Prolonged evolution of virus-specific memory T cell immunity post severe avian influenza A (H7N9) virus infection.

PubMed

Zhao, Min; Chen, Junbo; Tan, Shuguang; Dong, Tao; Jiang, Hui; Zheng, Jiandong; Quan, Chuansong; Liao, Qiaohong; Zhang, Hangjie; Wang, Xiling; Wang, Qianli; Bi, Yuhai; Liu, Fengfeng; Feng, Luzhao; Horby, Peter W; Klenerman, Paul; Gao, George F; Liu, William J; Yu, Hongjie

2018-06-20

Since 2013, influenza A/H7N9 has emerged as the commonest avian influenza subtype causing human infection, and is associated with a high fatality risk. However, the characteristics of immune memory in patients who have recovered from H7N9 infection are not well understood. We assembled a cohort of forty-five H7N9 survivors followed for up to 15 months after infection. Humoral and cellular immune responses were analyzed in sequential samples obtained at 1.5-4 months, 6-8 months and 12-15 months post-infection. H7N9-specific antibody concentrations declined over time, and protective antibodies persisted longer in severely ill patients admitted to ICU and patients presenting with ARDS than that in patients with mild disease. Frequencies of virus-specific IFN-γ secreting T cells were lower in critically ill patients requiring ventilation than those in patients without ventilation within four months after infection. The percentages of H7N9-specific IFN-γ secreting T cells tended to increase over time in patients ≥60 years or critically ill patients requiring ventilation. Elevated levels of antigen-specific CD8 + T cells expressing lung-homing marker CD49a were observed at 6-8 months after H7N9 infection compared to samples obtained at 1.5-4 months. Our findings indicate the prolonged reconstruction and evolution of virus-specific T cell immunity in older or critically ill patients, and provide implications for T-cell directed immunization strategies. IMPORTANCE Avian influenza A H7N9 remains a major threat to public health. However, no previous studies have determined the characteristics and dynamics of virus specific T cell immune memory in patients who have recovered from H7N9 infection. Our findings showed that establishment of H7N9-specific T cell memory after H7N9 infection was prolonged in older and severely affected patients. Severely ill patients mounted lower T cell responses in the first 4 months after infection, while T cell responses tended to increase

Nanodiamond enhances immune responses in mice against recombinant HA/H7N9 protein.

PubMed

Pham, Ngoc Bich; Ho, Thuong Thi; Nguyen, Giang Thu; Le, Thuy Thi; Le, Ngoc Thu; Chang, Huan-Cheng; Pham, Minh Dinh; Conrad, Udo; Chu, Ha Hoang

2017-10-05

The continuing spread of the newly emerged H7N9 virus among poultry in China, as well as the possibility of human-to-human transmission, has attracted numerous efforts to develop an effective vaccine against H7N9. The use of nanoparticles in vaccinology is inspired by the fact that most pathogens have a dimension within the nano-size range and therefore can be processed efficiently by the immune system, which leads to a potent immune response. Herein, we report a facile approach to increase antigen size to achieve not only fast but also effective responses against the recombinant HA/H7N9 protein via a simple conjugation of the protein onto the surface of nanodiamond particles. In this study, trimeric Haemagglutinin (H7) that is transiently expressed in N. benthamiana was purified using affinity chromatography, and its trimeric state was revealed successfully by the cross-linking reaction. The trimeric H7 solution was subsequently mixed with a nanodiamond suspension in different ratios. The successful conjugation of the trimeric H7 onto the surface of nanodiamond particles was demonstrated by the changes in size and Zeta-potential of the particles before and after protein coating, Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and Western-blot analysis. Next, biofunction of the protein-nanodiamond conjugates was screened using a haemagglutination assay. A mixture containing 5 µg of trimeric H7 and 60 µg of nanodiamond corresponds to a ratio of 1:12 (w/w) of agglutinated chicken red blood cells at HA titer of 1024, which is 512-fold higher than the HA titer of free trimeric H7. After the 2nd and 3rd immunization in mice, ELISA and Western blot analyses demonstrated that the physical mixture of trimeric H7 protein and nanodiamond (1:12, w/w) elicited statistically significant stronger H7-specific-IgG response demonstrated by higher amounts of H7N9-specific IgG (over 15.4-fold with P < 0.05 after the second immunization). These results

Treatment with proteasome inhibitor bortezomib enhances antigen-specific CD8+ T cell-mediated antitumor immunity induced by DNA vaccination

PubMed Central

Tseng, Chih Wen; Monie, Archana; Wu, Chao-Yi; Huang, Bruce; Wang, Mei-Cheng; Hung, Chien-Fu; Wu, T.-C.

2008-01-01

There is an urgent need to develop new innovative therapies for the control of cancer. Antigen-specific immunotherapy and the employment of proteasome inhibitors have emerged as two potentially plausible approaches for the control of cancer. In the current study, we explored the combination of the DNA vaccine encoding calreticulin (CRT) linked to human papillomavirus type 16 (HPV-16) E7 antigen (CRT/E7) with the proteasome inhibitor; bortezomib for their ability to generate E7-specific immune responses and antitumor effects in vaccinated mice. We found that the combination of treatment with bortezomib and CRT/E7(detox) DNA generated more potent E7-specific CD8+ T cell immune responses and better therapeutic effects against TC-1 tumors in tumor bearing mice compared to monotherapy. Furthermore, we found that treatment with bortezomib led to increased apoptosis of TC-1 tumor cells and could render the TC-1 tumor cells more susceptible to lysis by E7-specific CTLs. Our data has significant implications for future clinical translation. PMID:18542898

Immunization of pregnant cows with Shiga toxin-2 induces high levels of specific colostral antibodies and lactoferrin able to neutralize E. coli O157:H7 pathogenicity.

PubMed

Albanese, Adriana; Sacerdoti, Flavia; Seyahian, E Abril; Amaral, Maria Marta; Fiorentino, Gabriela; Fernandez Brando, Romina; Vilte, Daniel A; Mercado, Elsa C; Palermo, Marina S; Cataldi, Angel; Zotta, Elsa; Ibarra, Cristina

2018-03-20

E. coli O157:H7 is a foodborne pathogen responsible for bloody diarrhea, hemorrhagic colitis and hemolytic uremic syndrome (HUS). The objective of the present work was to evaluate the ability of colostral IgG obtained from Stx2-immunized cows to prevent against E. coli O157:H7 infection and Stx2 cytotoxicity. Hyperimmune colostrum (HC) was obtained from cows intramuscularly immunized with inactivated Stx2 or vehicle for controls. Colostral IgG was purified by affinity chromatography. Specific IgG antibodies against Stx2 and bovine lactoferrin (bLF) levels in HC and the corresponding IgG (HC-IgG/bLF) were determined by ELISA. The protective effects of HC-IgG/bLF against Stx2 cytotoxicity and adhesion of E. coli O157:H7 and its Stx2-negative mutant were analyzed in HCT-8 cells. HC-IgG/bLF prevention against E. coli O157:H7 was studied in human colon and rat colon loops. Protection against a lethal dose of E. coli O157:H7 was evaluated in a weaned mice model. HC-IgG/bLF showed high anti-Stx2 titers and high bLF levels that were able to neutralize the cytotoxic effects of Stx2 in vitro and in vivo. Furthermore, HC-IgG/bLF avoided the inhibition of water absorption induced by E. coli O157:H7 in human colon and also the pathogenicity of E. coli O157:H7 and E. coli O157:H7Δstx2 in rat colon loops. Finally, HC-IgG/bLF prevented in a 100% the lethality caused by E. coli O157:H7 in a weaned mice model. Our study suggests that HC-IgG/bLF have protective effects against E. coli O157:H7 infection. These beneficial effects may be due to specific anti-Stx2 neutralizing antibodies in combination with high bLF levels. These results allow us to consider HC-IgG/bLF as a nutraceutical tool which could be used in combination with balanced supportive diets to prevent HUS. However further studies are required before recommendations can be made for therapeutic and clinical applications. Copyright © 2018 Elsevier Ltd. All rights reserved.

[Immune response in cervical cancer. Strategies for the development of therapeutic vaccines].

PubMed

Mora-García, María Lourdes; Monroy-García, Alberto

2015-01-01

High-risk human papillomaviruses (HR-HPV), as HPV-16, evade immune recognition through the inactivation of cells of the innate immune response. HPV-16 E6 and E7 genes down-regulate type I interferon response. They do not produce viremia or cell death; therefore, they do not cause inflammation or damage signal that alerts the immune system. Virus-like particles (VLPs), consisting of structural proteins (L1 and L2) of the main HR-HPV types that infect the genitourinary tract, are the most effective prophylactic vaccines against HR-HPV infection. While for the high grade neoplastic lesions, therapeutic vaccines based on viral vectors, peptides, DNA or complete HR-HPV E6 and E7 proteins as antigens, have had limited effectiveness. Chimeric virus-like particles (cVLPs) that carry immunogenic peptides derived from E6 and E7 viral proteins, capable to induce activation of specific cytotoxic T lymphocytes, emerge as an important alternative to provide prophylactic and therapeutic activity against HR-HPV infection and cervical cancer.

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

PubMed Central

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-01-01

BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

PubMed

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-12-01

Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

Plant-derived H7 VLP vaccine elicits protective immune response against H7N9 influenza virus in mice and ferrets.

PubMed

Pillet, S; Racine, T; Nfon, C; Di Lenardo, T Z; Babiuk, S; Ward, B J; Kobinger, G P; Landry, N

2015-11-17

In March 2013, the Chinese Centre for Disease Control and Prevention confirmed the first reported case of human infection with an avian influenza A H7N9 virus. Infection with this virus often caused severe pneumonia and acute respiratory distress syndrome resulting in a case fatality rate >35%. The risk of pandemic highlighted, once again, the need for a more rapid and scalable vaccine response capability. Here, we describe the rapid (19 days) development of a plant-derived VLP vaccine based on the hemagglutinin sequence of influenza H7N9 A/Hangzhou/1/2013. The immunogenicity of the H7 VLP vaccine was assessed in mice and ferrets after one or two intramuscular dose(s) with and without adjuvant (alum or GLA-SE™). In ferrets, we also measured H7-specific cell-mediated immunity. The mice and ferrets were then challenged with H7N9 A/Anhui/1/2013 influenza virus. A single immunization with the adjuvanted vaccine elicited a strong humoral response and protected mice against an otherwise lethal challenge. Two doses of unadjuvanted vaccine significantly increased humoral response and resulted in 100% protection with significant reduction of clinical signs leading to nearly asymptomatic infections. In ferrets, a single immunization with the alum-adjuvanted H7 VLP vaccine induced strong humoral and CMI responses with antigen-specific activation of CD3(+) T cells. Compared to animals injected with placebo, ferrets vaccinated with alum-adjuvanted vaccine displayed no weight loss during the challenge. Moreover, the vaccination significantly reduced the viral load in lungs and nasal washes 3 days after the infection. This candidate plant-made H7 vaccine therefore induced protective responses after either one adjuvanted or two unadjuvanted doses. Studies are currently ongoing to better characterize the immune response elicited by the plant-derived VLP vaccines. Regardless, these data are very promising for the rapid production of an immunogenic and protective vaccine against

Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.

PubMed

Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T

1999-06-01

Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.

Antibody response and maternal immunity upon boosting PRRSV-immune sows with experimental farm-specific and commercial PRRSV vaccines.

PubMed

Geldhof, Marc F; Van Breedam, Wander; De Jong, Ellen; Lopez Rodriguez, Alfonso; Karniychuk, Uladzimir U; Vanhee, Merijn; Van Doorsselaere, Jan; Maes, Dominiek; Nauwynck, Hans J

2013-12-27

The porcine reproductive and respiratory syndrome virus (PRRSV) causes reproductive failure in sows and respiratory disease in pigs of all ages. Despite the frequent use of vaccines to maintain PRRSV immunity in sows, little is known on how the currently used vaccines affect the immunity against currently circulating and genetically divergent PRRSV variants in PRRSV-immune sows, i.e. sows that have a pre-existing PRRSV-specific immunity due to previous infection with or vaccination against the virus. Therefore, this study aimed to assess the capacity of commercially available attenuated/inactivated PRRSV vaccines and autogenous inactivated PRRSV vaccines - prepared according to a previously optimized in-house protocol - to boost the antibody immunity against currently circulating PRRSV variants in PRRSV-immune sows. PRRSV isolates were obtained from 3 different swine herds experiencing PRRSV-related problems, despite regular vaccination of gilts and sows against the virus. In a first part of the study, the PRRSV-specific antibody response upon booster vaccination with commercial PRRSV vaccines and inactivated farm-specific PRRSV vaccines was evaluated in PRRSV-immune, non-pregnant replacement sows from the 3 herds. A boost in virus-neutralizing antibodies against the farm-specific isolate was observed in all sow groups vaccinated with the corresponding farm-specific inactivated vaccines. Use of the commercial attenuated EU type vaccine boosted neutralizing antibodies against the farm-specific isolate in sows derived from 2 farms, while use of the commercial attenuated NA type vaccine did not boost farm-specific virus-neutralizing antibodies in any of the sow groups. Interestingly, the commercial inactivated EU type vaccine boosted farm-specific virus-neutralizing antibodies in sows from 1 farm. In the second part of the study, a field trial was performed at one of the farms to evaluate the booster effect of an inactivated farm-specific vaccine and a commercial

Supplementation with Natural Forms of Vitamin E Augments Antigen-Specific TH1-Type Immune Response to Tetanus Toxoid

PubMed Central

Radhakrishnan, Ammu Kutty; Mahalingam, Dashayini; Selvaduray, Kanga Rani; Nesaretnam, Kalanithi

2013-01-01

This study compared the ability of three forms of vitamin E [tocotrienol-rich fraction (TRF), alpha-tocopherol (α-T), and delta-tocotrienol (δ-T3)] to enhance immune response to tetanus toxoid (TT) immunisation in a mouse model. Twenty BALB/c mice were divided into four groups of five mice each. The mice were fed with the different forms of vitamin E (1 mg) or vehicle daily for two weeks before they were given the TT vaccine [4 Lf] intramuscularly (i.m.). Booster vaccinations were given on days 28 and 42. Serum was collected (days 0, 28, and 56) to quantify anti-TT levels. At autopsy, splenocytes harvested were cultured with TT or mitogens. The production of anti-TT antibodies was augmented (P < 0.05) in mice that were fed with δ-T3 or TRF compared to controls. The production of IFN-γ and IL-4 by splenocytes from the vitamin E treated mice was significantly (P < 0.05) higher than that from controls. The IFN-γ production was the highest in animals supplemented with δ-T3 followed by TRF and finally α-T. Production of TNF-α was suppressed in the vitamin E treated group compared to vehicle-supplemented controls. Supplementation with δ-T3 or TRF can enhance immune response to TT immunisation and production of cytokines that promote cell-mediated (TH1) immune response. PMID:23936847

A Non-oncogenic HPV 16 E6/E7 Vaccine Enhances Treatment of HPV Expressing Tumors

PubMed Central

Wieking, Bryant G.; Vermeer, Daniel W.; Spanos, William C.; Lee, Kimberly M.; Vermeer, Paola; Lee, Walter T.; Xu, Younong; Gabitzsch, Elizabeth S.; Balcaitis, Stephanie; Balint, Joseph P.; Jones, Frank R.; Lee, John H.

2012-01-01

Human papillomaviruses (HPVs) are the causative factor for greater than 90% of cervical cancers and 25% of head and neck cancers. The incidence of HPV positive (+) head and neck squamous cell carcinomas (HNSCCs) has greatly increased in the last 30 years. E6 and E7 are the two key viral oncoproteins that induce and propagate cellular transformation. An immune response generated during cisplatin/radiation therapy improves tumor clearance of HPV(+) cancers. Augmenting this induced response during therapy with an adenoviral HPV16 E6/E7 vaccine improves long term survival in preclinical models. Here we describe the generation of an HPV16 E6/E7 construct, which contains mutations that render E6/E7 non-oncogenic, while preserving antigenicity. These mutations do not allow E6/E7 to degrade p53, pRb, PTPN13, or activate telomerase. Non-oncogenic E6/E7 (E6Δ/E7Δ) expressed as a stable integrant, or in the [E1-, E2b-] adenovirus, lacks the ability to transform human cells while retaining the ability to induce an HPV specific immune response. Moreover, E6Δ/E7Δ plus chemotherapy/radiation statistically enhances clearance of established HPV(+) cancer in vivo. PMID:22918471

Role of B7 costimulatory molecules in immune responses and T-helper cell differentiation in response to recombinant HagB from Porphyromonas gingivalis.

PubMed

Zhang, Ping; Martin, Michael; Yang, Qiu-Bo; Michalek, Suzanne M; Katz, Jannet

2004-02-01

In addition to antigen-specific signals mediated through the T-cell receptor, T cells also require antigen nonspecific costimulation for activation. The B7 family of molecules on antigen-presenting cells, which include B7-1 (CD80) and B7-2 (CD86), play important roles in providing costimulatory signals required for development of antigen-specific immune responses. Hemagglutinin B (HagB) is a nonfimbrial adhesin of the periodontopathic microorganism Porphyromonas gingivalis and is thought to be involved in the attachment of the bacterium to host tissues. However, the immune mechanisms involved in responses to HagB and their roles in pathogenesis have yet to be elucidated. Therefore, the purpose of this study was to determine the role of B7 costimulatory molecules on T-helper-cell differentiation for the induction of immune responses to HagB. Mice deficient in either or both of the costimulatory molecules B7-1 and B7-2 were used to explore their role in immune responses to HagB after subcutaneous immunization. B7-1(-/-) mice had levels of immunoglobulin G (IgG) anti-HagB antibody activity in serum similar to those of wild-type mice, whereas lower serum IgG anti-HagB antibody responses were seen in B7-2(-/-) mice. Moreover, significantly lower numbers of IgG antibody-secreting cells and lower levels of CD4(+)-T-cell proliferation were observed in B7-2(-/-) mice compared to wild-type mice. No serum IgG response to HagB was detected in B7-1/B7-2(-/-) mice. Analysis of the subclass of the serum IgG responses and the cytokines induced in response to HagB revealed that B7-2(-/-) mice had significantly lower IgG1 and higher IgG2a anti-HagB antibody responses compared to wild-type mice. The B7-2(-/-) mice also had significantly reduced levels of interleukin-4 (IL-4) and IL-5 and enhanced level of gamma interferon. Furthermore, assessment of B7-1 and B7-2 expression on B cells and macrophages derived from wild-type BALB/c mice after in vitro stimulation with HagB revealed a

Enhanced immunogenicity of HPV 16 E7 fusion proteins in DNA vaccination.

PubMed

Michel, Nico; Osen, Wolfram; Gissmann, Lutz; Schumacher, Ton N M; Zentgraf, Hanswalter; Müller, Martin

2002-03-01

DNA vaccination is a promising approach for inducing both humoral and cellular immune responses. For immunotherapy of HPV-16-associated diseases the E7 protein is considered a prime candidate, as it is expressed in all HPV-16-positive tumors. Unfortunately, the E7 protein is a very poor inducer of a cytotoxic T-cell response, when being used as antigen in DNA vaccination. Here we demonstrate that after fusion to protein export/import signals such as the herpes simplex virus ferry protein VP22, E7 can translocate in vitro from VP22-E7-expressing cells to neighboring cells that do not carry the VP22-E7 gene. In vivo, the VP22-E7 fusion shows significantly increased efficiency in inducing a cytotoxic T-cell response. Our data suggest that the export function of VP22 plays a major role in this phenomenon, since VP22 can be replaced by classical protein export signals, without impairing the induction of the E7-specific cellular immune response. However, all E7 fusion constructs showed significantly elevated protein steady-state levels, which might also account for the observed boost in immunogenicity. (C)2002 Elsevier Science (USA).

Complement is a central mediator of radiotherapy-induced tumor-specific immunity and clinical response.

PubMed

Surace, Laura; Lysenko, Veronika; Fontana, Andrea Orlando; Cecconi, Virginia; Janssen, Hans; Bicvic, Antonela; Okoniewski, Michal; Pruschy, Martin; Dummer, Reinhard; Neefjes, Jacques; Knuth, Alexander; Gupta, Anurag; van den Broek, Maries

2015-04-21

Radiotherapy induces DNA damage and cell death, but recent data suggest that concomitant immune stimulation is an integral part of the therapeutic action of ionizing radiation. It is poorly understood how radiotherapy supports tumor-specific immunity. Here we report that radiotherapy induced tumor cell death and transiently activated complement both in murine and human tumors. The local production of pro-inflammatory anaphylatoxins C3a and C5a was crucial to the tumor response to radiotherapy and concomitant stimulation of tumor-specific immunity. Dexamethasone, a drug frequently given during radiotherapy, limited complement activation and the anti-tumor effects of the immune system. Overall, our findings indicate that anaphylatoxins are key players in radiotherapy-induced tumor-specific immunity and the ensuing clinical responses. Copyright © 2015 Elsevier Inc. All rights reserved.

Giardia-specific cellular immune responses in post-giardiasis chronic fatigue syndrome.

PubMed

Hanevik, Kurt; Kristoffersen, Einar; Mørch, Kristine; Rye, Kristin Paulsen; Sørnes, Steinar; Svärd, Staffan; Bruserud, Øystein; Langeland, Nina

2017-01-28

The role of pathogen specific cellular immune responses against the eliciting pathogen in development of post-infectious chronic fatigue syndrome (PI-CFS) is not known and such studies are difficult to perform. The aim of this study was to evaluate specific anti-Giardia cellular immunity in cases that developed CFS after Giardia infection compared to cases that recovered well. Patients reporting chronic fatigue in a questionnaire study three years after a Giardia outbreak were clinically evaluated five years after the outbreak and grouped according to Fukuda criteria for CFS and idiopathic chronic fatigue. Giardia specific immune responses were evaluated in 39 of these patients by proliferation assay, T cell activation and cytokine release analysis. 20 Giardia exposed non-fatigued individuals and 10 healthy unexposed individuals were recruited as controls. Patients were clinically classified into CFS (n = 15), idiopathic chronic fatigue (n = 5), fatigue from other causes (n = 9) and recovered from fatigue (n = 10). There were statistically significant antigen specific differences between these Giardia exposed groups and unexposed controls. However, we did not find differences between the Giardia exposed fatigue classification groups with regard to CD4 T cell activation, proliferation or cytokine levels in 6 days cultured PBMCs. Interestingly, sCD40L was increased in patients with PI-CFS and other persons with fatigue after Giardia infection compared to the non-fatigued group, and correlated well with fatigue levels at the time of sampling. Our data show antigen specific cellular immune responses in the groups previously exposed to Giardia and increased sCD40L in fatigued patients.

Immunization with Brucella VirB Proteins Reduces Organ Colonization in Mice through a Th1-Type Immune Response and Elicits a Similar Immune Response in Dogs

PubMed Central

Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.

2014-01-01

VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276

Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

PubMed

Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

2015-03-01

VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Interleukin-7 in Patients With Chronic Hepatitis B May Have Effect on T Follicular Helper Cells and Specific Cellular Immunity.

PubMed

Zhong, Hua; Xibing, Gu; Yaping, Dai; Zheng, Wang; Decai, Fu; Xiaoye, Guo; Hangyuan, Wu; Dong, Wang; Zhonghua, Lu

2016-09-01

In patients with chronic hepatitis B (CHB), the relation of interkeukin-7 (IL-7) to either the T follicular helper cells (Tfh cells) or to a specific cellular immune response is not clear. The present study aims to explore the possible relationship of IL-7 to Tfh cells and to hepatitis B virus (HBV)-specific cellular immune response in patients with CHB. Ninety-one adult patients with CHB were divided into groups A, B, and C, according to the patients' IL-7 levels (low, medium, and high). Tfh cells and HBV-specific cytotoxic T lymphocytes (CTLs) were detected with flow cytometry; IL-7 and IL-21 were determined with a double antibody sandwich enzyme-linked immunosorbent assay; and HBV DNA was determined by using a real-time fluorescent quantitative polymerase chain reaction. The results showed that the levels of IL-7, Tfh cells, IL-21, and HBV-specific CTLs of patients in group C were significantly higher than those of patients in group B, (P < 0.01 for each comparison) and that the levels of these four parameters of patients in group B were significantly higher than those of the patients in group A (P < 0.01 for each comparison). Meanwhile, the level of HBV DNA of the patients in group C was significantly lower than that of the patients in group B (P < 0.01), and that of the patients in group B was significantly lower than that of the patients in group A (P < 0.05). Multiple linear regression analyses showed that IL-7, Tfh cells, IL-21, and HBV-specific CTL might have effects on HBV DNA and that only the HBV-specific CTL had an independent effect on HBV DNA (P < 0.01). IL-7, Tfh cells, and IL-21 showed independent effects on HBV-specific CTL (P < 0.05, P < 0.01, and P < 0.01). This study suggests that the IL-7 level of CHB patients may be related to Tfh cells. In CHB patients, IL-7 possibly increases the level of Tfh cells and HBV-specific cellular immune responses and thereby reduces the HBV DNA level.

Gelatin-specific humoral and cellular immune responses in children with immediate- and nonimmediate-type reactions to live measles, mumps, rubella, and varicella vaccines.

PubMed

Kumagai, T; Yamanaka, T; Wataya, Y; Umetsu, A; Kawamura, N; Ikeda, K; Furukawa, H; Kimura, K; Chiba, S; Saito, S; Sugawara, N; Kurimoto, F; Sakaguchi, M; Inouye, S

1997-07-01

This study was designed to investigate the development of both cellular and humoral immune responses to gelatin in patients with vaccine-related immediate and nonimmediate reactions. Our purpose was to define the nature of the responses in the different clinical states. Six patients with immediate reactions and 21 patients with nonimmediate reactions after inoculation of various live vaccines were studied. Measurement of gelatin-specific IgE was performed in all subjects. Gelatin-specific T-cell responses detected by an in vitro lymphocyte proliferation assay and by an assay for IL-2 responsiveness were investigated to compare the immune response in patients with the two types of reaction. All six patients with immediate reactions had IgE responses to gelatin, whereas none of the 21 patients with nonimmediate reactions had any anti-gelatin IgE. All of the six patients with immediate reactions and 17 of the 21 patients with nonimmediate reactions exhibited positive T-lymphocyte responses specific to gelatin. Immediate and nonimmediate reactions are caused by different types of allergy to gelatin, and cell-mediated immunity to gelatin may play an important role in the pathogenesis of nonimmediate reactions.

HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin

PubMed Central

Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago

2014-01-01

AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN

A novel ICOS-independent, but CD28- and SAP-dependent, pathway of T cell-dependent, polysaccharide-specific humoral immunity in response to intact Streptococcus pneumoniae versus pneumococcal conjugate vaccine

PubMed Central

Chen, Quanyi; Cannons, Jennifer L.; Paton, James C.; Akiba, Hisaya; Schwartzberg, Pamela L.; Snapper, Clifford M.

2010-01-01

Polysaccharide (PS)- and protein-specific murine IgG responses to intact Streptococcus pneumoniae (Pn) are both dependent upon CD4+ T cell help, B7-dependent costimulation, and CD40/CD40-ligand interactions. However, the primary PS-, relative to protein-specific, IgG response terminates more rapidly, requires a shorter period of T cell help and B7-dependent costimulation, and fails to generate memory. In light of the critical role for ICOS/ICOS-ligand interactions in sustaining T cell-dependent Ig responses and promoting germinal center reactions, we hypothesized that this interaction was non-essential for PS-specific IgG responses to Pn. We now demonstrate that ICOS-/-, relative to WT, mice elicit a normal PS-specific IgG isotype response to Pn, despite marked inhibition of both the primary and secondary IgG anti-protein (i.e. PspA, PspC, and PsaA) response. A blocking anti-ICOS-ligand mAb injected during primary Pn immunization inhibits both the primary anti-protein response and the generation of protein-specific memory, but has no effect when injected during secondary immunization. In contrast to Pn, both PS- and protein-specific IgG responses to a pneumococcal conjugate vaccine are inhibited in ICOS-/- mice. ICOS-/- mice immunized with intact Pn or conjugate exhibit nearly complete abrogation in germinal center formation. Finally, although mice that lack the adaptor molecule SAP resemble ICOS-/- mice (and can exhibit decreased ICOS expression), we observe that the PS-, as well as protein-specific IgG responses to both Pn and conjugate are markedly defective in SAP-/- mice. These data define a novel T cell-, SAP-, and B7-dependent, but ICOS-independent, extrafollicular pathway of Ig induction. PMID:19050242

Potent Cell-Intrinsic Immune Responses in Dendritic Cells Facilitate HIV-1-Specific T Cell Immunity in HIV-1 Elite Controllers.

PubMed

Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G

2015-06-01

The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.

Sex-specific consequences of an induced immune response on reproduction in a moth.

PubMed

Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

2015-12-16

Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

Specific memory B cell response and participation of CD4+ central and effector memory T cells in mice immunized with liposome encapsulated recombinant NE protein based Hepatitis E vaccine candidate.

PubMed

Kulkarni, Shruti P; Thanapati, Subrat; Arankalle, Vidya A; Tripathy, Anuradha S

2016-11-21

Liposome encapsulated neutralizing epitope protein of Hepatitis E virus (HEV), rNEp, our Hepatitis E vaccine candidate, was shown to be immunogenic and safe in pregnant and non-pregnant mice and yielded sterilizing immunity in rhesus monkeys. The current study in Balb/c mice assessed the levels and persistence of anti-HEV IgG antibodies by ELISA, frequencies of B, memory B, T and memory T cells by flow cytometry and HEV-specific IgG secreting memory B cells by ELISPOT till 420days post immunization (PI) with 5?g rNEp encapsulated in liposome based adjuvant (2 doses, 4weeks apart). Mice immunized with a lower dose (1?g) were assessed only for anamnestic response post booster dose. Vaccine candidate immunized mice (5?g dose) elicited strong anti-HEV IgG response that was estimated to persist for lifetime. At day 120 PI, frequency of memory B cells was higher in immunized mice than those receiving adjuvant alone. Anti-HEV IgG titers were lower in mice immunized with 1?g dose. A booster dose yielded a heightened antibody response in mice with both high (>800GMT, 5?g) and low (?100GMT, 1?g) anti-HEV IgG titers. At day 6th post booster dose, HEV-specific antibody secreting plasma cells (ASCs) were detected in 100% and 50% of mice with high and low anti-HEV IgG titers, respectively, whereas the frequencies of CD4 + central and effector memory T cells were high in mice with high anti-HEV IgG titers only. Taken together, the vaccine candidate effectively generates persistent and anamnestic antibody response, elicits participation of CD4 + memory T cells and triggers memory B cells to differentiate into ASCs upon boosting. This approach of assessing the immunogenicity of vaccine candidate could be useful to explore the longevity of HEV-specific memory response in future HEV vaccine trials in human. Copyright © 2016. Published by Elsevier Ltd.

Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

NASA Astrophysics Data System (ADS)

Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

1995-12-01

Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

PubMed

Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

2015-06-23

F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

Influence of a cocoa-enriched diet on specific immune response in ovalbumin-sensitized rats.

PubMed

Pérez-Berezo, Teresa; Ramiro-Puig, Emma; Pérez-Cano, Francisco J; Castellote, Cristina; Permanyer, Joan; Franch, Angels; Castell, Margarida

2009-03-01

Previous studies in young rats have reported the impact of 3 weeks of high cocoa intake on healthy immune status. The present article describes the effects of a longer-term cocoa-enriched diet (9 weeks) on the specific immune response to ovalbumin (OVA) in adult Wistar rats. At 4 weeks after immunization, control rats produced anti-OVA antibodies, which, according their amount and isotype, were arranged as follows: IgG1 > IgG2a > IgM > IgG2b > IgG2c. Both cocoa diets studied (4% and 10%) down-modulated OVA-specific antibody levels of IgG1 (main subclass associated with the Th2 immune response in rats), IgG2a, IgG2c and IgM isotypes. Conversely, cocoa-fed rats presented equal or higher levels of anti-OVA IgG2b antibodies (subclass linked to the Th1 response). Spleen and lymph node cells from OVA-immunized control and cocoa-fed animals proliferated similarly under OVA stimulation. However, spleen cells from cocoa-fed animals showed decreased interleukin-4 secretion (main Th2 cytokine), and lymph node cells from the same rats displayed higher interferon-gamma secretion (main Th1 cytokine). These changes were accompanied by a reduction in the number of anti-OVA IgG-secreting cells in spleen. In conclusion, cocoa diets induced attenuation of antibody synthesis that may be attributable to specific down-regulation of the Th2 immune response.

Polyomavirus Reactivation and Immune Responses to Kidney-Specific Self-Antigens in Transplantation.

PubMed

Seifert, Michael E; Gunasekaran, Muthukumar; Horwedel, Timothy A; Daloul, Reem; Storch, Gregory A; Mohanakumar, Thalachallour; Brennan, Daniel C

2017-04-01

Humoral immune responses against donor antigens are important determinants of long-term transplant outcomes. Reactivation of the polyomavirus BK has been associated with de novo antibodies against mismatched donor HLA antigens in kidney transplantation. The effect of polyomavirus reactivation (BK viremia or JC viruria) on antibodies to kidney-specific self-antigens is unknown. We previously reported excellent 5-year outcomes after minimization of immunosuppression for BK viremia and after no intervention for JC viruria. Here, we report the 10-year results of this trial ( n =193) along with a nested case-control study ( n =40) to explore associations between polyomavirus reactivation and immune responses to the self-antigens fibronectin (FN) and collagen type-IV (Col-IV). Consistent with 5-year findings, subjects taking tacrolimus, compared with those taking cyclosporin, had less acute rejection (11% versus 22%, P =0.05) and graft loss (9% versus 22%, P =0.01) along with better transplant function (eGFR 65±19 versus 50±24 ml/min per 1.73 m 2 , P <0.001) at 10 years. Subjects undergoing immunosuppression reduction for BK viremia had 10-year outcomes similar to those without viremia. In the case-control study, antibodies to FN/Col-IV were more prevalent during year 1 in subjects with polyomavirus reactivation than in those without reactivation (48% versus 11%, P= 0.04). Subjects with antibodies to FN/Col-IV had more acute rejection than did those without these antibodies (38% versus 8%, P =0.02). These data demonstrate the long-term safety and effectiveness of minimizing immunosuppression to treat BK viremia. Furthermore, these results indicate that polyomavirus reactivation associates with immune responses to kidney-specific self-antigens that may increase the risk for acute rejection through unclear mechanisms. Copyright © 2017 by the American Society of Nephrology.

Expression, Polyubiquitination, and Therapeutic Potential of Recombinant E6E7 from HPV16 Antigens Fused to Ubiquitin.

PubMed

de Oliveira, Liliane M Fernandes; Morale, Mirian G; Chaves, Agtha A M; Demasi, Marilene; Ho, Paulo L

2017-01-01

Ubiquitin-proteasome system plays an essential role in the immune response due to its involvement in the antigen generation and presentation to CD8 + T cells. Hereby, ubiquitin fused to antigens has been explored as an immunotherapeutic strategy that requires the activation of cytotoxic T lymphocytes. Here we propose to apply this ubiquitin fusion approach to a recombinant vaccine against human papillomavirus 16-infected cells. E6E7 multi-epitope antigen was fused genetically at its N- or C-terminal end to ubiquitin and expressed in Escherichia coli as inclusion bodies. The antigens were solubilized using urea and purified by nickel affinity chromatography in denatured condition. Fusion of ubiquitin to E6E7 resulted in marked polyubiquitination in vitro mainly when fused to the E6E7 N-terminal. When tested in a therapeutic scenario, the fusion of ubiquitin to E6E7 reinforced the anti-tumor protection and increased the E6/E7-specific cellular immune responses. Present results encourage the investigation of the adjuvant potential of the ubiquitin fusion to recombinant vaccines requiring CD8 + T cells.

Qualitative analysis of a stochastic epidemic model with specific functional response and temporary immunity

NASA Astrophysics Data System (ADS)

Hattaf, Khalid; Mahrouf, Marouane; Adnani, Jihad; Yousfi, Noura

2018-01-01

In this paper, we propose a stochastic delayed epidemic model with specific functional response. The time delay represents temporary immunity period, i.e., time from recovery to becoming susceptible again. We first show that the proposed model is mathematically and biologically well-posed. Moreover, the extinction of the disease and the persistence in the mean are established in the terms of a threshold value R0S which is smaller than the basic reproduction number R0 of the corresponding deterministic system.

Characterization of immune response to Eimeria tenella antigens in a natural immunity model with hosts which differ serologically at the B locus of the major histocompatibility complex.

PubMed Central

Brake, D A; Fedor, C H; Werner, B W; Miller, T J; Taylor, R L; Clare, R A

1997-01-01

A model to simulate natural immunity to Eimeria tenella was developed in three chicken lines which differ at the B locus of the major histocompatibility complex. Homozygous, 1-day-old chicks of the B19B19, B24B24, or B30B30 genotype were trickle immunized by being orally fed a small infectious dose of E. tenella oocysts for 5 consecutive days. These naturally exposed birds were then challenged at different times between 5 and 24 days after the final dose, and the level of protection was assessed 6 days after challenge, using body weight gain and intestinal lesion scores. The duration of immunity in naturally exposed birds differed among the major histocompatibility complex lines. Trickle immunization of the B19B19 haplotype afforded the longest and strongest level of protection compared to the other two haplotypes tested. In addition, in vitro splenic and peripheral blood lymphocyte proliferative responses in trickle-immunized birds were measured against sporozoite, merozoite, and tissue culture-derived E. tenella parasite antigens isolated from the recently described SB-CEV-1/F7 established cell line. The lymphocytes obtained from B19B19 birds trickle immunized responded in vitro to the E. tenella-infected SB-CEV-1/F7 tissue culture-derived parasite antigen. Furthermore, antigen-specific immune responses appeared earlier in immune, challenged B19B19 birds than in their naive, challenged counterparts. The development of a model simulating natural immunization will serve as a foundation to further characterize both humoral and cell-mediated responses to E. tenella tissue culture-derived parasite antigens and to better understand host protective immune responses to avian coccidiosis. PMID:9119452

Evaluation of the Immune Responses to and Cross-Protective Efficacy of Eurasian H7 Avian Influenza Viruses

PubMed Central

Kwon, Hyeok-Il; Kim, Young-Il; Park, Su-Jin; Song, Min-Suk; Kim, Eun-Ha; Kim, Se Mi; Si, Young-Jae; Lee, In-Won; Song, Byung-Min; Lee, Youn-Jeong; Yun, Seok Joong; Kim, Wun-Jae

2017-01-01

isolated in China since 2013. Due to the increasing concerns regarding the global public health risk posed by H7 viruses, we evaluated the genetic relationships between Eurasian H7 avian influenza viruses and the cross-protective efficacies of three different H7 viruses: W109/06 (group I), W478/14 (group II), and Anhui1/13 (a sublineage of group I). While each vaccine induced group-specific antibody responses and cross-protective efficacy, only Anhui1/13 was able to cross-protect immunized hosts against lethal challenge across groups. In fact, the Anhui1/13 virus induced not only cross-protection but also broad serum neutralizing antibody responses against both groups of viruses. This suggests that Anhui1/13-like H7N9 viruses may be viable vaccine candidates for broad protection against Eurasian H7 viruses. PMID:28331080

Evaluation of the Immune Responses to and Cross-Protective Efficacy of Eurasian H7 Avian Influenza Viruses.

PubMed

Kwon, Hyeok-Il; Kim, Young-Il; Park, Su-Jin; Song, Min-Suk; Kim, Eun-Ha; Kim, Se Mi; Si, Young-Jae; Lee, In-Won; Song, Byung-Min; Lee, Youn-Jeong; Yun, Seok Joong; Kim, Wun-Jae; Choi, Young Ki

2017-06-01

in China since 2013. Due to the increasing concerns regarding the global public health risk posed by H7 viruses, we evaluated the genetic relationships between Eurasian H7 avian influenza viruses and the cross-protective efficacies of three different H7 viruses: W109/06 (group I), W478/14 (group II), and Anhui1/13 (a sublineage of group I). While each vaccine induced group-specific antibody responses and cross-protective efficacy, only Anhui1/13 was able to cross-protect immunized hosts against lethal challenge across groups. In fact, the Anhui1/13 virus induced not only cross-protection but also broad serum neutralizing antibody responses against both groups of viruses. This suggests that Anhui1/13-like H7N9 viruses may be viable vaccine candidates for broad protection against Eurasian H7 viruses. Copyright © 2017 American Society for Microbiology.

Human Immune Response to Dengue Infections

DTIC Science & Technology

1989-07-31

antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8

Elicitation of strong immune responses by a DNA vaccine expressing a secreted form of hepatitis C virus envelope protein E2 in murine and porcine animal models

PubMed Central

Li, Yi-Ping; Kang, Hye Na; Babiuk, Lorne A; Liu, Qiang

2006-01-01

AIM: To characterize the immunogenicity of a hepatitis C virus (HCV) E2 DNA vaccine alone or with a protein vaccine boost in murine and porcine animal models. METHODS: A DNA vaccine expressing a secreted form of HCV E2 protein was constructed and used to vaccinate mice and piglets with or without boosting with a recombinant E2 protein vaccine formulated with CpG ODN and 10% Emulsigen. The immunogenicity of HCV E2 vaccines was analyzed by ELISA for antibody responses, MTT assay for lymphocyte proliferation, ELISPOT for the number of interferon-γ secreting cells, and cytotoxic T lymphocyte assays. RESULTS: Intradermal injection of E2 DNA vaccine induced strong Th1-like immune responses in mice. In piglets, E2 DNA vaccine elicited moderate and more balanced immune responses. A DNA vaccine prime and protein boost vaccination strategy induced significantly higher E2-specific antibody levels and shifted the immune response towards Th2-like ones in piglets. CONCLUSION: A DNA vaccine expressing a secreted form of HCV E2 protein elicited E2-specific immune responses in mice and piglets. Recombinant E2 protein vaccination following DNA immunization significantly increased the antibody response in piglets. These HCV E2 vaccines may represent promising hepatitis C vaccine candidates for further investigations. PMID:17131474

OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

PubMed

Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

2014-10-14

There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

PubMed Central

Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

2013-01-01

Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation.

PubMed

Godec, Jernej; Tan, Yan; Liberzon, Arthur; Tamayo, Pablo; Bhattacharya, Sanchita; Butte, Atul J; Mesirov, Jill P; Haining, W Nicholas

2016-01-19

Gene-expression profiling has become a mainstay in immunology, but subtle changes in gene networks related to biological processes are hard to discern when comparing various datasets. For instance, conservation of the transcriptional response to sepsis in mouse models and human disease remains controversial. To improve transcriptional analysis in immunology, we created ImmuneSigDB: a manually annotated compendium of ∼5,000 gene-sets from diverse cell states, experimental manipulations, and genetic perturbations in immunology. Analysis using ImmuneSigDB identified signatures induced in activated myeloid cells and differentiating lymphocytes that were highly conserved between humans and mice. Sepsis triggered conserved patterns of gene expression in humans and mouse models. However, we also identified species-specific biological processes in the sepsis transcriptional response: although both species upregulated phagocytosis-related genes, a mitosis signature was specific to humans. ImmuneSigDB enables granular analysis of transcriptomic data to improve biological understanding of immune processes of the human and mouse immune systems. Copyright © 2016 Elsevier Inc. All rights reserved.

Ubiquitin enzymes in the regulation of immune responses.

PubMed

Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo

2017-08-01

Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.

Overexpression of Interleukin-7 Extends the Humoral Immune Response Induced by Rabies Vaccination.

PubMed

Li, Yingying; Zhou, Ming; Luo, Zhaochen; Zhang, Yachun; Cui, Min; Chen, Huanchun; Fu, Zhen F; Zhao, Ling

2017-04-01

Rabies continues to present a public health threat in most countries of the world. The most efficient way to prevent and control rabies is to implement vaccination programs for domestic animals. However, traditional inactivated vaccines used in animals are costly and have relatively low efficiency, which impedes their extensive use in developing countries. There is, therefore, an urgent need to develop single-dose and long-lasting rabies vaccines. However, little information is available regarding the mechanisms underlying immunological memory, which can broaden humoral responses following rabies vaccination. In this study, a recombinant rabies virus (RABV) that expressed murine interleukin-7 (IL-7), referred to here as rLBNSE-IL-7, was constructed, and its effectiveness was evaluated in a mouse model. rLBNSE-IL-7 induced higher rates of T follicular helper (Tfh) cells and germinal center (GC) B cells from draining lymph nodes (LNs) than the parent virus rLBNSE. Interestingly, rLBNSE-IL-7 improved the percentages of long-lived memory B cells (Bmem) in the draining LNs and plasma cells (PCs) in the bone marrow (BM) for up to 360 days postimmunization (dpi). As a result of the presence of the long-lived PCs, it also generated prolonged virus-neutralizing antibodies (VNAs), resulting in better protection against a lethal challenge than that seen with rLBNSE. Moreover, consistent with the increased numbers of Bmem and PCs after a boost with rLBNSE, rLBNSE-IL-7-immunized mice promptly produced a more potent secondary anti-RABV neutralizing antibody response than rLBNSE-immunized mice. Overall, our data suggest that overexpressing IL-7 improved the induction of long-lasting primary and secondary antibody responses post-RABV immunization. IMPORTANCE Extending humoral immune responses using adjuvants is an important method to develop long-lasting and efficient vaccines against rabies. However, little information is currently available regarding prolonged immunological

Helminth Allergens, Parasite-Specific IgE, and Its Protective Role in Human Immunity

PubMed Central

Fitzsimmons, Colin Matthew; Falcone, Franco Harald; Dunne, David William

2014-01-01

The Th2 immune response, culminating in eosinophilia and IgE production, is not only characteristic of allergy but also of infection by parasitic worms (helminths). Anti-parasite IgE has been associated with immunity against a range of helminth infections and many believe that IgE and its receptors evolved to help counter metazoan parasites. Allergens (IgE-antigens) are present in only a small minority of protein families and known IgE targets in helminths belong to these same families (e.g., EF-hand proteins, tropomyosin, and PR-1 proteins). During some helminth infection, especially with the well adapted hookworm, the Th2 response is moderated by parasite-expressed molecules. This has been associated with reduced allergy in helminth endemic areas and worm infection or products have been proposed as treatments for allergic conditions. However, some infections (especially Ascaris) are associated with increased allergy and this has been linked to cross-reactivity between worm proteins (e.g., tropomyosins) and highly similar molecules in dust-mites and insects. The overlap between allergy and helminth infection is best illustrated in Anisakis simplex, a nematode that when consumed in under-cooked fish can be both an infective helminth and a food allergen. Nearly 20 molecular allergens have been isolated from this species, including tropomyosin (Ani s 3) and the EF-hand protein, Ani s troponin. In this review, we highlight aspects of the biology and biochemistry of helminths that may have influenced the evolution of the IgE response. We compare dominant IgE-antigens in worms with clinically important environmental allergens and suggest that arrays of such molecules will provide important information on anti-worm immunity as well as allergy. PMID:24592267

Pineal-adrenal-immune system relationship under thermal stress: effect on physiological, endocrine, and non-specific immune response in goats.

PubMed

Sejian, Veerasamy; Srivastava, Rajendra Swaroop

2010-12-01

The purpose of the investigation was to observe the pineal-adrenal-immune system relationships and their influence on non-specific immune response in female goats under short-term thermal stress. Six female goats had been exposed to 40°C and 60% relative humidity in the psychrometric chamber for 17 days. Blood samples were obtained on days 0 and 10 to establish control and thermal stress effects, respectively. Chemical adrenalectomy was achieved by injecting metyrapone (100 mg/kg body weight) followed by exogenous melatonin treatment (0.1 mg/kg body weight) from 11th to 17th day of experiment. Thermal stress significantly (P≤0.05) altered the physiological responses. Metyrapone and melatonin treatment significantly (P≤0.05) reduced the thermal-stress-induced increase in plasma concentrations of cortisol and corticosterone while significantly (P≤0.05) increased the plasma melatonin on days 11 and 17. Furthermore, these treatments significantly (P<0.05) increased the phagocytic activity of neutrophils as compared to both control and thermal exposure values from 11-17 days of experiment. The data generated from this study help us to understand the functional relationship between pineal, adrenal, and immune system, and how this relationship modifies the non-specific immune response for the well being of goats during thermal stress.

Host Immune Status and Response to Hepatitis E Virus Infection

PubMed Central

Krain, Lisa J.; Nelson, Kenrad E.

2014-01-01

SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140

Ubiquitin enzymes in the regulation of immune responses

PubMed Central

Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo

2017-01-01

Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749

Stressor-Specific Alterations in Corticosterone and Immune Responses in Mice

PubMed Central

Bowers, Stephanie L.; Bilbo, Staci D.; Dhabhar, Firdaus S.; Nelson, Randy J.

2007-01-01

Different stressors likely elicit different physiological and behavioral responses. Previously reported differences in the effects of stressors on immune function may reflect qualitatively different physiological responses to stressors; alternatively, both large and subtle differences in testing protocols and methods among laboratories may make direct comparisons among studies difficult. Here we examine the effects of chronic stressors on plasma corticosterone concentrations, leukocyte redistribution, and skin delayed-type hypersensitivity (DTH) and the effects of acute stressors on plasma corticosterone and leukocyte redistribution. The effects of several commonly used laboratory stressors including restraint, forced swim, isolation, and low ambient temperatures (4°C) were examined. Exposure to each stressor elevated corticosterone concentrations, with restraint (a putative psychological stressor) evoking a significantly higher glucocorticoid response than other stressors. Chronic restraint and forced swim enhanced the DTH response compared to the handled, low temperature, or isolation conditions. Restraint, low temperature, and isolation significantly increased trafficking of lymphocytes and monocytes compared to forced swim or handling. Generally, acute restraint, low temperature, isolation, and handling increased trafficking of lymphocytes and monocytes. Considered together, our results suggest that the different stressors commonly used in psychoneuroimmunology research may not activate the physiological stress response to the same extent. The variation observed in the measured immune responses may reflect differential glucocorticoid activation, differential metabolic adjustments, or both processes in response to specific stressors. PMID:17890050

Humoral and cellular immune response in mice induced by the classical swine fever virus E2 protein fused to the porcine CD154 antigen.

PubMed

Sordo, Yusmel; Suárez, Marisela; Caraballo, Rosalina; Sardina, Talía; Brown, Emma; Duarte, Carlos; Lugo, Joanna; Gil, Lázaro; Perez, Danny; Oliva, Ayme; Vargas, Milagros; Santana, Elaine; Valdés, Rodolfo; Rodríguez, María Pilar

2018-03-01

The development of subunit vaccines against classical swine fever is a desirable goal, because it allows discrimination between vaccinated and infected animals. In this study, humoral and cellular immune response elicited in inbred BALB/c mice by immunization with a recombinant classical swine fever virus (CSFV) E2 protein fused to porcine CD154 antigen (E2CD154) was assessed. This model was used as a predictor of immune response in swine. Mice were immunized with E2CD154 emulsified in Montanide ISA50V2 or dissolved in saline on days 1 and 21. Another group received E2His antigen, without CD154, in the same adjuvant. Montanide ISA50V2 or saline served as negative controls for each experimental group. Animals immunized with 12.5 and 2.5 μg/dose of E2CD154 developed the highest titers (>1:2000) of CSFV neutralizing antibodies. Moreover, CSFV specific splenocyte gamma-interferon production, measured after seven and twenty-eight days of immunization, was significantly higher in mice immunized with 12.5 μg of E2CD154. As a conclusion, E2CD154 emulsified in Montanide ISA50 V2 was able to induce a potent humoral and an early cellular immune response in inbred BALB/c mice. Therefore, this immunogen might be an appropriate candidate to elicit immune response in swine, control CSF disease and to eliminate CSFV in swine. Copyright © 2018 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Parasite-specific immune response in adult Drosophila melanogaster: a genomic study

PubMed Central

Roxström-Lindquist, Katarina; Terenius, Olle; Faye, Ingrid

2004-01-01

Insects of the order Diptera are vectors for parasitic diseases such as malaria, sleeping sickness and leishmania. In the search for genes encoding proteins involved in the antiparasitic response, we have used the protozoan parasite Octosporea muscaedomesticae for oral infections of adult Drosophila melanogaster. To identify parasite-specific response molecules, other flies were exposed to virus, bacteria or fungi in parallel. Analysis of gene expression patterns after 24 h of microbial challenge, using Affymetrix oligonucleotide microarrays, revealed a high degree of microbe specificity. Many serine proteases, key intermediates in the induction of insect immune responses, were uniquely expressed following infection of the different organisms. Several lysozyme genes were induced in response to Octosporea infection, while in other treatments they were not induced or downregulated. This suggests that lysozymes are important in antiparasitic defence. PMID:14749722

Glove-derived foreign proteins induce allergen-specific IgE in a mouse model.

PubMed

Busch, Marion; Schröder, Claudia; Baron, Jens-Malte; Ott, Hagen; Bruckner, Thomas; Diepgen, Thomas L; Mahler, Vera

2008-04-01

Currently, most medical gloves are produced with a low content of natural rubber latex (NRL) protein. However, they may be substituted by proteins of foreign origin to maintain specific properties of the material. The aim of this study was to investigate the allergenicity and immunogenicity of unexpected proteins (i.e., soy and casein) compared with NRL proteins in a murine model in BALB/c mice. All respective allergen sources (extracts from three brands of NRL gloves, soy, and casein) were able to induce significant allergen-specific IgE and IgG(1) responses. On average, the highest IgE induction occurred after immunization with NRL, followed by soy and casein. Certain individuals from each treatment group exhibited levels of specific IgE as high as due to NRL. To analyze further specific IgE responses on a single allergen level, we established a microarray based on recombinant allergens for allergen-specific murine IgE detection. Besides specific IgE against rHev b 3, -6, -7, -8, and -11, specific IgE against kappa-casein could be detected in mice immunized with NRL glove extract, indicating a sensitization potential of the contained foreign protein. The substitution of genuine latex proteins by proteins of foreign origin may lead to a shift and de novo increase in sensitization to the finished products.

Manipulating the antigen-specific immune response by the hydrophobicity of amphiphilic poly(γ-glutamic acid) nanoparticles.

PubMed

Shima, Fumiaki; Akagi, Takami; Uto, Tomofumi; Akashi, Mitsuru

2013-12-01

The new generation vaccines are safe but poorly immunogenic, and thus they require the use of adjuvants. However, conventional vaccine adjuvants fail to induce potent cellular immunity, and their toxicity and side-effects hinder the clinical use. Therefore, a vaccine adjuvant which is safe and can induce an antigen-specific cellular immunity-biased immune response is urgently required. In the development of nanoparticle-based vaccine adjuvants, the hydrophobicity is one of the most important factors. It could control the interaction between the encapsulated antigens and/or nanoparticles with immune cells. In this study, nanoparticles (NPs) composed of amphiphilic poly(γ-glutamic acid)-graft-L-phenylalanine ethyl ester (γ-PGA-Phe) with various grafting degrees of hydrophobic side chains were prepared to evaluate the effect of hydrophobicity of vaccine carriers on the antigen encapsulation behavior, cellular uptake, activation of dendritic cells (DCs), and induction of antigen-specific cellular immunity-biased immune responses. These NPs could efficiently encapsulate antigens, and the uptake amount of the encapsulated antigen by DCs was dependent on the hydrophobicity of γ-PGA-Phe NPs. Moreover, the activation potential of the DCs and the induction of antigen-specific cellular immunity were correlated with the hydrophobicity of γ-PGA-Phe NPs. By controlling the hydrophobicity of antigen-encapsulated γ-PGA-Phe NPs, the activation potential of DCs was able to manipulate about 5 to 30-hold than the conventional vaccine, and the cellular immunity was about 10 to 40-hold. These results suggest that the hydrophobicity of NPs is a key factor for changing the interaction between NPs and immune cells, and thus the induction of cellular immunity-biased immune response could be achieved by controlling the hydrophobicity of them. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effects of traditional medical herbs "minor bupleurum decoction" on the non-specific immune responses of white shrimp (Litopenaeus vannamei).

PubMed

Wu, Yu-Sheng; Lee, Meng-Chou; Huang, Cheng-Ting; Kung, Tzu-Chi; Huang, Chih-Yang; Nan, Fan-Hua

2017-05-01

This study is investigating the effect of minor bupleurum decoction (Xiao-Chai-Hu decoction) on the non-specific immune response of white shrimp (Litopenaeus vannamei). To determine prophenoloxidase activity (proPO), reactive oxygen species production (ROS), superoxide anion production (O 2 - ), nitric oxide production (NO), phagocytic rate (PR), phagocytic index (PI), superoxide dismutase activity (SOD), total haemocyte count (THC) and differential haemocyte count (DHC). In this experiment, treating with different dosages (0, 0.25, 0.5 and, 1%) of minor bupleurum decoction to detect immune parameters on day 0, 1, 2, 4, 7, 14, 21 and 28. Result is shown that 0.25% treatment significantly enhanced the superoxide dismutase (SOD) activity and, 0.25 and 1% treatment significantly increased the ROS production, nitric oxide (NO) production and phagocytic rate (PR) moreover, 0.5 and 1% treatment induced the proPO activity and superoxide anion (O 2 - ) production. Evidence exactly indicated that minor bupleurum decoction is able to enhance the non-specific immunity responses of white shrimp via in vivo examination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Enhanced humoural and cellular immune responses to influenza H7N9 antigen HA1-2 fused with flagellin in chickens.

PubMed

Song, Li; Xiong, Dan; Hu, Maozhi; Kang, Xilong; Pan, Zhiming; Jiao, Xinan

2017-06-21

Sudden increases in the number of human A (H7N9) cases reported during December and January have been observed in previous years. Most reported infection cases are due to prior exposure to live poultry or potentially contaminated environments. Low pathogenicity of influenza A (H7N9) virus in avian species complicates timely discovery of infected birds. Therefore, there is a pressing need to develop safe and effective anti-H7N9 vaccines for poultry to reduce the risk of human infection and prevent the emergence of novel mutated strains. In addition to a good antigen, an effective vaccine also requires an appropriate adjuvant to enhance its immunogenicity. Previously, we generated an H7N9 influenza recombinant subunit vaccine (HA1-2-fliC), in which haemagglutinin globular head domain (HA1-2) was fused with flagellin (fliC), a potent TLR5 ligand, and demonstrated that HA1-2-fliC elicited effective HA1-2-specific immune responses in mice. In this study, we determined flagellin-induced expression profiles of cytokines and chemokines in different types of avian immune cells in vitro and ex vivo. We found that flagellin significantly increased the expression levels of CXCL inflammatory chemokines (CXCLi1 and CXCLi2) and CCL chemokines (MIP-1β and MCP-3) in avian macrophage HD11 cells. In addition, HA1-2-fliC induced significant upregulation of cytokines (IL-1β, IL-6, IL-18 and IFN-γ) and chemokines (CXCLi1, CXCLi2 and MIP-1β) in ex vivo splenic lymphocytes and peripheral blood mononuclear cells (PBMCs), suggesting that flagellin promoted immune responses of avian cells in vitro. We also evaluated specific humoural and cellular immune responses induced by HA1-2-fliC and found that chickens immunised intramuscularly with HA1-2-fliC showed significantly higher HA1-2-specific immunoglobulin (Ig)G titers in serum. Furthermore, HA1-2-fliC potentiated cellular immune responses, as reflected by an increase in CD4 + and CD8 + T cells and proliferation of PBMCs. Significantly

Profiling Humoral Immune Responses to Clostridium difficile-Specific Antigens by Protein Microarray Analysis

PubMed Central

Negm, Ola H.; Hamed, Mohamed R.; Dilnot, Elizabeth M.; Shone, Clifford C.; Marszalowska, Izabela; Lynch, Mark; Loscher, Christine E.; Edwards, Laura J.; Tighe, Patrick J.; Wilcox, Mark H.

2015-01-01

Clostridium difficile is an anaerobic, Gram-positive, and spore-forming bacterium that is the leading worldwide infective cause of hospital-acquired and antibiotic-associated diarrhea. Several studies have reported associations between humoral immunity and the clinical course of C. difficile infection (CDI). Host humoral immune responses are determined using conventional enzyme-linked immunosorbent assay (ELISA) techniques. Herein, we report the first use of a novel protein microarray assay to determine systemic IgG antibody responses against a panel of highly purified C. difficile-specific antigens, including native toxins A and B (TcdA and TcdB, respectively), recombinant fragments of toxins A and B (TxA4 and TxB4, respectively), ribotype-specific surface layer proteins (SLPs; 001, 002, 027), and control proteins (tetanus toxoid and Candida albicans). Microarrays were probed with sera from a total of 327 individuals with CDI, cystic fibrosis without diarrhea, and healthy controls. For all antigens, precision profiles demonstrated <10% coefficient of variation (CV). Significant correlation was observed between microarray and ELISA in the quantification of antitoxin A and antitoxin B IgG. These results indicate that microarray is a suitable assay for defining humoral immune responses to C. difficile protein antigens and may have potential advantages in throughput, convenience, and cost. PMID:26178385

Tattoo Delivery of a Semliki Forest Virus-Based Vaccine Encoding Human Papillomavirus E6 and E7.

PubMed

van de Wall, Stephanie; Walczak, Mateusz; van Rooij, Nienke; Hoogeboom, Baukje-Nynke; Meijerhof, Tjarko; Nijman, Hans W; Daemen, Toos

2015-03-24

The skin is an attractive organ for immunization because of the presence of antigen-presenting cells. Intradermal delivery via tattooing has demonstrated superior vaccine immunogenicity of DNA vaccines in comparison to conventional delivery methods. In this study, we explored the efficacy of tattoo injection of a tumor vaccine based on recombinant Semliki Forest virus replicon particles (rSFV) targeting human papillomavirus (HPV). Tattoo injection of rSFV particles resulted in antigen expression in both the skin and draining lymph nodes. In comparison with intramuscular injection, the overall antigen expression determined at the site of administration and draining lymph nodes was 10-fold lower upon tattoo injection. Delivery of SFV particles encoding the E6 and E7 antigens of human papillomavirus type 16 (SFVeE6,7) via tattooing resulted in HPV-specific cytotoxic T cells and in vivo therapeutic antitumor response. Strikingly, despite the observed lower overall transgene expression, SFVeE6,7 delivered via tattoo injection resulted in higher or equal levels of immune responses as compared to intramuscular injection. The intrinsic immunogenic potential of tattooing provides a benefit for immunotherapy based on an alphavirus.

Tattoo Delivery of a Semliki Forest Virus-Based Vaccine Encoding Human Papillomavirus E6 and E7

PubMed Central

van de Wall, Stephanie; Walczak, Mateusz; van Rooij, Nienke; Hoogeboom, Baukje-Nynke; Meijerhof, Tjarko; Nijman, Hans W.; Daemen, Toos

2015-01-01

The skin is an attractive organ for immunization because of the presence of antigen-presenting cells. Intradermal delivery via tattooing has demonstrated superior vaccine immunogenicity of DNA vaccines in comparison to conventional delivery methods. In this study, we explored the efficacy of tattoo injection of a tumor vaccine based on recombinant Semliki Forest virus replicon particles (rSFV) targeting human papillomavirus (HPV). Tattoo injection of rSFV particles resulted in antigen expression in both the skin and draining lymph nodes. In comparison with intramuscular injection, the overall antigen expression determined at the site of administration and draining lymph nodes was 10-fold lower upon tattoo injection. Delivery of SFV particles encoding the E6 and E7 antigens of human papillomavirus type 16 (SFVeE6,7) via tattooing resulted in HPV-specific cytotoxic T cells and in vivo therapeutic antitumor response. Strikingly, despite the observed lower overall transgene expression, SFVeE6,7 delivered via tattoo injection resulted in higher or equal levels of immune responses as compared to intramuscular injection. The intrinsic immunogenic potential of tattooing provides a benefit for immunotherapy based on an alphavirus. PMID:26343186

The Ocular Conjunctiva as a Mucosal Immunization Route: A Profile of the Immune Response to the Model Antigen Tetanus Toxoid

PubMed Central

Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

2013-01-01

Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID

The ocular conjunctiva as a mucosal immunization route: a profile of the immune response to the model antigen tetanus toxoid.

PubMed

Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

2013-01-01

In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.

Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

PubMed

Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

2005-02-01

CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

Dendritic Cell Immune Responses in HIV-1 Controllers.

PubMed

Martin-Gayo, Enrique; Yu, Xu G

2017-02-01

Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.

Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

PubMed

Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E

2000-04-01

Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

Connective tissue growth factor linked to the E7 tumor antigen generates potent antitumor immune responses mediated by an antiapoptotic mechanism.

PubMed

Cheng, W-F; Chang, M-C; Sun, W-Z; Lee, C-N; Lin, H-W; Su, Y-N; Hsieh, C-Y; Chen, C-A

2008-07-01

A novel method for generating an antigen-specific cancer vaccine and immunotherapy has emerged using a DNA vaccine. However, antigen-presenting cells (APCs) have a limited life span, which hinders their long-term ability to prime antigen-specific T cells. Connective tissue growth factor (CTGF) has a role in cell survival. This study explored the intradermal administration of DNA encoding CTGF with a model tumor antigen, human papilloma virus type 16 E7. Mice vaccinated with CTGF/E7 DNA exhibited a dramatic increase in E7-specific CD4(+) and CD8(+) T-cell precursors. They also showed an impressive antitumor effect against E7-expressing tumors compared with mice vaccinated with the wild-type E7 DNA. The delivery of DNA encoding CTGF and E7 or CTGF alone could prolong the survival of transduced dendritic cells (DCs) in vivo. In addition, CTGF/E7-transduced DCs could enhance a higher number of E7-specific CD8(+) T cells than E7-transduced DCs. By prolonging the survival of APCs, DNA vaccine encoding CTGF linked to a tumor antigen represents an innovative approach to enhance DNA vaccine potency and holds promise for cancer prophylaxis and immunotherapy.

Adjuvants in the Driver’s Seat: How Magnitude, Type, Fine Specificity and Longevity of Immune Responses Are Driven by Distinct Classes of Immune Potentiators

PubMed Central

Bergmann-Leitner, Elke S.; Leitner, Wolfgang W.

2014-01-01

The mechanism by which vaccine adjuvants enhance immune responses has historically been considered to be the creation of an antigen depot. From here, the antigen is slowly released and provided to immune cells over an extended period of time. This “depot” was formed by associating the antigen with substances able to persist at the injection site, such as aluminum salts or emulsions. The identification of Pathogen-Associated Molecular Patterns (PAMPs) has greatly advanced our understanding of how adjuvants work beyond the simple concept of extended antigen release and has accelerated the development of novel adjuvants. This review focuses on the mode of action of different adjuvant classes in regards to the stimulation of specific immune cell subsets, the biasing of immune responses towards cellular or humoral immune response, the ability to mediate epitope spreading and the induction of persistent immunological memory. A better understanding of how particular adjuvants mediate their biological effects will eventually allow them to be selected for specific vaccines in a targeted and rational manner. PMID:26344620

Intranasal immunization with novel EspA-Tir-M fusion protein induces protective immunity against enterohemorrhagic Escherichia coli O157:H7 challenge in mice.

PubMed

Lin, Ruqin; Zhu, Bo; Zhang, Yiduo; Bai, Yang; Zhi, Fachao; Long, Beiguo; Li, Yawen; Wu, Yuhua; Wu, Xianbo; Fan, Hongying

2017-04-01

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 causes hemorrhagic colitis and hemolytic uremic syndrome in humans. Due to the risks associated with antibiotic treatment against EHEC O157:H7 infection, vaccines represent a promising method for prevention of EHEC O157:H7 infection. Therefore, we constructed the novel bivalent antigen EspA-Tir-M as a candidate EHEC O157:H7 subunit vaccine. We then evaluated the immunogenicity of this novel EHEC O157:H7 subunit vaccine. Immune responses to the fusion protein administered by intranasal and subcutaneous routes were compared in mice. Results showed higher levels of specific mucosal and systemic antibody responses induced by intranasal as compared to subcutaneous immunization. Intranasal immunization enhanced the concentration of interleukin-4, interleukin-10, and interferon-γ, while subcutaneous immunization enhanced only the latter two. In addition, intranasal immunization protected against EHEC O157:H7 colonization and infection in mice at a rate of 90%.Histopathological analysis revealed that vaccination reduced colon damage, especially when administered intranasally. In contrast, subcutaneous immunization elicited a weak immune response and exhibited a low protection rate. These findings demonstrate that intranasal immunization with the fusion protein induces both humoral and cellular immune (Th1/Th2) responses in mice. The novel EspA-Tir-M novel fusion protein therefore represents a promising subunit vaccine against EHEC O157:H7 infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Profiling Humoral Immune Responses to Clostridium difficile-Specific Antigens by Protein Microarray Analysis.

PubMed

Negm, Ola H; Hamed, Mohamed R; Dilnot, Elizabeth M; Shone, Clifford C; Marszalowska, Izabela; Lynch, Mark; Loscher, Christine E; Edwards, Laura J; Tighe, Patrick J; Wilcox, Mark H; Monaghan, Tanya M

2015-09-01

Clostridium difficile is an anaerobic, Gram-positive, and spore-forming bacterium that is the leading worldwide infective cause of hospital-acquired and antibiotic-associated diarrhea. Several studies have reported associations between humoral immunity and the clinical course of C. difficile infection (CDI). Host humoral immune responses are determined using conventional enzyme-linked immunosorbent assay (ELISA) techniques. Herein, we report the first use of a novel protein microarray assay to determine systemic IgG antibody responses against a panel of highly purified C. difficile-specific antigens, including native toxins A and B (TcdA and TcdB, respectively), recombinant fragments of toxins A and B (TxA4 and TxB4, respectively), ribotype-specific surface layer proteins (SLPs; 001, 002, 027), and control proteins (tetanus toxoid and Candida albicans). Microarrays were probed with sera from a total of 327 individuals with CDI, cystic fibrosis without diarrhea, and healthy controls. For all antigens, precision profiles demonstrated <10% coefficient of variation (CV). Significant correlation was observed between microarray and ELISA in the quantification of antitoxin A and antitoxin B IgG. These results indicate that microarray is a suitable assay for defining humoral immune responses to C. difficile protein antigens and may have potential advantages in throughput, convenience, and cost. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Poliovirus intrahost evolution is required to overcome tissue-specific innate immune responses.

PubMed

Xiao, Yinghong; Dolan, Patrick Timothy; Goldstein, Elizabeth Faul; Li, Min; Farkov, Mikhail; Brodsky, Leonid; Andino, Raul

2017-08-29

RNA viruses, such as poliovirus, have a great evolutionary capacity, allowing them to quickly adapt and overcome challenges encountered during infection. Here we show that poliovirus infection in immune-competent mice requires adaptation to tissue-specific innate immune microenvironments. The ability of the virus to establish robust infection and virulence correlates with its evolutionary capacity. We further identify a region in the multi-functional poliovirus protein 2B as a hotspot for the accumulation of minor alleles that facilitate a more effective suppression of the interferon response. We propose that population genetic dynamics enables poliovirus spread between tissues through optimization of the genetic composition of low frequency variants, which together cooperate to circumvent tissue-specific challenges. Thus, intrahost virus evolution determines pathogenesis, allowing a dynamic regulation of viral functions required to overcome barriers to infection.RNA viruses, such as polioviruses, have a great evolutionary capacity and can adapt quickly during infection. Here, the authors show that poliovirus infection in mice requires adaptation to innate immune microenvironments encountered in different tissues.

A Functional Toll-Interacting Protein Variant Is Associated with Bacillus Calmette-Guérin-Specific Immune Responses and Tuberculosis.

PubMed

Shah, Javeed A; Musvosvi, Munyaradzi; Shey, Muki; Horne, David J; Wells, Richard D; Peterson, Glenna J; Cox, Jeffery S; Daya, Michelle; Hoal, Eileen G; Lin, Lin; Gottardo, Raphael; Hanekom, Willem A; Scriba, Thomas J; Hatherill, Mark; Hawn, Thomas R

2017-08-15

The molecular mechanisms that regulate tuberculosis susceptibility and bacillus Calmette-Guérin (BCG)-induced immunity are mostly unknown. However, induction of the adaptive immune response is a critical step in host control of Mycobacterium tuberculosis. Toll-interacting protein (TOLLIP) is a ubiquitin-binding protein that regulates innate immune responses, including Toll-like receptor signaling, which initiate adaptive immunity. TOLLIP variation is associated with susceptibility to tuberculosis, but the mechanism by which it regulates tuberculosis immunity is poorly understood. To identify functional TOLLIP variants and evaluate the role of TOLLIP variation on innate and adaptive immune responses to mycobacteria and susceptibility to tuberculosis. We used human cellular immunology approaches to characterize the role of a functional TOLLIP variant on monocyte mRNA expression and M. tuberculosis-induced monocyte immune functions. We also examined the association of TOLLIP variation with BCG-induced T-cell responses and susceptibility to latent tuberculosis infection. We identified a functional TOLLIP promoter region single-nucleotide polymorphism, rs5743854, which was associated with decreased TOLLIP mRNA expression in infant monocytes. After M. tuberculosis infection, TOLLIP-deficient monocytes demonstrated increased IL-6, increased nitrite, and decreased bacterial replication. The TOLLIP-deficiency G/G genotype was associated with decreased BCG-specific IL-2 + CD4 + T-cell frequency and proliferation. This genotype was also associated with increased susceptibility to latent tuberculosis infection. TOLLIP deficiency is associated with decreased BCG-specific T-cell responses and increased susceptibility to tuberculosis. We hypothesize that the heightened antibacterial monocyte responses after vaccination of TOLLIP-deficient infants are responsible for decreased BCG-specific T-cell responses. Activating TOLLIP may provide a novel adjuvant strategy for BCG

Immunization with mutant HPV16 E7 protein inhibits the growth of TC-1 cells in tumor-bearing mice.

PubMed

Li, Yan-Li; Ma, Zhong-Liang; Zhao, Yue; Zhang, Jing

2015-04-01

Two human papillomavirus (HPV) 16 oncogenic proteins, E6 and E7, are co-expressed in the majority of HPV16-induced cervical cancer cells. Thus, the E6 and E7 proteins are good targets for developing therapeutic vaccines for cervical cancer. In the present study, immunization with the mutant non-transforming HPV16 E7 (mE7) protein was demonstrated to inhibit the growth of TC-1 cells in the TC-1 mouse model. The HPV16 mE7 gene was amplified by splicing overlap extension polymerase chain reaction using pET-28a(+)-E7 as a template, and the gene was cloned into pET-28a(+) to form pET-28a(+)-mE7. Compared with the E7 protein, mE7 lacks amino acid residues 94-98, and at residue 24, there is a Cys to Gly substitution. pET-28a(+)-mE7 was then introduced into Escherichia coli Rosetta. The expression of mE7 was induced by isopropyl β-D-1-thiogalactopyranoside. The mE7 protein was purified using Ni-NTA agarose and detected by SDS-PAGE and western blot analysis. In the tumor prevention model, no tumor was detected in the mice vaccinated with the mE7 protein. After 40 days, the tumor-free mice and control mice were challenged with 2×10 5 TC-1 cells. All control mice developed tumors six days later, but mE7 immunized mice were tumor free until 90 days. In the tumor therapy model, the TC-1 cells were initially injected subcutaneously, and the mice were subsequently vaccinated. Vaccination against the mE7 protein may significantly inhibit TC-1 cell growth compared to the control. These results demonstrated that immunization with the HPV16 mE7 protein elicited a long-term protective immunity against TC-1 tumor growth and generated a significant inhibition of TC-1 growth in a TC-1 mouse model.

Recombinant Chimpanzee Adenovirus Vaccine AdC7-M/E Protects against Zika Virus Infection and Testis Damage.

PubMed

Xu, Kun; Song, Yufeng; Dai, Lianpan; Zhang, Yongli; Lu, Xuancheng; Xie, Yijia; Zhang, Hangjie; Cheng, Tao; Wang, Qihui; Huang, Qingrui; Bi, Yuhai; Liu, William J; Liu, Wenjun; Li, Xiangdong; Qin, Chuan; Shi, Yi; Yan, Jinghua; Zhou, Dongming; Gao, George F

2018-03-15

The recent outbreak of Zika virus (ZIKV) has emerged as a global health concern. ZIKV can persist in human semen and be transmitted by sexual contact, as well as by mosquitoes, as seen for classical arboviruses. We along with others have previously demonstrated that ZIKV infection leads to testis damage and infertility in mouse models. So far, no prophylactics or therapeutics are available; therefore, vaccine development is urgently demanded. Recombinant chimpanzee adenovirus has been explored as the preferred vaccine vector for many pathogens due to the low preexisting immunity against the vector among the human population. Here, we developed a ZIKV vaccine based on recombinant chimpanzee adenovirus type 7 (AdC7) expressing ZIKV M/E glycoproteins. A single vaccination of AdC7-M/E was sufficient to elicit potent neutralizing antibodies and protective immunity against ZIKV in both immunocompetent and immunodeficient mice. Moreover, vaccinated mice rapidly developed neutralizing antibody with high titers within 1 week postvaccination, and the elicited antiserum could cross-neutralize heterologous ZIKV strains. Additionally, ZIKV M- and E-specific T cell responses were robustly induced by AdC7-M/E. Moreover, one-dose inoculation of AdC7-M/E conferred mouse sterilizing immunity to eliminate viremia and viral burden in tissues against ZIKV challenge. Further investigations showed that vaccination with AdC7-M/E completely protected against ZIKV-induced testicular damage. These data demonstrate that AdC7-M/E is highly effective and represents a promising vaccine candidate for ZIKV control. IMPORTANCE Zika virus (ZIKV) is a pathogenic flavivirus that causes severe clinical consequences, including congenital malformations in fetuses and Guillain-Barré syndrome in adults. Vaccine development is a high priority for ZIKV control. In this study, to avoid preexisting anti-vector immunity in humans, a rare serotype chimpanzee adenovirus (AdC7) expressing the ZIKV M/E

Malnutrition: Modulator of Immune Responses in Tuberculosis

PubMed Central

Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth

2017-01-01

Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710

Immune Responses to a Recombinant Glycoprotein E Herpes Zoster Vaccine in Adults Aged 50 Years or Older

PubMed Central

Cunningham, Anthony L; Heineman, Thomas C; Lal, Himal; Godeaux, Olivier; Chlibek, Roman; Hwang, Shinn-Jang; McElhaney, Janet E; Vesikari, Timo; Andrews, Charles; Choi, Won Suk; Esen, Meral; Ikematsu, Hideyuki; Choma, Martina Kovac; Pauksens, Karlis; Ravault, Stéphanie; Salaun, Bruno; Schwarz, Tino F; Smetana, Jan; Abeele, Carline Vanden; Van den Steen, Peter; Vastiau, Ilse; Weckx, Lily Yin; Levin, Myron J

2018-01-01

Abstract Background The herpes zoster subunit vaccine (HZ/su), consisting of varicella-zoster virus glycoprotein E (gE) and AS01B Adjuvant System, was highly efficacious in preventing herpes zoster in the ZOE-50 and ZOE-70 trials. We present immunogenicity results from those trials. Methods Participants (ZOE-50: ≥50; ZOE-70: ≥70 years of age) received 2 doses of HZ/su or placebo, 2 months apart. Serum anti-gE antibodies and CD4 T cells expressing ≥2 of 4 activation markers assessed (CD42+) after stimulation with gE-peptides were measured in subcohorts for humoral (n = 3293) and cell-mediated (n = 466) immunogenicity. Results After vaccination, 97.8% of HZ/su and 2.0% of placebo recipients showed a humoral response. Geometric mean anti-gE antibody concentrations increased 39.1-fold and 8.3-fold over baseline in HZ/su recipients at 1 and 36 months post-dose 2, respectively. A gE-specific CD42+ T-cell response was shown in 93.3% of HZ/su and 0% of placebo recipients. Median CD42+ T-cell frequencies increased 24.6-fold (1 month) and 7.9-fold (36 months) over baseline in HZ/su recipients and remained ≥5.6-fold above baseline in all age groups at 36 months. The proportion of CD4 T cells expressing all 4 activation markers increased over time in all age groups. Conclusions Most HZ/su recipients developed robust immune responses persisting for 3 years following vaccination. Clinical Trials Registration NCT01165177; NCT01165229. PMID:29529222

Evidence that interferon-tau secreted from Day-7 embryo in vivo generates anti-inflammatory immune response in the bovine uterus.

PubMed

Rashid, Mohammad B; Talukder, Anup K; Kusama, Kazuya; Haneda, Shingo; Takedomi, Toshiro; Yoshino, Hitomi; Moriyasu, Satoru; Matsui, Motozumi; Shimada, Masayuki; Imakawa, Kazuhiko; Miyamoto, Akio

2018-06-12

Recent studies suggest that Day-7 bovine embryo starts to communicate with the uterine epithelium through interferon-tau (IFNT) signaling. However, immune modulatory role of IFNT in the uterus just after the embryo moves from the oviduct is unclear. We aimed to examine the hypothesis that Day-7 bovine embryo secretes IFNT in the uterus, which induces anti-inflammatory response in immune cells. The uterine flush (UF) with multiple embryos was collected from Day-7 donor pregnant cows and peripheral blood mononuclear cells (PBMCs) were then cultured in UF. Transcripts detected in PBMCs revealed that UF from pregnant cows down-regulated pro-inflammatory cytokines (TNFA, IL1B) and up-regulated anti-inflammatory cytokine (IL10) expression, with activation of interferon-stimulated genes (ISGs; ISG15, OAS1) as compared with UF from non-pregnant cows. An addition of specific anti-IFNT antibody to the UF inhibited the effect on PBMCs, indicating that IFNT is a major factor for such immune modulation. The observation that conditioned media from bovine uterine epithelial cells both stimulated with IFNT in vitro and supplemented with fresh IFNT induced similar PBMCs gene expression, confirming that IFNT directly acts on this immune crosstalk. This study shows that IFNT secreted from Day-7 embryo in vivo generates anti-inflammatory response in immune cells, which may provide immunological tolerance to accept the embryo. Copyright © 2018 Elsevier Inc. All rights reserved.

Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

PubMed Central

Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

2011-01-01

Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

Specific immune response genes of the guinea pig. II. Relationship between the poly-L-lysine gene and the genes controlling immune responsiveness to copolymers of L-glutamic acid and L-alanine and L-glutamic acid and L-tyrosine in random-bred Hartley guinea pigs.

PubMed

Bluestein, H G; Green, I; Benacerraf, B

1971-08-01

The ability of guinea pigs to make immune responses to GA, a linear random copolymer of L-glutamic acid and L-alanine, GT, a random linear copolymer of L-glutamic acid and L-tyrosine, and PLL, a linear homopolymer of L-lysine, is controlled by different autosomal dominant genes specific for each of those polymers. We have investigated the relationship between the PLL gene and the GA and GT immune response genes by simultaneously immunizing random-bred Hartley strain guinea pigs with GA and PLL, GT and PLL, or GA and GT. In most Hartley guinea pigs the ability to respond immunologically to GA and to PLL is inherited together; that is, most animals responding to GA respond to PLL and vice versa. However, a few animals respond to either GA or to PLL but not both, demonstrating that the GA and PLL immune response genes are not identical but linked in most Hartley animals. Conversely, when simultaneously immunized with GT and PLL, most Hartley guinea pigs respond to either PLL or GT but not both, indicating that GT and PLL responsiveness tends to segregate away from each other. Thus, the GT and PLL immune response genes also are not inherited independently but, rather, behave as alleles or pseudoalleles. Similar results are observed when Hartley guinea pigs are simultaneously immunized with GA and GT. The ability to respond to GA segregates away from the ability to respond to GT. Our studies demonstrated that the specific immune response genes thus far identified in guinea pigs controlling the ability to respond to GA, GT, and PLL, respectively, are found on the same chromosome. In most Hartley animals, the GA and PLL immune response genes are often linked, i.e. occur on the same chromosome strand, and tend to behave as alleles or pseudoalleles to the GT immune response gene.

The innate immune response to Aspergillus fumigatus at the alveolar surface.

PubMed

Margalit, Anatte; Kavanagh, Kevin

2015-09-01

Aspergillus fumigatus is an ubiquitous, saprophytic mould that forms and releases airborne conidia which are inhaled by humans on a daily basis. When the immune system is compromised (e.g. immunosuppressive therapy prior to organ transplantation) or there is pre-existing pulmonary malfunction (e.g. asthma, cystic fibrosis, TB lesions), A. fumigatus exploits weaknesses in the host defenses which can result in the development of saphrophytic, allergic or invasive aspergillosis. If not effectively eliminated by the innate immune response, conidia germinate and form invasive hyphae which can penetrate pulmonary tissues. The innate immune response to A. fumigatus is stage-specific and various components of the host's defenses are recruited to challenge the different cellular forms of the pathogen. In immunocompetent hosts, anatomical barriers (e.g. the mucociliary elevator) and professional phagocytes such as alveolar macrophages (AM) and neutrophils prevent the development of aspergillosis by inhibiting the growth of conidia and hyphae. The recognition of inhaled conidia by AM leads to the intracellular degradation of the spores and the secretion of proinflammatory mediators which recruit neutrophils to assist in fungal clearance. During the later stages of infection, dendritic cells activate a protective A. fumigatus-specific adaptive immune response which is driven by Th1 CD4(+) T cells. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

CD200 Receptor Controls Sex-Specific TLR7 Responses to Viral Infection

PubMed Central

Raaben, Matthijs; Grinwis, Guy C. M.; Coenjaerts, Frank E.; Ressing, Maaike E.; Rottier, Peter J. M.; de Haan, Cornelis A. M.; Meyaard, Linde

2012-01-01

Immunological checkpoints, such as the inhibitory CD200 receptor (CD200R), play a dual role in balancing the immune system during microbial infection. On the one hand these inhibitory signals prevent excessive immune mediated pathology but on the other hand they may impair clearance of the pathogen. We studied the influence of the inhibitory CD200-CD200R axis on clearance and pathology in two different virus infection models. We find that lack of CD200R signaling strongly enhances type I interferon (IFN) production and viral clearance and improves the outcome of mouse hepatitis corona virus (MHV) infection, particularly in female mice. MHV clearance is known to be dependent on Toll like receptor 7 (TLR7)-mediated type I IFN production and sex differences in TLR7 responses previously have been reported for humans. We therefore hypothesize that CD200R ligation suppresses TLR7 responses and that release of this inhibition enlarges sex differences in TLR7 signaling. This hypothesis is supported by our findings that in vivo administration of synthetic TLR7 ligand leads to enhanced type I IFN production, particularly in female Cd200−/− mice and that CD200R ligation inhibits TLR7 signaling in vitro. In influenza A virus infection we show that viral clearance is determined by sex but not by CD200R signaling. However, absence of CD200R in influenza A virus infection results in enhanced lung neutrophil influx and pathology in females. Thus, CD200-CD200R and sex are host factors that together determine the outcome of viral infection. Our data predict a sex bias in both beneficial and pathological immune responses to virus infection upon therapeutic targeting of CD200-CD200R. PMID:22615569

Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

PubMed

Simi, S; Peter, Valsa S; Peter, M C Subhash

2017-09-15

Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

Effects of dietary L-glutamine supplementation on specific and general defense responses in mice immunized with inactivated Pasteurella multocida vaccine.

PubMed

Chen, Shuai; Liu, Shuping; Zhang, Fengmei; Ren, Wenkai; Li, Nengzhang; Yin, Jie; Duan, Jielin; Peng, Yuanyi; Liu, Gang; Yin, Yulong; Wu, Guoyao

2014-10-01

Little is known about effects of dietary glutamine supplementation on specific and general defense responses in a vaccine-immunized animal model. Thus, this study determined roles for dietary glutamine supplementation in specific and general defense responses in mice immunized with inactivated Pasteurella multocida vaccine. The measured variables included: (1) the production of pathogen-specific antibodies; (2) mRNA levels for pro-inflammatory cytokines, toll-like receptors and anti-oxidative factors; and (3) the distribution of P. multocida in tissues and the expression of its major virulence factors in vivo. Dietary supplementation with 0.5 % glutamine had a better protective role than 1 or 2 % glutamine against P. multocida infection in vaccine-immunized mice, at least partly resulting from its effects in modulation of general defense responses. Dietary glutamine supplementation had little effects on the production of P. multocida-specific antibodies. Compared to the non-supplemented group, dietary supplementation with 0.5 % glutamine had no effect on bacterial burden in vivo but decreased the expression of major virulence factors in the spleen. Collectively, supplementing 0.5 % glutamine to a conventional diet provides benefits in vaccine-immunized mice by enhancing general defense responses and decreasing expression of specific virulence factors.

Host-Specific Response to HCV Infection in the Chimeric SCID-beige/Alb-uPA Mouse Model: Role of the Innate Antiviral Immune Response

PubMed Central

Thompson, Jill C; Smith, Maria W; Yeh, Matthew M; Proll, Sean; Zhu, Lin-Fu; Gao, T. J; Kneteman, Norman M; Tyrrell, D. Lorne; Katze, Michael G

2006-01-01

The severe combined immunodeficiency disorder (SCID)-beige/albumin (Alb)-urokinase plasminogen activator (uPA) mouse containing a human-mouse chimeric liver is currently the only small animal model capable of supporting hepatitis C virus (HCV) infection. This model was utilized to characterize the host transcriptional response to HCV infection. The purpose of these studies was to investigate the genetic component of the host response to HCV infection and also to distinguish virus-induced gene expression changes from adaptive HCV-specific immune-mediated effects. Gene expression profiles from HCV-infected mice were also compared to those from HCV-infected patients. Analyses of the gene expression data demonstrate that host factors regulate the response to HCV infection, including the nature of the innate antiviral immune response. They also indicate that HCV mediates gene expression changes, including regulation of lipid metabolism genes, which have the potential to be directly cytopathic, indicating that liver pathology may not be exclusively mediated by HCV-specific adaptive immune responses. This effect appears to be inversely related to the activation of the innate antiviral immune response. In summary, the nature of the initial interferon response to HCV infection may determine the extent of viral-mediated effects on host gene expression. PMID:16789836

Effect of vitamin E supplementation on antioxidant defense systems and humoral immune responses in young, middle-aged and elderly Korean women.

PubMed

Park, Ock Jin; Kim, Hye Young P; Kim, Woo Kyung; Kim, Yeon Joong; Kim, Sook He

2003-04-01

Free radical-mediated oxidative stress has been implicated in the pathogenesis of numerous chronic diseases. Vitamin E is known to play an important role in the free-radical quenching process. However, clinical trials with vitamin E have yielded contrasting results in the prevention of several diseases related to oxidative stress. This study was undertaken to investigate the antioxidative and humoral immunologic effects of vitamin E supplementation in three different age groups: young (mean age 32.7 +/- 5.7 y), middle-aged (mean age 47.0 +/- 5.0 y) and elderly (67.6 +/- 4.7 y) women. Volunteer subjects were given a supplement of 400 IU dl-alpha-tocopherol acetate for 6 wk. Thiobarbituric acid reacting substances (TBARS) in the plasma significantly decreased with vitamin E supplementation. In addition, the radical scavenger activities (RSA) of red blood cells significantly increased with vitamin E supplementation in all age groups. However, humoral immune response modulation was not observed following vitamin E supplementation. Even though there is no clear indication that vitamin E supplementation is necessary to improve the humoral immune functions, vitamin E supplementation may be beneficial to all adult age groups as a preventive measure for complications related to oxidative damage.

Quantification of systemic and local immune responses to individual rotavirus proteins during rotavirus infection in mice.

PubMed Central

Ishida, S; Feng, N; Tang, B; Gilbert, J M; Greenberg, H B

1996-01-01

The purpose of the present study was to develop a quantitative assay that could be used to measure the local and systemic immune responses to specific rotavirus proteins following rotavirus infection of adult mice. To measure these responses, we used an immunocytochemical staining assay of Spodoptera frugiperda (Sf-9) cells which were infected with recombinant baculovirus expressing selected rotavirus proteins. The specificity of the assay was documented by using a series of monoclonal antibodies to individual rotavirus proteins. We observed that the assay had high levels of sensitivity and specificity for a series of VP7- and VP4-specific neutralizing monoclonal antibodies which recognized conformation-dependent epitopes on their target proteins. We also studied immunoglobulin G (IgG) immune responses in serum and IgA immune responses in the stools of mice infected with wild-type murine rotavirus strain EHPw. In both sera and stools, the most immunogenic proteins were VP6 and VP4. VP2 was less immunogenic than VP6 or VP4, and the immune responses to VP7, NSP2, and NSP4 were very low in serum and undetectable in stools. PMID:8784572

Toll-like receptor 7 is required for effective adaptive immune responses that prevent persistent virus infection.

PubMed

Walsh, Kevin B; Teijaro, John R; Zuniga, Elina I; Welch, Megan J; Fremgen, Daniel M; Blackburn, Shawn D; von Tiehl, Karl F; Wherry, E John; Flavell, Richard A; Oldstone, Michael B A

2012-06-14

TLR7 is an innate signaling receptor that recognizes single-stranded viral RNA and is activated by viruses that cause persistent infections. We show that TLR7 signaling dictates either clearance or establishment of life-long chronic infection by lymphocytic choriomeningitis virus (LCMV) Cl 13 but does not affect clearance of the acute LCMV Armstrong 53b strain. TLR7(-/-) mice infected with LCMV Cl 13 remained viremic throughout life from defects in the adaptive antiviral immune response-notably, diminished T cell function, exacerbated T cell exhaustion, decreased plasma cell maturation, and negligible antiviral antibody production. Adoptive transfer of TLR7(+/+) LCMV immune memory cells that enhanced clearance of persistent LCMV Cl 13 infection in TLR7(+/+) mice failed to purge LCMV Cl 13 infection in TLR7(-/-) mice, demonstrating that a TLR7-deficient environment renders antiviral responses ineffective. Therefore, methods that promote TLR7 signaling are promising treatment strategies for chronic viral infections. Copyright © 2012 Elsevier Inc. All rights reserved.

Immune protection of microneme 7 (EmMIC7) against Eimeria maxima challenge in chickens.

PubMed

Huang, Jingwei; Zhang, Zhenchao; Li, Menghui; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

2015-10-01

In the present study, the immune protective effects of recombinant microneme protein 7 of Eimeria maxima (rEmMIC7) and a DNA vaccine encoding this antigen (pVAX1-EmMIC7) on experimental challenge were evaluated. Two-week-old chickens were randomly divided into five groups. Experimental groups of chickens were immunized with 100 μg DNA vaccine pVAX1-MIC7 or 200 μg rEmMIC7, while control groups of chickens were injected with pVAX1 plasmid or sterile phosphate buffered saline (PBS). The results showed that the anti-EmMIC7 antibody titres in chickens of both rEmMIC7 and pVAX1-MIC7 groups were significantly higher as compared to PBS and pVAX1 control (P < .05). The splenocytes from both vaccinated groups of chickens displayed significantly greater proliferation response compared with the controls (P < .05). Serum from chickens immunized with pVAX1-MIC7 and rEmMIC7 displayed significantly high levels of interleukin-2, interferon-γ, IL-10, IL-17, tumour growth factor-β and IL-4 (P < .05) compared to those of negative controls. The challenge experiment results showed that both the recombinant antigen and the DNA vaccine could obviously alleviate jejunum lesions, body weight loss and enhance oocyst decrease ratio. The anti-coccidial index (ACI) of the pVAX1-MIC7 group was 167.84, higher than that of the recombinant MIC7 protein group, 167.10. Our data suggested that immunization with EmMIC7 was effective in imparting partial protection against E. maxima challenge in chickens and it could be an effective antigen candidate for the development of new vaccines against E. maxima.

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

PubMed Central

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

2017-01-01

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

PubMed

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

2008-10-09

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

Microwave ablation combined with OK-432 induces Th1-type response and specific antitumor immunity in a murine model of breast cancer.

PubMed

Li, Li; Wang, Wei; Pan, Hong; Ma, Ge; Shi, Xinyi; Xie, Hui; Liu, Xiaoan; Ding, Qiang; Zhou, Wenbin; Wang, Shui

2017-01-31

Minimally invasive therapies, such as microwave ablation (MWA), are widely used for the treatment of solid tumors. Previous studies suggest that MWA is feasible for the treatment of small breast cancer, and thermal ablation may induce adaptive antitumor immunity. However, the induced immune responses are mostly weak, and the immunomodulation effects of MWA in breast cancer are unclear. Immunostimulant OK-432 can induce tumor-specific T-cell responses and may augment the immunity induced by MWA. We treated 4T1 breast cancer bearing BALB/c mice with MWA, OK-432, MWA plus OK-432, or left without treatment. Survival time was evaluated with the Kaplan-Meyer method comparing survival curves by log-rank test. On day 25 after ablation, surviving mice received tumor rechallenge, and the rechallenged tumor volumes were calculated every 5 days. Immunohistochemistry and flow cytometry were used to evaluate the T-cell immune responses in ablated tissues and spleens. The tumor-specific immunity was assessed by enzyme-linked immunospot assays. Besides, the cytokine patterns were identified from enzyme-linked immunosorbent assay. Microwave ablation plus OK-432 resulted in longer survival than single treatment and protect most surviving mice from tumor rechallenge. Both local and systemic T-cell responses were induced by MWA and were further enhanced by subsequent administration of OK-432. Moreover, the combination of MWA and OK-432 induced stronger tumor-specific immune responses than MWA alone. In addition, OK-432 and MWA synergistically promoted the production of Th1-type but not Th2-type cytokines, and polarized T-cell responses to Th1-dominant state. The T-cell immune responses were activated by MWA in breast cancer. Furthermore, the combination of MWA and OK-432 induced Th1-type response and elicited specific antitumor immunity.

The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

PubMed Central

Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

2011-01-01

The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

Regression of Established Human Papillomavirus Type 16 (HPV-16) Immortalized Tumors In Vivo by Vaccinia Viruses Expressing Different Forms of HPV-16 E7 Correlates with Enhanced CD8+ T-Cell Responses That Home to the Tumor Site

PubMed Central

Lamikanra, Abigail; Pan, Zhen-Kun; Isaacs, Stuart N.; Wu, Tzyy-Choou; Paterson, Yvonne

2001-01-01

Using vaccinia virus as a live vector, we show that the expression of human papillomavirus type 16 (HPV-16) E7 fused to a nonhemolytic portion of the Listeria monocytogenes virulence factor, listeriolysin O (LLO), induces an immune response that causes the regression of established HPV-16 immortalized tumors in C57BL/6 mice. The vaccinia virus construct expressing LLO fused to E7 (VacLLOE7) was compared with two previously described vaccinia virus constructs: one that expresses unmodified E7 (VacE7) and another that expresses E7 in a form designed to direct it to intracellular lysosomal compartments and improve major histocompatibility complex class II-restricted responses (VacSigE7LAMP-1). C57BL/6 mice bearing established HPV-16 immortalized tumors of 5 or 8 mm were treated with each of these vaccines. Fifty percent of the mice treated with VacLLOE7 remained tumor free 2 months after tumor inoculation, whereas 12 to 25% of the mice were tumor free after treatment with VacSigE7LAMP-1 (depending on the size of the tumor). No mice were tumor free in the group given VacE7. Compared to VacE7, VacSigE7LAMP-1 and VacLLOE7 resulted in increased numbers of H2-Db-specific tetramer-positive CD8+ T cells in mouse spleens that produced gamma interferon and tumor necrosis factor alpha upon stimulation with RAHYNIVTF peptide. In addition, the highest frequency of tetramer-positive T cells was seen in the tumor sites of mice treated with VacLLOE7. An increased efficiency of E7-specific lysis by splenocytes from mice immunized with VacLLOE7 was also observed. These results indicate that the fusion of E7 with LLO not only enhances antitumor therapy by improving the tumoricidal function of E7-specific CD8+ T cells but may also increase the number of antigen-specific CD8+ T cells in the tumor, the principle site of antigen expression. PMID:11559797

Immune response

MedlinePlus

Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...

CP7_E2alf oral vaccination confers partial protection against early classical swine fever virus challenge and interferes with pathogeny-related cytokine responses

PubMed Central

2013-01-01

The conventional C-strain vaccine induces early protection against classical swine fever (CSF), but infected animals cannot be distinguished from vaccinated animals. The CP7_E2alf marker vaccine, a pestivirus chimera, could be a suitable substitute for C-strain vaccine to control CSF outbreaks. In this study, single oral applications of CP7_E2alf and C-strain vaccines were compared for their efficacy to induce protection against a CSF virus (CSFV) challenge with the moderately virulent Bas-Rhin isolate, in pigs as early as two days post-immunization. This work emphasizes the powerful potential of CP7_E2alf vaccine administered orally by a rapid onset of partial protection similar to that induced by the C-strain vaccine. Furthermore, our results revealed that both vaccinations attenuated the effects induced by CSFV on production of the pig major acute phase protein (PigMAP), IFN-α, IL-12, IL-10, and TGF-β1 cytokines. By this interference, several cytokines that may play a role in the pathogeny induced by moderately virulent CSFV strains were revealed. New hypotheses concerning the role of each of these cytokines in CSFV pathogeny are discussed. Our results also show that oral vaccination with either vaccine (CP7_E2alf or C-strain) enhanced CSFV–specific IgG2 production, compared to infection alone. Interestingly, despite the similar antibody profiles displayed by both vaccines post-challenge, the production of CSFV-specific IgG1 and neutralizing antibodies without challenge was lower with CP7_E2alf vaccination than with C-strain vaccination, suggesting a slight difference in the balance of adaptive immune responses between these vaccines. PMID:23398967

SUMO-Enriched Proteome for Drosophila Innate Immune Response

PubMed Central

Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.

2015-01-01

Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570

SUMO-Enriched Proteome for Drosophila Innate Immune Response.

PubMed

Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S

2015-08-18

Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.

Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

PubMed

Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

2015-03-15

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Microglial expression of the B7 family member B7 homolog 1 confers strong immune inhibition: implications for immune responses and autoimmunity in the CNS.

PubMed

Magnus, Tim; Schreiner, Bettina; Korn, Thomas; Jack, Carolyn; Guo, Hong; Antel, Jack; Ifergan, Igal; Chen, Lieping; Bischof, Felix; Bar-Or, Amit; Wiendl, Heinz

2005-03-09

Inflammation of the CNS is usually locally limited to avoid devastating consequences. Critical players involved in this immune regulatory process are the resident immune cells of the brain, the microglia. Interactions between the growing family of B7 costimulatory ligands and their receptors are increasingly recognized as important pathways for costimulation and/or inhibition of immune responses. Human and mouse microglial cells constitutively express B7 homolog 1 (B7-H1) in vitro. However, under inflammatory conditions [presence of interferon-gamma (IFN-gamma) or T-helper 1 supernatants], a significant upregulation of B7-H1 was detectable. Expression levels of B7-H1 protein on microglial cells were substantially higher compared with astrocytes or splenocytes. Coculture experiments of major histocompatibility complex class II-positive antigen-presenting cells (APC) with syngeneic T cells in the presence of antigen demonstrated the functional consequences of B7-H1 expression on T-cell activation. In the presence of a neutralizing anti-B7-H1 antibody, both the production of inflammatory cytokines (IFN-gamma and interleukin-2) and the upregulation of activation markers (inducible costimulatory signal) by T cells were markedly enhanced. Interestingly, this effect was clearly more pronounced when microglial cells were used as APC, compared with astrocytes or splenocytes. Furthermore, B7-H1 was highly upregulated during the course of myelin oligodendrocyte glycoprotein-induced and proteolipid protein-induced experimental allergic encephalomyelitis in vivo. Expression was predominantly localized to areas of strongest inflammation and could be colocalized with microglial cells/macrophages as well as T cells. Together, our data propose microglial B7-H1 as an important immune inhibitory molecule capable of downregulating T-cell activation in the CNS and thus confining immunopathological damage.

Serologic and mucosal immune response to rotavirus infection in the rabbit model.

PubMed Central

Conner, M E; Gilger, M A; Estes, M K; Graham, D Y

1991-01-01

We examined the humoral immune response to rotavirus infection in specific pathogen-free rabbits inoculated and challenged orally with rabbit Ala rotavirus (7.5 x 10(5) to 1 x 10(7) PFU). The humoral immune response in both serologic and mucosal samples was monitored by using total antibody enzyme-linked immunosorbent assays (ELISAs), isotype-specific ELISAs, and plaque reduction neutralization assays. Following a primary infection, all rabbits shed virus and serologic and mucosal antibody responses were initially detected by 1 week postinoculation. Intestinal immunoglobulin M was detected by 3 days postinoculation, and secretory immunoglobulin A was detected by 6 days postinoculation. Following challenge, rabbits were protected (no detectable virus shedding) from infection. An anamnestic immune response was observed only with mucosal neutralizing antibodies, and all serologic and mucosal immune responses persisted at high levels until at least 175 days postchallenge (204 days postinoculation). Detection of neutralization responses was influenced by the virus strain used in the neutralization assay; all inoculated rabbits developed detectable serum and intestinal neutralizing antibodies against the infecting (Ala) virus strain. Neutralization activity in both serum and mucosal samples was generally, but not exclusively, homotypic (VP7 serotype 3) after both primary and challenge inoculations with Ala virus. Heterotypic serum neutralization activity was observed with serotype 8 (9 of 12 rabbits) and 9 (12 of 12 rabbits) viruses and may be based on reactivity with the outer capsid protein VP4 or on a shared epitope in the C region of VP7. Comparisons of heterologous (serotype 3) and heterotypic neutralizing responses in mucosal and serologic samples revealed that 43% (21 of 49) of the responses were discordant. In 19 of 49 (39%) of these cases, a heterotypic serologic response was seen in the absence of a heterotypic mucosal response, but in 2 of 49 (4%) instances, a

Distinctive TLR7 signaling, type I IFN production, and attenuated innate and adaptive immune responses to yellow fever virus in a primate reservoir host.

PubMed

Mandl, Judith N; Akondy, Rama; Lawson, Benton; Kozyr, Natalia; Staprans, Silvija I; Ahmed, Rafi; Feinberg, Mark B

2011-06-01

Why cross-species transmissions of zoonotic viral infections to humans are frequently associated with severe disease when viruses responsible for many zoonotic diseases appear to cause only benign infections in their reservoir hosts is unclear. Sooty mangabeys (SMs), a reservoir host for SIV, do not develop disease following SIV infection, unlike nonnatural HIV-infected human or SIV-infected rhesus macaque (RM) hosts. SIV infections of SMs are characterized by an absence of chronic immune activation, in association with significantly reduced IFN-α production by plasmacytoid dendritic cells (pDCs) following exposure to SIV or other defined TLR7 or TLR9 ligands. In this study, we demonstrate that SM pDCs produce significantly less IFN-α following ex vivo exposure to the live attenuated yellow fever virus 17D strain vaccine, a virus that we show is also recognized by TLR7, than do RM or human pDCs. Furthermore, in contrast to RMs, SMs mount limited activation of innate immune responses and adaptive T cell proliferative responses, along with only transient antiviral Ab responses, following infection with yellow fever vaccine 17D strain. However, SMs do raise significant and durable cellular and humoral immune responses comparable to those seen in RMs when infected with modified vaccinia Ankara, a virus whose immunogenicity does not require TLR7/9 recognition. Hence, differences in the pattern of TLR7 signaling and type I IFN production by pDCs between primate species play an important role in determining their ability to mount and maintain innate and adaptive immune responses to specific viruses, and they may also contribute to determining whether disease follows infection.

Effects of effluent from electoplating industry on the immune response in the freshwater fish, Cyprinus carpio.

PubMed

Borgia, V J Florence; Thatheyus, A J; Murugesan, A G; Alexander, S Catherine P; Geetha, I

2018-08-01

The present study was designed to assess the effect of sublethal concentrations of electoplating industry effluent (EIE) on the non-specific and specific immune responses in the freshwater fish, Cyprinus carpio. Sublethal concentrations of electroplating industry effluent such as 0.004, 0.007, 0.010 and 0.013% were chosen based on the LC 50 values. Experimental fish were exposed to these sublethal concentrations of EIE for 28 days. After 7, 14, 21 and 28 days of treatment, non-specific immune response by serum lysozyme activity, myeloperoxidase activity and antiprotease activity and specific immune response by antibody response to Aeromonas hydrophila using bacterial agglutination assay and ELISA were assessed. The results showed that chronic exposure of fish to 0.004, 0.007, 0.010 and 0.013% EIE, dose-dependently decreased the non-specific and specific immune responses on all the days tested compared to control fish whereas statistically significant suppressive effects were observed in fish exposed to 0.013% of EIE on all activities tested. Copyright © 2018 Elsevier Ltd. All rights reserved.

Skin prick test responses and allergen-specific IgE levels as predictors of peanut, egg, and sesame allergy in infants.

PubMed

Peters, Rachel L; Allen, Katrina J; Dharmage, Shyamali C; Tang, Mimi L K; Koplin, Jennifer J; Ponsonby, Anne-Louise; Lowe, Adrian J; Hill, David; Gurrin, Lyle C

2013-10-01

Ninety-five percent positive predictive values (PPVs) provide an invaluable tool for clinicians to avoid unnecessary oral food challenges. However, 95% PPVs specific to infants, the age group most likely to present for diagnosis of food allergy, are limited. We sought to develop skin prick test (SPT) and allergen-specific IgE (sIgE) thresholds with 95% PPVs for challenge-confirmed food allergy in a large population-based cohort of 1-year-old infants with challenges undertaken irrespective of SPT wheal size or previous history of ingestion. HealthNuts is a population-based, longitudinal food allergy study with baseline recruitment of 1-year-old infants. Infants were recruited from council-run immunization sessions during which they underwent SPTs to 4 allergens: egg, peanut, sesame, and cow's milk/shrimp. Any infant with a detectable SPT response was invited to undergo oral food challenge and sIgE testing. Five thousand two hundred seventy-six infants participated in the study. Peanut SPT responses of 8 mm or greater (95% CI, 7-9 mm), egg SPT responses of 4 mm or greater (95% CI, 3-5 mm), and sesame SPT responses of 8 mm or greater (95% CI, 5-9 mm) had 95% PPVs for challenge-proved food allergy. Peanut sIgE levels of 34 kUA/L or greater (95% CI, 14-48 kUA/L) and egg sIgE levels of 1.7 kUA/L or greater (95% CI, 1-3 kUA/L) had 95% PPVs for challenge-proved food allergy. Results were robust when stratified on established risk factors for food allergy. Egg SPT responses and sIgE levels were poor predictors of allergy to egg in baked goods. These 95% PPVs, which were generated from a unique dataset, are valuable for the diagnosis of food allergy in young infants and were robust when stratified across a number of different risk factors. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Specific immune response genes of new inbred strains of guinea pigs.

PubMed

Chiba, J; Egashira, Y

1978-01-01

Distribution of specific immune-response (Ir) genes controlling responsiveness to synthetic polypeptide antigens, homopolymer of poly-L-lysine (PLL), copolymer of L-glutamic acid and L-alanine (GA) and copolymer of L-glutamic acid and L-tyrosine (GT), and limiting doses of 2,4-dinitrophenyl guinea pig serum albumin (DNP-GPA) was surveyed in new inbred strains of guinea pigs, JY 1, JY 2, JY 9 and JY 10, established in this Institute. The PLL gene was not found in any of the guinea pigs. The GA gene was found in JY 1 and JY 2 guinea pigs and the GT gene in all the guinea pigs. The gene controlling responsiveness to low doses (1 microgram) of DNP-GPA was found in JY 1, JY 9 and JY 10 guinea pigs. The associated (Ia) antigens was discussed.

Vaccination with dendritic cells pulsed with hepatitis C pseudo particles induces specific immune responses in mice

PubMed Central

Weigand, Kilian; Voigt, Franziska; Encke, Jens; Hoyler, Birgit; Stremmel, Wolfgang; Eisenbach, Christoph

2012-01-01

AIM: To explore dendritic cells (DCs) multiple functions in immune modulation. METHODS: We used bone-marrow derived dendritic cells from BALB/c mice pulsed with pseudo particles from the hepatitis C virus to vaccinate naive BALB/c mice. Hepatitis C virus (HCV) pseudo particles consist of the genotype 1b derived envelope proteins E1 and E2, covering a non-HCV core structure. Thus, not a single epitope, but the whole “viral surface” induces immunogenicity. For vaccination, mature and activated DC were injected subcutaneously twice. RESULTS: Humoral and cellular immune responses measured by enzyme-linked immunosorbent assay and interferon-gamma enzyme-linked immunosorbent spot test showed antibody production as well as T-cells directed against HCV. Furthermore, T-cell responses confirmed two highly immunogenic regions in E1 and E2 outside the hypervariable region 1. CONCLUSION: Our results indicate dendritic cells as a promising vaccination model for HCV infection that should be evaluated further. PMID:22371638

Kill: boosting HIV-specific immune responses.

PubMed

Trautmann, Lydie

2016-07-01

Increasing evidence suggests that purging the latent HIV reservoir in virally suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV-infected cells ('Shock and Kill' strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in-vivo and in-silico models to accelerate the design of new clinical trials. New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment.

Kill: Boosting HIV-specific immune responses

PubMed Central

Trautmann, Lydie

2016-01-01

Purpose of review Increasing evidences suggest that purging the latent HIV reservoir in virally-suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV infected cells (“Shock and Kill” strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent findings Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in vivo and in silico models to accelerate the design of new clinical trials. Summary New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment. PMID:27054280

Gut microbiome and innate immune response patterns in IgE-associated eczema.

PubMed

West, C E; Rydén, P; Lundin, D; Engstrand, L; Tulic, M K; Prescott, S L

2015-09-01

Gut microbiome patterns have been associated with predisposition to eczema potentially through modulation of innate immune signalling. We examined gut microbiome development in the first year of life in relation to innate immune responses and onset of IgE-associated eczema over the first 2.5 years in predisposed children due to maternal atopy [www.anzctr.org.au, trial ID ACTRN12606000280505]. Microbial composition and diversity were analysed with barcoded 16S rRNA 454 pyrosequencing in stool samples in pregnancy and at ages 1 week, 1 month and 12 months in infants (n = 10) who developed IgE-associated eczema and infants who remained free of any allergic symptoms at 2.5 years of age (n = 10). Microbiome data at 1 week and 1 month were analysed in relation to previously assessed immune responses to TLR 2 and 4 ligands at 6 months of age. The relative abundance of Gram-positive Ruminococcaceae was lower at 1 week of age in infants developing IgE-associated eczema, compared with controls (P = 0.0047). At that age, the relative abundance of Ruminococcus was inversely associated with TLR2 induced IL-6 (-0.567, P = 0.042) and TNF-α (-0.597, P = 0.032); there was also an inverse association between the abundance of Proteobacteria (comprising Gram-negative taxa) and TLR4-induced TNF-α (rs = -0.629, P = 0.024). This relationship persisted at 1 month, with inverse associations between the relative abundance of Enterobacteriaceae (within the Proteobacteria phylum) and TLR4-induced TNF-α (rs = -0.697, P = 0.038) and Enterobacteriaceae and IL-6 (rs = -0.709, P = 0.035). Mothers whose infants developed IgE-associated eczema had lower α-diversity of Bacteroidetes (P = 0.04) although this was not seen later in their infants. At 1 year, α-diversity of Actinobacteria was lower in infants with IgE-associated eczema compared with controls (P = 0.002). Our findings suggest that reduced relative abundance of potentially immunomodulatory gut bacteria is associated with exaggerated

Modulation of Specific and Allergy-Related Immune Responses by Helminths

PubMed Central

Daniłowicz-Luebert, Emilia; O'Regan, Noëlle L.; Steinfelder, Svenja; Hartmann, Susanne

2011-01-01

Helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective Th2-type responses and favour long-term persistence. Such evasion mechanisms ensure mutual survival of both the parasite and the host. In this paper, we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection. We discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation. We also examine recent findings on helminth-derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti-inflammatory therapeutics. PMID:22219659

Vaccination Enhances Early Immune Responses in White Shrimp Litopenaeus vannamei after Secondary Exposure to Vibrio alginolyticus

PubMed Central

Lin, Yong-Chin; Chen, Jiann-Chu; Morni, Wan Zabidii W.; Putra, Dedi Fazriansyah; Huang, Chien-Lun; Li, Chang-Che; Hsieh, Jen-Fang

2013-01-01

Background Recent work suggested that the presence of specific memory or some form of adaptive immunity occurs in insects and shrimp. Hypervariable pattern recognition molecules, known as Down syndrome cell adhesion molecules, are able to mount specific recognition, and immune priming in invertebrates. In the present study, we attempted to understand the immune response pattern of white shrimp Litopenaeus vannamei which received primary (PE) and secondary exposure (SE) to Vibrio alginolyticus. Methodology Immune parameters and proliferation of haematopoietic tissues (HPTs) of shrimp which had received PE and SE to V. alginolyticus were measured. In the PE trial, the immune parameters and proliferation of HPTs of shrimp that received heat-killed V. alginolyticus (HVa) and formalin-inactivated V. alginolyticus (FVa) were measured. Mortality, immune parameters and proliferation of HPTs of 7-day-HVa-PE shrimp (shrimp that received primary exposure to HVa after 7 days) and 7-day-FVa-PE shrimp (shrimp that received primary exposure to FVa after 7 days) following SE to live V. alginolyticus (LVa) were measured. Phagocytic activity and clearance efficiency were examined for the 7∼35-day-HVa-PE and FVa-PE shrimp. Results HVa-receiving shrimp showed an earlier increase in the immune response on day 1, whereas FVa-receiving shrimp showed a late increase in the immune response on day 5. The 7-day-FVa-PE shrimp showed enhancement of immunity when encountering SE to LVa, whereas 7-day-HVa-PE shrimp showed a minor enhancement in immunity. 7-day-FVa-PE shrimp showed higher proliferation and an HPT mitotic index. Both phagocytic activity and clearance maintained higher for both HVa-PE and FVa-PE shrimp after 28 days. Conclusions HVa- and FVa-receiving shrimp showed the bacteria agglutinated prior to being phagocytised. FVa functions as a vaccine, whereas HVa functions as an inducer and can be used as an immune adjuvant. A combined mixture of FVa and HVa can serve as a �

Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation

PubMed Central

Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.

1978-01-01

A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541

Immune oncology, immune responsiveness and the theory of everything.

PubMed

Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue

2018-06-05

Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

The Regulation of Polysaccharide Specific Humoral Immune Response Against Intact Streptococcus Pneumoniae

DTIC Science & Technology

2008-06-19

Attanavanich, K . and J. F. Kearney (2004). "Marginal zone, but not follicular B cells, are potent activators of naive CD4 T cells." J Immunol 172(2): 803-11...resistance in B cells." J Immunol 157(7): 2749-53. Fujita, T., K . Inoue, et al. (1994). "Fungal metabolites. Part 11. A potent immunosuppressive activity...Girkontaite, I., K . Missy, et al. (2001). "Lsc is required for marginal zone B cells, regulation of lymphocyte motility and immune responses." Nat

Transplacental rotavirus IgG interferes with immune response to live oral rotavirus vaccine ORV-116E in Indian infants.

PubMed

Appaiahgari, Mohan Babu; Glass, Roger; Singh, Shakti; Taneja, Sunita; Rongsen-Chandola, Temsunaro; Bhandari, Nita; Mishra, Sukhdev; Vrati, Sudhanshu

2014-02-03

The lower immune response and efficacy of live oral rotavirus (RV) vaccines tested in developing countries may be due in part to high levels of pre-existing RV antibodies transferred to the infant from mother via the placenta. The candidate RV vaccine strain 116E was isolated from a newborn indicating that it might grow well even in the presence of this transplacental rotavirus antibody. Since the immune response to this vaccine among infants in the Indian subcontinent has been greater than that of the commercially licensed vaccines, we questioned whether this might be due to the ability of RV 116E to grow well in infants despite the presence of maternal RV antibody. To this end, we tested pre-immunization sera from Indian infants enrolled in a phase Ia/IIb trial of candidate RV vaccine ORV-116E for transplacental RV IgG to see whether it affected the immune responses and seroconversion to the vaccine. We found that the high titers of transplacental RV IgG diminished the immune responses of infants to ORV-116E vaccine. However, the vaccine was able to overcome the inhibitory effect of this RV IgG in a dose-dependent manner. This report clearly demonstrates the interference of maternal antibody on RV vaccine immunogenicity in infants in a field study as well as the ability of ORV-116E to overcome this interference when used at a higher dose. Copyright © 2013. Published by Elsevier Ltd.

Transcriptomics of the Vaccine Immune Response: Priming With Adjuvant Modulates Recall Innate Responses After Boosting.

PubMed

Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata

2018-01-01

Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream

Humoral Immune Response against Neural Antigens and Its Effects on Cognition in Lung Cancer Patients.

PubMed

Rybacka-Mossakowska, J; Ramlau, R; Gazdulska, J; Gołda-Gocka, I; Kozubski, W; Michalak, S

2016-01-01

Cognitive impairment develops as a clinical manifestation of immune-mediated indirect effects of malignancy in lung cancer patients. This study aimed to evaluate the effects of humoral immune response on cognition in lung cancer patients. Fifty-one lung cancer patients were subjected to neurological examination: Mini Mental State Examination (MMSE), Trail Making Test (TMT), and Hamilton scale. The Psychology Experiment Building Language software was used for the evaluation of digit span, simple reaction time (SRT), and choice reaction time (CRT) tests. Serum samples were tested for the presence of onconeuronal antibodies and antineural antibodies. The results demonstrate that autoantibodies were found in 31 % patients. MMSE scores were lower (26.7 ± 2.7) in seropositive patients than in seronegative subjects (28.7 ± 1.2; p = 0.013). Executive functions were also influenced by the presence of autoantibodies. The humoral immune response in lung cancer patients affected both SRT and CRT. We conclude that the humoral immune response in lung cancer patients is associated with cognitive impairment. Cognitive impairment is associated with both specific reactions against onconeuronal or antineural antigens and non-organ specific reactions against nucleosome antigens.

Gelatin-specific cellular immune responses persist for more than 3 years after priming with gelatin containing DTaP vaccine.

PubMed

Kumagai, T; Kamada, M; Igarashi, C; Yuri, K; Furukawa, H; Nagata, N; Saito, A; Okui, T; Yano, S

2002-10-01

Gelatin-specific cell-mediated immunity develops in subjects inoculated with gelatin containing DTaP vaccine. However, it is not yet known whether such established sensitization to gelatin disappears or persists with time. The aim of this study was to follow the patients with gelatin sensitization elicited by DTaP vaccination for their lymphocyte responsiveness and IgE, IgG antibody specific to gelatin over several years and to compare the activities with those at the time of enrollment into the study. We studied 28 subjects who developed positive lymphocyte proliferation test (LPT) after receiving gelatin containing DTaP vaccine and eight subjects who had a negative LPT after inoculation of non-gelatin DTaP. Determination of IgE, IgG antibodies and specific lymphoproliferative response directed against gelatin were performed at enrollment and on follow up. None of the subjects had antibody to gelatin at enrollment and none developed gelatin IgE or IgG during follow-up. There was no significant difference in the SIs of the subjects receiving gelatin DTaP (P = 0.150, 95% CI, -0.198-0.032), whereas lymphocyte activity to gelatin increased between enrollment and follow-up in the subjects with non-gelatin DTaP (P = 0.011, 95% CI, 0.063-0.338). Gelatin-specific lymphocyte activity persists at comparable levels for more than 3 years in subjects who acquire a positive LPT response to gelatin after receiving primary DTaP vaccine containing gelatin. Furthermore, five out of eight subjects initially with negative LPT to gelatin have been shown to acquire specific LPT with time.

B cell function in the immune response to helminths

PubMed Central

Harris, Nicola

2010-01-01

Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556

Monoclonal antibodies for the measurement of class-specific antibody responses in the green turtle, Chelonia mydas.

PubMed

Herbst, L H; Klein, P A

1995-06-01

Monoclonal antibodies (Mabs) were developed against the known immunoglobulin classes of the green turtle, Chelonia mydas. Plasma protein fractions enriched for 5.7S IgY, 7S IgY, and IgM turtle immunoglobulins were used to immunize Balb/c mice for hybridoma production and for hybridoma screening. Fifteen hybridomas produced Mabs with specificity for turtle immunoglobulins and for affinity purified dinitrophenol (DNP) specific turtle antibodies. Three Mabs specific for either turtle 5.7S IgY heavy chain (HL814), 7S IgY heavy chain (HL857), or IgM heavy chain (HL846) were purified and used in an enzyme-linked immunosorbent assay (ELISA) to measure antibody responses in two turtles immunized with 2,4-dinitrophenylated bovine serum albumin (DNP-BSA) over a 10 month period. In both turtles the 7S IgY antibody response developed within 5 weeks of the first inoculation and remained high over the following 9 months. The 5.7S IgY antibody response was detected in one turtle at 3-4 months and in the other at 8 months, and reached high levels in both individuals by 10 months. The IgM responses were difficult to interpret. One turtle had pre-inoculation anti-DNP IgM antibody in its plasma and the other developed only a weak, transient response at about 4 months. The class-specific antibody activity in immune turtle plasma could be strongly inhibited by soluble DNP or by rabbit anti-DNP specific antiserum, showing that these antibody responses were directed predominantly to the DNP hapten on the DNP-BSA antigen. Antibody responses to the BSA carrier could not be detected in either turtle over the course of the immunization. Mab HL814, specific for an epitope on the 5.7S green turtle immunoglobulin heavy chain, will be useful for characterizing the molecular relationships of 5.7S, 7S and IgM heavy chains and the role of 5.7S antibody in humoral immunity in this species. All anti-turtle Ig Mabs were screened against the plasma globulins of Loggerhead (Caretta caretta), Olive

Control of SIV infection and subsequent induction of pandemic H1N1 immunity in rhesus macaques using an Ad5 [E1-, E2b-] vector platform.

PubMed

Gabitzsch, Elizabeth S; Balint-Junior, Joseph P; Xu, Younong; Balcaitis, Stephanie; Sanders-Beer, Brigitte; Karl, Julie; Weinhold, Kent J; Paessler, Slobodan; Jones, Frank R

2012-11-26

Anti-vector immunity mitigates immune responses induced by recombinant adenovirus vector vaccines, limiting their prime-boost capabilities. We have developed a novel gene delivery and expression platform (Ad5 [E1-, E2b-]) that induces immune responses despite pre-existing and/or developed concomitant Ad5 immunity. In the present study, we evaluated if this new Ad5 platform could overcome the adverse condition of pre-existing Ad5 immunity to induce effective immune responses in prime-boost immunization regimens against two different infectious diseases in the same animal. Ad5 immune rhesus macaques (RM) were immunized multiple times with the Ad5 [E1-, E2b-] platform expressing antigens from simian immunodeficiency virus (SIV). Immunized RM developed cell-mediated immunity against SIV antigens Gag, Pol, Nef and Env as well as antibody against Env. Vaccinated and vector control RMs were challenged intra-rectally with homologous SIVmac239. During a 7-week follow-up, there was perturbation of SIV load in some immunized RM. At 7 weeks post-challenge, eight immunized animals (53%) did not have detectable SIV, compared to two RM controls (13%) (P<0.02; log-rank Mantel-Cox test). There was no correlation of protective MHC contributing to infection control. The RM without detectable circulating SIV, now hyper immune to Ad5, were then vaccinated with the same Ad5 [E1-, E2b-] platform expressing H1N1 influenza hemagglutinin (HA). Thirty days post Ad5 [E1-, E2b-]-HA vaccination, significant levels of influenza neutralizing antibody were induced in all animals that increased after an Ad5 [E1-, E2b-]-HA homologous boost. These data demonstrate the versatility of this new vector platform to immunize against two separate disease targets in the same animal despite the presence of immunity against the delivery platform, permitting homologous repeat immunizations with an Ad5 gene delivery platform. Copyright © 2012 Elsevier Ltd. All rights reserved.

Dependence of the immune response to coccidiosis on the age of rabbit suckling.

PubMed

Pakandl, Michal; Hlásková, Lenka; Poplstein, Martin; Chromá, Vera; Vodicka, Tomás; Salát, Jirí; Mucksová, Jitka

2008-11-01

To study the immune response to coccidiosis, the suckling rabbits were inoculated with 2,000 oocysts of either Eimeria intestinalis or Eimeria flavescens at 19, 22, 25, 29, and 33 days of age (DA) and in the case of E. intestinalis at 14 and 16 DA as well and sacrificed 14 days later. Another group served as an uninfected control and the rabbits were killed at the same age as their infected counterparts. Unlike the antibody response, the parameters reflecting cellular immunity (total number of leukocytes in mesenteric lymph nodes, lymphocyte proliferation upon stimulation with specific antigen and the dynamics of CD4+ and CD8+ cell proportions in the intestinal epithelium at the specific site of parasite development) were significantly changed from about 25 DA onwards. In contrast to the rabbits infected with weakly immunogenic coccidium E. flavescens, the proportions of CD4+ and CD8+ lymphocytes in intraepithelial lymphocytes from the specific site of parasite development were considerably changed after infection with highly immunogenic species E. intestinalis. As the immune system of sucklings from about 25 DA reacts to the infection, this age may be considered in terms of vaccination against coccidiosis.

Testing the "toxin hypothesis of allergy": Mast cells, IgE, and innate and acquired immune responses to venoms*

PubMed Central

Tsai, Mindy; Starkl, Philipp; Marichal, Thomas; Galli, Stephen J.

2015-01-01

Summary Work in mice indicates that innate functions of mast cells, particularly degradation of venom toxins by mast cell-derived proteases, can enhance resistance to certain arthropod or reptile venoms. Recent reports indicate that acquired Th2 immune responses associated with the production of IgE antibodies, induced by Russell’s viper venom or honeybee venom, or by a component of honeybee venom, bee venom phospholipase 2 (bvPLA2), can increase the resistance of mice to challenge with potentially lethal doses of either of the venoms or bvPLA2. These findings support the conclusion that, in contrast to the detrimental effects associated with allergic Th2 immune responses, mast cells and IgE-dependent immune responses to venoms can contribute to innate and adaptive resistance to venom-induced pathology and mortality. PMID:26210895

Immunization with the conjugate vaccine Vi-CRM₁₉₇ against Salmonella typhi induces Vi-specific mucosal and systemic immune responses in mice.

PubMed

Fiorino, Fabio; Ciabattini, Annalisa; Rondini, Simona; Pozzi, Gianni; Martin, Laura B; Medaglini, Donata

2012-09-21

Typhoid fever is a public health problem, especially among young children in developing countries. To address this need, a glycoconjugate vaccine Vi-CRM₁₉₇, composed of the polysaccharide antigen Vi covalently conjugated to the non-toxic mutant of diphtheria toxin CRM₁₉₇, is under development. Here, we assessed the antibody and cellular responses, both local and systemic, following subcutaneous injection of Vi-CRM₁₉₇. The glycoconjugate elicited Vi-specific serum IgG titers significantly higher than unconjugated Vi, with prevalence of IgG1 that persisted for at least 60 days after immunization. Vi-specific IgG, but not IgA, were present in intestinal washes. Lymphocytes proliferation after restimulation with Vi-CRM₁₉₇ was observed in spleen and mesenteric lymph nodes. These data confirm the immunogenicity of Vi-CRM₁₉₇ and demonstrate that the vaccine-specific antibody and cellular immune responses are present also in the intestinal tract, thus strengthening the suitability of Vi-CRM₁₉₇ as a promising candidate vaccine against Salmonella Typhi. Copyright © 2012 Elsevier Ltd. All rights reserved.

Mapping the interactome of HPV E6 and E7 oncoproteins with the ubiquitin-proteasome system.

PubMed

Poirson, Juline; Biquand, Elise; Straub, Marie-Laure; Cassonnet, Patricia; Nominé, Yves; Jones, Louis; van der Werf, Sylvie; Travé, Gilles; Zanier, Katia; Jacob, Yves; Demeret, Caroline; Masson, Murielle

2017-10-01

Protein ubiquitination and its reverse reaction, deubiquitination, regulate protein stability, protein binding activity, and their subcellular localization. These reactions are catalyzed by the enzymes E1, E2, and E3 ubiquitin (Ub) ligases and deubiquitinases (DUBs). The Ub-proteasome system (UPS) is targeted by viruses for the sake of their replication and to escape host immune response. To identify novel partners of human papillomavirus 16 (HPV16) E6 and E7 proteins, we assembled and screened a library of 590 cDNAs related to the UPS by using the Gaussia princeps luciferase protein complementation assay. HPV16 E6 was found to bind to the homology to E6AP C terminus-type Ub ligase (E6AP), three really interesting new gene (RING)-type Ub ligases (MGRN1, LNX3, LNX4), and the DUB Ub-specific protease 15 (USP15). Except for E6AP, the binding of UPS factors did not require the LxxLL-binding pocket of HPV16 E6. LNX3 bound preferentially to all high-risk mucosal HPV E6 tested, whereas LNX4 bound specifically to HPV16 E6. HPV16 E7 was found to bind to several broad-complex tramtrack and bric-a-brac domain-containing proteins (such as TNFAIP1/KCTD13) that are potential substrate adaptors of Cullin 3-RING Ub ligases, to RING-type Ub ligases implicated in innate immunity (RNF135, TRIM32, TRAF2, TRAF5), to the substrate adaptor DCAF15 of Cullin 4-RING Ub ligase and to some DUBs (USP29, USP33). The binding to UPS factors did not require the LxCxE motif but rather the C-terminal region of HPV16 E7 protein. The identified UPS factors interacted with most of E7 proteins across different HPV types. This study establishes a strategy for the rapid identification of interactions between host or pathogen proteins and the human ubiquitination system. © 2017 Federation of European Biochemical Societies.

The immune complex CTA1-DD/IgG adjuvant specifically targets connective tissue mast cells through FcγRIIIA and augments anti-HPV immunity after nasal immunization.

PubMed

Fang, Y; Zhang, T; Lidell, L; Xu, X; Lycke, N; Xiang, Z

2013-11-01

We have previously reported that CTA1-DD/IgG immune complexes augment antibody responses in a mast cell-dependent manner following intranasal (IN) immunizations. However, from a safety perspective, mast cell activation could preclude clinical use. Therefore, we have extended these studies and demonstrate that CTA1-DD/IgG immune complexes administered IN did not trigger an anaphylactic reaction. Importantly, CTA1-DD/IgE immune complexes did not activate mast cells. Interestingly, only connective tissue, but not mucosal, mast cells could be activated by CTA1-DD/IgG immune complexes. This effect was mediated by FcγRIIIA, only expressed on connective tissue mast cells, and found in the nasal submucosa. FcγRIIIA-deficient mice had compromised responses to immunization adjuvanted by CTA1-DD/IgG. Proof-of-concept studies revealed that IN immunized mice with human papillomavirus (HPV) type 16 L1 virus-like particles (VLP) and CTA1-DD/IgG immune complexes demonstrated strong and sustained specific antibody titers in serum and vaginal secretions. From a mast cell perspective, CTA1-DD/IgG immune complexes appear to be safe and effective mucosal adjuvants.

Differences in Kaposi sarcoma-associated herpesvirus-specific and herpesvirus-non-specific immune responses in classic Kaposi sarcoma cases and matched controls in Sicily.

PubMed

Amodio, Emanuele; Goedert, James J; Barozzi, Patrizia; Riva, Giovanni; Firenze, Alberto; Bonura, Filippa; Viviano, Enza; Romano, Nino; Luppi, Mario

2011-10-01

Kaposi sarcoma (KS) might develop because of incompetent immune responses, both non-specifically and specifically against the KS-associated herpesvirus (KSHV). Peripheral blood mononuclear cells from 15 classic (non-AIDS) KS cases, 13 KSHV seropositives (without KS) and 15 KSHV-seronegative controls were tested for interferon-γ T-cell (enzyme-linked immunospot [Elispot]) responses to KSHV-latency-associated nuclear antigen (LANA), KSHV-K8.1 and CMV/Epstein-Barr virus (EBV) peptide pools. The forearm and thigh of each participant was also tested for delayed-type hypersensitivity (DTH) against common recall antigens. Groups were compared with Fisher exact test and multinomial logistic regression to calculate odds ratios (OR) and 95% confidence intervals (CI). A KSHV Elispot response was detected in 10 (67%) classic KS cases, 11 (85%) KSHV seropositives (without KS) and two (13%) seronegative controls. All four cases with KSHV-LANA responses had current KS lesions, whereas five of six cases with KSHV-K8.1 responses had no lesions (P = 0.048). No case responded to both LANA and K8.1. Compared with the seronegative controls, the risk for classic KS was inversely related to DTH in the thigh (OR 0.71, 95% CI 0.55-0.94, P = 0.01), directly associated with DTH in the forearm (OR 1.35, 95% CI 1.02-1.80, P = 0.04) and tended to be increased fivefold per KSHV Elispot response (OR 5.13, 95% CI 0.86-30.77, P = 0.07). Compared with KSHV seropositives (without KS), the risk for classic KS was reduced fivefold (OR 0.20, CI 0.03-0.77, P = 0.04) per KSHV response. The CMV/EBV Elispot responses were irrelevant. Deficiency of both KSHV-specific and KSHV-non-specific immunity is associated with classic KS. This might clarify why Kaposi sarcoma responds to immune reconstitution. © 2011 Japanese Cancer Association and this article is a US Government work and is in the public domain in the USA.

Characterization of Specific Immune Responses to Different Aspergillus Antigens during the Course of Invasive Aspergillosis in Hematologic Patients

PubMed Central

Beauvais, Anne; Beau, Remi; Candoni, Anna; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Zanetti, Eleonora; Quadrelli, Chiara; Codeluppi, Mauro; Guaraldi, Giovanni; Pagano, Livio; Caira, Morena; Giovane, Cinzia Del; Maccaferri, Monica; Stefani, Alessandro; Morandi, Uliano; Tazzioli, Giovanni; Girardis, Massimo; Delia, Mario; Specchia, Giorgina; Longo, Giuseppe; Marasca, Roberto; Narni, Franco; Merli, Francesco; Imovilli, Annalisa; Apolone, Giovanni; Carvalho, Agostinho; Comoli, Patrizia; Romani, Luigina; Latgè, Jean Paul; Luppi, Mario

2013-01-01

Several studies in mouse model of invasive aspergillosis (IA) and in healthy donors have shown that different Aspergillus antigens may stimulate different adaptive immune responses. However, the occurrence of Aspergillus-specific T cells have not yet been reported in patients with the disease. In patients with IA, we have investigated during the infection: a) whether and how specific T-cell responses to different Aspergillus antigens occur and develop; b) which antigens elicit the highest frequencies of protective immune responses and, c) whether such protective T cells could be expanded ex-vivo. Forty hematologic patients have been studied, including 22 patients with IA and 18 controls. Specific T cells producing IL-10, IFN-γ, IL-4 and IL-17A have been characterized through enzyme linked immunospot and cytokine secretion assays on 88 peripheral blood (PB) samples, by using the following recombinant antigens: GEL1p, CRF1p, PEP1p, SOD1p, α1–3glucan, β1–3glucan, galactomannan. Specific T cells were expanded through short term culture. Aspergillus-specific T cells producing non-protective interleukin-10 (IL-10) and protective interferon-gamma (IFN-γ) have been detected to all the antigens only in IA patients. Lower numbers of specific T cells producing IL-4 and IL-17A have also been shown. Protective T cells targeted predominantly Aspergillus cell wall antigens, tended to increase during the IA course and to be associated with a better clinical outcome. Aspergillus-specific T cells could be successfully generated from the PB of 8 out of 8 patients with IA and included cytotoxic subsets able to lyse Aspergillus hyphae. Aspergillus specific T-cell responses contribute to the clearance of the pathogen in immunosuppressed patients with IA and Aspergillus cell wall antigens are those mainly targeted by protective immune responses. Cytotoxic specific T cells can be expanded from immunosuppressed patients even during the infection by using the above mentioned

The Verticillium-specific protein VdSCP7 localizes to the plant nucleus and modulates immunity to fungal infections.

PubMed

Zhang, Lisha; Ni, Hao; Du, Xuan; Wang, Sheng; Ma, Xiao-Wei; Nürnberger, Thorsten; Guo, Hui-Shan; Hua, Chenlei

2017-07-01

Fungal pathogens secrete effector proteins to suppress plant basal defense for successful colonization. Resistant plants, however, can recognize effectors by cognate R proteins to induce effector-triggered immunity (ETI). By analyzing secretomes of the vascular fungal pathogen Verticillium dahliae, we identified a novel secreted protein VdSCP7 that targets the plant nucleus. The green fluorescent protein (GFP)-tagged VdSCP7 gene with either a mutated nuclear localization signal motif or with additional nuclear export signal was transiently expressed in Nicotiana benthamiana, and investigated for induction of plant immunity. The role of VdSCP7 in V. dahliae pathogenicity was characterized by gene knockout and complementation, and GFP labeling. Expression of the VdSCP7 gene in N. benthamiana activated both salicylic acid and jasmonate signaling, and altered the plant's susceptibility to the pathogens Botrytis cinerea and Phytophthora capsici. The immune response activated by VdSCP7 was highly dependent on its initial extracellular secretion and subsequent nuclear localization in plants. Knockout of the VdSCP7 gene significantly enhanced V. dahliae aggressiveness on cotton. GFP-labeled VdSCP7 is secreted by V. dahliae and accumulates in the plant nucleus. We conclude that VdSCP7 is a novel effector protein that targets the host nucleus to modulate plant immunity, and suggest that plants can recognize VdSCP7 to activate ETI during fungal infection. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Immunization Elicits Antigen-Specific Antibody Sequestration in Dorsal Root Ganglia Sensory Neurons

PubMed Central

Gunasekaran, Manojkumar; Chatterjee, Prodyot K.; Shih, Andrew; Imperato, Gavin H.; Addorisio, Meghan; Kumar, Gopal; Lee, Annette; Graf, John F.; Meyer, Dan; Marino, Michael; Puleo, Christopher; Ashe, Jeffrey; Cox, Maureen A.; Mak, Tak W.; Bouton, Chad; Sherry, Barbara; Diamond, Betty; Andersson, Ulf; Coleman, Thomas R.; Metz, Christine N.; Tracey, Kevin J.; Chavan, Sangeeta S.

2018-01-01

The immune and nervous systems are two major organ systems responsible for host defense and memory. Both systems achieve memory and learning that can be retained, retrieved, and utilized for decades. Here, we report the surprising discovery that peripheral sensory neurons of the dorsal root ganglia (DRGs) of immunized mice contain antigen-specific antibodies. Using a combination of rigorous molecular genetic analyses, transgenic mice, and adoptive transfer experiments, we demonstrate that DRGs do not synthesize these antigen-specific antibodies, but rather sequester primarily IgG1 subtype antibodies. As revealed by RNA-seq and targeted quantitative PCR (qPCR), dorsal root ganglion (DRG) sensory neurons harvested from either naïve or immunized mice lack enzymes (i.e., RAG1, RAG2, AID, or UNG) required for generating antibody diversity and, therefore, cannot make antibodies. Additionally, transgenic mice that express a reporter fluorescent protein under the control of Igγ1 constant region fail to express Ighg1 transcripts in DRG sensory neurons. Furthermore, neural sequestration of antibodies occurs in mice rendered deficient in neuronal Rag2, but antibody sequestration is not observed in DRG sensory neurons isolated from mice that lack mature B cells [e.g., Rag1 knock out (KO) or μMT mice]. Finally, adoptive transfer of Rag1-deficient bone marrow (BM) into wild-type (WT) mice or WT BM into Rag1 KO mice revealed that antibody sequestration was observed in DRG sensory neurons of chimeric mice with WT BM but not with Rag1-deficient BM. Together, these results indicate that DRG sensory neurons sequester and retain antigen-specific antibodies released by antibody-secreting plasma cells. Coupling this work with previous studies implicating DRG sensory neurons in regulating antigen trafficking during immunization raises the interesting possibility that the nervous system collaborates with the immune system to regulate antigen-mediated responses. PMID:29755449

Administration of HPV DNA vaccine via electroporation elicits the strongest CD8+ T cell immune responses compared to intramuscular injection and intradermal gene gun delivery

PubMed Central

Best, Simon R.; Peng, Shiwen; Juang, Chi-Mou; Hung, Chien-Fu; Hannaman, Drew; Saunders, John R.; Wu, T.-C.; Pai, Sara I.

2009-01-01

DNA vaccines are an attractive approach to eliciting antigen-specific immunity. Intracellular targeting of tumor antigens through its linkage to immunostimulatory molecules such as calreticulin (CRT) can improve antigen processing and presentation through the MHC Class I pathway and increase cytotoxic CD8+ T cell production. However, even with these enhancements, the efficacy of such immunotherapeutic strategies is dependent on the identification of an effective route and method of DNA administration. Electroporation and gene gun-mediated particle delivery are leading methods of DNA vaccine delivery that can generate protective and therapeutic levels of immune responses in experimental models. In this study, we perform a head-to-head comparison of three methods of vaccination – conventional intramuscular injection, electroporation mediated intramuscular delivery, and epidermal gene gun-mediated particle delivery - in the ability to generate antigen specific cytotoxic CD8+ T cell responses as well as anti-tumor immune responses against an HPV-16 E7 expressing tumor cell line using the pNGVL4a-CRT/E7(detox) DNA vaccine. Vaccination via electroporation generated the highest number of E7-specific cytotoxic CD8+ T cells, which correlated to improved outcomes in the treatment of growing tumors. In addition, we demonstrate that electroporation results in significantly higher levels of circulating protein compared to gene gun or intramuscular vaccination, which likely enhances calreticulin’s role as a local tumor anti-angiogenesis agent. We conclude that electroporation is a promising method for delivery of HPV DNA vaccines and should be considered for DNA vaccine delivery in human clinical trials. PMID:19622402

Suppression of antigen-specific antibody responses in mice ...

EPA Pesticide Factsheets

T-cell-dependent antibody responses (TDAR) are suppressed in female C57BL/6N mice exposed to ≥3.75 mg/kg of perfluorooctanoic acid (PFOA) for 15 days. To determine if suppression of humoral immunity by PFOA is peroxisome proliferator activated receptor alpha (PPARa)-dependent and if suppression is associated with specific targeting of T- or B-cells, three separate experiments were conducted: (1) female PPARa constitutive knockout (PPARa KO; B6.129S4-Ppar(tm1Gonz)N12) and wild-type controls (WT; C57BL/6-Tac) exposed to 0, 7.5, or 30 mg PFOA/kg for 15 days were immunized on Day 11 with a T-cell-dependent antigen and sera then collected for measures of antigen-specific lgM titers (TDAR) 5 days later; (2) female C57BL/6N WT mice exposed to 0, 0.94, 1.88, 3.75, or 7.5mg PFOA/kg for 15 days were immunized with a T-cell-independent antigen on Day 11 and sera were then collected foranalyses of antigen-specific lgM titers (TIAR) 7 days later; and (3) splenic lymphocyte phenotypes were assessed in unimmunized female C57BL/6N WT mice exposed to 0, 3.75, or 7.5 mg PFOA/kg for 10 days to investigate effects of PFOA in the absence of specific immunization. Separate groups of mice were immunized with a T-cell-dependent antigen after 11 days of exposure and splenic lymphocyte sub-populations were assessed after 13 or 15 days of exposure to assess numbers of stimulated cells. The results indicated that exposure to ≥1.88mg PFOA/kg suppressed the TIAR; exposure to 30 mg PFOA/k

Synergies between vaccination and dietary arginine and glutamine supplementation improve the immune response of channel catfish against Edwardsiella ictaluri.

PubMed

Pohlenz, Camilo; Buentello, Alejandro; Criscitiello, Michael F; Mwangi, Waithaka; Smith, Roger; Gatlin, Delbert M

2012-09-01

Channel catfish was used to investigate the enhancement of vaccine efficacy following dietary supplementation with arginine (ARG, 4% of diet), glutamine (GLN, 2% of diet), or a combination of both. After vaccination against Edwardsiella ictaluri, humoral and cellular immune responses, along with lymphoid organ responses were evaluated. E. ictaluri-specific antibody titers in plasma were higher (P < 0.05) in fish fed the supplemented diets compared to those fed the basal diet as early as 7 d post-vaccination (dpv). B-cell proportion in head-kidney was higher (P < 0.05) at 14 dpv in vaccinated fish fed the GLN diet. The responsiveness of spleen and head-kidney lymphocytes against E. ictaluri was enhanced (P < 0.05) by dietary supplementation of ARG or GLN at 14 dpv. Additionally, at 7 dpv, vaccinated fish fed the GLN diet had higher (P < 0.05) head kidney weights relative to the other dietary treatments, and vaccinated fish fed ARG-supplemented diets had higher (P < 0.05) protein content in this tissue. Results from this study suggest that dietary supplementation of ARG and GLN may improve specific cellular and humoral mechanisms, enhancing the acquired immunity in vaccinated channel catfish. Copyright © 2012 Elsevier Ltd. All rights reserved.

Host Immune Response to Influenza A Virus Infection.

PubMed

Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long

2018-01-01

Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.

Pig model mimicking chronic hepatitis E virus infection in immunocompromised patients to assess immune correlates during chronicity

PubMed Central

Cao, Dianjun; Cao, Qian M.; Subramaniam, Sakthivel; Yugo, Danielle M.; Heffron, C. Lynn; Rogers, Adam J.; Kenney, Scott P.; Tian, Debin; Matzinger, Shannon R.; Overend, Christopher; Catanzaro, Nicholas; LeRoith, Tanya; Wang, Heng; Piñeyro, Pablo; Lindstrom, Nicole; Clark-Deener, Sherrie; Yuan, Lijuan; Meng, Xiang-Jin

2017-01-01

Chronic hepatitis E virus (HEV) infection is a significant clinical problem in immunocompromised individuals such as organ transplant recipients, although the mechanism remains unknown because of the lack of an animal model. We successfully developed a pig model of chronic HEV infection and examined immune correlates leading to chronicity. The conditions of immunocompromised patients were mimicked by treating pigs with an immunosuppressive regimen including cyclosporine, azathioprine, and prednisolone. Immunocompromised pigs infected with HEV progressed to chronicity, because 8/10 drug-treated HEV-infected pigs continued fecal virus shedding beyond the acute phase of infection, whereas the majority (7/10) of mock-treated HEV-infected pigs cleared fecal viral shedding at 8 wk postinfection. During chronic infection, serum levels of the liver enzyme γ-glutamyl transferase and fecal virus shedding were significantly higher in immunocompromised HEV-infected pigs. To identify potential immune correlates of chronic infection, we determined serum levels of cytokines and cell-mediated immune responses in pigs. Results showed that HEV infection of immunocompromised pigs reduced the serum levels of Th1 cytokines IL-2 and IL-12, and Th2 cytokines IL-4 and IL-10, particularly during the acute phase of infection. Furthermore IFN-γ–specific CD4+ T-cell responses were reduced in immunocompromised pigs during the acute phase of infection, but TNF-α–specific CD8+ T-cell responses increased during the chronic phase of infection. Thus, active suppression of cell-mediated immune responses under immunocompromised conditions may facilitate the establishment of chronic HEV infection. This pig model will aid in delineating the mechanisms of chronic HEV infection and in developing effective therapeutics against chronic hepatitis E. PMID:28630341

Pig model mimicking chronic hepatitis E virus infection in immunocompromised patients to assess immune correlates during chronicity.

PubMed

Cao, Dianjun; Cao, Qian M; Subramaniam, Sakthivel; Yugo, Danielle M; Heffron, C Lynn; Rogers, Adam J; Kenney, Scott P; Tian, Debin; Matzinger, Shannon R; Overend, Christopher; Catanzaro, Nicholas; LeRoith, Tanya; Wang, Heng; Piñeyro, Pablo; Lindstrom, Nicole; Clark-Deener, Sherrie; Yuan, Lijuan; Meng, Xiang-Jin

2017-07-03

Chronic hepatitis E virus (HEV) infection is a significant clinical problem in immunocompromised individuals such as organ transplant recipients, although the mechanism remains unknown because of the lack of an animal model. We successfully developed a pig model of chronic HEV infection and examined immune correlates leading to chronicity. The conditions of immunocompromised patients were mimicked by treating pigs with an immunosuppressive regimen including cyclosporine, azathioprine, and prednisolone. Immunocompromised pigs infected with HEV progressed to chronicity, because 8/10 drug-treated HEV-infected pigs continued fecal virus shedding beyond the acute phase of infection, whereas the majority (7/10) of mock-treated HEV-infected pigs cleared fecal viral shedding at 8 wk postinfection. During chronic infection, serum levels of the liver enzyme γ-glutamyl transferase and fecal virus shedding were significantly higher in immunocompromised HEV-infected pigs. To identify potential immune correlates of chronic infection, we determined serum levels of cytokines and cell-mediated immune responses in pigs. Results showed that HEV infection of immunocompromised pigs reduced the serum levels of Th1 cytokines IL-2 and IL-12, and Th2 cytokines IL-4 and IL-10, particularly during the acute phase of infection. Furthermore IFN-γ-specific CD4 + T-cell responses were reduced in immunocompromised pigs during the acute phase of infection, but TNF-α-specific CD8 + T-cell responses increased during the chronic phase of infection. Thus, active suppression of cell-mediated immune responses under immunocompromised conditions may facilitate the establishment of chronic HEV infection. This pig model will aid in delineating the mechanisms of chronic HEV infection and in developing effective therapeutics against chronic hepatitis E.

Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis.

PubMed

Gao, Bo; Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-Hua; Xue, Dongbo

2017-01-01

Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including "immune response" as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma.

Adaptive Evolution as a Predictor of Species-Specific Innate Immune Response.

PubMed

Webb, Andrew E; Gerek, Z Nevin; Morgan, Claire C; Walsh, Thomas A; Loscher, Christine E; Edwards, Scott V; O'Connell, Mary J

2015-07-01

It has been proposed that positive selection may be associated with protein functional change. For example, human and macaque have different outcomes to HIV infection and it has been shown that residues under positive selection in the macaque TRIM5α receptor locate to the region known to influence species-specific response to HIV. In general, however, the relationship between sequence and function has proven difficult to fully elucidate, and it is the role of large-scale studies to help bridge this gap in our understanding by revealing major patterns in the data that correlate genotype with function or phenotype. In this study, we investigate the level of species-specific positive selection in innate immune genes from human and mouse. In total, we analyzed 456 innate immune genes using codon-based models of evolution, comparing human, mouse, and 19 other vertebrate species to identify putative species-specific positive selection. Then we used population genomic data from the recently completed Neanderthal genome project, the 1000 human genomes project, and the 17 laboratory mouse genomes project to determine whether the residues that were putatively positively selected are fixed or variable in these populations. We find evidence of species-specific positive selection on both the human and the mouse branches and we show that the classes of genes under positive selection cluster by function and by interaction. Data from this study provide us with targets to test the relationship between positive selection and protein function and ultimately to test the relationship between positive selection and discordant phenotypes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Epitope-Specific Evolution of Human B Cell Responses to Borrelia burgdorferi VlsE Protein from Early to Late Stages of Lyme Disease.

PubMed

Jacek, Elzbieta; Tang, Kevin S; Komorowski, Lars; Ajamian, Mary; Probst, Christian; Stevenson, Brian; Wormser, Gary P; Marques, Adriana R; Alaedini, Armin

2016-02-01

Most immunogenic proteins of Borrelia burgdorferi, the causative agent of Lyme disease, are known or expected to contain multiple B cell epitopes. However, the kinetics of the development of human B cell responses toward the various epitopes of individual proteins during the course of Lyme disease has not been examined. Using the highly immunogenic VlsE as a model Ag, we investigated the evolution of humoral immune responses toward its immunodominant sequences in 90 patients with a range of early to late manifestations of Lyme disease. The results demonstrate the existence of asynchronous, independently developing, Ab responses against the two major immunogenic regions of the VlsE molecule in the human host. Despite their strong immunogenicity, the target epitopes were inaccessible to Abs on intact spirochetes, suggesting a lack of direct immunoprotective effect. These observations document the association of immune reactivity toward specific VlsE sequences with different phases of Lyme disease, demonstrating the potential use of detailed epitope mapping of Ags for staging of the infection, and offer insights regarding the pathogen's possible immune evasion mechanisms. Copyright © 2016 by The American Association of Immunologists, Inc.

Testing the 'toxin hypothesis of allergy': mast cells, IgE, and innate and acquired immune responses to venoms.

PubMed

Tsai, Mindy; Starkl, Philipp; Marichal, Thomas; Galli, Stephen J

2015-10-01

Work in mice indicates that innate functions of mast cells, particularly degradation of venom toxins by mast cell-derived proteases, can enhance resistance to certain arthropod or reptile venoms. Recent reports indicate that acquired Th2 immune responses associated with the production of IgE antibodies, induced by Russell's viper venom or honeybee venom, or by a component of honeybee venom, bee venom phospholipase 2 (bvPLA2), can increase the resistance of mice to challenge with potentially lethal doses of either of the venoms or bvPLA2. These findings support the conclusion that, in contrast to the detrimental effects associated with allergic type 2 (Th2) immune responses, mast cells and IgE-dependent immune responses to venoms can contribute to innate and adaptive resistance to venom-induced pathology and mortality. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nonlytic Fc-fused IL-7 synergizes with Mtb32 DNA vaccine to enhance antigen-specific T cell responses in a therapeutic model of tuberculosis.

PubMed

Ahn, So-Shin; Jeon, Bo-Young; Park, Seong-Jeong; Choi, Dong-Hoon; Ku, Sun-Hwa; Cho, Sang-Nae; Sung, Young-Chul

2013-06-12

Improvement to the immunogenicity of DNA vaccines was evaluated in a Mycobacterium tuberculosis (MTB) infection mouse model examining the combined effects of nonlytic Fc-fused IL-7 DNA (IL-7-nFc) and Flt3-ligand fused Mtb32 (F-Mtb32) DNA. Mice were treated with conventional chemotherapy for 6 weeks from 4 weeks after aerosol infection of MTB. Following the start of chemotherapy, DNA immunizations were administered five times with 2-week intervals. Coadministration of IL-7-nFc and F-Mtb32 DNA given during chemotherapy synergistically enhanced the magnitude of Mtb32-specific T cell responses and sustained for one-year after the last immunization assessed by IFN-γ ELISPOT assay. After dexamethasone treatment, a significantly reduced MTB reactivation was observed in mice received both IL-7-nFc and F-Mtb32 DNA, compared with F-MTb32 DNA alone or with control mice. In addition, mice treated with IL-7-nFc and F-Mtb32 DNA together showed improved lung pathology and reduced pulmonary inflammation values relative to F-Mtb32 DNA or saline injected mice. Intracellular cytokine staining revealed that the protection levels induced by combination therapy with IL-7-nFc and F-Mtb32 DNA was associated with enhanced Mtb32-specific IFN-γ secreting CD4(+) T cell responses and CD8(+) T cell responses stimulated with CTL epitope peptide in the lungs and spleens. These data suggest that IL-7-nFc as a novel TB adjuvant may facilitate therapeutic TB DNA vaccine to the clinics through significant enhancement of codelivered DNA vaccine-induced T cell immunity. Copyright © 2013 Elsevier Ltd. All rights reserved.

Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route.

PubMed

Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C

2014-08-21

Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.

Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

PubMed Central

Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

2014-01-01

Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082

Memory and Specificity in the Insect Immune System: Current Perspectives and Future Challenges.

PubMed

Cooper, Dustin; Eleftherianos, Ioannis

2017-01-01

The immune response of a host to a pathogen is typically described as either innate or adaptive. The innate form of the immune response is conserved across all organisms, including insects. Previous and recent research has focused on the nature of the insect immune system and the results imply that the innate immune response of insects is more robust and specific than previously thought. Priming of the insect innate immune system involves the exposure of insects to dead or a sublethal dose of microbes in order to elicit an initial response. Comparing subsequent infections in primed insects to non-primed individuals indicates that the insect innate immune response may possess some of the qualities of an adaptive immune system. Although some studies demonstrate that the protective effects of priming are due to a "loitering" innate immune response, others have presented more convincing elements of adaptivity. While an immune mechanism capable of producing the same degree of recognition specificity as seen in vertebrates has yet to be discovered in insects, a few interesting cases have been identified and discussed.

Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas

USGS Publications Warehouse

Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.

2000-01-01

Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a

Species-Specific Immunity Induced by Infection with Entamoeba histolytica and Entamoeba moshkovskii in Mice

PubMed Central

Shimokawa, Chikako; Culleton, Richard; Imai, Takashi; Suzue, Kazutomo; Hirai, Makoto; Taniguchi, Tomoyo; Kobayashi, Seiki; Hisaeda, Hajime; Hamano, Shinjiro

2013-01-01

Entamoeba histolytica, the parasitic amoeba responsible for amoebiasis, causes approximately 100,000 deaths every year. There is currently no vaccine against this parasite. We have previously shown that intracecal inoculation of E. histolytica trophozoites leads to chronic and non-healing cecitis in mice. Entamoeba moshkovskii, a closely related amoeba, also causes diarrhea and other intestinal disorders in this model. Here, we investigated the effect of infection followed by drug-cure of these species on the induction of immunity against homologous or heterologous species challenge. Mice were infected with E. histolytica or E. moshkovskii and treated with metronidazole 14 days later. Re-challenge with E. histolytica or E. moshkovskii was conducted seven or 28 days following confirmation of the clearance of amoebae, and the degree of protection compared to non-exposed control mice was evaluated. We show that primary infection with these amoebae induces a species-specific immune response which protects against challenge with the homologous, but not a heterologous species. These findings pave the way, therefore, for the identification of novel amoebae antigens that may become the targets of vaccines and provide a useful platform to investigate host protective immunity to Entamoeba infections. PMID:24312397

Safety and efficacy of E coli enterotoxin adjuvant for urease-based rectal immunization against Helicobacter pylori.

PubMed

Sougioultzis, Stavros; Lee, Cynthia K; Alsahli, Mazen; Banerjee, Subhas; Cadoz, Michel; Schrader, Robert; Guy, Bruno; Bedford, Philip; Monath, Thomas P; Kelly, Ciaran P; Michetti, Pierre

2002-12-13

Low dose E. coli heat-labile enterotoxin (LT), delivered orally or enterically, has been used as an adjuvant for Helicobacter pylori (H. pylori) urease in healthy adults. In this study we aim to test the safety and adjuvant efficacy of LT delivered rectally together with recombinant H. pylori urease. Eighteen healthy adults without present or past H. pylori infection were enrolled in a double blind, randomized, ascending dose study to receive either urease (60 mg), or urease (60 mg) + LT (5 or 25 microg). The immunization preparation was administered per rectum on days 0, 14 and 28. Serum, stool and saliva anti-urease and anti-LT IgG and IgA antibodies (Abs) were measured and urease-specific and LT-specific antigen secreting cells (ASCs) were counted in peripheral blood at baseline and 7 (ASC counts) or 14 days (antibody levels) after each dosing. Peripheral blood lymphoproliferation assays were also performed at baseline and at the end of the study. Rectally delivered urease and LT were well tolerated. Among the 12 subjects assigned to urease+LT, 2 (16.7%) developed anti-urease IgG Abs, 1 (8.3%) developed anti-urease IgA Abs, and 3 (25%) showed urease-specific IgA(+) ASCs. Immune responses to LT were more vigorous, especially in subjects exposed to 5 microg LT. In the urease+ 5 microg LT group, anti-LT IgG and IgA Abs developed in 60 and 80% of the subjects, respectively, while LT-specific IgG(+) and IgA(+) ASCs were detected in all subjects. The magnitude of the anti-LT response was much higher than the response to urease. No IgA anti-urease or anti-LT Abs were detected in stool or saliva and lymphocyte proliferative responses to urease were unsatisfactory. In conclusion, rectal delivery of 5 microg LT is safe and induces vigorous systemic anti-LT immune responses. Further studies are needed to determine if LT can be an effective adjuvant for rectally delivered antigens.

Characterization of host immune responses in Ebola virus infections.

PubMed

Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

2014-06-01

Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis

PubMed Central

Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-hua; Xue, Dongbo

2017-01-01

Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including “immune response” as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma. PMID:28355233

RING-Domain E3 Ligase-Mediated Host–Virus Interactions: Orchestrating Immune Responses by the Host and Antagonizing Immune Defense by Viruses

PubMed Central

Zhang, Yuexiu; Li, Lian-Feng; Munir, Muhammad; Qiu, Hua-Ji

2018-01-01

The RING-domain E3 ligases (RING E3s), a group of E3 ligases containing one or two RING finger domains, are involved in various cellular processes such as cell proliferation, immune regulation, apoptosis, among others. In the host, a substantial number of the RING E3s have been implicated to inhibit viral replication through regulating immune responses, including activation and inhibition of retinoic acid-inducible gene I-like receptors, toll-like receptors, and DNA receptor signaling pathways, modulation of cell-surface expression of major histocompatibility complex, and co-stimulatory molecules. During the course of evolution and adaptation, viruses encode RING E3s to antagonize host immune defense, such as the infected cell protein 0 of herpes simplex virus type 1, the non-structural protein 1 of rotavirus, and the K3 and K5 of Kaposi’s sarcoma-associated herpesvirus. In addition, recent studies suggest that viruses can hijack the host RING E3s to facilitate viral replication. Based on emerging and interesting discoveries, the RING E3s present novel links among the host and viruses. Herein, we focus on the latest research progresses in the RING E3s-mediated host–virus interactions and discuss the outlooks of the RING E3s for future research. PMID:29872431

Immunosuppression in Early Postnatal Days Induces Persistent and Allergen-Specific Immune Tolerance to Asthma in Adult Mice

PubMed Central

Chen, Yan; Zhang, Jin; Lu, Yong; Wang, Libo

2015-01-01

Bronchial asthma is a chronic airway inflammatory condition with high morbidity, and effective treatments for asthma are limited. Allergen-specific immunotherapy can only induce peripheral immune tolerance and is not sustainable. Exploring new therapeutic strategies is of great clinical importance. Recombinant adenovirus (rAdV) was used as a vector to make cells expressing cytotoxic T lymphocyte-associated antigen-4-immunoglobulin (CTLA4Ig) a soluble CTLA4 immunoglobulin fusion protein. Dendritic cells (DCs) were modified using the rAdVs together with allergens. Then these modified DCs were transplanted to mice before allergen sensitization. The persistence and specificity of immune tolerance were evaluated in mice challenged with asthma allergens at 3 and 7 months. DCs modified by CTLA4Ig showed increased IL-10 secretion, decreased IL-12 secretion, and T cell stimulation in vitro. Mice treated with these DCs in the early neonatal period developed tolerance against the allergens that were used to induce asthma in the adult stage. Asthma symptoms, lung damage, airway reactivity, and inflammatory response all improved. Humoral immunity indices showed that this therapeutic strategy strongly suppressed mice immune responses and was maintained for as long as 7 months. Furthermore, allergen cross-sensitization and challenge experiments demonstrated that this immune tolerance was allergen-specific. Treatment with CTLA4Ig modified DCs in the early neonatal period, inducing persistent and allergen-specific immune tolerance to asthma in adult mice. Our results suggest that it may be possible to develop a vaccine for asthma. PMID:25860995

Trafficking receptor signatures define blood plasmablasts responding to tissue-specific immune challenge

PubMed Central

Seong, Yekyung; Lazarus, Nicole H.; Sutherland, Lusijah; Habtezion, Aida; Abramson, Tzvia; He, Xiao-Song; Greenberg, Harry B.

2017-01-01

Antibody-secreting cells are generated in regional lymphoid tissues and traffic as plasmablasts (PBs) via lymph and blood to target sites for local immunity. We used multiparameter flow cytometry to define PB trafficking programs (TPs, combinations of adhesion molecules and chemoattractant receptors) and their imprinting in patients in response to localized infection or immune insults. TPs enriched after infection or autoimmune inflammation of mucosae correlate with sites of immune response or symptoms, with different TPs imprinted during small intestinal, colon, throat, and upper respiratory immune challenge. PBs induced after intramuscular or intradermal influenza vaccination, including flu-specific antibody–secreting cells, display TPs characterized by the lack of mucosal homing receptors. PBs of healthy donors display diverse mucosa-associated TPs, consistent with homeostatic immune activity. Identification of TP signatures of PBs may facilitate noninvasive monitoring of organ-specific immune responses. PMID:28352656

Humoral immune responses of experimentally Eimeria ninakholyakimovae-infected goat kids.

PubMed

Matos, Lorena; Muñoz, María Del Carmen; Molina, José Manuel; Ferrer, Otilia; Rodríguez, Francisco; Pérez, Davinia; López, Adassa María; Martín, Sergio; Hermosilla, Carlos; Taubert, Anja; Ruiz, Antonio

2017-04-01

Although cellular immune reactions seem to be crucial for protective immune responses in Eimeria spp. infections, there are also evidences on an active involvement of the humoral counterpart. In the present study, we have analyzed the humoral response of goat kids subjected to primary and challenge infections with Eimeria ninakholyakimovae. Specific levels of IgG and IgM in serum samples and IgA in the ileal mucus were estimated. In infected kids, significantly increased levels of IgG were observed from 3 weeks post infection onwards in addition to an enhancement of specific IgM and secretory IgA levels. A wide range of peptides of sporulated oocyst antigen (SOA) was recognized by specific IgG as determined by immunoblotting. However, no correlations were found between immunoglobulin levels and OPG counts after challenge infection. Overall, these data indicate a significant specific humoral response of E. ninakohlyakimovae-infected goat kids that does not seem to convey immunoprotection. Further studies should be addressed to clarify if the lack of correlation might be associated to the type of antigen used for the immunoenzimatic assays, the age of the animals or other factors. Copyright © 2017 Elsevier Ltd. All rights reserved.

Immune Response in Thyroid Cancer: Widening the Boundaries

PubMed Central

Ward, Laura Sterian

2014-01-01

The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

Host Immune Responses That Promote Initial HIV Spread

DTIC Science & Technology

2011-07-01

exposure to virus and peak viremia. The vaginal mucosa is the most common site of infection and vaccine strategies focus mainly on promoting...spread to the lymph node specifically in the acute phase, i.e., upon vaginal inoculation. The resulting mathematical model is based on mechanistic...for early immune response to SIV and HIV infection are generally assumed to be similar and are described as follows. Virus enters the vaginal lumen and

Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

PubMed Central

Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

Potentiation of the humoral immune response elicited by a commercial vaccine against bovine respiratory disease by Enterococcus faecalis CECT7121.

PubMed

Díaz, A M; Almozni, B; Molina, M A; Sparo, M D; Manghi, M A; Canellada, A M; Castro, M S

2018-04-10

Vaccination against pathogens involved in bovine respiratory disease (BRD) is a useful tool to reduce the risk of this disease however, it has been observed that the commercially available vaccines only partially prevent the infections caused by Pasteurella multocida and Mannheimia haemolytica. Therefore, it is recommended to search for new adjuvant strategies to minimise the economic impact of this respiratory syndrome. A possibility to improve the conventional vaccine response is to modulate the immune system with probiotics, since there is accumulating evidence that certain immunomodulatory strains administered around the time of vaccination can potentiate the immune response. Considering veterinary vaccines are frequently tested in murine models, we have developed an immunisation schedule in BALB/c mice that allows us to study the immune response elicited by BRD vaccine. In order to evaluate a potential strategy to enhance vaccine efficacy, the adjuvant effect of Enterococcus faecalis CECT7121 on the murine specific humoral immune response elicited by a commercial vaccine against BRD was studied. Results indicate that the intragastric administration of E. faecalis CECT7121 was able to induce an increase in the specific antibody titres against the bacterial components of the BRD vaccines (P. multocida and M. haemolytica). The quality of the humoral immune response, in terms of antibody avidity, was also improved. Regarding the cellular immune response, although the BRD vaccination induced a low specific secretion of cytokines in the spleen cell culture supernatants, E. faecalis CECT7121-treated mice showed higher interferon-γ production than immunised control mice. Our results allowed us to conclude that the administration of E. faecalis CECT7121 could be employed as an adjuvant strategy to potentiate humoral immune responses.

DNA and protein co-immunization improves the magnitude and longevity of humoral immune responses in macaques.

PubMed

Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K

2014-01-01

We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.

Assessing immune competence in pigs by immunization with tetanus toxoid.

PubMed

Gimsa, U; Tuchscherer, A; Gimsa, J; Tuchscherer, M

2018-01-01

Immune competence can be tested by challenging organisms with a set of infectious agents. However, disease control requirements impose restrictions on the infliction of infections upon domestic pigs. Alternatively, vaccinations induce detectable immune responses that reflect immune competence. Here, we tested this approach with tetanus toxoid (TT) in young domestic pigs. To optimize the vaccination protocol, we immunized the pigs with a commercial TT vaccine at the age of 21 or 35 days. Booster immunizations were performed either 14 or 21 days later. TT-specific antibodies in plasma as well as lymphoproliferative responses were determined both 7 and 14 days after booster immunization using ELISA and lymphocyte transformation tests, respectively. In addition, general IgG and IgM plasma concentrations and mitogen-induced proliferation were measured. The highest TT-specific antibody responses were detected when blood samples were collected 1 week after a booster immunization conducted 21 days after primary immunization. The pigs' age at primary immunization did not have a significant influence on TT-specific antibody responses. Similarly, the TT-specific proliferative responses were highest when blood samples were collected 1 week after booster immunization, while age and time of primary and booster immunization were irrelevant in our setup. While general IgG and IgM plasma levels were highly age dependent, there were no significant age effects for TT-specific immune responses. In addition, mitogen-induced proliferation was independent of immunization as well as blood sampling protocols. In summary, our model of TT vaccination provides an interesting approach for the assessment of immune competence in young pigs. The detected vaccination effects were not biased by age, even though our data were acquired from immune systems that were under development during our tests.

Screening Immunomodulators To Skew the Antigen-Specific Autoimmune Response.

PubMed

Northrup, Laura; Sullivan, Bradley P; Hartwell, Brittany L; Garza, Aaron; Berkland, Cory

2017-01-03

Current therapies to treat autoimmune diseases often result in side effects such as nonspecific immunosuppression. Therapies that can induce antigen-specific immune tolerance provide an opportunity to reverse autoimmunity and mitigate the risks associated with global immunosuppression. In an effort to induce antigen-specific immune tolerance, co-administration of immunomodulators with autoantigens has been investigated in an effort to reprogram autoimmunity. To date, identifying immunomodulators that may skew the antigen-specific immune response has been ad hoc at best. To address this need, we utilized splenocytes obtained from mice with experimental autoimmune encephalomyelitis (EAE) in order to determine if certain immunomodulators may induce markers of immune tolerance following antigen rechallenge. Of the immunomodulatory compounds investigated, only dexamethasone modified the antigen-specific immune response by skewing the cytokine response and decreasing T-cell populations at a concentration corresponding to a relevant in vivo dose. Thus, antigen-educated EAE splenocytes provide an ex vivo screen for investigating compounds capable of skewing the antigen-specific immune response, and this approach could be extrapolated to antigen-educated cells from other diseases or human tissues.

Immune and clinical response to honeybee venom in beekeepers.

PubMed

Matysiak, Jan; Matysiak, Joanna; Bręborowicz, Anna; Kycler, Zdzisława; Dereziński, Paweł; Kokot, Zenon J

2016-01-01

The aim of the study was to assess immune response to honeybee venom in relation to the degree of exposure, time after a sting and clinical symptoms. Fifty-four volunteers were divided into 2 groups: beekeepers and a control group. The serum levels of total IgE (tIgE), bee venom-specific IgE (venom sIgE), phospholipase A2-specific IgE (phospholipase A2 sIgE), tryptase and venom-specific IgG4 (venom sIgG4) were determined. In beekeepers, diagnostic tests were performed within 3 hours following a sting and were repeated after a minimum of 6 weeks from the last sting. In individuals from the control group, the tests were performed only once, without a sting. The tests showed significant differences in venom sIgE (beekeepers' median = 0.34 kUA/l, control group median = 0.29 kUA/l), baseline serum tryptase (beekeepers' median = 4.25 µg/l, control group median = 2.74 µg/l) and sIgG4 (beekeepers' median = 21.2 mgA/l, control group median = 0.14 mgA/l), confirming higher levels of the tested substances in the beekeepers than in the control group. A significant positive correlation was observed between phospholipase A2 sIgE concentration and severity of clinical symptoms after a sting in the group of beekeepers. It was also demonstrated that the clinical symptoms after a sting became less severe with increasing age of the beekeepers. The differences in the immune response to a bee sting between the beekeepers and individuals not exposed to bees were probably due to the high exposure of the beekeepers to honeybee venom allergens. This may suggest a different approach to the bee venom allergy diagnostic tests in this occupational group.

Arginine and vitamin E improve the immune response after a Salmonella challenge in broiler chicks

USDA-ARS?s Scientific Manuscript database

Two experiments were conducted to evaluate the effects of arginine (ARG), vitamin E (VE), and mannanoligosaccharide (MOS) on the immune response and clearance of Salmonella in broiler chickens. In each experiment, chicks were randomly distributed into 4 groups: antibiotic-free diet (negative contro...

Silica Vesicle Nanovaccine Formulations Stimulate Long-Term Immune Responses to the Bovine Viral Diarrhoea Virus E2 Protein

PubMed Central

Mody, Karishma T.; Mahony, Donna; Cavallaro, Antonino S.; Zhang, Jun; Zhang, Bing; Mahony, Timothy J.; Yu, Chengzhong; Mitter, Neena

2015-01-01

Bovine Viral Diarrhoea Virus (BVDV) is one of the most serious pathogen, which causes tremendous economic loss to the cattle industry worldwide, meriting the development of improved subunit vaccines. Structural glycoprotein E2 is reported to be a major immunogenic determinant of BVDV virion. We have developed a novel hollow silica vesicles (SV) based platform to administer BVDV-1 Escherichia coli-expressed optimised E2 (oE2) antigen as a nanovaccine formulation. The SV-140 vesicles (diameter 50 nm, wall thickness 6 nm, perforated by pores of entrance size 16 nm and total pore volume of 0.934 cm3g-1) have proven to be ideal candidates to load oE2 antigen and generate immune response. The current study for the first time demonstrates the ability of freeze-dried (FD) as well as non-FD oE2/SV140 nanovaccine formulation to induce long-term balanced antibody and cell mediated memory responses for at least 6 months with a shortened dosing regimen of two doses in small animal model. The in vivo ability of oE2 (100 μg)/SV-140 (500 μg) and FD oE2 (100 μg)/SV-140 (500 μg) to induce long-term immunity was compared to immunisation with oE2 (100 μg) together with the conventional adjuvant Quil-A from the Quillaja saponira (10 μg) in mice. The oE2/SV-140 as well as the FD oE2/SV-140 nanovaccine generated oE2-specific antibody and cell mediated responses for up to six months post the final second immunisation. Significantly, the cell-mediated responses were consistently high in mice immunised with oE2/SV-140 (1,500 SFU/million cells) at the six-month time point. Histopathology studies showed no morphological changes at the site of injection or in the different organs harvested from the mice immunised with 500 μg SV-140 nanovaccine compared to the unimmunised control. The platform has the potential for developing single dose vaccines without the requirement of cold chain storage for veterinary and human applications. PMID:26630001

Virus-like nanostructures for tuning immune response

NASA Astrophysics Data System (ADS)

Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

2015-11-01

Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

Innate Immune Response to Burkholderia mallei

DTIC Science & Technology

2017-02-16

stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the

Single-Dose Hepatitis A Immunization: 7.5-Year Observational Pilot Study in Nicaraguan Children to Assess Protective Effectiveness and Humoral Immune Memory Response.

PubMed

Mayorga, Orlando; Bühler, Silja; Jaeger, Veronika K; Bally, Seraina; Hatz, Christoph; Frösner, Gert; Protzer, Ulrike; Van Damme, Pierre; Egger, Matthias; Herzog, Christian

2016-11-15

 Universal 2-dose hepatitis A virus (HAV) vaccination of toddlers effectively controls hepatitis A. High vaccine costs, however, impede implementation in endemic countries. To test single-dose vaccination as a possible alternative, we initiated an observational, longitudinal study in Nicaragua, to assess protective effectiveness and-through challenge vaccination-humoral immune memory response.  After a 2003 serosurvey, 130 originally seronegative children received one dose of virosomal HAV vaccine in 2005, followed by yearly serological and clinical assessments until 2012. After 7.5 years, a vaccine booster was administered. Concurrent antibody screening of patients presenting with hepatitis symptoms documented persistent HAV circulation in the communities studied.  Between serosurvey and vaccination, 25 children contracted hepatitis A subclinically (>8000 mIU/mL anti-HAV). In the remaining 105 children, immunization resulted in anti-HAV levels of 17-572 mIU/mL. Based on the ≥15% annual infection risk, an estimated 60% of children were exposed to HAV encounters during follow-up. No child presented with hepatitis symptoms. Serological breakthrough infection (7106 mIU/mL) was documented in 1 child, representing an estimated protective effectiveness of 98.3% (95% confidence interval, 87.9-99.8). Boosting elicited an average 29.7-fold increase of anti-HAV levels.  In children living in hyperendemic settings, a single dose of virosomal HAV vaccine is sufficient to activate immune memory and may provide long-term protection. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Pollen derived low molecular compounds enhance the human allergen specific immune response in vivo.

PubMed

Gilles-Stein, S; Beck, I; Chaker, A; Bas, M; McIntyre, M; Cifuentes, L; Petersen, A; Gutermuth, J; Schmidt-Weber, C; Behrendt, H; Traidl-Hoffmann, C

2016-10-01

Besides allergens, pollen release bioactive, low molecular weight compounds that modulate and stimulate allergic reactions. Clinical relevance of these substances has not been investigated to date. To elucidate the effect of a non-allergenic, low molecular weight factors from aqueous birch pollen extracts (Bet-APE < 3 kDa) on the human allergic immune response in vivo. Birch and grass pollen allergic individuals underwent skin prick testing with allergen alone, allergen plus Bet-APE < 3 kDa, or allergen plus pre-identified candidate substances from low molecular pollen fraction. Nasal allergen challenges were performed in non-atopic and pollen allergic individuals using a 3 day repeated threshold challenge battery. Subjects were either exposed to allergen alone or to allergen plus Bet-APE< 3 kDa. Local cytokine levels, nasal secretion weights, nasal congestion and symptom scores were determined. Skin prick test reactions to pollen elicited larger weals when allergens were tested together with the low molecular weight compounds from pollen. Similar results were obtained with candidate pollen-associated lipid mediators. In nasal lining fluids of allergic patients challenged with allergen plus Bet-APE < 3 kDa, IL-8 and IgE was significantly increased as compared to allergen-only challenged patients. These patients also produced increased amounts of total nasal secretion and reported more severe rhinorrhea than the allergen-only challenged group. Low molecular compounds from pollen enhance the allergen specific immune response in the skin and nose. They are therefore of potential clinical relevance in allergic patients. © 2016 John Wiley & Sons Ltd.

Density-dependent effects of Caligus rogercresseyi infestation on the immune responses of Salmo salar.

PubMed

Boltaña, Sebastian; Sanchez, Marcos; Valenzuela, Valentina; Gallardo-Escárate, Cristian

2016-12-01

Sea lice infestations are a particular concern in the salmonid aquaculture industry due to damaging effects on fish growth, disease/infection susceptibility, and survival. Despite the impacts of sea lice parasitism, few studies have determined corresponding physiological thresholds, or the quantity of sea lice that can trigger measurable effects in the host immune response. The present study evaluated the mRNA expressions of immune-related genes in Salmo salar (Atlantic salmon) under infestation challenges with contrasting loads of the sea louse Caligus rogercresseyi. Specifically, two groups of S. salar were infected with either 35 (i.e. low parasitic load) or 100 (i.e. high parasitic load) copepodids per fish. At 14 days post-infestation, the mRNA levels of immune-related genes (e.g. related to oxidative stress, pro- and inflammatory responses, and the adaptive T H 1/T H 2 pathways) were assessed through RT-qPCR. Significant differences were found in relation to parasitic load, suggesting density-dependent effects that activated the S. salar immune system. Higher parasitic load promoted strong inflammatory and oxidative stress responses that were correlated with the T H 1 immune response. This study highlights the molecular signatures for distinct parasitic loads, providing new perspectives towards fully understanding parasite-host interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Varicella-Zoster Virus-Specific Cellular Immune Responses to the Live Attenuated Zoster Vaccine in Young and Older Adults.

PubMed

Weinberg, Adriana; Canniff, Jennifer; Rouphael, Nadine; Mehta, Aneesh; Mulligan, Mark; Whitaker, Jennifer A; Levin, Myron J

2017-07-15

The incidence and severity of herpes zoster (HZ) increases with age. The live attenuated zoster vaccine generates immune responses similar to HZ. We compared the immune responses to zoster vaccine in young and older to adults to increase our understanding of the immune characteristics that may contribute to the increased susceptibility to HZ in older adults. Young (25-40 y; n = 25) and older (60-80 y; n = 33) adults had similar magnitude memory responses to varicella-zoster virus (VZV) ex vivo restimulation measured by responder cell-frequency and flow cytometry, but the responses were delayed in older compared with young adults. Only young adults had an increase in dual-function VZV-specific CD4 + and CD8 + T cell effectors defined by coexpression of IFN-γ, IL-2, and CD107a after vaccination. In contrast, older adults showed marginal increases in VZV-specific CD8 + CD57 + senescent T cells after vaccination, which were already higher than those of young adults before vaccination. An increase in VZV-stimulated CD4 + CD69 + CD57 + PD1 + and CD8 + CD69 + CD57 + PD1 + T cells from baseline to postvaccination was associated with concurrent decreased VZV-memory and CD8 + effector responses, respectively, in older adults. Blocking the PD1 pathway during ex vivo VZV restimulation increased the CD4 + and CD8 + proliferation, but not the effector cytokine production, which modestly increased with TIM-3 blockade. We conclude that high proportions of senescent and exhausted VZV-specific T cells in the older adults contribute to their poor effector responses to a VZV challenge. This may underlie their inability to contain VZV reactivation and prevent the development of HZ. Copyright © 2017 by The American Association of Immunologists, Inc.

[Immune response induced by HIV DNA vaccine combined with recombinant adeno-associated virus].

PubMed

Liu, Yan-zheng; Zhou, Ling; Wang, Qi; Ye, Shu-qing; Li, Hong-xia; Zeng, Yi

2004-09-01

HIV-1 DNA vaccine and recombinant adeno-associated virus (rAAV) expressing gagV3 gene of HIV-1 subtype B were constructed and BALB/c mice were immunized by vaccination regimen consisting of consecutive priming with DNA vaccine and boosting with rAAV vaccine; the CTL and antibody response were detected and compared with those induced by DNA vaccine or rAAV vaccine separately. HIV-1 subtype B gagV3 gene was inserted into the polyclonal site of plasmid pCI-neo, DNA vaccine pCI-gagV3 was thereby constructed; pCI-gagV3 was transfected into p815 cells, G-418-resistant cells were obtained through screening transfected cells with G418, the expression of HIV-1 antigen in G-418-resistant cells was detected by EIA; BALB/c mice were immunized with pCI-gagV3 and the immune response was tested; BALB/c mouse immunized with pCI-gagV3 and combined with rAAV expressing the same gagV3 genes were tested for antibody level in sera by EIA method and cytotoxicity response by LDH method. pCI-gagV3 could express HIV-1 gene in p815 cells; pCI-gagV3 could induce HIV-1 specific humoral and cell-mediated immune response in BALB/c mice. The HIV-1 specific antibody level was 1/20; when the ratio of effector cells: target cells was 50:1, the average specific cytotoxicity was 41.7%; there was no evident increase in the antibody level induced by pCI-gagV3 combined with rAAV, but there was increase in CTL response, the average specific cytotoxicity was 61.3% when effector cells: target cells ratio was 50:1. HIV-1 specific cytotoxicity in BALB/c mice can be increased by immunization of BALB/c mice with DNA vaccine combined with rAAV vaccine.

Immune response to measles vaccine in Peruvian children.

PubMed Central

Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

2001-01-01

OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

Immune-Specific Expression and Estrogenic Regulation of the Four Estrogen Receptor Isoforms in Female Rainbow Trout (Oncorhynchus mykiss).

PubMed

Casanova-Nakayama, Ayako; Wernicke von Siebenthal, Elena; Kropf, Christian; Oldenberg, Elisabeth; Segner, Helmut

2018-03-21

Genomic actions of estrogens in vertebrates are exerted via two intracellular estrogen receptor (ER) subtypes, ERα and ERβ, which show cell- and tissue-specific expression profiles. Mammalian immune cells express ERs and are responsive to estrogens. More recently, evidence became available that ERs are also present in the immune organs and cells of teleost fish, suggesting that the immunomodulatory function of estrogens has been conserved throughout vertebrate evolution. For a better understanding of the sensitivity and the responsiveness of the fish immune system to estrogens, more insight is needed on the abundance of ERs in the fish immune system, the cellular ratios of the ER subtypes, and their autoregulation by estrogens. Consequently, the aims of the present study were (i) to determine the absolute mRNA copy numbers of the four ER isoforms in the immune organs and cells of rainbow trout, Oncorhynchus mykiss , and to compare them to the hepatic ER numbers; (ii) to analyse the ER mRNA isoform ratios in the immune system; and, (iii) finally, to examine the alterations of immune ER mRNA expression levels in sexually immature trout exposed to 17β-estradiol (E2), as well as the alterations of immune ER mRNA expression levels in sexually mature trout during the reproductive cycle. All four ER isoforms were present in immune organs-head kidney, spleen-and immune cells from head kidney and blood of rainbow trout, but their mRNA levels were substantially lower than in the liver. The ER isoform ratios were tissue- and cell-specific, both within the immune system, but also between the immune system and the liver. Short-term administration of E2 to juvenile female trout altered the ER mRNA levels in the liver, but the ERs of the immune organs and cells were not responsive. Changes of ER gene transcript numbers in immune organs and cells occurred during the reproductive cycle of mature female trout, but the changes in the immune ER profiles differed from those in the

Kinetic of the CMV-specific T-cell immune response and CMV infection in CMV-seropositive kidney transplant recipients receiving rabbit anti-thymocyte globulin induction therapy: A pilot study.

PubMed

Martín-Gandul, Cecilia; Pérez-Romero, Pilar; Mena-Romo, Damián; Molina-Ortega, Alejandro; González-Roncero, Francisco M; Suñer, Marta; Bernal, Gabriel; Cordero, Elisa

2018-03-23

Some studies have suggested that rATG treatment may be associated with an increased incidence of CMV infection and delayed CMV immune response. However, the evidences supporting this matter are scarce. This study aims to characterize the kinetic of the CMV-specific T-cell immune response before and after rATG induction therapy and the relationship with the development of CMV infection in CMV-seropositive kidney transplant recipients. An observational prospective study of CMV-seropositive kidney transplant patients that received rATG induction therapy was performed. A pretransplant sample was obtained before the surgery to determine the CMV-specific immunity. CMV viral load (by PCR) and CMV-specific T-cell immune response (by flow cytometry) were determined during the follow-up at 0.5, 1, 2, 3, 6, and 12 months post transplantation. A total of 23 patients were included in the study. CMV prophylaxis was administrated for a media of 90 days after transplantation. At the end of follow-up, 18 (78.3%) patients had CMV-specific immunity with a median value of 0.31% CD8 + CD69 + INF-γ + T cells at a median of 16 weeks post transplantation. Five patients never acquired CMV-specific immunity. No statistically significant association between CMV infection and CMV-specific T-cell immune response (P = .086) was observed. However, patients with positive pretransplant CMV-specific immunity developed earlier immunity and achieved higher levels of CD8 + CD69 + INF-γ+ T-cell post-transplantation than patients with negative pretransplant immunity. CMV-specific immune monitoring in addition to CMV-serology may be useful to stratify patient's risk of CMV infection before transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Engineering HIV-Specific Immunity with Chimeric Antigen Receptors.

PubMed

Kitchen, Scott G; Zack, Jerome A

2016-12-01

HIV remains a highly important public health and clinical issue despite many recent advances in attempting to develop a cure, which has remained elusive for most people infected with HIV. HIV disease can be controlled with pharmacologic therapies; however, these treatments are expensive, may have severe side effects, and are not curative. Consequently, an improved means to control or eliminate HIV replication is needed. Cytotoxic T lymphocytes (CTLs) play a critical role in controlling viral replication and are an important part in the ability of the immune response to eradicate most viral infections. There are considerable efforts to enhance CTL responses in HIV-infected individuals in hopes of providing the immune response with armaments to more effectively control viral replication. In this review, we discuss some of these efforts and focus on the development of a gene therapy-based approach to engineer hematopoietic stem cells with an HIV-1-specific chimeric antigen receptor, which seeks to provide an inexhaustible source of HIV-1-specific immune cells that are MHC unrestricted and superior to natural antiviral T cell responses. These efforts provide the basis for further development of T cell functional enhancement to target and treat chronic HIV infection in hopes of eradicating the virus from the body.

Immune response to second vaccination series of hepatitis B virus among booster dose non-responders.

PubMed

Salama, Iman I; Sami, Samia M; Salama, Somaia I; Rabah, Thanaa Mahmoud; El Etreby, Lobna Ahmed; Abdel Hamid, Amany T; Elmosalami, Dalia; El Hariri, Hazem; Said, Zeinab N

2016-04-07

To evaluate the response to second vaccination series among post-booster sero-negative children who had previously received compulsory HBV vaccination. After given a booster dose to 1070 children, 103 of them failed to generate anamnestic response (anti-HBs <10 IU/L). Only 91/103 children received additional two doses of recombinant HBV vaccine (i.e. 2(nd) vaccination series) after 1 and 6 months post-booster. Blood sample was withdrawn aseptically one month later for quantitative assessment of anti-HBs to detect development of protective immune response (≥10 IU/L). Immunological vaccination failure was assigned to children who did not develop protective immune response after 2(nd) vaccination series. Protective immune response was detected among 84/91 children (92.3%). While 7/91 (7.7%) whose age were ≥10 years did not respond and had post-booster undetectable anti-HBs. About 80% of children with post-booster detectable anti-HBs showed significant protective immune response (anti-HBs ≥100 IU/L) and higher GMT (299.1 ± 3.6 IU/L) compared to those with undetectable 60% and 106.2 ± 12.9 IU/L respectively (P<0.05). No significant difference was detected as regards gender or residence, P>0.05. All children with history of rheumatic fever (7 children) or diabetes mellitus (1 child) developed immune response after 2(nd) vaccination series. A booster dose of HB vaccine may be unable to induce sufficient immunological response in children who had undetectable anti-HBs titers. Revaccination for non-responders is an important procedure to increase HBV protection rate. Copyright © 2016 Elsevier Ltd. All rights reserved.

Q fever in pregnant goats: humoral and cellular immune responses

PubMed Central

2013-01-01

Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213

Toll-Like Receptor 7 Agonist GS-9620 Induces HIV Expression and HIV-Specific Immunity in Cells from HIV-Infected Individuals on Suppressive Antiretroviral Therapy.

PubMed

Tsai, Angela; Irrinki, Alivelu; Kaur, Jasmine; Cihlar, Tomas; Kukolj, George; Sloan, Derek D; Murry, Jeffrey P

2017-04-15

maintained in reservoirs of latently infected cells. Consequently, lifelong therapy is required to maintain viral suppression. Ultimately, new therapies that specifically target and eliminate the latent HIV reservoir are needed. Toll-like receptor agonists are potent enhancers of innate antiviral immunity that can also improve the adaptive immune response. Here, we show that a highly selective TLR7 agonist, GS-9620, activated HIV from peripheral blood mononuclear cells isolated from HIV-infected individuals with suppressed infection. GS-9620 also improved immune effector functions that specifically targeted HIV-infected cells. Previously published studies on the compound in other chronic viral infections show that it can effectively induce immune activation at safe and tolerable clinical doses. Together, the results of these studies suggest that GS-9620 may be useful for treating HIV-infected individuals on suppressive antiretroviral therapy. Copyright © 2017 Tsai et al.

Toll-Like Receptor 7 Agonist GS-9620 Induces HIV Expression and HIV-Specific Immunity in Cells from HIV-Infected Individuals on Suppressive Antiretroviral Therapy

PubMed Central

Tsai, Angela; Irrinki, Alivelu; Kaur, Jasmine; Cihlar, Tomas; Kukolj, George

2017-01-01

persistently maintained in reservoirs of latently infected cells. Consequently, lifelong therapy is required to maintain viral suppression. Ultimately, new therapies that specifically target and eliminate the latent HIV reservoir are needed. Toll-like receptor agonists are potent enhancers of innate antiviral immunity that can also improve the adaptive immune response. Here, we show that a highly selective TLR7 agonist, GS-9620, activated HIV from peripheral blood mononuclear cells isolated from HIV-infected individuals with suppressed infection. GS-9620 also improved immune effector functions that specifically targeted HIV-infected cells. Previously published studies on the compound in other chronic viral infections show that it can effectively induce immune activation at safe and tolerable clinical doses. Together, the results of these studies suggest that GS-9620 may be useful for treating HIV-infected individuals on suppressive antiretroviral therapy. PMID:28179531

Human Immune Responses to Dengue Viruses.

DTIC Science & Technology

1986-07-01

0-1 NO- 3K1- INO. "඄o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in

The sickle-cell trait modifies the intensity and specificity of the immune response against P. falciparum malaria and leads to acquired protective immunity.

PubMed

Bayoumi, R A

1987-03-01

It is proposed that the in vivo mechanism of protection against falciparum malaria in individuals of the Hb AS genotype is not due solely to the adverse influence of Hb AS erythrocytes on the intraerythrocytic growth and development of P. falciparum. Instead, the simple physiological effect of Hb S on parasite growth appears to trigger an in vivo process of enhancement of the intensity and/or specificity of the host immune response, leading to acquired protective immunity, in a process simulating vaccination. Testing the hypothesis may lead to the identification of plasmodial antigens that induce protective responses in the human host and distinguish them from non-protective, immunosuppressive or decoy antigens that promote parasite survival. This may ultimately help in the selection of candidate antigens for a malaria blood-stage vaccine.

Antitumor immune responses mediated by dendritic cells

PubMed Central

Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne

2013-01-01

Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744

Feeding Immunity: Physiological and Behavioral Responses to Infection and Resource Limitation

PubMed Central

Budischak, Sarah A.; Hansen, Christina B.; Caudron, Quentin; Garnier, Romain; Kartzinel, Tyler R.; Pelczer, István; Cressler, Clayton E.; van Leeuwen, Anieke; Graham, Andrea L.

2018-01-01

Resources are a core currency of species interactions and ecology in general (e.g., think of food webs or competition). Within parasite-infected hosts, resources are divided among the competing demands of host immunity and growth as well as parasite reproduction and growth. Effects of resources on immune responses are increasingly understood at the cellular level (e.g., metabolic predictors of effector function), but there has been limited consideration of how these effects scale up to affect individual energetic regimes (e.g., allocation trade-offs), susceptibility to infection, and feeding behavior (e.g., responses to local resource quality and quantity). We experimentally rewilded laboratory mice (strain C57BL/6) in semi-natural enclosures to investigate the effects of dietary protein and gastrointestinal nematode (Trichuris muris) infection on individual-level immunity, activity, and behavior. The scale and realism of this field experiment, as well as the multiple physiological assays developed for laboratory mice, enabled us to detect costs, trade-offs, and potential compensatory mechanisms that mice employ to battle infection under different resource conditions. We found that mice on a low-protein diet spent more time feeding, which led to higher body fat stores (i.e., concentration of a satiety hormone, leptin) and altered metabolite profiles, but which did not fully compensate for the effects of poor nutrition on albumin or immune defenses. Specifically, immune defenses measured as interleukin 13 (IL13) (a primary cytokine coordinating defense against T. muris) and as T. muris-specific IgG1 titers were lower in mice on the low-protein diet. However, these reduced defenses did not result in higher worm counts in mice with poorer diets. The lab mice, living outside for the first time in thousands of generations, also consumed at least 26 wild plant species occurring in the enclosures, and DNA metabarcoding revealed that the consumption of different wild foods

Epstein-Barr Virus-Specific Humoral Immune Responses in Health and Disease.

PubMed

Middeldorp, Jaap M

2015-01-01

Epstein-Barr virus (EBV) is widely distributed in the world and associated with a still increasing number of acute, chronic, malignant and autoimmune disease syndromes. Humoral immune responses to EBV have been studied for diagnostic, pathogenic and protective (vaccine) purposes. These studies use a range of methodologies, from cell-based immunofluorescence testing to antibody-diversity analysis using immunoblot and epitope analysis using recombinant or synthetic peptide-scanning. First, the individual EBV antigen complexes (VCA , MA, EA(D), EA(R) and EBNA) are defined at cellular and molecular levels, providing a historic overview. The characteristic antibody responses to these complexes in health and disease are described, and differences are highlighted by clinical examples. Options for EBV vaccination are briefly addressed. For a selected number of immunodominant proteins, in particular EBNA1, the interaction with human antibodies is further detailed at the epitope level, revealing interesting insights for structure, function and immunological aspects, not considered previously. Humoral immune responses against EBV-encoded tumour antigens LMP1, LMP2 and BARF1 are addressed, which provide novel options for targeted immunotherapy. Finally, some considerations on EBV-linked autoimmune diseases are given, and mechanisms of antigen mimicry are briefly discussed. Further analysis of humoral immune responses against EBV in health and disease in carefully selected patient cohorts will open new options for understanding pathogenesis of individual EBV-linked diseases and developing targeted diagnostic and therapeutic approaches.

Vaccination with DNA Encoding Truncated Enterohemorrhagic Escherichia coli (EHEC) Factor for Adherence-1 Gene (efa-1') Confers Protective Immunity to Mice Infected with E. coli O157:H7.

PubMed

Riquelme-Neira, Roberto; Rivera, Alejandra; Sáez, Darwin; Fernández, Pablo; Osorio, Gonzalo; del Canto, Felipe; Salazar, Juan C; Vidal, Roberto M; Oñate, Angel

2015-01-01

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1') in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1' gene (pVAXefa-1') into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1', EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10, and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1' have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

T7 phage displaying latent membrane protein 1 of Epstein-Barr virus elicits humoral and cellular immune responses in rats.

PubMed

Gao, J; Liu, Z; Huang, M; Li, X; Wang, Z

2011-01-01

The latent membrane protein 1 (LMP1) encoded by Epstein-Barr virus (EBV) has become a potential target in EBV-associated tumor prevention and treatment due to its multiple biological effects. In this study, the recombinant T7 phage displaying full-length LMP1 protein was cloned and used as an immunogen to immunize rats. Results of flow cytometry, Western blot analysis, and ELISA confirmed that both humoral and cellular immune responses were elicited in the immunized rats. Our data suggested that T7 phage was an efficient antigen carrier. The recombinant T7-LMP1 phage reconstitutes the antigenic and immunogenic properties of LMP1 and can serve as a vaccine against EBV.

Modification to the Capsid of the Adenovirus Vector That Enhances Dendritic Cell Infection and Transgene-Specific Cellular Immune Responses

PubMed Central

Worgall, Stefan; Busch, Annette; Rivara, Michael; Bonnyay, David; Leopold, Philip L.; Merritt, Robert; Hackett, Neil R.; Rovelink, Peter W.; Bruder, Joseph T.; Wickham, Thomas J.; Kovesdi, Imi; Crystal, Ronald G.

2004-01-01

Adenovirus (Ad) gene transfer vectors can be used to transfer and express antigens and function as strong adjuvants and thus are useful platforms for the development of genetic vaccines. Based on the hypothesis that Ad vectors with enhanced infectibility of dendritic cells (DC) may be able to evoke enhanced immune responses against antigens encoded by the vector in vivo, the present study analyzes the vaccine potential of an Ad vector expressing β-galactosidase as a model antigen and genetically modified with RGD on the fiber knob [AdZ.F(RGD)] to more selectively infect DC and consequently enhance immunity against the β-galactosidase antigen. Infection of murine DC in vitro with AdZ.F(RGD) showed an eightfold-increased transgene expression following infection compared to AdZ (also expressing β-galactosidase, but with a wild-type capsid). Binding, cellular uptake, and trafficking in DC were also increased with AdZ.F(RGD) compared to AdZ. To determine whether AdZ.F(RGD) could evoke enhanced immune responses to β-galactosidase in vivo, C57BL/6 mice were immunized with AdZ.F(RGD) or AdZ subcutaneously via the footpad. Humoral responses with both vectors were comparable, with similar anti-β-galactosidase antibody levels following vector administration. However, cellular responses to β-galactosidase were significantly enhanced, with the frequency of CD4+ as well as the CD8+ β-galactosidase-specific gamma interferon response in cells isolated from the draining lymph nodes increased following immunization with AdZ.F(RGD) compared to Ad.Z (P < 0.01). Importantly, this enhanced cellular immune response of the AdZ.F(RGD) vector was sufficient to evoke enhanced inhibition of the growth of preexisting tumors expressing β-galactosidase: BALB/c mice implanted with the CT26 syngeneic β-galactosidase-expressing colon carcinoma cell line and subsequently immunized with AdZ.F(RGD) showed decreased tumor growth and improved survival compared to mice immunized with AdZ. These

Distinctive roles of age, sex, and genetics in shaping transcriptional variation of human immune responses to microbial challenges.

PubMed

Piasecka, Barbara; Duffy, Darragh; Urrutia, Alejandra; Quach, Hélène; Patin, Etienne; Posseme, Céline; Bergstedt, Jacob; Charbit, Bruno; Rouilly, Vincent; MacPherson, Cameron R; Hasan, Milena; Albaud, Benoit; Gentien, David; Fellay, Jacques; Albert, Matthew L; Quintana-Murci, Lluis

2018-01-16

The contribution of host genetic and nongenetic factors to immunological differences in humans remains largely undefined. Here, we generated bacterial-, fungal-, and viral-induced immune transcriptional profiles in an age- and sex-balanced cohort of 1,000 healthy individuals and searched for the determinants of immune response variation. We found that age and sex affected the transcriptional response of most immune-related genes, with age effects being more stimulus-specific relative to sex effects, which were largely shared across conditions. Although specific cell populations mediated the effects of age and sex on gene expression, including CD8 + T cells for age and CD4 + T cells and monocytes for sex, we detected a direct effect of these intrinsic factors for the majority of immune genes. The mapping of expression quantitative trait loci (eQTLs) revealed that genetic factors had a stronger effect on immune gene regulation than age and sex, yet they affected a smaller number of genes. Importantly, we identified numerous genetic variants that manifested their regulatory effects exclusively on immune stimulation, including a Candida albicans -specific master regulator at the CR1 locus. These response eQTLs were enriched in disease-associated variants, particularly for autoimmune and inflammatory disorders, indicating that differences in disease risk may result from regulatory variants exerting their effects only in the presence of immune stress. Together, this study quantifies the respective effects of age, sex, genetics, and cellular heterogeneity on the interindividual variability of immune responses and constitutes a valuable resource for further exploration in the context of different infection risks or disease outcomes. Copyright © 2018 the Author(s). Published by PNAS.

Transcriptional analysis of the innate immune response of ducks to different species-of-origin low pathogenic H7 avian influenza viruses.

PubMed

Maughan, Michele N; Dougherty, Lorna S; Preskenis, Lauren A; Ladman, Brian S; Gelb, Jack; Spackman, Erica V; Keeler, Calvin L

2013-03-23

Wild waterfowl, including ducks, represent the classic reservoir for low pathogenicity avian influenza (LPAI) viruses and play a major role in the worldwide dissemination of AIV. AIVs belonging to the hemagglutinin (H) 7 subtype are of epidemiological and economic importance due to their potential to mutate into a highly pathogenic form of the virus. Thus far, however, relatively little work has been conducted on elucidating the host-pathogen interactions of ducks and H7 LPAIVs. In the current study, three H7 LPAIVs isolated from either chicken, duck, or turkey avian species were evaluated for their comparative effect on the transcriptional innate immune response of ducks. Three H7 LPAIV isolates, chicken-origin (A/chicken/Maryland/MinhMa/2004), duck-origin (A/pintail/Minnesota/423/1999), and turkey-origin (A/turkey/Virginia/SEP-67/2002) were used to infect Pekin ducks. At 3 days post-infection, RNA from spleen tissue was used for transcriptional analysis using the Avian Innate Immune Microarray (AIIM) and quantitative real-time RT-PCR (qRT-PCR). Microarray analysis revealed that a core set of 61 genes was differentially regulated in response to all three LPAIVs. Furthermore, we observed 101, 135, and 628 differentially expressed genes unique to infection with the chicken-, duck-, or turkey-origin LPAIV isolates, respectively. qRT-PCR results revealed significant (p<0.05) induction of IL-1β, IL-2, and IFNγ transcription, with the greatest induction observed upon infection with the chicken-origin isolate. Several key innate immune pathways were activated in response to LPAIV infection including the toll-like receptor and RIG-I-like receptor pathways. Pekin ducks elicit a unique innate immune response to different species-of-origin H7 LPAIV isolates. However, twelve identifiable genes and their associated cell signaling pathways (RIG-I, NOD, TLR) are differentially expressed regardless of isolate origin. This core set of genes are critical to the duck immune

A humoral immune response confers protection against Haemophilus ducreyi infection.

PubMed

Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H

2003-12-01

Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.

Humoral and Cellular Immune Response in Canine Hypothyroidism.

PubMed

Miller, J; Popiel, J; Chełmońska-Soyta, A

2015-07-01

Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response. Copyright © 2015 Elsevier Ltd. All rights reserved.

Whole-Transcriptome Analysis of Verocytotoxigenic Escherichia coli O157:H7 (Sakai) Suggests Plant-Species-Specific Metabolic Responses on Exposure to Spinach and Lettuce Extracts

PubMed Central

Crozier, Louise; Hedley, Pete E.; Morris, Jenny; Wagstaff, Carol; Andrews, Simon C.; Toth, Ian; Jackson, Robert W.; Holden, Nicola J.

2016-01-01

Verocytotoxigenic Escherichia coli (VTEC) can contaminate crop plants, potentially using them as secondary hosts, which can lead to food-borne infection. Currently, little is known about the influence of the specific plant species on the success of bacterial colonization. As such, we compared the ability of the VTEC strain, E. coli O157:H7 ‘Sakai,’ to colonize the roots and leaves of four leafy vegetables: spinach (Spinacia oleracea), lettuce (Lactuca sativa), vining green pea (Pisum sativum), and prickly lettuce (Lactuca serriola), a wild relative of domesticated lettuce. Also, to determine the drivers of the initial response on interaction with plant tissue, the whole transcriptome of E. coli O157:H7 Sakai was analyzed following exposure to plant extracts of varying complexity (spinach leaf lysates or root exudates, and leaf cell wall polysaccharides from spinach or lettuce). Plant extracts were used to reduce heterogeneity inherent in plant–microbe interactions and remove the effect of plant immunity. This dual approach provided information on the initial adaptive response of E. coli O157:H7 Sakai to the plant environment together with the influence of the living plant during bacterial establishment and colonization. Results showed that both the plant tissue type and the plant species strongly influence the short-term (1 h) transcriptional response to extracts as well as longer-term (10 days) plant colonization or persistence. We show that propagation temperature (37 vs. 18°C) has a major impact on the expression profile and therefore pre-adaptation of bacteria to a plant-relevant temperature is necessary to avoid misleading temperature-dependent wholescale gene-expression changes in response to plant material. For each of the plant extracts tested, the largest group of (annotated) differentially regulated genes were associated with metabolism. However, large-scale differences in the metabolic and biosynthetic pathways between treatment types indicate

Respiratory allergy to Blomia tropicalis: Immune response in four syngeneic mouse strains and assessment of a low allergen-dose, short-term experimental model

PubMed Central

2010-01-01

Background The dust mite Blomia tropicalis is an important source of aeroallergens in tropical areas. Although a mouse model for B. tropicalis extract (BtE)-induced asthma has been described, no study comparing different mouse strains in this asthma model has been reported. The relevance and reproducibility of experimental animal models of allergy depends on the genetic background of the animal, the molecular composition of the allergen and the experimental protocol. Objectives This work had two objectives. The first was to study the anti-B. tropicalis allergic responses in different mouse strains using a short-term model of respiratory allergy to BtE. This study included the comparison of the allergic responses elicited by BtE with those elicited by ovalbumin in mice of the strain that responded better to BtE sensitization. The second objective was to investigate whether the best responder mouse strain could be used in an experimental model of allergy employing relatively low BtE doses. Methods Groups of mice of four different syngeneic strains were sensitized subcutaneously with 100 μg of BtE on days 0 and 7 and challenged four times intranasally, at days 8, 10, 12, and 14, with 10 μg of BtE. A/J mice, that were the best responders to BtE sensitization, were used to compare the B. tropicalis-specific asthma experimental model with the conventional experimental model of ovalbumin (OVA)-specific asthma. A/J mice were also sensitized with a lower dose of BtE. Results Mice of all strains had lung inflammatory-cell infiltration and increased levels of anti-BtE IgE antibodies, but these responses were significantly more intense in A/J mice than in CBA/J, BALB/c or C57BL/6J mice. Immunization of A/J mice with BtE induced a more intense airway eosinophil influx, higher levels of total IgE, similar airway hyperreactivity to methacholine but less intense mucous production, and lower levels of specific IgE, IgG1 and IgG2 antibodies than sensitization with OVA. Finally

Combined Chromatin and Expression Analysis Reveals Specific Regulatory Mechanisms within Cytokine Genes in the Macrophage Early Immune Response

PubMed Central

Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

2012-01-01

Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the

Amyloid Form of Ovalbumin Evokes Native Antigen-specific Immune Response in the Host

PubMed Central

Tufail, Saba; Owais, Mohammad; Kazmi, Shadab; Balyan, Renu; Kaur Khalsa, Jasneet; Faisal, Syed Mohd.; Sherwani, Mohd. Asif; Gatoo, Manzoor Ahmad; Umar, Mohd. Saad; Zubair, Swaleha

2015-01-01

Amyloids are highly organized protein aggregates that arise from inappropriately folded versions of proteins or polypeptides under both physiological as well as simulated ambiences. Once thought to be irreversible assemblies, amyloids have begun to expose their more dynamic and reversible attributes depending upon the intrinsic properties of the precursor protein/peptide and experimental conditions such as temperature, pressure, structural modifications in proteins, or presence of chemicals in the reaction mixture. It has been repeatedly proposed that amyloids undergo transformation to the bioactive peptide/protein forms under specific conditions. In the present study, amyloids assembled from the model protein ovalbumin (OVA) were found to release the precursor protein in a slow and steady manner over an extended time period. Interestingly, the released OVA from amyloid depot was found to exhibit biophysical characteristics of native protein and reacted with native-OVA specific monoclonal as well as polyclonal antibodies. Moreover, antibodies generated upon immunization of OVA amyloidal aggregates or fibrils were found to recognize the native form of OVA. The study suggests that amyloids may act as depots for the native form of the protein and therefore can be exploited as vaccine candidates, where slow antigen release over extended time periods is a pre-requisite for the development of desired immune response. PMID:25512377

Regulation of growth, intestinal microbiota, non-specific immune response and disease resistance of sea cucumber Apostichopus japonicus (Selenka) in biofloc systems.

PubMed

Chen, Jinghua; Ren, Yichao; Li, Yuquan; Xia, Bin

2018-06-01

Bioflocs are not only a source of supplemental nutrition but also provide substantial probiotic bacteria and bioactive compounds, which play an important role in improving physiological health of aquatic organisms. A 60-day experiment was conducted to investigate the growth, intestinal microbiota, non-specific immune response and disease resistance of sea cucumber in biofloc systems with different carbon sources (glucose, sucrose and starch). Control (no biofloc) and three biofloc systems were set up, and each group has three replicates. The results showed that biofloc volume (BFV) and total suspended solids (TSS) increased in the sequences of glucose > sucrose > starch and green sea cucumber > white sea cucumber during the experiment. The highest specific growth rates (SGRs) were observed in biofloc system with glucose as carbon source, which also had relatively lower glucose, lactate and cortisol levels in coelomic fluid and higher glycogen content in muscle compared to other groups. There were significant increased Bacillus and Lactobacillus counts of sea cucumber intestine in biofloc systems, and the activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) also showed obvious ascending trends. Significant increases in total coelomocytes counts (TCC), phagocytosis, respiratory burst, complement C3 content and lysozyme (LSZ) and acid phosphatase (ACP) activities of sea cucumber were all found in biofloc system (glucose). The expression patterns of most immune-related genes (i.e. Hsp90, Hsp70, c-type lectin (CL), toll-like receptor (TLR)) were up-regulated, suggesting the promotion of pathogen recognition ability and immune signaling pathways activation by biofloc. Furthermore, green and white sea cucumber had significantly higher survival rates in biofloc systems during the 14-day challenge test. In conclusion, biofloc technology could improve growth and physiological health of A. japonicus, by optimizing intestinal

RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes

PubMed Central

Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.

2011-01-01

Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430

Immune responses in Eimeria acervulina infected one-day-old broilers compared to amount of Eimeria in the duodenum, measured by real-time PCR.

PubMed

Swinkels, W J C; Post, J; Cornelissen, J B; Engel, B; Boersma, W J A; Rebel, J M J

2006-06-15

T-cell responses are supposed to be the major immune reactions in broilers infected with Eimeria. The nature of such T-cell responses is influenced by the species of Eimeria involved, age of the host, amount of parasites and the preceding infection history. In young chicks the intestine is still developing in length while the lymphocyte populations in the gut develop and differentiate. In chicks infected at young age the immune response may be different in quality as compared to responses in adults. We investigated the (T-cell) immune responses of young broilers to a primary Eimeria acervulina infection in relation to the number of parasites used for infection. In our experiment we infected one-day-old broilers with a low (5 x 10(2) oocysts) and a high (5 x 10(4) oocysts) dose of E. acervulina. We used a newly developed species specific real-time PCR to quantify total amount of parasites in the duodenum as the number of oocysts in faeces may not be representative for the exposure of the gut immune system. We characterized T-cell subsets in the duodenum by means of FACS-analyses, lymphocyte proliferation assays with spleen lymphocytes and the mRNA profiles of different cytokines (TGF-beta2, -4, IFN-gamma, IL-2, -6, -8 and -18) in the duodenum by means of real-time PCR. From day 5 p.i. broilers with a high dose of E. acervulina had a significantly lower body weight than the control group. No increase in CD4(+) cells, but a strong increase in CD8(+) cells was observed at days 7 and 9 p.i. in the duodenum of broilers infected with a high dose E. acervulina. IL-8 mRNA responses were observed after infection with low and with high infection doses, but no IFN-gamma and TGF-beta mRNA responses were found in the duodenum. The specific proliferative T-cell responses to a low infectious dose were not significantly different as compared to the control group. In conclusion, based on the kinetics of observed responses a primary infection with a high dose of E. acervulina in one

Influence of bedding type on mucosal immune responses.

PubMed

Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

2002-10-01

The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

CMV-specific T-cell immunity in solid organ transplant recipients at low risk of CMV infection. Chronology and applicability in preemptive therapy.

PubMed

Mena-Romo, Juan Damián; Pérez Romero, Pilar; Martín-Gandul, Cecilia; Gentil, Miguel Ángel; Suárez-Artacho, Gonzalo; Lage, Ernesto; Sánchez, Magdalena; Cordero, Elisa

2017-10-01

To characterize whether the CMV-specific cellular immune response can be used as a predictor of the control of CMV infection and disease and determine thresholds in solid organ transplant (SOT) recipients seropositive for CMV (R+). The CMV-specific T-cell response was characterized using intracellular cytokine staining and the evolution of clinical and virological parameters were recorded during the first year after transplantation. Besides having positive CMV serology, only 28.4% patients had positive immunity (CD8 + CD69 + IFN-γ + ≥0.25%) at 2 weeks after transplantation. These patients had less indication of preemptive treatment (p = 0.025) and developed less high grade (≥2000 IU/ml) CMV replication episodes (p = 0.006) than patients with no immunity. Of the 49 patients with a pretransplant sample, only 22.4% had positive immunity, and had a detectable immune response early after transplantation (median of 3.7 weeks). However, only 50% of patients with negative pretransplant immunity acquired a positive immune response and it was significantly later, at a median of 11 weeks (p < 0.001). Patients that developed CMV disease had no CMV-specific immunity. Having CMV-specific CD8 + IFN-γ + cells ≥0.25% before transplant; 0.15% at two weeks or 0.25% at four weeks after transplantation, identifies patients that may spontaneously control CMV infection and may require less monitoring. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

A CpG-containing oligodeoxynucleotide as an efficient adjuvant counterbalancing the Th1/Th2 immune response in diphtheria-tetanus-pertussis vaccine.

PubMed

Sugai, Toshiyuki; Mori, Masaaki; Nakazawa, Masatoshi; Ichino, Motohide; Naruto, Takuya; Kobayashi, Naoki; Kobayashi, Yoshinori; Minami, Mutsuhiko; Yokota, Shumpei

2005-11-16

Adjuvants in vaccines are immune stimulants that play an important role in the induction of effective and appropriate immune responses to vaccine component(s). Diphtheria-tetanus-pertussis (DPT) vaccine contains not only aluminum hydrate (alum) to enhance the immune response to the vaccine ingredients, but also, both for that purpose and as a principal ingredient, pertussis toxin (PT). However, both adjuvants strongly promote T helper (Th) 2 type immune responses. Th1 and Th2 type immune responses are counterbalanced in vivo, and a Th2-prone immune response is not effective against intracellular infections but promotes IgE production, which is related to allergic disease. In this study, we used the CpG motif contained in oligodeoxynucleotide (CpG-ODN), which has an adjuvant effect and also induces the Th1 response, as an adjuvant to this vaccine, and we investigated its adjuvanticity and its potential to modulate immune responses to DPT vaccine. Administration of DPT vaccine with CpG-ODN (DPT-alum/ODN) to mice significantly reduced the total IgE levels and increased the anti-PT specific IgG2a titer in serum, in comparison with ordinary DPT vaccine (DPT-alum). Moreover, we investigated the antibody response to orally administrated ovalbumin (OVA) after vaccine administration. In the DPT-alum/ODN-administered group, the OVA specific IgE production in serum greatly decreased in comparison with that in the DPT-alum-administered group. These data indicate that CpG-ODN was not useful only as an efficient vaccine adjuvant but also shifted the immune responses substantially toward Th1 and modulated the Th1/Th2 immune response in DPT vaccine. These data suggested new applications of CpG-ODN as adjuvants in DPT vaccine.

Stress proteins and the immune response.

PubMed

Moseley, P

2000-07-25

The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

Immune complexome analysis reveals the specific and frequent presence of immune complex antigens in lung cancer patients: A pilot study.

PubMed

Ohyama, Kaname; Yoshimi, Haruka; Aibara, Nozomi; Nakamura, Yoichi; Miyata, Yasuyoshi; Sakai, Hideki; Fujita, Fumihiko; Imaizumi, Yoshitaka; Chauhan, Anil K; Kishikawa, Naoya; Kuroda, Naotaka

2017-01-15

Cancer immunotherapies such as antibodies targeting T cell checkpoints, or adaptive tumor-infiltrating lymphocyte (TIL) transfer, have been developed to boost the endogenous immune response against human malignancies. However, activation of T cells by such antibodies can lead to the risk of autoimmune diseases. Also, the selection of tumor-reactive T cells for TIL relies on information regarding mutated antigens in tumors and does not reflect other factors involved in protein antigenicity. It is therefore essential to engineer therapeutic interventions by which T cell reactivity against tumor cells is selectively enhanced (i.e., "focused cancer immunotherapy") based on tumor antigens that are specifically expressed in the tumor of a certain cancer and in many patients with this cancer. Immune complexes (ICs) are the direct and stable products of immunological recognition by humoral immunity. Here, we searched for tumor-specific IC antigens in each of five cancers (lung (n = 28), colon (n = 20), bladder (n = 20), renal cell (n = 15) and malignant lymphoma (n = 9)), by using immune complexome analysis that comprehensively identifies and profiles the constituent antigens in ICs. This analysis indicated that gelsolin and inter-alpha-trypsin inhibitor heavy chains were specifically and frequently detected (at a frequency higher than 80%), and that phosphoproteins (VENTX, VCIP135) were also specifically present in the ICs of lung cancer patients. Immune complexome analysis successfully identified several tumor-specific IC antigens with high detection frequency in lung cancer patients. These specific antigens are required to validate the clinical benefit by further analysis using a large number of patients. © 2016 UICC.

Insect immunity shows specificity in protection upon secondary pathogen exposure.

PubMed

Sadd, Ben M; Schmid-Hempel, Paul

2006-06-20

Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.

Antigen-specific antibody response in juvenile-onset SLE patients following routine immunization with tetanus toxoid.

PubMed

Kashef, Sara; Ghazizadeh, Farid; Derakhshan, Ali; Farjadian, Shirin; Alyasin, Soheila

2008-09-01

Infection is now the most common cause of morbidity in Systemic Lupus Erythematosus (SLE). There is lack of information regarding the specific antibody formation in response to vaccines in young SLE patients. To determine the efficacy of anti-tetanus antibody response in young patients with SLE. Forty SLE patients with mean age of 14.1 years (range: 7-21) and 60 age and sex matched normal controls were enrolled in this study over a period of one year. Diagnosis was made according to the ACR criteria and disease activity was determined based on SLE Disease Activity Index (SLEDAI). All patients and controls had received the complete schedule of tetanus vaccinations consisting of three primary doses and two boosters by the age of six. Serum immunoglobulins and anti-tetanus antibody titers were determined by Nephelometry and ELISA. Anti-tetanus antibody levels greater than 0.1 IU/ml have been suggested as protective. In all of the patients and controls anti-tetanus antibody titer was > 0.1 IU/ml. IgG, IgA, and IgM levels were in the normal range for their age. Mean disease activity score was 4.9 (range: 0-16). There was no association between SLEDAI score and anti-tetanus antibody response. School age onset and immunosuppressive therapy does not seem to interfere with development of consistent immunity to tetanus vaccine in young SLE patients.

Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

PubMed

Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

2008-04-01

Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

Oral immunization with rotavirus VP7-CTB fusion expressed in transgenic Arabidopsis thaliana induces antigen-specific IgA and IgG and passive protection in mice

PubMed Central

Li, Yuxian; Guan, Lili; Liu, Xiuming; Liu, Weican; Yang, Jing; Zhang, Xiaomei; Wang, Fawei; Guo, Yongxin; Li, Haiyan; Li, Xiaokun

2018-01-01

Human rotavirus (HRV) is the primary cause of severe gastroenteritis in children. However, there is currently no protective virus for rotavirus available. In the present study, an HRVVP7-cholera toxin B subunit (CTB) fusion protein was expressed in Arabidopsis thaliana. To determine the adjuvant effect of HRVVP7-CTB, HRVVP7 without CTB was expressed in the same manner. HRVVP7-CTB accounted for 0.39% of the total soluble protein (TSP) in the transgenic seeds and 52.65 µg/g of HRVVP7 protein was expressed in these seeds. Mice were immunized with TSP from the transformed seeds and produced serum immunoglobulin G (IgG) and mucosal IgA specifically directed against HRVVP7. Antibody titers were highest in mice orally immunized with the plant-expressed HRVVP7-CTB protein, whereas HRVVP7-CTB-specific IgG neutralized the rotavirus. Suckling pups born from dams immunized with the HRVVP7-CTB fusion protein were protected against challenge with virulent rotavirus. The results of the present study suggest that the HRVVP7-CTB fusion protein produced in A. thaliana may be a rotaviral-specific candidate subunit vaccine. PMID:29805507

Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens

PubMed Central

Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.

2007-01-01

In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440

SagE induces highly effective protective immunity against Streptococcus iniae mainly through an immunogenic domain in the extracellular region.

PubMed

Sun, Yun; Sun, Li; Xing, Ming-qing; Liu, Chun-sheng; Hu, Yong-hua

2013-11-12

Streptococcus iniae is a Gram-positive bacterium and a severe pathogen of a wide range of farmed fish. S. iniae possesses a virulence-associated streptolysin S cluster composed of several components, one of which is SagE. SagE a transmembrane protein with one major extracellular region named ECR. This study aimed to develop a SagE-based DNA candidate vaccine against streptococcosis and examine the immunoprotective mechanism of the vaccine. We constructed a DNA vaccine, pSagE, based on the sagE gene and examined its immunological property in a Japanese flounder (Paralichthys olivaceus) model. The results showed that at 7 days post-vaccination, expression of SagE at transcription and translation levels was detected in the tissues of the vaccinated fish. After challenge with S. iniae at one and two months post-vaccination, pSagE-vaccinated fish exhibited relative percent survival (RPS) of 95% and 88% respectively. Immunological analysis showed that (i) pSagE significantly upregulated the expression of a wide range of immune genes, (ii) pSagE induced the production of specific serum antibodies that bound whole-cell S. iniae, and (iii) treatment of S. iniae with pSagE-induced antibodies blocked bacterial invasion of host cells. To localize the immunoprotective domain of SagE, the ECR-expressing DNA vaccine pSagEECR was constructed. Immunization analysis showed that flounder vaccinated with pSagEECR exhibited a RPS of 68%, and that pSagEECR induced serum antibody production and immune gene expression in a manner similar to, though to lower magnitudes than, those induced by pSagE. We in this study developed a DNA vaccine, pSagE, which induces highly protective immunity against S. iniae. The protective effect of pSagE is probably due to its ability to elicit systemic immune response, in particular that of the humoral branch, which leads to production of specific serum antibodies that impair bacterial infection. These results add insights to the immunoprotective mechanism

Enhancement of Tumor-Specific T Cell–Mediated Immunity in Dendritic Cell–Based Vaccines by Mycobacterium tuberculosis Heat Shock Protein X

PubMed Central

Jung, In Duk; Shin, Sung Jae; Lee, Min-Goo; Kang, Tae Heung; Han, Hee Dong; Lee, Seung Jun; Kim, Woo Sik; Kim, Hong Min; Park, Won Sun; Kim, Han Wool; Yun, Cheol-Heui; Lee, Eun Kyung; Wu, T.-C.

2014-01-01

Despite the potential for stimulation of robust antitumor immunity by dendritic cells (DCs), clinical applications of DC-based immunotherapy are limited by the low potency in generating tumor Ag-specific T cell responses. Therefore, optimal conditions for generating potent immunostimulatory DCs that overcome tolerance and suppression are key factors in DC-based tumor immunotherapy. In this study, we demonstrate that use of the Mycobacterium tuberculosis heat shock protein X (HspX) as an immunoadjuvant in DC-based tumor immunotherapy has significant potential in therapeutics. In particular, the treatment aids the induction of tumor-reactive T cell responses, especially tumor-specific CTLs. The HspX protein induces DC maturation and proinflammatory cytokine production (TNF-α, IL-1β, IL-6, and IFN-β) through TLR4 binding partially mediated by both the MyD88 and the TRIF signaling pathways. We employed two models of tumor progression and metastasis to evaluate HspX-stimulated DCs in vivo. The administration of HspX-stimulated DCs increased the activation of naive T cells, effectively polarizing the CD4+ and CD8+ T cells to secrete IFN-γ, as well as enhanced the cytotoxicity of splenocytes against HPV-16 E7 (E7)–expressing TC-1 murine tumor cells in therapeutic experimental animals. Moreover, the metastatic capacity of B16-BL6 melanoma cancer cells toward the lungs was remarkably attenuated in mice that received HspX-stimulated DCs. In conclusion, the high therapeutic response rates with tumor-targeted Th1-type T cell immunity as a result of HspX-stimulated DCs in two models suggest that HspX harnesses the exquisite immunological power and specificity of DCs for the treatment of tumors. PMID:24990079

An optimized assay of specific IgE antibodies to reactive dyes and studies of immunologic responses in exposed workers.

PubMed

Wass, U; Nilsson, R; Nordlinder, R; Belin, L

1990-03-01

Methods of assaying reactive dye-specific IgE antibodies were investigated with a RAST. Sera from three patients, occupationally exposed to a reactive dye, Remazol black B (Chemical Abstract registry number 17095-24-8), were used. Directly dyed disks, that is, disks without any carrier protein, resulted in poor and unreliable measures of specific IgE. In contrast, optimized preparation of conjugates between the dye and human serum albumin resulted in efficient binding of specific IgE. The patients' RAST results were strongly positive, whereas sera from 36 exposed workers but without symptoms and sera from unexposed subjects with high levels of total IgE were negative. The hapten and carrier specificity of the IgE antibodies was studied by direct RAST and RAST inhibition. In one patient, the antibodies were principally hapten specific, whereas another patient was found to have antibodies with a high degree of specificity to the carrier. The third patient's antibodies were intermediate between the other two patients' antibodies in this respect, suggesting that antibody specificity is dependent not only on the nature of the hapten but also on individual immune response factors. The study demonstrates that it is important to use an optimized preparation of dye-protein conjugates to elicit reliable results and a high degree of specific IgE binding in the RAST.

Induction of antigen-specific immunity by pH-sensitive carbonate apatite as a potent vaccine carrier

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hebishima, Takehisa; Tada, Seiichi; Takeshima, Shin-nosuke

Highlights: Black-Right-Pointing-Pointer To develop effective vaccine, we examined the effects of CO{sub 3}Ap as an antigen carrier. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap was taken up by BMDCs more effectively than free OVA. Black-Right-Pointing-Pointer OVA-immunized splenocytes was activated by OVA contained in CO{sub 3}Ap effectively. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap induced strong OVA-specific immune responses to C57BL/6 mice. Black-Right-Pointing-Pointer CO{sub 3}Ap is promising antigen carrier for the achievement of effective vaccine. -- Abstract: The ability of carbonate apatite (CO{sub 3}Ap) to enhance antigen-specific immunity was examined in vitro and in vivo to investigate its utility as a vaccine carrier.more » Murine bone marrow-derived dendritic cells took up ovalbumin (OVA) containing CO{sub 3}Ap more effectively than free OVA. Interestingly, mice immunized with OVA-containing CO{sub 3}Ap produced OVA-specific antibodies more effectively than mice immunized with free OVA. Furthermore, immunization of C57BL/6 mice with OVA-containing CO{sub 3}Ap induced the proliferation and antigen-specific production of IFN-{gamma} by splenocytes more strongly than immunization with free OVA. Moreover, no significant differences were detected in the induction of delayed-type hypersensitivity responses, an immune reaction involving an antigen-specific, cell-mediated immune response between OVA-containing CO{sub 3}Ap and OVA-containing alumina salt (Alum), suggesting that CO{sub 3}Ap induced cell-mediated immune response to the same degree as Alum, which is commonly used for clinical applications. This study is the first to demonstrate the induction of antigen-specific immune responses in vivo by CO{sub 3}Ap.« less

Extracellular self-DNA as a damage-associated molecular pattern (DAMP) that triggers self-specific immunity induction in plants.

PubMed

Duran-Flores, Dalia; Heil, Martin

2017-10-16

Mammals sense self or non-self extracellular or extranuclear DNA fragments (hereinafter collectively termed eDNA) as indicators of injury or infection and respond with immunity. We hypothesised that eDNA acts as a damage-associated molecular pattern (DAMP) also in plants and that it contributes to self versus non-self discrimination. Treating plants and suspension-cultured cells of common bean (Phaseolus vulgaris) with fragmented self eDNA (obtained from other plants of the same species) induced early, immunity-related signalling responses such as H 2 O 2 generation and MAPK activation, decreased the infection by a bacterial pathogen (Pseudomonas syringae) and increased an indirect defence to herbivores (extrafloral nectar secretion). By contrast, non-self DNA (obtained from lima bean, Phaseolus lunatus, and Acacia farnesiana) had significantly lower or no detectable effects. Only fragments below a size of 700 bp were active, and treating the eDNA preparation DNAse abolished its inducing effects, whereas treatment with RNAse or proteinase had no detectable effect. These findings indicate that DNA fragments, rather than small RNAs, single nucleotides or proteins, accounted for the observed effects. We suggest that eDNA functions a DAMP in plants and that plants discriminate self from non-self at a species-specific level. The immune systems of plants and mammals share multiple central elements, but further work will be required to understand the mechanisms and the selective benefits of an immunity response that is triggered by eDNA in a species-specific manner. Copyright © 2017 Elsevier Inc. All rights reserved.

Novel Adjuvant Based on the Pore-Forming Protein Sticholysin II Encapsulated into Liposomes Effectively Enhances the Antigen-Specific CTL-Mediated Immune Response

PubMed Central

Laborde, Rady J.; Sanchez-Ferras, Oraly; Luzardo, María C.; Cruz-Leal, Yoelys; Fernández, Audry; Mesa, Circe; Oliver, Liliana; Canet, Liem; Abreu-Butin, Liane; Nogueira, Catarina V.; Tejuca, Mayra; Pazos, Fabiola; Álvarez, Carlos; Alonso, María E.; Longo-Maugéri, Ieda M.; Starnbach, Michael N.; Higgins, Darren E.; Fernández, Luis E.; Lanio, María E.

2017-01-01

Vaccine strategies to enhance CD8+ CTL responses remain a current challenge because they should overcome the plasmatic and endosomal membranes for favoring exogenous Ag access to the cytosol of APCs. As a way to avoid this hurdle, sticholysin (St) II, a pore-forming protein from the Caribbean Sea anemone Stichodactyla helianthus, was encapsulated with OVA into liposomes (Lp/OVA/StII) to assess their efficacy to induce a CTL response. OVA-specific CD8+ T cells transferred to mice immunized with Lp/OVA/StII experienced a greater expansion than when the recipients were injected with the vesicles without St, mostly exhibiting a memory phenotype. Consequently, Lp/OVA/StII induced a more potent effector function, as shown by CTLs, in vivo assays. Furthermore, treatment of E.G7-OVA tumor-bearing mice with Lp/OVA/StII significantly reduced tumor growth being more noticeable in the preventive assay. The contribution of CD4+ and CD8+ T cells to CTL and antitumor activity, respectively, was elucidated. Interestingly, the irreversibly inactive variant of the StI mutant StI W111C, encapsulated with OVA into Lp, elicited a similar OVA-specific CTL response to that observed with Lp/OVA/StII or vesicles encapsulating recombinant StI or the reversibly inactive StI W111C dimer. These findings suggest the relative independence between StII pore-forming activity and its immuno-modulatory properties. In addition, StII-induced in vitro maturation of dendritic cells might be supporting these properties. These results are the first evidence, to our knowledge, that StII, a pore-forming protein from a marine eukaryotic organism, encapsulated into Lp functions as an adjuvant to induce a robust specific CTL response. PMID:28258198

Characterization of rubella-specific humoral immunity following two doses of MMR vaccine using proteome microarray technology

PubMed Central

Haralambieva, Iana H.; Gibson, Michael J.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Warner, Nathaniel D.; Grill, Diane E.

2017-01-01

Introduction//Background The lack of standardization of the currently used commercial anti-rubella IgG antibody assays leads to frequent misinterpretation of results for samples with low/equivocal antibody concentration. The use of alternative approaches in rubella serology could add new information leading to a fuller understanding of rubella protective immunity and neutralizing antibody response after vaccination. Methods We applied microarray technology to measure antibodies to all rubella virus proteins in 75 high and 75 low rubella virus-specific antibody responders after two MMR vaccine doses. These data were used in multivariate penalized logistic regression modeling of rubella-specific neutralizing antibody response after vaccination. Results We measured antibodies to all rubella virus structural proteins (i.e., the glycoproteins E1 and E2 and the capsid C protein) and to the non-structural protein P150. Antibody levels to each of these proteins were: correlated with the neutralizing antibody titer (p<0.006); demonstrated differences between the high and the low antibody responder groups (p<0.008); and were components of the model associated with/predictive of vaccine-induced rubella virus-specific neutralizing antibody titers (misclassification error = 0.2). Conclusion Our study supports the use of this new technology, as well as the use of antibody profiles/patterns (rather than single antibody measures) as biomarkers of neutralizing antibody response and correlates of protective immunity in rubella virus serology. PMID:29145521

Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.

PubMed

Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi

2018-04-16

While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

hrHPV E5 oncoprotein: immune evasion and related immunotherapies.

PubMed

de Freitas, Antonio Carlos; de Oliveira, Talita Helena Araújo; Barros, Marconi Rego; Venuti, Aldo

2017-05-25

The immune response is a key factor in the fight against HPV infection and related cancers, and thus, HPV is able to promote immune evasion through the expression of oncogenes. In particular, the E5 oncogene is responsible for modulation of several immune mechanisms, including antigen presentation and inflammatory pathways. Moreover, E5 was suggested as a promising therapeutic target, since there is still no effective medical therapy for the treatment of HPV-related pre-neoplasia and cancer. Indeed, several studies have shown good prospective for E5 immunotherapy, suggesting that it could be applied for the treatment of pre-cancerous lesions. Thus, insofar as the majority of cervical, oropharyngeal and anal cancers are caused by high-risk HPV (hrHPV), mainly by HPV16, the aim of this review is to discuss the immune pathways interfered by E5 oncoprotein of hrHPV highlighting the various aspects of the potential immunotherapeutic approaches.

Role of Pathogen-Derived Cell Wall Carbohydrates and Prostaglandin E2 in Immune Response and Suppression of Fish Immunity by the Oomycete Saprolegnia parasitica

PubMed Central

Belmonte, Rodrigo; Wang, Tiehui; Duncan, Gary J.; Skaar, Ida; Mélida, Hugo; Bulone, Vincent; van West, Pieter

2014-01-01

Saprolegnia parasitica is a freshwater oomycete that is capable of infecting several species of fin fish. Saprolegniosis, the disease caused by this microbe, has a substantial impact on Atlantic salmon aquaculture. No sustainable treatment against saprolegniosis is available, and little is known regarding the host response. In this study, we examined the immune response of Atlantic salmon to S. parasitica infection and to its cell wall carbohydrates. Saprolegnia triggers a strong inflammatory response in its host (i.e., induction of interleukin-1β1 [IL-1β1], IL-6, and tumor necrosis factor alpha), while severely suppressing the expression of genes associated with adaptive immunity in fish, through downregulation of T-helper cell cytokines, antigen presentation machinery, and immunoglobulins. Oomycete cell wall carbohydrates were recognized by fish leukocytes, triggering upregulation of genes involved in the inflammatory response, similar to what is observed during infection. Our data suggest that S. parasitica is capable of producing prostaglanding E2 (PGE2) in vitro, a metabolite not previously shown to be produced by oomycetes, and two proteins with homology to vertebrate enzymes known to play a role in prostaglandin biosynthesis have been identified in the oomycete genome. Exogenous PGE2 was shown to increase the inflammatory response in fish leukocytes incubated with cell wall carbohydrates while suppressing genes involved in cellular immunity (gamma interferon [IFN-γ] and the IFN-γ-inducible protein [γ-IP]). Inhibition of S. parasitica zoospore germination and mycelial growth by two cyclooxygenase inhibitors (aspirin and indomethacin) also suggests that prostaglandins may be involved in oomycete development. PMID:25114122

Specific Humoral Immune Response Induced by Propionibacterium acnes Can Prevent Actinobacillus pleuropneumoniae Infection in Mice

PubMed Central

Yang, Feng; Ma, Qiuyue; Huang, Jing; Ji, Qun; Zhai, Ruidong; Wang, Lei; Wang, Yu; Li, Linxi; Sun, Changjiang; Feng, Xin; Han, Wenyu

2014-01-01

Porcine contagious pleuropneumonia, caused by Actinobacillus pleuropneumoniae, has a major impact on economics, ecology, and animal welfare in the pig-rearing industry. Propionibacterium acnes, a facultative anaerobic Gram-positive corynebacterium, exists widely in normal healthy adult animals. We have shown previously that P. acnes can prevent A. pleuropneumoniae infections in mice and pigs. To elucidate the mechanism of this effect and to identify novel A. pleuropneumoniae vaccines, the role of anti-P. acnes antibodies in preventing infection was analyzed by indirect immunofluorescence and opsonophagocytosis assays in vitro. The role of the specific humoral immune response induced by P. acnes was confirmed in a B cell depletion mouse model. The survival rates of mice challenged with A. pleuropneumoniae exhibited a highly significant positive rank correlation with the levels of anti-P. acnes antibodies. The specific antibodies induced by P. acnes had the ability to combine with A. pleuropneumoniae and increase opsonization of A. pleuropneumoniae for phagocytosis. Furthermore, analysis in the murine B cell depletion model confirmed that the humoral immune response induced by P. acnes played an important role in resistance to A. pleuropneumoniae infection. In this study, we further elucidated the reasons that P. acnes can prevent A. pleuropneumoniae infection, which provides useful evidence for the development of heterologous vaccines for the control of porcine contagious pleuropneumonia. PMID:24429068

Soy isoflavones and immunity.

PubMed

Sakai, Tohru; Kogiso, Mari

2008-08-01

The amount of soy products consumed in Japan is much greater than that in Western countries. Recent evidence indicates that soy isoflavones play a beneficial role in obesity, cancer, osteoporosis, and cardiovascular disease. The soybean isoflavone genistein is present at high levels in soy products. Genistein is structurally similar to 17beta-estradiol (E2), and genistein has been suggested to be act as E2 or an antagonist against E2. Genistein suppresses antigen-specific immune response in vivo and lymphocyte proliferation response in vitro. However, genistein enhances the cytotoxic response mediated by NK and cytotoxic T cells and the cytokine production from T cells. Thus, the effect of genistein on immunity is immune cell-dependent. Due to its unique effect on immune function, genistein has been used for the treatment of the diseases in animal models and it has been found that genistein inhibits allergic inflammatory responses. In this review, we summarize current studies related to the effect of isoflavone genistein on the immune system.

INFLUENCE OF GENETIC FACTORS ON THE MAGNITUDE AND THE HETEROGENEITY OF THE IMMUNE RESPONSE IN THE RABBIT

PubMed Central

Eichmann, Klaus; Braun, Dietmar G.; Krause, Richard M.

1971-01-01

Selective breeding of rabbits immunized with Group C and Group A streptococcal vaccines was employed to reveal genetic influences on the magnitude and on the restriction in heterogeneity of the immune response to the group-specific carbohydrates. After two generations of selective breeding, complete segregation was achieved between a high-response population (>18 mg precipitins/ml serum, average 33 mg/ml) and a low-response population (<13 mg precipitins/ml serum, average 7.5 mg/ml) to Group C carbohydrate. This suggests that a limited number of genes controls the magnitude of the immune response to this antigen. Selective breeding of rabbits which were representative of heterogeneous, restricted, and monoclonal responses revealed that the degree of antibody heterogeneity in the parental rabbits is reflected in the offspring. More than 95% of the offspring derived from rabbits which had a heterogeneous immune response developed heterogeneous antibodies. 33% of the offspring derived from rabbits which had restricted and monoclonal immune responses developed monoclonal antibodies. This suggests that the degree of heterogeneity of the antibody response to the streptococcal carbohydrates is under genetic control. The degree of heterogeneity and the magnitude of the immune response appear to be independent variables. PMID:5558071

Gene vaccination to bias the immune response to amyloid-beta peptide as therapy for Alzheimer disease.

PubMed

Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A

2004-12-01

The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid

17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients.

PubMed

Wieten, R W; Goorhuis, A; Jonker, E F F; de Bree, G J; de Visser, A W; van Genderen, P J J; Remmerswaal, E B M; Ten Berge, I J M; Visser, L G; Grobusch, M P; van Leeuwen, E M M

2016-06-01

The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen patients using different immunosuppressive drugs and 30 healthy individuals vaccinated 0-22 years ago were included. The serological response was measured using the plaque reduction neutralization test (PRNT). CD8(+) and CD4(+) T-cell responses were measured following proliferation and re-stimulation with YFV peptide pools. Phenotypic characteristics and cytokine responses of CD8(+) T-cells were determined using class I tetramers. The geometric mean titre of neutralizing antibodies was not different between the groups (p = 0.77). The presence of YFV-specific CD4(+) and CD8(+) T-cell did not differ between patients and healthy individuals (15/15, 100.0% vs. 29/30, 96.7%, p = 0.475). Time since vaccination correlated negatively with the number of YFV-specific CD8(+) T-cells (r = -0.66, p = 0.0045). Percentages of early-differentiated memory cells increased (r = 0.67, p = 0.017) over time. These results imply that YF vaccination is effective despite certain immunosuppressive drug regimens. An early-differentiated memory-like phenotype persisted, which is associated with effective expansion upon re-encounter with antigen, suggesting a potent memory T-cell pool remains. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

JP-8 jet fuel exposure suppresses the immune response to viral infections.

PubMed

Harris, D T; Sakiestewa, D; Titone, D; He, X; Hyde, J; Witten, M

2008-05-01

The US Air Force has implemented the widespread use of JP-8 jet fuel in its operations, although a thorough understanding of its potential effects upon exposed personnel is unclear. Previous work has reported that JP-8 exposure is immunosuppressive. Exposure of mice to JP-8 for 1A h/day resulted in immediate secretion of two immunosuppressive agents, namely, interleukin-10 and prostaglandin E2. Thus, it was of interest to determine if jet fuel exposure might alter the immune response to infectious agents. The Hong Kong influenza model was used for these studies. Mice were exposed to 1000A mg/m(3) JP-8 (1A h/day) for 7A days before influenza viral infection. Animals were infected intra-nasally with virus and followed in terms of overall survival as well as immune responses. All surviving animals were killed 14A days after viral infection. In the present study, JP-8 exposure increased the severity of the viral infection by suppressing the anti-viral immune responses. That is, exposure of mice to JP-8 for 1A h/day for 7A days before infection resulted in decreased immune cell viability after exposure and infection, a greater than fourfold decrease in immune proliferative responses to mitogens, as well as an overall loss of CD3(+), CD4(+), and CD8(+) T cells from the lymph nodes, but not the spleens, of infected animals. These changes resulted in decreased survival of the exposed and infected mice, with only 33% of animals surviving as compared with 50% of mice infected but not jet fuel-exposed (and 100% of mice exposed only to JP-8). Thus, short-term, low-concentration JP-8 jet fuel exposures have significant suppressive effects on the immune system which can result in increased severity of viral infections.

Mucosal and Systemic Immune Responses to Influenza H7N9 Antigen HA1-2 Co-Delivered Intranasally with Flagellin or Polyethyleneimine in Mice and Chickens.

PubMed

Song, Li; Xiong, Dan; Song, Hongqin; Wu, Lili; Zhang, Meihua; Kang, Xilong; Pan, Zhiming; Jiao, Xinan

2017-01-01

Consecutive cases of human infection with H7N9 influenza viruses since 2013 in China have prompted efforts to develop an effective treatment. Subunit vaccines introduced by intranasal administration can block an infection at its primary site; flagellin (fliC) and polyethyleneimine (PEI) have been shown to be potent adjuvants. We previously generated the hemagglutinin (HA)1-2-fliC fusion protein consisting of the globular head domain (HA1-2; amino acids 62-284) of HA fused with Salmonella typhimurium fliC. In the present study, we investigated its effectiveness of both flagellin and PEI as mucosal adjuvants for the H7N9 influenza subunit vaccine. Mice immunized intranasally with HA1-2-fliC and HA1-2-PEI showed higher HA1-2-specific immunoglobulin (Ig)G and IgA titers in serum, nasal wash, and bronchial alveolar lavage fluid. Moreover, splenocyte activation and proliferation and the number of HA1-2-specific interferon (IFN)-γ- and interleukin (IL)-4-producing splenocytes were markedly increased in the fliC and PEI groups; in the latter, there were more cells secreting IL-4 than IFN-γ, suggesting that fliC induced T helper type (Th)1 and Th2 immune responses, and PEI induced Th2-biased responses, consistent with the serum antibody isotype pattern (IgG1/IgG2a ratio). Furthermore, virus challenge was performed in a chicken model. The results showed that chickens receiving fliC and PEI adjuvant vaccine exhibited robust immune responses leading to a significant reduction in viral loads of throat and cloaca compared to chickens receiving only HA1-2. These findings provide a basis for the development of H7N9 influenza HA1-2 mucosal subunit vaccines.

CELLS INVOLVED IN THE IMMUNE RESPONSE

PubMed Central

Singhal, Sharwan K.; Richter, Maxwell

1968-01-01

Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID

The innate immune response to lower respiratory tract E. Coli infection and the role of the CCL2-CCR2 axis in neonatal mice.

PubMed

McGrath-Morrow, Sharon A; Ndeh, Roland; Collaco, Joseph M; Poupore, Amy K; Dikeman, Dustin; Zhong, Qiong; Singer, Benjamin D; D'Alessio, Franco; Scott, Alan

2017-09-01

Neonates have greater morbidity/mortality from lower respiratory tract infections (LRTI) compared to older children. Lack of conditioning of the pulmonary immune system due to limited environmental exposures and/or infectious challenges likely contributes to the increase susceptibility in the neonate. In this study, we sought to gain insights into the nature and dynamics of the neonatal pulmonary immune response to LRTI using a murine model. Wildtype (WT) and Ccr2 -/- C57BL/6 neonatal and juvenile mice received E. coli or PBS by direct pharyngeal aspiration. Flow cytometry was used to measure immune cell dynamics and identify cytokine-producing cells. Real-time PCR and ELISA were used to measure cytokine/chemokine expression. Innate immune cell recruitment in response to E. coli-induced LRTI was delayed in the neonatal lung compared to juvenile lung. Lung clearance of bacteria was also significantly delayed in the neonate. Ccr2 -/- neonates, which lack an intact CCL2-CCR2 axis, had higher mortality after E. coli challenged than Ccr2 +/+ neonates. A greater percentage of CD8 + T cells and monocytes from WT neonates challenged with E. coli produced TNF compared to controls. The pulmonary immune response to E. coli-induced LRTI differed significantly between neonatal and juvenile mice. Neonates were more susceptible to increasing doses of E. coli and exhibited greater mortality than juveniles. In the absence of an intact CCL2-CCR2 axis, susceptibility to LRTI-induced mortality was further increased in neonatal mice. Taken together these findings underscore the importance of age-related differences in the innate immune response to LRTI during early stages of postnatal life. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cell-Specific Imd-NF-κB Responses Enable Simultaneous Antibacterial Immunity and Intestinal Epithelial Cell Shedding upon Bacterial Infection.

PubMed

Zhai, Zongzhao; Boquete, Jean-Philippe; Lemaitre, Bruno

2018-05-03

Intestinal infection triggers potent immune responses to combat pathogens and concomitantly drives epithelial renewal to maintain barrier integrity. Current models propose that epithelial renewal is primarily driven by damage caused by reactive oxygen species (ROS). Here we found that in Drosophila, the Imd-NF-κB pathway controlled enterocyte (EC) shedding upon infection, via a mechanism independent of ROS-associated apoptosis. Mechanistically, the Imd pathway synergized with JNK signaling to induce epithelial cell shedding specifically in the context of bacterial infection, requiring also the reduced expression of the transcription factor GATAe. Furthermore, cell-specific NF-κB responses enabled simultaneous production of antimicrobial peptides (AMPs) and epithelial shedding in different EC populations. Thus, the Imd-NF-κB pathway is central to the intestinal antibacterial response by mediating both AMP production and the maintenance of barrier integrity. Considering the similarities between Drosophila Imd signaling and mammalian TNFR pathway, our findings suggest the existence of an evolutionarily conserved genetic program in immunity-induced epithelial shedding. Copyright © 2018 Elsevier Inc. All rights reserved.

Effect of gender and sex hormones on immune responses following shock.

PubMed

Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H

2000-08-01

Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.

Protective immune responses during prepatency in goat kids experimentally infected with Eimeria ninakohlyakimovae.

PubMed

Matos, L; Muñoz, M C; Molina, J M; Rodríguez, F; Perez, D; Lopez, A; Ferrer, O; Hermosilla, C; Taubert, A; Ruiz, A

2017-08-15

During the first schizogony, the goat coccidia Eimeria ninakohlyakimovae develops macroschizonts in lacteal duct endothelial cells, whose rupture leads to severe ileal damage and clinical signs during the prepatent period. The immune response elicited against early stages of the parasite development still requires to be investigated. In the present study we have evaluated immune reactions in goat kids primary- and challenged-infected with Eimeria ninakohlyakimovae, and sacrificed during prepatency (7days after challenge). The oocyst output during the primary infection, body weight and clinical condition of all the animals were examined and, at the end of the experiment, all the goat kids were euthanized and subjected to necropsy. Samples were taken from different sections of the ileum, colon and mesenteric lymph nodes (MLN) of primary- and challenged E. ninakohlyakimovae-infected animals. Intestinal leukocyte subpopulations were characterized in E. ninakohlyakimovae-infected mucosa and counts of lymphocytes, eosinophils, polymorphonuclear neutrophils (PMN), globular leukocytes and mast cells were recorded. Additionally, gene expression of caprine IL-2, IL-4, IL-10 and INFγ of ileal, colonic and MLN tissues were performed, as well as the immunohistochemical characterization of immune cells. The E. ninakohlyakimovae primary infection resulted in moderate to severe enteritis with different degrees of diarrhoea and was accompanied by high OPG counts and an increase of most immune cells analyzed when compared to uninfected control animals. Furthermore, eosinophil-, lymphocyte-, globular leukocyte- and mast cell-counts were significantly higher in the challenge group compared to the primary infected animals, whilst the opposite was true for PMN counts. The challenge infection was also associated with moderate increased levels of local mucosal IgA. Interestingly, the number of immature schizonts found at the ileal mucosa was statistically higher in the challenge infected

Innate immune response development in nestling tree swallows

USGS Publications Warehouse

Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

2011-01-01

We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

IGG Subclass and Isotype Specific Immunoglobulin Responses to LASSA fever and Venezuelan Equine Encephalomyelitis: Natural Infection and Immunication

DTIC Science & Technology

1989-03-01

VENEZUELAN EQUINE ENCEPHALOMYELITIS: NATURAL INFECTION AND IMMUNIZATION PRINCIPAL INVESTIGATOR: Renata J. Engler CONTRACTING ORGANIZATION: Uniformed Services...University of Health Sciences 4301 Jones Bridges Road Bethesda, MD 20814-4799 DTIC REPORT DATE: March 1, 1989 E T E MAR0 6 1990 TYPE OF REPORT...University (if applicable) of Health Sciences I 6c. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) 4301 Jones Bridges Road

An oral Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus delivered by Escherichia coli elicits immune responses in dogs.

PubMed

Dahiya, S S; Saini, M; Kumar, P; Gupta, P K

2011-01-01

A Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus (CPV) was delivered by Escherichia coli to elicit immune responses. The orally immunized dogs developed CPV-specific serum IgG and virus neutralizing antibody responses. The cellular immune responses analyzed using lymphocyte proliferation test and flow cytometry indicated CPV-specific sensitization of both CD3+CD4+ and CD3+CD8+ lymphocytes. This study demonstrated that the oral CPV DNA vaccine delivered by E. coli can be considered as a promising approach for vaccination of dogs against CPV.

Targeting with bovine CD154 enhances humoral immune responses induced by a DNA vaccine in sheep.

PubMed

Manoj, Sharmila; Griebel, Philip J; Babiuk, Lorne A; van Drunen Littel-van den Hurk, Sylvia

2003-01-15

CD40-CD154 interactions play an important role in regulating humoral and cell-mediated immune responses. Recently, these interactions have been exploited for the development of therapeutic and preventive treatments. The objective of this study was to test the ability of bovine CD154 to target a plasmid-encoded Ag to CD40-expressing APCs. To achieve this, a plasmid coding for bovine CD154 fused to a truncated secreted form of bovine herpesvirus 1 glycoprotein D (tgD), pSLIAtgD-CD154, was constructed. The chimeric tgD-CD154 was expressed in vitro in COS-7 cells and reacted with both glycoprotein D- and CD154-specific Abs. Both tgD and tgD-CD154 were capable of binding to epithelial cells, whereas only tgD-CD154 bound to B cells. Furthermore, dual-labeling of ovine PBMCs revealed that tgD-CD154 was bound by primarily B cells. The functional integrity of the tgD-CD154 chimera was confirmed by the induction of both IL-4-dependent B cell proliferation and tgD-specific lymphoproliferative responses in vitro. Finally, sheep immunized with pSLIAtgD-CD154 developed a more rapid primary tgD-specific Ab response and a significantly stronger tgD-specific secondary response when compared with animals immunized with pSLIAtgD and control animals. Similarly, virus-neutralizing Ab titers were significantly higher after secondary immunization with pSLIAtgD-CD154. These results demonstrate that using CD154 to target plasmid-expressed Ag can significantly enhance immune responses induced by a DNA vaccine.

Immune and inflammatory responses in pigs infected with Trichuris suis and Oesophagostomum dentatum.

PubMed

Andreasen, Annette; Petersen, Heidi H; Kringel, Helene; Iburg, Tine M; Skovgaard, Kerstin; Dawson, Harry; Urban, Joseph F; Thamsborg, Stig M

2015-01-30

The aim of the present study was to investigate parasite induced immune responses in pigs co-infected with Trichuris suis and Oesophagostomum dentatum as compared to mono-species infected pigs. T. suis is known to elicit a strong immune response leading to rapid expulsion, and a strong antagonistic effect on O. dentatum populations has been observed in co-infected pigs. Forty-eight helminth naïve pigs were allocated into 4 groups in a 2-factorial design. Two groups were trickle inoculated with either 10 T. suis eggs/kg/day (Group T) or 20 O. dentatum L3/kg/day (Group O). Group OT was infected with same levels of both T. suis and O. dentatum (Group OT) and Group C remained uninfected. In each group, six pigs were necropsied after 35 days and the remaining pigs after 71 days. Parasite E/S-antigen specific serum antibodies were quantified by an in-direct ELISA. qPCR was used to measure the expression of immune function related genes in the mucosa of proximal colon and the draining lymph node. Highly significant interactions were identified for O. dentatum specific IgG1 (p<0.0001) and IgG2 (p<0.0006) antibodies with a remarkable 2-fold higher antibody response in group OT pigs as compared to group O. These findings indicated that T. suis enhanced the antibody response against O. dentatum in Group OT. The gene expression data confirmed a strong Type 2 response to T. suis (e.g. marked increase in IL-13, ARG1 and CCL11) and clearly weaker in amplitude and/or delayed onset response to O. dentatum in the single infected group. Interactions were found between the two nematodes with regard to several cytokines, e.g. the increase in IL-13 observed in Group T was absent in Group OT (p=0.06, proximal colon mucosa, 35 and 71 p.i.). Some of these immune response-related interactions may support, or even partially explain, the observed interactions between the two worm populations in co-infected pigs. Copyright © 2014 Elsevier B.V. All rights reserved.

Transciptomic study of mucosal immune, antioxidant and growth related genes and non-specific immune response of common carp (Cyprinus carpio) fed dietary Ferula (Ferula assafoetida).

PubMed

Safari, Roghieh; Hoseinifar, Seyed Hossein; Nejadmoghadam, Shabnam; Jafar, Ali

2016-08-01

A 8-weeks feeding trial was conducted to examine the effects of different levels (0, 0.5, 1 and 2%) of dietary Ferula (Ferula assafoetida) on expression of antioxidant enzymes (GSR, GPX and GSTA), immune (TNF-alpha, IL1B, IL- 8 and LYZ) and growth (GH, IGF1 and Ghrl) genes as well as cutaneous mucus and serum non-specific immune response in common carp. The results revealed Ferula significantly increased antioxidant gene expression (GSR and GSTA) in a dose dependent manner (P < 0.05). The expression of immune growth related genes were significantly higher in Ferula fed fish compared control group (P < 0.05). The effects of Ferula on expression of genes was more pronounced in higher doses. Feeding on Ferula supplemented diet remarkably increased skin mucus lysozyme activity (P < 0.05). However, evaluation of mucus total Ig and protease activity revealed no significant difference between control and treated groups (P > 0.05). Regarding non-specific humoral response, serum total Ig, lysozyme and ACH50 showed no remarkable variation between Ferula fed carps and control group (P > 0.05). These results indicated up-regulation of growth and health related genes in Ferula fed common carp. Further studies using pathogen or stress challenge is required to conclude that transcriptional modulation is beneficial in common carp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detection of herpes simplex virus type 2 (HSV-2) -specific cell-mediated immune responses in guinea pigs during latent HSV-2 genital infection.

PubMed

Perry, Clarice L; Banasik, Brianne N; Gorder, Summer R; Xia, Jingya; Auclair, Sarah; Bourne, Nigel; Milligan, Gregg N

2016-12-01

Genital infections with herpes simplex virus type 2 (HSV-2) are a source of considerable morbidity and are a health concern for newborns exposed to virus during vaginal delivery. Additionally, HSV-2 infection diminishes the integrity of the vaginal epithelium resulting in increased susceptibility of individuals to infection with other sexually transmitted pathogens. Understanding immune protection against HSV-2 primary infection and immune modulation of virus shedding events following reactivation of the virus from latency is important for the development of effective prophylactic and therapeutic vaccines. Although the murine model of HSV-2 infection is useful for understanding immunity following immunization, it is limited by the lack of spontaneous reactivation of HSV-2 from latency. Genital infection of guinea pigs with HSV-2 accurately models the disease of humans including the spontaneous reactivation of HSV-2 from latency and provides a unique opportunity to examine virus-host interactions during latency. Although the guinea pig represents an accurate model of many human infections, relatively few reagents are available to study the immunological response to infection. To analyze the cell-mediated immune response of guinea pigs at extended periods of time after establishment of HSV-2 latency, we have modified flow-cytometry based proliferation assays and IFN-γ ELISPOT assays to detect and quantify HSV-specific cell-mediated responses during latent infection of guinea pigs. Here we demonstrate that a combination of proliferation and ELISPOT assays can be used to quantify and characterize effecter function of virus-specific immune memory responses during HSV-latency. Copyright © 2016 Elsevier B.V. All rights reserved.

Myeloid IKKβ Promotes Antitumor Immunity by Modulating CCL11 and the Innate Immune Response

PubMed Central

Yang, Jinming; Hawkins, Oriana E.; Barham, Whitney; Gilchuk, Pavlo; Boothby, Mark; Ayers, Gregory D.; Joyce, Sebastian; Karin, Michael; Yull, Fiona E.; Richmond, Ann

2015-01-01

Myeloid cells are capable of promoting or eradicating tumor cells and the nodal functions that contribute to their different roles are still obscure. Here, we show that mice with myeloid-specific genetic loss of the NF-κB pathway regulatory kinase IKKβ exhibit more rapid growth of cutaneous and lung melanoma tumors. In a BRAFV600E/PTEN−/− allograft model, IKKβ loss in macrophages reduced recruitment of myeloid cells into the tumor, lowered expression of MHC class II molecules, and enhanced production of the chemokine CCL11, thereby negatively regulating dendritic-cell maturation. Elevated serum and tissue levels of CCL11 mediated suppression of dendritic-cell differentiation/maturation within the tumor microenvironment, skewing it toward a Th2 immune response and impairing CD8+ T cell–mediated tumor cell lysis. Depleting macrophages or CD8+ T cells in mice with wild-type IKKβ myeloid cells enhanced tumor growth, where the myeloid cell response was used to mediate antitumor immunity against melanoma tumors (with less dependency on a CD8+ T-cell response). In contrast, myeloid cells deficient in IKKβ were compromised in tumor cell lysis, based on their reduced ability to phagocytize and digest tumor cells. Thus, mice with continuous IKKβ signaling in myeloid-lineage cells (IKKβCA) exhibited enhanced antitumor immunity and reduced melanoma outgrowth. Collectively, our results illuminate new mechanisms through which NF-κB signaling in myeloid cells promotes innate tumor surveillance. PMID:25336190

Effect of nanovaccine chemistry on humoral immune response kinetics and maturation

NASA Astrophysics Data System (ADS)

Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji

2014-10-01

Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry

Photodynamic therapy for cancer and activation of immune response

NASA Astrophysics Data System (ADS)

Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.

2010-02-01

Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.

Role of pathogen-derived cell wall carbohydrates and prostaglandin E2 in immune response and suppression of fish immunity by the oomycete Saprolegnia parasitica.

PubMed

Belmonte, Rodrigo; Wang, Tiehui; Duncan, Gary J; Skaar, Ida; Mélida, Hugo; Bulone, Vincent; van West, Pieter; Secombes, Christopher J

2014-11-01

Saprolegnia parasitica is a freshwater oomycete that is capable of infecting several species of fin fish. Saprolegniosis, the disease caused by this microbe, has a substantial impact on Atlantic salmon aquaculture. No sustainable treatment against saprolegniosis is available, and little is known regarding the host response. In this study, we examined the immune response of Atlantic salmon to S. parasitica infection and to its cell wall carbohydrates. Saprolegnia triggers a strong inflammatory response in its host (i.e., induction of interleukin-1β1 [IL-1β1], IL-6, and tumor necrosis factor alpha), while severely suppressing the expression of genes associated with adaptive immunity in fish, through downregulation of T-helper cell cytokines, antigen presentation machinery, and immunoglobulins. Oomycete cell wall carbohydrates were recognized by fish leukocytes, triggering upregulation of genes involved in the inflammatory response, similar to what is observed during infection. Our data suggest that S. parasitica is capable of producing prostaglandin [corrected] E2 (PGE2) in vitro, a metabolite not previously shown to be produced by oomycetes, and two proteins with homology to vertebrate enzymes known to play a role in prostaglandin biosynthesis have been identified in the oomycete genome. Exogenous PGE2 was shown to increase the inflammatory response in fish leukocytes incubated with cell wall carbohydrates while suppressing genes involved in cellular immunity (gamma interferon [IFN-γ] and the IFN-γ-inducible protein [γ-IP]). Inhibition of S. parasitica zoospore germination and mycelial growth by two cyclooxygenase inhibitors (aspirin and indomethacin) also suggests that prostaglandins may be involved in oomycete development. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A zebrafish larval model reveals early tissue-specific innate immune responses to Mucor circinelloides.

PubMed

Voelz, Kerstin; Gratacap, Remi L; Wheeler, Robert T

2015-11-01

Mucormycosis is an emerging fungal infection that is clinically difficult to manage, with increasing incidence and extremely high mortality rates. Individuals with diabetes, suppressed immunity or traumatic injury are at increased risk of developing disease. These individuals often present with defects in phagocytic effector cell function. Research using mammalian models and phagocytic effector cell lines has attempted to decipher the importance of the innate immune system in host defence against mucormycosis. However, these model systems have not been satisfactory for direct analysis of the interaction between innate immune effector cells and infectious sporangiospores in vivo. Here, we report the first real-time in vivo analysis of the early innate immune response to mucormycete infection using a whole-animal zebrafish larval model system. We identified differential host susceptibility, dependent on the site of infection (hindbrain ventricle and swim bladder), as well as differential functions of the two major phagocyte effector cell types in response to viable and non-viable spores. Larval susceptibility to mucormycete spore infection was increased upon immunosuppressant treatment. We showed for the first time that macrophages and neutrophils were readily recruited in vivo to the site of infection in an intact host and that spore phagocytosis can be observed in real-time in vivo. While exploring innate immune effector recruitment dynamics, we discovered the formation of phagocyte clusters in response to fungal spores that potentially play a role in fungal spore dissemination. Spores failed to activate pro-inflammatory gene expression by 6 h post-infection in both infection models. After 24 h, induction of a pro-inflammatory response was observed only in hindbrain ventricle infections. Only a weak pro-inflammatory response was initiated after spore injection into the swim bladder during the same time frame. In the future, the zebrafish larva as a live whole

A dendritic cell targeted vaccine induces long-term HIV-specific immunity within the gastrointestinal tract.

PubMed

Ruane, D; Do, Y; Brane, L; Garg, A; Bozzacco, L; Kraus, T; Caskey, M; Salazar, A; Trumpheller, C; Mehandru, S

2016-09-01

Despite significant therapeutic advances for HIV-1 infected individuals, a preventative HIV-1 vaccine remains elusive. Studies focusing on early transmission events, including the observation that there is a profound loss of gastrointestinal (GI) CD4(+) T cells during acute HIV-1 infection, highlight the importance of inducing HIV-specific immunity within the gut. Here we report on the generation of cellular and humoral immune responses in the intestines by a mucosally administered, dendritic cell (DC) targeted vaccine. Our results show that nasally delivered α-CD205-p24 vaccine in combination with polyICLC, induced polyfunctional immune responses within naso-pulmonary lymphoid sites that disseminated widely to systemic and mucosal (GI tract and the vaginal epithelium) sites. Qualitatively, while α-CD205-p24 prime-boost immunization generated CD4(+) T-cell responses, heterologous prime-boost immunization with α-CD205-p24 and NYVAC gag-p24 generated high levels of HIV-specific CD4(+) and CD8(+) T cells within the GI tract. Finally, DC-targeting enhanced the amplitude and longevity of vaccine-induced immune responses in the GI tract. This is the first report of a nasally delivered, DC-targeted vaccine to generate HIV-specific immune responses in the GI tract and will potentially inform the design of preventative approaches against HIV-1 and other mucosal infections.

Humoral and cellular immune response in Wistar Han RCC rats fed two genetically modified maize MON810 varieties for 90 days (EU 7th Framework Programme project GRACE).

PubMed

Tulinská, Jana; Adel-Patient, Karine; Bernard, Hervé; Líšková, Aurélia; Kuricová, Miroslava; Ilavská, Silvia; Horváthová, Mira; Kebis, Anton; Rollerová, Eva; Babincová, Júlia; Aláčová, Radka; Wal, Jean-Michel; Schmidt, Kerstin; Schmidtke, Jörg; Schmidt, Paul; Kohl, Christian; Wilhelm, Ralf; Schiemann, Joachim; Steinberg, Pablo

2018-07-01

The genetically modified maize event MON810 expresses a Bacillus thuringiensis-derived gene, which encodes the insecticidal protein Cry1Ab to control some lepidopteran insect pests such as the European corn borer. It has been claimed that the immune system may be affected following the oral/intragastric administration of the MON810 maize in various different animal species. In the frame of the EU-funded project GRACE, two 90-day feeding trials, the so-called studies D and E, were performed to analyze the humoral and cellular immune responses of male and female Wistar Han RCC rats fed the MON810 maize. A MON810 maize variety of Monsanto was used in the study D and a MON810 maize variety of Pioneer Hi-Bred was used in the study E. The total as well as the maize protein- and Cry1Ab-serum-specific IgG, IgM, IgA and IgE levels, the proliferative activity of the lymphocytes, the phagocytic activity of the granulocytes and monocytes, the respiratory burst of the phagocytes, a phenotypic analysis of spleen, thymus and lymph node cells as well as the in vitro production of cytokines by spleen cells were analyzed. No specific Cry1Ab immune response was observed in MON810 rats, and anti-maize protein antibody responses were similar in MON810 and control rats. Single parameters were sporadically altered in rats fed the MON810 maize when compared to control rats, but these alterations are considered to be of no immunotoxicological significance.

Immune Response to Recombinant Adenovirus in Humans: Capsid Components from Viral Input Are Targets for Vector-Specific Cytotoxic T Lymphocytes

PubMed Central

Molinier-Frenkel, Valérie; Gahery-Segard, Hanne; Mehtali, Majid; Le Boulaire, Christophe; Ribault, Sébastien; Boulanger, Pierre; Tursz, Thomas; Guillet, Jean-Gérard; Farace, Françoise

2000-01-01

We previously demonstrated that a single injection of 109 PFU of recombinant adenovirus into patients induces strong vector-specific immune responses (H. Gahéry-Ségard, V. Molinier-Frenkel, C. Le Boulaire, P. Saulnier, P. Opolon, R. Lengagne, E. Gautier, A. Le Cesne, L. Zitvogel, A. Venet, C. Schatz, M. Courtney, T. Le Chevalier, T. Tursz, J.-G. Guillet, and F. Farace, J. Clin. Investig. 100:2218–2226, 1997). In the present study we analyzed the mechanism of vector recognition by cytotoxic T lymphocytes (CTL). CD8+ CTL lines were derived from two patients and maintained in long-term cultures. Target cell infections with E1-deleted and E1-plus E2-deleted adenoviruses, as well as transcription-blocking experiments with actinomycin D, revealed that host T-cell recognition did not require viral gene transcription. Target cells treated with brefeldin A were not lysed, indicating that viral input protein-derived peptides are associated with HLA class I molecules. Using recombinant capsid component-loaded targets, we observed that the three major proteins could be recognized. These results raise the question of the use of multideleted adenoviruses for gene therapy in the quest to diminish antivector CTL responses. PMID:10906225

Immune responses in children infected with the pinworm Enterobius vermicularis in central Greece.

PubMed

Patsantara, G G; Piperaki, E-T; Tzoumaka-Bakoula, C; Kanariou, M G

2016-05-01

Previous studies have suggested an immunomodulatory and even protective role for Enterobius vermicularis, the least pathogenic human intestinal helminth. Here, in a study using haematological and serological parameters, we tested a total of 215 children from central Greece, with a mean age of 8.39, of whom 105 (48.84%) were infected with E. vermicularis and 110 (51.16%) were matched healthy controls. In particular, we analysed eosinophil counts (EO), serum eosinophil cationic protein (ECP), total and specific serum immunoglobulin E (IgE) and the ECP/EO ratio. The atopic status and the potential occurrence of clinically expressed allergic diseases were both taken into account. Eosinophils, ECP and IgE were found to be higher in infected than in uninfected children, indicating a type-2 immune response activation during infection. Atopic infected children exhibited higher IgE levels compared to non-atopic ones. EO and ECP were found to be lower in atopic children who had a history of allergic disease than in those with no such history. The type-2 oriented immune response elicited against E. vermicularis could contribute to a balanced activation of the immune system in the examined children. Interestingly, although the atopic children showed a stronger activation, they did not exhibit any symptoms and, moreover, there seemed to be some indication of immunosuppression in those children with a positive history of allergic disease.

Optimization of heterologous DNA-prime, protein boost regimens and site of vaccination to enhance therapeutic immunity against human papillomavirus-associated disease.

PubMed

Peng, Shiwen; Qiu, Jin; Yang, Andrew; Yang, Benjamin; Jeang, Jessica; Wang, Joshua W; Chang, Yung-Nien; Brayton, Cory; Roden, Richard B S; Hung, Chien-Fu; Wu, T-C

2016-01-01

Human papillomavirus (HPV) has been identified as the primary etiologic factor of cervical cancer as well as subsets of anogenital and oropharyngeal cancers. The two HPV viral oncoproteins, E6 and E7, are uniquely and consistently expressed in all HPV infected cells and are therefore promising targets for therapeutic vaccination. Both recombinant naked DNA and protein-based HPV vaccines have been demonstrated to elicit HPV-specific CD8+ T cell responses that provide therapeutic effects against HPV-associated tumor models. Here we examine the immunogenicity in a preclinical model of priming with HPV DNA vaccine followed by boosting with filterable aggregates of HPV 16 L2E6E7 fusion protein (TA-CIN). We observed that priming twice with an HPV DNA vaccine followed by a single TA-CIN booster immunization generated the strongest antigen-specific CD8+ T cell response compared to other prime-boost combinations tested in C57BL/6 mice, whether naïve or bearing the HPV16 E6/E7 transformed syngeneic tumor model, TC-1. We showed that the magnitude of antigen-specific CD8+ T cell response generated by the DNA vaccine prime, TA-CIN protein vaccine boost combinatorial strategy is dependent on the dose of TA-CIN protein vaccine. In addition, we found that a single booster immunization comprising intradermal or intramuscular administration of TA-CIN after priming twice with an HPV DNA vaccine generated a comparable boost to E7-specific CD8+ T cell responses. We also demonstrated that the immune responses elicited by the DNA vaccine prime, TA-CIN protein vaccine boost strategy translate into potent prophylactic and therapeutic antitumor effects. Finally, as seen for repeat TA-CIN protein vaccination, we showed that the heterologous DNA prime and protein boost vaccination strategy is well tolerated by mice. Our results provide rationale for future clinical testing of HPV DNA vaccine prime, TA-CIN protein vaccine boost immunization regimen for the control of HPV-associated diseases.

Mucosal and Systemic Immune Responses to Influenza H7N9 Antigen HA1–2 Co-Delivered Intranasally with Flagellin or Polyethyleneimine in Mice and Chickens

PubMed Central

Song, Li; Xiong, Dan; Song, Hongqin; Wu, Lili; Zhang, Meihua; Kang, Xilong; Pan, Zhiming; Jiao, Xinan

2017-01-01

Consecutive cases of human infection with H7N9 influenza viruses since 2013 in China have prompted efforts to develop an effective treatment. Subunit vaccines introduced by intranasal administration can block an infection at its primary site; flagellin (fliC) and polyethyleneimine (PEI) have been shown to be potent adjuvants. We previously generated the hemagglutinin (HA)1–2-fliC fusion protein consisting of the globular head domain (HA1–2; amino acids 62–284) of HA fused with Salmonella typhimurium fliC. In the present study, we investigated its effectiveness of both flagellin and PEI as mucosal adjuvants for the H7N9 influenza subunit vaccine. Mice immunized intranasally with HA1–2-fliC and HA1–2-PEI showed higher HA1–2-specific immunoglobulin (Ig)G and IgA titers in serum, nasal wash, and bronchial alveolar lavage fluid. Moreover, splenocyte activation and proliferation and the number of HA1–2-specific interferon (IFN)-γ- and interleukin (IL)-4-producing splenocytes were markedly increased in the fliC and PEI groups; in the latter, there were more cells secreting IL-4 than IFN-γ, suggesting that fliC induced T helper type (Th)1 and Th2 immune responses, and PEI induced Th2-biased responses, consistent with the serum antibody isotype pattern (IgG1/IgG2a ratio). Furthermore, virus challenge was performed in a chicken model. The results showed that chickens receiving fliC and PEI adjuvant vaccine exhibited robust immune responses leading to a significant reduction in viral loads of throat and cloaca compared to chickens receiving only HA1–2. These findings provide a basis for the development of H7N9 influenza HA1–2 mucosal subunit vaccines. PMID:28424686

Mechanism study of tumor-specific immune responses induced by laser immunotherapy

NASA Astrophysics Data System (ADS)

Li, Xiaosong; Zhou, Feifan; Le, Henry; Wolf, Roman F.; Howard, Eric; Nordquist, Robert E.; Hode, Tomas; Liu, Hong; Chen, Wei R.

2011-03-01

Laser immunotherapy (LIT) has shown its efficacy against late-stage, metastatic cancers, both in pre-clinical studies and clinical pilot trials. However, the possible mechanism of LIT is still not fully understood. In our previous studies, we have shown that LIT induces tumor-specific antibodies that strongly bind to the target tumors. Tumor resistance in cured animals demonstrated long-term immunological effect of LIT. Successful transfer of adoptive immunity using spleen cells from LIT-cured animals indicated a long-term immunological memory of the host system. In clinical trials for the treatment of late-stage melanoma patients and breast cancer patients, the similar long-term, systemic effects have also been observed. To further study the immunological mechanism of LIT, immuno-histochemical analysis of patient tumor samples has performed before and after LIT treatment. Our results showed strong evidence that LIT significantly increases the infiltration of immune cells in the target tumors. Specifically, LIT appeared to drive the infiltrating immune cell populations in the direction of CD4, CD8 and CD68 T-cells. It is possible that activation and enhancement of both humeral and cellular arms of the host immune system are achievable by the treatment of LIT. These special features of LIT have contributed to the success of patient treatment. The underlying mechanism of LIT appears to be an in-situ autologous whole-cell cancer vaccination, using all components of tumors as sources of tumor antigens. Our preliminary mechanistic studies and future in-depth studies will contribute to the understanding and development of LIT as an effective modality for the treatment of late stage cancer patients who are facing severely limited options.

Mathematical modeling provides kinetic details of the human immune response to vaccination

PubMed Central

Le, Dustin; Miller, Joseph D.; Ganusov, Vitaly V.

2015-01-01

With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data. PMID:25621280

Mathematical modeling provides kinetic details of the human immune response to vaccination.

PubMed

Le, Dustin; Miller, Joseph D; Ganusov, Vitaly V

2014-01-01

With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.

Nucleoporin MOS7/Nup88 contributes to plant immunity and nuclear accumulation of defense regulators.

PubMed

Wiermer, Marcel; Germain, Hugo; Cheng, Yu Ti; García, Ana V; Parker, Jane E; Li, Xin

2010-01-01

Controlled nucleocytoplasmic trafficking is an important feature for fine-tuning signaling pathways in eukaryotic organisms. Nuclear pore complexes (NPCs) composed of nucleoporin proteins (Nups) are essential for the exchange of macromolecules across the nuclear envelope. A recent genetic screen in our laboratory identified a partial loss-of-function mutation in Arabidopsis MOS7/Nup88 that causes defects in basal immunity, Resistance (R) protein-mediated defense and systemic acquired resistance. In Drosophila and mammalian cells, exportin-mediated nuclear export of activated Rel/NFκB transcription factors is enhanced in nup88 mutants resulting in immune response failure. Consistent with Nup88 promoting nuclear retention of NFκB, our functional analyses revealed that MOS7/Nup88 is required for appropriate nuclear accumulation of the autoactivated R protein snc1, as well as the key immune regulators EDS1 and NPR1. These results suggest that controlling the nuclear concentrations of specific immune regulators is fundamental for defining defense outputs.

Serotype-Specific Neutralizing Antibody Epitopes of Human Adenovirus Type 3 (HAdV-3) and HAdV-7 Reside in Multiple Hexon Hypervariable Regions

PubMed Central

Qiu, Hongling; Li, Xiao; Tian, Xingui; Zhou, Zhichao; Xing, Ke; Li, Haitao; Tang, Ni; Liu, Wenkuan; Bai, Peisheng

2012-01-01

Human adenovirus types 3 and 7 (HAdV-3 and HAdV-7) occur epidemically and contribute greatly to respiratory diseases, but there is no currently available licensed recombinant HAdV-3/HAdV-7 bivalent vaccine. Identification of serotype-specific neutralizing antibody (NAb) epitopes for HAdV-3 and HAdV-7 will be beneficial for development of recombinant HAdV-3/HAdV-7 bivalent vaccines. In this study, four NAb epitopes within hexon hypervariable regions (HVRs) were predicted for HAdV-3 and HAdV-7, respectively, by using bioinformatics. Eight hexon chimeric adenovirus vectors with the alternation of only one predicted neutralizing epitope were constructed. Further in vitro and in vivo neutralization assays indicated that E2 (residing in HVR2) and E3 (residing in HVR5) are NAb epitopes for HAdV-7, and E3 plays a more important role in generating NAb responses. Cross-neutralization assays indicated that all four predicted epitopes, R1 to R4, are NAb epitopes for HAdV-3, and R1 (residing in HVR1) plays the most important role in generating NAb responses. Humoral immune responses elicited by the recombinant rAdH7R1 (containing the R1 epitope) were significantly and durably suppressed by HAdV-3-specific NAbs. Surprisingly, the rAdΔE3GFP-specific neutralizing epitope responses induced by rAdMHE3 (R3 replaced by E3) and rAdMHE4 (R4 replaced by E4) were weaker than those of rAdMHE1 (R1 replaced by E1) or rAdMHE2 (R2 relaced by E2) in vitro and in vivo. Furthermore, rAdMHE4 replicated more slowly in HEp-2 cells, and the final yield was about 10-fold lower than that of rAdΔE3GFP. The current findings contribute not only to the development of new adenovirus vaccine candidates, but also to the construction of new gene delivery vectors. PMID:22623776

Total and allergen-specific IgE levels during and after pregnancy in relation to maternal allergy.

PubMed

Sandberg, Martina; Frykman, Anne; Jonsson, Yvonne; Persson, Marie; Ernerudh, Jan; Berg, Göran; Matthiesen, Leif; Ekerfelt, Christina; Jenmalm, Maria C

2009-07-01

Type 2 T-helper cell (Th2)-skewed immunity is associated with successful pregnancy and the ability to easily direct immune responses to a Th2-polarised profile may be an evolutionary benefit. The Th2-like immunity associated with allergic disease might generate favourable effects for the maintenance of pregnancy, but could also promote development of Th2-like immune responses and allergic disease in the offspring. The aim of this study was to explore, by using IgE as a stable proxy for Th2, the Th1/Th2 balance in allergic and non-allergic women by measuring allergen-specific and total IgE antibody levels in plasma during pregnancy and after delivery. Specific and total IgE antibody levels were determined by ImmunoCAP technology at five occasions during pregnancy (gestational weeks 10-12, 15-16, 25, 35 and 39), as well as at 2 and 12 months after delivery. Thirty-six women without and 20 women with allergic symptoms were included, of whom 13 were sensitised with allergic symptoms and 30 were non-sensitised without allergic symptoms. The levels of total IgE, but not allergen-specific IgE, were increased during early pregnancy when compared to 12 months after delivery in the sensitised women with allergic symptoms, but not in the non-sensitised women without allergic symptoms (p<0.01). This increase in total IgE levels during early pregnancy only in the sensitised women with allergic symptoms indicates that allergy is associated with an enhanced Th2 deviation during pregnancy.

Cord blood Streptococcus pneumoniae‐specific cellular immune responses predict early pneumococcal carriage in high‐risk infants in Papua New Guinea

PubMed Central

Francis, J. P.; Richmond, P. C.; Strickland, D.; Prescott, S. L.; Pomat, W. S.; Michael, A.; Nadal‐Sims, M. A.; Edwards‐Devitt, C. J.; Holt, P. G.; Lehmann, D.

2016-01-01

Summary In areas where Streptococcus pneumoniae is highly endemic, infants experience very early pneumococcal colonization of the upper respiratory tract, with carriage often persisting into adulthood. We aimed to explore whether newborns in high‐risk areas have pre‐existing pneumococcal‐specific cellular immune responses that may affect early pneumococcal acquisition. Cord blood mononuclear cells (CBMC) of 84 Papua New Guinean (PNG; high endemic) and 33 Australian (AUS; low endemic) newborns were stimulated in vitro with detoxified pneumolysin (dPly) or pneumococcal surface protein A (PspA; families 1 and 2) and compared for cytokine responses. Within the PNG cohort, associations between CBMC dPly and PspA‐induced responses and pneumococcal colonization within the first month of life were studied. Significantly higher PspA‐specific interferon (IFN)‐γ, tumour necrosis factor (TNF)‐α, interleukin (IL)‐5, IL‐6, IL‐10 and IL‐13 responses, and lower dPly‐IL‐6 responses were produced in CBMC cultures of PNG compared to AUS newborns. Higher CBMC PspA‐IL‐5 and PspA‐IL‐13 responses correlated with a higher proportion of cord CD4 T cells, and higher dPly‐IL‐6 responses with a higher frequency of cord antigen‐presenting cells. In the PNG cohort, higher PspA‐specific IL‐5 and IL‐6 CBMC responses were associated independently and significantly with increased risk of earlier pneumococcal colonization, while a significant protective effect was found for higher PspA‐IL‐10 CBMC responses. Pneumococcus‐specific cellular immune responses differ between children born in pneumococcal high versus low endemic settings, which may contribute to the higher risk of infants in high endemic settings for early pneumococcal colonization, and hence disease. PMID:27859014

Chemokine-mediated immune responses in the female genital tract mucosa.

PubMed

Deruaz, Maud; Luster, Andrew D

2015-04-01

The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

Strain-specific protective immunity following vaccination against experimental Trypanosoma cruzi infection.

PubMed

Haolla, Filipe A; Claser, Carla; de Alencar, Bruna C G; Tzelepis, Fanny; de Vasconcelos, José Ronnie; de Oliveira, Gabriel; Silvério, Jaline C; Machado, Alexandre V; Lannes-Vieira, Joseli; Bruna-Romero, Oscar; Gazzinelli, Ricardo T; dos Santos, Ricardo Ribeiro; Soares, Milena B P; Rodrigues, Mauricio M

2009-09-18

Immunisation with Amastigote Surface Protein 2 (asp-2) and trans-sialidase (ts) genes induces protective immunity in highly susceptible A/Sn mice, against infection with parasites of the Y strain of Trypanosoma cruzi. Based on immunological and biological strain variations in T. cruzi parasites, our goal was to validate our vaccination results using different parasite strains. Due to the importance of the CD8(+) T cells in protective immunity, we initially determined which strains expressed the immunodominant H-2K(k)-restricted epitope TEWETGQI. We tested eight strains, four of which elicited immune responses to this epitope (Y, G, Colombian and Colombia). We selected the Colombian and Colombia strains for our studies. A/Sn mice were immunised with different regimens using both T. cruzi genes (asp-2 and ts) simultaneously and subsequently challenged with blood trypomastigotes. Immune responses before the challenge were confirmed by the presence of specific antibodies and peptide-specific T cells. Genetic vaccination did not confer protective immunity against acute infection with a lethal dose of the Colombian strain. In contrast, we observed a drastic reduction in parasitemia and a significant increase in survival, following challenge with an otherwise lethal dose of the Colombia strain. In many surviving animals with late-stage chronic infection, we observed alterations in the heart's electrical conductivity, compared to naive mice. In summary, we concluded that immunity against T. cruzi antigens, similar to viruses and bacteria, may be strain-specific and have a negative impact on vaccine development.

The absence of platelet-derived growth factor-B in circulating cells promotes immune and inflammatory responses in atherosclerosis-prone ApoE-/- mice.

PubMed

Tang, Jingjing; Kozaki, Koichi; Farr, Andrew G; Martin, Paul J; Lindahl, Per; Betsholtz, Christer; Raines, Elaine W

2005-09-01

Both innate and adaptive immunity contribute to the progression of inflammatory-fibrotic lesions of atherosclerosis. Although platelet-derived growth factor (PDGF)-B has been investigated as a stimulant of smooth muscle cells in vascular diseases, its effects on the immune response during disease have not been evaluated in vivo. We used hematopoietic chimeras generated after lethal irradiation of ApoE-/- recipients to test the role of PDGF in atherosclerosis. Monocyte accumulation in early atherosclerotic lesions increased 1.9-fold in ApoE-/-/PDGF-B-/- chimeras. Lymphocytes from null chimeras showed a 1.6- to 2.0-fold increase in the number of activated CD4(+) T cells and a 2.5-fold elevation of interferon-gamma-secreting CD4(+) T cells on ex vivo challenge with modified low-density lipoprotein. Splenocyte transcript levels were also altered with a twofold decrease in interleukin-10 and 1.7- and 3.0-fold increases in interleukin-18 and CCR 5, respectively. These cellular and molecular changes were consistent with a shift to a proinflammatory phenotype in null chimeras. Our data also demonstrated for the first time the presence of a recently discovered family of negative regulators of innate and adaptive immunity, the suppressors of cytokine signaling (SOCS), in developing atherosclerotic lesions. Thus, our studies identify two independent negative immune regulatory pathways-PDGF-B and SOCS-that may help limit lesion expansion.

Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.

PubMed

Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna

2017-12-11

Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.

Modeling Systems-Level Regulation of Host Immune Responses

PubMed Central

Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka

2007-01-01

Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300

Evaluation of Th1/Th2-Related Immune Response against Recombinant Proteins of Brucella abortus Infection in Mice.

PubMed

Im, Young Bin; Park, Woo Bin; Jung, Myunghwan; Kim, Suk; Yoo, Han Sang

2016-06-28

Brucellosis is a zoonotic disease caused by Brucella, a genus of gram-negative bacteria. Cytokines have key roles in the activation of innate and acquired immunities. Despite several research attempts to reveal the immune responses, the mechanism of Brucella infection remains unclear. Therefore, immune responses were analyzed in mice immunized with nine recombinant proteins. Cytokine production profiles were analyzed in the RAW 264.7 cells and naive splenocytes after stimulation with three recombinant proteins, metal-dependent hydrolase (r0628), bacterioferritin (rBfr), and thiamine transporter substrate-binding protein (rTbpA). Immune responses were analyzed by ELISA and ELISpot assay after immunization with proteins in mice. The production levels of NO, TNF-α, and IL-6 were time-dependently increased after having been stimulated with proteins in the RAW 264.7 cells. In naive splenocytes, the production of IFN-γ and IL-2 was increased after stimulation with the proteins. It was concluded that two recombinant proteins, r0628 and rTbpA, showed strong immunogenicity that was induced with Th1-related cytokines IFN-γ, IL-2, and TNF-α more than Th2-related cytokines IL-6, IL-4, and IL-5 in vitro. Conversely, a humoral immune response was activated by increasing the number of antigen-secreting cells specifically. Furthermore, these could be candidate diagnosis antigens for better understanding of brucellosis.

Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

PubMed Central

Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

2015-01-01

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

Polyomavirus-Specific Cellular Immunity: From BK-Virus-Specific Cellular Immunity to BK-Virus-Associated Nephropathy?

PubMed Central

Dekeyser, Manon; François, Hélène; Beaudreuil, Séverine; Durrbach, Antoine

2015-01-01

In renal transplantation, BK-virus (BKV)-associated nephropathy has emerged as a major complication, with a prevalence of 1–10% and graft loss in >50% of cases. BKV is a member of the polyomavirus family and rarely induces apparent clinical disease in the general population. However, replication of polyomaviruses, associated with significant organ disease, is observed in patients with acquired immunosuppression. Monitoring of specific immunity combined with viral load could be used to individually assess the risk of viral reactivation and virus control. We review the current knowledge on BKV-specific cellular immunity and, more specifically, in immunocompromised patients. In the future, immune-based therapies could allow us to treat and prevent BKV-associated nephropathy. PMID:26136745

Simultaneous Presence of Non- and Highly Mutated Keyhole Limpet Hemocyanin (KLH)-Specific Plasmablasts Early after Primary KLH Immunization Suggests Cross-Reactive Memory B Cell Activation.

PubMed

Giesecke, Claudia; Meyer, Tim; Durek, Pawel; Maul, Jochen; Preiß, Jan; Jacobs, Joannes F M; Thiel, Andreas; Radbruch, Andreas; Ullrich, Reiner; Dörner, Thomas

2018-06-15

There are currently limited insights into the progression of human primary humoral immunity despite numerous studies in experimental models. In this study, we analyzed a primary and related secondary parenteral keyhole limpet hemocyanin (KLH) immunization in five human adults. The primary challenge elicited discordant KLH-specific serum and blood effector B cell responses (i.e., dominant serum KLH-specific IgG and IgM levels versus dominant KLH-specific IgA plasmablast frequencies). Single-cell IgH sequencing revealed early appearance of highly (>15 mutations) mutated circulating KLH-specific plasmablasts 2 wk after primary KLH immunization, with simultaneous KLH-specific plasmablasts carrying non- and low-mutated IgH sequences. The data suggest that the highly mutated cells might originate from cross-reactive memory B cells (mBCs) rather than from the naive B cell repertoire, consistent with previous reported mutation rates and the presence of KLH-reactive mBCs in naive vaccinees prior to immunization. Whereas upon secondary immunization, serum Ab response kinetics and plasmablast mutation loads suggested the exclusive reactivation of KLH-specific mBCs, we, however, detected only little clonal overlap between the peripheral KLH-specific secondary plasmablast IgH repertoire and the primary plasmablast and mBC repertoire, respectively. Our data provide novel mechanistic insights into human humoral immune responses and suggest that primary KLH immunization recruits both naive B cells and cross-reactive mBCs, whereas secondary challenge exclusively recruits from a memory repertoire, with little clonal overlap with the primary response. Copyright © 2018 by The American Association of Immunologists, Inc.

Passive Antibody Administration (Immediate Immunity) as a Specific Defense Against Biological Weapons

PubMed Central

2002-01-01

The potential threat of biological warfare with a specific agent is proportional to the susceptibility of the population to that agent. Preventing disease after exposure to a biological agent is partially a function of the immunity of the exposed individual. The only available countermeasure that can provide immediate immunity against a biological agent is passive antibody. Unlike vaccines, which require time to induce protective immunity and depend on the host’s ability to mount an immune response, passive antibody can theoretically confer protection regardless of the immune status of the host. Passive antibody therapy has substantial advantages over antimicrobial agents and other measures for postexposure prophylaxis, including low toxicity and high specific activity. Specific antibodies are active against the major agents of bioterrorism, including anthrax, smallpox, botulinum toxin, tularemia, and plague. This article proposes a biological defense initiative based on developing, producing, and stockpiling specific antibody reagents that can be used to protect the population against biological warfare threats. PMID:12141970

Vaccine specific immune response to an inactivated oral cholera vaccine and EPI vaccines in a high and low arsenic area in Bangladeshi children.

PubMed

Saha, Amit; Chowdhury, Mohiul I; Nazim, Mohammad; Alam, Mohammad Murshid; Ahmed, Tanvir; Hossain, Mohammad Bakhtiar; Hore, Samar Kumar; Sultana, Gazi Nurun Nahar; Svennerholm, Ann-Mari; Qadri, Firdausi

2013-01-11

Immune responses to the inactivated oral whole cell cholera toxin B (CTB) subunit cholera vaccine, Dukoral(®), as well as three childhood vaccines in the national immunization system were compared in children living in high and low arsenic contaminated areas in Bangladesh. In addition, serum complement factors C3 and C4 levels were evaluated among children in the two areas. VACCINATIONS: Toddlers (2-5 years) were orally immunized with two doses of Dukoral 14 days apart. Study participants had also received diphtheria, tetanus and measles vaccines according to the Expanded Program on Immunization (EPI) in Bangladesh. The mean level of arsenic in the urine specimens in the children of the high arsenic area (HAA, Shahrasti, Chandpur) was 291.8μg/L while the level was 6.60μg/L in the low arsenic area (LAA, Mirpur, Dhaka). Cholera specific vibriocidal antibody responses were significantly increased in the HAA (87%, P<0.001) and the LAA (75%, P<0.001) children after vaccination with Dukoral, but no differences were found between the two groups. Levels of CTB specific IgA and IgG antibodies were comparable between the two groups, whereas LPS specific IgA and IgG were higher in the LAA group, although response rates were comparable. Diphtheria and tetanus vaccine specific IgG responses were significantly higher in the HAA compared to the LAA group (P<0.001, P=0.048 respectively), whereas there were no differences in the measles specific IgG responses between the groups. Complement C3 and C4 levels in sera were higher in participants from the HAA than the LAA groups (P<0.001, P=0.049 respectively). The study demonstrates that the oral cholera vaccine as well as the EPI vaccines studied are immunogenic in children in high and low arsenic areas in Bangladesh. The results are encouraging for the potential use of cholera vaccines as well as the EPI vaccines in arsenic endemic areas. Copyright © 2012 Elsevier Ltd. All rights reserved.

Longitudinal analysis of Prototheca zopfii-specific immune responses: correlation with disease progression and carriage in dairy cows.

PubMed

Roesler, Uwe; Hensel, Andreas

2003-03-01

In order to characterize the humoral and cellular immune responses to bovine mammary protothecosis, serum and whey samples obtained from 72 dairy cows assigned to four different clinical stages of infection were examined for specific antibodies by indirect enzyme-linked immunosorbent assay techniques. Milk samples were analyzed for the total numbers of excreted algal cells and somatic cells. After characterization of the course of immune induction in bovine protothecal mastitis, a long-term sentinel study was performed in an affected herd in order to investigate disease progression. A total of 61 dairy cows with protothecal mastitis were examined for shedding of algae cells and for local immune responses three times in 6-month intervals. During acute and chronic stages of protothecosis, significantly elevated specific antibody activities in sera were detected. A strong correlation of whey immunoglobulin A (IgA) and whey IgG1 antibody activity with the total counts of somatic cells in milk was observed, whereas only a weak correlation of whey IgA and whey IgG1 concentrations to the number of algal cells excreted with the milk was seen. Our results from the sentinel long-term study of infected cows revealed that 70.5% of the persistently infected animals were continuously shedding the pathogen. About 4.9% of the animals showed an intermittent shedding, whereas 18% of the cows were tested culturally negative throughout the study. It can be assumed that Prototheca zopfii mastitis in dairy cows is maintained on the herd level by subclinically infected alga-shedding cows.