tumors. No cases showed loss of ATRX/DAXX expression by immunohistochemistry. TERT promoter mutations showed a lower prevalence in our series and appeared to be associated with aggressive behavior. In PTCs, telomerase activation by TERT promoter mutation might be more important than alternative lengthening of telomeres.

Structural Impact of Three Parkinsonism-Associated Missense Mutations on Human DJ-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lakshminarasimhan, M.; Maldonado, M.T.; Zhou, W.

2009-05-20

A number of missense mutations in the oxidative stress response protein DJ-1 are implicated in rare forms of familial Parkinsonism. The best-characterized Parkinsonian DJ-1 missense mutation, L166P, disrupts homodimerization and results in a poorly folded protein. The molecular basis by which the other Parkinsonism-associated mutations disrupt the function of DJ-1, however, is incompletely understood. In this study we show that three different Parkinsonism-associated DJ-1 missense mutations (A104T, E163K, and M26I) reduce the thermal stability of DJ-1 in solution by subtly perturbing the structure of DJ-1 without causing major folding defects or loss of dimerization. Atomic resolution X-ray crystallography shows thatmore » the A104T substitution introduces water and a discretely disordered residue into the core of the protein, E163K disrupts a key salt bridge with R145, and M26I causes packing defects in the core of the dimer. The deleterious effect of each Parkinsonism-associated mutation on DJ-1 is dissected by analysis of engineered substitutions (M26L, A104V, and E163K/R145E) that partially alleviate each of the defects introduced by the A104T, E163K and M26I mutations. In total, our results suggest that the protective function of DJ-1 can be compromised by diverse perturbations in its structural integrity, particularly near the junctions of secondary structural elements.« less

Dual PI3K/mTOR Inhibition in Colorectal Cancers with APC and PIK3CA Mutations.

PubMed

Foley, Tyler M; Payne, Susan N; Pasch, Cheri A; Yueh, Alex E; Van De Hey, Dana R; Korkos, Demetra P; Clipson, Linda; Maher, Molly E; Matkowskyj, Kristina A; Newton, Michael A; Deming, Dustin A

2017-02-09

Therapeutic targeting of the PI3K pathway is an active area of research in multiple cancer types, including breast and endometrial cancers. This pathway is commonly altered in cancer and plays an integral role in numerous vital cellular functions. Mutations in the PIK3CA gene, resulting in a constitutively active form of PI3K, often occur in colorectal cancer, though the population of patients who would benefit from targeting this pathway has yet to be identified. In human colorectal cancers, PIK3CA mutations most commonly occur concomitantly with loss of adenomatous polyposis coli (APC). Here, treatment strategies are investigated that target the PI3K pathway in colon cancers with mutations in APC and PIK3CA Colorectal cancer spheroids with Apc and Pik3ca mutations were generated and characterized confirming that these cultures represent the tumors from which they were derived. Pan and alpha isomer-specific PI3K inhibitors did not induce a significant treatment response, whereas the dual PI3K/mTOR inhibitors BEZ235 and LY3023414 induced a dramatic treatment response through decreased cellular proliferation and increased differentiation. The significant treatment responses were confirmed in mice with Apc and Pik3ca -mutant colon cancers as measured using endoscopy with a reduction in median lumen occlusion of 53% with BEZ235 and a 24% reduction with LY3023414 compared with an increase of 53% in controls ( P < 0.001 and P = 0.03, respectively). This response was also confirmed with 18 F-FDG microPET/CT imaging. Implications: Spheroid models and transgenic mice suggest that dual PI3K/mTOR inhibition is a potential treatment strategy for APC and PIK3CA -mutant colorectal cancers. Thus, further clinical studies of dual PI3K/mTOR inhibitors are warranted in colorectal cancers with these mutations. Mol Cancer Res; 15(3); 1-11. ©2016 AACR. ©2016 American Association for Cancer Research.

WalK(S221P), a naturally occurring mutation, confers vancomycin resistance in VISA strain XN108.

PubMed

Peng, Huagang; Hu, Qiwen; Shang, Weilong; Yuan, Jizhen; Zhang, Xiaopeng; Liu, Hui; Zheng, Ying; Hu, Zhen; Yang, Yi; Tan, Li; Li, Shu; Hu, Xiaomei; Li, Ming; Rao, Xiancai

2017-04-01

Vancomycin-intermediate Staphylococcus aureus (VISA) strains have spread globally. We previously isolated an ST239 VISA (XN108) with a vancomycin MIC of 12 mg/L. The mechanism for XN108 resistance to vancomycin was investigated in this study. Genome comparison was performed to characterize mutations that might contribute to the XN108 resistance phenotype. The novel mutation WalK(S221P) was identified and investigated using allelic replacement experiments. Vancomycin susceptibilities, autolytic activities and morphologies of the strains were examined. Autophosphorylation activities of WalK and the WalK(S221P) mutant were determined in vitro with [λ- 32 P]ATP, and binding activity of WalK(S221P)-activated WalR to the promoter region of its target gene lytM was determined by electrophoretic mobility shift assay. Genome comparison revealed three mutations, GraS(T136I), RpoB(H481N) and WalK(S221P), which might be responsible for vancomycin resistance in XN108. The introduction of WalK(S221P) to the vancomycin-susceptible strain N315 increased its vancomycin MIC from 1.5 to 8 mg/L, whereas the allelic replacement of WalK(S221P) with the native N315 WalK allele in XN108 decreased its vancomycin MIC from 12 to 4 mg/L. The VISA strains have thickened cell walls and decreased autolysis, consistent with observed changes in the expression of genes involved in cell wall metabolism and virulence regulation. WalK(S221P) exhibited reduced autophosphorylation, which may lead to reduced phosphorylation of WalR. WalK(S221P)-phosphorylated WalR also exhibited a reduced capacity to bind to the lytM promoter. The naturally occurring WalK(S221P) mutation plays a key role in vancomycin resistance in XN108. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

BRAF Mutations in an Italian Regional Population: Implications for the Therapy of Thyroid Cancer

PubMed Central

Monti, Eleonora; Bovero, Michela; Mortara, Lorenzo; Pera, Giorgia; Zupo, Simonetta; Gugiatti, Elena; Dono, Mariella; Massa, Barbara; Ansaldo, Gian Luca; Massimo, Giusti

2015-01-01

Background. Molecular diagnostics has offered new techniques for searching for mutations in thyroid indeterminate lesions. The study's aim was to evaluate the BRAF mutations' incidence in an Italian regional population. Subjects and Methods. 70 Caucasian patients born in Liguria with indeterminate or suspicious cytological diagnoses. Results. A BRAF gene mutation was successfully analyzed in 56/70 patients. The mutation was BRAF V600E in 12/56 cases (21%) and BRAF K601E in 2/56 (4%). Of the BRAF mutated samples on cytological diagnosis (14/56 cases), 2/14 cases (14%) were benign on final histology and 12/14 (86%) were malignant. All BRAF-mutated cases on cytology that were found to be benign on histological examination carried the K601E mutation. Of the nonmutated BRAF cases (42/56, 75%) which were later found to be malignant on definitive histology, 5 cases were follicular carcinomas (36%), 3 cases were incidentally found to be papillary microcarcinomas (22%), 2 were cases papillary carcinomas (14%), 1 was case follicular variant of papillary carcinoma (7%), 1 was case medullary carcinoma (7%), 1 case was Hurtle cell tumor (7%), and 1 case was combined cell carcinoma and papillary oncocytic carcinoma (7%). Conclusions. The presence of the BRAF V600E mutation may suggest a more aggressive surgical approach. BRAF K601E mutation did not correlate with malignancy indexes. PMID:26693224

p53 inhibits autophagy by interacting with the human ortholog of yeast Atg17, RB1CC1/FIP200.

PubMed

Morselli, Eugenia; Shen, Shensi; Ruckenstuhl, Christoph; Bauer, Maria Anna; Mariño, Guillermo; Galluzzi, Lorenzo; Criollo, Alfredo; Michaud, Mickael; Maiuri, Maria Chiara; Chano, Tokuhiro; Madeo, Frank; Kroemer, Guido

2011-08-15

The tumor suppressor protein p53 tonically suppresses autophagy when it is present in the cytoplasm. This effect is phylogenetically conserved from mammals to nematodes, and human p53 can inhibit autophagy in yeast, as we show here. Bioinformatic investigations of the p53 interactome in relationship to the autophagy-relevant protein network underscored the possible relevance of a direct molecular interaction between p53 and the mammalian ortholog of the essential yeast autophagy protein Atg17, namely RB1-inducible coiled-coil protein 1 (RB1CC1), also called FAK family kinase-interacting protein of 200 KDa (FIP200). Mutational analyses revealed that a single point mutation in p53 (K382R) abolished its capacity to inhibit autophagy upon transfection into p53-deficient human colon cancer or yeast cells. In conditions in which wild-type p53 co-immunoprecipitated with RB1CC1/FIP200, p53 (K382R) failed to do so, underscoring the importance of the physical interaction between these proteins for the control of autophagy. In conclusion, p53 regulates autophagy through a direct molecular interaction with RB1CC1/FIP200, a protein that is essential for the very apical step of autophagy initiation.

PI3K/AKT pathway mutations cause a spectrum of brain malformations from megalencephaly to focal cortical dysplasia

PubMed Central

Mirzaa, Ghayda M.; Ishak, Gisele E.; O'Roak, Brian J.; Hiatt, Joseph B.; Roden, William H.; Gunter, Sonya A.; Christian, Susan L.; Collins, Sarah; Adams, Carissa; Rivière, Jean-Baptiste; St-Onge, Judith; Ojemann, Jeffrey G.; Shendure, Jay; Hevner, Robert F.; Dobyns, William B.

2015-01-01

Malformations of cortical development containing dysplastic neuronal and glial elements, including hemimegalencephaly and focal cortical dysplasia, are common causes of intractable paediatric epilepsy. In this study we performed multiplex targeted sequencing of 10 genes in the PI3K/AKT pathway on brain tissue from 33 children who underwent surgical resection of dysplastic cortex for the treatment of intractable epilepsy. Sequencing results were correlated with clinical, imaging, pathological and immunohistological phenotypes. We identified mosaic activating mutations in PIK3CA and AKT3 in this cohort, including cancer-associated hotspot PIK3CA mutations in dysplastic megalencephaly, hemimegalencephaly, and focal cortical dysplasia type IIa. In addition, a germline PTEN mutation was identified in a male with hemimegalencephaly but no peripheral manifestations of the PTEN hamartoma tumour syndrome. A spectrum of clinical, imaging and pathological abnormalities was found in this cohort. While patients with more severe brain imaging abnormalities and systemic manifestations were more likely to have detected mutations, routine histopathological studies did not predict mutation status. In addition, elevated levels of phosphorylated S6 ribosomal protein were identified in both neurons and astrocytes of all hemimegalencephaly and focal cortical dysplasia type II specimens, regardless of the presence or absence of detected PI3K/AKT pathway mutations. In contrast, expression patterns of the T308 and S473 phosphorylated forms of AKT and in vitro AKT kinase activities discriminated between mutation-positive dysplasia cortex, mutation-negative dysplasia cortex, and non-dysplasia epilepsy cortex. Our findings identify PI3K/AKT pathway mutations as an important cause of epileptogenic brain malformations and establish megalencephaly, hemimegalencephaly, and focal cortical dysplasia as part of a single pathogenic spectrum. PMID:25722288

TG101209, a small molecule JAK2-selective kinase inhibitor potently inhibits myeloproliferative disorder-associated JAK2V617F and MPLW515L/K mutations.

PubMed

Pardanani, A; Hood, J; Lasho, T; Levine, R L; Martin, M B; Noronha, G; Finke, C; Mak, C C; Mesa, R; Zhu, H; Soll, R; Gilliland, D G; Tefferi, A

2007-08-01

JAK2V617F and MPLW515L/K represent recently identified mutations in myeloproliferative disorders (MPD) that cause dysregulated JAK-STAT signaling, which is implicated in MPD pathogenesis. We developed TG101209, an orally bioavailable small molecule that potently inhibits JAK2 (IC(50)=6 nM), FLT3 (IC(50)=25 nM) and RET (IC(50)=17 nM) kinases, with significantly less activity against other tyrosine kinases including JAK3 (IC(50)=169 nM). TG101209 inhibited growth of Ba/F3 cells expressing JAK2V617F or MPLW515L mutations with an IC(50) of approximately 200 nM. In a human JAK2V617F-expressing acute myeloid leukemia cell line, TG101209-induced cell cycle arrest and apoptosis, and inhibited phosphorylation of JAK2V617F, STAT5 and STAT3. Therapeutic efficacy of TG101209 was demonstrated in a nude mouse model. Furthermore, TG101209 suppressed growth of hematopoietic colonies from primary progenitor cells harboring JAK2V617F or MPL515 mutations.

Comparison in gas media (absolute and gauge mode)in the range from 25 kPa TO 200 kPa (EURAMET.M.P-K8)

NASA Astrophysics Data System (ADS)

Wuethrich, C.; Alisic, S.; Altintas, A.; van Andel, I.; C, In­Mook; Eltawil, A. A.; Farár, P.; Hetherington, P.; Koçaş, I.; Lefkopoulos, A.; Otal, P.; Prazak, D.; Sabuga, W.; Salustiano, R.; Sandu, I.; Sardi, M.; Saxholm, S.; Setina, J.; Spohr, I.; Steindl, D.; Testa, N.; Vámossy, C.; Grgec Bermanec, L.

2016-01-01

It was decided at the EURAMET TC-M meeting in Torino in 2006 to realize a comparison in gauge and absolute pressure up to 200 kPa as it would allow a link to the CCM.P-K6 and CCM.P-K2 comparisons to be established. This project interested a lot of laboratories from the beginning with 23 participants, 22 of which have submitted results. The circulation of the transfer standard began in July 2009 and lasted until January 2012. No major problems occurred during the transport. The measurand of the comparison is the effective area of a piston-cylinder determined in gauge and absolute pressure from 25 kPa to 200 kPa with pressure steps of 25 kPa. The transfer standard is a gas lubricated tungsten carbide piston-cylinder with an effective area of ~9.8 cm2, fabricated by DH Instruments and compatible with a PG-7601 pressure balance. Some participants used their own pressure balance while a pressure balance with a reference vacuum sensor has been circulated for the participants not equipped with this system. One participant (SMU, Slovakia) has never provided the measurement results and another participant (FORCE Technology, Denmark) submitted a revised set of measurement results after the pilot laboratory mentioned that the equivalence was not met. After the determination of the reference value, all the 22 participants who delivered the results in gauge pressure demonstrated equivalence respective to the reference value on most of the range. In absolute pressure the equivalence is demonstrated, for all nominal pressures, by all 17 participants who submitted results. The comparison is linked to the CCM.P-K6 for gauge pressure and to CCM.P-K2 for absolute pressure. The link does not strongly affect the equivalence of the results and an excellent degree of equivalence is achieved in gauge and absolute pressure. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb

NT5E Mutations and Arterial Calcifications

PubMed Central

St. Hilaire, Cynthia; Ziegler, Shira G.; Markello, Thomas C.; Brusco, Alfredo; Groden, Catherine; Gill, Fred; Carlson-Donohoe, Hannah; Lederman, Robert J.; Chen, Marcus Y.; Yang, Dan; Siegenthaler, Michael P.; Arduino, Carlo; Mancini, Cecilia; Freudenthal, Bernard; Stanescu, Horia C.; Zdebik, Anselm A.; Chaganti, R. Krishna; Nussbaum, Robert L.; Kleta, Robert; Gahl, William A.; Boehm, Manfred

2011-01-01

BACKGROUND Arterial calcifications are associated with increased cardiovascular risk, but the genetic basis of this association is unclear. METHODS We performed clinical, radiographic, and genetic studies in three families with symptomatic arterial calcifications. Single-nucleotide-polymorphism analysis, targeted gene sequencing, quantitative polymerase-chain-reaction assays, Western blotting, enzyme measurements, transduction rescue experiments, and in vitro calcification assays were performed. RESULTS We identified nine persons with calcifications of the lower-extremity arteries and hand and foot joint capsules: all five siblings in one family, three siblings in another, and one patient in a third family. Serum calcium, phosphate, and vitamin D levels were normal. Affected members of Family 1 shared a single 22.4-Mb region of homozygosity on chromosome 6 and had a homozygous nonsense mutation (c.662C→A, p.S221X) in NT5E, encoding CD73, which converts AMP to adenosine. Affected members of Family 2 had a homozygous missense mutation (c.1073G→A, p.C358Y) in NT5E. The proband of Family 3 was a compound heterozygote for c.662C→A and c.1609dupA (p.V537fsX7). All mutations found in the three families result in nonfunctional CD73. Cultured fibroblasts from affected members of Family 1 showed markedly reduced expression of NT5E messenger RNA, CD73 protein, and enzyme activity, as well as increased alkaline phosphatase levels and accumulated calcium phosphate crystals. Genetic rescue experiments normalized the CD73 and alkaline phosphatase activity in patients’ cells, and adenosine treatment reduced the levels of alkaline phosphatase and calcification. CONCLUSIONS We identified mutations in NT5E in members of three families with symptomatic arterial and joint calcifications. This gene encodes CD73, which converts AMP to adenosine, supporting a role for this metabolic pathway in inhibiting ectopic tissue calcification. (Funded by the National Human Genome Research

K13 Propeller Mutations in Plasmodium falciparum Populations in Regions of Malaria Endemicity in Vietnam from 2009 to 2016.

PubMed

Thuy-Nhien, Nguyen; Tuyen, Nguyen Kim; Tong, Nguyen Thanh; Vy, Nguyen Tuong; Thanh, Ngo Viet; Van, Huynh Thuy; Huong-Thu, Pham; Quang, Huynh Hong; Boni, Maciej F; Dolecek, Christiane; Farrar, Jeremy; Thwaites, Guy E; Miotto, Olivo; White, Nicholas J; Hien, Tran Tinh

2017-04-01

The spread of artemisinin-resistant Plasmodium falciparum compromises the therapeutic efficacy of artemisinin combination therapies (ACTs) and is considered the greatest threat to current global initiatives to control and eliminate malaria. This is particularly relevant in Vietnam, where dihydroartemisinin-piperaquine (DP) is the recommended ACT for P. falciparum infection. The propeller domain gene of K13, a molecular marker of artemisinin resistance, was successfully sequenced in 1,060 P. falciparum isolates collected at 3 malaria hot spots in Vietnam between 2009 and 2016. Eight K13 propeller mutations (Thr474Ile, Tyr493His, Arg539Thr, Ile543Thr, Pro553Leu, Val568Gly, Pro574Leu, and Cys580Tyr), including several that have been validated to be artemisinin resistance markers, were found. The prevalences of K13 mutations were 29% (222/767), 6% (11/188), and 43% (45/105) in the Binh Phuoc, Ninh Thuan, and Gia Lai Provinces of Vietnam, respectively. Cys580Tyr became the dominant genotype in recent years, with 79.1% (34/43) of isolates in Binh Phuoc Province and 63% (17/27) of isolates in Gia Lai Province carrying this mutation. K13 mutations were associated with reduced ring-stage susceptibility to dihydroartemisinin (DHA) in vitro and prolonged parasite clearance in vivo An analysis of haplotypes flanking K13 suggested the presence of multiple strains with the Cys580Tyr mutation rather than a single strain expanding across the three sites. Copyright © 2017 Thuy-Nhien et al.

Transporters for the Intestinal Absorption of Cholesterol, Vitamin E, and Vitamin K.

PubMed

Yamanashi, Yoshihide; Takada, Tappei; Kurauchi, Ryoya; Tanaka, Yusuke; Komine, Toko; Suzuki, Hiroshi

2017-04-03

Humans cannot synthesize fat-soluble vitamins such as vitamin E and vitamin K. For this reason, they must be obtained from the diet via intestinal absorption. As the deficiency or excess of these vitamins has been reported to cause several types of diseases and disorders in humans, the intestinal absorption of these nutrients must be properly regulated to ensure good health. However, the mechanism of their intestinal absorption remains poorly understood. Recent studies on cholesterol using genome-edited mice, genome-wide association approaches, gene mutation analyses, and the development of cholesterol absorption inhibitors have revealed that several membrane proteins play crucial roles in the intestinal absorption of cholesterol. Surprisingly, detailed analyses of these cholesterol transporters have revealed that they can also transport vitamin E and vitamin K, providing clues to uncover the molecular mechanisms underlying the intestinal absorption of these fat-soluble vitamins. In this review, we focus on the membrane proteins (Niemann-Pick C1 like 1, scavenger receptor class B type I, cluster of differentiation 36, and ATP-binding cassette transporter A1) that are (potentially) involved in the intestinal absorption of cholesterol, vitamin E, and vitamin K and discuss their physiological and pharmacological importance. We also discuss the related uncertainties that need to be explored in future studies.

Transporters for the Intestinal Absorption of Cholesterol, Vitamin E, and Vitamin K

PubMed Central

Yamanashi, Yoshihide; Kurauchi, Ryoya; Tanaka, Yusuke; Komine, Toko; Suzuki, Hiroshi

2017-01-01

Humans cannot synthesize fat-soluble vitamins such as vitamin E and vitamin K. For this reason, they must be obtained from the diet via intestinal absorption. As the deficiency or excess of these vitamins has been reported to cause several types of diseases and disorders in humans, the intestinal absorption of these nutrients must be properly regulated to ensure good health. However, the mechanism of their intestinal absorption remains poorly understood. Recent studies on cholesterol using genome-edited mice, genome-wide association approaches, gene mutation analyses, and the development of cholesterol absorption inhibitors have revealed that several membrane proteins play crucial roles in the intestinal absorption of cholesterol. Surprisingly, detailed analyses of these cholesterol transporters have revealed that they can also transport vitamin E and vitamin K, providing clues to uncover the molecular mechanisms underlying the intestinal absorption of these fat-soluble vitamins. In this review, we focus on the membrane proteins (Niemann-Pick C1 like 1, scavenger receptor class B type I, cluster of differentiation 36, and ATP-binding cassette transporter A1) that are (potentially) involved in the intestinal absorption of cholesterol, vitamin E, and vitamin K and discuss their physiological and pharmacological importance. We also discuss the related uncertainties that need to be explored in future studies. PMID:28100881

PI3K/AKT pathway mutations cause a spectrum of brain malformations from megalencephaly to focal cortical dysplasia.

PubMed

Jansen, Laura A; Mirzaa, Ghayda M; Ishak, Gisele E; O'Roak, Brian J; Hiatt, Joseph B; Roden, William H; Gunter, Sonya A; Christian, Susan L; Collins, Sarah; Adams, Carissa; Rivière, Jean-Baptiste; St-Onge, Judith; Ojemann, Jeffrey G; Shendure, Jay; Hevner, Robert F; Dobyns, William B

2015-06-01

Malformations of cortical development containing dysplastic neuronal and glial elements, including hemimegalencephaly and focal cortical dysplasia, are common causes of intractable paediatric epilepsy. In this study we performed multiplex targeted sequencing of 10 genes in the PI3K/AKT pathway on brain tissue from 33 children who underwent surgical resection of dysplastic cortex for the treatment of intractable epilepsy. Sequencing results were correlated with clinical, imaging, pathological and immunohistological phenotypes. We identified mosaic activating mutations in PIK3CA and AKT3 in this cohort, including cancer-associated hotspot PIK3CA mutations in dysplastic megalencephaly, hemimegalencephaly, and focal cortical dysplasia type IIa. In addition, a germline PTEN mutation was identified in a male with hemimegalencephaly but no peripheral manifestations of the PTEN hamartoma tumour syndrome. A spectrum of clinical, imaging and pathological abnormalities was found in this cohort. While patients with more severe brain imaging abnormalities and systemic manifestations were more likely to have detected mutations, routine histopathological studies did not predict mutation status. In addition, elevated levels of phosphorylated S6 ribosomal protein were identified in both neurons and astrocytes of all hemimegalencephaly and focal cortical dysplasia type II specimens, regardless of the presence or absence of detected PI3K/AKT pathway mutations. In contrast, expression patterns of the T308 and S473 phosphorylated forms of AKT and in vitro AKT kinase activities discriminated between mutation-positive dysplasia cortex, mutation-negative dysplasia cortex, and non-dysplasia epilepsy cortex. Our findings identify PI3K/AKT pathway mutations as an important cause of epileptogenic brain malformations and establish megalencephaly, hemimegalencephaly, and focal cortical dysplasia as part of a single pathogenic spectrum. © The Author (2015). Published by Oxford University Press

Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

PubMed

Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

2012-11-01

A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.

The N355K atlastin 1 mutation is associated with hereditary sensory neuropathy and pyramidal tract features.

PubMed

Leonardis, L; Auer-Grumbach, M; Papić, L; Zidar, J

2012-07-01

  Mutations in atlastin-1 (ATL-1), a gene known to cause pure, early-onset autosomal dominant hereditary spastic paraplegia SPG3A, have been recently reported to cause hereditary sensory neuropathy I (HSN I). We describe the detailed clinical and electrophysiologic findings in the first family with ulcero-mutilating sensory neuropathy carrying the c. C1065A, p.N355K mutation in ATL-1.   Detailed clinical and electrophysiologic studies were performed in affected and at-risk family members. Motor and sensory nerve conductions studies (NCS) were carried out in upper and lower limbs. ATL-1 was screened for mutations by direct sequencing.   Ten patients were found to carry the N355K mutation. With the exception of the two youngest patients, all had trophic skin changes in the feet consisting mainly of painless ulcers. Frequently, amputation of toes, feet, or even more proximal parts of the lower legs became necessary. A variable degree of increased muscle tone was observed in younger patients, whilst some older affected individuals only presented with hyperreflexia of patellar tendon reflexes. NCS revealed signs of an axonal motor and sensory neuropathies.   Our family carrying the N355K ATL1 mutation, which was initially diagnosed as HSN I, enlarges the SPG3A phenotype. We therefore suggest that patients with HSN I excluded for more common causes of HSN I, and in particular, affected individuals who exhibit additional pyramidal tract features should also be screened for mutations in ATL1. © 2012 The Author(s) European Journal of Neurology © 2012 EFNS.

High-risk long QT syndrome mutations in the Kv7.1 (KCNQ1) pore disrupt the molecular basis for rapid K(+) permeation.

PubMed

Burgess, Don E; Bartos, Daniel C; Reloj, Allison R; Campbell, Kenneth S; Johnson, Jonathan N; Tester, David J; Ackerman, Michael J; Fressart, Véronique; Denjoy, Isabelle; Guicheney, Pascale; Moss, Arthur J; Ohno, Seiko; Horie, Minoru; Delisle, Brian P

2012-11-13

Type 1 long QT syndrome (LQT1) is caused by loss-of-function mutations in the KCNQ1 gene, which encodes the K(+) channel (Kv7.1) that underlies the slowly activating delayed rectifier K(+) current in the heart. Intragenic risk stratification suggests LQT1 mutations that disrupt conserved amino acid residues in the pore are an independent risk factor for LQT1-related cardiac events. The purpose of this study is to determine possible molecular mechanisms that underlie the loss of function for these high-risk mutations. Extensive genotype-phenotype analyses of LQT1 patients showed that T322M-, T322A-, or G325R-Kv7.1 confers a high risk for LQT1-related cardiac events. Heterologous expression of these mutations with KCNE1 revealed they generated nonfunctional channels and caused dominant negative suppression of WT-Kv7.1 current. Molecular dynamics simulations of analogous mutations in KcsA (T85M-, T85A-, and G88R-KcsA) demonstrated that they disrupted the symmetrical distribution of the carbonyl oxygen atoms in the selectivity filter, which upset the balance between the strong attractive and K(+)-K(+) repulsive forces required for rapid K(+) permeation. We conclude high-risk LQT1 mutations in the pore likely disrupt the architectural and physical properties of the K(+) channel selectivity filter.

High-risk Long QT Syndrome Mutations in the Kv7.1 (KCNQ1) Pore Disrupt the Molecular Basis for Rapid K+ Permeation

PubMed Central

Burgess, Don E.; Bartos, Daniel C.; Reloj, Allison R.; Campbell, Kenneth S.; Johnson, Jonathan N.; Tester, David J.; Ackerman, Michael J.; Fressart, Véronique; Denjoy, Isabelle; Guicheney, Pascale; Moss, Arthur J.; Ohno, Seiko; Horie, Minoru; Delisle, Brian P.

2012-01-01

Type 1 long QT syndrome (LQT1) syndrome is caused by loss-of-function mutations in the KCNQ1, which encodes the K+ channel (Kv7.1) that underlies the slowly activating delayed rectifier K+ current in the heart. Intragenic risk stratification suggests LQT1 mutations that disrupt conserved amino acid residues in the pore are an independent risk factor for LQT1-related cardiac events. The purpose of this study is to determine possible molecular mechanisms that underlie the loss-of-function for these high-risk mutations. Extensive genotype-phenotype analyses of LQT1 patients showed that T322M-, T322A-, or G325R-Kv7.1 confer a high risk for LQT1-related cardiac events. Heterologous expression of these mutations with KCNE1 revealed they generated non-functional channels and caused dominant negative suppression of WT-Kv7.1 current. Molecular dynamic simulations (MDS) of analogous mutations in KcsA (T85M-, T85A-, and G88R-KcsA) demonstrated that they disrupted the symmetrical distribution of the carbonyl oxygen atoms in the selectivity filter, which upset the balance between the strong attractive and K+-K+ repulsive forces required for rapid K+ permeation. We conclude high-risk LQT1 mutations in the pore likely disrupt the architectural and physical properties of the K+ channel selectivity filter. PMID:23092362

200 kHz Commercial Sonar Systems Generate Lower Frequency Side Lobes Audible to Some Marine Mammals

PubMed Central

Deng, Z. Daniel; Southall, Brandon L.; Carlson, Thomas J.; Xu, Jinshan; Martinez, Jayson J.; Weiland, Mark A.; Ingraham, John M.

2014-01-01

The spectral properties of pulses transmitted by three commercially available 200 kHz echo sounders were measured to assess the possibility that marine mammals might hear sound energy below the center (carrier) frequency that may be generated by transmitting short rectangular pulses. All three sounders were found to generate sound at frequencies below the center frequency and within the hearing range of some marine mammals, e.g. killer whales, false killer whales, beluga whales, Atlantic bottlenose dolphins, harbor porpoises, and others. The frequencies of these sub-harmonic sounds ranged from 90 to 130 kHz. These sounds were likely detectable by the animals over distances up to several hundred meters but were well below potentially harmful levels. The sounds generated by the sounders could potentially affect the behavior of marine mammals within fairly close proximity to the sources and therefore the exclusion of echo sounders from environmental impact analysis based solely on the center frequency output in relation to the range of marine mammal hearing should be reconsidered. PMID:24736608

Molecular basis for the role of oncogenic histone mutations in modulating H3K36 methylation

DOE PAGES

Zhang, Yinglu; Shan, Chun -Min; Wang, Jiyong; ...

2017-03-03

Histone H3 lysine 36 methylation (H3K36me) is critical for epigenetic regulation and mutations at or near H3K36 are associated with distinct types of cancers. H3K36M dominantly inhibits H3K36me on wild-type histones, whereas H3G34R/V selectively affects H3K36me on the same histone tail. Here we report the crystal structures of SETD2 SET domain in complex with an H3K36M peptide and SAM or SAH. There are large conformational changes in the substrate binding regions of the SET domain, and the K36M residue interacts with the catalytic pocket of SETD2. H3G34 is surrounded by a very narrow tunnel, which excludes larger amino acid sidemore » chains. H3P38 is in the trans configuration, and the cis configuration is incompatible with SETD2 binding. Lastly, mutations of H3G34 or H3P38 alleviate the inhibitory effects of H3K36M on H3K36me, demonstrating that the stable interaction of H3K36M with SETD2 is critical for its inhibitory effects.« less

PDH E1β deficiency with novel mutations in two patients with Leigh syndrome.

PubMed

Quintana, E; Mayr, J A; García Silva, M T; Font, A; Tortoledo, M A; Moliner, S; Ozaez, L; Lluch, M; Cabello, A; Ricoy, J R; Koch, J; Ribes, A; Sperl, W; Briones, P

2009-12-01

Most cases of pyruvate dehydrogenase complex (PDHc) deficiency are attributable to mutations in the PDHA1 gene which encodes the E(1)α subunit, with few cases of mutations in the genes for E(3), E3BP (E(3) binding protein), E(2) and E(1)-phosphatase being reported. Only seven patients with deficiency of the E(1)β subunit have been described, with mutations in the PDHB gene in six of them. Clinically they presented with a non-specific encephalomyopathy. We report two patients with new mutations in PDHB and Leigh syndrome. Patient 1 was a boy with neonatal onset of hyperlactataemia, corpus callosum hypoplasia and a convulsive encephalopathy. After neurological deterioration, he died at age 5 months. Autopsy revealed the characteristic features of Leigh syndrome. Patient 2, also a boy, presented a milder clinical course. First symptoms were noticed at age 16 months with muscular hypotonia, lactic acidosis and recurrent episodes of somnolence and transient tetraparesis. MRI revealed bilateral signal hyperintensities in the globus pallidus, midbrain and crura cerebri. PDHc and E(1) activities were deficient in fibroblasts in patient 1; in patient 2 PDHc deficiency was found in skeletal muscle. Mutations in PDHA1 were excluded. Sequencing of PDHB revealed a homozygous point mutation (c.302T>C), causing a predicted amino acid change (p.M101T) in patient 1. Patient 2 is compound heterozygote for mutations c.301A>G (p.M101V) and c.313G>A (p.R105Q). All three mutations appear to destabilize the E(1) enzyme with a decrease of both E(1)α and E(1)β subunits in immunoblot analysis. To our knowledge, these patients with novel PDHB mutations are the first reported with Leigh syndrome.

Screening for mutations in exon 4 of the LDL receptor gene: identification of a new deletion mutation.

PubMed Central

Theart, L; Kotze, M J; Langenhoven, E; Loubser, O; Peeters, A V; Lintott, C J; Scott, R S

1995-01-01

DNA from 14 unrelated New Zealand familial hypercholesterolaemia (FH) heterozygotes, originating from the United Kingdom, was screened for mutations in exon 4 of the low density lipoprotein receptor (LDLR) gene. One patient was heterozygous for mutation D206E, which was initially identified in South Africa. The chromosomal background of this mutant allele was compatible with that described previously in Afrikaner and English patients, suggesting that this mutation originated in the United Kingdom. The 2 bp deletion in codon 206 and mutations D154N and D200G, previously reported in English FH patients, were not detected in this sample. In one of the patients, however, a new deletion of 7 bp was identified after nucleotide 581 (or 582) in exon 4 of the LDLR gene. Images PMID:7616546

Emergence of the virulence-associated PB2 E627K substitution in a fatal human case of highly pathogenic avian influenza virus A(H7N7) infection as determined by Illumina ultra-deep sequencing.

PubMed

Jonges, Marcel; Welkers, Matthijs R A; Jeeninga, Rienk E; Meijer, Adam; Schneeberger, Peter; Fouchier, Ron A M; de Jong, Menno D; Koopmans, Marion

2014-02-01

Avian influenza viruses are capable of crossing the species barrier and infecting humans. Although evidence of human-to-human transmission of avian influenza viruses to date is limited, evolution of variants toward more-efficient human-to-human transmission could result in a new influenza virus pandemic. In both the avian influenza A(H5N1) and the recently emerging avian influenza A(H7N9) viruses, the polymerase basic 2 protein (PB2) E627K mutation appears to be of key importance for human adaptation. During a large influenza A(H7N7) virus outbreak in the Netherlands in 2003, the A(H7N7) virus isolated from a fatal human case contained the PB2 E627K mutation as well as a hemagglutinin (HA) K416R mutation. In this study, we aimed to investigate whether these mutations occurred in the avian or the human host by Illumina Ultra-Deep sequencing of three previously uninvestigated clinical samples obtained from the fatal case. In addition, we investigated three chicken samples, two of which were obtained from the source farm. Results showed that the PB2 E627K mutation was not present in any of the chicken samples tested. Surprisingly, the avian samples were characterized by the presence of influenza virus defective RNA segments, suggestive for the synthesis of defective interfering viruses during infection in poultry. In the human samples, the PB2 E627K mutation was identified with increasing frequency during infection. Our results strongly suggest that human adaptation marker PB2 E627K has emerged during virus infection of a single human host, emphasizing the importance of reducing human exposure to avian influenza viruses to reduce the likelihood of viral adaptation to humans.

Trinucleotide Insertions, Deletions, and Point Mutations in Glucose Transporters Confer K+ Uptake in Saccharomyces cerevisiae

PubMed Central

Liang, Hong; Ko, Christopher H.; Herman, Todd; Gaber, Richard F.

1998-01-01

Deletion of TRK1 and TRK2 abolishes high-affinity K+ uptake in Saccharomyces cerevisiae, resulting in the inability to grow on typical synthetic growth medium unless it is supplemented with very high concentrations of potassium. Selection for spontaneous suppressors that restored growth of trk1Δ trk2Δ cells on K+-limiting medium led to the isolation of cells with unusual gain-of-function mutations in the glucose transporter genes HXT1 and HXT3 and the glucose/galactose transporter gene GAL2. 86Rb uptake assays demonstrated that the suppressor mutations conferred increased uptake of the ion. In addition to K+, the mutant hexose transporters also conferred permeation of other cations, including Na+. Because the selection strategy required such gain of function, mutations that disrupted transporter maturation or localization to the plasma membrane were avoided. Thus, the importance of specific sites in glucose transport could be independently assessed by testing for the ability of the mutant transporter to restore glucose-dependent growth to cells containing null alleles of all of the known functional glucose transporter genes. Twelve sites, most of which are conserved among eukaryotic hexose transporters, were revealed to be essential for glucose transport. Four of these have previously been shown to be essential for glucose transport by animal or plant transporters. Eight represented sites not previously known to be crucial for glucose uptake. Each suppressor mutant harbored a single mutation that altered an amino acid(s) within or immediately adjacent to a putative transmembrane domain of the transporter. Seven of 38 independent suppressor mutations consisted of in-frame insertions or deletions. The nature of the insertions and deletions revealed a striking DNA template dependency: each insertion generated a trinucleotide repeat, and each deletion involved the removal of a repeated nucleotide sequence. PMID:9447989

Phase Transitions and Melting in Magnesium to 200 GPa and 4500 K

NASA Astrophysics Data System (ADS)

Stinton, G.; MacLeod, S.; Cynn, H.; Errandonea, D.; Proctor, J.; Meng, Y.; McMahon, M.

2013-06-01

Magnesium is a ``simple'' nearly free-electron metal up to around 100 GPa. Despite similarly-simple group II metals being the subject of numerous studies that have revealed complex high-pressure behaviour, Mg has very few high-pressure diffraction studies, particularly above room temperature. Here we describe such studies to above 200 GPa at 300 K, combined with resistive- and laser-heating experiments to 4500 K and 100 GPa. The hcp-bcc transition at ~50 GPa exhibits a large region of phase co-existence at all temperatures up to 800 K, and the transition pressure is found to decrease with temperature at the rate of ~3.4 GPa per 100 K, somewhat smaller than the rate calculated by Mehta et al.,. At lower pressures, below the melting curve at 10 GPa, we find the dhcp phase to be stable, in agreement with Errandonea et al.. Laser heating studies to 4500 K and 100 GPa show that Mg remains bcc up to the melting curve, our measurement of which is in good agreement with the previous ``speckle'' studies of Errandonea et al.. This work was performed under the auspices of the US DOE by LLNL under Contract DE-AC52-07NA27344.

A universal method for the mutational analysis of K-ras and p53 gene in non-small-cell lung cancer using formalin-fixed paraffin-embedded tissue.

PubMed

Sarkar, F H; Valdivieso, M; Borders, J; Yao, K L; Raval, M M; Madan, S K; Sreepathi, P; Shimoyama, R; Steiger, Z; Visscher, D W

1995-12-01

The p53 tumor suppressor gene has been found to be altered in almost all human solid tumors, whereas K-ras gene mutations have been observed in a limited number of human cancers (adenocarcinoma of colon, pancreas, and lung). Studies of mutational inactivation for both genes in the same patient's sample on non-small-cell lung cancer have been limited. In an effort to perform such an analysis, we developed and compared methods (for the mutational detection of p53 and K-ras gene) that represent a modified and universal protocol, in terms of DNA extraction, polymerase chain reaction (PCR) amplification, and nonradioisotopic PCR-single-strand conformation polymorphism (PCR-SSCP) analysis, which is readily applicable to either formalin-fixed, paraffin-embedded tissues or frozen tumor specimens. We applied this method to the evaluation of p53 (exons 5-8) and K-ras (codon 12 and 13) gene mutations in 55 cases of non-small-cell lung cancer. The mutational status in the p53 gene was evaluated by radioisotopic PCR-SSCP and compared with PCR-SSCP utilizing our standardized nonradioisotopic detection system using a single 6-microns tissue section. The mutational patterns observed by PCR-SSCP were subsequently confirmed by PCR-DNA sequencing. The mutational status in the K-ras gene was similarly evaluated by PCR-SSCP, and the specific mutation was confirmed by Southern slot-blot hybridization using 32P-labeled sequence-specific oligonucleotide probes for codons 12 and 13. Mutational changes in K-ras (codon 12) were found in 10 of 55 (18%) of non-small-cell lung cancers. Whereas adenocarcinoma showed K-ras mutation in 33% of the cases at codon 12, only one mutation was found at codon 13. As expected, squamous cell carcinoma samples (25 cases) did not show K-ras mutations. Mutations at exons 5-8 of the p53 gene were documented in 19 of 55 (34.5%) cases. Ten of the 19 mutations were single nucleotide point mutations, leading to amino acid substitution. Six showed insertional

Study of the decays D0-->pi{-}e{+}nu{e}, D{0}-->K{-}e{+}nu{e}, D{+}-->pi{0}e{+}nu{e}, and D{+}-->K0e{+}nu{e}.

PubMed

Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Zweber, P; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Ernst, J; Severini, H; Dytman, S A; Love, W; Savinov, V; Aquines, O; Li, Z; Lopez, A; Mehrabyan, S; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Brock, I; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Patel, R; Potlia, V; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K

2008-06-27

By using 1.8x10{6} DDpairs, we have measured B(D{0}-->pi{-}e{+}nu{e})=0.299(11)(9)%, B(D{+}-->pi{0}e{+}nu{e})=0.373(22)(13)%, B(D{0}-->K{-}e{+}nu{e})=3.56(3)(9)%, and B(D{+}-->K{0}e{+}nu{e})=8.53(13)(23)% and have studied the q;{2} dependence of the form factors. By combining our results with recent lattice calculations, we obtain |V{cd}|=0.217(9)(4)(23) and |V{cs}|=1.015(10)(11)(106).

Estimation of weekly 99Mo production by AHR 200 kW

NASA Astrophysics Data System (ADS)

Siregar, I. H.; Suharyana; Khakim, A.; Siregar, D.; Frida, A. R.

2016-11-01

The estimation of weekly 99Mo production by AHR 200 kW fueled with Low Enriched Uranium Uranyl Nitrate solution has been simulated by using MCNPX computer code. We have employed the AHR design of Babcock & Wilcox Medical Isotope Production System with 9Be Reflector and Stainless steel vessel. We found that when the concentration of uranium in the fresh fuel was 108 gr U/L of UO2(NO3)2 fuel solution, the multiplication factor was 1.0517. The 99Mo concentration reached saturated at tenth day operation. The AHR can produce approximately 1.96×103 6-day-Ci weekly.

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Clinical utility of TERT promoter mutations and ALK rearrangement in thyroid cancer patients with a high prevalence of the BRAF V600E mutation.

PubMed

Bae, Ja Seong; Kim, Yourha; Jeon, Sora; Kim, Se Hee; Kim, Tae Jung; Lee, Sohee; Kim, Min-Hee; Lim, Dong Jun; Lee, Youn Soo; Jung, Chan Kwon

2016-02-09

Mutations in the TERT promoter, ALK rearrangement, and the BRAF V600E mutation are associated with aggressive clinicopathologic features in thyroid cancers. However, little is known about the impact of TERT promoter mutations and ALK rearrangement in thyroid cancer patients with a high prevalence of BRAF mutations. We performed Sanger sequencing to detect BRAF V600E and TERT promoter mutations and both immunohistochemistry and fluorescence in situ hybridization to identify ALK rearrangement on 243 thyroid cancers. TERT promoter mutations were not present in 192 well-differentiated thyroid carcinomas (WDTC) without distant metastasis or in 9 medullary carcinomas. However, the mutations did occur in 40 % (12/30) of WDTC with distant metastasis, 29 % (2/7) of poorly differentiated carcinomas and 60 % (3/5) of anaplastic carcinomas. ALK rearrangement was not present in all thyroid cancers. The BRAF V600E mutation was more frequently found in WDTC without distant metastasis than in WDTC with distant metastasis (p = 0.007). In the cohort of WDTC with distant metastasis, patients with wild-type BRAF and TERT promoter had a significantly higher response rate after radioiodine therapy (p = 0.024), whereas the BRAF V600E mutation was significantly correlated with progressive disease (p = 0.025). The TERT promoter mutation is an independent predictor for distant metastasis of WDTC, but ALK testing is not useful for clinical decision-making in Korean patients with a high prevalence of the BRAF V600E mutation. Radioiodine therapy for distant metastasis of WDTC is most effective in patients without BRAF V600E and TERT promoter mutations.

Familial Prion Disease with Alzheimer Disease-Like Tau Pathology and Clinical Phenotype

PubMed Central

Jayadev, Suman; Nochlin, David; Poorkaj, Parvoneh; Steinbart, Ellen J.; Mastrianni, James A.; Montine, Thomas J.; Ghetti, Bernardino; Schellenberg, Gerard D.; Bird, Thomas D.; Leverenz, James B.

2011-01-01

Objective To describe the Alzheimer disease (AD)-like clinical and pathological features, including marked neurofibrillary tangle (NFT) pathology, of a familial prion disease due to a rare nonsense mutation of the prion gene (PRNP). Methods Longitudinal clinical assessments were available for the proband and her mother. After death, both underwent neuropathological evaluation. PRNP was sequenced after failure to find immunopositive Aβ deposits in the proband and the documentation of prion protein (PrP) immunopositive pathology. Results The proband presented at age 42 years with a 3-year history of progressive short-term memory impairment and depression. Neuropsychological testing found impaired memory performance, with relatively preserved attention and construction. She was diagnosed with AD and died at age 47 years. Neuropathologic evaluation revealed extensive limbic and neocortical NFT formation and neuritic plaques consistent with a Braak stage of VI. The NFTs were immunopositive, with multiple tau antibodies, and electron microscopy revealed paired helical filaments. However, the neuritic plaques were immunonegative for Aβ, whereas immunostaining for PrP was positive. The mother of the proband had a similar presentation, including depression, and had been diagnosed clinically and pathologically as AD. Reevaluation of her brain tissue confirmed similar tau and PrP immunostaining findings. Genetic analysis revealed that both the proband and her mother had a rare PRNP mutation (Q160X) that resulted in the production of truncated PrP. Interpretation We suggest that PRNP mutations that result in a truncation of PrP lead to a prolonged clinical course consistent with a clinical diagnosis of AD and severe AD-like NFTs. PMID:21416485

Outsider to insider: resetting the natural host niche of commensal E. coli K-12.

PubMed

Sahu, Upasana; Kar, Sudeshna

2012-01-01

The status of E. coli K-12 as an exclusively non-invasive, non-pathogenic bacterium has almost been incontrovertible. Our recent finding that a mutation in one of its main architectural protein, HU, converts E. coli K-12 to an actively invasive form suggests that gaining host cell entry might be an expedient survival tactic for traditional commensals during certain altered host conditions. The mutant E. coli (SK3842) exhibits properties usually associated with pathogenic bacteria: host cell invasion, phagosomal disruption and intracellular replication. However, unlike the situation with some pathogens, internalized SK3842 imparts anti-apoptotic and cyto-protective effects rather than lethality on the host cell, both in vitro and in vivo. Here, we show that SK3842 also provides colonization resistance against other invasive pathogens--a trait not shared by the parental commensal strain. Thus, the altered lifestyle of SK3842 encompasses characteristics both from traditional pathogens as well as beneficial probiotic strains.

Cross-talk Signaling between HER3 and HPV16 E6 and E7 Mediates Resistance to PI3K Inhibitors in Head and Neck Cancer.

PubMed

Brand, Toni M; Hartmann, Stefan; Bhola, Neil E; Li, Hua; Zeng, Yan; O'Keefe, Rachel A; Ranall, Max V; Bandyopadhyay, Sourav; Soucheray, Margaret; Krogan, Nevan J; Kemp, Carolyn; Duvvuri, Umamaheswar; LaVallee, Theresa; Johnson, Daniel E; Ozbun, Michelle A; Bauman, Julie E; Grandis, Jennifer R

2018-05-01

Human papillomavirus (HPV) type 16 is implicated in approximately 75% of head and neck squamous cell carcinomas (HNSCC) that arise in the oropharynx, where viral expression of the E6 and E7 oncoproteins promote cellular transformation, tumor growth, and maintenance. An important oncogenic signaling pathway activated by E6 and E7 is the PI3K pathway, a key driver of carcinogenesis. The PI3K pathway is also activated by mutation or amplification of PIK3CA in over half of HPV(+) HNSCC. In this study, we investigated the efficacy of PI3K-targeted therapies in HPV(+) HNSCC preclinical models and report that HPV(+) cell line- and patient-derived xenografts are resistant to PI3K inhibitors due to feedback signaling emanating from E6 and E7. Receptor tyrosine kinase profiling indicated that PI3K inhibition led to elevated expression of the HER3 receptor, which in turn increased the abundance of E6 and E7 to promote PI3K inhibitor resistance. Targeting HER3 with siRNA or the mAb CDX-3379 reduced E6 and E7 abundance and enhanced the efficacy of PI3K-targeted therapies. Together, these findings suggest that cross-talk between HER3 and HPV oncoproteins promotes resistance to PI3K inhibitors and that cotargeting HER3 and PI3K may be an effective therapeutic strategy in HPV(+) tumors. Significance: These findings suggest a new therapeutic combination that may improve outcomes in HPV(+) head and neck cancer patients. Cancer Res; 78(9); 2383-95. ©2018 AACR . ©2018 American Association for Cancer Research.

A histone H3K9M mutation traps histone methyltransferase Clr4 to prevent heterochromatin spreading

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shan, Chun-Min; Wang, Jiyong; Xu, Ke

2016-09-20

Histone lysine-to-methionine (K-to-M) mutations are associated with multiple cancers, and they function in a dominant fashion to block the methylation of corresponding lysines on wild type histones. However, their mechanisms of function are controversial. Here we show that in fission yeast, introducing the K9M mutation into one of the three histone H3 genes dominantly blocks H3K9 methylation on wild type H3 across the genome. In addition, H3K9M enhances the interaction of histone H3 tail with the H3K9 methyltransferase Clr4 in a SAM (S-adenosyl-methionine)-dependent manner, and Clr4 is trapped at nucleation sites to prevent its spreading and the formation of largemore » heterochromatin domains. We further determined the crystal structure of an H3K9M peptide in complex with human H3K9 methyltransferase G9a and SAM, which reveales that the methionine side chain had enhanced van der Waals interactions with G9a. Therefore, our results provide a detailed mechanism by which H3K9M regulates H3K9 methylation.« less

Oral inoculation of neonatal Suffolk sheep with the agent of classical scrapie results in PrPSc accumulation in sheep with the PRNP ARQ/ARQ but not the ARQ/ARR genotype

USDA-ARS?s Scientific Manuscript database

Background Scrapie is a transmissible spongiform encephalopathy that can be transmitted amongst susceptible sheep. The prion protein gene (PRNP) profoundly influences the susceptibility of sheep to the scrapie agent. Findings This study reports the failure to detect PrPSc in nervous or lymphoid tis...

CMS-dependent prognostic impact of KRAS and BRAFV600E mutations in primary colorectal cancer.

PubMed

Smeby, J; Sveen, A; Merok, M A; Danielsen, S A; Eilertsen, I A; Guren, M G; Dienstmann, R; Nesbakken, A; Lothe, R A

2018-05-01

The prognostic impact of KRAS and BRAFV600E mutations in primary colorectal cancer (CRC) varies with microsatellite instability (MSI) status. The gene expression-based consensus molecular subtypes (CMSs) of CRC define molecularly and clinically distinct subgroups, and represent a novel stratification framework in biomarker analysis. We investigated the prognostic value of these mutations within the CMS groups. Totally 1197 primary tumors from a Norwegian series of CRC stage I-IV were analyzed for MSI and mutation status in hotspots in KRAS (codons 12, 13 and 61) and BRAF (codon 600). A subset was analyzed for gene expression and confident CMS classification was obtained for 317 samples. This cohort was expanded with clinical and molecular data, including CMS classification, from 514 patients in the publically available dataset GSE39582. Gene expression signatures associated with KRAS and BRAFV600E mutations were used to evaluate differential impact of mutations on gene expression among the CMS groups. BRAFV600E and KRAS mutations were both associated with inferior 5-year overall survival (OS) exclusively in MSS tumors (BRAFV600E mutation versus KRAS/BRAF wild-type: Hazard ratio (HR) 2.85, P < 0.001; KRAS mutation versus KRAS/BRAF wild-type: HR 1.30, P = 0.013). BRAFV600E-mutated MSS tumors were strongly enriched and associated with metastatic disease in CMS1, leading to negative prognostic impact in this subtype (OS: BRAFV600E mutation versus wild-type: HR 7.73, P = 0.001). In contrast, the poor prognosis of KRAS mutations was limited to MSS tumors with CMS2/CMS3 epithelial-like gene expression profiles (OS: KRAS mutation versus wild-type: HR 1.51, P = 0.011). The subtype-specific prognostic associations were substantiated by differential effects of BRAFV600E and KRAS mutations on gene expression signatures according to the MSI status and CMS group. BRAFV600E mutations are enriched and associated with metastatic disease in CMS1 MSS tumors, leading

Cardiomyopathy mutations in the tail of β-cardiac myosin modify the coiled-coil structure and affect integration into thick filaments in muscle sarcomeres in adult cardiomyocytes.

PubMed

Wolny, Marcin; Colegrave, Melanie; Colman, Lucy; White, Ed; Knight, Peter J; Peckham, Michelle

2013-11-01

It is unclear why mutations in the filament-forming tail of myosin heavy chain (MHC) cause hypertrophic or dilated cardiomyopathy as these mutations should not directly affect contraction. To investigate this, we first investigated the impact of five hypertrophic cardiomyopathy-causing (N1327K, E1356K, R1382W, E1555K, and R1768K) and one dilated cardiomyopathy-causing (R1500W) tail mutations on their ability to incorporate into muscle sarcomeres in vivo. We used adenoviral delivery to express full-length wild type or mutant enhanced GFP-MHC in isolated adult cardiomyocytes. Three mutations (N1327K, E1356K, and E1555K) reduced enhanced GFP-MHC incorporation into muscle sarcomeres, whereas the remainder had no effect. No mutations significantly affected contraction. Fluorescence recovery after photobleaching showed that fluorescence recovery for the mutation that incorporated least well (N1327K) was significantly faster than that of WT with half-times of 25.1 ± 1.8 and 32.2 ± 2.5 min (mean ± S.E.), respectively. Next, we determined the effects of each mutation on the helical properties of wild type and seven mutant peptides (7, 11, or 15 heptads long) from the myosin tail by circular dichroism. R1382W and E1768K slightly increased the α-helical nature of peptides. The remaining mutations reduced α-helical content, with N1327K showing the greatest reduction. Only peptides containing residues 1301-1329 were highly α-helical suggesting that this region helps in initiation of coiled coil. These results suggest that small effects of mutations on helicity translate into a reduced ability to incorporate into sarcomeres, which may elicit compensatory hypertrophy.

Evidence for the decay D0-->K(-)pi(+)pi(-)e(+)nu(e).

PubMed

Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Naik, P; Briere, R A; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Cassel, D G; Duboscq, J E; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Mohapatra, D; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Athar, S B; Patel, R; Potlia, V; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Selen, M; White, E J; Wiss, J; Mitchell, R E; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Zweber, P; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Ernst, J; Ecklund, K M; Severini, H; Love, W; Savinov, V; Aquines, O; Lopez, A; Mehrabyan, S; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Hu, D; Moziak, B; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F

2007-11-09

Using a 281 pb{-1} data sample collected at the psi(3770) with the CLEO-c detector, we present the first absolute branching fraction measurement of the decay D0-->K(-)pi(+)pi(-)e(+)nu(e) at a statistical significance of about 4.0 standard deviations. We find 10 candidates consistent with the decay D0-->K(-)pi(+)pi(-)e(+)nu(e). The probability that a background fluctuation accounts for this signal is less than 4.1 x 10{-5}. We find B(D0-->K(-)pi(+)pi(-)e(+)nu(e)) = [2.8{-1.1}{+1.4}(stat)+/-0.3(syst)]x10{-4}. By restricting the invariant mass of the hadronic system to be consistent with K1(1270), we obtain the product of branching fractions B(D{0}-->K{1}{-}(1270)e{+}nu{e})xB(K1-(1270)-->K{-}pi{+}pi{-})=[2.5{-1.0}{+1.3}(stat)+/-0.2(syst)]x10{-4}. Using B(K1-(1270)-->K{-}pi{+}pi{-})=(33+/-3)%, we obtain B(D{0}-->K{1}{-}(1270)e{+}nu{e})=[7.6{-3.0}{+4.1}(stat)+/-0.6(syst)+/-0.7]x10{-4}. The last error accounts for the uncertainties in the measured K1-(1270)-->K{-}pi{+}pi{-} branching fractions.

Loss-of-function mutations in co-chaperone BAG3 destabilize small HSPs and cause cardiomyopathy

PubMed Central

Fang, Xi; Wu, Tongbin; Liu, Canzhao; Veevers, Jennifer; Stroud, Matthew J.; Zhang, Zhiyuan; Ma, Xiaolong; Mu, Yongxin; Lao, Dieu-Hung; Dalton, Nancy D.; Gu, Yusu; Wang, Celine; Wang, Michael; Liang, Yan; Ouyang, Kunfu; Peterson, Kirk L.; Evans, Sylvia M.

2017-01-01

Defective protein quality control (PQC) systems are implicated in multiple diseases. Molecular chaperones and co-chaperones play a central role in functioning PQC. Constant mechanical and metabolic stress in cardiomyocytes places great demand on the PQC system. Mutation and downregulation of the co-chaperone protein BCL-2–associated athanogene 3 (BAG3) are associated with cardiac myopathy and heart failure, and a BAG3 E455K mutation leads to dilated cardiomyopathy (DCM). However, the role of BAG3 in the heart and the mechanisms by which the E455K mutation leads to DCM remain obscure. Here, we found that cardiac-specific Bag3-KO and E455K-knockin mice developed DCM. Comparable phenotypes in the 2 mutants demonstrated that the E455K mutation resulted in loss of function. Further experiments revealed that the E455K mutation disrupted the interaction between BAG3 and HSP70. In both mutants, decreased levels of small heat shock proteins (sHSPs) were observed, and a subset of proteins required for cardiomyocyte function was enriched in the insoluble fraction. Together, these observations suggest that interaction between BAG3 and HSP70 is essential for BAG3 to stabilize sHSPs and maintain cardiomyocyte protein homeostasis. Our results provide insight into heart failure caused by defects in BAG3 pathways and suggest that increasing BAG3 protein levels may be of therapeutic benefit in heart failure. PMID:28737513

Loss-of-function mutations in co-chaperone BAG3 destabilize small HSPs and cause cardiomyopathy.

PubMed

Fang, Xi; Bogomolovas, Julius; Wu, Tongbin; Zhang, Wei; Liu, Canzhao; Veevers, Jennifer; Stroud, Matthew J; Zhang, Zhiyuan; Ma, Xiaolong; Mu, Yongxin; Lao, Dieu-Hung; Dalton, Nancy D; Gu, Yusu; Wang, Celine; Wang, Michael; Liang, Yan; Lange, Stephan; Ouyang, Kunfu; Peterson, Kirk L; Evans, Sylvia M; Chen, Ju

2017-08-01

Defective protein quality control (PQC) systems are implicated in multiple diseases. Molecular chaperones and co-chaperones play a central role in functioning PQC. Constant mechanical and metabolic stress in cardiomyocytes places great demand on the PQC system. Mutation and downregulation of the co-chaperone protein BCL-2-associated athanogene 3 (BAG3) are associated with cardiac myopathy and heart failure, and a BAG3 E455K mutation leads to dilated cardiomyopathy (DCM). However, the role of BAG3 in the heart and the mechanisms by which the E455K mutation leads to DCM remain obscure. Here, we found that cardiac-specific Bag3-KO and E455K-knockin mice developed DCM. Comparable phenotypes in the 2 mutants demonstrated that the E455K mutation resulted in loss of function. Further experiments revealed that the E455K mutation disrupted the interaction between BAG3 and HSP70. In both mutants, decreased levels of small heat shock proteins (sHSPs) were observed, and a subset of proteins required for cardiomyocyte function was enriched in the insoluble fraction. Together, these observations suggest that interaction between BAG3 and HSP70 is essential for BAG3 to stabilize sHSPs and maintain cardiomyocyte protein homeostasis. Our results provide insight into heart failure caused by defects in BAG3 pathways and suggest that increasing BAG3 protein levels may be of therapeutic benefit in heart failure.

Activation of the cryptic PhnE permease promotes rapid adaptive evolution in a population of Escherichia coli K-12 starved for phosphate.

PubMed

Guillemet, Mélanie L; Moreau, Patrice L

2012-01-01

Escherichia coli K-12 suffers acetic acid stress during prolonged incubation in glucose minimal medium containing a limiting concentration of inorganic phosphate (0.1 mM P(i)), which decreases the number of viable cells from 6 × 10(8) to ≤10 CFU/ml between days 6 and 14 of incubation. Here we show that following two serial transfers into P(i)-limiting medium, evolved mutants survived prolonged incubation (≈10(7) CFU/ml on day 14 of incubation). The evolved strains that overtook the populations were generally PhnE(+), whereas the ancestral K-12 strain carries an inactive phnE allele, which prevents the transport of phosphonates. The switching in phnE occurred with a high frequency as a result of the deletion of an 8-bp repeated sequence. In a mixed culture starved for P(i) that contained the K-12 ancestral strain in majority, evolved strains grew through PhnE-dependent scavenging of probably organic phosphate esters (not phosphonates or P(i)) released by E. coli K-12 between days 1 and 3, before acetic acid excreted by E. coli K-12 reached toxic levels. The growth yield of phnE(+) strains in mixed culture was dramatically enhanced by mutations that affect glucose metabolism, such as an rpoS mutation inactivating the alternative sigma factor RpoS. The long-term viability of evolved populations was generally higher when the ancestral strain carried an inactive rather than an active phnE allele, which indicates that cross-feeding of phosphorylated products as a result of the phnE polymorphism may be essential for the spread of mutants which eventually help populations to survive under P(i) starvation conditions.

Gerstmann-Straüssler-Scheinker disease

PubMed Central

Jones, Matthew; Odunsi, Sola; du Plessis, Daniel; Vincent, Angela; Bishop, Matthew; Head, Mark W.; Ironside, James W.

2014-01-01

Objective: To describe a unique case of Gerstmann-Straüssler-Scheinker (GSS) disease caused by a novel prion protein (PRNP) gene mutation and associated with strongly positive voltage-gated potassium channel (VGKC)-complex antibodies (Abs). Methods: Clinical data were gathered from retrospective review of the case notes. Postmortem neuropathologic examination was performed, and DNA was extracted from frozen brain tissue for full sequence analysis of the PRNP gene. Results: The patient was diagnosed in life with VGKC-complex Ab–associated encephalitis based on strongly positive VGKC-complex Ab titers but no detectable LGI1 or CASPR2 Abs. He died despite 1 year of aggressive immunosuppressive treatment. The neuropathologic diagnosis was GSS disease, and a novel mutation, P84S, in the PRNP gene was found. Conclusion: VGKC-complex Abs are described in an increasingly broad range of clinical syndromes, including progressive encephalopathies, and may be amenable to treatment with immunosuppression. However, the failure to respond to aggressive immunotherapy warns against VGKC-complex Abs being pathogenic, and their presence does not preclude the possibility of prion disease. PMID:24814844

Hematological shift in goat kids naturally devoid of prion protein.

PubMed

Reiten, Malin R; Bakkebø, Maren K; Brun-Hansen, Hege; Lewandowska-Sabat, Anna M; Olsaker, Ingrid; Tranulis, Michael A; Espenes, Arild; Boysen, Preben

2015-01-01

The physiological role of the cellular prion protein (PrP(C)) is incompletely understood. The expression of PrP(C) in hematopoietic stem cells and immune cells suggests a role in the development of these cells, and in PrP(C) knockout animals altered immune cell proliferation and phagocytic function have been observed. Recently, a spontaneous nonsense mutation at codon 32 in the PRNP gene in goats of the Norwegian Dairy breed was discovered, rendering homozygous animals devoid of PrP(C). Here we report hematological and immunological analyses of homozygous goat kids lacking PrP(C) (PRNP(Ter/Ter) ) compared to heterozygous (PRNP (+/Ter)) and normal (PRNP (+/+)) kids. Levels of cell surface PrP(C) and PRNP mRNA in peripheral blood mononuclear cells (PBMCs) correlated well and were very low in PRNP (Ter/Ter), intermediate in PRNP (+/Ter) and high in PRNP (+/+) kids. The PRNP (Ter/Ter) animals had a shift in blood cell composition with an elevated number of red blood cells (RBCs) and a tendency toward a smaller mean RBC volume (P = 0.08) and an increased number of neutrophils (P = 0.068), all values within the reference ranges. Morphological investigations of blood smears and bone marrow imprints did not reveal irregularities. Studies of relative composition of PBMCs, phagocytic ability of monocytes and T-cell proliferation revealed no significant differences between the genotypes. Our data suggest that PrP(C) has a role in bone marrow physiology and warrant further studies of PrP(C) in erythroid and immune cell progenitors as well as differentiated effector cells also under stressful conditions. Altogether, this genetically unmanipulated PrP(C)-free animal model represents a unique opportunity to unveil the enigmatic physiology and function of PrP(C).

Sensitivity of the ViroSeq HIV-1 Genotyping System for Detection of the K103N Resistance Mutation in HIV-1 Subtypes A, C, and D

PubMed Central

Church, Jessica D.; Jones, Dana; Flys, Tamara; Hoover, Donald; Marlowe, Natalia; Chen, Shu; Shi, Chanjuan; Eshleman, James R.; Guay, Laura A.; Jackson, J. Brooks; Kumwenda, Newton; Taha, Taha E.; Eshleman, Susan H.

2006-01-01

The US Food and Drug Administration-cleared ViroSeq HIV-1 Genotyping System (ViroSeq) and other population sequencing-based human immunodeficiency virus type 1 (HIV-1) genotyping methods detect antiretroviral drug resistance mutations present in the major viral population of a test sample. These assays also detect some mutations in viral variants that are present as mixtures. We compared detection of the K103N nevirapine resistance mutation using ViroSeq and a sensitive, quantitative point mutation assay, LigAmp. The LigAmp assay measured the percentage of K103N-containing variants in the viral population (percentage of K103N). We analyzed 305 samples with HIV-1 subtypes A, C, and D collected from African women after nevirapine administration. ViroSeq detected K103N in 100% of samples with >20% K103N, 77.8% of samples with 10 to 20% K103N, 71.4% of samples with 5 to 10% K103N, and 16.9% of samples with 1 to 5% K103N. The sensitivity of ViroSeq for detection of K103N was similar for subtypes A, C, and D. These data indicate that the ViroSeq system reliably detects the K103N mutation at levels above 20% and frequently detects the mutation at lower levels. Further studies are needed to compare the sensitivity of different assays for detection of HIV-1 drug resistance mutations and to determine the clinical relevance of HIV-1 minority variants. PMID:16931582

Mutated form (G52E) of inactive diphtheria toxin CRM197: molecular simulations clearly display effect of the mutation to NAD binding.

PubMed

Salmas, Ramin Ekhteiari; Mestanoglu, Mert; Unlu, Ayhan; Yurtsever, Mine; Durdagi, Serdar

2016-11-01

Mutated form (G52E) of diphtheria toxin (DT) CRM197 is an inactive and nontoxic enzyme. Here, we provided a molecular insight using comparative molecular dynamics (MD) simulations to clarify the influence of a single point mutation on overall protein and active-site loop. Post-processing MD analysis (i.e. stability, principal component analysis, hydrogen-bond occupancy, etc.) is carried out on both wild and mutated targets to investigate and to better understand the mechanistic differences of structural and dynamical properties on an atomic scale especially at nicotinamide adenine dinucleotide (NAD) binding site when a single mutation (G52E) happens at the DT. In addition, a docking simulation is performed for wild and mutated forms. The docking scoring analysis and docking poses results revealed that mutant form is not able to properly accommodate the NAD molecule.

Identification of the M1101K mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and complete detection of cystic fibrosis mutations in the Hutterite population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zielenski, J.; Markiewicz, D.; Fujiwara, M.

1993-03-01

The Hutterite population is a genetic isolate with an increased incidence of cystic fibrosis (CF). Previously the authors identified three CF haplotypes defined by polymorphisms flanking the CF transmembrane conductance regulator (CFTR) gene. [Delta]F508 was present on one of the haplotypes in only 35% of CF chromosomes. They hypothesized that the other two CF haplotypes, one of which was the most common and the other of which is rare, each harbored different non-[Delta]F508 mutations. Single-strand conformation polymorphism analysis detected a missense mutation, M1101K, in both chromosomes of a Hutterite patient carrying the two non-[Delta]F508 haplotypes. M1101K appears to have originatedmore » on an uncommon CFTR allele and to be infrequent outside the Hutterite population. The presence of M1101K on two haplotypes is likely the result of a CFTR intragenic recombination which occurred since the founding, 10-12 generations ago, of the Hutterite population. The crossover was located between exons 14a and 17b, an interval of approximately 15 kbp. [Delta]F508 and M1101K accounted for all of the CF mutations in patients from 16 CF families representing the three subdivisions of the Hutterite population. 38 refs., 3 figs., 1 tab.« less

Relationship of body mass index with BRAF (V600E) mutation in papillary thyroid cancer.

PubMed

Shi, Rong-Liang; Qu, Ning; Liao, Tian; Wei, Wen-Jun; Lu, Zhong-Wu; Ma, Ben; Wang, Yu-Long; Ji, Qing-Hai

2016-06-01

Current evidences suggest an influence of overweight body mass index (BMI) on the carcinogenesis in malignancies. However, the role of BMI is unclear in papillary thyroid cancer (PTC). The aim of the present study is to investigate the relationship between BMI and BRAF (V600E) mutation status in PTC. BRAF (V600E) mutation in 108 patients with PTC was analyzed by Sanger sequencing. The cutoff point of BMI was identified by X-tile for predicting mutation by overweight. Odds ratios (OR) and 95 % confidence interval (CI) of BRAF (V600E) mutation according to BMI and clinicopathologic variables were calculated using logistic regression models. Fifty-one patients were positive for BRAF (V600E) mutation. A positive relationship existed between BRAF (V600E) mutation and BMI (p = 0.039). A 24.3 kg/m(2) was identified as cutoff point for differentiating greater than 52.0 % observed probability of mutation for BRAF (V600E) in entire cohort, which was similar to the midpoint between the upper limit of normal BMI and overweight defined by WHO (≥24 kg/m(2)). Multivariate analysis confirmed the association between BRAF (V600E) mutation with overweight BMI range (OR 7.645, 95 % CI 1.275-45.831, p = 0.026). This study suggests an influence of overweight BMI on the status of BRAF (V600E) in patients with PTC, whereas the underlying mechanism need to be further investigated.

Detection of MPLW515L/K Mutations and Determination of Allele Frequencies with a Single-Tube PCR Assay

PubMed Central

Takei, Hiraku; Morishita, Soji; Araki, Marito; Edahiro, Yoko; Sunami, Yoshitaka; Hironaka, Yumi; Noda, Naohiro; Sekiguchi, Yuji; Tsuneda, Satoshi; Ohsaka, Akimichi; Komatsu, Norio

2014-01-01

A gain-of-function mutation in the myeloproliferative leukemia virus (MPL) gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs). The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system)-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5%) of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner. PMID:25144224

Detection of MPLW515L/K mutations and determination of allele frequencies with a single-tube PCR assay.

PubMed

Takei, Hiraku; Morishita, Soji; Araki, Marito; Edahiro, Yoko; Sunami, Yoshitaka; Hironaka, Yumi; Noda, Naohiro; Sekiguchi, Yuji; Tsuneda, Satoshi; Ohsaka, Akimichi; Komatsu, Norio

2014-01-01

A gain-of-function mutation in the myeloproliferative leukemia virus (MPL) gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs). The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system)-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5%) of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner.

Electron Beam Misalignment Study of MIG for 42 GHz, 200 kW Gyrotron

NASA Astrophysics Data System (ADS)

Sharma, S. K.; Singh, Udaybir; Kumar, Nitin; Sahu, Naveen; Shekhawat, Narendra; Srivastava, Deepak; Alaria, M. K.; Bera, A.; Jain, P. K.; Sinha, A. K.

2017-10-01

This paper presents the electron beam misalignment study with respect to cathode position and cathode magnetic field of 42 GHz, 200 kW gyrotron. The performance of gyrotron is affected with the misalignment of cathode position. The simulation results confirm the tolerance of cathode misalignment with respect to the design parameters such as the transverse-to-axial velocity ratio, the maximum transverse velocity spread, etc.

Spectrum of EGFR gene mutations in Vietnamese patients with non-small cell lung cancer.

PubMed

Vu, Hoang Anh; Xinh, Phan Thi; Ha, Hua Thi Ngoc; Hanh, Ngo Thi Tuyet; Bach, Nguyen Duc; Thao, Doan Thi Phuong; Dat, Ngo Quoc; Trung, Nguyen Sao

2016-03-01

Epidermal growth factor receptor (EGFR) mutational status is a crucial biomarker for prediction of response to tyrosine kinase inhibitors in patients with non-small cell lung cancer (NSCLC). Although these mutations have been well characterized in other countries, little is known about the frequency or spectrum of EGFR mutations in Vietnamese NSCLC patients. Using Sanger DNA sequencing, we investigated mutations in EGFR exons 18-21 from 332 patients diagnosed with NSCLC at University of Medicine and Pharmacy, Ho Chi Minh City, Vietnam. DNA was extracted from formalin-fixed, paraffin-embedded tissues, followed by PCR amplification and sequencing. EGFR mutations were detected in 135 samples (40.7%), of which eight samples carried double mutations. In total, 46 different types of EGFR mutations were found, including six novel mutations (p.K713E, p.K714R, p.P794S, p.R803W, p.P848S, and p.K867E). Among the four exons investigated, exon 19 was most frequently mutated (63 out of 332 patients, 19%), with the p.E746_A750del appearing in 43 samples. Exon 21 was mutated in 56 samples (16.9%), of which 47 were p.L858R. Each of exons 18 and 20 was mutated in 12 samples (3.6%). The frequency of EGFR mutations was higher in females than in males (48.9% vs 35%, P = 0.012), but not statistically different between adenocarcinomas and other histological types of NSCLC (41.3% vs 34.5%, P = 0.478). DNA sequencing detected EGFR mutations with high frequency and revealed a broad spectrum of mutation type in Vietnamese patients with NSCLC. © 2015 Wiley Publishing Asia Pty Ltd.

K-Ras mutation detection in liquid biopsy and tumor tissue as prognostic biomarker in patients with pancreatic cancer: a systematic review with meta-analysis.

PubMed

Li, Tao; Zheng, Yuanting; Sun, Hong; Zhuang, Rongyuan; Liu, Jing; Liu, Tianshu; Cai, Weimin

2016-07-01

K-Ras gene mutations have been found in most pancreatic cancers; however, conflicting data on the prognostic value of K-Ras mutations in pancreatic cancer have been published. We conducted a meta-analysis to assess its prognostic significance. Literature searches of PubMed, EMBASE, Cochrane Library, Web of Science and Google Scholar were performed through December 2015 to identify publications exploring the association of K-Ras mutation with overall survival. Forty eligible studies involving 3427 patients with pancreatic cancer were included in the present meta-analysis. Our analysis showed a hazard ratio (HR) of negative association with survival of 1.61 [95 % confidence interval (CI) 1.36-1.90; p < 0.01] in K-Ras mutant pancreatic cancer patients. In subgroup analyses, K-Ras mutations detected in tumor tissues and in liquid biopsies had HRs of 1.37 (95 % CI 1.20-1.57; p < 0.01) and 3.16 (95 % CI 2.1-4.71; p < 0.01), respectively. In addition, the HR was higher when K-Ras mutations were detected in fresh frozen samples (HR = 2.01, 95 % CI 1.28-3.16, p = 0.002) than in formalin-fixed, paraffin-embedded (FFPE) samples (HR = 1.29, 95 % CI 1.12-1.49, p < 0.01). Though K-Ras alterations are more frequent among non-East Asian individuals than East Asian individuals, there were no significant differences in HRs of survival between the two ethnic subgroups. In conclusion, this meta-analysis suggests that K-Ras mutations are associated with a worse overall survival in pancreatic cancer patients, especially when mutations are detected in liquid biopsies or fresh frozen tumor tissue samples.

[Two novel pathogenic mutations of GAN gene identified in a patient with giant axonal neuropathy].

PubMed

Wang, Juan; Ma, Qingwen; Cai, Qin; Liu, Yanna; Wang, Wei; Ren, Zhaorui

2016-06-01

To explore the disease-causing mutations in a patient suspected for giant axonal neuropathy(GAN). Target sequence capture sequencing was used to screen potential mutations in genomic DNA extracted from peripheral blood sample of the patient. Sanger sequencing was applied to confirm the detected mutation. The mutation was verified among 400 GAN alleles from 200 healthy individuals by Sanger sequencing. The function of the mutations was predicted by bioinformatics analysis. The patient was identified as a compound heterozygote carrying two novel pathogenic GAN mutations, i.e., c.778G>T (p.Glu260Ter) and c.277G>A (p.Gly93Arg). Sanger sequencing confirmed that the c.778G>T (p.Glu260Ter) mutation was inherited from his father, while c.277G>A (p.Gly93Arg) was inherited from his mother. The same mutations was not found in the 200 healthy individuals. Bioinformatics analysis predicted that the two mutations probably caused functional abnormality of gigaxonin. Two novel GAN mutations were detected in a patient with GAN. Both mutations are pathogenic and can cause abnormalities of gigaxonin structure and function, leading to pathogenesis of GAN. The results may also offer valuable information for similar diseases.

The presence of OMP inclusion bodies in a Escherichia coli K-12 mutated strain is not related to lipopolysaccharide structure.

PubMed

Corsaro, M Michela; Parrilli, Ermenegilda; Lanzetta, Rosa; Naldi, Teresa; Pieretti, Giuseppina; Lindner, Buko; Carpentieri, Andrea; Parrilli, Michelangelo; Tutino, M Luisa

2009-08-01

The role of lipopolysaccharides (LPSs) in the biogenesis of outer membrane proteins have been investigated in several studies. Some of these analyses showed that LPS is required for correct and efficient folding of outer membrane proteins; other studies support the idea of independence of outer membrane proteins biogenesis from LPS structure. In this article, we investigated the involvement of LPS structure in the anomalous aggregation of outer membrane proteins in a E. coli mutant strain (S17-1(lambdapir)). To achieve this aim, the LPS structure of the mutant strain was carefully determined and compared with the E. coli K-12 one. It turned out that LPS of these two strains differs in the inner core for the absence of a heptose residue (HepIII). We demonstrated that this difference is due to a mutation in waaQ, a gene encoding the transferase for the branch heptose HepIII residue. The mutation was complemented to find out if the restoration of LPS structure influenced the observed outer membrane proteins aggregation. Data reported in this work demonstrated that, in E. coli S17-1(lambdapir) there is no influence of LPS structure on the outer membrane proteins inclusion bodies formation.

Alexander Disease: A Novel Mutation in GFAP Leading to Epilepsia Partialis Continua.

PubMed

Bonthius, Daniel J; Karacay, Bahri

2016-06-01

Alexander disease is a genetically induced leukodystrophy, due to dominant mutations in the glial fibrillary acidic protein (GFAP ) gene, causing dysfunction of astrocytes. We have identified a novel GFAP mutation, associated with a novel phenotype for Alexander disease. A boy with global developmental delay and hypertonia was found to have a leukodystrophy. Genetic analysis revealed a heterozygous point mutation in exon 6 of the GFAP gene. The guanine-to-adenine change causes substitution of the normal glutamic acid codon (GAG) with a mutant lysine codon (AAG) at position 312 (E312 K mutation). At the age of 4 years, the child developed epilepsia partialis continua, consisting of unabating motor seizures involving the unilateral perioral muscles. Epilepsia partialis continua has not previously been reported in association with Alexander disease. Whether and how the E312 K mutation produces pathologic changes and clinical signs that are unique from other Alexander disease-inducing mutations in GFAP remain to be determined. © The Author(s) 2015.

Decreased Sensitivity to Changes in the Concentration of Metal Ions as the Basis for the Hyperactivity of DtxR(E175K)

DOE Office of Scientific and Technical Information (OSTI.GOV)

D’Aquino, J. Alejandro; Denninger, Andrew R.; Moulin, Aaron G.

2010-01-12

The metal-ion-activated diphtheria toxin repressor (DtxR) is responsible for the regulation of virulence and other genes in Corynebacterium diphtheriae. A single point mutation in DtxR, DtxR(E175K), causes this mutant repressor to have a hyperactive phenotype. Mice infected with Mycobacterium tuberculosis transformed with plasmids carrying this mutant gene show reduced signs of the tuberculosis infection. Corynebacterial DtxR is able to complement mycobacterial IdeR and vice versa. To date, an explanation for the hyperactivity of DtxR(E175K) has remained elusive. In an attempt to address this issue, we have solved the first crystal structure of DtxR(E175K) and characterized this mutant using circular dichroism,more » isothermal titration calorimetry, and other biochemical techniques. The results show that although DtxR(E175K) and the wild type have similar secondary structures, DtxR(E175K) gains additional thermostability upon activation with metal ions, which may lead to this mutant requiring a lower concentration of metal ions to reach the same levels of thermostability as the wild-type protein. The E175K mutation causes binding site 1 to retain metal ion bound at all times, which can only be removed by incubation with an ion chelator. The crystal structure of DtxR(E175K) shows an empty binding site 2 without evidence of oxidation of Cys102. The association constant for this low-affinity binding site of DtxR(E175K) obtained from calorimetric titration with Ni(II) is K{sub a} = 7.6 {+-} 0.5 x 10{sup 4}, which is very similar to the reported value for the wild-type repressor, K{sub a} = 6.3 x 10{sup 4}. Both the wild type and DtxR(E175K) require the same amount of metal ion to produce a shift in the electrophoretic mobility shift assay, but unlike the wild type, DtxR(E175K) binding to its cognate DNA [tox promoter-operator (toxPO)] does not require metal-ion supplementation in the running buffer. In the timescale of these experiments, the Mn(II)-DtxR(E175K

Mutational definition of functional domains within the Rev homolog encoded by human endogenous retrovirus K.

PubMed

Bogerd, H P; Wiegand, H L; Yang, J; Cullen, B R

2000-10-01

Nuclear export of the incompletely spliced mRNAs encoded by several complex retroviruses, including human immunodeficiency virus type 1 (HIV-1), is dependent on a virally encoded adapter protein, termed Rev in HIV-1, that directly binds both to a cis-acting viral RNA target site and to the cellular Crm1 export factor. Human endogenous retrovirus K, a family of ancient endogenous retroviruses that is not related to the exogenous retrovirus HIV-1, was recently shown to also encode a Crm1-dependent nuclear RNA export factor, termed K-Rev. Although HIV-1 Rev and K-Rev display little sequence identity, they share the ability not only to bind to Crm1 and to RNA but also to form homomultimers and shuttle between nucleus and cytoplasm. We have used mutational analysis to identify sequences in the 105-amino-acid K-Rev protein required for each of these distinct biological activities. While mutations in K-Rev that inactivate any one of these properties also blocked K-Rev-dependent nuclear RNA export, several K-Rev mutants were comparable to wild type when assayed for any of these individual activities yet nevertheless defective for RNA export. Although several nonfunctional K-Rev mutants acted as dominant negative inhibitors of K-Rev-, but not HIV-1 Rev-, dependent RNA export, these were not defined by their inability to bind to Crm1, as is seen with HIV-1 Rev. In total, this analysis suggests a functional architecture for K-Rev that is similar to, but distinct from, that described for HIV-1 Rev and raises the possibility that viral RNA export mediated by the approximately 25 million-year-old K-Rev protein may require an additional cellular cofactor that is not required for HIV-1 Rev function.

940nm QCW diode laser bars with 70% efficiency at 1 kW output power at 203K: analysis of remaining limits and path to higher efficiency and power at 200K and 300K

NASA Astrophysics Data System (ADS)

Frevert, C.; Bugge, F.; Knigge, S.; Ginolas, A.; Erbert, G.; Crump, P.

2016-03-01

Both high-energy-class laser facilities and commercial high-energy pulsed laser sources require reliable optical pumps with the highest pulse power and electro-optical efficiency. Although commercial quasi-continuous wave (QCW) diode laser bars reach output powers of 300…500 W further improvements are urgently sought to lower the cost per Watt, improve system performance and reduce overall system complexity. Diode laser bars operating at temperatures of around 200 K show significant advances in performance, and are particularly attractive in systems that use cryogenically cooled solid state lasers. We present the latest results on 940 nm, passively cooled, 4 mm long QCW diode bars which operate under pulse conditions of 1.2 ms, 10 Hz at an output power of 1 kW with efficiency of 70% at 203 K: a two-fold increase in power compared to 300 K, without compromising efficiency. We discuss how custom low-temperature design of the vertical layers can mitigate the limiting factors such as series resistance while sustaining high power levels. We then focus on the remaining obstacles to higher efficiency and power, and use a detailed study of multiple vertical structures to demonstrate that the properties of the active region are a major performance limit. Specifically, one key limit to series resistance is transport in the layers around the active region and the differential internal efficiency is closely correlated to the threshold current. Tailoring the barriers around the active region and reducing transparency current density thus promise bars with increased performance at temperatures of 200 K as well as 300 K.

Measurement of the e + e - → K s 0 K ± π ∓ π 0 and K s 0 K ± π ∓ η cross sections using initial-state radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lees, J. P.; Poireau, V.; Tisserand, V.

The processes e + e - → Kmore » $$0\\atop{S}$$ K ±π ∓π 0 and e + e - → K$$0\\atop{S}$$ K ±π ∓η are studied over a continuum of energies from threshold to 4 GeV with the initial-state photon radiation method. Using 454 fb -1 of data collected with the BABAR detector at the SLAC PEP-II storage ring, the first measurements of the cross sections for these processes are obtained. The intermediate resonance structures from K* 0(Kπ) 0, K *(892) ± (Kπ) ∓ , and K$$0\\atop{S}$$K ±ρ ∓ are studied. Lastly, the J / ψ is observed in all of these channels, and corresponding branching fractions are measured.« less

Measurement of the e + e - → K s 0 K ± π ∓ π 0 and K s 0 K ± π ∓ η cross sections using initial-state radiation

DOE PAGES

Lees, J. P.; Poireau, V.; Tisserand, V.; ...

2017-05-30

The processes e + e - → Kmore » $$0\\atop{S}$$ K ±π ∓π 0 and e + e - → K$$0\\atop{S}$$ K ±π ∓η are studied over a continuum of energies from threshold to 4 GeV with the initial-state photon radiation method. Using 454 fb -1 of data collected with the BABAR detector at the SLAC PEP-II storage ring, the first measurements of the cross sections for these processes are obtained. The intermediate resonance structures from K* 0(Kπ) 0, K *(892) ± (Kπ) ∓ , and K$$0\\atop{S}$$K ±ρ ∓ are studied. Lastly, the J / ψ is observed in all of these channels, and corresponding branching fractions are measured.« less

Familial CJD Associated PrP Mutants within Transmembrane Region Induced Ctm-PrP Retention in ER and Triggered Apoptosis by ER Stress in SH-SY5Y Cells

PubMed Central

Wang, Xin; Shi, Qi; Xu, Kun; Gao, Chen; Chen, Cao; Li, Xiao-Li; Wang, Gui-Rong; Tian, Chan; Han, Jun; Dong, Xiao-Ping

2011-01-01

Background Genetic prion diseases are linked to point and inserted mutations in the prion protein (PrP) gene that are presumed to favor conversion of the cellular isoform of PrP (PrPC) to the pathogenic one (PrPSc). The pathogenic mechanisms and the subcellular sites of the conversion are not completely understood. Here we introduce several PRNP gene mutations (such as, PrP-KDEL, PrP-3AV, PrP-A117V, PrP-G114V, PrP-P102L and PrP-E200K) into the cultured cells in order to explore the pathogenic mechanism of familial prion disease. Methodology/Principal Findings To address the roles of aberrant retention of PrP in endoplasmic reticulum (ER), the recombinant plasmids expressing full-length human PrP tailed with an ER signal peptide at the COOH-terminal (PrP-KDEL) and PrP with three amino acids exchange in transmembrane region (PrP-3AV) were constructed. In the preparations of transient transfections, 18-kD COOH-terminal proteolytic resistant fragments (Ctm-PrP) were detected in the cells expressing PrP-KDEL and PrP-3AV. Analyses of the cell viabilities in the presences of tunicamycin and brefeldin A revealed that expressions of PrP-KDEL and PrP-3AV sensitized the transfected cells to ER stress stimuli. Western blots and RT-PCR identified the clear alternations of ER stress associated events in the cells expressing PrP-KDEL and PrP-3AV that induced ER mediated apoptosis by CHOP and capase-12 apoptosis pathway. Moreover, several familial CJD related PrP mutants were transiently introduced into the cultured cells. Only the mutants within the transmembrane region (G114V and A117V) induced the formation of Ctm-PrP and caused the ER stress, while the mutants outside the transmembrane region (P102L and E200K) failed. Conclusions/Significance The data indicate that the retention of PrP in ER through formation of Ctm-PrP results in ER stress and cell apoptosis. The cytopathic activities caused by different familial CJD associated PrP mutants may vary, among them the mutants

Tri-linear color multi-linescan sensor with 200 kHz line rate

NASA Astrophysics Data System (ADS)

Schrey, Olaf; Brockherde, Werner; Nitta, Christian; Bechen, Benjamin; Bodenstorfer, Ernst; Brodersen, Jörg; Mayer, Konrad J.

2016-11-01

In this paper we present a newly developed linear CMOS high-speed line-scanning sensor realized in a 0.35 μm CMOS OPTO process for line-scan with 200 kHz true RGB and 600 kHz monochrome line rate, respectively. In total, 60 lines are integrated in the sensor allowing for electronic position adjustment. The lines are read out in rolling shutter manner. The high readout speed is achieved by a column-wise organization of the readout chain. At full speed, the sensor provides RGB color images with a spatial resolution down to 50 μm. This feature enables a variety of applications like quality assurance in print inspection, real-time surveillance of railroad tracks, in-line monitoring in flat panel fabrication lines and many more. The sensor has a fill-factor close to 100%, preventing aliasing and color artefacts. Hence the tri-linear technology is robust against aliasing ensuring better inspection quality and thus less waste in production lines.

Molecular dynamics simulations and principal component analysis on human laforin mutation W32G and W32G/K87A.

PubMed

Srikumar, P S; Rohini, K; Rajesh, Perumbilavil Kaithamanakallam

2014-06-01

Mutations in human laforin lead to an autosomal neurodegenerative disorder Lafora disease. In N-terminal carbohydrate binding domain of laforin, two mutations W32G and K87A are reported as highly disease causing laforin mutants. Experimental studies reported that mutations are responsible for the abolishment of glycogen binding which is a critical function of laforin. Our current computational study focused on the role of conformational changes in human laforin structure due to existing single mutation W32G and prepared double mutation W32G/K87A related to loss of glycogen binding. We performed 10 ns molecular dynamics (MD) simulation studies in the Gromacs package for both mutations and analyzed the trajectories. From the results, the global properties like root mean square deviation, root mean square fluctuation, radius of gyration, solvent accessible surface area and hydrogen bonds showed structural changes in atomic level observed in W32G and W32G/K87A laforin mutants. The conformational change induced by mutants influenced the loss of the overall stability of the native laforin. Moreover, the change in overall motion of protein was analyzed by principal component analysis and results showed protein clusters expanded more than native and also change in direction in case of double mutant in conformational space. Overall, our report provides theoretical information on loss of structure-function relationship due to flexible nature of laforin mutants. In conclusion, comparative MD simulation studies support the experimental data on W32G and W32G/K87A related to the lafora disease mechanism on glycogen binding.

Clinical significance of the BRAFV600E mutation in Asian patients with colorectal cancer.

PubMed

Cheng, Hou-Hsuan; Lin, Jen-Kou; Chen, Wei-Shone; Jiang, Jeng-Kai; Yang, Shung-Haur; Chang, Shih-Ching

2018-06-04

To investigate the clinicopathological features and prognostic significance of the BRAFV600E mutation in Asian patients with colorectal cancer. We retrospectively reviewed the medical records of 1969 patients with colorectal cancer admitted to Taipei Veterans General Hospital for surgical treatment between 2000 and 2013. The measured endpoint was overall survival after surgery. The prognostic value of the BRAFV600E mutation was analyzed using the log-rank test and Cox regression analysis. The BRAFV600E mutation was detected in 106 (5.4%) patients and associated with female gender, abnormal cancer antigen (CA)19-9 at diagnosis, microsatellite status, right-sided primary tumors, mucinous histology, poor differentiation, and lymphovascular invasion. Metastatic patterns were more common in non-regional lymph node metastasis (20.8 vs. 7.4%, p = 0.06) and peritoneal seeding (41. vs. 21.2%, p = 0.04). Mutations were not prognostic in the overall survival of the entire study group but only in specific patients: age < 65, normal carcinoembryonic antigen at diagnosis, and stage IV disease. The BRAFV600E mutation was associated with distinct clinicopathological features and metastatic patterns. The overall survival rate was lower in selected colorectal patients with the BRAFV600E mutation.

Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder.

PubMed

Tepakhan, Wanicha; Yamsri, Supawadee; Sanchaisuriya, Kanokwan; Fucharoen, Goonnapa; Xu, Xiangmin; Fucharoen, Supan

2016-07-01

Hemoglobin E is the most common Hb variant found in South East Asia. Variation of Hb F expression in Hb E syndrome is associated with several genetic modifiers. We report several single nucleotide polymorphisms (SNPs), including nine known and five novel mutations of the Krüppel-like factor 1 (KLF1; an erythroid specific transcription factor) gene and determine their associations with phenotypic expression of Hb F in Hb E disorders. KLF1 mutations were examined using high resolution melting (HRM) assay and DNA sequencing in 575 homozygous Hb E, 278 heterozygous Hb E and 100 normal subjects. Fourteen mutations were mostly observed in subjects with elevated Hb F, including nine known mutations (G176AfsX179, T334R, R238H, -154 (C>T), A298P, S270W, R301H, -148 (G>A) and G335R and five novel mutations (Q217X, Q223X, Y290_S293del, K307N, and M358I). None of them, but the -148 (G>A), were observed in normal controls to have Hb F <1%. Combined KLF1 mutations with other SNPs including (G)γ-XmnI, BCL11A and HBS1L-MYB were associated with higher Hb F levels. KLF1 is therefore an important genetic factor associated with increased Hb F and in combination with other modifying factors could explain the phenotypic variation of Hb F expression in this common hemoglobinopathy. Copyright © 2016 Elsevier Inc. All rights reserved.

Differences in K-ras and mitochondrial DNA mutations and microsatellite instability between colorectal cancers of Vietnamese and Japanese patients.

PubMed

Miwata, Tomohiro; Hiyama, Toru; Quach, Duc Trong; Le, Huy Minh; Hua, Ha Ngoc Thi; Oka, Shiro; Tanaka, Shinji; Arihiro, Koji; Chayama, Kazuaki

2014-11-30

The incidence of early-onset (under 50 years of age) colorectal cancer (CRC) in the Vietnamese has been reported to be quite higher than that in the Japanese. To clarify the differences in genetic alterations between Vietnamese and Japanese CRCs, we investigated mutations in K-ras and mitochondrial DNA (mtDNA) and high-frequency microsatellite instability (MSI-H) in the CRCs of Vietnamese and Japanese patients. We enrolled 60 Vietnamese and 233 Japanese patients with invasive CRCs. DNA was extracted from formalin-fixed, paraffin-embedded tissue sections. K-ras mutations were examined with PCR-single-strand conformation polymorphism analysis. mtDNA mutations and MSI-H were examined with microsatellite analysis using D310 and BAT-26, respectively. K-ras mutations were examined in 60 Vietnamese and 45 Japanese CRCs. The frequency of the mutations in the Vietnamese CRCs was significantly higher than that in the Japanese CRCs (8 of 24 [33%] vs 5 of 45 [11%], p =0.048). MSI-H was examined in 60 Vietnamese and 130 Japanese CRCs. The frequency of MSI-H in the Vietnamese CRCs was also significantly higher than that in the Japanese CRCs (6 of 27 [22%] vs 10 of 130 [8%], p =0.030). mtDNA mutations were examined in 60 Vietnamese and 138 Japanese CRCs. The frequency of mtDNA mutations in the Vietnamese CRCs was significantly higher than that in the Japanese CRCs (19 of 44 [43%] vs 11 of 133 [9%], p <0.001). There were no significant differences in clinicopathologic characteristics, such as age, sex, tumour location, and depth, in terms of tumours with/without each genetic alteration in the CRCs of the Vietnamese and Japanese patients. These results indicate that the developmental pathways of CRCs in the Vietnamese may differ from those of CRCs in the Japanese.

Neonatal Diabetes Caused by Mutations in Sulfonylurea Receptor 1: Interplay between Expression and Mg-Nucleotide Gating Defects of ATP-Sensitive Potassium Channels

PubMed Central

Zhou, Qing; Garin, Intza; Castaño, Luis; Argente, Jesús; Muñoz-Calvo, Ma. Teresa; Perez de Nanclares, Guiomar; Shyng, Show-Ling

2010-01-01

Context: ATP-sensitive potassium (KATP) channels regulate insulin secretion by coupling glucose metabolism to β-cell membrane potential. Gain-of-function mutations in the sulfonylurea receptor 1 (SUR1) or Kir6.2 channel subunit underlie neonatal diabetes. Objective: The objective of the study was to determine the mechanisms by which two SUR1 mutations, E208K and V324M, associated with transient neonatal diabetes affect KATP channel function. Design: E208K or V324M mutant SUR1 was coexpressed with Kir6.2 in COS cells, and expression and gating properties of the resulting channels were assessed biochemically and electrophysiologically. Results: Both E208K and V324M augment channel response to MgADP stimulation without altering sensitivity to ATP4− or sulfonylureas. Surprisingly, whereas E208K causes only a small increase in MgADP response consistent with the mild transient diabetes phenotype, V324M causes a severe activating gating defect. Unlike E208K, V324M also impairs channel expression at the cell surface, which is expected to dampen its functional impact on β-cells. When either mutation was combined with a mutation in the second nucleotide binding domain of SUR1 previously shown to abolish Mg-nucleotide response, the activating effect of E208K and V324M was also abolished. Moreover, combination of E208K and V324M results in channels with Mg-nucleotide sensitivity greater than that seen in individual mutations alone. Conclusion: The results demonstrate that E208K and V324M, located in distinct domains of SUR1, enhance transduction of Mg-nucleotide stimulation from the SUR1 nucleotide binding folds to Kir6.2. Furthermore, they suggest that diabetes severity is determined by interplay between effects of a mutation on channel expression and channel gating. PMID:20810569

Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis.

PubMed

Esteller, M; Toyota, M; Sanchez-Cespedes, M; Capella, G; Peinado, M A; Watkins, D N; Issa, J P; Sidransky, D; Baylin, S B; Herman, J G

2000-05-01

O6-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that removes mutagenic and cytotoxic adducts from the O6 position of guanine. O6-methylguanine mispairs with thymine during replication, and if the adduct is not removed, this results in conversion from a guanine-cytosine pair to an adenine-thymine pair. In vitro assays show that MGMT expression avoids G to A mutations and MGMT transgenic mice are protected against G to A transitions at ras genes. We have recently demonstrated that the MGMT gene is silenced by promoter methylation in many human tumors, including colorectal carcinomas. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of K-ras mutations, we studied 244 colorectal tumor samples for MGMT promoter hypermethylation and K-ras mutational status. Our results show a clear association between the inactivation of MGMT by promoter hypermethylation and the appearance of G to A mutations at K-ras: 71% (36 of 51) of the tumors displaying this particular type of mutation had abnormal MGMT methylation, whereas only 32% (12 of 37) of those with other K-ras mutations not involving G to A transitions and 35% (55 of 156) of the tumors without K-ras mutations demonstrated MGMT methylation (P = 0.002). In addition, MGMT loss associated with hypermethylation was observed in the small adenomas, including those that do not yet contain K-ras mutations. Hypermethylation of other genes such as p16INK4a and p14ARF was not associated with either MGMT hypermethylation or K-ras mutation. Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to a particular genetic change in human cancer, specifically G to A transitions in the K-ras oncogene.

A Library of Infectious Hepatitis C Viruses with Engineered Mutations in the E2 Gene Reveals Growth-Adaptive Mutations That Modulate Interactions with Scavenger Receptor Class B Type I.

PubMed

Zuiani, Adam; Chen, Kevin; Schwarz, Megan C; White, James P; Luca, Vincent C; Fremont, Daved H; Wang, David; Evans, Matthew J; Diamond, Michael S

2016-12-01

While natural hepatitis C virus (HCV) infection results in highly diverse quasispecies of related viruses over time, mutations accumulate more slowly in tissue culture, in part because of the inefficiency of replication in cells. To create a highly diverse population of HCV particles in cell culture and identify novel growth-enhancing mutations, we engineered a library of infectious HCV with all codons represented at most positions in the ectodomain of the E2 gene. We identified many putative growth-adaptive mutations and selected nine highly represented E2 mutants for further study: Q412R, T416R, S449P, T563V, A579R, L619T, V626S, K632T, and L644I. We evaluated these mutants for changes in particle-to-infectious-unit ratio, sensitivity to neutralizing antibody or CD81 large extracellular loop (CD81-LEL) inhibition, entry factor usage, and buoyant density profiles. Q412R, T416R, S449P, T563V, and L619T were neutralized more efficiently by anti-E2 antibodies and T416R, T563V, and L619T by CD81-LEL. Remarkably, all nine variants showed reduced dependence on scavenger receptor class B type I (SR-BI) for infection. This shift from SR-BI usage did not correlate with a change in the buoyant density profiles of the variants, suggesting an altered E2-SR-BI interaction rather than changes in the virus-associated lipoprotein-E2 interaction. Our results demonstrate that residues influencing SR-BI usage are distributed across E2 and support the development of large-scale mutagenesis studies to identify viral variants with unique functional properties. Characterizing variant viruses can reveal new information about the life cycle of HCV and the roles played by different viral genes. However, it is difficult to recapitulate high levels of diversity in the laboratory because of limitations in the HCV culture system. To overcome this limitation, we engineered a library of mutations into the E2 gene in the context of an infectious clone of the virus. We used this library of viruses

False-negative BRAF V600E mutation results on fine-needle aspiration cytology of papillary thyroid carcinoma.

PubMed

Paek, Se Hyun; Kim, Byung Seup; Kang, Kyung Ho; Kim, Hee Sung

2017-11-13

The BRAF V600E mutation is highly specific for papillary thyroid carcinoma (PTC). A test for this mutation can increase the diagnostic accuracy of fine-needle aspiration cytology (FNAC), but a considerably high false-negative rate for the BRAF V600E mutation on FNAC has been reported. In this study, we investigated the risk factors associated with false-negative BRAF V600E mutation results on FNAC. BRAF V600E mutation results of 221 PTC nodules between December 2011 and June 2013 were retrospectively reviewed. BRAF V600E mutation results on both preoperative FNAC and postoperative formalin-fixed, paraffin-embedded (FFPE) samples were compared. We investigated the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of BRAF V600E mutation results on FNAC. And, we identified the risk factors associated with false-negative results. Of 221 PTC nodules, 150 (67.9%) on FNAC and 185 (83.7%) on FFPE samples were BRAF V600E mutation positive. The sensitivity, specificity, PPV, and NPV for BRAF V600E mutation testing with FNAC were 80.5, 97.2, 99.3, and 49.3%, respectively. Thirty-six (16.3%) BRAF V600E mutation-negative nodules on FNAC were mutation positive on FFPE sample analysis. Risk factors for these false-negative results were age, indeterminate FNAC results (nondiagnostic, atypia of undetermined significance (AUS), and findings suspicious for PTC), and PTC subtype. False-negative rate of BRAF mutation testing with FNAC for thyroid nodules is increased in cases of old age, indeterminate FNAC pathology results, and certain PTC subtypes. Therapeutic surgery can be considered for these cases. A well-designed prospective study with informed consent of patients will be essential for more informative results.

LOFT L2-3 blowdown experiment safety analyses D, E, and G; LOCA analyses H, K, K1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perryman, J.L.; Keeler, C.D.; Saukkoriipi, L.O.

1978-12-01

Three calculations using conservative off-nominal conditions and evaluation model options were made using RELAP4/MOD5 for blowdown-refill and RELAP4/MOD6 for reflood for Loss-of-Fluid Test Experiment L2-3 to support the experiment safety analysis effort. The three analyses are as follows: Analysis D: Loss of commercial power during Experiment L2-3; Analysis E: Hot leg quick-opening blowdown valve (QOBV) does not open during Experiment L2-3; and Analysis G: Cold leg QOBV does not open during Experiment L2-3. In addition, the results of three LOFT loss-of-coolant accident (LOCA) analyses using a power of 56.1 MW and a primary coolant system flow rate of 3.6 millionmore » 1bm/hr are presented: Analysis H: Intact loop 200% hot leg break; emergency core cooling (ECC) system B unavailable; Analysis K: Pressurizer relief valve stuck in open position; ECC system B unavailable; and Analysis K1: Same as analysis K, but using a primary coolant system flow rate of 1.92 million 1bm/hr (L2-4 pre-LOCE flow rate). For analysis D, the maximum cladding temperature reached was 1762/sup 0/F, 22 sec into reflood. In analyses E and G, the blowdowns were slower due to one of the QOBVs not functioning. The maximum cladding temperature reached in analysis E was 1700/sup 0/F, 64.7 sec into reflood; for analysis G, it was 1300/sup 0/F at the start of reflood. For analysis H, the maximum cladding temperature reached was 1825/sup 0/F, 0.01 sec into reflood. Analysis K was a very slow blowdown, and the cladding temperatures followed the saturation temperature of the system. The results of analysis K1 was nearly identical to analysis K; system depressurization was not affected by the primary coolant system flow rate.« less

Coexistence of EGFR with KRAS, or BRAF, or PIK3CA somatic mutations in lung cancer: a comprehensive mutation profiling from 5125 Chinese cohorts

PubMed Central

Li, S; Li, L; Zhu, Y; Huang, C; Qin, Y; Liu, H; Ren-Heidenreich, L; Shi, B; Ren, H; Chu, X; Kang, J; Wang, W; Xu, J; Tang, K; Yang, H; Zheng, Y; He, J; Yu, G; Liang, N

2014-01-01

Background: Determining the somatic mutations of epidermal growth factor receptor (EGFR)-pathway networks is the key to effective treatment for non-small cell lung cancer (NSCLC) with tyrosine kinase inhibitors (TKIs).The somatic mutation frequencies and their association with gender, smoking history and histology was analysed and reported in this study. Methods: Five thousand one hundred and twenty-five NSCLC patients' pathology samples were collected, and EGFR, KRAS, BRAF and PIK3CA mutations were detected by multiplex testing. The mutation status of EGFR, KRAS, BRAF and PIK3CA and their association with gender, age, smoking history and histological type were evaluated by appropriate statistical analysis. Results: EGFR, KRAS, BRAF and PIK3CA mutation rates revealed 36.2%, 8.4%, 0.5% and 3.3%, respectively, across the 5125 pathology samples. For the first time, evidence of KRAS mutations were detected in two female, non-smoking patients, age 5 and 14, with NSCLC. Furthermore, we identified 153 double and coexisting mutations and 7 triple mutations. Interestingly, the second drug-resistant mutations, T790M or E545K, were found in 44 samples from patients who had never received TKI treatments. Conclusions: EGFR exons 19, 20 and 21, and BRAF mutations tend to happen in females and non-smokers, whereas KRAS mutations were more inclined to males and smokers. Activating and resistant mutations to EGFR-TKI drugs can coexist and ‘second drug-resistant mutations', T790M or E545K, may be primary mutations in some patients. These results will help oncologists to decide candidates for mutation testing and EGFR-TKI treatment. PMID:24743704

Identification of new molecular alterations in Fatal Familial Insomnia

USDA-ARS?s Scientific Manuscript database

Fatal Familial Insomnia (FFI) is a rare disease caused by a D178N mutation in combination with methionine (Met) at codon 129 in the mutated allele of PRNP (D178N-129M haplotype). FFI is manifested by sleep disturbances with insomnia, autonomic disorders, hallucinations, delirium, and spontaneous and...

E-cadherin germline mutation carriers: clinical management and genetic implications.

PubMed

Corso, Giovanni; Figueiredo, Joana; Biffi, Roberto; Trentin, Chiara; Bonanni, Bernardo; Feroce, Irene; Serrano, Davide; Cassano, Enrico; Annibale, Bruno; Melo, Soraia; Seruca, Raquel; De Lorenzi, Francesca; Ferrara, Francesco; Piagnerelli, Riccardo; Roviello, Franco; Galimberti, Viviana

2014-12-01

Hereditary diffuse gastric cancer is an autosomic dominant syndrome associated with E-cadherin protein (CDH1) gene germline mutations. Clinical criteria for genetic screening were revised in 2010 by the International Gastric Cancer Linkage Consortium at the Cambridge meeting. About 40 % of families fulfilling clinical criteria for this inherited disease present deleterious CDH1 germline mutations. Lobular breast cancer is a neoplastic condition associated with hereditary diffuse gastric cancer syndrome. E-cadherin constitutional mutations have been described in both settings, in gastric and breast cancers. The management of CDH1 asymptomatic mutation carriers requires a multidisciplinary approach; the only life-saving procedure is the prophylactic total gastrectomy after thorough genetic counselling. Several prophylactic gastrectomies have been performed to date; conversely, no prophylactic mastectomies have been described in CDH1 mutant carriers. However, the recent discovery of novel germline alterations in pedigree clustering only for lobular breast cancer opens up a new debate in the management of these individuals. In this critical review, we describe the clinical management of CDH1 germline mutant carriers providing specific recommendations for genetic counselling, clinical criteria, surveillance and/ or prophylactic surgery.

Evidence for the Decay D0→K-π+π-e+νe

NASA Astrophysics Data System (ADS)

Artuso, M.; Blusk, S.; Butt, J.; Li, J.; Menaa, N.; Mountain, R.; Nisar, S.; Randrianarivony, K.; Sia, R.; Skwarnicki, T.; Stone, S.; Wang, J. C.; Zhang, K.; Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Asner, D. M.; Edwards, K. W.; Naik, P.; Briere, R. A.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M. E.; Rosner, J. L.; Adam, N. E.; Alexander, J. P.; Cassel, D. G.; Duboscq, J. E.; Ehrlich, R.; Fields, L.; Galik, R. S.; Gibbons, L.; Gray, R.; Gray, S. W.; Hartill, D. L.; Heltsley, B. K.; Hertz, D.; Jones, C. D.; Kandaswamy, J.; Kreinick, D. L.; Kuznetsov, V. E.; Mahlke-Krüger, H.; Mohapatra, D.; Onyisi, P. U. E.; Patterson, J. R.; Peterson, D.; Pivarski, J.; Riley, D.; Ryd, A.; Sadoff, A. J.; Schwarthoff, H.; Shi, X.; Stroiney, S.; Sun, W. M.; Wilksen, T.; Athar, S. B.; Patel, R.; Potlia, V.; Yelton, J.; Rubin, P.; Cawlfield, C.; Eisenstein, B. I.; Karliner, I.; Kim, D.; Lowrey, N.; Selen, M.; White, E. J.; Wiss, J.; Mitchell, R. E.; Shepherd, M. R.; Besson, D.; Pedlar, T. K.; Cronin-Hennessy, D.; Gao, K. Y.; Hietala, J.; Kubota, Y.; Klein, T.; Lang, B. W.; Poling, R.; Scott, A. W.; Smith, A.; Zweber, P.; Dobbs, S.; Metreveli, Z.; Seth, K. K.; Tomaradze, A.; Ernst, J.; Ecklund, K. M.; Severini, H.; Love, W.; Savinov, V.; Aquines, O.; Lopez, A.; Mehrabyan, S.; Mendez, H.; Ramirez, J.; Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Hu, D.; Moziak, B.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.

2007-11-01

Using a 281pb-1 data sample collected at the ψ(3770) with the CLEO-c detector, we present the first absolute branching fraction measurement of the decay D0→K-π+π-e+νe at a statistical significance of about 4.0 standard deviations. We find 10 candidates consistent with the decay D0→K-π+π-e+νe. The probability that a background fluctuation accounts for this signal is less than 4.1×10-5. We find B(D0→K-π+π-e+νe)=[2.8-1.1+1.4(stat)±0.3(syst)]×10-4. By restricting the invariant mass of the hadronic system to be consistent with K1(1270), we obtain the product of branching fractions B(D0→K1-(1270)e+νe)×B(K1-(1270)→K-π+π-)=[2.5-1.0+1.3(stat)±0.2(syst)]×10-4. Using B(K1-(1270)→K-π+π-)=(33±3)%, we obtain B(D0→K1-(1270)e+νe)=[7.6-3.0+4.1(stat)±0.6(syst)±0.7]×10-4. The last error accounts for the uncertainties in the measured K1-(1270)→K-π+π- branching fractions.

Ubiquitin-proteasome system impairment caused by a missense cardiac myosin-binding protein C mutation and associated with cardiac dysfunction in hypertrophic cardiomyopathy.

PubMed

Bahrudin, Udin; Morisaki, Hiroko; Morisaki, Takayuki; Ninomiya, Haruaki; Higaki, Katsumi; Nanba, Eiji; Igawa, Osamu; Takashima, Seiji; Mizuta, Einosuke; Miake, Junichiro; Yamamoto, Yasutaka; Shirayoshi, Yasuaki; Kitakaze, Masafumi; Carrier, Lucie; Hisatome, Ichiro

2008-12-26

The ubiquitin-proteasome system is responsible for the disappearance of truncated cardiac myosin-binding protein C, and the suppression of its activity contributes to cardiac dysfunction. This study investigated whether missense cardiac myosin-binding protein C gene (MYBPC3) mutation in hypertrophic cardiomyopathy (HCM) leads to destabilization of its protein, causes UPS impairment, and is associated with cardiac dysfunction. Mutations were identified in Japanese HCM patients using denaturing HPLC and sequencing. Heterologous expression was investigated in COS-7 cells as well as neonatal rat cardiac myocytes to examine protein stability and proteasome activity. The cardiac function was measured using echocardiography. Five novel MYBPC3 mutations -- E344K, DeltaK814, Delta2864-2865GC, Q998E, and T1046M -- were identified in this study. Compared with the wild type and other mutations, the E334K protein level was significantly lower, it was degraded faster, it had a higher level of polyubiquination, and increased in cells pretreated with the proteasome inhibitor MG132 (50 microM, 6 h). The electrical charge of its amino acid at position 334 influenced its stability, but E334K did not affect its phosphorylation. The E334K protein reduced cellular 20 S proteasome activity, increased the proapoptotic/antiapoptotic protein ratio, and enhanced apoptosis in transfected Cos-7 cells and neonatal rat cardiac myocytes. Patients carrying the E334K mutation presented significant left ventricular dysfunction and dilation. The conclusion is the missense MYBPC3 mutation E334K destabilizes its protein through UPS and may contribute to cardiac dysfunction in HCM through impairment of the ubiquitin-proteasome system.

Potential relationship between Hashimoto's thyroiditis and BRAF(V600E) mutation status in papillary thyroid cancer.

PubMed

Zeng, Rui-Chao; Jin, Lang-Ping; Chen, En-Dong; Dong, Si-Yang; Cai, Ye-Feng; Huang, Guan-Li; Li, Quan; Jin, Chun; Zhang, Xiao-Hua; Wang, Ou-Chen

2016-04-01

The purpose of this study was to evaluate the potential relationship between Hashimoto's thyroiditis and BRAF(V600E) mutation status in patients with papillary thyroid carcinoma (PTC). A total of 619 patients with PTC who underwent total thyroidectomy with lymph node dissection were enrolled in this study. Univariable and multivariate analyses were used. Hashimoto's thyroiditis was present in 35.9% (222 of 619) of PTCs. Multivariate logistic regressions showed that BRAF(V600E) mutation, sex, extrathyroidal extension, and lymph node metastasis were independent factors for Hashimoto's thyroiditis. Female sex, more frequent extrathyroidal extension, and a higher incidence of lymph node metastasis were significantly associated with PTCs accompanied by BRAF(V600E) mutation without Hashimoto's thyroiditis compared with PTCs accompanied by BRAF(V600E) mutation with Hashimoto's thyroiditis. Hashimoto's thyroiditis was negatively associated with BRAF(V600E) mutation, extrathyroidal extension, and lymph node metastasis. In addition, Hashimoto's thyroiditis was related to less lymph node metastasis and extrathyroidal extension in PTCs with BRAF(V600E) mutation. Therefore, Hashimoto's thyroiditis is a potentially protective factor in PTC. © 2015 Wiley Periodicals, Inc. Head Neck 38: E1019-E1025, 2016. © 2015 Wiley Periodicals, Inc.

Association of folate intake, dietary habits, smoking and COX-2 promotor -765G>C polymorphism with K-ras mutation in patients with colorectal cancer.

PubMed

Kamal, Manal M; Youssef, Omar Z; Lotfy, Ahmed N; Elsaed, Eman T; Fawzy, May M T

2012-09-01

Understanding the role of environmental and molecular influences on the nature and rate of K-ras mutations in colorectal neoplasms is crucial. COX-2 polymorphisms -765G>C may play a role in carcinogenic processes in combination with specific life-style conditions or dependent on the racial composition of a particular population. If mutational events play an important role in colorectal carcinogenesis sequence, one can hypothesize that modification of these events by life-style or other factors would be a useful prevention strategy. To explore the association between K-ras mutation and potential variables known or suspected to be related to the risk of colorectal cancer (CRC) as well as determining the possible modulating effect of the COX-2 polymorphism, -765G>C. The study was conducted on 80 patients with colorectal cancer from Tropical Medicine and Gastrointestinal Tract endoscopy Departments and those attending clinic of the National Cancer Institute, Cairo University during the period extending from April 2009 to March 2010. Full history taking with emphasis on the risk factors of interest, namely age, sex, family history, smoking and dietary history. Serum CEA and CA19-9, RBCs folic acid and occult blood in stool were done to all samples. K-ras protooncogene mutation at codon 12 (exon 1) and cyclooxygenase 2 (COX-2) -765G>C polymorphism were determined by PCR-RFLP. The K-ras mutation was positive in 23 (28.7%) patients. COX-2 polymorphism revealed GG in 62.5%, GC in 26.2 % and CC genotype was found in 11.3 % of cases. The mean red blood cell folic acid level was lower in the K-ras positive group (100.96±51.3 ng/ml) than the negative group (216.6±166.4 ng/ml), (P<0.01). Higher folate levels were found in males than females (median=173 ng/ml and 85 ng/ml; respectively, P=0.002) with adjusted odds ratio (OR) of 0.984. Only, the RBCs folate (P=0.0018) followed by gender (P=0.036) contributed significantly in the discrimination between patients prone to develop K

Mechanical and energetic properties of papillary muscle from ACTC E99K transgenic mouse models of hypertrophic cardiomyopathy

PubMed Central

Song, Weihua; Vikhorev, Petr G.; Kashyap, Mavin N.; Rowlands, Christina; Ferenczi, Michael A.; Woledge, Roger C.; MacLeod, Kenneth; Curtin, Nancy A.

2013-01-01

We compared the contractile performance of papillary muscle from a mouse model of hypertrophic cardiomyopathy [α-cardiac actin (ACTC) E99K mutation] with nontransgenic (non-TG) littermates. In isometric twitches, ACTC E99K papillary muscle produced three to four times greater force than non-TG muscle under the same conditions independent of stimulation frequency and temperature, whereas maximum isometric force in myofibrils from these muscles was not significantly different. ACTC E99K muscle relaxed slower than non-TG muscle in both papillary muscle (1.4×) and myofibrils (1.7×), whereas the rate of force development after stimulation was the same as non-TG muscle for both electrical stimulation in intact muscle and after a Ca2+ jump in myofibrils. The EC50 for Ca2+ activation of force in myofibrils was 0.39 ± 0.33 μmol/l in ACTC E99K myofibrils and 0.80 ± 0.11 μmol/l in non-TG myofibrils. There were no significant differences in the amplitude and time course of the Ca2+ transient in myocytes from ACTC E99K and non-TG mice. We conclude that hypercontractility is caused by higher myofibrillar Ca2+ sensitivity in ACTC E99K muscles. Measurement of the energy (work + heat) released in actively cycling heart muscle showed that for both genotypes, the amount of energy turnover increased with work done but with decreasing efficiency as energy turnover increased. Thus, ACTC E99K mouse heart muscle produced on average 3.3-fold more work than non-TG muscle, and the cost in terms of energy turnover was disproportionately higher than in non-TG muscles. Efficiency for ACTC E99K muscle was in the range of 11–16% and for non-TG muscle was 15–18%. PMID:23604709

Mechanical and energetic properties of papillary muscle from ACTC E99K transgenic mouse models of hypertrophic cardiomyopathy.

PubMed

Song, Weihua; Vikhorev, Petr G; Kashyap, Mavin N; Rowlands, Christina; Ferenczi, Michael A; Woledge, Roger C; MacLeod, Kenneth; Marston, Steven; Curtin, Nancy A

2013-06-01

We compared the contractile performance of papillary muscle from a mouse model of hypertrophic cardiomyopathy [α-cardiac actin (ACTC) E99K mutation] with nontransgenic (non-TG) littermates. In isometric twitches, ACTC E99K papillary muscle produced three to four times greater force than non-TG muscle under the same conditions independent of stimulation frequency and temperature, whereas maximum isometric force in myofibrils from these muscles was not significantly different. ACTC E99K muscle relaxed slower than non-TG muscle in both papillary muscle (1.4×) and myofibrils (1.7×), whereas the rate of force development after stimulation was the same as non-TG muscle for both electrical stimulation in intact muscle and after a Ca²⁺ jump in myofibrils. The EC₅₀ for Ca²⁺ activation of force in myofibrils was 0.39 ± 0.33 μmol/l in ACTC E99K myofibrils and 0.80 ± 0.11 μmol/l in non-TG myofibrils. There were no significant differences in the amplitude and time course of the Ca²⁺ transient in myocytes from ACTC E99K and non-TG mice. We conclude that hypercontractility is caused by higher myofibrillar Ca²⁺ sensitivity in ACTC E99K muscles. Measurement of the energy (work + heat) released in actively cycling heart muscle showed that for both genotypes, the amount of energy turnover increased with work done but with decreasing efficiency as energy turnover increased. Thus, ACTC E99K mouse heart muscle produced on average 3.3-fold more work than non-TG muscle, and the cost in terms of energy turnover was disproportionately higher than in non-TG muscles. Efficiency for ACTC E99K muscle was in the range of 11-16% and for non-TG muscle was 15-18%.

Prevalence of ESR1 E380Q mutation in tumor tissue and plasma from Japanese breast cancer patients.

PubMed

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Sueta, Aiko; Tomiguchi, Mai; Murakami, Keiichi; Omoto, Yoko; Iwase, Hirotaka

2017-11-22

ESR1 mutations have attracted attention as a potentially important marker and treatment target in endocrine therapy-resistant breast cancer patients. The E380Q mutation, which is one of the ESR1 mutations, is associated with estradiol (E2) hypersensitivity, increased DNA binding to the estrogen response element, and E2-independent constitutive trans-activation activity, but its frequency in ESR1 mutations remains unknown. The present study aimed to investigate the E380Q mutation in comparison with the other representative ESR1 mutations. We screened a total of 62 patients (66 tumor tissues and 69 plasma cell-free DNA (cfDNA)) to detect ESR1 mutations (E380Q, Y537S, Y537N, Y537C, and D538G) using droplet-digital polymerase chain reaction. Plasma was collected at more than two points of the clinical course, in whom changes of ESR1 mutations under treatment were investigated. We detected ESR1 mutations in 21% (12/57) of MBCs. The E380Q ESR1 mutation was found in 16% (2/12) and the other ESR1 LBD mutations were five (41.6%) of Y537S, and four each (33.3%) of D538G, Y537N, and Y537C, in 12 ESR1 mutant breast cancer patients. Five tumors had multiple ESR1 mutations: three had double ESR1 mutations; Y537S/E380Q, Y37S/Y537C, and Y537S/D538G, and two had triple ESR1 mutations; Y537S/Y537N/D538G. In plasma cfDNA analysis, the E380Q mutation was not detected, but increases in other ESR1 mutations were detected in 46.2% (6/13) of MBC patients under treatment. We have shown that there are distinct populations of ESR1 mutations in metastatic tissue and plasma. Each ESR1 mutation may have different clinical significance, and it will be necessary to investigate them all.

A 12b 200kS/s 0.52mA 0.47mm2 Algorithmic A/D Converter for MEMS Applications

NASA Astrophysics Data System (ADS)

Kim, Young-Ju; Choi, Hee-Cheol; Lee, Seung-Hoon; Cho, Dongil “Dan”

This work describes a 12b 200kS/s 0.52mA 0.47mm2 ADC for sensor applications such as motor control, 3-phase power control, and CMOS image sensors simultaneously requiring ultra-low power and small size. The proposed ADC is based on the conventional algorithmic architecture with a recycling signal path to optimize sampling rate, resolution, chip area, and power consumption. The input SHA with eight input channels employs a folded-cascode amplifier to achieve a required DC gain and a high phase margin. A 3-D fully symmetric layout with critical signal lines shielded reduces the capacitor and device mismatch of the multiplying D/A converter while switched-bias power-reduction circuits minimize the power consumption of analog amplifiers. Current and voltage references are integrated on chip with optional off-chip voltage references for low glitch noise. The down-sampling clock signal selects the sampling rate of 200kS/s and 10kS/s with a further reduced power depending on applications. The prototype ADC in a 0.18μm n-well 1P6M CMOS process demonstrates a maximum measured DNL and INL within 0.40 LSB and 1.97 LSB and shows a maximum SNDR and SFDR of 55dB and 70dB at all sampling frequencies up to 200kS/s, respectively. The ADC occupies an active die area of 0.47mm2 and consumes 0.94mW at 200kS/s and 0.63mW at 10kS/s with a 1.8V supply.

Absolute rate of the reaction of C l(2P) with methane from 200-500 K

NASA Technical Reports Server (NTRS)

Whytock, D. A.; Lee, J. H.; Michael, J. V.; Payne, W. A.; Stief, L. J.

1976-01-01

Rate constants for the reaction of atomic chlorine with methane have been measured from 200-500K using the flash photolysis-resonance fluorescence technique. When the results from fourteen equally spaced experimental determinations are plotted in Arrhenius form a definite curvature is noted. The results are compared to previous work and are theoretically discussed.

Driven by Mutations: The Predictive Value of Mutation Subtype in EGFR-Mutated Non-Small Cell Lung Cancer.

PubMed

Castellanos, Emily; Feld, Emily; Horn, Leora

2017-04-01

EGFR-mutated NSCLC is a genetically heterogeneous disease that includes more than 200 distinct mutations. The implications of mutational subtype for both prognostic and predictive value are being increasingly understood. Although the most common EGFR mutations-exon 19 deletions or L858R mutations-predict sensitivity to EGFR tyrosine kinase inhibitors (TKIs), it is now being recognized that outcomes may be improved in patients with exon 19 deletions. Additionally, 10% of patients will have an uncommon EGFR mutation, and response to EGFR TKI therapy is highly variable depending on the mutation. Given the growing recognition of the genetic and clinical variation seen in this disease, the development of comprehensive bioinformatics-driven tools to both analyze response in uncommon mutation subtypes and inform clinical decision making will be increasingly important. Clinical trials of novel EGFR TKIs should prospectively account for the presence of uncommon mutation subtypes in study design. Copyright © 2016 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

The R292K mutation that confers resistance to neuraminidase inhibitors leads to competitive fitness loss of A/Shanghai/1/2013 (H7N9) influenza virus in ferrets.

PubMed

Yen, Hui-Ling; Zhou, Jie; Choy, Ka-Tim; Sia, Sin Fun; Teng, Ooiean; Ng, Iris H; Fang, Vicky J; Hu, Yunwen; Wang, Wei; Cowling, Benjamin J; Nicholls, John M; Guan, Yi; Peiris, Joseph Sriyal Malik

2014-12-15

Neuraminidase (NA) inhibitors are the only licensed therapeutic option for human zoonotic H7N9 infections. An NA-R292K mutation that confers broad-spectrum resistance to NA inhibitors has been documented in H7N9 patients after treatment. We evaluated the transmission potential of a human influenza A H7N9 isolate with a NA-R292K mutation in the ferret model followed by genotyping assay to monitor its competitive fitness in vivo. Plaque-purified A/Shanghai/1/2013 wild-type and NA-R292K viruses transmitted at comparable efficiency to direct or respiratory droplet contact ferrets. In ferrets inoculated with the plaque-purified A/Shanghai/1/2013 NA-R292K virus with dominant K292 (94%), the resistant K292 genotype was outgrown by the wild-type R292 genotype during the course of infection. Transmission of the resistant K292 genotype was detected in 3/4 direct contact and 3/4 respiratory droplet contact ferrets at early time points but was gradually replaced by the wild-type genotype. In the respiratory tissues of inoculated or infected ferrets, the wild-type R292 genotype dominated in the nasal turbinate, whereas the resistant K292 genotype was more frequently detected in the lungs. The NA inhibitor-resistant H7N9 virus with the NA-R292K mutation may transmit among ferrets but showed compromised fitness in vivo while in competition with the wild-type virus. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Exploring the structural insights on human laforin mutation K87A in Lafora disease--a molecular dynamics study.

PubMed

Srikumar, P S; Rohini, K

2013-10-01

Lafora disease (LD) is an autosomal recessive, progressive form of myoclonus epilepsy which affects worldwide. LD occurs mainly in countries like southern Europe, northern Africa, South India, and in the Middle East. LD occurs with its onset mainly in teenagers and leads to decline and death within 2 to 10 years. The genes EPM2A and EPM2B are commonly involved in 90 % of LD cases. EPM2A codes for protein laforin which contains an amino terminal carbohydrate binding module (CBM) belonging to the CBM20 family and a carboxy terminal dual specificity phosphatase domain. Mutations in laforin are found to abolish glycogen binding and have been reported in wet lab methods. In order to investigate on structural insights on laforin mutation K81A, we performed molecular dynamics (MD) simulation studies for native and mutant protein. MD simulation results showed loss of stability due to mutation K87A which confirmed the structural reason for conformational changes observed in laforin. The conformational change of mutant laforin was confirmed by analysis using root mean square deviation, root mean square fluctuation, solvent accessibility surface area, radius of gyration, hydrogen bond, and principle component analysis. Our results identified that the flexibility of K87A mutated laforin structure, with replacement of acidic amino acid to aliphatic amino acid in functional CBM domain, have more impact in abolishing glycogen binding that favors LD.

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flh

Goats without Prion Protein Display Enhanced Proinflammatory Pulmonary Signaling and Extracellular Matrix Remodeling upon Systemic Lipopolysaccharide Challenge.

PubMed

Salvesen, Øyvind; Reiten, Malin R; Kamstra, Jorke H; Bakkebø, Maren K; Espenes, Arild; Tranulis, Michael A; Ersdal, Cecilie

2017-01-01

A naturally occurring mutation in the PRNP gene of Norwegian dairy goats terminates synthesis of the cellular prion protein (PrP C ), rendering homozygous goats ( PRNP Ter/Ter ) devoid of the protein. Although PrP C has been extensively studied, particularly in the central nervous system, the biological role of PrP C remains incompletely understood. Here, we examined whether loss of PrP C affects the initial stage of lipopolysaccharide (LPS)-induced acute lung injury (ALI). Acute pulmonary inflammation was induced by intravenous injection of LPS ( Escherichia coli O26:B6) in 16 goats (8 PRNP Ter/Ter and 8 PRNP +/+ ). A control group of 10 goats (5 PRNP Ter/Ter and 5 PRNP +/+ ) received sterile saline. Systemic LPS challenge induced sepsis-like clinical signs including tachypnea and respiratory distress. Microscopic examination of lungs revealed multifocal areas with alveolar hemorrhages, edema, neutrophil infiltration, and higher numbers of alveolar macrophages, with no significant differences between PRNP genotypes. A total of 432 ( PRNP +/+ ) and 596 ( PRNP Ter/Ter ) genes were differentially expressed compared with the saline control of the matching genotype. When assigned to gene ontology categories, biological processes involved in remodeling of the extracellular matrix (ECM), were exclusively enriched in PrP C -deficient goats. These genes included a range of collagen-encoding genes, and proteases such as matrix metalloproteinases ( MMP1, MMP2, MMP14, ADAM15 ) and cathepsins. Several proinflammatory upstream regulators (TNF-α, interleukin-1β, IFN-γ) showed increased activation scores in goats devoid of PrP C . In conclusion, LPS challenge induced marked alterations in the lung tissue transcriptome that corresponded with histopathological and clinical findings in both genotypes. The increased activation of upstream inflammatory regulators and enrichment of ECM components could reflect increased inflammation in the absence of PrP C . Further studies are

Cross sections for the reactions e + e - → K S 0 K L 0 π 0 , K S 0 K L 0 η , and K S 0 K L 0 π 0 π 0 from events with initial-state radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lees, J. P.; Poireau, V.; Tisserand, V.

Here, we study the processes e + e - → Kmore » $$0\\atop{S}$$ K$$0\\atop{L}$$ π 0 γ , K $$0\\atop{S}$$ K$$0\\atop{L}$$ η γ , and K$$0\\atop{S}$$ K$$0\\atop{L}$$ π 0 π 0 γ , where the photon is radiated from the initial state, providing cross section measurements for the hadronic final states over a continuum of center-of-mass energies. The results are based on 469 fb -1 of data collected at or near the Υ ( 4 S ) resonance with the BABAR detector at SLAC. We present the first measurements of the e + e - → K$$0\\atop{S}$$ K$$0\\atop{L}$$ π 0 , K$$0\\atop{S}$$ K$$0\\atop{L}$$ η , and K$$0\\atop{S}$$ K$$0\\atop{L}$$ π 0π 0 cross sections up to a center-of-mass energy of 4 GeV and study their intermediate resonance structures. We observe J / ψ decays to all of these final states for the first time, present measurements of their J / ψ branching fractions, and search for ψ (2S) decays.« less

Cross sections for the reactions e + e - → K S 0 K L 0 π 0 , K S 0 K L 0 η , and K S 0 K L 0 π 0 π 0 from events with initial-state radiation

DOE PAGES

Lees, J. P.; Poireau, V.; Tisserand, V.; ...

2017-03-06

Here, we study the processes e + e - → Kmore » $$0\\atop{S}$$ K$$0\\atop{L}$$ π 0 γ , K $$0\\atop{S}$$ K$$0\\atop{L}$$ η γ , and K$$0\\atop{S}$$ K$$0\\atop{L}$$ π 0 π 0 γ , where the photon is radiated from the initial state, providing cross section measurements for the hadronic final states over a continuum of center-of-mass energies. The results are based on 469 fb -1 of data collected at or near the Υ ( 4 S ) resonance with the BABAR detector at SLAC. We present the first measurements of the e + e - → K$$0\\atop{S}$$ K$$0\\atop{L}$$ π 0 , K$$0\\atop{S}$$ K$$0\\atop{L}$$ η , and K$$0\\atop{S}$$ K$$0\\atop{L}$$ π 0π 0 cross sections up to a center-of-mass energy of 4 GeV and study their intermediate resonance structures. We observe J / ψ decays to all of these final states for the first time, present measurements of their J / ψ branching fractions, and search for ψ (2S) decays.« less

Safety and efficacy of vemurafenib in BRAFV600E and BRAFV600K mutation-positive melanoma (BRIM-3): extended follow-up of a phase 3, randomised, open-label study

PubMed Central

McArthur, Grant A; Chapman, Paul B; Robert, Caroline; Larkin, James; Haanen, John B; Dummer, Reinhard; Ribas, Antoni; Hogg, David; Hamid, Omid; Ascierto, Paolo A; Garbe, Claus; Testori, Alessandro; Maio, Michele; Lorigan, Paul; Lebbé, Celeste; Jouary, Thomas; Schadendorf, Dirk; O’Day, Stephen J; Kirkwood, John M.; Eggermont, Alexander M; Dréno, Brigitte; Sosman, Jeffrey A; Flaherty, Keith T; Yin, Ming; Caro, Ivor; Cheng, Suzanne; Trunzer, Kerstin; Hauschild, Axel

2015-01-01

Summary Background In the BRIM-3 trial, vemurafenib was associated with risk reduction versus dacarbazine of both death and progression in patients with advanced BRAFV600 mutation-positive melanoma. We present an extended follow-up analysis of the total population and in the BRAFV600E and BRAFV600K mutation subgroups. Methods Patients older than 18 years, with treatment-naive metastatic melanoma and whose tumour tissue was positive for BRAFV600 mutations were eligible. Patients also had to have a life expectancy of at least 3 months, an Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1, and adequate haematological, hepatic, and renal function. Patients were randomly assigned by interactive voice recognition system to receive either vemurafenib (960 mg orally twice daily) or dacarbazine (1000 mg/m2 of body surface area intravenously every 3 weeks). Coprimary endpoints were overall survival and progression-free survival, analysed in the intention-to-treat population (n=675), with data censored at crossover. A sensitivity analysis was done. This trial is registered with ClinicalTrials.gov, NCT01006980. Findings 675 eligible patients were enrolled from 104 centres in 12 countries between Jan 4, 2010, and Dec 16, 2010. 337 patients were randomly assigned to receive vemurafenib and 338 to receive dacarbazine. Median follow-up was 12·5 months (IQR 7·7–16·0) on vemurafenib and 9·5 months (3·1–14·7) on dacarbazine. 83 (25%) of the 338 patients initially randomly assigned to dacarbazine crossed over from dacarbazine to vemurafenib. Median overall survival was significantly longer in the vemurafenib group than in the dacarbazine group (13·6 months [95% CI 12·0–15·2] vs 9·7 months [7·9–12·8]; hazard ratio [HR] 0·70 [95% CI 0·57–0·87]; p=0·0008), as was median progression-free survival (6·9 months [95% CI 6·1–7·0] vs 1·6 months [1·6–2·1]; HR 0·38 [95% CI 0·32–0·46]; p<0·0001). For the 598 (91%) patients with BRAFV

Identification of new molecular alterations in Fatal Familial Insomnia.

USDA-ARS?s Scientific Manuscript database

Fatal familial insomnia (FFI) is an autosomal dominant prion disease caused by a D178N mutation in PRNP in combination with methionine (Met) at codon 129 in the mutated allele of the same gene (D178N-129M haplotype). The present study analyzes pathological and molecular features in seven FFI cases c...

A mutation in a new gene bglJ, activates the bgl operon in Escherichia coli K-12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giel, M.; Desnoyer, M.; Lopilato, J.

1996-06-01

A new mutation , bglJ4, has been characterized that results in the expression of the silent bgl operon. The bgl operon encodes proteins necessary for the transport and utilization of the aromatic {beta}-glucosides arbutin and salicin. A variety of mutations activate the operon and result in a Bgl{sup +} phenotype. Activating mutations are located upstream of the bgl promoter and in genes located elsewhere on the chromosome. Mutations outside of the bgl operon occur in the genes encoding DNA gyrase and in the gene encoding the nucleoid associated protein H-NS. The mutation described here, bglJ4, has been mapped to amore » new locus at min 99 on the Escherichia coli K-12 genetic map. The putative protein encoded by the bglJ gene has homology to a family of transcriptional activators. Evidence is presented that increased expression of the bglJ product is needed for activation of the bgl operon. 56 refs., 3 figs., 3 tabs.« less

Liquid biopsy of PIK3CA mutations in cervical cancer in Hong Kong Chinese women.

PubMed

Chung, Tony K H; Cheung, Tak Hong; Yim, So Fan; Yu, Mei Yun; Chiu, Rossa W K; Lo, Keith W K; Lee, Ida P C; Wong, Raymond R Y; Lau, Kitty K M; Wang, Vivian W; Worley, Michael J; Elias, Kevin M; Fiascone, Stephen J; Smith, David I; Berkowitz, Ross S; Wong, Yick Fu

2017-08-01

Cervical cancer is the fourth most common female cancer worldwide. The prognosis for women with advanced-stage or recurrent cervical cancer remains poor and response to treatment is variable. Standardized management protocols leave little room for individualization. We report on a novel blood-based liquid biopsy for specific PIK3CA mutations as a clinically useful biomarker in patients with invasive cervical cancer. One hundred seventeen Hong Kong Chinese women with primary invasive cervical cancer and their pre-treatment plasma samples were investigated. Two PIK3CA mutations, p.E542K and p.E545K were measured in cell free DNA (cfDNA) extracted from plasma using droplet digital PCR. This liquid biopsy of PIK3CA in cervical cancer was correlated to clinico-pathological features to verify the potential of PIK3CA as a clinically useful molecular biomarker for predicting disease prognosis and monitoring for progression. PIK3CA mutations, either p.E542K or p.E545K, were detected in plasma cfDNA from 22.2% of the patients. PIK3CA mutation status was significantly correlated to median tumor size (p<0.01). PIK3CA mutations detected in the plasma were significantly associated with decreased disease-free survival and overall survival (p<0.05). As a liquid molecular biopsy, analysis of circulating PIK3CA mutations shows promise as a way to refine risk stratification of individual patients with cervical cancer, and provides a platform for further research to offer individualized therapy with the purpose of improving outcomes. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of mutations in the PI3K-AKT-mTOR signalling pathway in patients with macrocephaly and developmental delay and/or autism.

PubMed

Yeung, Kit San; Tso, Winnie Wan Yee; Ip, Janice Jing Kun; Mak, Christopher Chun Yu; Leung, Gordon Ka Chun; Tsang, Mandy Ho Yin; Ying, Dingge; Pei, Steven Lim Cho; Lee, So Lun; Yang, Wanling; Chung, Brian Hon-Yin

2017-01-01

Macrocephaly, which is defined as a head circumference greater than or equal to + 2 standard deviations, is a feature commonly observed in children with developmental delay and/or autism spectrum disorder. Although PTEN is a well-known gene identified in patients with this syndromic presentation, other genes in the PI3K-AKT-mTOR signalling pathway have also recently been suggested to have important roles. The aim of this study is to characterise the mutation spectrum of this group of patients. We performed whole-exome sequencing of 21 patients with macrocephaly and developmental delay/autism spectrum disorder. Sources of genomic DNA included blood, buccal mucosa and saliva. Germline mutations were validated by Sanger sequencing, whereas somatic mutations were validated by droplet digital PCR. We identified ten pathogenic/likely pathogenic mutations in PTEN ( n  = 4), PIK3CA ( n  = 3), MTOR ( n  = 1) and PPP2R5D ( n  = 2) in ten patients. An additional PTEN mutation, which was classified as variant of unknown significance, was identified in a patient with a pathogenic PTEN mutation, making him harbour bi-allelic germline PTEN mutations. Two patients harboured somatic PIK3CA mutations, and the level of somatic mosaicism in blood DNA was low. Patients who tested positive for mutations in the PI3K-AKT-mTOR pathway had a lower developmental quotient than the rest of the cohort (DQ = 62.8 vs. 76.1, p = 0.021). Their dysmorphic features were non-specific, except for macrocephaly. Among the ten patients with identified mutations, brain magnetic resonance imaging was performed in nine, all of whom showed megalencephaly. We identified mutations in the PI3K-AKT-mTOR signalling pathway in nearly half of our patients with macrocephaly and developmental delay/autism spectrum disorder. These patients have subtle dysmorphic features and mild developmental issues. Clinically, patients with germline mutations are difficult to distinguish from patients with somatic

Genetic and Pathological Follow-Up Study of Goats Experimentally and Naturally Exposed to a Sheep Scrapie Isolate.

PubMed

Maestrale, Caterina; Cancedda, Maria G; Pintus, Davide; Masia, Mariangela; Nonno, Romolo; Ru, Giuseppe; Carta, Antonello; Demontis, Francesca; Santucciu, Cinzia; Ligios, Ciriaco

2015-10-01

Thirty-seven goats carrying different prion protein genotypes (PRNP) were orally infected with a classical scrapie brain homogenate from wild-type (ARQ/ARQ) sheep and then mated to obtain 2 additional generations of offspring, which were kept in the same environment and allowed to be naturally exposed to scrapie. Occurrence of clinical or subclinical scrapie was observed in the experimentally infected goats (F0) and in only one (F1b) of the naturally exposed offspring groups. In both groups (F0 and F1b), goats carrying the R154H, H154H, R211Q, and P168Q-P240P dimorphisms died of scrapie after a longer incubation period than wild-type, G37V, Q168Q-P240P, and S240P goats. In contrast, D145D and Q222K goats were resistant to infection. The immunobiochemical signature of the scrapie isolate and its pathological aspects observed in the sheep donors were substantially maintained over 2 goat generations, i.e., after experimental and natural transmission. This demonstrates that the prion protein gene sequence, which is shared by sheep and goats, is more powerful than any possible but unknown species-related factors in determining scrapie phenotypes. With regard to genetics, our study confirms that the K222 mutation protects goats even against ovine scrapie isolates, and for the first time, a possible association of D145 mutation with scrapie resistance is shown. In addition, it is possible that the sole diverse frequencies of these genetic variants might, at least in part, shape the prevalence of scrapie among naturally exposed progenies in affected herds. This study was aimed at investigating the genetic and pathological features characterizing sheep-to-goat transmission of scrapie. We show that in goats with different prion protein gene mutations, the K222 genetic variant is associated with scrapie resistance after natural and experimental exposure to ovine prion infectivity. In addition, we observed for the first time a protective effect of the D145 goat variant against

Genetic and Pathological Follow-Up Study of Goats Experimentally and Naturally Exposed to a Sheep Scrapie Isolate

PubMed Central

Maestrale, Caterina; Cancedda, Maria G.; Pintus, Davide; Masia, Mariangela; Nonno, Romolo; Ru, Giuseppe; Carta, Antonello; Demontis, Francesca; Santucciu, Cinzia

2015-01-01

ABSTRACT Thirty-seven goats carrying different prion protein genotypes (PRNP) were orally infected with a classical scrapie brain homogenate from wild-type (ARQ/ARQ) sheep and then mated to obtain 2 additional generations of offspring, which were kept in the same environment and allowed to be naturally exposed to scrapie. Occurrence of clinical or subclinical scrapie was observed in the experimentally infected goats (F0) and in only one (F1b) of the naturally exposed offspring groups. In both groups (F0 and F1b), goats carrying the R154H, H154H, R211Q, and P168Q-P240P dimorphisms died of scrapie after a longer incubation period than wild-type, G37V, Q168Q-P240P, and S240P goats. In contrast, D145D and Q222K goats were resistant to infection. The immunobiochemical signature of the scrapie isolate and its pathological aspects observed in the sheep donors were substantially maintained over 2 goat generations, i.e., after experimental and natural transmission. This demonstrates that the prion protein gene sequence, which is shared by sheep and goats, is more powerful than any possible but unknown species-related factors in determining scrapie phenotypes. With regard to genetics, our study confirms that the K222 mutation protects goats even against ovine scrapie isolates, and for the first time, a possible association of D145 mutation with scrapie resistance is shown. In addition, it is possible that the sole diverse frequencies of these genetic variants might, at least in part, shape the prevalence of scrapie among naturally exposed progenies in affected herds. IMPORTANCE This study was aimed at investigating the genetic and pathological features characterizing sheep-to-goat transmission of scrapie. We show that in goats with different prion protein gene mutations, the K222 genetic variant is associated with scrapie resistance after natural and experimental exposure to ovine prion infectivity. In addition, we observed for the first time a protective effect of the D145

Effect of point mutations on Herbaspirillum seropedicae NifA activity.

PubMed

Aquino, B; Stefanello, A A; Oliveira, M A S; Pedrosa, F O; Souza, E M; Monteiro, R A; Chubatsu, L S

2015-08-01

NifA is the transcriptional activator of the nif genes in Proteobacteria. It is usually regulated by nitrogen and oxygen, allowing biological nitrogen fixation to occur under appropriate conditions. NifA proteins have a typical three-domain structure, including a regulatory N-terminal GAF domain, which is involved in control by fixed nitrogen and not strictly required for activity, a catalytic AAA+ central domain, which catalyzes open complex formation, and a C-terminal domain involved in DNA-binding. In Herbaspirillum seropedicae, a β-proteobacterium capable of colonizing Graminae of agricultural importance, NifA regulation by ammonium involves its N-terminal GAF domain and the signal transduction protein GlnK. When the GAF domain is removed, the protein can still activate nif genes transcription; however, ammonium regulation is lost. In this work, we generated eight constructs resulting in point mutations in H. seropedicae NifA and analyzed their effect on nifH transcription in Escherichia coli and H. seropedicae. Mutations K22V, T160E, M161V, L172R, and A215D resulted in inactive proteins. Mutations Q216I and S220I produced partially active proteins with activity control similar to wild-type NifA. However, mutation G25E, located in the GAF domain, resulted in an active protein that did not require GlnK for activity and was partially sensitive to ammonium. This suggested that G25E may affect the negative interaction between the N-terminal GAF domain and the catalytic central domain under high ammonium concentrations, thus rendering the protein constitutively active, or that G25E could lead to a conformational change comparable with that when GlnK interacts with the GAF domain.

Effect of point mutations on Herbaspirillum seropedicae NifA activity

PubMed Central

Aquino, B.; Stefanello, A.A.; Oliveira, M.A.S.; Pedrosa, F.O.; Souza, E.M.; Monteiro, R.A.; Chubatsu, L.S.

2015-01-01

NifA is the transcriptional activator of the nif genes in Proteobacteria. It is usually regulated by nitrogen and oxygen, allowing biological nitrogen fixation to occur under appropriate conditions. NifA proteins have a typical three-domain structure, including a regulatory N-terminal GAF domain, which is involved in control by fixed nitrogen and not strictly required for activity, a catalytic AAA+ central domain, which catalyzes open complex formation, and a C-terminal domain involved in DNA-binding. In Herbaspirillum seropedicae, a β-proteobacterium capable of colonizing Graminae of agricultural importance, NifA regulation by ammonium involves its N-terminal GAF domain and the signal transduction protein GlnK. When the GAF domain is removed, the protein can still activate nif genes transcription; however, ammonium regulation is lost. In this work, we generated eight constructs resulting in point mutations in H. seropedicae NifA and analyzed their effect on nifH transcription in Escherichia coli and H. seropedicae. Mutations K22V, T160E, M161V, L172R, and A215D resulted in inactive proteins. Mutations Q216I and S220I produced partially active proteins with activity control similar to wild-type NifA. However, mutation G25E, located in the GAF domain, resulted in an active protein that did not require GlnK for activity and was partially sensitive to ammonium. This suggested that G25E may affect the negative interaction between the N-terminal GAF domain and the catalytic central domain under high ammonium concentrations, thus rendering the protein constitutively active, or that G25E could lead to a conformational change comparable with that when GlnK interacts with the GAF domain. PMID:26176311

K13-propeller polymorphisms in Plasmodium falciparum parasites from sub-Saharan Africa.

PubMed

Kamau, Edwin; Campino, Susana; Amenga-Etego, Lucas; Drury, Eleanor; Ishengoma, Deus; Johnson, Kimberly; Mumba, Dieudonne; Kekre, Mihir; Yavo, William; Mead, Daniel; Bouyou-Akotet, Marielle; Apinjoh, Tobias; Golassa, Lemu; Randrianarivelojosia, Milijaona; Andagalu, Ben; Maiga-Ascofare, Oumou; Amambua-Ngwa, Alfred; Tindana, Paulina; Ghansah, Anita; MacInnis, Bronwyn; Kwiatkowski, Dominic; Djimde, Abdoulaye A

2015-04-15

Mutations in the Plasmodium falciparum K13-propeller domain have recently been shown to be important determinants of artemisinin resistance in Southeast Asia. This study investigated the prevalence of K13-propeller polymorphisms across sub-Saharan Africa. A total of 1212 P. falciparum samples collected from 12 countries were sequenced. None of the K13-propeller mutations previously reported in Southeast Asia were found, but 22 unique mutations were detected, of which 7 were nonsynonymous. Allele frequencies ranged between 1% and 3%. Three mutations were observed in >1 country, and the A578S was present in parasites from 5 countries. This study provides the baseline prevalence of K13-propeller mutations in sub-Saharan Africa. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Abrogation of BRAFV600E-induced senescence by PI3K pathway activation contributes to melanomagenesis

PubMed Central

Vredeveld, Liesbeth C.W.; Possik, Patricia A.; Smit, Marjon A.; Meissl, Katrin; Michaloglou, Chrysiis; Horlings, Hugo M.; Ajouaou, Abderrahim; Kortman, Pim C.; Dankort, David; McMahon, Martin; Mooi, Wolter J.; Peeper, Daniel S.

2012-01-01

Human melanocytic nevi (moles) are benign lesions harboring activated oncogenes, including BRAF. Although this oncogene initially acts mitogenically, eventually, oncogene-induced senescence (OIS) ensues. Nevi can infrequently progress to melanomas, but the mechanistic relationship with OIS is unclear. We show here that PTEN depletion abrogates BRAFV600E-induced senescence in human fibroblasts and melanocytes. Correspondingly, in established murine BRAFV600E-driven nevi, acute shRNA-mediated depletion of PTEN prompted tumor progression. Furthermore, genetic analysis of laser-guided microdissected human contiguous nevus–melanoma specimens recurrently revealed identical mutations in BRAF or NRAS in adjacent benign and malignant melanocytes. The PI3K pathway was often activated through either decreased PTEN or increased AKT3 expression in melanomas relative to their adjacent nevi. Pharmacologic PI3K inhibition in melanoma cells suppressed proliferation and induced the senescence-associated tumor suppressor p15INK4B. This treatment also eliminated subpopulations resistant to targeted BRAFV600E inhibition. Our findings suggest that a significant proportion of melanomas arise from nevi. Furthermore, these results demonstrate that PI3K pathway activation serves as a rate-limiting event in this setting, acting at least in part by abrogating OIS. The reactivation of senescence features and elimination of cells refractory to BRAFV600E inhibition by PI3K inhibition warrants further investigation into the therapeutic potential of simultaneously targeting these pathways in melanoma. PMID:22549727

Preclinical Evaluation of Vemurafenib as Therapy for BRAFV600E Mutated Sarcomas.

PubMed

Gouravan, Sarina; Meza-Zepeda, Leonardo A; Myklebost, Ola; Stratford, Eva W; Munthe, Else

2018-03-23

The BRAF V600E mutation, which in melanoma is targetable with vemurafenib, is also found in sarcomas and we here evaluate the therapeutic potential in sarcoma cell lines. Four sarcoma cell lines harboring the BRAFV600E mutation, representing liposarcomas (SA-4 and SW872), Ewing sarcoma (A673) and atypical synovial sarcoma (SW982), were treated with vemurafenib and the effects on cell growth, apoptosis, cell cycle progression and cell signaling were determined. Vemurafenib induced a strong cytostatic effect in SA-4 cells, mainly due to cell cycle arrest, whereas only moderate levels of apoptosis were observed. However, a high dose was required compared to BRAF V600E mutated melanoma cells, and removal of vemurafenib demonstrated that the continuous presence of drug was required for sustained growth inhibition. A limited growth inhibition was observed in the other three cell lines. Protein analyses demonstrated reduced phosphorylation of ERK during treatment with vemurafenib in all the four sarcoma cell lines confirming that the MAPK pathway is active in these cell lines, and that the pathway can be inhibited by vemurafenib, but also that these cells can proliferate despite this. These findings indicate that vemurafenib alone would not be an efficient therapy against BRAF V600E mutated sarcomas. However, further investigations of combination with other drugs are warranted.

Therapeutic Application of Phage Capsule Depolymerases against K1, K5, and K30 Capsulated E. coli in Mice.

PubMed

Lin, Han; Paff, Matthew L; Molineux, Ian J; Bull, James J

2017-01-01

Capsule depolymerase enzymes offer a promising class of new antibiotics. In vivo studies are encouraging but it is unclear how well this type of phage product will generalize in therapeutics, or whether different depolymerases against the same capsule function similarly. Here, in vivo efficacy was tested using cloned bacteriophage depolymerases against Escherichia coli strains with three different capsule types: K1, K5, and K30. When treating infections with the cognate capsule type in a mouse thigh model, the previously studied K1E depolymerase rescued poorly, whereas K1F, K1H, K5, and K30 depolymerases rescued well. K30 gp41 was identified as the catalytically active protein. In contrast to the in vivo studies, K1E enzyme actively degraded K1 capsule polysaccharide in vitro and sensitized K1 bacteria to serum killing. The only in vitro correlate of poor K1E performance in vivo was that the purified enzyme did not form the expected trimer. K1E appeared as an 18-mer which might limit its in vivo distribution. Overall, depolymerases were easily identified, cloned from phage genomes, and as purified proteins they proved generally effective.

Comparison of Immunohistochemistry and Direct Sanger Sequencing for Detection of the BRAFV600E Mutation in Thyroid Neoplasm

PubMed Central

Oh, Hye-Seon; Kwon, Hyemi; Park, Suyeon; Kim, Mijin; Jeon, Min Ji; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae; Choi, Jene

2018-01-01

Background The BRAFV600E mutation is the most common genetic alteration identified in papillary thyroid carcinoma (PTC). Because of its costs effectiveness and sensitivity, direct Sanger sequencing has several limitations. The aim of this study was to evaluate the efficiency of immunohistochemistry (IHC) as an alternative method to detect the BRAFV600E mutation in preoperative and postoperative tissue samples. Methods We evaluated 71 patients who underwent thyroid surgery with the result of direct sequencing of the BRAFV600E mutation. IHC staining of the BRAFV600E mutation was performed in 49 preoperative and 23 postoperative thyroid specimens. Results Sixty-two patients (87.3%) had PTC, and of these, BRAFV600E was confirmed by direct sequencing in 57 patients (91.9%). In 23 postoperative tissue samples, the BRAFV600E mutation was detected in 16 samples (70%) by direct sequencing and 18 samples (78%) by IHC. In 24 fine needle aspiration (FNA) samples, BRAFV600E was detected in 18 samples (75%) by direct sequencing and 16 samples (67%) by IHC. In 25 core needle biopsy (CNB) samples, the BRAFV600E mutation was detected in 15 samples (60%) by direct sequencing and 16 samples (64%) by IHC. The sensitivity and specificity of IHC for detecting the BRAFV600E mutation were 77.8% and 66.7% in FNA samples and 99.3% and 80.0% in CNB samples. Conclusion IHC could be an alternative method to direct Sanger sequencing for BRAFV600E mutation detection both in postoperative and preoperative samples. However, application of IHC to detect the BRAFV600E mutation in FNA samples is of limited value compared with direct sequencing. PMID:29388401

Mutations in the glucocerebrosidase gene are common in patients with Parkinson's disease from Eastern Canada.

PubMed

Han, Fabin; Grimes, David A; Li, Fang; Wang, Ting; Yu, Zhe; Song, Na; Wu, Shichao; Racacho, Lemuel; Bulman, Dennis E

2016-01-01

Mutations in the β-glucocerebrosidase gene (GBA) have been implicated as a risk factor for Parkinson's disease (PD). However, GBA mutations in PD patients of different ethnic origins were reported to be inconsistent. We sequenced all exons of the GBA gene in 225 PD patients and 110 control individuals from Eastern Canada. Two novel GBA variants of c.-119 A/G and S(-35)N, five known GBA mutations of R120W, N370S, L444P, RecNciI and RecTL mutation (del55/D409H/RecNciI) as well as two non-pathological variants of E326K and T369M were identified from PD patients while only one mutation of S13L and two non-pathological variants of E326K and T369M were found in the control individuals. The frequency of GBA mutations within PD patients (4.4%) is 4.8 times higher than the 0.91% observed in control individuals (X(2) = 2.91, p = 0.088; odds ratio = 4.835; 95% confidence interval = 2.524-9.123). The most common mutations of N370S and L444P accounted for 36.0% (9/25) of all the GBA mutations in this Eastern Canadian PD cohort. The frequency (6.67%) of E326K and T369M in PD patients is comparable to 7.27% in control individuals (X(2) = 0.042, p = 0.8376), further supporting that these two variants have no pathological effects on PD. Phenotype analysis showed that no significant difference in family history, age at onset and cognitive impairment was identified between the GBA mutation carriers and non-GBA mutation carriers. GBA mutations were found to be a common genetic risk factor for PD in Eastern Canadian patients.

Selection of target mutation in rat gastrointestinal tract E. coli by minute dosage of enrofloxacin.

PubMed

Lin, Dachuan; Chen, Kaichao; Li, Ruichao; Liu, Lizhang; Guo, Jiubiao; Yao, Wen; Chen, Sheng

2014-01-01

It has been suggested that bacterial resistance is selected within a mutation selection window of antibiotics. More recent studies showed that even extremely low concentration of antibiotic could select resistant bacteria in vitro. Yet little is known about the exact antibiotic concentration range that can effectively select for resistant organisms in animal gastrointestinal (GI) tract. In this study, the effect of different dosages of enrofloxacin on resistance and mutation development in rat GI tract E. coli was investigated by determining the number of resistant E. coli recoverable from rat fecal samples. Our data showed that high dose antibiotic treatment could effectively eliminate E. coli with single gyrA mutation in the early course of treatment, yet the eradication effects diminished upon prolonged treatment. Therapeutic and sub-therapeutic dose (1/10 and 1/100 of therapeutic doses) of enrofloxacin could effectively select for mutation in GI tract E. coli at the later course of enrofloxacin treatment and during the cessation periods. Surprisingly, very low dose of enrofloxacin (1/1000 therapeutic dose) could also select for mutation in GI tract E. coli at the later course of enrofloxacin treatment, only with slightly lower efficiency. No enrofloxacin-resistant E. coli could be selected at all test levels of enrofloxacin during long term treatment and the strength of antibiotic treatment does not alter the overall level of E. coli in rat GI tract. This study demonstrated that long term antibiotic treatment seems to be the major trigger for the development of target mutations in GI tract E. coli, which provided insight into the rational use of antibiotics in animal husbandry.

The effect of charge-introduction mutations on E. coli thioredoxin stability.

PubMed

Perez-Jimenez, Raul; Godoy-Ruiz, Raquel; Ibarra-Molero, Beatriz; Sanchez-Ruiz, Jose M

2005-04-01

Technological applications of proteins are often hampered by their low-stability and, consequently, the development of procedures for protein stabilization is of considerable biotechnological interest. Here, we use simple electrostatics to determine positions in E. coli thioredoxin at which mutations that introduce new charged residues are expected to lead to stability enhancement. We also obtain the corresponding mutants and characterize their stability using differential scanning calorimetry. The results are interpreted in terms of the accessibility in the native structure of the mutated residues and the potential effect of the mutations on the residual structure of the denatured state.

Response of head and neck squamous cell carcinoma cells carrying PIK3CA mutations to selected targeted therapies.

PubMed

Wirtz, Eric D; Hoshino, Daisuke; Maldonado, Anthony T; Tyson, Darren R; Weaver, Alissa M

2015-06-01

The PIK3CA mutation is one of the most common mutations in head and neck squamous cell carcinoma (HNSCC). Through this research we attempt to elicit the role of oncogene dependence and effects of targeted therapy on this PIK3CA mutation. (1) To determine the role of oncogene dependence on PIK3CA-one of the more common and targetable oncogenes in HNSCC, and (2) to evaluate the consequence of this oncogene on the effectiveness of newly developed targeted therapies. This was a cell culture-based, in vitro study performed at an academic research laboratory assessing the viability of PIK3CA-mutated head and neck cell lines when treated with targeted therapy. PIK3CA-mutated head and neck cell lines were treated with 17-AAG, GDC-0941, trametinib, and BEZ-235. Assessment of cell viability of HNSCC cell lines characterized for PIK3CA mutations or SCC25 cells engineered to express the PIK3CA hotspot mutations E545K or H1047R. Surprisingly, in engineered cell lines, the hotspot E545K and H1047R mutations conferred increased, rather than reduced, IC50 assay measurements when treated with the respective HSP90, PI3K, and MEK inhibitors, 17-AAG, GDC-0941, and trametinib, compared with the SCC25 control cell lines. When treated with BEZ-235, H1047R-expressing cell lines showed increased sensitivity to inhibition compared with control, whereas those expressing E545K showed slightly increased sensitivity of unclear significance. (1) The PIK3CA mutations within our engineered cell model did not lead to enhanced oncogene-dependent cell death when treated with direct inhibition of the PI3K enzyme yet did show increased sensitivity compared with control with dual PI3K/mTOR inhibition. (2) Oncogene addiction to PIK3CA hotspot mutations, if it occurs, is likely to evolve in vivo in the context of additional molecular changes that remain to be identified. Additional study is required to develop new model systems and approaches to determine the role of targeted therapy in the treatment of

Response of Head and Neck Squamous Cell Carcinoma Cells Carrying PIK3CA Mutations to Select Targeted Therapies

PubMed Central

Wirtz, Eric D; Hoshino, Daisuke; Maldonado, Anthony T; Tyson, Darren R; Weaver, Alissa M

2015-01-01

Importance The PIK3CA mutation is one of the most common mutations in Head and Neck Squamous Cell Carcinoma (HNSCC). Through this research we attempt to elicit the role of oncogene dependence and effects of targeted therapy on this PIK3CA mutation. Objectives 1) To determine the role of oncogene dependence on one of the more common and targetable oncogenes in HNSCC – PIK3CA; 2) To evaluate the consequence of this oncogene on the effectiveness of newly developed targeted therapies. Study Design In vitro study. Setting Academic research laboratory. Participants Cell culture based study assessing the viability of PIK3CA mutated head and neck cell lines when treated with targeted therapy. Exposures PIK3CA mutated head and neck cell lines were treated with 17-AAG, GDC-0941, trametinib, and BEZ-235. Main Outcome and Measures Assessment of cell viability of HNSCC cell lines characterized for PIK3CA mutations or SCC25 cells engineered to express the PIK3CA hotspot mutations E545K or H1047R Results Surprisingly, in engineered cell lines, the hotspot E545K and H1047R mutations conferred decreased, rather than increased, sensitivity as measured by IC50 when treated with the respective HSP90, PI3K, and MEK inhibitors, 17-AAG, GDC-0941, and trametinib, compared to the SCC25 control cell lines. When treated with BEZ-235, H1047R-expressing cell lines showed increased sensitivity to inhibition compared to control while those expressing E545K showed slightly increased sensitivity of unclear significance. Conclusions and Relevance 1) The PIK3CA mutations within our engineered cell model did not lead to enhanced oncogene-dependent cell death when treated with direct inhibition of the PI3K enzyme yet did show increased sensitivity compared to control with dual PI3K/mTOR inhibition. 2) Oncogene addiction to PIK3CA hot spot mutations, if it occurs, is likely to evolve in vivo molecular changes that remain to be identified. Additional study is required to develop new model systems and

Phenotypic spectrum and prevalence of INPP5E mutations in Joubert syndrome and related disorders.

PubMed

Travaglini, Lorena; Brancati, Francesco; Silhavy, Jennifer; Iannicelli, Miriam; Nickerson, Elizabeth; Elkhartoufi, Nadia; Scott, Eric; Spencer, Emily; Gabriel, Stacey; Thomas, Sophie; Ben-Zeev, Bruria; Bertini, Enrico; Boltshauser, Eugen; Chaouch, Malika; Cilio, Maria Roberta; de Jong, Mirjam M; Kayserili, Hulya; Ogur, Gonul; Poretti, Andrea; Signorini, Sabrina; Uziel, Graziella; Zaki, Maha S; Johnson, Colin; Attié-Bitach, Tania; Gleeson, Joseph G; Valente, Enza Maria

2013-10-01

Joubert syndrome and related disorders (JSRD) are clinically and genetically heterogeneous ciliopathies sharing a peculiar midbrain-hindbrain malformation known as the 'molar tooth sign'. To date, 19 causative genes have been identified, all coding for proteins of the primary cilium. There is clinical and genetic overlap with other ciliopathies, in particular with Meckel syndrome (MKS), that is allelic to JSRD at nine distinct loci. We previously identified the INPP5E gene as causative of JSRD in seven families linked to the JBTS1 locus, yet the phenotypic spectrum and prevalence of INPP5E mutations in JSRD and MKS remain largely unknown. To address this issue, we performed INPP5E mutation analysis in 483 probands, including 408 JSRD patients representative of all clinical subgroups and 75 MKS fetuses. We identified 12 different mutations in 17 probands from 11 JSRD families, with an overall 2.7% mutation frequency among JSRD. The most common clinical presentation among mutated families (7/11, 64%) was Joubert syndrome with ocular involvement (either progressive retinopathy and/or colobomas), while the remaining cases had pure JS. Kidney, liver and skeletal involvement were not observed. None of the MKS fetuses carried INPP5E mutations, indicating that the two ciliopathies are not allelic at this locus.

Helicity of short E-R/K peptides.

PubMed

Sommese, Ruth F; Sivaramakrishnan, Sivaraj; Baldwin, Robert L; Spudich, James A

2010-10-01

Understanding the secondary structure of peptides is important in protein folding, enzyme function, and peptide-based drug design. Previous studies of synthetic Ala-based peptides (>12 a.a.) have demonstrated the role for charged side chain interactions involving Glu/Lys or Glu/Arg spaced three (i, i + 3) or four (i, i + 4) residues apart. The secondary structure of short peptides (<9 a.a.), however, has not been investigated. In this study, the effect of repetitive Glu/Lys or Glu/Arg side chain interactions, giving rise to E-R/K helices, on the helicity of short peptides was examined using circular dichroism. Short E-R/K-based peptides show significant helix content. Peptides containing one or more E-R interactions display greater helicity than those with similar E-K interactions. Significant helicity is achieved in Arg-based E-R/K peptides eight, six, and five amino acids long. In these short peptides, each additional i + 3 and i + 4 salt bridge has substantial contribution to fractional helix content. The E-R/K peptides exhibit a strongly linear melt curve indicative of noncooperative folding. The significant helicity of these short peptides with predictable dependence on number, position, and type of side chain interactions makes them an important consideration in peptide design.

Structural Consequences of Mutations to the α-Tocopherol Transfer Protein Associated with the Neurodegenerative Disease Ataxia with Vitamin E Deficiency

PubMed Central

Bromley, Dennis; Anderson, Peter C.; Daggett, Valerie

2013-01-01

The α-tocopherol transfer protein (α-TTP) is a liver protein that transfers α-tocopherol (vitamin E) to very-low-density lipoproteins (VLDLs). These VLDLs are then circulated throughout the body to maintain blood α-tocopherol levels. Mutations to the α-TTP gene are associated with ataxia with vitamin E deficiency (AVED), a disease characterized by peripheral nerve degeneration. In this study, molecular dynamics simulations of the E141K and R59W disease-associated mutants were performed. The mutants displayed disruptions in and around the ligand-binding pocket. Structural analysis and ligand docking to the mutant structures predicted a decreased affinity for α-tocopherol. To determine the detailed mechanism of the mutation-related changes, we developed a new tool called ContactWalker that analyzes contact differences between mutant and wild-type proteins and highlights pathways of altered contacts within the mutant proteins. Taken together, our findings are in agreement with experiment and suggest structural explanations for the reduced ability of the mutants to bind and carry α-tocopherol. PMID:23713716

Mutation of genes of the PI3K/AKT pathway in breast cancer supports their potential importance as biomarker for breast cancer aggressiveness.

PubMed

Tserga, Aggeliki; Chatziandreou, Ilenia; Michalopoulos, Nicolaos V; Patsouris, Efstratios; Saetta, Angelica A

2016-07-01

Deregulation of phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway is closely associated with cancer development and cancer progression. PIK3CA, AKT1, and PTEN are the fundamental molecules of the PI3K/AKT pathway with increased mutation rates in cancer cases leading to aberrant regulation of the pathway. Even though molecular alterations of the PI3K/AKT pathway have been studied in breast cancer, correlations between specific molecular alterations and clinicopathological features remain contradictory. In this study, we examined mutations of the PI3K/AKT pathway in 75 breast carcinomas using high-resolution melting analysis and pyrosequencing, in parallel with analysis of relative expression of PIK3CA and AKT2 genes. Mutations of PIK3CA were found in our cohort in 21 cases (28 %), 10 (13 %) in exon 9 and 11(15 %) in exon 20. Mutation frequency of AKT1 and PTEN genes was 4 and 3 %, respectively. Overall, alterations in the PI3K/AKT signaling cascade were detected in 35 % of the cases. Furthermore, comparison of 50 breast carcinomas with adjacent normal tissues showed elevated PIK3CA messenger RNA (mRNA) levels in 18 % of tumor cases and elevated AKT2 mRNA levels in 14 %. Our findings, along with those of previous studies, underline the importance of the PI3K/AKT pathway components as potential biomarkers for breast carcinogenesis.

Absolute rate of the reaction of Cl(p-2) with molecular hydrogen from 200 - 500 K

NASA Technical Reports Server (NTRS)

Whytock, D. A.; Lee, J. H.; Michael, J. V.; Payne, W. A.; Stief, L. J.

1976-01-01

Rate constants for the reaction of atomic chlorine with hydrogen are measured from 200 - 500 K using the flash photolysis-resonance fluorescence technique. The results are compared with previous work and are discussed with particular reference to the equilibrium constant for the reaction and to relative rate data for chlorine atom reactions. Theoretical calculations, using the BEBO method with tunneling, give excellent agreement with experiment.

Biochemical basis of type IB (E1beta ) mutations in maple syrup urine disease. A prevalent allele in patients from the Druze kindred in Israel.

PubMed

Wynn, R M; Chuang, J L; Sansaricq, C; Mandel, H; Chuang, D T

2001-09-28

Maple syrup urine disease (MSUD) is a metabolic disorder associated with often-fatal ketoacidosis, neurological derangement, and mental retardation. In this study, we identify and characterize two novel type IB MSUD mutations in Israeli patients, which affect the E1beta subunit in the decarboxylase (E1) component of the branched-chain alpha-ketoacid dehydrogenase complex. The recombinant mutant E1 carrying the prevalent S289L-beta (TCG --> TTG) mutation in the Druze kindred exists as a stable inactive alphabeta heterodimer. Based on the human E1 structure, the S289L-beta mutation disrupts the interactions between Ser-289-beta and Glu-290-beta', and between Arg-309-beta and Glu-290-beta', which are essential for native alpha(2)beta(2) heterotetrameric assembly. The R133P-beta (CGG --> CCG) mutation, on the other hand, is inefficiently expressed in Escherichia coli as heterotetramers in a temperature-dependent manner. The R133P-beta mutant E1 exhibits significant residual activity but is markedly less stable than the wild-type, as measured by thermal inactivation and free energy change of denaturation. The R133P-beta substitution abrogates the coordination of Arg-133-beta to Ala-95-beta, Glu-96-beta, and Ile-97-beta, which is important for strand-strand interactions and K(+) ion binding in the beta subunit. These findings provide new insights into folding and assembly of human E1 and will facilitate DNA-based diagnosis for MSUD in the Israeli population.

JAK and MPL mutations in myeloid malignancies.

PubMed

Tefferi, Ayalew

2008-03-01

The Janus family of non-receptor tyrosine kinases (JAK1, JAK2, JAK3 and tyrosine kinase 2) transduces signals downstream of type I and II cytokine receptors via signal transducers and activators of transcription (STATs). JAK3 is important in lymphoid and JAK2 in myeloid cell proliferation and differentiation. The thrombopoietin receptor MPL is one of several JAK2 cognate receptors and is essential for myelopoiesis in general and megakaryopoiesis in particular. Germline loss-of-function (LOF) JAK3 and MPL mutations cause severe combined immunodeficiency and congenital amegakaryocytic thrombocytopenia, respectively. Germline gain-of-function (GOF) MPL mutation (MPLS505N) causes familial thrombocytosis. Somatic JAK3 (e.g. JAK3A572V, JAK3V722I, JAK3P132T) and fusion JAK2 (e.g. ETV6-JAK2, PCM1-JAK2, BCR-JAK2) mutations have respectively been described in acute megakaryocytic leukemia and acute leukemia/chronic myeloid malignancies. However, current attention is focused on JAK2 (e.g. JAK2V617F, JAK2 exon 12 mutations) and MPL (e.g. MPLW515L/K/S, MPLS505N) mutations associated with myeloproliferative neoplasms (MPNs). A JAK2 mutation, primarily JAK2V617F, is invariably associated with polycythemia vera (PV). The latter mutation also occurs in the majority of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF). MPL mutational frequency in MPNs is substantially less (<10%). In general, despite a certain degree of genotype - phenotype correlations, the prognostic relevance of harbouring one of these mutations, or their allele burden when present, remains dubious. Regardless, based on the logical assumption that amplified JAK-STAT signalling is central to the pathogenesis of PV, ET and PMF, several anti-JAK2 tyrosine kinase inhibitors have been developed and are currently being tested in humans with these disorders.

Na(+) transport, and the E(1)P-E(2)P conformational transition of the Na(+)/K(+)-ATPase.

PubMed Central

Babes, A; Fendler, K

2000-01-01

We have used admittance analysis together with the black lipid membrane technique to analyze electrogenic reactions within the Na(+) branch of the reaction cycle of the Na(+)/K(+)-ATPase. ATP release by flash photolysis of caged ATP induced changes in the admittance of the compound membrane system that are associated with partial reactions of the Na(+)/K(+)-ATPase. Frequency spectra and the Na(+) dependence of the capacitive signal are consistent with an electrogenic or electroneutral E(1)P <--> E(2)P conformational transition which is rate limiting for a faster electrogenic Na(+) dissociation reaction. We determine the relaxation rate of the rate-limiting reaction and the equilibrium constants for both reactions at pH 6.2-8.5. The relaxation rate has a maximum value at pH 7.4 (approximately 320 s(-1)), which drops to acidic (approximately 190 s(-1)) and basic (approximately 110 s(-1)) pH. The E(1)P <--> E(2)P equilibrium is approximately at a midpoint position at pH 6.2 (equilibrium constant approximately 0.8) but moves more to the E(1)P side at basic pH 8.5 (equilibrium constant approximately 0.4). The Na(+) affinity at the extracellular binding site decreases from approximately 900 mM at pH 6.2 to approximately 200 mM at pH 8.5. The results suggest that during Na(+) transport the free energy supplied by the hydrolysis of ATP is mainly used for the generation of a low-affinity extracellular Na(+) discharge site. Ionic strength and lyotropic anions both decrease the relaxation rate. However, while ionic strength does not change the position of the conformational equilibrium E(1)P <--> E(2)P, lyotropic anions shift it to E(1)P. PMID:11053130

E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

PubMed

Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

2017-01-01

Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

PubMed Central

Lee, Ja Yil; Kim, D. S.

2009-01-01

Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K+ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K+ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K+ concentrations and longstanding folded states at high K+ concentrations. Several factors such as base-stacking interaction and K+ coordination are responsible for the different dynamics according to the mutation position. PMID:19359361

Extreme Ultraviolet Emission Spectrum of CO_2 Induced by Electron Impact at 200 eV

NASA Technical Reports Server (NTRS)

Kanik, I.; Ajello, J. M.; James, G. K.

1993-01-01

We present the extreme ultraviolet (EUV) emission spectrum of CO_2 induced by electronimpact at 200 eV. There are 36 spectral features which are identified with a resolution of 0.5 nmover the wavelength range of 40 to 125 nm. Absolute emission cross sections were obtained for eachof these features. The EUV emission spectrum induced by electron impact consist of atomicmultiplets of CI,II and OI,II,III as well as CO and CO^+ molecular band systems produced bydissociative excitation. The CI (119.4 nm) multiplet is the strongest feature of CI with a peak crosssection of 3.61 x 10^(-19) cm^2 at 200 eV. The strongest feature of OI in the EUV spectrum is theOI (99.0 nm) multiplet with a peak cross section of 3.59 x 10^(-19) cm^2 at 200 eV.

H3.1 K36M mutation in a congenital-onset soft tissue neoplasm.

PubMed

Kernohan, Kristin D; Grynspan, David; Ramphal, Raveena; Bareke, Eric; Wang, You Chang; Nizalik, Elizabeth; Ragoussis, Jiannis; Jabado, Nada; Boycott, Kym M; Majewski, Jacek; Sawyer, Sarah L

2017-12-01

We describe a patient who presented with a congenital soft tissue lesion initially diagnosed as infantile fibromatosis at 15 days of age. Unusually, the mass demonstrated malignant progression leading to death at 20 months of age. Biological progression to malignancy is not known to occur in fibromatosis, and fibrosarcoma is not known to progress from a benign lesion. Whole-exome sequencing of the tumor identified a driver mutation in histone H3.1 at lysine (K)36. Our findings support the link between oncohistones and infantile soft tissue tumors and provide additional evidence for the oncogenic effects of p.K36M in H3 variants. © 2017 Wiley Periodicals, Inc.

Location of aerodynamic noise sources from a 200 kW vertical-axis wind turbine

NASA Astrophysics Data System (ADS)

Ottermo, Fredric; Möllerström, Erik; Nordborg, Anders; Hylander, Jonny; Bernhoff, Hans

2017-07-01

Noise levels emitted from a 200 kW H-rotor vertical-axis wind turbine have been measured using a microphone array at four different positions, each at a hub-height distance from the tower. The microphone array, comprising 48 microphones in a spiral pattern, allows for directional mapping of the noise sources in the range of 500 Hz to 4 kHz. The produced images indicate that most of the noise is generated in a narrow azimuth-angle range, compatible with the location where increased turbulence is known to be present in the flow, as a result of the previous passage of a blade and its support arms. It is also shown that a semi-empirical model for inflow-turbulence noise seems to produce noise levels of the correct order of magnitude, based on the amount of turbulence that could be expected from power extraction considerations.

HSP27 expression in primary colorectal cancers is dependent on mutation of KRAS and PI3K/AKT activation status and is independent of TP53.

PubMed

Ghosh, Anil; Lai, Cecilia; McDonald, Sarah; Suraweera, Nirosha; Sengupta, Neel; Propper, David; Dorudi, Sina; Silver, Andrew

2013-02-01

Colorectal adenomas display features of senescence, but these are often lost upon progression to carcinoma, indicating that oncogene induced senescence (OIS) could be a roadblock in colorectal cancer (CRC) development. Heat shock proteins (HSPs) have been implicated in the prognosis of CRC and HSP based therapy is a current interest for drug development. Recent cell culture studies have suggested that in the absence of a TP53 mutation, OIS mediated by PI3K/AKT activation can be circumvented by high expression of HSPs. Furthermore, while PI3K/AKT activation and KRAS mutations are independent inducers of OIS, PI3K/AKT activation can suppress KRAS-induced OIS when both are present in cultured cells. As KRAS mutations, PI3K/AKT activation and TP53 mutations are all common features of CRC, it is possible that the requirement for HSP to inhibit OIS in CRC is dependent on the mutation spectrum of a tumour. However, work on HSP that utilised mutation profiled human tumour tissues has been limited. Here, we characterised the expression of two major HSP proteins (HSP27 and 72) by immunohistochemistry (IHC), the mutation status of TP53, KRAS and PIK3CA genes by direct sequencing and the activation status of AKT by IHC in a cohort of unselected primary CRC (n=74). We compare our data with findings generated from cell-based studies. Expression of HSP27 and HSP72 was correlated to clinicopathological and survival data but no significant association was found. We also established the mutation status of TP53, KRAS and PIK3CA genes and the activation status of AKT in our CRC panel. We did not detect any associations between HSP27 or HSP72 expression with TP53 mutation status. However, HSP27 expression in CRCs was strongly associated with the co-presence of wildtype KRAS and activated PI3K/AKT (p=0.004), indicating a possible role of HSP27 in overcoming PI3K/AKT induced OIS in tumours. Our studies suggest a role for using archival tissues in validating hypotheses generated from cell

Phenotypic variability in familial prion diseases due to the D178N mutation

PubMed Central

Zarranz, J; Digon, A; Atares, B; Rodriguez-Martine..., A; Arce, A; Carrera, N; Fernandez-Manchol..., I; Fernandez-Martine..., M; Fernandez-Maizteg..., C; Forcadas, I; Galdos, L; Gomez-Esteban, J; Ibanez, A; Lezcano, E; d Lopez; Marti-Masso, J; Mendibe, M; Urtasun, M; Uterga, J; Saracibar, N; Velasco, F; de Pancorbo, M M

2005-01-01

Background: Between January 1993 and December 2003, 19 patients with familial prion diseases due to the D178N mutation were referred to the regional epidemiological registry for spongiform encephalopathies in the Basque Country in Spain, a small community of some 2 100 000 inhabitants. Methods: Ten further patients belonging to the same pedigrees were retrospectively ascertained through neurological or neuropathological records. In four of the patients, the diagnosis was confirmed by analysing DNA obtained from paraffin blocks. In this article, we report on the clinical, genetic, and pathological features of the 23 patients carrying the D178N mutation confirmed by genetic molecular analysis. Haplotyping studies suggest a founder effect among Basque born families, explaining in part this unusually high incidence of the D178N mutation in a small community. Only two patients (8%) lack familial antecedents. Results: We have observed a phenotypic variability even among homozygous 129MM patients. Our findings challenge the currently accepted belief that MM homozygosity in codon 129 is always related to a fatal familial insomnia (FFI) phenotype. Indeed, seven out of 17 patients with a 129MM genotype in this series presented with a Creutzfeldt-Jakob disease (CJD) clinicopathological picture. Conclusions: The considerable clinical and pathological overlapping observed among homozygous 129MM patients favours the view that FFI and CJD178 are the extremes of a spectrum rather than two discrete and separate entities. Other genetic or environmental factors apart from the polymorphism in codon 129 may play a role in determining the phenotypic expression of the D178N mutation in the PRNP gene. PMID:16227536

Investigating the effects of tropomyosin mutations on its flexibility and interactions with filamentous actin using molecular dynamics simulation.

PubMed

Zheng, Wenjun; Hitchcock-DeGregori, Sarah E; Barua, Bipasha

2016-10-01

Tropomyosin (Tpm) is a two-chained α-helical coiled-coil protein that binds to filamentous actin (F-actin), and regulates its interactions with myosin by occupying three average positions on F-actin (blocked, closed, and open). Mutations in the Tpm are linked to heart diseases including hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM). To elucidate the molecular mechanisms of Tpm mutations (including DCM mutation E54K, HCM mutations E62Q, A63V, K70T, V95A, D175N, E180G, L185R, E192K, and a designed synthetic mutation D137L) in terms of their effects on Tpm flexibility and its interactions with F-actin, we conducted extensive molecular dynamics simulations for the wild-type and mutant Tpm in complex with F-actin (total simulation time 160 ns per mutant). The mutants exhibited distinct changes (i.e., increase or decrease) in the overall and local flexibility of the Tpm coiled-coil, with each mutation causing both local and long-range modifications of the Tpm flexibility. In addition, our binding calculations revealed weakened Tpm-F-actin interactions (except for L185R, D137L and A63V) involving five periods of Tpm, which correlate with elevated fluctuation of Tpm relative to the blocked position on F-actin that may lead to easier activation and increased Ca 2+ -sensitivity. We also simulated the αβ/βα-Tpm heterodimer in comparison with the αα-Tpm homodimer, which revealed greater flexibility and weaker actin binding in the heterodimer. Our findings are consistent with a complex mechanism underlying how different Tpm mutations perturb the Tpm function in distinct ways (e.g., by affecting specific sites of Tpm), which bear no simple links to the disease phenotypes (e.g., HCM vs. DCM).

Genetics of Prion Disease in Cattle

PubMed Central

Murdoch, Brenda M.; Murdoch, Gordon K.

2015-01-01

Bovine spongiform encephalopathy (BSE) is a prion disease that is invariably fatal in cattle and has been implicated as a significant human health risk. As a transmissible disease of livestock, it has impacted food safety, production practices, global trade, and profitability. Genetic polymorphisms that alter the prion protein in humans and sheep are associated with transmissible spongiform encephalopathy susceptibility or resistance. In contrast, there is no strong evidence that nonsynonymous mutations in the bovine prion gene (PRNP) are associated with classical BSE (C-BSE) disease susceptibility, though two bovine PRNP insertion/deletion polymorphisms, in the putative region, are associated with susceptibility to C-BSE. However, these associations do not explain the full extent of BSE susceptibility, and loci outside of PRNP appear to be associated with disease incidence in some cattle populations. This article provides a review of the current state of genetic knowledge regarding prion diseases in cattle. PMID:26462233

Mutational Analysis of Plant Cap-Binding Protein eIF4E Reveals Key Amino Acids Involved in Biochemical Functions and Potyvirus Infection▿

PubMed Central

German-Retana, Sylvie; Walter, Jocelyne; Doublet, Bénédicte; Roudet-Tavert, Geneviève; Nicaise, Valérie; Lecampion, Cécile; Houvenaghel, Marie-Christine; Robaglia, Christophe; Michon, Thierry; Le Gall, Olivier

2008-01-01

The eukaryotic translation initiation factor 4E (eIF4E) (the cap-binding protein) is involved in natural resistance against several potyviruses in plants. In lettuce, the recessive resistance genes mo11 and mo12 against Lettuce mosaic virus (LMV) are alleles coding for forms of eIF4E unable, or less effective, to support virus accumulation. A recombinant LMV expressing the eIF4E of a susceptible lettuce variety from its genome was able to produce symptoms in mo11 or mo12 varieties. In order to identify the eIF4E amino acid residues necessary for viral infection, we constructed recombinant LMV expressing eIF4E with point mutations affecting various amino acids and compared the abilities of these eIF4E mutants to complement LMV infection in resistant plants. Three types of mutations were produced in order to affect different biochemical functions of eIF4E: cap binding, eIF4G binding, and putative interaction with other virus or host proteins. Several mutations severely reduced the ability of eIF4E to complement LMV accumulation in a resistant host and impeded essential eIF4E functions in yeast. However, the ability of eIF4E to bind a cap analogue or to fully interact with eIF4G appeared unlinked to LMV infection. In addition to providing a functional mutational map of a plant eIF4E, this suggests that the role of eIF4E in the LMV cycle might be distinct from its physiological function in cellular mRNA translation. PMID:18480444

[The Influence of Rifampicin Resistant Mutations on the Biosynthesis of Exopolysaccharides by Strain Escherichia coli K-12 lon].

PubMed

Hovhannisyan, H G; Barseghyan, A H

2015-01-01

The influence of RNA polymerase (rif) mutations on the yield of capsular exopolysaccharide--colanic acid (CA) of Escherichia coli K-12 lon strain was studied. Five colanic acid isogenic producing strains were created by transduction transfer of rif alleles possessing pleiotropic effects. The obtained isogenic strains differed by specific growth rate, size and mucoidness of colonies, the dependence of growth on the medium composition and cultivation temperature, as well as by the adsorption rate of virulent bacteriophage M59, specifically lysing E. coli cells producing CA. Direct correlation between the yield of exopolysaccharides, growth rate and adsorption of bacteriophage M59 was revealed. Among rif recombinants strain AH203, which synthesized twice as much CA compared with the parental strain in submerged cultivation was selected.

Effects of missense mutations in sortase A gene on enzyme activity in Streptococcus mutans.

PubMed

Zhuang, P L; Yu, L X; Tao, Y; Zhou, Y; Zhi, Q H; Lin, H C

2016-04-11

Streptococcus mutans (S. mutans) is the major aetiological agent of dental caries, and the transpeptidase Sortase A (SrtA) plays a major role in cariogenicity. The T168G and G470A missense mutations in the srtA gene may be linked to caries susceptibility, as demonstrated in our previous studies. This study aimed to investigate the effects of these missense mutations of the srtA gene on SrtA enzyme activity in S. mutans. The point mutated recombinant S.mutans T168G and G470A sortases were expressed in expression plasmid pET32a. S. mutans UA159 sortase coding gene srtA was used as the template for point mutation. Enzymatic activity was assessed by quantifying increases in the fluorescence intensity generated when a substrate Dabcyl-QALPNTGEE-Edans was cleaved by SrtA. The kinetic constants were calculated based on the curve fit for the Michaelis-Menten equation. SrtA△N40(UA159) and the mutant enzymes, SrtA△N40(D56E) and SrtA△N40(R157H), were expressed and purified. A kinetic analysis showed that the affinity of SrtA△N40(D56E) and SrtA△N40(R157H) remained approximately equal to the affinity of SrtA△N40(UA159), as determined by the Michaelis constant (K m ). However, the catalytic rate constant (k cat ) and catalytic efficiency (k cat /K m ) of SrtA△N40(D56E) were reduced compared with those of SrtA△N40(R157H) and SrtA△N40(UA159), whereas the k cat and k cat /K m values of SrtA△N40(R157H) were slightly lower than those of SrtA△N40(UA159). The findings of this study indicate that the T168G missense mutation of the srtA gene results in a significant reduction in enzymatic activity compared with S. mutans UA159, suggesting that the T168G missense mutation of the srtA gene may be related to low cariogenicity.

Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity

NASA Astrophysics Data System (ADS)

Woods, Christopher J.; Malaisree, Maturos; Long, Ben; McIntosh-Smith, Simon; Mulholland, Adrian J.

2013-12-01

The emergence of a novel H7N9 avian influenza that infects humans is a serious cause for concern. Of the genome sequences of H7N9 neuraminidase available, one contains a substitution of arginine to lysine at position 292, suggesting a potential for reduced drug binding efficacy. We have performed molecular dynamics simulations of oseltamivir, zanamivir and peramivir bound to H7N9, H7N9-R292K, and a structurally related H11N9 neuraminidase. They show that H7N9 neuraminidase is structurally homologous to H11N9, binding the drugs in identical modes. The simulations reveal that the R292K mutation disrupts drug binding in H7N9 in a comparable manner to that observed experimentally for H11N9-R292K. Absolute binding free energy calculations with the WaterSwap method confirm a reduction in binding affinity. This indicates that the efficacy of antiviral drugs against H7N9-R292K will be reduced. Simulations can assist in predicting disruption of binding caused by mutations in neuraminidase, thereby providing a computational `assay.'

Prevalence of K13 mutation and Day-3 positive parasitaemia in artemisinin-resistant malaria endemic area of Cambodia: a cross-sectional study.

PubMed

Kheang, Soy Ty; Sovannaroth, Siv; Ek, Sovann; Chy, Say; Chhun, Phally; Mao, Sokkieng; Nguon, Sokomar; Lek, Dy Soley; Menard, Didier; Kak, Neeraj

2017-09-13

The presence of artemisinin-resistant malaria parasites was confirmed in western Cambodia in 2009. In 2013, mutations in the propeller domain of the kelch protein K13 was found to be associated with artemisinin resistance. A cross-sectional study was conducted to determine the prevalence of Day-3 parasitaemia, estimate the frequency of k13 molecular marker and assess their relationship in the context of operational research. Blood smears and filter paper blood spots were collected from febrile patients in Kravanh District, Pursat Province. The blood smears were examined by microscopy, and blood spots by a k13 mutation assay. Data from 92 patients were analysed. Only one was positive for Day-3 parasitaemia. Results of the k13 assay were interpretable for 76 of the 92 samples. The findings were: wild type: 9 (12%), C580Y: 64 (84%), Y493H: 3 (4%). Therefore, despite the high prevalence of k13 mutants (67/76: 88%), only 1 of the 92 patients remained blood smear positive for Plasmodium falciparum on Day-3. These preliminary findings suggest good potency of artemisinin despite the dominance of k13 mutation in Kravanh, but the result is not necessarily representative of the western part of Cambodia. Further investigation should be made to determine if k13 marker remains useful as a tool for tracking artemisinin resistance and predicting the trend of the efficacy of artemisinin combination therapy once the mutant alleles have been well established in the population.

Impact of disease-causing mutations on inter-domain interactions in cMyBP-C: a steered molecular dynamics study.

PubMed

Krishnamoorthy, Navaneethakrishnan; Gajendrarao, Poornima; Olivotto, Iacopo; Yacoub, Magdi

2017-07-01

The molecular interactions of the sarcomeric proteins are essential in the regulation of various cardiac functions. Mutations in the gene MYBPC3 coding for cardiac myosin-binding protein-C (cMyBP-C), a multi-domain protein, are the most common cause of hypertrophic cardiomyopathy (HCM). The N-terminal complex, C1-motif-C2 is a central region in cMyBP-C for the regulation of cardiac muscle contraction. However, the mechanism of binding/unbinding of this complex during health and disease is unknown. Here, we study possible mechanisms of unbinding using steered molecular dynamics simulations for the complex in the wild type, in single mutations (E258K in C1, E441K in C2), as well as in a double mutation (E258K in C1 + E441K in C2), which are associated with severe HCM. The observed molecular events and the calculation of force utilized for the unbinding suggest the following: (i) double mutation can encourage the formation of rigid complex that required large amount of force and long-time to unbind, (ii) C1 appears to start to unbind ahead of C2 regardless of the mutation, and (iii) unbinding of C2 requires larger amount of force than C1. This molecular insight suggests that key HCM-causing mutations might significantly modify the native affinity required for the assembly of the domains in cMyBP-C, which is essential for normal cardiac function.

Measurement of e+e-→K K ¯J /ψ cross sections at center-of-mass energies from 4.189 to 4.600 GeV

NASA Astrophysics Data System (ADS)

Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, P. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, S.; Gu, Y. T.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leiber, S.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, J. Q.; Li, Jin; Li, Kang; Li, Ke; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. M.; Liu, Huanhuan; Liu, Huihui; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Morello, G.; Muchnoi, N. Yu.; Muramatsu, H.; Musiol, P.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, J. J.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rong, G.; Rosner, Ch.; Ruan, X. D.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, Meng; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Zongyuan; Weber, T.; Wei, D. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, X.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Yang, Yifan; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhou, Y. X.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

2018-04-01

We investigate the process e+e-→K K ¯J /ψ at center-of-mass energies from 4.189 to 4.600 GeV using 4.7 fb-1 of data collected by the BESIII detector at the BEPCII collider. The Born cross sections for the reactions e+e-→K+K-J /ψ and KS0KS0J /ψ are measured as a function of center-of-mass energy. The energy dependence of the cross section for e+e-→K+K-J /ψ is shown to differ from that for π+π-J /ψ in the region around the Y (4260 ). In addition, there is evidence for a structure around 4.5 GeV in the e+e-→K+K-J /ψ cross section that is not present in π+π-J /ψ .

Safety and efficacy of vemurafenib in BRAF(V600E) and BRAF(V600K) mutation-positive melanoma (BRIM-3): extended follow-up of a phase 3, randomised, open-label study.

PubMed

McArthur, Grant A; Chapman, Paul B; Robert, Caroline; Larkin, James; Haanen, John B; Dummer, Reinhard; Ribas, Antoni; Hogg, David; Hamid, Omid; Ascierto, Paolo A; Garbe, Claus; Testori, Alessandro; Maio, Michele; Lorigan, Paul; Lebbé, Celeste; Jouary, Thomas; Schadendorf, Dirk; O'Day, Stephen J; Kirkwood, John M; Eggermont, Alexander M; Dréno, Brigitte; Sosman, Jeffrey A; Flaherty, Keith T; Yin, Ming; Caro, Ivor; Cheng, Suzanne; Trunzer, Kerstin; Hauschild, Axel

2014-03-01

In the BRIM-3 trial, vemurafenib was associated with risk reduction versus dacarbazine of both death and progression in patients with advanced BRAF(V600) mutation-positive melanoma. We present an extended follow-up analysis of the total population and in the BRAF(V600E) and BRAF(V600K) mutation subgroups. Patients older than 18 years, with treatment-naive metastatic melanoma and whose tumour tissue was positive for BRAF(V600) mutations were eligible. Patients also had to have a life expectancy of at least 3 months, an Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1, and adequate haematological, hepatic, and renal function. Patients were randomly assigned by interactive voice recognition system to receive either vemurafenib (960 mg orally twice daily) or dacarbazine (1000 mg/m(2) of body surface area intravenously every 3 weeks). Coprimary endpoints were overall survival and progression-free survival, analysed in the intention-to-treat population (n=675), with data censored at crossover. A sensitivity analysis was done. This trial is registered with ClinicalTrials.gov, NCT01006980. 675 eligible patients were enrolled from 104 centres in 12 countries between Jan 4, 2010, and Dec 16, 2010. 337 patients were randomly assigned to receive vemurafenib and 338 to receive dacarbazine. Median follow-up was 12·5 months (IQR 7·7-16·0) on vemurafenib and 9·5 months (3·1-14·7) on dacarbazine. 83 (25%) of the 338 patients initially randomly assigned to dacarbazine crossed over from dacarbazine to vemurafenib. Median overall survival was significantly longer in the vemurafenib group than in the dacarbazine group (13·6 months [95% CI 12·0-15·2] vs 9·7 months [7·9-12·8]; hazard ratio [HR] 0·70 [95% CI 0·57-0·87]; p=0·0008), as was median progression-free survival (6·9 months [95% CI 6·1-7·0] vs 1·6 months [1·6-2·1]; HR 0·38 [95% CI 0·32-0·46]; p<0·0001). For the 598 (91%) patients with BRAF(V600E) disease, median overall survival in

Clonal status of actionable driver events and the timing of mutational processes in cancer evolution

PubMed Central

McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C.; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

2015-01-01

Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal “actionable” mutations, including BRAF(V600E), IDH1(R132H), PIK3CA(E545K), EGFR(L858R), and KRAS(G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K(phosphatidylinositol 3-kinase)–AKT–mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS–MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTORsignaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. PMID:25877892

Clonal status of actionable driver events and the timing of mutational processes in cancer evolution.

PubMed

McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

2015-04-15

Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal "actionable" mutations, including BRAF (V600E), IDH1 (R132H), PIK3CA (E545K), EGFR (L858R), and KRAS (G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K (phosphatidylinositol 3-kinase)-AKT-mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS-MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTOR signaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. Copyright © 2015, American Association for the Advancement of Science.

Abnormal sleep architecture is an early feature in the E46K familial synucleinopathy.

PubMed

Zarranz, Juan J; Fernández-Bedoya, Anabel; Lambarri, Imanol; Gómez-Esteban, Juan C; Lezcano, Elena; Zamacona, Javier; Madoz, Pedro

2005-10-01

We examined 7 patients from a family harboring a novel mutation in the alpha-synuclein gene (E46K) that segregated with a phenotype of parkinsonism and dementia with Lewy bodies. An abnormal restless sleep was the presenting symptom in 2 of them. Polysomnographic (PSG) studies were performed in 4 of the 7 patients and in 2 asymptomatic carriers of the mutation. A severe loss of both rapid eye movement (REM) and non-REM sleep was observed in 2 patients complaining of insomnia and in a third parkinsonian member of the family who did not complain of trouble with sleeping. Another parkinsonian family member had a mild disorganization of the sleep architecture. The 2 asymptomatic carriers also had minor changes in the PSG findings. Episodes of bizarre behavior at night were reported historically in the 2 symptomatic patients, but we did not observed the behaviors during the PSG studies. REM sleep behavior disorder could not be recorded in any case. Our findings expand the spectrum of sleep disorders reported in synucleinopathies whether sporadic or familial. Copyright (c) 2005 Movement Disorder Society.

Child with RET proto-oncogene codon 634 mutation.

PubMed

İnce, Dilek; Demirağ, Bengü; Ataseven, Eda; Oymak, Yeşim; Tuhan, Hale; Karakuş, Osman Zeki; Hazan, Filiz; Abacı, Ayhan; Özer, Erdener; Mutafoglu, Kamer; Olgun, Nur

2017-01-01

İnce D, Demirağ B, Ataseven E, Oymak Y, Tuhan H, Karakuş OZ, Hazan F, Abacı A, Özer E, Mutafoglu K, Olgun N. Child with RET proto-oncogene codon 634 mutation. Turk J Pediatr 2017; 59: 590-593. Herein we reported a 7-year-old child with RET proto-oncogene c634 mutation. Her mother had been diagnosed with medullary thyroid carcinoma (MTC), and treated six years ago. Heterozygous mutation of the RET proto-oncogene at c634 had been detected in her mother. Genetic analysis showed the presence of the same mutation in our patient. Thyroid functions were normal. Serum calcitonin level was found mildly elevated. Parathormone (PTH) and carcinoembrionic antigen (CEA) levels were normal. Prophylactic thyroidectomy and sampling of cervical lymph nodes were performed. Histopathologic examination revealed hyperplasia in thyroid C cells, and reactive lymphadenopathy. The risk of MTC has been reported 100% through the life of patients with RET proto-oncogene mutation. It has been reported that particularly patients with c634 mutation have more risk of occurence of metastatic and progressive/recurrent MTC. Prophylactic `thyroidectomy, cervical lymph node dissection` before 5-years-of-age should be considered for these patients.

Detection of PIK3CA gene mutations with HRM analysis and association with IGFBP-5 expression levels in breast cancer.

PubMed

Dirican, Ebubekir; Kaya, Zehra; Gullu, Gokce; Peker, Irem; Ozmen, Tolga; Gulluoglu, Bahadir M; Kaya, Handan; Ozer, Ayse; Akkiprik, Mustafa

2014-01-01

Breast cancer is the second most common cancer and second leading cause of cancer deaths in women. Phosphatidylinositol-3-kinase (PI3K)/AKT pathway mutations are associated with cancer and phosphatidylinositol-4, 5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) gene mutations have been observed in 25-45% of breast cancer samples. Insulin growth factor binding protein-5 (IGFBP-5) can show different effects on apoptosis, cell motility and survival in breast cancer. We here aimed to determine the association between PIK3CA gene mutations and IGFBP-5 expressions for the first time in breast cancer patients. Frozen tumor samples from 101 Turkish breast cancer patients were analyzed with high resolution melting (HRM) for PIK3CA mutations (exon 9 and exon 20) and 37 HRM positive tumor samples were analyzed by DNA sequencing, mutations being found in 31. PIK3CA exon 9 mutations (Q546R, E542Q, E545K, E542K and E545D) were found in 10 tumor samples, exon 20 mutations (H1047L, H1047R, T1025T and G1049R) in 21, where only 1 tumor sample had two exon 20 mutations (T1025T and H1047R). Moreover, we detected one sample with both exon 9 (E542Q) and exon 20 (H1047R) mutations. 35% of the tumor samples with high IGFBP-5 mRNA expression and 29.4% of the tumor samples with low IGFBP-5 mRNA expression had PIK3CA mutations (p=0.9924). This is the first study of PIK3CA mutation screening results in Turkish breast cancer population using HRM analysis. This approach appears to be a very effective and reliable screening method for the PIK3CA exon 9 and 20 mutation detection. Further analysis with a greater number of samples is needed to clarify association between PIK3CA gene mutations and IGFBP-5 mRNA expression, and also clinical outcome in breast cancer patients.

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

PubMed Central

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

2013-01-01

Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

PubMed

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

2013-01-01

To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

Analysis of mutations in DNA gyrase and topoisomerase IV of Ureaplasma urealyticum and Ureaplasma parvum serovars resistant to fluoroquinolones.

PubMed

Piccinelli, Giorgio; Gargiulo, Franco; Biscaro, Valeria; Caccuri, Francesca; Caruso, Arnaldo; De Francesco, Maria Antonia

2017-01-01

This study aims to determine the prevalence of fluoroquinolone resistance of Ureaplasma biovars and serovars isolated from urogenital clinical samples and determine the underlying molecular mechanism for quinolone resistance for all resistant isolates. Of 105 samples confirmed as positive for U. urealyticum/U. parvum, 85 were resistant to quinolones by the Mycoplasma-IST2 kit. However, only 43 out of 85 quinolone resistant isolates had amino acid substitutions in GyrA, GyrB, ParC and ParE proteins underlining that this assay have mis-identified as fluoroquinolone resistant 42 isolates. The known ParC E87K and ParC S83L mutations were found in 1 and 10 isolates, respectively. An original mutation of ureaplasmal ParC (E87Q, 1 isolate) was found. Furthermore, we found a ParE R448K mutation in one isolate, already described. Among the additional alterations detected, the most prevalent mutation found was L176F in GyrA protein in 18 isolates with single infection and in 3 isolates with mixed ureaplasma infections. Mutations in GyrB (E502Q, 4 isolates), ParE (Q412K, Q412P, Q412T, 3 independent isolates), whose role is unknown, were also found. Other sporadic mutations in the four genes were identified. This investigation is the result of monitoring the data for molecular fluoroquinone resistance in Ureaplasma spp. in Italy. Resulting that this acquired resistance is high and that continued local epidemiological studies are essential to monitor and document their antimicrobial resistance trends. Copyright © 2016 Elsevier B.V. All rights reserved.

A 350 MHz, 200 kW CW, Multiple Beam Inductive Output Tube - Final Report