Sample records for early aseptic loosening

  1. [Early aseptic loosening of the CF 30 femoral stem].


    Kovanda, M; Havlícek, V; Hudec, J


    The CF 30 stem in combination with a cementless acetabulum was used at the First Department of Orthopedic Surgery in Brno in the years 1994 to 1995. From the second year following implantation, aseptic stem loosening was recorded. In order to find explanation of this early loosening, the authors, in cooperation with the Institute of Solid Mechanics, Mechatronics and Biomechanics, carried out the stress-strain analysis in a model system. Eighty patients (31 men and 49 women) received a cemented CF30 femoral component in 1994. Of them, 16 patients underwent revision arthroplasty, three died of causes unrelated to the surgery, and four were lost to follow-up. The final clinical and radiographic check-up was carried out in 2001. The results of a comprehensive examination were available in 57 patients with a CF30 stem. The patients were evaluated on the basis of the Harris hip score and anteroposterior radiographs of the hip. X-ray films obtained immediately after surgery and those taken at regular intervals during follow-up were compared. The following characteristics were noted: translucent lines in individual zones along the stem at the cement-bone interface; osteolysis, i. e., non-linear translucent areas, at least 5 mm long, at the cement-bone interface; and subsidence of the femoral component, i. e., migration of the stem distal to the tip of the greater trochanter. The CF 30 stem survival curve showed that aseptic stem loosening occurred from post-implantation year 2, and increased during the following years. At 6 years and 6 months, a total of 16 patients underwent revision surgery, involving reimplantation in 14 and implant removal in 2 patients. Potential causes of aseptic loosening: Polyethylene wear.However, no acetabular loosening was found in this group, although acetabular components are reported to become loose more often than femoral components. By comparison of the stem survival curves for Poldi and CF 30 stems it appeared that, at 6 years and 6 months

  2. Early Migration Predicts Aseptic Loosening of Cementless Femoral Stems: A Long-term Study.


    Streit, Marcus R; Haeussler, Daniel; Bruckner, Thomas; Proctor, Tanja; Innmann, Moritz M; Merle, Christian; Gotterbarm, Tobias; Weiss, Stefan


    Excessive early migration of cemented stems and cups after THA has been associated with poor long-term survival and allows predictable evaluation of implant performance. However, there are few data regarding the relationship between early migration and aseptic loosening of cementless femoral components, and whether early migration might predict late failure has not been evaluated, to our knowledge. Einzel-Bild-Röntgen-Analyse-femoral component analysis (EBRA-FCA) is a validated technique to accurately measure axial femoral stem migration without the need for tantalum markers, can be performed retrospectively, and may be a suitable tool to identify poor performing implants before their widespread use. We asked: (1) Is axial migration within the first 24 months as assessed by EBRA-FCA greater among cementless stems that develop aseptic loosening than those that remain well fixed through the second decade; (2) what is the diagnostic performance of implant migration at 24 months postoperatively to predict later aseptic loosening of these components; and (3) how does long-term stem survivorship compare between groups with high and low early migration? We evaluated early axial stem migration in 158 cementless THAs using EBRA-FCA. The EBRA-FCA measurements were performed during the first week postoperatively (baseline measurement) and at regular followups of 3, 6, and 12 months postoperatively and annually thereafter. The mean duration of followup was 21 years (range, 18-24 years). The stems studied represented 45% (158 of 354) of the cementless THAs performed during that time, and cementless THAs represented 34% (354 of 1038) of the THA practice during that period. No patient enrolled in this study was lost to followup. Multivariate survivorship analysis using Cox's regression model was performed with an endpoint of aseptic loosening of the femoral component. Loosening was defined according to the criteria described by Engh et al. and assessed by two independent

  3. An experimental animal model of aseptic loosening of hip prostheses in sheep to study early biochemical changes at the interface membrane

    PubMed Central

    El-Warrak, Alexander O; Olmstead, Marvin; Schneider, Rebecca; Meinel, Lorenz; Bettschart-Wolfisberger, Regula; Akens, Margarete K; Auer, Joerg; von Rechenberg, Brigitte


    Background Aseptic loosening of hip prosthesis as it occurs in clinical cases in human patients was attributed to wear particles of the implants, the response of the tissue dominated by macrophages and the production of inflammatory mediators and matrix degrading enzymes; however, the cascade of events initiating the process and their interaction regarding the time course is still open and discussed controversially. Therefore, the goal of this study was to establish an experimental animal model in sheep allowing to follow the cascade of early mechanical and biochemical events within the interface membrane and study the sequence of how they contribute to the pathological bone resorption necessary for aseptic loosening of the implant. Methods A cemented modular system (Biomedtrix) was used as a hip replacement in 24 adult Swiss Alpine sheep, with one group receiving a complete cement mantle as controls (n = 12), and the other group a cement mantle with a standardized, lateral, primary defect in the cement mantle (n = 12). Animals were followed over time for 2 and 8.5 months (n = 6 each). After sacrifice, samples from the interface membranes were harvested from five different regions of the femur and joint capsule. Explant cell cultures were performed and supernatant of cultures were tested and assayed for nitric oxide, prostaglandin E2, caseinolytic and collagenolytic activity. RNA extraction and quantification were performed for inducible nitric oxide synthase, cyclooxygenase-2, interleukin 1, and interleukin 6. Overall differences between groups and time periods and interactions thereof were calculated using a factorial analysis of variance (ANOVA). Results The development of an interface membrane was noticed in both groups at both time points. However, in the controls the interface membrane regressed in thickness and biological activity, while both variables increased in the experimental group with the primary cement mantle defect over time. Nitric oxide (NO) and

  4. Role of free radicals in aseptic loosening of hip arthroplasty.


    Kinov, Plamen; Leithner, Andreas; Radl, Roman; Bodo, Koppany; Khoschsorur, Gholam-Ali; Schauenstein, Konrad; Windhager, Reinhard


    Fibrous pseudocapsule around hip implants is an invariable finding at revision operations and is believed to release inflammatory mediators that stimulate bone resorption. Reactive oxygen species have been proposed to be causative factors in various disorders with tissue fibrosis. We were interested in investigating whether aseptic loosening is connected with high oxidative stress, and in showing the underlying mechanism of periprosthetic fibrosis and its role in loosening. Levels of oxidative stress markers reduced (GSH) and oxidized (GSSG) gluthatione and malondialdehyde (MDA) were assayed in 28 loose hips and in 12 stable hips revised for high rate of wear and osteolysis. Collagen in the periprosthetic tissues was measured as hydroxyproline content. Osteolysis and polyethylene wear were graded. Increased oxidative stress measured by low GSH/GSSG ratio as well as by increased MDA level was established in patients compared to controls. Oxidative stress markers intercorrelated significantly. MDA and both GSH and GSSG levels correlated significantly with hydroxyproline level. Levels of GSSG and MDA were higher in hips with greater polyethylene wear. The results suggest that high oxidative stress may play a role in formation of a fibrous membrane observed at revision of loose hips. The fibrous pseudocapsule is probably related to high intraarticular pressure and expansion of the effective joint space. This study may elicit some aspects of the pathogenesis of aseptic hip loosening and aid in future investigations aiming at prevention of this complication.

  5. Aseptic loosening of cobalt chromium monoblock sockets after hip resurfacing.


    Amstutz, Harlan C; Le Duff, Michel J


    Acetabular component loosening is a leading cause for revision after metal-on-metal hip resurfacing arthroplasty (MMHRA). We aimed to identify potential risk factors and determine radiographic signs associated with this mode of failure. From a series of 1375 hips treated with MMHRA, 21 (20 patients) underwent revision surgery secondary to aseptic loosening of the acetabular component and 6 patients had a radiographically loose acetabular component. A control group of 27 hips (26 patients) was selected among the patients that did not have a revision, and was matched for age, gender, component size and diagnosis. Mean time to revision in the loosening group was 103.0 months and the mean time of follow-up in the control group was 161.4 months. We found greater activity levels, range of motion scores, and cup abduction angles in the loosening group. The centre-edge (CE) angle of Wiberg was 10° lower in the loosening group compared with the control group. In addition, 11 of the hips from the study group presented a sclerotic halo superior to the cup on the last radiograph vs. none in the control group. There was no difference in the prevalence of postoperative reaming gaps or radiographic signs of neck-cup impingement between the 2 groups. Risk factors for acetabular loosening included hip dysplasia with low CE angle, and a large cup abduction angle. The patient's level of activity influences the appearance of symptoms and the time to revision. We recommend selecting patients with a sufficient CE angle and properly orienting the cup.

  6. Correlation of quantitative histopathological morphology and quantitative radiological analysis during aseptic loosening of hip endoprostheses.


    Bertz, S; Kriegsmann, J; Eckardt, A; Delank, K-S; Drees, P; Hansen, T; Otto, M


    Aseptic hip prosthesis loosening is the most important long-term complication in total hip arthroplasty. Polyethylene (PE) wear is the dominant etiologic factor in aseptic loosening, which together with other factors induces mechanisms resulting in bone loss, and finally in implant loosening. The single-shot radiograph analysis (EBRA, abbreviation for the German term "Einzel-Bild-Röntgenanalyse") is a computerized method for early radiological prediction of aseptic loosening. In this study, EBRA parameters were correlated with histomorphological parameters of the periprosthetic membrane. Periprosthetic membranes obtained from 19 patients during revision surgery of loosened ABG I-type total hip pros-theses were analyzed histologically and morphometrically. The pre-existing EBRA parameters, the thickness of the PE debris lay-er and the dimension of inclination and anteversion, were compared with the density of macrophages and giant cells. Addi-tionally, the semiquantitatively determined density of lymphocytes, plasma cells, giant cells and the size of the necrotic areas were correlated with the EBRA results. All periprosthetic membranes were classified as debris-induced type membranes. We found a positive correlation between the number of giant cells and the thickness of the PE debris layer. There was no significant correlation between the number of macrophages or all semiquantitative parameters and EBRA parameters. The number of giant cells decreased with implant duration. The morphometrically measured number of foreign body giant cells more closely reflects the results of the EBRA. The semiquantitative estimation of giant cell density could not substitute for the morphometrical analysis. The density of macrophages, lymphocytes, plasma cells and the size of necrotic areas did not correlate with the EBRA parameters, indicating that there is no correlation with aseptic loosening.

  7. Diabetes Mellitus and Hyperglycemia and the Risk of Aseptic Loosening in Total Joint Arthroplasty.


    Maradit Kremers, Hilal; Schleck, Cathy D; Lewallen, Eric A; Larson, Dirk R; Van Wijnen, Andre J; Lewallen, David G


    It is unknown to what extent diabetes mellitus modifies the long-term risk of aseptic loosening in total hip arthroplasty (THA) and total knee arthroplasty (TKA). We examined the association between diabetes mellitus, perioperative hyperglycemia, and the likelihood of revisions for aseptic loosening. We studied 16,085 primary THA and TKA procedures performed at a large tertiary care hospital between 2002 and 2009. All blood glucose values around the time of surgery (within 1 week) were retrieved. Subsequent revision surgeries and the reasons for revision were ascertained through the institutional joint registry. Multivariate Cox models were used to estimate the hazard ratios (HRs) and 95% confidence intervals (CIs) for aseptic loosening associated with diabetes mellitus and hyperglycemia adjusting for age, gender, body mass index, and surgery type. A total of 2911 (18%) surgeries had a diagnosis of diabetes mellitus at the time of surgery. Glucose testing was performed at least once in 7055 (44%) procedures within ±1 week of surgery. Although diabetic patients did not experience a higher risk of revision for aseptic loosening (HR, 0.87; 95% CI, 0.55-1.38), higher preoperative glucose values on the day before surgery were significantly associated with both the overall risk of revisions (HR, 2.80; 95% CI, 1.00-7.85) and revisions for aseptic loosening (HR, 4.95; 95% CI, 1.26-19.54). High preoperative hyperglycemia is a potential risk factor for aseptic loosening in THA and TKA. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Endoglin (CD105) expression differentiates between aseptic loosening and periprosthetic joint infection after total joint arthroplasty.


    Jansen, Philipp; Mumme, Torsten; Randau, Thomas; Gravius, Sascha; Hermanns-Sachweh, Benita


    The differentiation between aseptic loosening and periprosthetic joint infection (PJI) after total joint arthroplasty is essential for successful therapy. A better understanding of pathogenesis of aseptic loosening and PJI may help to prevent or treat these complications. Previous investigations revealed an increased vascularization in the periprosthetic membrane in cases of PJI via PET signals. Based on these findings our hypothesis was that PJI is associated with an increased neovascularization in the periprosthetic membrane. Tissue samples from periprosthetic membranes of the bone-implant interface were investigated histologically for inflammation, wear particles, vascularization and fibrosis. To identify vascular structures antibodies against CD 31, CD 34, factor VIII and CD 105 (endoglin) were applied for immunohistochemical investigations. According to a consensus classification of Morawietz the tissue samples were divided into four types: type I (wear particle induced type, n = 11), type II (infectious type, n = 7), type III (combined type, n = 7) and type IV (indeterminate type, n = 7). Patients with PJI (type II) showed a pronounced infiltration of neutrophil granulocytes in the periprosthetic membrane and an enhanced neovascularization indicated by positive immunoreaction with antibodies against CD 105 (endoglin). Tissue samples classified as type I, type III and type IV showed significantly less immune reaction for CD 105. In cases of aseptic loosening and PJI vascularization is found in different expression in periprosthetic membranes. However, in aseptic loosening, there is nearly no neovascularization with CD 105-positive immune reaction. Therefore, endoglin (CD 105) expression allows for differentiation between aseptic loosening and PJI.

  9. The Role of TLR and Chemokine in Wear Particle-Induced Aseptic Loosening

    PubMed Central

    Gu, Qiaoli; Shi, Qin; Yang, Huilin


    Wear particle-induced periprosthetic osteolysis remains the principal cause of aseptic loosening of orthopaedic implants. Monocytes/macrophages phagocytose wear particles and release cytokines that induce inflammatory response. This response promotes osteoclast differentiation and osteolysis. The precise mechanisms by which wear particles are recognized and induce the accumulation of inflammatory cells in the periprosthetic tissue have not been fully elucidated. Recent studies have shown that toll-like receptors (TLRs) contribute to the cellular interaction with wear particles. Wear particles are recognized by monocytes/macrophages through TLRs coupled with the adaptor protein MyD88. After the initial interaction, wear particles induce both local and systemic migration of monocytes/macrophages to the periprosthetic region. The cellular migration is mediated through chemokines including interleukin-8, macrophage chemotactic protein-1, and macrophage inhibitory protein-1 in the periprosthetic tissues. Interfering with chemokine-receptor axis can inhibit cellular migration and inflammatory response. This paper highlights recent advances in TLR, and chemokine participated in the pathogenesis of aseptic loosening. A comprehensive understanding of the recognition and migration mechanism is critical to the development of measures that prevent wear particle-induced aseptic loosening of orthopaedic implants. PMID:23193363

  10. Mechanical instability and titanium particles induce similar transcriptomic changes in a rat model for periprosthetic osteolysis and aseptic loosening.


    Amirhosseini, Mehdi; Andersson, Göran; Aspenberg, Per; Fahlgren, Anna


    signaling pathways in this rat model for aseptic loosening. Pathways associated to the innate inflammatory response appear to be a major driver for osteolysis. Our findings implicate early restriction of inflammation to be critical to prevent or mitigate osteolysis and aseptic loosening of orthopedic implants.

  11. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.


    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng


    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones.

  12. Femoral Component Varus Malposition is Associated with Tibial Aseptic Loosening After TKA.


    Lee, Bum-Sik; Cho, Hyun-Ik; Bin, Seong-Il; Kim, Jong-Min; Jo, Byeong-Kyu


    The notion that neutral alignment is mandatory to assure long-term durability after TKA has been based mostly on short-film studies. However, this is challenged by recent long-film studies. We conducted this long-film study to know (1) whether the risk of aseptic revision for nontraumatic reasons was greater among knees with greater than 3° varus or valgus (defined as "outliers") than those that were aligned within 3° of neutral on long-standing mechanical axis (hip to knee) radiographs; and (2) what the failure mechanisms were and whether the malalignment was femoral or tibial in origin, or both, among those in the outlier group. Between November 1998 and January 2009 we performed 1299 cemented, posterior cruciate ligament-substituting TKAs in 867 patients for primary osteoarthritis. We had inadequate long-standing radiographs to analyze postoperative alignment for 124 of those knees, and an additional 24 were excluded for prespecified reasons. Consequently, 1151 knees were enrolled in our study. Of these, 982 (85%) in 661 patients (620 women and 41 men) who had followup greater than 24 months were analyzed. The knees were divided according to whether the postoperative mechanical axis was neutral (0° ± 3°), varus (> 3°), or valgus (< -3°) alignment on long-standing radiographs. The survivorships free from aseptic revision for nontraumatic reasons were compared among groups. The mechanical femoral and the tibial component alignment (MFCA and MTCA, respectively) were investigated to know the origin of overall mechanical malalignment of the outlier knees. The mean duration of followup was 8 ± 4 years (range, 2-17 years). Thirty-five knees (4%) showed aseptic loosening at 7 ± 4 years (range, 0.1-14 years) and five (1%) showed polyethylene wear at 12 ± 1 years (range, 10-13 years). Tibial loosening (73%) was the most common reason for aseptic revision followed by femoral loosening (30%). Of this cohort, 687 (70%), 250 (25%), and 45 (5%) knees had overall

  13. Increased risk of aseptic loosening for 43,525 rotating-platform vs. fixed-bearing total knee replacements

    PubMed Central

    Gothesen, Oystein; Lygre, Stein Hakon L; Lorimer, Michelle; Graves, Stephen; Furnes, Ove


    Background and purpose — Given similar functional outcomes with mobile and fixed bearings, a difference in survivorship may favor either. This study investigated the risk of aseptic loosening for the most used subtypes of mobile-bearing rotating-platform knees, in Norway and Australia. Patients and methods — Primary TKRs reported to the Norwegian and Australian joint registries, between 2003 and 2014, were analyzed with aseptic loosening as primary end-point and all revisions as secondary end-point. We hypothesized that no difference would be found in the rate of revision between rotating-platform and the most used fixed-bearing TKRs, or between keeled and non-keeled tibia. Kaplan–Meier estimates and curves, and Cox regression relative risk estimates adjusted for age, sex, and diagnosis were used for comparison. Results — The rotating-platform TKRs had an increased risk of revision for aseptic loosening compared with the most used fixed-bearing knees, in Norway (RR =6, 95% CI 4–8) and Australia (RR =2.1, 95% CI 1.8–2.5). The risk of aseptic loosening as a reason for revision was highest in Norway compared with Australia (RR =1.7, 95% CI 1.4–2.0). The keeled tibial component had the same risk of aseptic loosening as the non-keeled tibia (Australia). Fixation method and subtypes of the tibial components had no impact on the risk of aseptic loosening in these mobile-bearing knees. Interpretation — The rotating-platform TKRs in this study appeared to have a higher risk of revision for aseptic loosening than the most used fixed-bearing TKRs. PMID:28929828

  14. Toll-like receptors and aseptic loosening of hip endoprosthesis-a potential to respond against danger signals?


    Lähdeoja, Tuomas; Pajarinen, Jukka; Kouri, Vesa-Petteri; Sillat, Tarvo; Salo, Jari; Konttinen, Yrjö T


    Bacterial remnants and subclinical biofilms residing on prosthesis surfaces have been speculated to play a role in hip implant loosening by opsonizing otherwise relatively inert wear particles. The innate immune system recognizes these microbial pathogen-associated molecular patterns (PAMPs) using Toll-like receptors (TLRs). Our objective was to evaluate the possible presence of TLRs in aseptic synovial membrane-like interface tissue. Bacterial culture-negative, aseptic (n = 4) periprosthetic synovial membrane-like tissue was compared to osteoarthritis synovial membrane (n = 5) for the presence of cells positive for all known human functional TLRs, stained using specific antibodies by immunohistochemistry, and evaluated using morphometry. In comparison to osteoarthtritic synovium, the number of TLR-positive cells was found to be increased in the aseptic setting, reflecting the considerable macrophage infiltration to the tissues investigated. Thus aseptic periprosthetic tissue seems to be very reactive to PAMPs. It has been recently recognized that TLR do not only respond to traditional PAMPs, but also to endogenous alarmings or danger signals released from necrotic and activated cells. Alarming-TLR interaction in the periprosthetic tissue might be a novel mechanism of aseptic loosening of endoprosthesis. (c) 2009 Orthopaedic Research Society.

  15. Association between Apoptotis and CD4+/CD8+ T-Lymphocyte Ratio in Aseptic Loosening after Total Hip Replacement

    PubMed Central

    Landgraeber, Stefan; von Knoch, Marius; Löer, Franz; Brankamp, Jochen; Tsokos, Michael; Grabellus, Florian; Schmid, Kurt Werner; Totsch, Martin


    Particle-induced osteolysis is a major cause of aseptic loosening after total joint replacement. While the osteolytic cascade initiated by cytokine release from macrophages has been studied extensively, the involvement of T-lymphocytes in this context is controversial and has been addressed by only a few authors. In a former study we detected that the quantity of T-lymphocytes may be influenced by apoptosis in patients with aseptic loosening. In this study we intended to find out more details about the apoptosis-induced shifting of the T-cell number. We focused our interest on the CD4+ and CD8+ T-cells and their relative ratio. Caspase-3 cleaved was evaluated immunohistochemically to detect apoptotic T-cells in capsules and interface membranes from patients with aseptic hip implant loosening and a varying degree of caspase-3 cleaved expression in CD4+ and CD8+ T-lymphocytes was detected. Moreover, a relationship between the intensity of the apoptotic reactions and the radiological extent of osteolysis was observed. The number of CD4+ cells was decreased in the presence of strong apoptotic reactions, respectively extensive osteolysis, while CD8+ cells were affected to a much lower degree. Thus, the CD4+/CD8+ ratio changed from 1.0 in cases with only small areas of periprosthetic osteolysis and minimally intense apoptosis to 0.33 in cases with large areas of osteolysis. This may suggest a causal relationship between the apoptosis-induced shift in the CD4+/CD8+ ratio and the osteolysis respectively aseptic loosening. It is possible that these findings may lead to a new understanding of particle-induced osteolysis. PMID:19214244

  16. Metal is not inert: role of metal ions released by biocorrosion in aseptic loosening--current concepts.


    Cadosch, Dieter; Chan, Erwin; Gautschi, Oliver P; Filgueira, Luis


    Metal implants are essential therapeutic tools for the treatment of bone fractures and joint replacements. The metals and metal alloys used in contemporary orthopedic and trauma surgery are well tolerated by the majority of patients. However, complications resulting from inflammatory and immune reactions to metal implants have been well documented. This review briefly discusses the different mechanisms of metal implant corrosion in the human body, which lead to the release of significant levels of metal ions into the peri-implant tissues and the systemic blood circulation. Additionally, this article reviews the effects of the released ions on bone metabolism and the immune system and discusses their involvement in the pathophysiological mechanisms of aseptic loosening and metal hypersensitivity in patients with metal implants.

  17. [Silicate coating of cemented titanium-based shafts in hip prosthetics reduces high aseptic loosening].


    Marx, R; Faramarzi, R; Jungwirth, F; Kleffner, B V; Mumme, T; Weber, M; Wirtz, D C


    For cemented hip prostheses, all requirements can be fulfilled by using forged Co/Cr/Mo stems. Co/Cr/Mo alloys, however, are contraindicated for allergy sufferers. For these patients, a cemented prosthesis made of titanium (alloy) would be indicated. Cemented stems from titanium (alloy), depending on the geometry of the prosthesis and its specific surface texture, however, may have loosening rates which are clinically not tolerable. In comparison to Co/Cr/Mo alloys, the greater roughness in conjunction with lesser abrasion resistance of titanium-based alloys leads to high loosening rates caused by abrasion. On the other hand, the greater surface roughness permits good mechanical retention of bone cement to the surface. Good mechanical retention enhances migration behaviour and reduces micromotions. However, there is no stable hydrolytic bond between bone cement and metallic surface; intermediate-term debonding between metal and bone cement is predictable. This debonding results in relative movements, consequently in wear particles which have their origin both from the rough metallic surface and from the PMMA cement. The roughness of the metallic surface operates as emery and with that, a rubbing wear from the PMMA. For the above reasons, a low or moderate roughness is essential for easily abradable implants such as shafts made of titanium (alloy) because low roughness provides a fail-safe running function in case of debonding. Thus, one must allow for inappropriate migration behaviour accompanied by greater micromotions due to insufficient mechanical retention in the case of low roughness. This can be accomplished by a silicate layer coating applied to the metal shaft surface via electrochemical "ECD" or physical vapour deposition "PVD". For analysis, specimens (screws for pull-out, cones for push-out tests) were sand-blasted, so that roughnesses between Ra = 0.8 microm (Rz = 4 microm) and Ra = 2.0 microm (Rz = 9 microm) were generated. The bond strengths observed

  18. Interleukin-6 in serum and in synovial fluid enhances the differentiation between periprosthetic joint infection and aseptic loosening.


    Randau, Thomas M; Friedrich, Max J; Wimmer, Matthias D; Reichert, Ben; Kuberra, Dominik; Stoffel-Wagner, Birgit; Limmer, Andreas; Wirtz, Dieter C; Gravius, Sascha


    The preoperative differentiation between septic and aseptic loosening after total hip or knee arthroplasty is essential for successful therapy and relies in part on biomarkers. The objective of this study was to assess synovial and serum levels of inflammatory proteins as diagnostic tool for periprosthetic joint infection and compare their accuracy with standard tests. 120 patients presenting with a painful knee or hip endoprosthesis for surgical revision were included in this prospective trial. Blood samples and samples of intraoperatively acquired joint fluid aspirate were collected. White blood cell count, C-reactive protein, procalcitonin and interleukin-6 were determined. The joint aspirate was analyzed for total leukocyte count and IL-6. The definite diagnosis of PJI was determined on the basis of purulent synovial fluid, histopathology and microbiology. IL-6 in serum showed significantly higher values in the PJI group as compared to aseptic loosening and control, with specificity at 58.3% and a sensitivity of 79.5% at a cut-off value of 2.6 pg/ml. With a cut-off >6.6 pg/ml, the specificity increased to 88.3%. IL-6 in joint aspirate had, at a cut-off of >2100 pg/ml, a specificity of 85.7% and sensitivity of 59.4%. At levels >9000 pg/ml, specificity was almost at 100% with sensitivity just below 50%, so PJI could be considered proven with IL-6 levels above this threshold. Our data supports the published results on IL-6 as a biomarker in PJI. In our large prospective cohort of revision arthroplasty patients, the use of IL-6 in synovial fluid appears to be a more accurate marker than either the white blood cell count or the C-reactive protein level in serum for the detection of periprosthetic joint infection. On the basis of the results we recommend the use of the synovial fluid biomarker IL-6 for the diagnosis of periprosthetic joint infection following total hip and knee arthroplasty.

  19. Early loosening of a press-fit cup with ceramic-on-ceramic articulation: our early results.


    Haverkamp, Daniël; Westerbos, Stijn; Campo, Martin M; Boonstra, Ritsert H; Rob Albers, G H; van der Vis, Harm M


    In this study, we present the short-term results of the Selexys TH+ cup with the Ceramys inlay which is a press-fit cup with a ceramic-on-ceramic articulation. (Mathys, Bettlach, Switzerland). We compared the results with a retrospective-matched control group with a Delta PF cup (Lima, Udine, Italy), which is also a press-fit cup with a ceramic-on-ceramic articulation. 257 elective hip arthroplasties with the Selexys TH+ cup in 250 patients placed in 2009 and 2010 were analyzed and compared with a control group retrospective analysis of the uncemented Delta PF cup (Lima, Udine, Italy) placed in 2007 and 2008 in 208 patients (222 hips). Surgical technique and surgeons were identical in both groups. During a follow-up period of 3-21 months, 19 aseptic loosenings (7.4 %) were found for the Selexys TH+ cup. The survival plotted by a Kaplan-Meier curve shows a 1-year survival of 87.4 %. The Lima Delta PF cup showed a 1-year survival of 99.5 %. Failure analysis showed no clear explanation for this early loosening. The Selexys TH+ cup combined with the Ceramys ceramic-on-ceramic inlay coupling show an unacceptable high early revision rate. Therefore, we advice against using this combination.

  20. Ibandronate and cementless total hip arthroplasty: densitometric measurement of periprosthetic bone mass and new therapeutic approach to the prevention of aseptic loosening

    PubMed Central

    Muratore, Maurizio; Quarta, Eugenio; Quarta, Laura; Calcagnile, Fabio; Grimaldi, Antonella; Orgiani, M. Antonio; Marsilio, Antonio; Rollo, Giuseppe


    Summary Studies of the mechanisms of periprosthetic bone loss have led to the development of pharmacologic strategies intended to enhance bone mass recovery after surgery and consequently prevent aseptic loosening and prolong the implant survival. Bisphosphonates, potent anti-resorptive drugs widely used in the treatment of osteoporosis and other disorders of bone metabolism, were shown to be particularly effective in reducing periprosthetic bone resorption in the first year after hip and knee arthroplasty, both cemented and cementless. Based on these results, we investigated the inhibitory effects of ibandronate on periprosthetic bone loss in a 2-year study of postmenopausal women that underwent cementless total hip arthroplasty. In the first 6 months both groups (A, treated with ibandronate 3 mg i.v. within five days after surgery and then with oral ibandronate 150 mg/month, plus calcium and vitamin D supplementation; and B, treated with calcium and vitamin D supplementation only) experienced bone loss, though to a lesser extent in group A. After 12 months, group A showed a remarkable BMD recovery, that was statistically significant versus baseline values (about +1, 74% of global BMD) and most evident in region R1 (+3, 81%) and R2 (+4, 12%); in group B, on the contrary, BMD values were unchanged compared with those at 6 months post-surgery. Quality of life scores also showed a greater improvement in group A, both at 6 and 12 months after surgery, likely because of the pain-reducing effects of ibandronate treatment. PMID:22783337

  1. The effect of Lipoxin A4 on the interaction between macrophage and osteoblast: possible role in the treatment of aseptic loosening.


    Li, Gang; Wu, Ping; Xu, Yao; Yu, Yan; Sun, Li; Zhu, Liang; Ye, Duyun


    Aseptic loosening (AL) is the main problem of total joints replacement (TJR) by the implantation of permanently prosthetic components. In vitro and in vivo studies have clearly demonstrated that wear debris and its byproducts could trigger inflammation in the peri-implant tissue. Lipoxins (LXs) are endogenous eicosanoids synthesized locally from arachidonate acid (AA) at sites of inflammation and mediate pro-resolving activity. A number of studies have demonstrated the effect of LXA4 to counteract inflammation in different cell and animal models, but till now, no relative report about the role of LXs in progress or prevention of AL. Murine RAW264.7 macrophage cell line and MC3T3-E1 osteoblasts (OB) cell line were purchased. Co-cultured model of these two cell lines was established. To explore the effect of exogenous Lipoxin A4 (LXA4) on polymethylmethacrylate (PMMA) induced inflammation, pro-inflammatory cytokines including TNF-alpha, IL-1beta, PGE2 and GM-CSF were measured by ELISA kits and bone resorption was quantified by measuring calcium release from 5-day-old mice calvaria in vitro. To determine further the endogenous effect of LXA4, cells were co-cultured and with or without 15-lipoxygease (15-LO) blocking by 15-LO siRNA. Both real-time PCR and western blotting were applied to confirm the inhibitory efficiency of 15-LO by siRNA. 0.1 mg/ml, 0.5 mg/ml and 1.0 mg/ml PMMA showed a time-dependent manner to trigger production of all the pro-inflammatory cytokines studied. Exogenous 0-100 nM LXA4 presented an inhibitory effect on both generation of above cytokines and PMMA stimulated calvarial bone resorption with a dose-dependent manner. LXA4 in supernatant from neither rest macrophages nor macrophages cultured alone exposing to PMMA was detectable. In co-cultured cells challenged by PMMA, LXA4 was increased significantly, while, this enhance could be partly inhibited by 15-LO siRNA. When LXA4 generation was blocked with 15-LO siRNA, the PMMA induced pro

  2. The effect of Lipoxin A4 on the interaction between macrophage and osteoblast: possible role in the treatment of aseptic loosening

    PubMed Central

    Li, Gang; Wu, Ping; Xu, Yao; Yu, Yan; Sun, Li; Zhu, Liang; Ye, Duyun


    Background Aseptic loosening (AL) is the main problem of total joints replacement (TJR) by the implantation of permanently prosthetic components. In vitro and in vivo studies have clearly demonstrated that wear debris and its byproducts could trigger inflammation in the peri-implant tissue. Lipoxins (LXs) are endogenous eicosanoids synthesized locally from arachidonate acid (AA) at sites of inflammation and mediate pro-resolving activity. A number of studies have demonstrated the effect of LXA4 to counteract inflammation in different cell and animal models, but till now, no relative report about the role of LXs in progress or prevention of AL. Methods Murine RAW264.7 macrophage cell line and MC3T3-E1 osteoblasts (OB) cell line were purchased. Co-cultured model of these two cell lines was established. To explore the effect of exogenous Lipoxin A4 (LXA4) on polymethylmethacrylate (PMMA) induced inflammation, pro-inflammatory cytokines including TNF-α, IL-1β, PGE2 and GM-CSF were measured by ELISA kits and bone resorption was quantified by measuring calcium release from 5-day-old mice calvaria in vitro. To determine further the endogenous effect of LXA4, cells were co-cultured and with or without 15-lipoxygease (15-LO) blocking by 15-LO siRNA. Both real-time PCR and western blotting were applied to confirm the inhibitory efficiency of 15-LO by siRNA. Results 0.1 mg/ml, 0.5 mg/ml and 1.0 mg/ml PMMA showed a time-dependent manner to trigger production of all the pro-inflammatory cytokines studied. Exogenous 0–100 nM LXA4 presented an inhibitory effect on both generation of above cytokines and PMMA stimulated calvarial bone resorption with a dose-dependent manner. LXA4 in supernatant from neither rest macrophages nor macrophages cultured alone exposing to PMMA was detectable. In co-cultured cells challenged by PMMA, LXA4 was increased significantly, while, this enhance could be partly inhibited by 15-LO siRNA. When LXA4 generation was blocked with 15-LO siRNA, the

  3. [Classification of prosthetic loosening and determination of wear particles].


    Otto, M


    Nowaday, loosening of orthopaedic implants implies important medical and socioeconomic problems. Implant loosening is caused by implant infections as well as aseptic loosening, due to particle disease and mechanical alterations. Clinically we divide the implant infection into early and late infections. Morphologically it is possible to reliably detect the infection by quantification of neutrophil granulocytes. Additionally molecular methods are suitable to detect micro-organisms which are responsible for the prosthetic joint infection including their resistance to antibiotics. Particle disease may be reproducibly classified by the detection of different types of wear particles, particularly polyethylene, metal, ceramic and cement. The aetiology of the indeterminate type of the periprosthetic membrane is obscure, but may be associated with osteopathies. This classification of the periprosthetic membrane morphology provides clinically significant information concerning clinical management of implant loosening.

  4. High incidence of loosening of the femoral component in legacy posterior stabilised-flex total knee replacement.


    Han, H S; Kang, S-B; Yoon, K S


    We have examined the results obtained with 72 NexGen legacy posterior stabilised-flex fixed total knee replacements in 47 patients implanted by a single surgeon between March 2003 and September 2004. Aseptic loosening of the femoral component was found in 27 (38%) of the replacements at a mean follow-up of 32 months (30 to 48) and 15 knees (21%) required revision at a mean of 23 months (11 to 45). We compared the radiologically-loose and revised knees with those which had remained well-fixed to identify the factors which had contributed to this high rate of aseptic loosening. Post-operatively, the mean maximum flexion was 136 degrees (110 degrees to 140 degrees) in the loosened group and 125 degrees (95 degrees to 140 degrees) in the well-fixed group (independent t-test, p = 0.022). Squatting, kneeling, or sitting cross-legged could be achieved by 23 (85%) of the loosened knees, but only 22 (49%) of the well-fixed knees (chi-squared test, p = 0.001). The loosened femoral components were found to migrate into a more flexed position, but no migration was detected in the well-fixed group. These implants allowed a high degree of flexion, but showed a marked rate of early loosening of the femoral component, which was associated with weight-bearing in maximum flexion.

  5. Unexpected Listeria monocytogenes detection with a dithiothreitol-based device during an aseptic hip revision.


    Banche, Giuliana; Bistolfi, Alessandro; Allizond, Valeria; Galletta, Claudia; Iannantuoni, Maria Rita; Marra, Elisa Simona; Merlino, Chiara; Massè, Alessandro; Cuffini, Anna Maria


    Prosthetic joint infection diagnosis is often difficult since biofilm-embedded microorganisms attach well to the prosthetic surfaces and resist their detection by conventional methods. DL-dithiothreitol has been described as a valid method for biofilm detachment on orthopedic devices. We report the case of an occasional detection of Listeria monocytogenes in a non immuno-compromised patient with a preoperative diagnosis of aseptic loosening. The infection diagnosis due to such rare bacteria was made postoperatively, thanks to a DL-dithiothreitol-based device. This may be considered a feasible approach for the microbiological analysis of prosthetic joint infection, considering that a prompt diagnosis of such biofilm-associated infections could bring some advantages, such as an early and appropriate antibiotic therapy administration and a reduction of undiagnosed infections.


    PubMed Central

    Hoogstraten-Miller, Shelley L.; Brown, Patricia A.


    Performing aseptic survival surgery in rodents can be challenging. This unit describes some basic principles to assist clinicians, researchers, and technicians in becoming proficient in performing aseptic rodent surgery. PMID:18729061

  7. Molecular Identification of Bacteria from Aseptically Loose Implants

    PubMed Central

    Kobayashi, Naomi; Procop, Gary W.; Krebs, Viktor; Kobayashi, Hideo


    Polymerase chain reaction (PCR) assays have been used to detect bacteria adherent to failed orthopaedic implants, but some PCR assays have had problems with probable false-positive results. We used a combination of a Staphylococcus species-specific PCR and a universal PCR followed by DNA sequencing to identify bacteria on implants retrieved from 52 patients (92 implants) at revision arthroplasty. We addressed two questions in this study: (1) Is this method able to show the existence of bacterial DNA on presumed aseptic loosed implants?; and (2) What proportion of presumed aseptic or culture-negative implants was positive for bacterial DNA by PCR? Fourteen implants (15%) were believed infected, whereas 74 implants (85%) were believed aseptic. Each implant was sonicated and the resulting solution was submitted for dual real-time PCR assay and culture. All implants believed aseptically loose were culture-negative, but nine of the 74 (12%) had bacterial DNA by PCR; two (2.7%) were PCR-positive and also showed histologic findings suggestive of infection. Uniquely developed PCR and bacterial sequencing assays showed bacterial DNA on 12% of implants removed for presumed aseptic loosening. Additional studies are needed to determine the clinical importance of bacterial DNA detected by PCR but not by conventional culture. Level of Evidence: Level III, diagnostic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18438724

  8. Interrelations among the adipocytokines leptin and adiponectin, oxidative stress and aseptic inflammation markers in pre- and early-pubertal normal-weight and obese boys.


    Paltoglou, George; Schoina, Maria; Valsamakis, George; Salakos, Nicolaos; Avloniti, Alexandra; Chatzinikolaou, Athanasios; Margeli, Alexandra; Skevaki, Chrysanthi; Papagianni, Maria; Kanaka-Gantenbein, Christina; Papassotiriou, Ioannis; Chrousos, George P; Fatouros, Ioannis G; Mastorakos, George


    Presumed interrelationships among deleterious aspects of adipose tissue metabolism, inflammation, and cellular oxidative stress could be influenced by pubertal hormonal changes. They were investigated in pre- and early pubertal normal-weight and obese boys before and after an exercise bout employed as an energy demanding stimulator. Cross-sectional study. Seventy-six healthy pre- (mean ± SD, 10.6 ± 0.2 years old, 28 normal-weight, and 11 obese) and early-(11.4 ± 0.2 years old, 25 normal-weight, and 12 obese) pubertal boys, were blood-sampled before and after a bout of exercise at 70% VO 2 max. Leptin, adiponectin, markers of inflammation (high-sensitivity C-reactive protein, high sensitivity IL-6), pro- (thiobarbitouric acid reactive substances, protein carbonyls) and anti- (glutathione, oxidized glutathione, glutathione peroxidase, catalase, total antioxidant capacity) oxidation were measured. Baseline and post-exercise adiponectin was greater and leptin and high-sensitivity C-reactive protein were lower in normal-weight than in obese pre- and early pubertal boys, while high sensitivity IL-6 was greater in obese than in normal-weight pre-pubertal boys. In pre-pubertal obese boys: at baseline, high-sensitivity C-reactive protein correlated negatively with catalase; high sensitivity IL-6 correlated positively with protein carbonyls; Δ (difference during exercise) adiponectin correlated positively with Δcatalase. In all boys: at baseline, high sensitivity IL-6 correlated positively with leptin and was the best negative and the second best positive predictor for post-exercise glutathione/oxidized glutathione and protein carbonyls, respectively; leptin was the best negative predictor for post-exercise glutathione; waist to height ratio was the best positive predictor for post-exercise thiobarbitouric acid reactive substances; body mass index z-score and adiponectin were, respectively, the best positive predictor for post-exercise protein carbonyls

  9. Early follow-up of a custom non-fluted diaphyseal press-fit tumour prosthesis.


    O'Donnell, Patrick W; Griffin, Anthony M; Eward, William C; Sternheim, Amir; Wunder, Jay S; Ferguson, Peter C


    The objective of this study was to evaluate the early results of a custom non-fluted diaphyseal press-fit stem for use with the global modular replacement system (GMRS) tumour prosthesis and the early complications associated with this implant. A total of 53 patients (54 implants) were identified from a prospective database where a custom non-fluted diaphyseal press-fit stem was used as part of the reconstruction of the limb. All patients had a minimum of 22 months of follow-up. The rates of stem revision for any reason were calculated. The median follow-up was 36 months (range 22-85 months). Aseptic loosening was not observed in any patient. At early term follow-up, an uncemented non-fluted stem used with the GMRS tumour endoprosthesis provides a stable bone-prosthesis interface with no evidence of aseptic loosening.

  10. [Aseptic process validation and stability study of an injectable preparation of fructose (5%)-glycerol (10%) as part of a hospital clinical research program on endoscopic curative treatment for early epithelial neoplastic lesions of the gastrointestinal tract].


    Tall, M L; Salmon, D; Diouf, E; Drai, J; Filali, S; Lépilliez, V; Pioche, M; Laleye, D; Dhelens, C; Ponchon, T; Pivot, C; Pirot, F


    As part of a hospital clinical research program on endoscopic curative treatment for early epithelial neoplastic lesions of the gastrointestinal tract, a new hospital sterile and non-pyrogenic preparation of fructose (5%)-glycerol (10%) was realized. Under pharmaceutical legislation, the provision of this hospital preparation involves of aseptic process validation and achieve a stability study. After the aseptic process validation with Mediafill Test, the preparation was made under aseptic conditions associated with a sterilizing filtration according to the good practices preparation. Prepared flexible bags (100mL of solution) were stored for one year in a climatic chamber (25±2°C). To assess stability, the physicochemical controls (fructose concentration, glycerol concentration, hydroxy-methyl-5 furfural [5-HMF] concentration, sodium concentration, pH measure, osmolality and sub-visible particles count) and microbiological (bioburden, bacterial endotoxin and sterility) were performed at regular intervals for one year. Neither significant decrease of fructose concentration, glycerol concentration and sodium concentration nor pH, 5-HMF, osmolality variations out of specifications were observed for one year. The sub-visible particles count, the bacterial endotoxin and sterility were in accordance with the European pharmacopoeia attesting limpidity, apyrogenicity and sterility of this injectable preparation. The hospital preparation was stable over one year at 25±2°C, ensuring safe administration in humans within the framework of this clinical research. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  11. Aseptic technique in microgravity.


    McCuaig, K


    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  12. Aseptic Meningitis and Viral Myelitis

    PubMed Central

    Irani, David N.


    SYNOPSIS Meningitis and myelitis represent common and very infrequent viral infections of the central nervous system (CNS), respectively. Indeed, the number of cases of viral meningitis that occurs annually exceeds the total number of meningitis cases caused by all other etiologies combined. Focal CNS infections, on the other hand, such as occur in the spinal cord with viral myelitis, are much less common and may be confused with non-infectious disorders that cause acute flaccid paralysis (AFP). This chapter will review some of the important clinical features, epidemiology, diagnostic approaches, and management strategies for patients with aseptic meningitis and viral myelitis. Particular focus will be placed on the diseases caused by enteroviruses (EVs), which as a group account for the vast majority of all aseptic meningitis cases as well as many focal infections of the spinal cord. PMID:18657719

  13. Aseptic meningitis and viral myelitis.


    Irani, David N


    Meningitis and myelitis represent common and very infrequent viral infections of the central nervous system, respectively. The number of cases of viral meningitis that occurs annually exceeds the total number of meningitis cases caused by all other etiologies combined. Focal central nervous system infections, such as occur in the spinal cord with viral myelitis, are much less common and may be confused with noninfectious disorders that cause acute flaccid paralysis. This article reviews some of the important clinical features, epidemiology, diagnostic approaches, and management strategies for patients with aseptic meningitis and viral myelitis. Particular focus is placed on the diseases caused by enteroviruses, which as a group account for most aseptic meningitis cases and many focal infections of the spinal cord.

  14. Loosening Psychometric Constraints on Educational Assessments

    ERIC Educational Resources Information Center

    Kane, Michael T.


    In response to an argument by Baird, Andrich, Hopfenbeck and Stobart (2017), Michael Kane states that there needs to be a better fit between educational assessment and learning theory. In line with this goal, Kane will examine how psychometric constraints might be loosened by relaxing some psychometric "rules" in some assessment…

  15. Development and validation of a quantitative method to assess pedicle screw loosening in posterior spine instrumentation on plain radiographs.


    Aghayev, Emin; Zullig, Nicolas; Diel, Peter; Dietrich, Daniel; Benneker, Lorin M


    Currently, the diagnosis of pedicle screw (PS) loosening is based on a subjectively assessed halo sign, that is, a radiolucent line around the implant wider than 1 mm in plain radiographs. We aimed at development and validation of a quantitative method to diagnose PS loosening on radiographs. Between 11/2004 and 1/2010 36 consecutive patients treated with thoraco-lumbar spine fusion with PS instrumentation without PS loosening were compared with 37 other patients who developed a clinically manifesting PS loosening. Three different angles were measured and compared regarding their capability to discriminate the loosened PS over the postoperative course. The inter-observer invariance was tested and a receiver operating characteristics curve analysis was performed. The angle measured between the PS axis and the cranial endplate was significantly different between the early and all later postoperative images. The Spearman correlation coefficient for the measurements of two observers at each postoperative time point ranged between 0.89 at 2 weeks to 0.94 at 2 months and 1 year postoperative. The angle change of 1.9° between immediate postoperative and 6-month postoperative was 75% sensitive and 89% specific for the identification of loosened screws (AUC = 0.82). The angle between the PS axis and the cranial endplate showed good ability to change in PS loosening. A change of this angle of at least 2° had a relatively high sensitivity and specificity to diagnose screw loosening.

  16. Alteration of the RANKL/RANK/OPG System in Periprosthetic Osteolysis with Septic Loosening.


    Wang, Long; Dai, Zixun; Xie, Jie; Liao, Hao; Lv, Cheng; Hu, Yihe


    The pathogenesis of periprosthetic osteolysis with septic loosening remains incompletely understood. The purpose of this study was to investigate whether expression of the RANKL/RANK/OPG system is altered in septic interface membranes (SIMs). Seventeen cases with a SIM, 26 cases with an aseptic interface membrane (AIM), and 12 cases with a normal synovium (NS) were assessed. Scanning and transmission electron microscopy (SEM and TEM, respectively) were used to observe the microscopic morphology of three tissue conditions. Differences in RANKL, RANK, and OPG expression at the mRNA level were assessed by real-time quantitative PCR, and differences at the protein level were assessed by immunohistochemical staining and Western blotting. SEM showed wear debris widely distributed on the AIM surface, and TEM showed Bacillus activity in the SIM. RANKL expression and the RANKL/OPG ratio were significantly increased in SIMs. Imbalance in the RANKL/RANK/OPG system is related to periprosthetic osteolysis with septic loosening but is not the only possible pathogenic mechanism.

  17. [Polyethylene abrasion: cause or consequence of an endoprosthesis loosening? Investigations of firm and loosened hip implants].


    Busse, B; Niecke, M; Püschel, K; Delling, G; Katzer, A; Hahn, M


    Periprosthetic tissue was analysed by the combination of different investigation techniques without destruction. The localisation and geometry of polyethylene abrasion particles were determined quantitatively to differentiate between abrasion due to function and abrasion due to implant loosening. Non-polyethylene particles from implant components which contaminate the tissue were micro-analytically measured. The results will help us to understand loosening mechanisms and thus lead to implant optimisations. A non-destructive particle analysis using highly sensitive proton-induced X-ray emission (PIXE) was developed to achieve a better histological allocation. Five autopsy cases with firmly fitting hip endoprosthesis (2 x Endo-Modell Mark III, 1 x St. Georg Mark II, LINK, Germany; 2 x Spongiosa Metal II, ESKA, Germany) were prepared as ground tissue specimens. Wear investigations were accomplished with a combined application of different microscopic techniques and microanalysis. The abrasion due to implant loosening was histologically evaluated on 293 loosened cup implants (St. Georg Mark II, LINK, Germany). Wear particles are heterogeneously distributed in the soft tissue. In cases of cemented prostheses, cement particles are dominating whereas metal particles could rarely be detected. The concentration of the alloy constituent cobalt (Co) is increased in the mineralised bone tissue. The measured co-depositions depend on the localisation and/or lifetime of an implant. Functional polyethylene (PE) abrasion needs to be differentiated from PE abrasion of another genesis (loosening, impingement) morphologically and by different tissue reactions. In the past a reduction of abrasion was targeted primarily by the optimisation of the bearing surfaces and tribology. The interpretation of our findings indicates that different mechanisms of origin in terms of tissue contamination with wear debris and the alloy should be included in the improvement of implants or implantation

  18. Aseptic laboratory techniques: plating methods.


    Sanders, Erin R


    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: Perform plating procedures without contaminating media. Isolate single bacterial colonies by the streak

  19. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.


    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  20. [Synovial fluid from aseptically failed total hip or knee arthroplasty is not toxic to osteoblasts].


    Gallo, J; Zdařilová, A; Rajnochová Svobodová, A; Ulrichová, J; Radová, L; Smižanský, M


    A failure of total hip or knee artroplasty is associated with an increased production of joint fluid. This contains wear particles and host cells and proteins, and is assumed to be involved in the pathogenesis of aseptic loosening and periprosthetic osteolysis. This study investigated the effect of synovial fluid from patients with aseptically failed joint prostheses on osteoblast cultures. Synovial fluid samples were obtained from patients with failed total joint prostheses (TJP; n=36) and from control patient groups (n = 16) involving cases without TJP and osteoarthritis, without TJP but with osteoarthritis, and with stable TJP. The samples were treated in the standard manner and then cultured with the SaOS-2 cell line which shows the characteristics and behaviour of osteoblasts. Each fluid sample was also examined for the content of proteins, cells and selected cytokines (IL-1ß, TNF-α, IL-6, RANKL and OPG detected by ELISA). We tested the hypothesis assuming that the fluids from failed joints would show higher cytotoxicity to osteoblast culture and we also expected higher levels of IL-1ß, TNF-α, IL-6, and RANKL in patients with TJP failure and/ or with more severe bone loss. The statistical methods used included the Kruskal-Wallis ANOVA and Mann-Whitney U test. The fluids from failed TJPs showed the highest RANKL and the lowest OPG levels resulting in the highest RANKL/OPG ratio. However, there was no evidence suggesting that the joint fluids from failed TJPs would be more toxic to osteoblast culture than the fluids from control groups. In addition, no correlation was found between the fluid levels of molecules promoting inflammation and osteoclastic activity and the extent of bone loss in the hip (in terms of Saleh's classification) or the knee (AORI classification). In fact, the fluids from failed TJPs had higher protein levels in comparison with the controls, but the difference was not significant. The finding of high RANKL levels and low OPG

  1. Radiation sterilization of aseptically manufactured products.


    Fairand, Barry P; Fidopiastis, Niki


    This paper discusses an approach for establishing a sterilization dose for an aseptically processed product after the product is in its final packaged state, in other words, terminal sterilization. It applies to aseptic processes where the fill/finish operation is conducted in a closed system using isolator or restricted access barrier technology, that is, no human intervention. The example that is given in this paper uses gamma radiation as the sterilizing agent. Other forms of radiation such as high-energy electrons or X-rays also could serve as the sterilizing agent. The proposed approach involves irradiation of the aseptically processed product at very low doses of radiation, which is possible due to the extremely low levels of bioburden that may be present on the product following a fill/finish operation. Rather than sacrificing a large number of product units that may be required to obtain a statistically significant sampling of the product for bioburden analysis and other test purposes, the test unit is a surrogate consisting of actual pharmaceutical product that was inoculated with a highly radiation-resistant micro-organism. Selection of the microorganism was based on analysis of a library of environmental monitoring data taken from the aseptic area. Because of microbial diversity between different aseptic processing facilities, selection of the test microorganism would depend on the aseptic area under study. The approach that is discussed in this paper addresses selection and preparation of the surrogate, test of sterility of the surrogate following irradiation, determination of the radiation resistance of the test microorganism, and application of the approach to calculate a sterilization dose that is less than 10 kGy. At this low dose, it may be possible to terminally sterilize radiation-sensitive pharmaceutical products, for example, those in liquid form. Additional studies are warranted to determine the general applicability of the proposed approach.

  2. Image Registration-Based Bolt Loosening Detection of Steel Joints.


    Kong, Xiangxiong; Li, Jian


    Self-loosening of bolts caused by repetitive loads and vibrations is one of the common defects that can weaken the structural integrity of bolted steel joints in civil structures. Many existing approaches for detecting loosening bolts are based on physical sensors and, hence, require extensive sensor deployment, which limit their abilities to cost-effectively detect loosened bolts in a large number of steel joints. Recently, computer vision-based structural health monitoring (SHM) technologies have demonstrated great potential for damage detection due to the benefits of being low cost, easy to deploy, and contactless. In this study, we propose a vision-based non-contact bolt loosening detection method that uses a consumer-grade digital camera. Two images of the monitored steel joint are first collected during different inspection periods and then aligned through two image registration processes. If the bolt experiences rotation between inspections, it will introduce differential features in the registration errors, serving as a good indicator for bolt loosening detection. The performance and robustness of this approach have been validated through a series of experimental investigations using three laboratory setups including a gusset plate on a cross frame, a column flange, and a girder web. The bolt loosening detection results are presented for easy interpretation such that informed decisions can be made about the detected loosened bolts.

  3. Image Registration-Based Bolt Loosening Detection of Steel Joints

    PubMed Central


    Self-loosening of bolts caused by repetitive loads and vibrations is one of the common defects that can weaken the structural integrity of bolted steel joints in civil structures. Many existing approaches for detecting loosening bolts are based on physical sensors and, hence, require extensive sensor deployment, which limit their abilities to cost-effectively detect loosened bolts in a large number of steel joints. Recently, computer vision-based structural health monitoring (SHM) technologies have demonstrated great potential for damage detection due to the benefits of being low cost, easy to deploy, and contactless. In this study, we propose a vision-based non-contact bolt loosening detection method that uses a consumer-grade digital camera. Two images of the monitored steel joint are first collected during different inspection periods and then aligned through two image registration processes. If the bolt experiences rotation between inspections, it will introduce differential features in the registration errors, serving as a good indicator for bolt loosening detection. The performance and robustness of this approach have been validated through a series of experimental investigations using three laboratory setups including a gusset plate on a cross frame, a column flange, and a girder web. The bolt loosening detection results are presented for easy interpretation such that informed decisions can be made about the detected loosened bolts. PMID:29597264

  4. Migration characteristics and early clinical results of the NANOS® short-stem hip arthroplasty.


    Kaipel, Martin; Grabowiecki, Phillip; Sinz, Katrina; Farr, Sebastian; Sinz, Günter


    Femoral short stems promise essential advantages in total hip arthroplasty. Up to now, only short- and midterm clinical studies exist. Data on early stem migration that could predict later aseptic loosening at an early stage are rare. The purpose of this study was to assess migration patterns and clinical outcome 2 years after hip replacement by a metaphyseal anchored cementless short stem. Migration data and clinical results were prospectively assessed in 49 patients. Clinical outcome was measured using the Harris Hip Score (HHS). Migration analyses were performed using the computer-assisted Einzel-Bild-Roentgen-Analyse (EBRA) system. At 2 years after surgery, none of the implants needed revision, and HHS increased from 47.9 up to 98.1. Of 49 patients, 5 (10%) showed increased vertical stem migration (1.5 mm/2a) that might predict late aseptic loosening. Of 49 stems, 44 (90%) showed stable migration patterns indicating a beneficial long-term outcome. Results of this study confirm the excellent clinical data of previous works. Migration patterns strongly suggest that short-stem arthroplasty is not only an innovative but also a reliable strategy in total hip replacement.

  5. Mumps vaccine virus strains and aseptic meningitis.


    Bonnet, Marie-Claude; Dutta, Anil; Weinberger, Clement; Plotkin, Stanley A


    Mumps immunization can easily be included in national schedules, particularly if combined with measles or measles and rubella vaccines, but debate continues concerning the relative safety of various licensed mumps vaccine strains. The opportunities for control of mumps are also being affected by differences in the cost of the vaccines prepared with different strains of mumps virus. The present report evaluates available data on the association of the Urabe and other strains of mumps vaccine with the occurrence of aseptic meningitis. We also review the comparative immunogenicity and efficacies of the most widely used mumps vaccines in controlled clinical trials and field evaluations, and briefly examine relative cost as it relates to the implementation of national immunization programs. We conclude that extensive experience with the most widely used mumps vaccine strains in many countries has shown that the risk-benefit ratio of live mumps vaccines is highly favourable for vaccination, despite the occasional occurence of aseptic meningitis.

  6. The Measurement Of Total Joint Loosening By X-Ray Photogrammetry

    NASA Astrophysics Data System (ADS)

    Lippert, Frederick G.; Veress, Sandor A.; Tiwari, Rama S.; Harrington, Richard M.


    Failure of total joint replacement due to loosening of the composents either between the implant and cement or between the cement and bone is emerging as a late complication with an incidence as high as 20 percent. Loosening may not only cause pain but progressive loss of support for the prosthesis with eventual structural failure. Early diagnosis is important so that revision may be carried when deterioration or pain occurs. No method is currently available which clearly establishes loosening at an early stage except surgical exploration. We have devised a method based on our in vivo photogrammetry studies of patellar tracking patterns using metallic markers placed in bone near both components of the total joint. Stereo x-rays taken with the joint loaded and unloaded are measured for relative motion between the implant and the metallic markers. Laboratory studies using prosthetic hip components mounted in plastic bone have revealed the ability of this method to detect pistoning movements as small as 80 microns. These findings were confirmed by physical measurements.

  7. Identification of inducible nitric oxide synthase in human macrophages surrounding loosened hip prostheses.

    PubMed Central

    Watkins, S. C.; Macaulay, W.; Turner, D.; Kang, R.; Rubash, H. E.; Evans, C. H.


    Exposure of rodent macrophages to certain cytokines and endotoxin results in the synthesis of inducible nitric oxide synthase (iNOS or NOS-II) leading to the production of large amounts of nitric oxide (NO). Cultures of human macrophages, in contrast, do not produce iNOS after cytokine stimulation, and their ability to act as a physiological source of NO remains questionable. Here we have used immunohistochemistry and in situ hybridization to demonstrate the presence of iNOS within human macrophages present in the interfacial membrane and pseudocapsule that surround failed prosthetic hip joints. Synovial tissue recovered from normal human joints did not express iNOS. Many of the iNOS-positive macrophages within the interfacial membrane had phagocytosed large amounts of polyethylene wear debris, suggesting a role for phagocytic stimuli in inducing iNOS in human macrophages. These findings additionally support a role for NO in modulating the localized bone resorption that accompanies the aseptic loosening of prosthetic joints. Images Figure 1 Figure 2 Figure 3 PMID:9094976

  8. Early subsidence of shape-closed hip arthroplasty stems is associated with late revision. A systematic review and meta-analysis of 24 RSA studies and 56 survival studies.


    van der Voort, Paul; Pijls, Bart G; Nieuwenhuijse, Marc J; Jasper, Jorrit; Fiocco, Marta; Plevier, Josepha W M; Middeldorp, Saskia; Valstar, Edward R; Nelissen, Rob G H H


    Few studies have addressed the association between early migration of femoral stems and late aseptic revision in total hip arthroplasty. We performed a meta-regression analysis on 2 parallel systematic reviews and meta-analyses to determine the association between early migration and late aseptic revision of femoral stems. Of the 2 reviews, one covered early migration data obtained from radiostereometric analysis (RSA) studies and the other covered long-term aseptic revision rates obtained from survival studies with endpoint revision for aseptic loosening. Stems were stratified according to the design concept: cemented shape-closed, cemented force-closed, and uncemented. A weighted regression model was used to assess the association between early migration and late aseptic revision, and to correct for confounders. Thresholds for acceptable and unacceptable migration were determined in accordance with the national joint registries (≤ 5% revision at 10 years) and the NICE criteria (≤ 10% revision at 10 years). 24 studies (731 stems) were included in the RSA review and 56 studies (20,599 stems) were included in the survival analysis review. Combining both reviews for the 3 design concepts showed that for every 0.1-mm increase in 2-year subsidence, as measured with RSA, there was a 4% increase in revision rate for the shape-closed stem designs. This association remained after correction for age, sex, diagnosis, hospital type, continent, and study quality. The threshold for acceptable migration of shape-closed designs was defined at 0.15 mm; stems subsiding less than 0.15 mm in 2 years had revision rates of less than 5% at 10 years, while stems exceeding 0.15 mm subsidence had revision rates of more than 5%. There was a clinically relevant association between early subsidence of shape-closed femoral stems and late revision for aseptic loosening. This association can be used to assess the safety of shape-closed stem designs. The published research is not sufficient

  9. Intramedullary nailing in the treatment of aseptic tibial nonunion.


    Megas, P; Panagiotopoulos, E; Skriviliotakis, S; Lambiris, E


    Fifty patients suffering from aseptic tibial nonunion underwent reamed intramedullary nailing (I.N.) and were retrospectively reviewed. Thirty-six patients were initially treated with external fixation, six with plate and screws, one with a static I.N., and seven with plaster of Paris. Eighteen of the fractures were initially open (A: 5, B: 6, and C: 7 according to the Gustilo classification). In 34 cases a closed procedure was performed, whereas in sixteen, an opening at the nonunion site was unavoidable either to remove metalwork or realign the fragments. Following failed external fixation, secondary I.N. was performed at least 10 days after removal of the device. Bone grafts from the iliac crest were used in three cases, and a fibular osteotomy was performed in 33. Patients were followed up for an average of 2.5 years after nailing, ranging from 10 months to 7 years. A solid union was achieved in all patients within a period of 6 months. One patient developed late infection, which settled after nail removal and one patient developed impending compartment syndrome which was detected on the first post-operative day and was treated with a fasciotomy. Transient peroneal nerve palsy occurred in one patient and this recovered in 3 months, whereas in nine patients a clinically acceptable deformity was noticed. In conclusion, we believe that reamed intramedullary nailing is a highly effective treatment for aseptic tibial nonunions. Early and late complications are rare and bone graft is rarely needed. The method allows early weight bearing even before solid union occurs, short hospitalisation time and early return to work without external support.

  10. Variations in aseptic technique and implications for infection control.


    Aziz, Anne Marie

    Healthcare-acquired infections (HAIs) are a serious concern, costing the NHS 1 billion pounds a year and causing 5000 deaths annually despite increased funding. A contributing factor is the variety of aseptic techniques in use in different hospitals and even within a single hospital. These cause problems for healthcare workers as well as increasing the risk of HAI. This article examines a number of traditional approaches to aseptic technique, highlighting their differences and the implications for infection control. It concludes that improvement in aseptic technique could be achieved by implementation of a single unified approach to aseptic technique that can be standardized and audited annually, such as the aseptic non-touch technique (ANTT), which has been recommended for adoption throughout the UK. It ends with suggestions for measures that could be introduced and strengthened to improve aseptic technique, and ultimately reduce the rate of HAI.

  11. A Stereophotogrammetric System For The Detection Of Prosthesis Loosening In Total Hip Arthroplasty

    NASA Astrophysics Data System (ADS)

    Baumrind, Sheldon; Genant, Harry K.; Hunter, John; Miller, David; Moffitt, Francis; Murray, William R.; Ross, Steven E.


    Loosening of the prosthetic device occurs in about 5% of cases following placement of total hip prostheses (THP). Early detection of loosening is much desired but is difficult to achieve using conventional methods. Due to errors of projection, it is quite possible to fail to detect mobility of even as much as 5 mm on single x-ray films. We are attempting to develop a simplified photogrammetric system suitable for general hospital use which could detect loosening of 0.8 mm at the 95 % level of confidence without use of complex stereoplotting equipment. Metal reference markers are placed in the shaft of the femur and in the acetabular region of the pelvis at the time of surgery. The distances between these reference markers and certain unambiguous points on the prostheses are computed analytically using an X-Y acoustical digitizer (accuracy ± 0.1 mm) and software developed previously for craniofacial measurement. Separate stereopairs of the joint region are taken under weight-bearing and nonweight-bearing conditions. Differences in the measured distances between the bo-ne markers and the prosthetic components on the two stereopairs are taken as indicators of prosthesis loosening. Measurements on a phantom using ten different x-ray stereopairs taken from as many different perspectives have established that true linear distances between reference points and prostheses can be measured at the desired reliability with the present low precision system. Preliminary in vivo measurements indicate that the main unresolved problem is the movement of the subject between the two exposures of each single stereopair. Two possible solutions to this problem are discussed.

  12. Failure of aseptic revision total knee arthroplasties

    PubMed Central

    Leta, Tesfaye H; Lygre, Stein Håkon L; Skredderstuen, Arne; Hallan, Geir; Furnes, Ove


    Background and purpose In Norway, the proportion of revision knee arthroplasties increased from 6.9% in 1994 to 8.5% in 2011. However, there is limited information on the epidemiology and causes of subsequent failure of revision knee arthroplasty. We therefore studied survival rate and determined the modes of failure of aseptic revision total knee arthroplasties. Method This study was based on 1,016 aseptic revision total knee arthroplasties reported to the Norwegian Arthroplasty Register between 1994 and 2011. Revisions done for infections were not included. Kaplan-Meier and Cox regression analyses were used to assess the survival rate and the relative risk of re-revision with all causes of re-revision as endpoint. Results 145 knees failed after revision total knee arthroplasty. Deep infection was the most frequent cause of re-revision (28%), followed by instability (26%), loose tibial component (17%), and pain (10%). The cumulative survival rate for revision total knee arthroplasties was 85% at 5 years, 78% at 10 years, and 71% at 15 years. Revision total knee arthroplasties with exchange of the femoral or tibial component exclusively had a higher risk of re-revision (RR = 1.7) than those with exchange of the whole prosthesis. The risk of re-revision was higher for men (RR = 2.0) and for patients aged less than 60 years (RR = 1.6). Interpretation In terms of implant survival, revision of the whole implant was better than revision of 1 component only. Young age and male sex were risk factors for re-revision. Deep infection was the most frequent cause of failure of revision of aseptic total knee arthroplasties. PMID:25267502

  13. Aseptic meningitis in children--the Singapore experience.


    Tee, W S N; Choong, C T; Lin, R V T P; Ling, A E


    To study the incidence, aetiology, clinical characteristics and management of paediatric aseptic meningitis in a paediatric hospital in Singapore. Patients with cerebrospinal fluid (CSF) pleocytosis, a negative Gram stain and bacterial culture were reviewed retrospectively from 1 January to 31 December 2000. Eighty-seven patients who fulfilled the criteria for aseptic meningitis and without neurological deficits were studied. In addition, reverse transcriptase polymerase chain reaction (RT-PCR) using pan enterovirus primers was subsequently performed on 73 of these CSF specimens which were available for storage. The incidence of aseptic meningitis was approximately 37 cases per 10,000 admissions. Non-polio enteroviruses were isolated from 29 of 64 (45.3%) CSF and 38 of 52 (73.1%) stool samples. RT-PCR was positive in 43 (58.9%) of the archived CSF specimens. The aetiologies of the remaining cases were mostly unidentified. Their ages ranged from 5 days to 12 years (median, 2 months). All patients except 1 had fever. Vomiting or poor feeding occurred in 44.7%, cough or running nose in 35.3%, irritability was observed in 35.3%, seizures in 7.1%, a rash in 10.6% and diarrhoea in 5.9%. All patients recovered without sequelae. The median CSF white cell count was 212 cells/mm3 (range, 7 to 12,000). The median glucose concentration was 2.7 mmol/L (range, 1.6 to 4.4). The median CSF/blood glucose ratio was 0.52 (range, 0.23 to 0.73). Median length of stay was 7 days (range, 4 to 17). Eighty-four patients (96.6%) received antibiotics for a median of 5.5 days (range, 2 to 14). Enteroviruses were the most common aetiologic agent identified. A method of early diagnosis using RT-PCR for enteroviruses is necessary to reduce the current duration of antibiotic usage and to decrease the length of hospital stay.

  14. Development of Anti-Loosening Performance of Hyper Lock Nut

    NASA Astrophysics Data System (ADS)

    Nishiyama, Shuji; Migita, Hiroaki; Kataoka, Mitumasa; Nakasaki, Nobuyuki; Murano, Kohshi

    Bolted joints are widely used in mechanical structures as they allow easy disassembly for maintenance without high cost. However, vibration-induced loosening due to dynamic loading remains a long-unresolved issue. We have developed a new type of nut named the hyper lock nut (HLN) that offers anti-loosening performance without a complicated tightening process and tools. In this study, we investigated the mechanisms of joints bolted with the HLN, and tightening behavior was analyzed using the three-dimensional finite element method. The analytical results were compared with the experimental results for the HLN, and close qualitative agreement was observed between the two with respect to displacement, tightening force and tightening torque. We found a number of new aspects and plus points for joints bolted with the HLN in comparison to those fastened with JIS standard nuts. It was found that the tightening torque of the HLN is higher than that of JIS standard nuts, and that satisfactory anti-loosening performance can be realized through the thread contact force at the slit region and the angular face of the bearing surface.

  15. [Dermoid cysts of the posterior cerebral fossa in children revealed by recurrent aseptic meningitis: Report of two cases and a review of the literature].


    Kouadria, R; Derkaoui, M


    Dermoid cysts of central nervous system are very rare. The usual clinical presentation is dominated by intracranial hypertension, epilepsy and cranial palsy. The revelation mode could be recurrent aseptic meningitis. The aim of this case report is to consider the dermoid cyst as regards the differential diagnosis in children treated for recurrent aseptic meningitis to avoid misdiagnosis and ice qui a orienté le diagnostic à une méningitnadequate treatment. Two children were admitted in the pediatric department for recurrent aseptic meningitis. The MRI confirmed the presence of a posterior fossa dermoid cyst. Loss of meningitis after microsurgical resection. The diagnosis of dermoid cyst is performed and reconsidered at an early stage in aseptic meningitis in order to establish an adequate therapy, which is surgery. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Aseptic meningitis in children: analysis of 506 cases.


    Michos, Athanasios G; Syriopoulou, Vassiliki P; Hadjichristodoulou, Christos; Daikos, George L; Lagona, Evagelia; Douridas, Panagiotis; Mostrou, Glykeria; Theodoridou, Maria


    Non-polio human enteroviruses are the leading cause of aseptic meningitis in children. The role of enterovirus PCR for diagnosis and management of aseptic meningitis has not been fully explored. A retrospective study was conducted to determine the epidemiological, clinical, and laboratory characteristics of aseptic meningitis and to evaluate the role of enterovirus PCR for the diagnosis and management of this clinical entity. The medical records of children who had as discharge diagnosis aseptic or viral meningitis were reviewed. A total of 506 children, median age 5 years, were identified. The annual incidence rate was estimated to be 17/100,000 children less than 14 years of age. Most of the cases occurred during summer (38%) and autumn (24%). The dominant clinical symptoms were fever (98%), headache (94%) and vomiting (67%). Neck stiffness was noted in 60%, and irritation in 46% of the patients. The median number of CSF cell count was 201/mm(3) with polymorphonuclear predominance (>50%) in 58.3% of the cases. Enterovirus RNA was detected in CSF in 47 of 96 (48.9%) children tested. Children with positive enterovirus PCR had shorter hospitalization stay as compared to children who had negative PCR or to children who were not tested (P = 0.01). There were no serious complications or deaths. Enteroviruses accounted for approximately one half of cases of aseptic meningitis. PCR may reduce the length of hospitalization and plays important role in the diagnosis and management of children with aseptic meningitis.

  17. SEM and fractography analysis of screw thread loosening in dental implants.


    Scarano, A; Quaranta, M; Traini, T; Piattelli, M; Piattelli, A


    Biological and technical failures of implants have already been reported. Mechanical factors are certainly of importance in implant failures, even if their exact nature has not yet been established. The abutment screw fracture or loosening represents a rare, but quite unpleasant failure. The aim of the present research is an analysis and structural examination of screw thread or abutment loosening compared with screw threads or abutment without loosening. The loosening of screw threads was compared to screw thread without loosening of three different implant systems; Branemark (Nobel Biocare, Gothenburg, Sweden), T.B.R. implant systems (Benax, Ancona, Italy) and Restore (Lifecore Biomedical, Chaska, Minnesota, USA). In this study broken screws were excluded. A total of 16 screw thread loosenings were observed (Group I) (4 Branemark, 4 T.B.R and 5 Restore), 10 screw threads without loosening were removed (Group II), and 6 screw threads as received by the manufacturer (unused) (Group III) were used as control (2 Branemark, 2 T.B.R and 2 Restore). The loosened abutment screws were retrieved and analyzed under SEM. Many alterations and deformations were present in concavities and convexities of screw threads in group I. No macroscopic alterations or deformations were observed in groups II and III. A statistical difference of the presence of microcracks were observed between screw threads with an abutment loosening and screw threads without an abutment loosening.

  18. Revision total knee arthroplasty for septic versus aseptic failure.


    Rajgopal, Ashok; Vasdev, Attique; Gupta, Himanshu; Dahiya, Vivek


    To compare the medium-term outcome of revision total knee arthroplasty (TKA) for septic versus aseptic failure. Records of 142 patients who underwent revision TKA by a single senior surgeon for septic (n=65) or aseptic (n=77) failure were reviewed. In the septic group, 67 knees in 42 women and 23 men were included. In the aseptic group, 88 knees in 51 women and 26 men were included. The Knee Society Score was measured. The Kaplan Meier survival curve at months 36, 60, and 95 was plotted, with revision as the end point. The survival rates at each specific time point between the 2 groups were compared using the Z test. The Knee Society Scores improved 18% from 51 to 69 in the septic group and 18% from 52 to 70 in the aseptic group (p=0.72). The range of motion improved 30% from 72 to 102 degrees in the septic group and 39% from 62 to 100 degrees in the aseptic group (p<0.001). Results of the 2 groups were similar in terms of the Knee Society Score, range of motion, and the Kaplan-Meier survivorship.

  19. [Aseptic cutaneous breast abscesses associated with ulcerative colitis].


    Sallé de Chou, C; Ortonne, N; Hivelin, M; Wolkenstein, P; Chosidow, O; Valeyrie-Allanore, L


    Inflammatory bowel diseases are associated with a broad range of cutaneous lesions. Herein we report the first case of aseptic skin abscesses associated with ulcerative colitis. Since March 2008, a 40-year-old woman presented with bilateral mammary abscesses, relapsing despite repeated antibiotic treatment. She was followed for ulcerative colitis diagnosed in 2011 by means of a rectal biopsy. Despite four surgical procedures, there was no improvement in her mammary abscesses and bilateral mastectomy was then proposed because of the persistent symptoms. Her general state of health remained stable. Clinically, there were bilateral inflammatory nodes with fistulae and pus. These lesions were extremely painful. Mild inflammatory syndrome was noted, but the immunological tests revealed nothing of note. Bacteriological, parasitological and mycological tests on biopsy specimens were negative. Histological examination of a surgical biopsy revealed lymphoplasmacytic infiltration of the dermis and subcutis with altered polymorphonuclear cells and epithelioid granuloma. The CT-scan showed no other remote lesions. The final diagnosis was cutaneous aseptic abscess syndrome associated with ulcerative colitis. Colchicine 1mg/day was initiated and resulted in regression of the skin lesions, with complete remission at one year of follow-up. Aseptic abscess syndrome must be considered in the event of recurrent aseptic cutaneous abscesses which may be associated with inflammatory bowel disease. Surgery should be avoided and treatment should be based on suitable drug therapy. Copyright © 2016. Published by Elsevier Masson SAS.

  20. Suitable pitch difference to realize anti-loosening performance for various bolts-nuts diameter

    NASA Astrophysics Data System (ADS)

    Kubo, S.; Tateishi, K.; Noda, N.-A.; Sano, Y.; Takase, Y.; Honda, K.


    In bolt-nut connection, the anti-loosening performance and high fatigue strength are always required with low cost to ensure the connected structure’s safety. In the previous study, a suitable pitch difference between the bolt-nut was obtained as α = 33 μm for M16 JIS bolt- nut through loosening experiment and FEM simulation for tightening process. However, other bolt-nut diameters have not been considered yet. In this paper, therefore, suitable pitch difference is considered for various diameters to realize anti-loosening performance. Since bolt-nut thread geometries are different depending on the diameter, they are expressed as approximate formula. Then, loosening force and anti-loosening force are considered by varying the diameter. Finally, suitable pitch difference {α }minsuit< α < {α }maxsuit was determined from mechanical condition.

  1. Does adding antibiotics to cement reduce the need for early revision in total knee arthroplasty?


    Bohm, Eric; Zhu, Naisu; Gu, Jing; de Guia, Nicole; Linton, Cassandra; Anderson, Tammy; Paton, David; Dunbar, Michael


    There is considerable debate about whether antibiotic-loaded bone cement should be used for fixation of TKAs. While antibiotics offer the theoretical benefit of lowering early revision due to infection, they may weaken the cement and thus increase the likelihood of aseptic loosening, perhaps resulting in a higher revision rate. We (1) compared the frequency of early knee revision arthroplasty in patients treated with antibiotic-loaded or non-antibiotic-loaded cement for initial fixation, (2) determined effects of age, sex, comorbidities, and surgeons' antibiotic-loaded cement usage patterns on revision rate, and (3) compared causes of revision (aseptic or septic) between groups. Our study sample was taken from the Canadian Joint Replacement Registry and Canada's Hospital Morbidity Database and included cemented TKAs performed between April 1, 2003, and March 31, 2008, including 20,016 TKAs inserted with non-antibiotic-loaded cement and 16,665 inserted with antibiotic-loaded cement. Chi-square test was used to compare the frequency of early revisions between groups. Cox regression modeling was used to determine whether revision rate would change by age, sex, comorbidities, or use of antibiotic-loaded cement. Similar Cox regression modeling was used to compare cause of revision between groups. Two-year revision rates were similar between the groups treated with non-antibiotic-loaded cement and antibiotic-loaded cement (1.40% versus 1.51%, p = 0.41). When controlling for age, sex, comorbidities, diabetes, and surgeons' antibiotic-loaded cement usage patterns, the revision risk likewise was similar between groups. Revision rates for infection were similar between groups; however, there were more revisions for aseptic loosening in the group treated with non-antibiotic-loaded cement (p = 0.02). The use of antibiotic-loaded cement in TKAs performed for osteoarthritis has no clinically significant effect on reducing revision within 2 years in patients who received

  2. Microbial Load in Septic and Aseptic Procedure Rooms.


    Harnoss, Julian-Camill; Assadian, Ojan; Diener, Markus Karl; Müller, Thomas; Baguhl, Romy; Dettenkofer, Markus; Scheerer, Lukas; Kohlmann, Thomas; Heidecke, Claus-Dieter; Gessner, Stephan; Büchler, Markus Wolfgang; Kramer, Axel


    Highly effective measures to prevent surgical wound infections have been established over the last two decades. We studied whether the strict separation of septic and aseptic procedure rooms is still necessary. In an exploratory, prospective observational study, the microbial concentration in an operating room without a room ventilating system (RVS) was analyzed during 16 septic and 14 aseptic operations with the aid of an air sampler (50 cm and 1 m from the operative field) and sedimentation plates (1 m from the operative field, and contact culture on the walls). The means and standard deviations of the microbial loads were compared with the aid of GEE models (generalized estimation equations). In the comparison of septic and aseptic operations, no relevant differences were found with respect to the overall microbial concentration in the room air (401.7 ± 176.3 versus 388.2 ± 178.3 CFU/m 3 ; p = 0.692 [CFU, colony-forming units]) or sedimentation 1 m from the operative field (45.3 ± 22.0 versus 48.7 ± 18.5 CFU/m 2 /min; p = 0.603) and on the walls (35.7 ± 43.7 versus 29.0 ± 49.4 CFU/m 2 /min; p = 0.685). The only relevant differences between the microbial spectra associated with the two types of procedure were a small amount of sedimentation of Escherichia coli and Enterococcus faecalis in septic operations, and of staphylococcus aureus and pseudomonas stutzeri in aseptic operations, up to 30 minutes after the end of the procedure. These data do not suggest that septic and aseptic procedure rooms need to be separated. In interpreting the findings, one should recall that the study was not planned as an equivalence or non-inferiority study. Wherever patient safety is concerned, high-level safety concepts should only be demoted to lower levels if new and convincing evidence becomes available.

  3. The effect of a single infusion of zoledronic acid on early implant migration in total hip arthroplasty. A randomized, double-blind, controlled trial.


    Friedl, Gerald; Radl, Roman; Stihsen, Christoph; Rehak, Peter; Aigner, Reingard; Windhager, Reinhard


    Aseptic loosening is the most frequent cause of implant failure in total hip arthroplasty. While a direct link between aseptic loosening and periprosthetic bone loss remains elusive, there is plentiful evidence for a close association with early implant migration. The present trial was primarily designed to evaluate whether a single infusion of 4 mg of zoledronic acid prevented early implant migration in patients with osteonecrosis of the femoral head. Fifty patients were consecutively enrolled to receive either zoledronic acid or saline solution after cementless total hip arthroplasty. Radiographs, biochemical parameters of bone turnover, and the Harris hip-rating score were determined preoperatively and at each follow-up examination at seven weeks, six months, one year, and yearly thereafter. The median follow-up period was 2.8 years. We found a significant subsidence of the stem of up to a mean (and standard deviation) of -1.2 +/- 0.6 mm at two years within the control group, and the cups had a mean medialization of 0.6 +/- 1.0 mm and a mean cranialization of 0.6 +/- 0.8 mm (p < 0.001). Treatment with zoledronic acid effectively minimized the migration of the cups in both the transverse and the vertical direction (mean, 0.15 +/- 0.6 mm and 0.06 +/- 0.6 mm, respectively; p < 0.05), while only a trend to decreased subsidence of the stem was detected. Finally, the Harris hip score rapidly increased over time in both treatment groups, although this increase was significantly more pronounced in the zoledronate-treated group than in the control group (analysis of variance, p = 0.008). A single infusion of zoledronic acid shows promise in improving initial fixation of a cementless implant, which may improve the clinical outcome of total hip arthroplasty in patients with osteonecrosis of the femoral head.

  4. Predictive validity of preoperative CT scans and the risk of pedicle screw loosening in spinal surgery.


    Bredow, Jan; Boese, C K; Werner, C M L; Siewe, J; Löhrer, L; Zarghooni, K; Eysel, P; Scheyerer, M J


    Pedicle screw fixation is the standard technique for the stabilization of the spine, a clinically relevant complication of which is screw loosening. This retrospective study investigates whether preoperative CT scanning can offer a predictor of screw loosening. CT-scan attenuation in 365 patients was evaluated to determine the mean bone density of each vertebral body. Screw loosening or dislocation was determined in CT scans postoperatively using the standard radiological criteria. Forty-five of 365 patients (12.3 %; 24 male, 21 female) suffered postoperative screw loosening (62 of 2038 screws) over a mean follow-up time of 50.8 months. Revision surgeries were necessary in 23 patients (6.3 %). The correlation between decreasing mean CT attenuation in Hounsfield Units (HU) and increasing patient age was significant (p < 0.001). Mean bone density was 116.3 (SD 53.5) HU in cases with screw loosening and 132.7 (SD 41.3) HU in cases in which screws remained fixed. The difference was statistically significant (p = 0.003). The determination of bone density with preoperative CT scanning can predict the risk of screw loosening and inform the decision to use cement augmentation to reduce the incidence of screw loosening.

  5. Early results of Latitude primary total elbow replacement with a minimum follow-up of 2 years.


    Mehta, Saurabh S; Watts, Adam C; Talwalkar, Sumedh C; Birch, Ann; Nuttall, David; Trail, Ian A


    The aim of this study was to present outcomes of primary Latitude total elbow replacement (TER) with a minimum follow-up of 2 years. A retrospective cohort study was undertaken with prospective outcome data collection for the latest outcome. Included were 63 consecutive primary Latitude TERs in 58 patients performed during a period of 5 years at a specialist orthopedic hospital. The mean age of the patients was 62 years (33-85 years). Five primary TERs (4 patients) were lost to follow-up. The primary diagnosis was rheumatoid arthritis in 49, osteoarthritis in 8, and trauma in 6 elbows. The mean flexion-extension arc was 75° preoperatively and 97° postoperatively. Mean postoperative Elbex pain score was 19/100, and function score was 37/100. Mean postoperative scores were 42/100 for the Quick Disabilities of the Arm, Shoulder, and Hand and 38/50 for the elbow-specific American Shoulder and Elbow Surgeons assessment. Four patients died of unrelated causes, and 8 of 63 underwent further surgical intervention, including explantation and conversion from unlinked to linked implant. On radiographic review of 41 surviving TERs, aseptic radiologic loosening was observed of the humeral component in 4 elbows and of the ulnar component in 9. Seven elbows had no radial component, and of the remaining 34 elbows, 16 (47%) had signs of loosening of the radial implant. Complications included 1 heterotopic ossification, 1 olecranon fracture, and 3 further procedures for ulnar nerve entrapment. The results indicate that the early outcome of Latitude TER is comparable to that of other prostheses. There is concern about early radiologic loosening of the radial component. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

  6. Risk factors for total hip arthroplasty aseptic revision.


    Khatod, Monti; Cafri, Guy; Namba, Robert S; Inacio, Maria C S; Paxton, Elizabeth W


    The purpose of this study was to evaluate patient, operative, implant, surgeon, and hospital factors associated with aseptic revision after primary THA in patients registered in a large US Total Joint Replacement Registry. A total of 35,960 THAs registered from 4/2001-12/2010 were evaluated. The 8-year survival rate was 96.7% (95% CI 96.4%-97.0%). Females had a higher risk of aseptic revision than males. Hispanic and Asian patients had a lower risk of revision than white patients. Ceramic-on-ceramic, ceramic-on-conventional polyethylene, and metal-on-conventional polyethylene bearing surfaces had a higher risk of revision than metal-on-highly cross-linked polyethylene. Body mass index, health status, diabetes, diagnosis, fixation, approach, bilateral procedures, head size, surgeon fellowship training, surgeon and hospital volume were not revision risk factors. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. [Recurrent aseptic meningitis secondary to taking ibuprofen and ketorolac].


    Cano Vargas-Machuca, E; Mondéjar-Marín, B; Navarro-Muñoz, S; Pérez-Molina, I; Garrido-Robres, J A; Alvarez-Tejerina, A

    Aseptic meningitis is a process that is characterised by an inflammatory reaction of the meninges that is not due to any infectious agent. Its aetiology is varied and is most frequently caused by rheumatologic and/or autoimmune processes, chemical or medication-induced meningitis, the most notable drugs involved being antibiotics and non-steroidal anti-inflammatory drugs (NSAI). We report the case of a 70-year-old male, with no relevant history, who was admitted to hospital five times over a period of 16 months because of acute meningitis with polymorphonuclear pleocytosis, high protein levels in cerebrospinal fluid and normal glucose in cerebrospinal fluid. No evidence of an infectious causation, chemical meningitis, carcinomatosis or autoimmune disease was found and the patient was diagnosed with recurrent aseptic meningitis. It was found that the patient had taken ibuprofen or ketorolac on several occasions, a few hours before the appearance of symptoms. These episodes were quickly resolved after withdrawal of this medication. A number of NSAI have been reported as inducers of aseptic meningitis, one of the most notable being ibuprofen. We report the case of a patient who, as a consequence of taking ibuprofen and ketorolac, presented episodes of recurrent aseptic meningitis. To our knowledge this side effect of ketorolac has not been reported before. Its clinical features are impossible to differentiate from those of infectious meningitis. Diagnosis is reached by exclusion and a careful pharmacological study, including over-the-counter drugs like some of the NSAI, must be performed in patients with this condition, since it is a problem that can easily be solved by withdrawing the drug that causes it.

  8. Aseptic nonunion of the tibia treated by intramedullary osteosynthesis.


    Gualdrini, G; Rollo, G; Montanari, A; Zinghi, G F


    The authors report 52 cases of aseptic nonunion of the tibia treated by intramedullary osteosynthesis. The means of synthesis used were the Küntscher nail, the Eiffel Tower Rush nail, and the Grosse-Kempf nail. Which means of synthesis was used depended on the site and the features of the nonunion. Healing occurred in all of the cases after an average of 5 months. Mean follow-up was 4.5 years.

  9. [Recent advances in treatment of aseptic femoral shaft nonunion].


    Zhang, Wei; Chen, Hua; Tang, Peifu


    To review the recent advances in treatment of aseptic femoral shaft nonunion. The clinical studies about the treatments of aseptic femoral shaft nonunion in recent years were widely reviewed and analyzed. There are several surgical methods for aseptic femoral shaft nonunion. Due to uncertain clinical outcome, dynamization of nail should be carefully selected. The exchange nailing is suitable for the hypertrophic nonunion of the isthmal femoral shaft fracture. The exchange lateral plating is suitable for nonunion with obvious malformation. However, wave plate or dual plate should be chosen when the bone nonuinon is combined with the medial defect. The augmentation plating improves the success rate of nailing for femoral shaft nonunion, but it should be carefully selected for patients with obvious deformity or bone defect. Ilizarov technique is suitable for various bone nonunion, especially with complicated or large segmental bone defects. Induced membrane technique is also an important method for the treatment of bone nonunion with large bone defects. The clinical efficacy of the blocking screw remains to be supported by further evidence. Biological stimulants are mainly used for atrophic nonunion, and the clinical efficacy of them alone are still controversial. Due to lack of comparative studies between different surgical methods, the orthopedist should choose the appropriate treatment according to the individual situations of the patient and the types of bone nonunion.

  10. Viral etiology of aseptic meningitis among children in southern Iran.


    Hosseininasab, Ali; Alborzi, Abdolvahab; Ziyaeyan, Mazyar; Jamalidoust, Marzieh; Moeini, Mahsa; Pouladfar, Gholamreza; Abbasian, Amin; Kadivar, Mohamad Rahim


    Aseptic meningitis refers to a clinical syndrome of meningeal inflammation in which bacteria cannot be identified in the cerebrospinal fluid (CSF). The viral etiology and the epidemiological, clinical, and laboratory characteristics of aseptic meningitis among children aged 2 months to 15 years in Shiraz, southern Iran were determined. From May 2007 to April 2008, 65 patients were admitted to the hospital with aseptic meningitis. Seven viruses, non-polio human enteroviruses, mumps virus, herpes simplex virus (HSV), varicella-zoster virus (VZV), human cytomegalovirus (HCMV), human herpes virus type 6 (HHV-6), and Epstein-Barr virus (EBV) were investigated by polymerase chain reaction (PCR) method. Viruses were detected in 30 (46.2%) patients in whom non-polio human enterovirus and mumps virus were detected in 13 (43.3%) and 11 (36.7%), respectively. The remaining 6 (20%) of the cases were caused by HSV, VZV, HCMV, and HHV-6. Haemophilus influenzae and non-polio human enterovirus were detected in one patient simultaneously. Viral meningitis was found to be more frequent during spring and summer. The majority (66.6%) of the patients were treated in the hospital for 10 days and had received antibiotics in the case of bacterial meningitis. Rapid diagnosis of viral meningitis using PCR testing of CSF can help shorten hospitalization, and avoid the unnecessary use of antibiotics. Copyright © 2011 Wiley-Liss, Inc.

  11. Aseptic and Bacterial Meningitis: Evaluation, Treatment, and Prevention.


    Mount, Hillary R; Boyle, Sean D


    The etiologies of meningitis range in severity from benign and self-limited to life-threatening with potentially severe morbidity. Bacterial meningitis is a medical emergency that requires prompt recognition and treatment. Mortality remains high despite the introduction of vaccinations for common pathogens that have reduced the incidence of meningitis worldwide. Aseptic meningitis is the most common form of meningitis with an annual incidence of 7.6 per 100,000 adults. Most cases of aseptic meningitis are viral and require supportive care. Viral meningitis is generally self-limited with a good prognosis. Examination maneuvers such as Kernig sign or Brudzinski sign may not be useful to differentiate bacterial from aseptic meningitis because of variable sensitivity and specificity. Because clinical findings are also unreliable, the diagnosis relies on the examination of cerebrospinal fluid obtained from lumbar puncture. Delayed initiation of antibiotics can worsen mortality. Treatment should be started promptly in cases where transfer, imaging, or lumbar puncture may slow a definitive diagnosis. Empiric antibiotics should be directed toward the most likely pathogens and should be adjusted by patient age and risk factors. Dexamethasone should be administered to children and adults with suspected bacterial meningitis before or at the time of initiation of antibiotics. Vaccination against the most common pathogens that cause bacterial meningitis is recommended. Chemoprophylaxis of close contacts is helpful in preventing additional infections.

  12. Pedicle screw loosening is correlated to chronic subclinical deep implant infection: a retrospective database analysis.


    Leitner, Lukas; Malaj, Isabella; Sadoghi, Patrick; Amerstorfer, Florian; Glehr, Mathias; Vander, Klaus; Leithner, Andreas; Radl, Roman


    Spinal fusion is used for treatment of spinal deformities, degeneration, infection, malignancy, and trauma. Reduction of motion enables osseous fusion and permanent stabilization of segments, compromised by loosening of the pedicle screws (PS). Deep implant infection, biomechanical, and chemical mechanisms are suspected reasons for loosening of PS. Study objective was to investigate the frequency and impact of deep implant infection on PS loosening. Intraoperative infection screening from wound and explanted material sonication was performed during revision surgeries following dorsal stabilization. Case history events and factors, which might promote implant infections, were included in this retrospective survey. 110 cases of spinal metal explantation were included. In 29.1% of revision cases, infection screening identified a germ, most commonly Staphylococcus (53.1%) and Propionibacterium (40.6%) genus. Patients screened positive had a significant higher number of previous spinal operations and radiologic loosening of screws. Patients revised for adjacent segment failure had a significantly lower rate of positive infection screening than patients revised for directly implant associated reasons. Removal of implants that revealed positive screening effected significant pain relief. Chronic implant infection seems to play a role in PS loosening and ongoing pain, causing revision surgery after spinal fusion. Screw loosening and multiple prior spinal operations should be suspicious for implant infection after spinal fusion when it comes to revision surgery. These slides can be retrieved under Electronic Supplementary Material.

  13. Comparison of acid-induced cell wall loosening in Valonia ventricosa and in oat coleoptiles


    Tepfer, M.; Cleland, R.E.

    The acid-induced loosening of cell walls of Valonia ventricosa has been compared to that of frozen-thawed oat coleoptiles. The two acid extension responses are similar in regard to the shape of the pH response curve and the increase in plastic compliance induced by acid treatment. In both systems the acid response can be inhibited by Ca/sup 2 +/ and in both the removal of the protons leads to a rapid termination of wall loosening. The two responses differ in several significant ways, however. The acid-induced extension of Valonia walls is more rapid than that of coleoptile walls, but of smallermore » total magnitude. Acid-induced loosening can occur in Valonia without the wall being under tension, but not in coleoptiles. The acid-induced extension of Valonia walls is not inhibited by 8 molar urea, whereas the response in oat coleoptiles is completely inhibited by this treatment. Ethylenediaminetetraacetate (EDTA) can cause wall loosening in Valonia comparable to that produced by low pH, whereas in coleoptiles EDTA causes a much smaller response. These results with Valonia are consistent with a mechanism of acid-induced wall loosening in which a central role is played by the displacement of Ca/sup 2 +/ from the wall, while the larger part of acid-induced wall loosening in oat coleoptiles appears to be via a different mechanism.« less

  14. Audio-based bolt-loosening detection technique of bolt joint

    NASA Astrophysics Data System (ADS)

    Zhang, Yang; Zhao, Xuefeng; Su, Wensheng; Xue, Zhigang


    Bolt joint, as the commonest coupling structure, is widely used in electro-mechanical system. However, it is the weakest part of the whole system. The increase of preload tension force can raise the reliability and strength of the bolt joint. Therefore, the pretension force is one of the most important factors to ensure the stability of bolt joint. According to the way of generating pretension force, the pretension force can be monitored by bolt torque, degrees and elongation. The existing bolt-loosening monitoring methods all require expensive equipment, which greatly restricts the practicality of the bolt-loosening monitoring. In this paper, a new method of bolt-loosening detection technique based on audio is proposed. The sound that bolt is hit by a hammer is recorded on the Smartphone, and the collected audio signal is classified and identified by support vector machine algorithm. First, a verification test was designed and the results show that this new method can identify the damage of bolt looseness accurately. Second, a variety of bolt-loosening was identified. The results indicate that this method has a high accuracy in multiclass classification of the bolt looseness. This bolt-loosening detection technique based on audio not only can reduce the requirements of technical and professional experience, but also make bolt-loosening monitoring simpler and easier.

  15. In Vitro Evaluation of Manual Torque Values Applied to Implant-Abutment Complex by Different Clinicians and Abutment Screw Loosening.


    Dincer Kose, Onur; Karataslı, Burcin; Demircan, Sabit; Kose, Taha Emre; Cene, Erhan; Aya, Serhan Aydın; Erdem, Mehmet Ali; Cankaya, Abdulkadir Burak


    Preload is applied to screws manually or using a torque wrench in dental implant systems, and the preload applied must be appropriate for the purpose. The aim of this study was to assess screw loosening and bending/torsional moments applied by clinicians of various specialties following application of manual tightening torque to combinations of implants and abutments. Ten-millimeter implants of 3.7 and 4.1 mm diameters and standard or solid abutments were used. Each group contained five implant-abutment combinations. The control and experimental groups comprised 20 and 160 specimens, respectively. Implants in the experimental group were tightened by dentists of different specialties. Torsional and bending moments during tightening were measured using a strain gauge. Control group and implants with preload values close to the ideal preload were subjected to a dynamic loading test at 150 N, 15 Hz, and 85,000 cycles. The implants that deformed in this test were examined using an optical microscope to assess deformities. Manual tightening did not yield the manufacturer-recommended preload values. Dynamic loading testing suggested early screw loosening/fracture in samples with insufficient preload.

  16. In Vitro Evaluation of Manual Torque Values Applied to Implant-Abutment Complex by Different Clinicians and Abutment Screw Loosening

    PubMed Central

    Demircan, Sabit; Cene, Erhan; Aya, Serhan Aydın; Erdem, Mehmet Ali; Cankaya, Abdulkadir Burak


    Preload is applied to screws manually or using a torque wrench in dental implant systems, and the preload applied must be appropriate for the purpose. The aim of this study was to assess screw loosening and bending/torsional moments applied by clinicians of various specialties following application of manual tightening torque to combinations of implants and abutments. Ten-millimeter implants of 3.7 and 4.1 mm diameters and standard or solid abutments were used. Each group contained five implant-abutment combinations. The control and experimental groups comprised 20 and 160 specimens, respectively. Implants in the experimental group were tightened by dentists of different specialties. Torsional and bending moments during tightening were measured using a strain gauge. Control group and implants with preload values close to the ideal preload were subjected to a dynamic loading test at 150 N, 15 Hz, and 85,000 cycles. The implants that deformed in this test were examined using an optical microscope to assess deformities. Manual tightening did not yield the manufacturer-recommended preload values. Dynamic loading testing suggested early screw loosening/fracture in samples with insufficient preload. PMID:28473988

  17. Performance of aseptic technique during neuraxial analgesia for labor before and after the publication of international guidelines on aseptic technique

    PubMed Central


    Background Aseptic technique and handwashing have been shown to be important factors in perioperative bacterial transmission, however compliance often remains low despite guidelines and educational programs. Infectious complications of neuraxial (epidural and spinal) anesthesia are severe but fortunately rare. We conducted a survey to assess aseptic technique practices for neuraxial anesthesia in Israel before and after publication of international guidelines (which focused on handwashing, jewelry/watch removal and the wearing of a mask and cap). Methods The sampling frame was the general anesthesiology workforce in hospitals selected from each of the four medical faculties in Israel. Data was collected anonymously over one week in each hospital in two periods: April 2006 and September 2009. Most anesthesiologists received the questionnaires at departmental staff meetings and filled them out during these meetings; additionally, a local investigator approached anesthesiologists not present at these staff meetings individually. Primary endpoint questions were: handwashing, removal of wristwatch/jewelry, wearing mask, wearing hat/cap, wearing sterile gown; answering options were: "always", "usually", "rarely" or "never". Primary endpoint for analysis: respondents who both always wash their hands and always wear a mask ("handwash-mask composite") - "always" versus "any other response". We used logistic regression to perform the analysis. Time (2006, 2009) and hospital were included in the analysis as fixed effects. Results 135/160 (in 2006) and 127/164 (in 2009) anesthesiologists responded to the surveys; response rate 84% and 77% respectively. Respondents constituted 23% of the national anesthesiologist workforce. The main outcome "handwash-mask composite" was significantly increased after guideline publication (33% vs 58%; p = 0.0003). In addition, significant increases were seen for handwashing (37% vs 63%; p = 0.0004), wearing of mask (61% vs 78%; p < 0

  18. [Clinico-instrumental methods of diagnosing aseptic femur head necrosis in patients with systemic lupus erythematosus].


    Tsurko, V V; Ivanova, M M; Sysoev, V F; Pushkova, O V; Badokina, G I


    Clinical, x-ray and scintigraphic investigations were performed in 34 patients with systemic lupus erythematosus (SLE): 24 patients with SLE complicated by osteonecrosis of the head of the femur (the 1st group) and 10 patients with SLE without clinicoroentgenological signs of aseptic necrosis (the 2nd group). Analysis of the results of scintigraphic investigation showed that the coefficient of radionuclide absorption in the SLE patients with suspected osteonecrosis (stage I) as compared to the controls and patients with stage II osteonecrosis of the head of the femur turned out to be significantly discernible (p less than 0.001). Thus, an early stage of osteonecrosis of the head of the femur can be reliably diagnosed by scintigraphy. Quantitative scintigraphy can be effectively used for dynamic observation and objectification of applied therapy.

  19. Performance analysis of exam gloves used for aseptic rodent surgery.


    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie


    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries.

  20. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie


    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  1. Loosening the link between childhood poverty and adolescent smoking and obesity: the protective effects of social capital.


    Evans, Gary W; Kutcher, Rachel


    Pervasive, lifelong inequalities in physical health begin in early childhood and are driven, in part, by social gradients in risk factors such as smoking and obesity. Yet not all low-income children have elevated physical-health risks as adults. The relation between income-to-needs ratio at age 9 and smoking prevalence and body fat (body mass index) at age 17 was examined in a sample of 196 rural adolescents. Income-to-needs ratio is the U.S. federal government's defined index of household income as a proportion of the poverty line. This is the first study to show that links between childhood poverty and subsequent physical-health outcomes can be loosened. At-risk youth in communities with a relatively rich array of social capital did not smoke more or have greater excess body fat compared with their more affluent counterparts.

  2. Early migration characteristics of a 180° porous-coated cup with 1-mm press fit.


    Stihsen, Christoph; Rath, Christopher; Radl, Roman; Saalabian, Ali A; Materna, Wilfried; Rehak, Peter; Windhager, Reinhard


    Evaluation of early cup movement is an important diagnostic tool to predict the likelihood of long-term implant loosening and clinical failure. The investigated cementless cup is clinically proven over 10 years, but there is a paucity of information that accurately describes the migration characteristics of this component. We retrospectively analysed the clinical outcome and migration behaviour of 60 Pinnacle 100 shells after an average 3.8-year follow-up (range 2.1-5.4 years). For migration measurement, EBRA (Einzel-Bild-Röntgen-Analyse) digital software was applied. Clinical assessment was performed using the HHS, the UCLA score and the SF-36 health survey. The clinical outcome showed excellent results with a mean HHS of 95.4 (SD 7.1) and mean UCLA of 6.9 (SD 1.3). All implants were radiologically stable within the observation period and none of the cups was at risk for aseptical loosening. EBRA analysis revealed a mean total migration of 1.4 mm (SD 0.9) (95 % CI 1.1-1.6) at 3 years. Eight cups migrated more than 1 mm within the first three postoperative months, thereafter the migration curves flattened down. Surgeons may expect to find a variable amount of early migration when using the Pinnacle cup. To our knowledge, these are the first results, which show an early "impaction" of a cementless cup, followed by subsequent osseointegration. We believe that an appropriate long-term outcome of the investigated cup is ensured. The data of the present investigation will provide clinicians with useful baseline information with which to compare new cup designs.

  3. Detection of fastener loosening in simple lap joint based on ultrasonic wavefield imaging

    NASA Astrophysics Data System (ADS)

    Gooda Sahib, M. I.; Leong, S. J.; Chia, C. C.; Mustapha, F.


    Joints in aero-mechanical structures are critical elements that ensure the structural integrity but they are prone to damages. Inspection of such joints that have no prior baseline data is really challenging but it can be possibly done using the Ultrasonic Propagation Imager (UPI). The feasibility of applying UPI for detection of loosened fastener is investigated in this study. A simple lap joint specimen made by connecting two pieces of 2.5mm thick SAE304 stainless steel plates using five M6 screws and nuts has been used in this study. All fasteners are tightened to 10Nm but one of them is completely loosened to simulate the damage. The wavefield data is processed into ultrasonic wavefield propagation video and a series of spectral amplitude images. The spectral images showed noticeable amplitude difference at the loosened fastener, hence confirmed the feasibility of using UPI for structural joints inspection. A simple contrast maximization method is also introduced to improve the result.

  4. Contact acoustic nonlinearity (CAN)-based continuous monitoring of bolt loosening: Hybrid use of high-order harmonics and spectral sidebands

    NASA Astrophysics Data System (ADS)

    Zhang, Zhen; Liu, Menglong; Liao, Yaozhong; Su, Zhongqing; Xiao, Yi


    The significance of evaluating bolt tightness in engineering structures, preferably in a continuous manner, cannot be overemphasized. With hybrid use of high-order harmonics (HOH) and spectral sidebands, a contact acoustic nonlinearity (CAN)-based monitoring framework is developed for detecting bolt loosening and subsequently evaluating the residual torque on a loose bolt. Low-frequency pumping vibration is introduced into the bolted joint to produce a "breathing" effect at the joining interface that modulates the propagation characteristics of a high-frequency probing wave when it traverses the bolt, leading to the generation of HOH and vibro-acoustic nonlinear distortions (manifested as sidebands in the signal spectrum). To gain insight into the mechanism of CAN generation and to correlate the acquired nonlinear responses of a loose joint with the residual torque remaining on the bolt, an analytical model based on micro-contact theory is established. Two types of nonlinear index, respectively exploiting the induced HOH and spectral sidebands, are defined without dependence on excitation intensity and are experimentally demonstrated to be effective in continuously monitoring bolt loosening in both aluminum-aluminum and composite-composite bolted joints. Taking a step further, variation of the index pair is quantitatively associated with the residual torque on a loose bolt. The approach developed provides a reliable method of continuous evaluation of bolt tightness in both composite and metallic joints, regardless of their working conditions, from early awareness of bolt loosening at an embryonic stage to quantitative estimation of residual torque.

  5. Video-assisted structured teaching to improve aseptic technique during neuraxial block.


    Friedman, Z; Siddiqui, N; Mahmoud, S; Davies, S


    Teaching epidural catheter insertion tends to focus on developing manual dexterity rather than improving aseptic technique which usually remains poor despite increasing experience. The aim of this study was to compare epidural aseptic technique performance, by novice operators after a targeted teaching intervention, with operators taught aseptic technique before the intervention was initiated. Starting July 2008, two groups of second-year anaesthesia residents (pre- and post-teaching intervention) performing their 4-month obstetric anaesthesia rotation in a university affiliated centre were videotaped three to four times while performing epidural procedures. Trained blinded independent examiners reviewed the procedures. The primary outcome was a comparison of aseptic technique performance scores (0-30 points) graded on a scale task-specific checklist. A total of 86 sessions by 29 residents were included in the study analysis. The intraclass correlation coefficient for inter-rater reliability for the aseptic technique was 0.90. The median aseptic technique scores for the rotation period were significantly higher in the post-intervention group [27.58, inter-quartile range (IQR) 22.33-29.50 vs 16.56, IQR 13.33-22.00]. Similar results were demonstrated when scores were analysed for low, moderate, and high levels of experience throughout the rotation. Procedure-specific aseptic technique teaching, aided by video assessment and video demonstration, helped significantly improve aseptic practice by novice trainees. Future studies should consider looking at retention over longer periods of time in more senior residents.

  6. Endotoxin as a cause of aseptic meningitis after radionuclide cisternography


    Cooper, J.F.; Harbert, J.C.


    The role of pyrogens in aseptic meningitis after radionuclide cisternography was studied by means of the Limulus test, a sensitive detector of endotoxin. During a 15-month period, 39 reactions associated with cisternography were reported. Ten samples of specific lots of the radioactive drugs implicated in 20 of these reactions were tested and all reacted strongly positive to the Limulus test. The less sensitive rabbit pyrogen test was negative for these preparations when tested on a dose-per-weight basis. Our findings apparently provide clinical evidence for the observation made in animals that endotoxin is at least 1,000 times more toxic intrathecally thanmore » intravenously. The data implicate endotoxin contamination as a cause of adverse reactions to radionuclide cisternography. We conclude that the USP pyrogen test is insufficiently sensitive for intrathecal injectables and should be supplemented by the Limulus test. (auth)« less

  7. Aseptic minimum volume vitrification technique for porcine parthenogenetically activated blastocyst.


    Lin, Lin; Yu, Yutao; Zhang, Xiuqing; Yang, Huanming; Bolund, Lars; Callesen, Henrik; Vajta, Gábor


    Minimum volume vitrification may provide extremely high cooling and warming rates if the sample and the surrounding medium contacts directly with the respective liquid nitrogen and warming medium. However, this direct contact may result in microbial contamination. In this work, an earlier aseptic technique was applied for minimum volume vitrification. After equilibration, samples were loaded on a plastic film, immersed rapidly into factory derived, filter-sterilized liquid nitrogen, and sealed into sterile, pre-cooled straws. At warming, the straw was cut, the filmstrip was immersed into a 39 degree C warming medium, and the sample was stepwise rehydrated. Cryosurvival rates of porcine blastocysts produced by parthenogenetical activation did not differ from control, vitrified blastocysts with Cryotop. This approach can be used for minimum volume vitrification methods and may be suitable to overcome the biological dangers and legal restrictions that hamper the application of open vitrification techniques.

  8. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.


    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  9. Aseptic Meningitis Caused by Lassa Virus: Case Series Report

    PubMed Central

    Bankole, Idowu A.; Iruolagbe, Christopher O.; Muoebonam, Benard E.; Okonofua, Martha O.; Dawodu, Simeon O.; Akpede, George O.


    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications. PMID:27957363

  10. [Proposal for the classification of the periprosthetic membrane from loosened hip and knee endoprostheses].


    Morawietz, L; Gehrke, Th; Classen, R-A; Barden, B; Otto, M; Hansen, T; Aigner, Th; Stiehl, P; Neidel, J; Schröder, J H; Frommelt, L; Schubert, Th; Meyer-Scholten, C; König, A; Ströbel, Ph; Rader, Ch P; Kirschner, S; Lintner, F; Rüther, W; Skwara, A; Bos, I; Kriegsmann, J; Krenn, V


    After 10 years, loosening of total joint endoprostheses occurs in about 3 to 10 percent of all patients, requiring elaborate revision surgery. A periprosthetic membrane is routinely found between bone and loosened prosthesis. Further histomorphological examination allows determination of the etiology of the loosening process. Aim of this study is the introduction of clearly defined histopathological criteria for a standardized evaluation of the periprosthetic membrane. Based on histomorphological criteria and polarized light microscopy, four types of the periprosthetic membrane were defined: periprosthetic membrane of wear particle type (type I), periprosthetic membrane of infectious type (type II), periprosthetic membrane of combined type (type III), periprosthetic membrane of indifferent type (type IV). Periprosthetic membranes of 268 patients were analyzed according to the defined criteria. The correlation between histopathological and microbiological diagnosis was high (89%, p<0,001), the inter-observer reproducibility was sufficient (95%). This classification system enables a standardized diagnostic procedure and therefore is a basis for further studies concerning the etiology of and pathogenesis of prosthesis loosening.

  11. A new diagnostic method of bolt loosening detection for thermal protection systems

    NASA Astrophysics Data System (ADS)

    Xie, Weihua; Meng, Songhe; Han, Jiecai; Du, Shanyi; Zhang, Boming; Yu, Dong


    Research and development efforts are underway to provide structural health monitoring systems to ensure the integrity of thermal protection system (TPS). An improved analytical method was proposed to assess the fastener integrity of a bolted structure in this paper. A new unsymmetrical washer was designed and fabricated, taking full advantage of piezoelectric ceramics (PZT) to play both roles as actuators and sensors, and using energy as the only extracted feature to identify abnormality. This diagnostic method is not restricted by the materials of the bracket, panel and base structure of the TPS whose condition is under inspection. A series of experiments on a metallic honeycomb sandwich panel were completed to demonstrate the capability of detecting bolt loosening on the TPS structure. Studies showed that this method can be used not only to identify the location of loosened bolts rapidly, but also to estimate the torque level of loosening bolts. Since that energy is the only extracted feature used to detect bolt loosening in this method, the diagnostic process become very simple and swift without sacrificing the accuracy of the results.

  12. Early Experience with a Short, Tapered Titanium Porous Plasma Sprayed Stem with Updated Design.


    Lombardi, Adolph V; Manocchio, Antonio G; Berend, Keith R; Morris, Michael J; Adams, Joanne B


    Short stem femoral components in primary total hip arthroplasty (THA) have increased in popularity since the advent of minimally invasive surgical techniques. The concept of a short stem is particularly compatible with tapered designs where the goal is to offload forces proximally in the femur. The purpose of this retrospective review was to review our early experience with a short, tapered titanium femoral component with updated design features. Beginning in November 2011 through February 2012, 92 consented patients (93 hips), at a single center, were treated with primary cementless THA using a short stem, tapered femoral component (Taperloc® Complete Microplasty; Zimmer Biomet, Warsaw, Indiana) and were available for review with a minimum two-year follow-up. Mean patient age at surgery was 63.2 years and body mass index (BMI) was 30.8 kg/m2. Mean stem length used was 110.3mm (range, 95-125). Mean follow-up was 4.5 years (2-6). Harris hip scores improved from 52.5 preoperatively to 84.7 at most recent. One stem was revised the same day for periprosthetic fracture. One patient with early infection was treated with single-stage exchange followed by recurrence that was treated successfully with two-stage exchange. A non-healing wound in one patient was treated with incision and debridement. Radiographic assessment demonstrated no evidence of loosening, osteolysis, distal hypertrophy, or pedestal formation in any hip, and all components appeared well fixed and in appropriate alignment. In this series of patients treated with primary THA using a short, tapered titanium porous plasma-sprayed femoral component with updated design features, good results were achieved with a low incidence of complications and revision. No aseptic loosening or osteolysis has occurred. Radiographic assessment was excellent for all patients.

  13. Histopathology of aseptic necrosis of the femoral head in sickle cell disease.


    Mukisi-Mukaza, Martin; Gomez-Brouchet, Anne; Donkerwolcke, Monique; Hinsenkamp, Maurice; Burny, Franz


    This study compares the histopathology of bone biopsies from patients suffering from sickle cell anaemia (homozygote SS) to heterozygote patients (SA) and homozygotes with aseptic osteonecrosis (AA). The sensitivity to bacterial infection of sickle cell patients raises the question of the aetiology of sepsis in the onset of the necrosis. To our knowledge this study is the first to analyse the histopathology of osteonecrosis of the femoral head, at its early stages, in sickle cell anaemia. At the University Hospital of Pointe-à-Pitre, from 1994 to 2007, 38 bone biopsies were obtained from adult patients with avascular necrosis of the femoral head at the time of a core decompression procedure (SS, SC: 27; AS: 5; AA: 6). The histology of the biopsies confirmed the necrosis; all bacteriological cultures were negative. Patients displaying one S gene (SS, SC, AS) compared to homozygote subjects (AA) showed a significant increase of a nonspecific inflammatory granulomatosis (p = 0.003). No relationship was observed between the radiological stages and the histology whatever the genotype (p = 0.1). Inflammatory histopathology without sepsis or advanced alteration characterises the early stages of sickle cell necrosis. This inflammatory process is absent in idiopathic avascular necrosis.

  14. The effect of middle-age body weight and physical activity on the risk of early revision hip arthroplasty: a cohort study of 1,535 individuals.


    Flugsrud, Gunnar B; Nordsletten, Lars; Espehaug, Birgitte; Havelin, Leif I; Meyer, Haakon E


    Overweight and a high level of physical activity are known risk factors for loosening of a total hip arthroplasty (THA) due to primary osteoarthritis. We wanted to investigate how these factors, together with age and sex, affect the risk of revision surgery. We matched data from the Norwegian Arthroplasty Register with information on risk factors collected at a cardiovascular screening. We identified 1,535 primary THAs in the screened cohort (930 cemented implants using well-documented cement). Of the participants included, 969 were female. Mean age at screening was 49 years, at primary THA 63 years, and 69 years at the end of follow-up. We used Cox regression analysis to estimate relative risks (RRs). Event was defined as implant revision due to aseptic loosening of cup, stem or both. Follow-up was time from primary THA to event or censoring. Men were at greater risk than women of loosening of the femoral stem (RR 2.0, 95% CI 1.3-3.2). Both men and women with upper-quartile body weight were at increased risk of revision due to loosening of the stem (RR 2.5 and 2.7, respectively). Men with a high level of physical activity during leisure time were at increased risk of revision due to loosening of the cup (RR 4.8, 95% CI 1.3-18). In the multivariate model with adjustment for activity, there was little association between age at primary THA and risk of revision due to loosening. We found that body weight and physical activity recorded long before THA affected the survival of total hip arthroplasties. Controlling for these variables weakened the association between age at primary surgery and aseptic loosening. Men had an increased risk of loosening of the femoral stem, also after controlling for lifestyle factors.

  15. Influence of the implant abutment types and the dynamic loading on initial screw loosening

    PubMed Central

    Kim, Eun-Sook


    PURPOSE This study examined the effects of the abutment types and dynamic loading on the stability of implant prostheses with three types of implant abutments prepared using different fabrication methods by measuring removal torque both before and after dynamic loading. MATERIALS AND METHODS Three groups of abutments were produced using different types of fabrication methods; stock abutment, gold cast abutment, and CAD/CAM custom abutment. A customized jig was fabricated to apply the load at 30° to the long axis. The implant fixtures were fixed to the jig, and connected to the abutments with a 30 Ncm tightening torque. A sine curved dynamic load was applied for 105 cycles between 25 and 250 N at 14 Hz. Removal torque before loading and after loading were evaluated. The SPSS was used for statistical analysis of the results. A Kruskal-Wallis test was performed to compare screw loosening between the abutment systems. A Wilcoxon signed-rank test was performed to compare screw loosening between before and after loading in each group (α=0.05). RESULTS Removal torque value before loading and after loading was the highest in stock abutment, which was then followed by gold cast abutment and CAD/CAM custom abutment, but there were no significant differences. CONCLUSION The abutment types did not have a significant influence on short term screw loosening. On the other hand, after 105 cycles dynamic loading, CAD/CAM custom abutment affected the initial screw loosening, but stock abutment and gold cast abutment did not. PMID:23509006

  16. Aseptic Bone Necrosis Among U.S. Navy Divers: Survey of 934 Nonrandomly Selected Personnel

    DTIC Science & Technology


    Health, Education, and Welfare, Washington, D.C. Kawashima, M., T. Torisu, K. Hayashi, and Y. Kamo. 1974. Avascular bone necrosis in Japanese diving...5ÜL ^4- P=- 7 RESEM^a^ATORY SUBMARINE BASE, GROTON, CONN. REPORT NUMBER 854 ASEPTIC BONE NECROSIS AMONG U. S. NAVY DIVERS: Survey of 934...Approved for public release; distribution unlimited SUMMARY PAGE THE PROBLEM Aseptic boire~ necrosis tABN) has beelTknown toT5e~ associated with

  17. A Novel RFID-Based Sensing Method for Low-Cost Bolt Loosening Monitoring

    PubMed Central

    Wu, Jian; Cui, Xingmei; Xu, Yunpeng


    In coal mines, bolt loosening in the cage guide is affected by the harsh environmental factors and cage hoist vibration, leading to significant threats to work safety. It is crucial, to this effect, to successfully detect the status of multipoint bolts of guide structures. This paper proposes a system to monitor bolt status in harsh environments established based on the RFID technique. A proof-of-concept model was demonstrated consisting of a bolt gearing system, passive UHF RFID tags, a reader, and monitoring software. A tinfoil metal film is fixed on the retaining plate and an RFID tag bonded to a large gear, with the bolt to be detected fixed in the center of a smaller gear. The radio-frequency signal cannot be received by the reader if the tag is completely obscured by the tinfoil, and if the bolt is loose, the tag’s antenna is exposed when the gear revolves. A radio-frequency signal that carries corresponding bolt’s information is transmitted by the RFID tag to the RFID reader due to coil coupling, identifying loose bolt location and reporting them in the software. Confirmatory test results revealed that the system indeed successfully detects bolt loosening and comparative test results (based on a reed switch multipoint bolt loosening monitor system) provided valuable information regarding the strengths and weaknesses of the proposed system. PMID:26828498

  18. Loosening torque of Universal Abutment screws after cyclic loading: influence of tightening technique and screw coating

    PubMed Central

    Regalin, Alexandre; Bhering, Claudia Lopes Brilhante; Alessandretti, Rodrigo; Spazzin, Aloisio Oro


    PURPOSE The purpose of this study was to evaluate the influence of tightening technique and the screw coating on the loosening torque of screws used for Universal Abutment fixation after cyclic loading. MATERIALS AND METHODS Forty implants (Titamax Ti Cortical, HE, Neodent) (n=10) were submerged in acrylic resin and four tightening techniques for Universal Abutment fixation were evaluated: A - torque with 32 Ncm (control); B - torque with 32 Ncm holding the torque meter for 20 seconds; C - torque with 32 Ncm and retorque after 10 minutes; D - torque (32 Ncm) holding the torque meter for 20 seconds and retorque after 10 minutes as initially. Samples were divided into subgroups according to the screw used: conventional titanium screw or diamond like carbon-coated (DLC) screw. Metallic crowns were fabricated for each abutment. Samples were submitted to cyclic loading at 106 cycles and 130 N of force. Data were analyzed by two-way ANOVA and Tukey's test (5%). RESULTS The tightening technique did not show significant influence on the loosening torque of screws (P=.509). Conventional titanium screws showed significant higher loosening torque values than DLC (P=.000). CONCLUSION The use of conventional titanium screw is more important than the tightening techniques employed in this study to provide long-term stability to Universal Abutment screws. PMID:26576253

  19. Loosening torque of Universal Abutment screws after cyclic loading: influence of tightening technique and screw coating.


    Bacchi, Atais; Regalin, Alexandre; Bhering, Claudia Lopes Brilhante; Alessandretti, Rodrigo; Spazzin, Aloisio Oro


    The purpose of this study was to evaluate the influence of tightening technique and the screw coating on the loosening torque of screws used for Universal Abutment fixation after cyclic loading. Forty implants (Titamax Ti Cortical, HE, Neodent) (n=10) were submerged in acrylic resin and four tightening techniques for Universal Abutment fixation were evaluated: A - torque with 32 Ncm (control); B - torque with 32 Ncm holding the torque meter for 20 seconds; C - torque with 32 Ncm and retorque after 10 minutes; D - torque (32 Ncm) holding the torque meter for 20 seconds and retorque after 10 minutes as initially. Samples were divided into subgroups according to the screw used: conventional titanium screw or diamond like carbon-coated (DLC) screw. Metallic crowns were fabricated for each abutment. Samples were submitted to cyclic loading at 10(6) cycles and 130 N of force. Data were analyzed by two-way ANOVA and Tukey's test (5%). The tightening technique did not show significant influence on the loosening torque of screws (P=.509). Conventional titanium screws showed significant higher loosening torque values than DLC (P=.000). The use of conventional titanium screw is more important than the tightening techniques employed in this study to provide long-term stability to Universal Abutment screws.

  20. A Novel RFID-Based Sensing Method for Low-Cost Bolt Loosening Monitoring.


    Wu, Jian; Cui, Xingmei; Xu, Yunpeng


    In coal mines, bolt loosening in the cage guide is affected by the harsh environmental factors and cage hoist vibration, leading to significant threats to work safety. It is crucial, to this effect, to successfully detect the status of multipoint bolts of guide structures. This paper proposes a system to monitor bolt status in harsh environments established based on the RFID technique. A proof-of-concept model was demonstrated consisting of a bolt gearing system, passive UHF RFID tags, a reader, and monitoring software. A tinfoil metal film is fixed on the retaining plate and an RFID tag bonded to a large gear, with the bolt to be detected fixed in the center of a smaller gear. The radio-frequency signal cannot be received by the reader if the tag is completely obscured by the tinfoil, and if the bolt is loose, the tag's antenna is exposed when the gear revolves. A radio-frequency signal that carries corresponding bolt's information is transmitted by the RFID tag to the RFID reader due to coil coupling, identifying loose bolt location and reporting them in the software. Confirmatory test results revealed that the system indeed successfully detects bolt loosening and comparative test results (based on a reed switch multipoint bolt loosening monitor system) provided valuable information regarding the strengths and weaknesses of the proposed system.

  1. On-line bolt-loosening detection method of key components of running trains using binocular vision

    NASA Astrophysics Data System (ADS)

    Xie, Yanxia; Sun, Junhua


    Bolt loosening, as one of hidden faults, affects the running quality of trains and even causes serious safety accidents. However, the developed fault detection approaches based on two-dimensional images cannot detect bolt-loosening due to lack of depth information. Therefore, we propose a novel online bolt-loosening detection method using binocular vision. Firstly, the target detection model based on convolutional neural network (CNN) is used to locate the target regions. And then, stereo matching and three-dimensional reconstruction are performed to detect bolt-loosening faults. The experimental results show that the looseness of multiple bolts can be characterized by the method simultaneously. The measurement repeatability and precision are less than 0.03mm, 0.09mm respectively, and its relative error is controlled within 1.09%.

  2. Comparative Analysis of Direct Hospital Care Costs between Aseptic and Two-Stage Septic Knee Revision

    PubMed Central

    Kasch, Richard; Merk, Sebastian; Assmann, Grit; Lahm, Andreas; Napp, Matthias; Merk, Harry; Flessa, Steffen


    Background The most common intermediate and long-term complications of total knee arthroplasty (TKA) include aseptic and septic failure of prosthetic joints. These complications cause suffering, and their management is expensive. In the future the number of revision TKA will increase, which involves a greater financial burden. Little concrete data about direct costs for aseptic and two-stage septic knee revisions with an in depth-analysis of septic explantation and implantation is available. Questions/Purposes A retrospective consecutive analysis of the major partial costs involved in revision TKA for aseptic and septic failure was undertaken to compare 1) demographic and clinical characteristics, and 2) variable direct costs (from a hospital department’s perspective) between patients who underwent single-stage aseptic and two-stage septic revision of TKA in a hospital providing maximum care. We separately analyze the explantation and implantation procedures in septic revision cases and identify the major cost drivers of knee revision operations. Methods A total of 106 consecutive patients (71 aseptic and 35 septic) was included. All direct costs of diagnosis, surgery, and treatment from the hospital department’s perspective were calculated as real purchase prices. Personnel involvement was calculated in units of minutes. Results Aseptic versus septic revisions differed significantly in terms of length of hospital stay (15.2 vs. 39.9 days), number of reported secondary diagnoses (6.3 vs. 9.8) and incision-suture time (108.3 min vs. 193.2 min). The management of septic revision TKA was significantly more expensive than that of aseptic failure ($12,223.79 vs. $6,749.43) (p <.001). On the level of the separate hospitalizations the mean direct costs of explantation stage ($4,540.46) were lower than aseptic revision TKA ($6,749.43) which were again lower than those of the septic implantation stage ($7,683.33). All mean costs of stays were not comparable as they

  3. Proposal for a new categorization of aseptic processing facilities based on risk assessment scores.


    Katayama, Hirohito; Toda, Atsushi; Tokunaga, Yuji; Katoh, Shigeo


    Risk assessment of aseptic processing facilities was performed using two published risk assessment tools. Calculated risk scores were compared with experimental test results, including environmental monitoring and media fill run results, in three different types of facilities. The two risk assessment tools used gave a generally similar outcome. However, depending on the tool used, variations were observed in the relative scores between the facilities. For the facility yielding the lowest risk scores, the corresponding experimental test results showed no contamination, indicating that these ordinal testing methods are insufficient to evaluate this kind of facility. A conventional facility having acceptable aseptic processing lines gave relatively high risk scores. The facility showing a rather high risk score demonstrated the usefulness of conventional microbiological test methods. Considering the significant gaps observed in calculated risk scores and in the ordinal microbiological test results between advanced and conventional facilities, we propose a facility categorization based on risk assessment. The most important risk factor in aseptic processing is human intervention. When human intervention is eliminated from the process by advanced hardware design, the aseptic processing facility can be classified into a new risk category that is better suited for assuring sterility based on a new set of criteria rather than on currently used microbiological analysis. To fully benefit from advanced technologies, we propose three risk categories for these aseptic facilities.

  4. Unusually severe varicella zoster (VZV) virus viral (aseptic) meningitis in an unimmunized, immunocompetent host with chickenpox.


    Cunha, Burke A; Warren-Favorito, Heather; Mickail, Nardeen


    Chickenpox is caused by the varicella zoster virus (VZV) and may be more severe in adults than in children. Central nervous system (CNS) manifestations of chickenpox and VZV are uncommon, for example, encephalitis and cerebellar ataxis. Viral (aseptic) meningitis is a rare CNS complication of VZV. The cerebrospinal fluid (CSF) profile in VZV viral (aseptic) meningitis is indistinguishable from other causes of viral meningitis. The clue to most of the diagnoses of VZV aseptic meningitis is based on the temporal relationship between antecedent or concomitant chickenpox. Chickenpox is a clinical diagnosis based on the appearance and distribution of the rash. The rash of chickenpox is vesicular/pruritic and typically appears in crops over 3 successive days. VZV vesicles are fragile, superficial, and surrounded by a erythematous halo. Common nonspecific laboratory findings in chickenpox include leukopenia, thrombocytopenia, and elevated serum transaminases (serum glutamate-oxaloacetate transaminase/serum glutamate-pyruvate transaminase). The erythrocyte sedimentation rate (ESR) is not highly elevated in chickenpox. In VZV aseptic meningitis, the CSF shows a lymphocytic pleocytosis with normal protein, glucose, and lactic acid levels. CSF red blood cells are not a feature of VZV meningitis. We present the case of a healthy unimmunized adult who was hospitalized with chickenpox complicated by VZV aseptic meningitis with an unusually severe headache and nuchal rigidity that occurred during hospitalization. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Migration characteristics and early clinical results of a novel-finned press-fit acetabular cup.


    Kaipel, Martin; Prenner, Anton; Bachl, Sebastian; Farr, Sebastian; Sinz, Günter


    Ana Nova® is a novel-finned press-fit acetabular cup which showed superior biomechanical characteristics in an experimental set-up. Using Einzel Bild Röntgen Analyse (EBRA) measurements should offer the opportunity to predict implant survival at an early stage. The purpose of this study was to assess migration and clinical outcome 2 years after total hip replacement by a novel-finned press-fit acetabular cup. In this study, migration and clinical results of the implant were prospectively assessed in 67 patients. Clinical outcome was assessed using the Harris hip score (HHS). Migration analyses were performed using the computer assisted EBRA system. Data were analyzed for normal distribution using the Kolmogorov-Smirnov test. Group comparisons were performed using the analysis of variance (ANOVA) test. P-values less than 0.05 were considered statistically significant. At 2 years after surgery, none of the implants needed revision and HHS increased from 39.7 up to 92.2. In contrast to the beneficial clinical outcome, 17 of 44 patients showed increased total migration ( 1 mm/2a). Adverse migration data in this study might predict aseptic loosening and decreased survival of the implant. According to previous studies, it is possible that this effect occurred because of limited accuracy of the EBRA system. In our opinion, migration analyses may not be recommended as a screening tool in a 2 year follow-up.

  6. Quality comparison of continuous steam sterilization segmented-flow aseptic processing versus conventional canning of whole and sliced mushrooms.


    Anderson, N M; Walker, P N


    This study was carried out to investigate segmented-flow aseptic processing of particle foods. A pilot-scale continuous steam sterilization unit capable of producing shelf stable aseptically processed whole and sliced mushrooms was developed. The system utilized pressurized steam as the heating medium to achieve high temperature-short time processing conditions with high and uniform heat transfer that will enable static temperature penetration studies for process development. Segmented-flow technology produced a narrower residence time distribution than pipe-flow aseptic processing; thus, whole and sliced mushrooms were processed only as long as needed to achieve the target F₀  = 7.0 min and were not overcooked. Continuous steam sterilization segmented-flow aseptic processing produced shelf stable aseptically processed mushrooms of superior quality to conventionally canned mushrooms. When compared to conventionally canned mushrooms, aseptically processed yield (weight basis) increased 6.1% (SD = 2.9%) and 6.6% (SD = 2.2%), whiteness (L) improved 3.1% (SD = 1.9%) and 4.7% (SD = 0.7%), color difference (ΔE) improved 6.0% (SD = 1.3%) and 8.5% (SD = 1.5%), and texture improved 3.9% (SD = 1.7%) and 4.6% (SD = 4.2%), for whole and sliced mushrooms, respectively. Segmented-flow aseptic processing eliminated a separate blanching step, eliminated the unnecessary packaging of water and promoted the use of bag-in-box and other versatile aseptic packaging methods. Segmented-flow aseptic processing is capable of producing shelf stable aseptically processed particle foods of superior quality to a conventionally canned product. This unique continuous steam sterilization process eliminates the need for a separate blanching step, reduces or eliminates the need for a liquid carrier, and promotes the use of bag-in-box and other versatile aseptic packaging methods. © 2011 Institute of Food Technologists®

  7. Dual infection with hepatitis A and E virus presenting with aseptic meningitis: a case report.


    Naha, Kushal; Karanth, Suman; Prabhu, Mukhyaprana; Sidhu, Manpreet Singh


    We report the case of a young male who presented with features of aseptic meningitis and elevated serum liver enzymes, but no symptoms or signs suggestive of an acute hepatitis. Subsequently, he was diagnosed with dual infection with hepatitis A and E viruses, and recovered completely with symptomatic therapy. Isolated aseptic meningitis, unaccompanied by hepatitic features is an unusual presentation of a hepatotrophic viral infection, and is yet to be reported with hepatitis A and E virus co-infection. Copyright © 2012 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  8. [A case of subacute necrotizing lymphadenitis with recurrent aseptic meningitis 11 years after the first episode].


    Itokawa, Kaori; Fukui, Miki; Nakazato, Yoshihiko; Yamamoto, Toshimasa; Tamura, Naotoshi; Sannohe, Seiya; Shimazu, Kunio


    We report a 29-year-old man with subacute necrotizing lymphadenitis (SNL) associated with recurrent aseptic meningitis following an 11-year remission period. In both episodes, headache and fever were followed by lymphadenopathy, with increased serum IgE level. Although pleocytosis in cerebrospinal fluid was confirmed at admission in the first episode, it appeared at one week after admission in the second episode. Administration of glucocorticoid was effective for treating meningitis. The present case suggests a pathomechanism for SNL that involves both an immunological background and an acute viral infection as triggers of exacerbation of aseptic meningitis.

  9. Optic neuritis following aseptic meningitis associated with modified measles: a case report.


    Nakajima, Nobuhito; Ueda, Masayuki; Yamazaki, Mineo; Takahashi, Toshiyuki; Katayama, Yasuo


    In this study, we report the case of a 35-year-old woman with modified measles complicated by aseptic meningitis and subsequent optic neuritis. Although her initial manifestations were only flu-like symptoms without any Koplik's spots or skin rashes, virological testing confirmed an acute measles infection. Subsequently, right optic neuritis appeared after aseptic meningitis and was completely resolved following steroid pulse therapy. In general, modified measles is believed to be associated with mild symptoms and few neurological complications; however, our present observations demonstrated that modified measles can cause rapid neurological complications.

  10. Hounsfield unit of screw trajectory as a predictor of pedicle screw loosening after single level lumber interbody fusion.


    Sakai, Yusuke; Takenaka, Shota; Matsuo, Yohei; Fujiwara, Hiroyasu; Honda, Hirotsugu; Makino, Takahiro; Kaito, Takashi


    This study aims to clarify the clinical potential of Hounsfield unit (HU), measured on computed tomography (CT) images, as a predictor of pedicle screw (PS) loosening, compared to bone mineral density (BMD). A total of 206 screws in 52 patients (21 men and 31 women; mean age 68.2 years) were analyzed retrospectively. The screws were classified into two groups depending on their screw loosening status on 3-month follow-up CT (loosening screw group vs. non-loosening screw group). Preoperative HU of the trajectory was evaluated by superimposing preoperative and postoperative CT images using three-dimensional image analysis software. Age, sex, body mass index, screw size, BMD of lumbar, and HU of screw trajectory were analyzed in association with screw loosening. Multivariate logistic regression analysis was performed, and the thresholds for PS loosening risk factors were evaluated using a continuous numerical variable and receiver operating characteristic (ROC) curve analyses. The area under the curve (AUC) was used to determine the diagnostic performance, and values > 0.75 were considered to represent good performance. The loosening screw group contained 24 screws (12%). Multivariate analysis revealed that the significant independent risk factors were not BMD but male sex [P = 0.028; odds ratio (OR) 2.852, 95% confidence interval (CI) 1.120-7.258] and HU of screw trajectory (P = 0.006; OR 0.989, 95% CI 0.980-0.997). ROC curve analysis demonstrated that the AUC for HU of screw trajectory for women was 0.880 (95% CI 0.798-0.961). The cutoff value was 153.5. AUC for men was 0.635 (95% CI 0.449-0.821), which was not considered to be a good performance. Low HU of screw trajectories was identified as a risk factor of PS loosening for women. For female patients with low HU, additional augmentation is recommended to prevent PS loosening. Copyright © 2018 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.

  11. Magnetic thermometry in the aseptic processing of foods containing particulates (abstract)

    NASA Astrophysics Data System (ADS)

    Ghiron, Kenneth; Litchfield, Bruce


    Aseptic processing of foods has many advantages over canning, including higher efficiency, lighter packaging, better taste, and higher nutritional value. Aseptic processing is different from canning where the food and container are sterilized together. Instead, a thin stream of food is heated and the packaging is independently sterilized before the food is placed in the package. However, no aseptic processes have been successfully filed with the FDA for foods containing sizable solid particles because of uncertainties in the thermal sterilization of the particles (e.g., soup). We have demonstrated that by inserting small paramagnetic particles in the interior of the simulated and real food particles, the local temperature can be measured. With this information, any questions about the adequate sterilization of the particles can be resolved. The measurements were done by directing the food stream through a magnetic field and sensing the voltages induced in a pickup coil by the motion of the magnetized particles. Details of the equipment design and data analysis will be discussed along with an introduction to the aseptic processing of foods.

  12. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations


    ISS022-E-068638 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  13. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations


    ISS022-E-068640 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  14. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations


    ISS022-E-068645 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  15. Rapid and sensitive detection of enteroviruses in specimens from patients with aseptic meningitis.

    PubMed Central

    Yerly, S; Gervaix, A; Simonet, V; Caflisch, M; Perrin, L; Wunderli, W


    A 5-h PCR assay (Amplicor enterovirus test) was compared with viral culture for the detection of enteroviruses in cerebrospinal fluid. Of the cerebrospinal fluid specimens collected during a summer outbreak of aseptic meningitis, 34% were positive by viral culture whereas 66% were positive by the Amplicor PCR, suggesting that this technique improves the diagnosis of enteroviral meningitis. PMID:8748304

  16. Isolation and molecular identification of echovirus 13 isolated from patients of aseptic meningitis in Korea, 2002.


    Cheon, Doo-Sung; Lee, Jiwon; Lee, Kangbum; Lee, Sunhwa; Park, Kwisung; Ahn, Jungbae; Jee, Youngmee; Yoon, Jaedeuk; Cho, Haewol


    During 2002, several epidemics of aseptic meningitis were attributed to echovirus 13 in Korea. The causative agents of these outbreaks were isolated and identified using rhabdosarcoma cells, HEp-2 and Buffalo green monkey kidney cells, and a neutralization test using monospecific antiserum. Fifty-four echovirus 13 isolates were isolated from patients with aseptic meningitis in the provinces, Seoul, Kyonggi, Gwangju, Jeonju, Busan, and Ulsan. Symptoms associated with aseptic meningitis infection in patients included the occurrence of headaches and mild fever. Molecular characterization of echovirus 13 samples was achieved by sequence and phylogenetic analyses on partial VP1 sequences from 20 Korean isolates and 10 foreign isolates listed in Genbank. Minor variation was observed among the Korean isolates, which formed a unique cluster with isolates of German and Japanese origin. The marked similarities between isolates could be attributed to a relatively recent arrival of the virus in Korea. This is the first such investigation of aseptic meningitis caused by echovirus 13 on the Korean peninsula. Copyright 2004 Wiley-Liss, Inc.

  17. Tibial component alignment and risk of loosening in unicompartmental knee arthroplasty: a radiographic and radiostereometric study.


    Barbadoro, P; Ensini, A; Leardini, A; d'Amato, M; Feliciangeli, A; Timoncini, A; Amadei, F; Belvedere, C; Giannini, S


    Unicompartmental knee arthroplasty (UKA) has shown a higher rate of revision compared with total knee arthroplasty. The success of UKA depends on prosthesis component alignment, fixation and soft tissue integrity. The tibial cut is the crucial surgical step. The hypothesis of the present study is that tibial component malalignment is correlated with its risk of loosening in UKA. This study was performed in twenty-three patients undergoing primary cemented unicompartmental knee arthroplasties. Translations and rotations of the tibial component and the maximum total point motion (MTPM) were measured using radiostereometric analysis at 3, 6, 12 and 24 months. Standard radiological evaluations were also performed immediately before and after surgery. Varus/valgus and posterior slope of the tibial component and tibial-femoral axes were correlated with radiostereometric micro-motion. A survival analysis was also performed at an average of 5.9 years by contacting patients by phone. Varus alignment of the tibial component was significantly correlated with MTPM, anterior tibial sinking, varus rotation and anterior and medial translations from radiostereometry. The posterior slope of the tibial component was correlated with external rotation. The survival rate at an average of 5.9 years was 89%. The two patients who underwent revision presented a tibial component varus angle of 10° for both. There is correlation between varus orientation of the tibial component and MTPM from radiostereometry in unicompartmental knee arthroplasties. Particularly, a misalignment in varus larger than 5° could lead to risk of loosening the tibial component. Prognostic studies-retrospective study, Level II.

  18. Torque removal evaluation of prosthetic screws after tightening and loosening cycles: an in vitro study.


    Cardoso, Mayra; Torres, Marcelo Ferreira; Lourenço, Eduardo José Veras; de Moraes Telles, Daniel; Rodrigues, Renata Cristina Silveira; Ribeiro, Ricardo Faria


    The aim of this study was to evaluate the variation in removal torque of implant prosthetic abutment screws after successive tightening and loosening cycles, in addition to evaluating the influence of the hexagon at the abutment base on screw removal torque. Twenty hexagonal abutments were tightened to 20 regular external hex implants with a titanium alloy screw, with an insertion torque of 32 N cm, measured with a digital torque gauge. The implant/abutment/screw assemblies were divided into two groups: (1) abutments without hexagon at the base and (2) abutments with a hexagon at the base. Each assembly received a provisional restoration and was submitted to mechanical loading cycles. After this, the screws were removed and the removal torque was measured. This sequence was repeated 10 times, then the screw was replaced by a new one, and another cycle was performed. Linear regression analysis was performed. Removal torque values tended to decrease as the number of insertion/removal cycles increased, for both groups. Comparisons of the slopes and the intercepts between groups showed no statistical difference. There was no significant difference between the mean values of last five cycles and the 11th cycle. Within the limitations of this in vitro study, it was concluded that (1) repeated insertion/removal cycles promoted gradual reduction in removal torque of screws, (2) replacing the screw with a new one after 10 cycles did not increase resistance to loosening, and (3) removal of the hexagon from the abutment base had no effect on the removal torque of the screws. © 2011 John Wiley & Sons A/S.

  19. Human enteroviruses in cerebrospinal fluid of children with suspected aseptic meningitis: A study in northern Iran.


    Sadeghi, Farzin; Talebi-Nesami, Masoumeh; Barari-Savadkouhi, Rahim; Bijani, Ali; Ferdosi-Shahandashti, Elahe; Yahyapour, Yousef


    Enterovirus (EV) infections are one of the most common causes of aseptic meningitis in pediatrics. To diagnose EV meningitis, virus isolation in cell cultures is often time consuming and lacks sensitivity to be of clinical relevance. This makes the virus culture results difficult to interpret. The rapid detection of EVs in cerebrospinal fluid (CSF) by molecular diagnostic techniques may improve the management of patients with aseptic meningitis. The purpose of the present study was to develop a more convenient and sensitive alternative technique to viral culture. The current investigation aimed to explore the prevalence of EVs in CSF of children with suspected aseptic meningitis in northern Iran, between June 2014 and March 2015 via the one-step real-time RT-PCR technique. A single center cross-sectional study was carried out on 50 children suspected with aseptic meningitis, aged 6 months to 13 years. The presence of EV RNA in CSF samples was screened by the use of qualitative one-step real-time RT-PCR. Enteroviral RNA was detected in 9 (18%) subjects using the one-step real-time RT-PCR assay. There was significant difference between EV positive and negative subjects regarding mean age (P=0.023), mean lymphocyte percentage (P=0.001) and mean glucose levels in CSF (P=0.037). The disease onset data indicate that the majority of EV meningitis occurred in the summer. This study provides the first data on the prevalence and epidemiology of EV infections in children with suspected aseptic meningitis in northern Iran.

  20. Effect of age on the incidence of aseptic meningitis following immunization with monovalent mumps vaccine.


    Muta, Hiromi; Nagai, Takao; Ito, Yuhei; Ihara, Toshiaki; Nakayama, Tetsuo


    The purpose of this study was to determine the risk of aseptic meningitis after mumps vaccination in younger children compared with older children. This prospective cohort study included a total of 21,465 children under 18 years of age who had received the first dose of three of the Japanese mumps monovalent vaccine. We compared the cumulative incidence of aseptic meningitis for 30 days after vaccination among the following age groups: ≤ 1, 2, 3-4, and ≥ 5 years old. We also investigated the cumulative incidence of salivary gland swelling, a fever (≥ 38°C) lasting at least 3 days during the 10 to 25 days following immunization, vomiting of 3 times or more, headache, and seizure. A total of 10 aseptic meningitis, 551 salivary gland swelling, 844 fevers, 669 vomiting, 757 headaches, and 29 seizure cases were identified. The cumulative incidence of aseptic meningitis increased with age (0.016%, 0.021%, 0.066%, and 0.096%, respectively). Statistical significance was observed between children ≥ 3 years old and those < 3 years of age [0.078% vs. 0.018%, RR 4.35 (95% CI 1.05-18.2), p=0.04]. The cumulative incidence of salivary gland swelling also increased with age (1.8%, 3.0%, 3.5%, and 4.5%, respectively). For non-specific adverse events, the cumulative incidence of fever or seizure decreased with age. In contrast, the cumulative incidence of headache increased with age. The cumulative incidence of vomiting was similar among children ≤ 4 years of age; however, that in those children ≥ 5 years old was significantly lower. The first dose of mumps vaccine that is currently available for use in Japan may be administered in children less than 3 years of age in order to complicate a less aseptic meningitis after immunization. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Molecular characterization of echovirus 30-associated outbreak of aseptic meningitis in Korea in 2008.


    Choi, Young Jin; Park, Kwi Sung; Baek, Kyoung Ah; Jung, Eun Hye; Nam, Hae Seon; Kim, Yong Bae; Park, Joon Soo


    Evaluation of the primary etiologic agents that cause aseptic meningitis outbreaks may provide valuable information regarding the prevention and management of aseptic meningitis. In Korea, an outbreak of aseptic meningitis caused by echovirus type 30 (E30) occurred from May to October in 2008. In order to determine the etiologic agent, CSF and/or stool specimens from 140 children hospitalized for aseptic meningitis at Soonchunhyang University Cheonan Hospital between June and October of 2008 were tested for virus isolation and identification. E30 accounted for 61.7% (37 cases) and echovirus 6 accounted for 21.7% (13 cases) of all the human enteroviruses (HEVs) isolates (60 cases in total). For the molecular characterization of the isolates, the VP1 gene sequence of 18 Korean E30 isolates was compared pairwise using the MegAlign with 34 reference strains from the GenBank database. The pairwise comparison of the nucleotide sequences of the VP1 genes demonstrated that the sequences of the Korean strains differed from those of lineage groups A, B, C, D, E, F and G. Reconstruction of the phylogenetic tree based on the complete VP1 nucleotide sequences resulted in a monophyletic tree, with eight clustered lineage groups. All Korean isolates were segregated from other lineage groups, thus suggesting that the Korean strains were a distinct lineage of E30, and a probable cause of this outbreak. This manuscript is the first report, to the best of our knowledge, of the molecular characteristics of E30 strains associated with an aseptic meningitis outbreak in Korea, and their respective phylogenetic relationships.

  2. CoCrMo alloy vs. UHMWPE Particulate Implant Debris Induces Sex Dependent Aseptic Osteolysis Responses In Vivo using a Murine Model

    PubMed Central

    Landgraeber, Stefan; Samelko, Lauryn; McAllister, Kyron; Putz, Sebastian; Jacobs, Joshua.J.; Hallab, Nadim James


    Background: The rate of revision for some designs of total hip replacements due to idiopathic aseptic loosening has been reported as higher for women. However, whether this is environmental or inherently sex-related is not clear. Objective: Can particle induced osteolysis be sex dependent? And if so, is this dependent on the type of implant debris (e.g. metal vs polymer)? The objective of this study was to test for material dependent inflammatory osteolysis that may be linked to sex using CoCrMo and implant grade conventional polyethylene (UHMWPE), using an in vivo murine calvaria model. Methods: Healthy 12 week old female and male C57BL/6J mice were treated with UHMWPE (1.0um ECD) or CoCrMo particles (0.9um ECD) or received sham surgery. Bone resorption was assessed by micro-computed tomography, histology and histomorphometry on day 12 post challenge. Results: Female mice that received CoCrMo particles showed significantly more inflammatory osteolysis and bone destruction compared to the females who received UHMWPE implant debris. Moreover, females challenged with CoCrMo particles exhibited 120% more inflammatory bone loss compared to males (p<0.01) challenged with CoCrMo implant debris (but this was not the case for UHMWPE particles). Conclusion: We demonstrated sex-specific differences in the amount of osteolysis resulting from CoCrMo particle challenge. This suggests osteo-immune responses to metal debris are preferentially higher in female compared to male mice, and supports the contention that there may be inherent sex related susceptibility to some types of implant debris. PMID:29785221

  3. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia


    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  4. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department.


    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia


    Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine.The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department.A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management.The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine.The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to viral agents or

  5. Synoviocyte-packaged Chlamydia trachomatis induces a chronic aseptic arthritis.

    PubMed Central

    Inman, R D; Chiu, B


    The basic mechanisms underlying reactive arthritis and specifically the joint injury that follows intra-articular Chlamydia trachomatis infection have not been defined. The present study addresses this question through the development of an experimental model. Stable cell lines were generated from synoviocytes harvested from the knee joints of Lewis rats. The synoviocytes were cocultivated with C. trachomatis to allow invasion by the microbe and were then transferred by intra-articular injection into the knee joints of Lewis rats. The ensuing arthritis could be subdivided into an early phase (early phase was characterized by intense, primarily neutrophilic, synovitis; accelerated cartilage injury; dissemination of Chlamydia to liver and spleen; and viable Chlamydia in the joints. The late phase was marked by mixed mononuclear lymphocyte infiltration in the joint; dysplastic cartilage injury and repair; absence of viable organisms; and development of a distinctive humoral response. Western blot analysis comparing reactive arthritis patients to the experimental model indicates that candidate arthritogenic chlamydial antigens are comparable between the two. This model demonstrates that an intense synovitis can be induced by this intracellular pathogen, and that chronic inflammation can persist well beyond the culture-positive phase. Furthermore, these data show that the synoviocyte is a suitable host cell for C. trachomatis and can function as a reservoir of microbial antigens sufficient to perpetuate joint injury. PMID:9819362

  6. Irradiated or aseptically prepared frozen dairy desserts: acceptability to bone marrow transplant recipients.


    Dong, F M; Hashisaka, A E; Rasco, B A; Einstein, M A; Mar, D R; Aker, S N


    Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovery immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be "market-tested" by the targeted patient population before inclusion in the menu.

  7. Waterjet cutting of periprosthetic interface tissue in loosened hip prostheses: an in vitro feasibility study.


    Kraaij, Gert; Tuijthof, Gabrielle J M; Dankelman, Jenny; Nelissen, Rob G H H; Valstar, Edward R


    Waterjet cutting technology is considered a promising technology to be used for minimally invasive removal of interface tissue surrounding aseptically loose hip prostheses. The goal of this study was to investigate the feasibility of waterjet cutting of interface tissue membrane. Waterjets with 0.2 mm and 0.6 mm diameter, a stand-off distance of 5 mm, and a traverse speed of 0.5 mm/s were used to cut interface tissue samples in half. The water flow through the nozzle was controlled by means of a valve. By changing the flow, the resulting waterjet pressure was regulated. Tissue sample thickness and the required waterjet pressures were measured. Mean thickness of the samples tested within the 0.2 mm nozzle group was 2.3 mm (SD 0.7 mm) and within the 0.6 mm nozzle group 2.6 mm (SD 0.9 mm). The required waterjet pressure to cut samples was between 10 and 12 MPa for the 0.2 mm nozzle and between 5 and 10 MPa for the 0.6 mm nozzle. Cutting bone or bone cement requires about 3 times higher waterjet pressure (30-50 MPa, depending on used nozzle diameter) and therefore we consider waterjet cutting as a safe technique to be used for minimally invasive interface tissue removal. Copyright © 2015 IPEM. Published by Elsevier Ltd. All rights reserved.

  8. The thin blue line: a review and discussion of aseptic technique and postprocedural infections in rodents.


    Cooper, D M; McIver, R; Bianco, R


    A basic tenet of animal welfare philosophy is that pain and distress must be minimized whenever possible without interfering with the goals of the research. Aseptic technique during surgical procedures is essential to prevent pain and distress associated with post-procedural infections. However, many investigators have found that applying the aseptic techniques used for large animal and human surgery is not always practical when performing surgery on small rodents. Furthermore, the efficacy of some of these techniques for preventing post-procedural infections has been questioned. This review examines what is known about the development of postprocedural infections in animals and humans and the methods used to prevent them. Detection of postprocedural infections in rodents can be difficult unless objective measurements of physiologic indices are made. These measurements should be used experimentally to assess the relative benefits of various methods for preventing postprocedural infections. Measures of contamination, such as quantitative bacterial cultures, also can be used; however, they do not reliably predict infection rates. Much of the dogma about decontamination of skin and hair prior to surgery is not supported by valid experimental evidence. Hair removal may not be necessary. Alcohol may in fact be a better disinfectant than is often credited. Draping should be used when it contributes to the maintenance of the sterile field, but when it does not, modification of surgical technique may provide more protection from infection than the drape does. The contribution of surgical technique to the prevention of postprocedural infections is probably equal to that of aseptic technique. Further research needs to be done to assess various aseptic techniques for use in rodent surgery.

  9. Aseptic Handling of the MOMA Mass Spectrometer After Dry Heat Microbial Reduction

    NASA Technical Reports Server (NTRS)

    Lalime, Erin


    Mars Organic Molecule Analyzer Mass Spectrometer (MOMA-MS) is an instrument in the larger MOMA instrument suite for the European Space Agency (ESA) ExoMars 2020 Rover. As a life-detection instrument on a Mars landing mission, MOMA-MS has very stringent Planetary Protection (PP) bioburden requirements. Within the MOMA instrument suite, the hardware surfaces of the sample path must be cleaned to a level of 0.03 spore/sq m. To meet this requirement, a process called Dry Heat Microbial Reduction (DHMR) is used to decrease the number of viable spores by 4 orders of magnitude. Before DHMR, the hardware is handled using standard cleanroom practices, while after DHMR, all sample path surfaces must be handled aseptically when exposed. Aseptic handling of the sample path involves a number of strategies and protocols including working only in an aseptic ISO class 5 work space, limiting the amount of time of exposure, using sterile garmenting with sterile gloves, and using sterile tools. Before work begins, the aseptic workspace will be tested for bioburden and particle fallout, and all tools that will contact sample path surfaces must be sterilized. During the exposure activity, sterile garments will be worn, sterile tools will be handled in a 2 person set up so that the operator touches only the sterile tool and not the exterior surfaces of the sterile pouch, and the environment will be monitored with active and passive fallout for bioburden and particle levels. Any breach in the planetary protection cleanliness can necessitate repeating DHMR, which not only has significant cost and schedule implications, it also become a risk to hardware that is not rated for repeated long exposures to high temperatures.

  10. Sutural loosening and skeletal flexibility during growth: determination of drop-like shapes in sea urchins.


    Johnson, Amy S; Ellers, Olaf; Lemire, Jim; Minor, Melissa; Leddy, Holly A


    The shape of sea urchins may be determined mechanically by patterns of force analogous to those that determine the shape of a water droplet. This mechanical analogy implies skeletal flexibility at the time of growth. Although comprised of many rigid calcite plates, sutural collagenous ligaments could confer such flexibility if the sutures between plates loosened and acted as joints at the time of growth. We present experimental evidence of such flexibility associated with weight gain and growth. Over 13-, 4-, and 2-week periods, fed urchins (Strongylocentrotus droebachiensis) gained weight and developed looser sutures than unfed urchins that maintained or lost weight. Further, skeletons of fed urchins force-relaxed more than did those of unfed urchins and urchins with loose sutures force-relaxed more than those with tight sutures. Urchins (Strongylocentrotus franciscanus) fed for two and a half weeks, gained weight, also had looser skeletons and deposited calcite at sutural margins, whereas unfed ones did not. In field populations of S. droebachiensis the percentage having loose sutures varied with urchin diameter and reflected their size-specific growth rate. The association between feeding, weight gain, calcite deposition, force relaxation and sutural looseness supports the hypothesis that urchins deform flexibly while growing, thus determining their drop-like shapes.

  11. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory.


    Neville, Michael W; Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie


    To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students' aseptic technique at the conclusion of the semester. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos.

  12. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie


    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  13. The spectrum of aseptic central nervous system infections in southern Germany - demographic, clinical and laboratory findings.


    Kaminski, M; Grummel, V; Hoffmann, D; Berthele, A; Hemmer, B


    Aseptic infections of the central nervous system (CNS) are frequently observed in Germany. However, no study has systematically addressed the spectrum of aseptic CNS infections in Germany. Data on 191 adult patients diagnosed from January 2007 to December 2014 with aseptic meningitis or encephalitis/meningoencephalitis at our hospital were collected by chart review and analyzed for demographic, clinical and laboratory findings. Patients were stratified according to the causative virus and findings were compared between groups. In our cohort, meningitis was caused in 36% by enterovirus (EV), 15% by herpes simplex virus (HSV), 12% by varicella zoster virus (VZV) and 5% by tick borne encephalitis (TBE). Encephalitis/meningoencephalitis was caused in 13% by HSV, 13% by VZV, and three out of 11 tested patients were positive for TBE. The highest incidence of EV infections was between 25 and 35 years and of HSV infections between 30 and 60 years. VZV infections had a bimodal distribution peaking below 30 and above 70 years. VZV and EV infections were more frequently observed during summer, whereas HSV infections showed no seasonal preference. Inflammatory changes in cerebrospinal fluid (CSF) were highest in HSV and lowest in EV infections. Polymerase chain reaction tests for HSV, VZV and EV in CSF and TBE serology determined the causative virus in over 60% of tested patients. The age of affected patients, seasonal distribution, disease course and inflammatory changes in CSF differ between groups of patients affected by the most common viral infections. © 2017 EAN.

  14. Aseptic meningitis outbreak caused by echovirus 30 in two regions in Bulgaria, May-August 2012.


    Mladenova, Z; Buttinelli, G; Dikova, A; Stoyanova, A; Troyancheva, M; Komitova, R; Stoycheva, M; Pekova, L; Parmakova, K; Fiore, L


    An aseptic meningitis outbreak emerged in two regions in Bulgaria in 2012 and echovirus 30 (E30) was established as the aetiological agent by cell culture isolation, serological test, and molecular-based techniques. A total of 157 patients with aseptic meningitis were investigated, of which 117 were confirmed as having E30-associated disease. Molecular analysis of 12 E30 isolates revealed 99-100% nucleotide and amino-acid identity between them and a close correlation with a Greek strain involved in an E30 outbreak in 2012. Children aged 5-14 years were mainly affected, which could reflect the absence of E30 epidemics in Bulgaria for a period of 11 years. The first case with E30 isolation (a 2-year-old patient from Plovdiv) was notified at the end of April 2012. This was most likely the index case, from which the spread of the virus started, causing sporadic cases first, which later led to an aseptic meningitis outbreak facilitated by person-to-person viral transmission.

  15. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.


    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie


    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  16. Multicenter Study on Incubation Conditions for Environmental Monitoring and Aseptic Process Simulation.


    Guinet, Roland; Berthoumieu, Nicole; Dutot, Philippe; Triquet, Julien; Ratajczak, Medhi; Thibaudon, Michel; Bechaud, Philippe; Arliaud, Christophe; Miclet, Edith; Giordano, Florine; Larcon, Marjorie; Arthaud, Catherine

    Environmental monitoring and aseptic process simulations represent an integral part of the microbiological quality control system of sterile pharmaceutical products manufacturing operations. However, guidance documents and manufacturers practices differ regarding recommendations for incubation time and incubation temperature, and, consequently, the environmental monitoring and aseptic process simulation incubation strategy should be supported by validation data. To avoid any bias coming from in vitro studies or from single-site manufacturing in situ studies, we performed a collaborative study at four manufacturing sites with four samples at each location. The environmental monitoring study was performed with tryptic soy agar settle plates and contact plates, and the aseptic process simulation study was performed with tryptic soy broth and thioglycolate broth. The highest recovery rate was obtained with settle plates (97.7%) followed by contact plates (65.4%) and was less than 20% for liquid media (tryptic soy broth 19% and thioglycolate broth 17%). Gram-positive cocci and non-spore-forming Gram-positive rods were largely predominant with more than 95% of growth and recovered best at 32.5 °C. The highest recovery of molds was obtained at 22.5 °C alone or as the first incubation temperature. Strict anaerobes were not recovered. At the end of the five days of incubation no significant statistical difference was obtained between the four conditions. Based on these data a single incubation temperature at 32.5 °C could be recommended for these four manufacturing sites for both environmental monitoring and aseptic process simulation, and a second plate could be used, periodically incubated at 22.5 °C. Similar studies should be considered for all manufacturing facilities in order to determine the optimal incubation temperature regime for both viable environmental monitoring and aseptic process simulation. Microbiological environmental monitoring and aseptic process

  17. Arthroscopic observation was useful to detect loosening of the femoral component of unicompartmental knee arthroplasty in a recurrent hemoarthrosis

    PubMed Central


    A case of recurrent hemarthrosis of the knee after a mobile-bearing unicompartmental knee arthroplasty (UKA; Oxford UKA) is described. A 58-year-old man met with a road traffic accident 10 months after UKA. He developed anteromedial pain and hemarthrosis of the knee joint 1 month after the accident, which required multiple aspirations. Physical examination showed no instability. Plain radiograph revealed no signs of loosening. All laboratory data, including bleeding and coagulation times, were within normal limits. Diagnostic arthroscopy demonstrated loosening of the femoral component. Any intraarticular pathology other than nonspecific synovitis was ruled out. The loose femoral component and polyethylene meniscal bearing were revised. Since then, hemarthrosis has not recurred. PMID:22353541

  18. Screw Loosening and Pelvic Canal Narrowing After Lateral Plating of Feline Ilial Fractures With Locking and Nonlocking Plates.


    Schmierer, Philipp A; Kircher, Patrick R; Hartnack, Sonja; Knell, Sebastian C


    To compare the frequency of complications, including screw loosening and pelvic canal narrowing, associated with dynamic compression plating, locking plating, and double locking plating of ilial fractures in cats. Historical cohort study. The radiographs and medical records of cats with pelvic fractures that were presented between 2004 and 2013 were reviewed. The cases were categorized based on the plate type and number as dynamic compression plate (DCP), single locking plate (LPS) and double locking plates (dLPS). The frequency of screw loosening was compared across categories using a Fisher's exact test. The change in pelvic alignment, described by the change in sacral index (postoperative sacral index-followup sacral index), was compared across plate categories using ANOVA. The frequency of screw loosening for DCP (5/10) was significantly higher than LPS (1/13) and dLPS (0/11) (P = .05, P = .012, respectively). There was no significant difference in the SI change across plate categories. The mean change in sacral index for DCP was -0.11 (95%CI -0.25 to 0.03), for LPS was 0.0007 (95%CI -0.07 to 0.08), and for dLPS was -0.01 (95%CI -0.04 to 0.02). None of the cats showed constipation postoperatively. Screw loosening occurred less often but the change in pelvic canal alignment was not significantly different in ilial fractures repaired with LPS or dLPS compared to ilial fractures repaired with DCP. Locking plating of ilial fractures in cats may offer advantages compared to nonlocking plating. © Copyright 2015 by The American College of Veterinary Surgeons.

  19. Does Abutment Collar Length Affect Abutment Screw Loosening After Cyclic Loading?


    Siadat, Hakimeh; Pirmoazen, Salma; Beyabanaki, Elaheh; Alikhasi, Marzieh


    A significant vertical space that is corrected with vertical ridge augmentation may necessitate selection of longer abutments, which would lead to an increased vertical cantilever. This study investigated the influence of different abutment collar heights on single-unit dental implant screw-loosening after cyclic loading. Fifteen implant-abutment assemblies each consisted of an internal hexagonal implant were randomly assigned to 3 groups: Group1, consisting of 5 abutments with 1.5 mm gingival height (GH); Group2, 5 abutments with 3.5 mm GH; and Group3, 5 abutments with 5.5 mm GH. Each specimen was mounted in transparent auto-polymerizing acrylic resin block, and the abutment screw was tightened to 35 Ncm with an electric torque wrench. After 5 minutes, initial torque loss (ITL) was recorded for all specimens. Metal crowns were fabricated with 45° occlusal surface and were placed on the abutments. A cyclic load of 75 N and frequency of 1 Hz were applied perpendicular to the long axis of each specimen. After 500 000 cycles, secondary torque loss (STL) was recorded. One-way ANOVA analysis was used to evaluate the effects of abutment collar height before and after cyclic loading. One-way ANOVA showed that ITL among the groups was not significantly different (P = .52), while STL was significantly different among the groups (P = .008). Post-hoc Tukey HSD tests showed that STL values were significantly different between the abutments with 1.5 mm GH (Group1) and with 5.5 mm GH (Group3) (P = .007). A paired comparison t-test showed that cyclic loading significantly influenced the STL in comparison with the ITL in each group. Within the limitations of this study, it can be concluded that increase in height of the abutment collar could adversely affect the torque loss of the abutment screw.

  20. In Vivo Cell Wall Loosening by Hydroxyl Radicals during Cress Seed Germination and Elongation Growth1[W][OA

    PubMed Central

    Müller, Kerstin; Linkies, Ada; Vreeburg, Robert A.M.; Fry, Stephen C.; Krieger-Liszkay, Anja; Leubner-Metzger, Gerhard


    Loosening of cell walls is an important developmental process in key stages of the plant life cycle, including seed germination, elongation growth, and fruit ripening. Here, we report direct in vivo evidence for hydroxyl radical (·OH)-mediated cell wall loosening during plant seed germination and seedling growth. We used electron paramagnetic resonance spectroscopy to show that ·OH is generated in the cell wall during radicle elongation and weakening of the endosperm of cress (Lepidium sativum; Brassicaceae) seeds. Endosperm weakening precedes radicle emergence, as demonstrated by direct biomechanical measurements. By 3H fingerprinting, we showed that wall polysaccharides are oxidized in vivo by the developmentally regulated action of apoplastic ·OH in radicles and endosperm caps: the production and action of ·OH increased during endosperm weakening and radicle elongation and were inhibited by the germination-inhibiting hormone abscisic acid. Both effects were reversed by gibberellin. Distinct and tissue-specific target sites of ·OH attack on polysaccharides were evident. In vivo ·OH attack on cell wall polysaccharides were evident not only in germinating seeds but also in elongating maize (Zea mays; Poaceae) seedling coleoptiles. We conclude that plant cell wall loosening by ·OH is a controlled action of this type of reactive oxygen species. PMID:19493972

  1. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    Mulcahy, Daniel M.


    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  2. Growth and toxin production by Clostridium botulinum in steamed rice aseptically packed under modified atmosphere.


    Kasai, Yoshiaki; Kimura, Bon; Kawasaki, Susumu; Fukaya, Tetsuya; Sakuma, Kinya; Fujii, Tateo


    Sales and consumption of ready-to-eat aseptic steamed rice products have increased manyfold in Japan over the past 10 years. To determine the safety of steamed rice (water content 60%, pH 6.5) aseptically packaged under modified atmosphere, challenge studies were performed using a mixture of Clostridium botulinum proteolytic strains (five strains of type A and five strains of type B). Atmospheric conditions of 0 and 15% oxygen (with 5% CO2 and 5% N2 as the balance) were used. No neurotoxins were detected, and organoleptically acceptable conditions persisted for 24 weeks at 15% oxygen conditions. However, botulinum neurotoxin was found in one of three samples at 12 weeks and in one of two samples at 24 weeks at 0% oxygen and 30 degrees C. When samples were inoculated with C. botulinum with amylase (0% oxygen), neurotoxin and sample spoilage was detected after only 1 week of storage. Challenge studies using proteolytic strains of C. botulinum mixed with Bacillus subtilis (amylase formers) also were performed with atmosphere conditions of oxygen at 0, 5, 10, and 15% (with 5% CO2 and 5% N2 as the balance). Under 10 and 15% oxygen conditions, neurotoxin was not detected after 1 week of storage, but sample spoilage was detected after the same period. Under 0% oxygen conditions, neurotoxin was detected at 1 week, but the sample remained organoleptically acceptable even after 2 weeks of storage. Both neurotoxin and sample spoilage were detected at 1 week of storage under 5% oxygen conditions. Based on these results, cocontamination of amylase-producing Bacillus with C. botulinum would increase the risk of foodborne botulism when aseptic rice samples are packed under low-oxygen conditions (<5%). Therefore, to ensure the safety of these products, packing under atmospheric containing more than 10% oxygen is recommended.

  3. Aseptic necrosis of the femoral head after pregnancy: a case report.


    Nassar, Kawtar; Rachidi, Wafae; Janani, Saadia; Mkinsi, Ouafa


    A documented case of beginning aseptic necrosis of the femoral head associated with pregnancy together with a review of the literature about this rare complication of pregnancy is presented. The known risk factors of osteonecrosis are; steroid use, alcoholism, organ transplantation, especially after kidney transplant or bone marrow transplantation bone, systemic lupus erythematosus, dyslipidemia especially hypertriglyceridemia, dysbaric decompression sickness, drepanocytosis and Gaucher's disease. Among the less established factors, we mention procoagulations abnormalities, HIV infection, chemotherapy. We report a case of osteonecrosis of femoral head after pregnancy.

  4. The influence of implant-abutment connection on the screw loosening and microleakage.


    Tsuruta, Katsuhiro; Ayukawa, Yasunori; Matsuzaki, Tatsuya; Kihara, Masafumi; Koyano, Kiyoshi


    There are some spaces between abutment and implant body which can be a reservoir of toxic substance, and they can penetrate into subgingival space from microgap at the implant-abutment interface. This penetration may cause periimplantitis which is known to be one of the most important factors associated with late failure. In the present study, three kinds of abutment connection system, external parallel connection (EP), internal parallel connection (IP), and internal conical connection (CC), were studied from the viewpoint of microleakage from the gap between the implant and the abutment and in connection with the loosening of abutment screw. We observed dye leakage from abutment screw hole to outside through microgap under the excessive compressive and tensile load and evaluated the anti-leakage characteristics of these connection systems. During the experiment, one abutment screw for EP and two screws for IP, out of seven samples in each group, were fractured. After the 2000 cycles of compressive tensile loadings, removal torque value (RTV) of abutment screw represented no statistical differences among three groups. Standard deviation was largest in the RTV of EP and smallest in that of CC. The results of microleakage of toluidine blue from implant-abutment connection indicated that microleakage generally increased as loading procedure progressed. The amount of microleakage was almost plateau at 2000 cycles in CC, but still increasing in other two groups. The value of microleakage greatly scattered in EP, but the deviation of that in CC is significantly smaller. At 500 cycles of loading, there were no significant differences in the amount of microleakage among the groups, but at 1000, 1500, and 2000 cycles of loading, the amount of microleakage in CC was significantly smaller than that in IP. Throughout the experiment, the amount of microleakage in EP was largest, but no statistical difference was indicated due to the high standard deviation. Within the

  5. Aseptic Culture Systems of Radopholus similis for In Vitro Assays on Musa spp. and Arabidopsis thaliana

    PubMed Central

    Elsen, A.; Lens, K.; Nguyet, D. T. M.; Broos, S.; Stoffelen, R.; De Waele, D.


    Radopholus similis is one of the most damaging nematodes in bananas. Chemical control is currently the most-used method, but nematode control through genetic improvement is widely encouraged. The objective of this study was to establish an aseptic culture system for R. similis and determine whether R. similis can infect and reproduce on in vitro banana plantlets and in vitro Arabidopsis thaliana. In the study's first part, a suitable aseptic culture system was developed using alfalfa callus. Radopholus similis could penetrate and reproduce in the callus. Six weeks after inoculation with 25 females, the reproduction ratio was 26.3 and all vermiform stages were present. The reproduction ratio increased to 223.2 after 12 weeks. Results of a greenhouse test showed that R. similis did not lose its pathogenicity after culturing on alfalfa callus. In the study's second part, the infection and reproduction of the nematodes cultured on the callus were studied on both in vitro banana plantlets and A. thaliana. Radopholus similis infected and reproduced on both banana and A. thaliana. Furthermore, nematode damage was observed in the root systems of both hosts. These successful infections open new perspectives for rapid in vitro screening for resistance in banana cultivars and anti-nematode proteins expressed in A. thaliana. PMID:19266012

  6. Molecular identification of enteroviruses associated with aseptic meningitis in children from India.


    Kumar, Arvind; Shukla, Deepti; Kumar, Rashmi; Idris, Mohammad Z; Jauhari, Prashant; Srivastava, Shalini; Dhole, Tapan N


    We identified and characterized enteroviruses associated with aseptic meningitis in children between April 2009 and March 2010. Enterovirus RNA was detected in 51 (45.5 %) of 112 CSF samples. Molecular typing by RT-PCR and sequencing of a partial VP1 region revealed the predominance of echovirus (ECV) 32 (n = 20), followed by ECV 11 (n = 10), ECV 13 and ECV 14 (n = 5 each), coxsackievirus (CV) B3 and CV B6 (n = 3 each), CV A2, CV A10 and ECV 30 (n = 1 each). Phylogenetic analysis of ECV 32 showed 0 to 4 % sequence divergence among strains of the present study and 20-23 % from the prototype Puerto Rico strain at the nucleotide level. This is the first report of ECV 32 associated with an aseptic meningitis epidemic and identification of seven different enterovirus serotypes (CV A2, CV A10, CV B3, CV B6, ECV 13, ECV 14 and ECV 32) in meningitis cases from India.

  7. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.


    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie


    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  8. Metagenomic Sequencing of an Echovirus 30 Genome From Cerebrospinal Fluid of a Patient With Aseptic Meningitis and Orchitis.


    Piantadosi, Anne; Mukerji, Shibani S; Chitneni, Pooja; Cho, Tracey A; Cosimi, Lisa A; Hung, Deborah T; Goldberg, Marcia B; Sabeti, Pardis C; Kuritzkes, Daniel R; Grad, Yonatan H


    Enteroviruses cause a wide spectrum of clinical disease. In this study, we describe the case of a young man with orchitis and aseptic meningitis who was diagnosed with enterovirus infection. Using unbiased "metagenomic" massively parallel sequencing, we assembled a near-complete viral genome, the first use of this method for full-genome viral sequencing from cerebrospinal fluid. We found that the genome belonged to the subgroup echovirus 30, which is a common cause of aseptic meningitis but has not been previously reported to cause orchitis.

  9. Measurements of Repeated Tightening and Loosening Torque of Seven Different Implant/Abutment Connection Designs and Their Modifications: An In Vitro Study.


    Butkevica, Alena; Nathanson, Dan; Pober, Richard; Strating, Herman


    Repeated tightening and loosening of the abutment screw may alter its mechanical and physical properties affecting the optimal torque and ultimate reliability of an implant/abutment connection. The purpose of this study was to evaluate the effect of repeated tightening and loosening of implant/abutment screws on the loosening torque of implant/abutment connections of commercially available implant systems. Seven different implant/abutment connections and their modifications were tested. The screws of each system were tightened according to the manufacturer's specifications. After 20 minutes the screws were loosened. This procedure was repeated ten times, and the differences between the 1st and 10th cycle were expressed as a percentage change RTq(%) and correlated with initial torque, the number of threads, the length of shank, and thread surface area employing Spearman's analysis. All systems showed significant differences in residual torque (RTq) value (p < 0.05) between the 1st and 10th cycle except groups 6 and 11 (p > 0.05). All connections but group 3 (p = 1.000) showed a significant change from the initial torque (ITq) to the RTq values. The first successive RTq values increased in two connection groups 1 and 2. The remaining connections showed reduced RTq values ranging from -1.2 % (group 5) to -23.5% (group 6). The RTq values declined gradually with every repeated tightening in groups 1, 2, 3, 8, 9, 11, 12. In group 2, after the tenth tightening the RTq was still above the ITq value. Only length of shank demonstrated a correlation with the RTq(%) change over the successive tightening loosening cycles (p < 0.05). Repeated tightening and loosening of implant/abutment screws caused varying torque level changes among the different systems. These observations can probably be attributed to connection design. Limiting the number of tightening/loosening cycles in clinical and laboratory procedures is advisable for most of the implant systems tested. © 2016 by the

  10. Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

    NASA Technical Reports Server (NTRS)

    Kuzmanoff, K. M.


    In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

  11. Should idiopathic facial aseptic granuloma be considered granulomatous rosacea? Report of three pediatric cases.


    Neri, Iria; Raone, Beatrice; Dondi, Arianna; Misciali, Cosimo; Patrizi, Annalisa


    Idiopathic facial aseptic granuloma (IFAG), or pyodermite froide du visage, is a skin disease reported only in children and characterized by painless red nodules usually located on the cheeks. Its etiology is still unclear, but some authors considered the possibility that IFAG might be included in the spectrum of granulomatous rosacea (GR). The histopathological features of IFAG and GR are quite similar, showing perifolliculitis, granulomas, folliculitis, and lymphocytes and plasmacells around epithelioid histiocytes. In the present article, we discuss three cases in which an association between a facial nodule, compatible with both IFAG and GR, and recurrent chalazia make us support the hypothesis that IFAG should be considered as GR. © 2012 Wiley Periodicals, Inc.

  12. Innovative food processing technology using ohmic heating and aseptic packaging for meat.


    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko


    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage. © 2013. Published by Elsevier Ltd on behalf of The American Meat Science Association. All rights reserved.

  13. Analysis of enterovirus types in patients with symptoms of aseptic meningitis in 2014 in Shandong, China.


    Chen, Peng; Lin, Xiaojuan; Liu, Guifang; Wang, Suting; Song, Lizhi; Tao, Zexin; Xu, Aiqiang


    We reviewed the epidemiological and clinical characteristics of 927 aseptic meningitis patients in Shandong in 2014, and the phylogeny of predominant enterovirus (EV) types causing this disease was analyzed. A total of 209 patients that were positive for EV were identified by both cell culture and a reverse transcription-seminested PCR in cerebrospinal fluid samples. The positive patients were most likely to be children within 15 years of age, had symptoms such as fever, vomiting and nausea (P< .05). The 209 EV sequences belonged to 11 types, and coxsackievirus B5, echovirus types 6 and 30 were predominant types. VP1 analysis exhibited multiple lineages were co-circulating. The significance of the study could come from the fact that surveillance is important to monitor the prevalence of EV types in population, which shows enterovirus meningitis maintains an important public health problem in China. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Establishing and monitoring an aseptic workspace for building the MOMA mass spectrometer

    NASA Astrophysics Data System (ADS)

    Lalime, Erin N.; Berlin, David


    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  15. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin


    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  16. [Aseptic non-touch technique in the operating room: keep it simple].


    Pans, Solange J A; Molmans, Eva; Marczinski, Susanne C; Bijker, Jilles B; Snijdelaar, Dik G


    The Dutch national patient safety platform developed a protocol for the preparation of intravenous medication; the Aseptic Non-Touch Technique (ANTT). Use of ANTT on nursing wards has shown to reduce contamination of intravenous medication. Therefore it is dictated by the Dutch Healthcare Inspectorate that this technique has to be used at all departments in the hospital, including the operating theatre. However, because of the use of air treatment and operating theatre uniforms, the operating theatre cannot be compared with a nursing ward. In this study, the bacterial contamination of syringes prepared in the operating theatre by anesthesia nurses was determined. Simulation study 45 anesthesia nurses prepared 1000 syringes of 10 ml bacterial culture medium, using their routine method of drawing up iv medication from vials. Turbidity in a syringe after culturing for 14 days at 30° C was used as evidence for bacterial contamination. Using questionnaires, nurses were interviewed in what degree their working method equals ANTT-protocol. We calculated how much extra time must be invested when using the strict ANTT-protocol in the operating theatre. Six syringes (0,6%) were contaminated. Normal dermal bacteria were identified in all syringes. The nurses who prepared the contaminated syringes worked similar manner as their colleagues. It takes an additional 54 minutes per day per operating theatre to work strictly using the ANTT technique. Contamination rates of aseptic preparations in the OR are very low, and are as low as ANTT preparations in a GMP-certified hospital pharmacy. Therefore it is legitimate to develop a modified ANTT-protocol for use in the operating theatre.



    Pires, Frederico Ribeiro; Franco, Andréia Christine Bonotto Farias; Gilio, Alfredo Elias; Troster, Eduardo Juan


    To evaluate Bacterial Meningitis Score (BMS) on its own and in association with Cerebrospinal Fluid (CSF) lactate dosage in order to distinguish bacterial from aseptic meningitis. Children diagnosed with meningitis at a tertiary hospital between January/2011 and December/2014 were selected. All data were obtained upon admission. BMS was applied and included: CSF Gram staining (2 points); CSF neutrophil count ≥1,000 cells/mm3 (1 point); CSF protein ≥80 mg/dL (1 point); peripheral blood neutrophil count ≥10,000 cells/mm3 (1 point) and seizures upon/before arrival (1 point). Cutoff value for CSF lactate was ≥30 mg/dL. Sensitivity, specificity and negative predictive value of several BMS cutoffs and BMS associated with high CSF lactate were evaluated for prediction of bacterial meningitis. Among 439 eligible patients, 94 did not have all data available to complete the score, and 345 patients were included: 7 in bacterial meningitis group and 338 in aseptic meningitis group. As predictive factors of bacterial meningitis, BMS ≥1 had 100% sensitivity (95%CI 47.3-100), 64.2% specificity (58.8-100) and 100% negative predictive value (97.5-100); BMS ≥2 or BMS ≥1 associated with high CSF lactate also showed 100% sensitivity (47.3-100); but 98.5% specificity (96.6-99.5) and 100% negative predictive value (98.3-100). 2 point BMS in association with CSF lactate dosage had the same sensitivity and negative predictive value, with increased specificity for diagnosis of bacterial meningitis when compared with 1-point BMS.


    PubMed Central

    Pires, Frederico Ribeiro; Franco, Andréia Christine Bonotto Farias; Gilio, Alfredo Elias; Troster, Eduardo Juan


    ABSTRACT Objective: To evaluate Bacterial Meningitis Score (BMS) on its own and in association with Cerebrospinal Fluid (CSF) lactate dosage in order to distinguish bacterial from aseptic meningitis. Methods: Children diagnosed with meningitis at a tertiary hospital between January/2011 and December/2014 were selected. All data were obtained upon admission. BMS was applied and included: CSF Gram staining (2 points); CSF neutrophil count ≥1,000 cells/mm3 (1 point); CSF protein ≥80 mg/dL (1 point); peripheral blood neutrophil count ≥10,000 cells/mm3 (1 point) and seizures upon/before arrival (1 point). Cutoff value for CSF lactate was ≥30 mg/dL. Sensitivity, specificity and negative predictive value of several BMS cutoffs and BMS associated with high CSF lactate were evaluated for prediction of bacterial meningitis. Results: Among 439 eligible patients, 94 did not have all data available to complete the score, and 345 patients were included: 7 in bacterial meningitis group and 338 in aseptic meningitis group. As predictive factors of bacterial meningitis, BMS ≥1 had 100% sensitivity (95%CI 47.3-100), 64.2% specificity (58.8-100) and 100% negative predictive value (97.5-100); BMS ≥2 or BMS ≥1 associated with high CSF lactate also showed 100% sensitivity (47.3-100); but 98.5% specificity (96.6-99.5) and 100% negative predictive value (98.3-100). Conclusions: 2 point BMS in association with CSF lactate dosage had the same sensitivity and negative predictive value, with increased specificity for diagnosis of bacterial meningitis when compared with 1-point BMS. PMID:29185620

  19. [Validation of a clinical prediction rule to distinguish bacterial from aseptic meningitis].


    Agüero, Gonzalo; Davenport, María C; Del Valle, María de la P; Gallegos, Paulina; Kannemann, Ana L; Bokser, Vivian; Ferrero, Fernando


    Despite most meningitis are not bacterial, antibiotics are usually administered on admission because bacterial meningitis is difficult to be rule-out. Distinguishing bacterial from aseptic meningitis on admission could avoid inappropriate antibiotic use and hospitalization. We aimed to validate a clinical prediction rule to distinguish bacterial from aseptic meningitis in children, on arriving to the emergency room. This prospective study included patients aged < 19 years with meningitis. Cerebrospinal fluid (CSF) and peripheral blood neutrophil count were obtained from all patients. The BMS (Bacterial Meningitis Score) described by Nigrovic (Pediatrics 2002; 110: 712), was calculated: positive CSF Gram stain= 2 points, CSF absolute neutrophil count > or = 1000 cells/mm(3), CSF protein > or = 80 mg/dl, peripheral blood absolute neutrophil count > or = 10.000/mm(3), seizure = 1 point each. Sensitivity (S), specificity (E), positive and negative predictive values (PPV and NPV), positive and negative likelihood ratios (PLR and NLR) of the BMS to predict bacterial meningitis were calculated. Seventy patients with meningitis were included (14 bacterial meningitis). When BMS was calculated, 25 patients showed a BMS= 0 points, 11 BMS= 1 point, and 34 BMS > or = 2 points. A BMS = 0 showed S: 100%, E: 44%, VPP: 31%, VPN: 100%, RVP: 1,81 RVN: 0. A BMS > or = 2 predicted bacterial meningitis with S: 100%, E: 64%, VPP: 41%, VPN: 100%, PLR: 2.8, NLR:0. Using BMS was simple, and allowed identifying children with very low risk of bacterial meningitis. It could be a useful tool to assist clinical decision making.

  20. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin N.; Berlin, David


    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  1. Techniques and clinical effect of aseptic procedures on patients with acute leukemia in laminar airflow rooms.


    Takeo, H; Sakurai, T; Amaki, I


    The techniques of aseptic procedures in the laminar airflow room (LAF) were evaluated in 110 adult patients undergoing antileukemic chemotherapy for remission induction. The patients were divided into three groups according to the regimens: Group A, consisting of 20 patients who stayed in the LAF and received the gown technique + sterile food + prophylactic oral and topical antibiotics; Group B, consisting of 12 patients who stayed in the LAF and received sterile food + prophylactic oral antibiotics; and Group C, consisting of 78 patients in open wards, who received prophylactic oral antibiotics alone. Species and numbers of microorganisms on the skin surface were far less in the patients in Group A than in those in Group B. Airborne microorganisms were counted by the air sampling method. No microorganisms could be detected at the time of the patient's rest and of blood collection in either Group A or B. Electrocardiography and X-ray examination caused an increase in the number of colonies to more than one colony in Group B, but Group A had a count of less than 0.5 colony. The colony counts became negative within 5 min after the cessation of each operation. The percentage of febrile days for patients with a peripheral granulocyte count of less than 100/microliter was 29% in Group A, 21% in Group B and 44% in Group C. The incidence of documented infections during the total hospital stay was 25% (5/20), 42% (5/12) and 86% (67/78), respectively. The aseptic procedures in Group B were not as strict as in Group A, but the incidence of infections in Group B was significantly lower than in Group C.

  2. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.


    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  3. Blood-CSF-barrier dysfunction is a marker for encephalitic involvement in patients with aseptic meningitis/meningoencephalitis.


    Hoyer, C; Eisele, P; Ebert, A D; Schneider, S; Gass, A; Fatar, M; Szabo, K; Alonso, A


    The term "aseptic meningitis" encompasses cases of meningitis with negative bacterial CSF culture, which predominantly are of viral etiology. While the clinical course is usually benign, complications such as encephalitic involvement resulting in a more severe clinical course may occur. Dysfunction of the blood-brain-barrier (BBB), which is a prerequisite for viral entry into the brain parenchyma, can be approximated using the CSF/serum albumin ratio, readily obtainable in routine CSF analysis. Analysis of CSF patterns in patients with aseptic meningitis/meningoencephalitis with a focus on BBB dysfunction as a marker for encephalitic involvement. Retrospective chart review of patients admitted to our hospital between 2004 and 2016 with a diagnosis of aseptic meningitis/meningoencephalitis. Patients with aseptic meningitis displaying clinical, MR-tomographic or electroencephalographic signs of encephalitic involvement were significantly older than patients without these features (47.4 vs. 35.5 yrs., p=0.002). In patients with meningoencephalitis, CSF analysis revealed a more severe disruption of BBB, approximated by the CSF/serum albumin ratio (p=0.002). Compromised BBB function correlated positively with length of hospitalization (p=0.007), indicative of a more severe clinical course. The number of CSF lymphocytes was found to predict the severity of the BBB disruption, which additionally was more frequently observed when herpesviridae were identified as infectious agents. We suggest that the CSF/serum albumin ratio as an estimate for BBB function should be attended to in the evaluation of patients with aseptic meningitis. Severe BBB dysfunction, older age and infection with herpesviridae appear to raise the risk for encephalitic involvement. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Iron Supplementation Effects on Redox Status following Aseptic Skeletal Muscle Trauma in Adults and Children.


    Deli, Chariklia K; Fatouros, Ioannis G; Paschalis, Vassilis; Tsiokanos, Athanasios; Georgakouli, Kalliopi; Zalavras, Athanasios; Avloniti, Alexandra; Koutedakis, Yiannis; Jamurtas, Athanasios Z


    Exercise-induced skeletal muscle microtrauma is characterized by loss of muscle cell integrity, marked aseptic inflammatory response, and oxidative stress. We examined if iron supplementation would alter redox status after eccentric exercise. In a randomized, double blind crossover study, that was conducted in two cycles, healthy adults ( n = 14) and children ( n = 11) received daily either 37 mg of elemental iron or placebo for 3 weeks prior to and up to 72 h after an acute eccentric exercise bout. Blood was drawn at baseline, before exercise, and 72 h after exercise for the assessment of iron status, creatine kinase activity (CK), and redox status. Iron supplementation at rest increased iron concentration and transferrin saturation ( p < 0.01). In adults, CK activity increased at 72 h after exercise, while no changes occurred in children. Iron supplementation increased TBARS at 72 h after exercise in both adults and children; no changes occurred under placebo condition. Eccentric exercise decreased bilirubin concentration at 72 h in all groups. Iron supplementation can alter redox responses after muscle-damaging exercise in both adults and children. This could be of great importance not only for healthy exercising individuals, but also in clinical conditions which are characterized by skeletal muscle injury and inflammation, yet iron supplementation is crucial for maintaining iron homeostasis. This study was registered at Identifier: NCT02374619.

  5. Effect of pilot-scale aseptic processing on tomato soup quality parameters.


    Colle, Ines J P; Andrys, Anna; Grundelius, Andrea; Lemmens, Lien; Löfgren, Anders; Buggenhout, Sandy Van; Loey, Ann; Hendrickx, Marc Van


    Tomatoes are often processed into shelf-stable products. However, the different processing steps might have an impact on the product quality. In this study, a model tomato soup was prepared and the impact of pilot-scale aseptic processing, including heat treatment and high-pressure homogenization, on some selected quality parameters was evaluated. The vitamin C content, the lycopene isomer content, and the lycopene bioaccessibility were considered as health-promoting attributes. As a structural characteristic, the viscosity of the tomato soup was investigated. A tomato soup without oil as well as a tomato soup containing 5% olive oil were evaluated. Thermal processing had a negative effect on the vitamin C content, while lycopene degradation was limited. For both compounds, high-pressure homogenization caused additional losses. High-pressure homogenization also resulted in a higher viscosity that was accompanied by a decrease in lycopene bioaccessibility. The presence of lipids clearly enhanced the lycopene isomerization susceptibility and improved the bioaccessibility. The results obtained in this study are of relevance for product formulation and process design of tomato-based food products. © 2011 Institute of Food Technologists®

  6. Controlled Human Malaria Infection of Tanzanians by Intradermal Injection of Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites

    PubMed Central

    Shekalaghe, Seif; Rutaihwa, Mastidia; Billingsley, Peter F.; Chemba, Mwajuma; Daubenberger, Claudia A.; James, Eric R.; Mpina, Maximillian; Ali Juma, Omar; Schindler, Tobias; Huber, Eric; Gunasekera, Anusha; Manoj, Anita; Simon, Beatus; Saverino, Elizabeth; Church, L. W. Preston; Hermsen, Cornelus C.; Sauerwein, Robert W.; Plowe, Christopher; Venkatesan, Meera; Sasi, Philip; Lweno, Omar; Mutani, Paul; Hamad, Ali; Mohammed, Ali; Urassa, Alwisa; Mzee, Tutu; Padilla, Debbie; Ruben, Adam; Lee Sim, B. Kim; Tanner, Marcel; Abdulla, Salim; Hoffman, Stephen L.


    Controlled human malaria infection (CHMI) by mosquito bite has been used to assess anti-malaria interventions in > 1,500 volunteers since development of methods for infecting mosquitoes by feeding on Plasmodium falciparum (Pf) gametocyte cultures. Such CHMIs have never been used in Africa. Aseptic, purified, cryopreserved Pf sporozoites, PfSPZ Challenge, were used to infect Dutch volunteers by intradermal injection. We conducted a double-blind, placebo-controlled trial to assess safety and infectivity of PfSPZ Challenge in adult male Tanzanians. Volunteers were injected intradermally with 10,000 (N = 12) or 25,000 (N = 12) PfSPZ or normal saline (N = 6). PfSPZ Challenge was well tolerated and safe. Eleven of 12 and 10 of 11 subjects, who received 10,000 and 25,000 PfSPZ respectively, developed parasitemia. In 10,000 versus 25,000 PfSPZ groups geometric mean days from injection to Pf positivity by thick blood film was 15.4 versus 13.5 (P = 0.023). Alpha-thalassemia heterozygosity had no apparent effect on infectivity. PfSPZ Challenge was safe, well tolerated, and infectious. PMID:25070995

  7. [Clinical, epidemiological and etiological studies of adult aseptic meningitis: Report of 13 cases with mumps meningitis].


    Takeshima, Shinichi; Yoshimoto, Takeshi; Shiga, Yuji; Kanaya, Yuhei; Neshige, Shuichiro; Himeno, Takahiro; Kono, Ryuhei; Takamatsu, Kazuhiro; Shimoe, Yutaka; Kuriyama, Masaru


    We experienced 13 cases (29.8 ± 7.0 years) of mumps meningitis and 365 cases of adult aseptic meningitis during 11 years from 2004 to 2014. A small epidemic of mumps occurred for 3-4 years, and the incidence rate of adult mumps meningitis coincided with the epidemic without seasonal fluctuation. Parotitis was observed in 8 of the 13 mumps meningitis patients (61.5%) and orchitis in 2 of 7 male patients (28.6%). There were no differences in clinical manifestations, laboratory findings, and outcome between patients with adult mumps meningitis and those with echovirus 9 meningitis (9 patients), except for the low frequency of nausea/vomiting and a high percentage of mononuclear cells of the cerebrospinal fluid in those with mumps. Eight patients had contact with persons with mumps before the symptomatic stage of meningitis. Only one patient had received mumps vaccination in childhood. On the basis of the values of the anti-mumps IgM and IgG antibodies, we speculated primary infection and the re-infection of mumps in 6 and 2 patients, respectively. Moreover, second vaccine failure was suggested in the vaccinated patient.

  8. Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait.


    Dalwai, Ajmal; Ahmad, Suhail; Al-Nakib, Widad


    The etiologic agents of aseptic meningitis (AM) often include human enteroviruses. The role of enteroviruses causing AM in young children was investigated during a 3-year period in Kuwait. Enteroviral RNA was detected in cerebrospinal fluid (CSF) by reverse transcription-PCR and specific genotypes of enteroviruses were identified by direct DNA sequencing of VP4-VP2 region. Enteroviral RNA was detected in 92 of 387 (24%) suspected AM cases and the results were confirmed by hybridization of amplicons with an internal, enterovirus-specific probe. The CSF samples from 75 of 281 (27%) children < 2 years old but only from 3 of 38 (8%) 4-12 year-old children were positive for enteroviral RNA (p = 0.011). Majority of infections in children < 2 years old (49 of 75, 65%) were due to three echoviruses; echovirus type 9 (E9), E11 and E30. Only three other enteroviruses, namely coxsackievirus type B4, coxsackievirus type B5 and enterovirus 71 were detected among AM cases in Kuwait. Our data show that three types of echoviruses (E9, E11 and E30) are associated with the majority of AM cases in Kuwait. To the best of our knowledge, this is the first report to characterize different enterovirus genotypes associated with AM in the Arabian Gulf region.

  9. [Serotype distribution of enteroviruses isolated from paediatric cases prediagnosed as aseptic meningitis between 2001-2004 period].


    Ozkaya, Etem; Uysal, Gülnar; Atak, Tunca; Alkan, Mehmet


    Enteroviruses have major clinical and public health importance and are one of the leading causes of aseptic meningitis. There are many diseases with similar clinical symptoms and cerebrospinal fluid (CSF) findings of aseptic meningitis, thus virus isolation and identification is crucial for definitive diagnosis. Virological diagnosis is nonetheless important to distinguish between induced meningitis and other treatable causes of disease with a similar clinical picture. A total of 249 samples obtained from 246 cases (age range: 0-15 years), prediagnosed as aseptic meningitis, were sent to Virology Laboratory of Refik Saydam Hygiene Center. The patients were followed at Department of Pediatric Infectious Diseases in the Social Security Hospital, Ankara, Turkey, between 2001 and 2004. Stool (n: 180), CSF (n: 54) and throat swab (n: 15) samples have been inoculated to RD (rhabdomyosarcoma), Hep-2 (human epithelioma) and L20B (transgenic mice) cell lines, and followed up for the presence of cytopathic effects. A total of 95 enterovirus strains were isolated from 85 (34.6%) cases, and serotyped by using RIVM (National Institute of Public and the Environment, Nederlands) antisera with microneutralization method. As a result, the most frequently isolated types were found as echovirus type 30 (n: 24) and coxsackievirus type B (n: 19), which were most frequently isolated between July to October. This is the first report from Turkey for aseptic meningitis cases due to echovirus type 25 (n:3), 18 (n:2), 14 (n:1), 13 (n:4), 11 (n:6), 9 (n:1), 6 (n:9), 5 (n:1), 4 (n:1) and coxsackievirus type A9 (n:1).

  10. Detection by PCR of Enteroviruses in Cerebrospinal Fluid during a Summer Outbreak of Aseptic Meningitis in Switzerland

    PubMed Central

    Gorgievski-Hrisoho, Meri; Schumacher, Jean-Daniel; Vilimonovic, Nevenka; Germann, Daniel; Matter, Lukas


    Enteroviruses (EV) are among the most common causes of aseptic meningitis. Standard diagnostic techniques are often too slow and lack sensitivity to be of clinical relevance. EV RNA can be detected within 5 h by a commercially available reverse transcription-PCR (RT-PCR) test kit. Cerebrospinal fluid (CSF) samples from 68 patients presenting with aseptic meningitis during a summer outbreak in Switzerland were examined in parallel with cell culture and commercial RT-PCR. RT-PCR was positive in all 16 CSF specimens positive by cell culture (100%). In addition, 42 of 52 (80%) CSF samples negative by cell culture were PCR positive. In 26 of these 42 (62%) patients, viral culture from other sites (throat swab or stool) was also positive. The CSF virus culture took 3 to 7 days to become positive. Echovirus 30 was the type most often isolated in this outbreak. The sensitivity of CSF RT-PCR based on clinical diagnosis during this aseptic meningitis outbreak in patients with negative bacterial culture results was 85%, i.e., considerably higher than the sensitivity of CSF virus culture (24%). We conclude that this commercial RT-PCR assay allows a positive diagnosis with minimal delay and may thus influence clinical decisions. PMID:9705364

  11. Herpes simplex virus type 2-associated recurrent aseptic (Mollaret's) meningitis in genitourinary medicine clinic: a case report.


    Abou-Foul, Ahmad K; Buhary, Thajunisha M; Gayed, Sedki L


    Cases of idiopathic recurrent benign aseptic meningitis were first described by Mollaret. Today, herpes simplex virus (HSV) is considered the cause of most cases of Mollaret's meningitis. A 40-year-old male was referred to our genitourinary medicine clinic with recurrent genital herpetic lesions. He had HSV-2-positive genital ulcers 8 years earlier. One year after the first infection, he developed severe recurrent attacks of headache associated with meningitis symptoms. The results of all radiological and biochemical tests were normal, but the patient reported a correlation between his attacks and genital herpes flare-ups. We diagnosed the patient with Mollaret's meningitis and started him on continuous suppressive acyclovir therapy, which resulted in marked clinical improvement. Mollaret's meningitis is a rare form of idiopathic recurrent aseptic meningitis that has a sudden onset, short duration, and spontaneous remission with unpredictable recurrence. We believe that the presence of concurrent or recurrent mucocutaneous herpetic lesions can aid its diagnosis, prior to which, affected patients usually have many unnecessary investigations and treatments. Therefore, detailed sexual history should be sought in all patients with aseptic meningitis, and clinicians should also ask about history of recurrent headaches in all patients with recurrent herpetic anogenital lesions. Continuous suppressive acyclovir therapy may reduce the frequency and severity of attacks and can dramatically improve lifestyle.

  12. Laboratory diagnosis and genetic analysis of a family clustering outbreak of aseptic meningitis due to echovirus 30.


    Zheng, Shufa; Ye, Hongyan; Yan, Juying; Xie, Guoliang; Cui, Dawei; Yu, Fei; Wang, Yiyin; Yang, Xianzhi; Zhou, Fangman; Zhang, Yanjun; Tian, Xueli; Chen, Yu


    Echovirus 30 (E30) is a major pathogen associated with aseptic meningitis. In the summer of 2014, a family clustering aseptic meningitis outbreak occurred in urban-rural fringe of Ningbo city in Zhejiang Province in China. To identify the etiologic agent, specimens were tested by cell culture and reverse transcriptase-polymerase chain reaction. Pathogenic examination confirmed that the outbreak is caused by E30. The first case is a 6-year-old child, who studied in kindergarten in local, suffered from headache and fever. Same symptoms appeared in his parents, aunts, and other six relatives continuously. Meanwhile, vomiting occurred in majority of the patients and diarrhea in parts of them. White blood cells in cerebrospinal fluid (CSF) exceeded normal range in all patients. Protein levels in CSF were above normal range in half of the patients. Glucose levels in CSF were within normal range in all patients. We isolated six strains E30 in the stool specimens of patients, and carried out sequencing analysis to VP1 region. Sequencing results showed that 100% sequence identity was seen in both nucleotide and amino acid levels. Phylogenetic analysis discovered that isolate in this study was grouped into sublineage D2 together with sequences isolated from other areas of China in the 2000s and 2010s. Our study is the first family clustering outbreak of aseptic meningitis caused by E30 in Zhejiang Province in China. It is essential to establish an enterovirus molecular surveillance system in China to prevent mass outbreaks in Zhejiang.

  13. RNA chaperone StpA loosens interactions of the tertiary structure in the td group I intron in vivo

    PubMed Central

    Waldsich, Christina; Grossberger, Rupert; Schroeder, Renée


    Efficient splicing of the td group I intron in vivo is dependent on the ribosome. In the absence of translation, the pre-mRNA is trapped in nonnative-splicing-incompetent conformations. Alternatively, folding of the pre-mRNA can be promoted by the RNA chaperone StpA or by the group I intron-specific splicing factor Cyt-18. To understand the mechanism of action of RNA chaperones, we probed the impact of StpA on the structure of the td intron in vivo. Our data suggest that StpA loosens tertiary interactions. The most prominent structural change was the opening of the base triples, which are involved in the correct orientation of the two major intron core domains. In line with the destabilizing activity of StpA, splicing of mutant introns with a reduced structural stability is sensitive to StpA. In contrast, Cyt-18 strengthens tertiary contacts, thereby rescuing splicing of structurally compromised td mutants in vivo. Our data provide direct evidence for protein-induced conformational changes within catalytic RNA in vivo. Whereas StpA resolves tertiary contacts enabling the RNA to refold, Cyt-18 contributes to the overall compactness of the td intron in vivo. PMID:12208852

  14. Structural health monitoring for bolt loosening via a non-invasive vibro-haptics human-machine cooperative interface

    NASA Astrophysics Data System (ADS)

    Pekedis, Mahmut; Mascerañas, David; Turan, Gursoy; Ercan, Emre; Farrar, Charles R.; Yildiz, Hasan


    For the last two decades, developments in damage detection algorithms have greatly increased the potential for autonomous decisions about structural health. However, we are still struggling to build autonomous tools that can match the ability of a human to detect and localize the quantity of damage in structures. Therefore, there is a growing interest in merging the computational and cognitive concepts to improve the solution of structural health monitoring (SHM). The main object of this research is to apply the human-machine cooperative approach on a tower structure to detect damage. The cooperation approach includes haptic tools to create an appropriate collaboration between SHM sensor networks, statistical compression techniques and humans. Damage simulation in the structure is conducted by releasing some of the bolt loads. Accelerometers are bonded to various locations of the tower members to acquire the dynamic response of the structure. The obtained accelerometer results are encoded in three different ways to represent them as a haptic stimulus for the human subjects. Then, the participants are subjected to each of these stimuli to detect the bolt loosened damage in the tower. Results obtained from the human-machine cooperation demonstrate that the human subjects were able to recognize the damage with an accuracy of 88 ± 20.21% and response time of 5.87 ± 2.33 s. As a result, it is concluded that the currently developed human-machine cooperation SHM may provide a useful framework to interact with abstract entities such as data from a sensor network.

  15. Loosening of the total knee arthroplasty: detection by radionuclide bone scanning. [/sup 99m/Tc-methylene diphosphonate


    Hunter, J.C.; Hattner, R.S.; Murray, W.R.


    Pain after total knee arthroplasty is a common clinical problem in orthopedics, and prosthetic loosening, often requiring surgical revision, is usually the etiology. Since standard clinical and radiographic diagnostic measures have not proven totally satisfactory, a study of the utility of bone scintigraphy to assess stability of the knee prosthesis was done. Thirty-five patients with 39 prostheses were studied. Seventeen patients with 21 total knee arthroplasties served as controls and were asymptomatic, were stable at surgery, or improved with conservative management. Eighteen knees in 18 symptomatic patients composed the experimental group. Of these, 11 knees were loose at surgery andmore » seven have had surgery recommended. Scintigrams of the knees were obtained using /sup 99m/Tc-MDP, and ranked 0-3 corresponding to increasingly abnormal localization by three observers. Highly significant differences were observed between the abnormal and control groups (p<0.001). Reciprocal changes in sensitivity and specificity with increasingly stringent criteria were shown. While it is apparent that the bone scan cannot be used as the sole diagnostic method for evaluation of prosthetic stability, it does seem to be a useful adjunct along with clinical criteria and radiographic studies.« less

  16. Media-fill simulation tests in manual and robotic aseptic preparation of injection solutions in syringes.


    Krämer, Irene; Federici, Matteo; Kaiser, Vanessa; Thiesen, Judith


    The purpose of this study was to evaluate the contamination rate of media-fill products either prepared automated with a robotic system (APOTECAchemo™) or prepared manually at cytotoxic workbenches in the same cleanroom environment and by experienced operators. Media fills were completed by microbiological environmental control in the critical zones and used to validate the cleaning and disinfection procedures of the robotic system. The aseptic preparation of patient individual ready-to-use injection solutions was simulated by using double concentrated tryptic soy broth as growth medium, water for injection and plastic syringes as primary packaging materials. Media fills were either prepared automated (500 units) in the robot or manually (500 units) in cytotoxic workbenches in the same cleanroom over a period of 18 working days. The test solutions were incubated at room temperature (22℃) over 4 weeks. Products were visually inspected for turbidity after a 2-week and 4-week period. Following incubation, growth promotion tests were performed with Staphylococcus epidermidis. During the media-fill procedures, passive air monitoring was performed with settle plates and surface monitoring with contact plates on predefined locations as well as fingerprints. The plates got incubated for 5-7 days at room temperature, followed by 2-3 days at 30-35℃ and the colony forming units (cfu) counted after both periods. The robot was cleaned and disinfected according to the established standard operating procedure on two working days prior to the media-fill session, while on six other working days only six critical components were sanitized at the end of the media-fill sessions. Every day UV irradiation was operated for 4 h after finishing work. None of the 1000 media-fill products prepared in the two different settings showed turbidity after the incubation period thereby indicating no contamination with microorganisms. All products remained uniform, clear, and light

  17. Anterior augmentation plating of aseptic humeral shaft nonunions after intramedullary nailing.


    Gessmann, Jan; Königshausen, Matthias; Coulibaly, Marlon Osman; Schildhauer, Thomas Armin; Seybold, Dominik


    Humeral shaft nonunion after intramedullary nailing is a rare but serious complication. Treatment options include implant removal, open plating, exchange nailing and external fixation. The objective of this retrospective study was to determine whether augmentation plating without nail removal is feasible for treating a humeral shaft nonunion. Between 2002 and 2014, 37 patients (mean age 51, range 20-84 years) with aseptic humeral shaft nonunions prior to intramedullary nailing were treated with augmentation plating. The initial fractures had been fixed with retrograde nails (10 cases) or anterograde nails (27 cases). There were 34 atrophic nonunions and 3 hypertrophic nonunions. Nonunion treatment of all patients consisted of local debridement through an anterior approach to the humerus and anterior placement of the augmentation plates. Supplemental bone grafting was performed in all atrophic nonunion cases. All patients were followed until union was radiologically confirmed. Union was achieved in 36 patients (97 %) after a mean of 6 months (range 3-24 months). There was one case of iatrogenic median nerve palsy that showed complete spontaneous recovery 6 weeks postoperatively. One patient sustained a peri-implant stress fracture that was treated successfully by exchanging the augmentation plate to bridge the nonunion and the fracture. No infections or wound healing complications developed. At a mean follow-up of 14 months, all patients showed free shoulder and elbow motion and no restrictions in daily or working life. The results indicate that augmentation plating using an anterior approach is a safe and reliable option for humeral shaft nonunions after failed nailing, and the treatment has no substantial complications. Because the healing rates are similar to the standard technique of nail removal and fixation by compression or locking plates, we consider this technique to be an alternative choice for treatment.

  18. Atrophic, aseptic, tibial nonunion: how effective is modified Judet's osteoperiosteal decortication technique and buttress plating?


    Binod, Bijukachhe; Nagmani, Singh; Bigyan, Bhandari; Rakesh, John; Prashant, Adhikari


    Tibial nonunion is the most common nonunion encountered by the orthopedic surgeon. Repeated surgeries, cost, increased duration of hospital stay, disability, pain all contribute to the increased morbidity. Many methods have been used to treat nonunion of tibia with variable results and none of them are 100 % successful. Our objective was to determine the effectiveness of modification of Judet's decortication technique and buttress plating, without bone graft, in the treatment of aseptic, atrophic tibial nonunion. Also, to find the correlation between time of achieving union and time since injury to decortication. Ours is a retrospective study conducted at a Level I trauma center. A total of 35 cases of atrophic tibial nonunion, irrespective of the cause, was treated by modifying Judet's osteoperiosteal decortication and plating during the time period January 2006 to July 2013. Demographic data, range of motion, time of achieving union and clinico-radiological evaluation for union of fracture were included as main outcome measurements. Union was achieved in all cases with a mean duration of 8.34 months. Pain and stiffness of joints were not reported in any case on long-term follow-up and the patients had satisfactory range of motion. Implant removal was done in three cases after fracture union. Treatment of atrophic tibial nonunion is challenging and management of each nonunion has to be customized based on the biological and mechanical characteristics of the nonunion. Plating with osteoperiosteal decortication is an effective and simple technique, which in our hands has shown to result in 100 % union rates without the need of additional bone healing augmentation procedures like bone grafting. Level II.

  19. Which is the preferred revision technique for loosened iliac screw? A novel technique of boring cement injection from the outer cortical shell.


    Yu, Bin-Sheng; Yang, Zhan-Kun; Li, Ze-Min; Zeng, Li-Wen; Wang, Li-Bing; Lu, William Weijia


    An in vitro biomechanical cadaver study. To evaluate the pull-out strength after 5000 cyclic loading among 4 revision techniques for the loosened iliac screw using corticocancellous bone, longer screw, traditional cement augmentation, and boring cement augmentation. Iliac screw loosening is still a clinical problem for lumbo-iliac fusion. Although many revision techniques using corticocancellous bone, larger screw, and polymethylmethacrylate (PMMA) augmentation were applied in repairing pedicle screw loosening, their biomechanical effects on the loosened iliac screw remain undetermined. Eight fresh human cadaver pelvises with the bone mineral density values ranging from 0.83 to 0.97 g/cm were adopted in this study. After testing the primary screw of 7.5 mm diameter and 70 mm length, 4 revision techniques were sequentially established and tested on the same pelvis as follows: corticocancellous bone, longer screw with 100 mm length, traditional PMMA augmentation, and boring PMMA augmentation. The difference of the boring technique from traditional PMMA augmentation is that PMMA was injected into the screw tract through 3 boring holes of outer cortical shell without removing the screw. On an MTS machine, after 5000 cyclic compressive loading of -200∼-500 N to the screw head, axial maximum pull-out strengths of the 5 screws were measured and analyzed. The pull-out strengths of the primary screw and 4 revised screws with corticocancellous bone, longer screw and traditional and boring PMMA augmentation were 1167 N, 361 N, 854 N, 1954 N, and 1820 N, respectively. Although longer screw method obtained significantly higher pull-out strength than corticocancellous bone (P<0.05), the revised screws using these 2 techniques exhibited notably lower pull-out strength than the primary screw and 2 PMMA-augmented screws (P<0.05). Either traditional or boring PMMA screw showed obviously higher pull-out strength than the primary screw (P<0.05); however, no significant difference of

  20. [Diagnosis of septic loosening of hip prosthesis with LeukoScan. SPECT scan with 99mTc-labeled monoclonal antibodies].


    Kaisidis, A; Megas, P; Apostolopoulos, D; Spiridonidis, T; Koumoundourou, D; Zouboulis, P; Lambiris, E; Vassilakos, P


    Diagnosis of septic loosening of hip endoprosthesis with antigranulocyte scintigraphy (AGS) was analysed. Twenty-one hip prostheses were studied using laboratory tests and, in cases of elevated values, three-phase bone scan (BS) and AGS. Elective SPECT/CT scans were performed. Histologic and microbiologic exams verified the diagnosis. The AGS analysis revealed sensitivity, specificity and accuracy of value 1, while positive and negative predictive values were also 1. BS showed sensitivity of 1 and specificity of 0.33. In three cases, SPECT/CT scans corroborated the AGS interpretation. This diagnostic algorithm proved effective in the detection of septic loosening of hip prostheses. AGS can be avoided without risk of infection being overlooked.

  1. Release of zirconia nanoparticles at the metal stem-bone cement interface in implant loosening of total hip replacements.


    Schunck, Antje; Kronz, Andreas; Fischer, Cornelius; Buchhorn, Gottfried Hans


    In a previous failure analysis performed on femoral components of cemented total hip replacements, we determined high volumes of abraded bone cement. Here, we describe the topography of the polished surface of polymethyl methacrylate (PMMA) bone cement containing zirconia radiopacifier, analyzed by scanning electron microscopy and vertical scanning interferometry. Zirconia spikes protruded about 300nm from the PMMA matrix, with pits of former crystal deposition measuring about 400nm in depth. We deduced that the characteristically mulberry-shaped agglomerates of zirconia crystals are ground and truncated into flat surfaces and finally torn out of the PMMA matrix. Additionally, evaluation of in vitro PMMA-on-PMMA articulation confirmed that crystal agglomerations of zirconia were exposed to grain pullout, fatigue, and abrasion. In great quantities, micron-sized PMMA wear and zirconia nanoparticles accumulate in the cement-bone interface and capsular tissues, thereby contributing to osteolysis. Dissemination of nanoparticles to distant lymph nodes and organs of storage has been reported. As sufficient information is lacking, foreign body reactions to accumulated nanosized zirconia in places of long-term storage should be investigated. The production of wear particles of PMMA bone cement in the interface to joint replacement devices, presents a local challenge. The presence of zirconia particles results in frustrated digestion attempts by macrophages, liberation of inflammatory mediators, and necrosis leading to aseptic inflammation and osteolyses. Attempts to minimize wear of articulating joints reduced the attention to the deterioration of cement cuffs. We therefore investigated polished surfaces of retrieved cuffs to demonstrate their morphology and to measure surface roughness. Industrially admixed agglomerates of the radiopacifier are abraded to micron and nano-meter sized particles. The dissemination of zirconia particles in the reticulo-endothelial system to

  2. Effect of retorque on loosening torque of prosthetic screws under two levels of fit of implant-supported dentures.


    Spazzin, Aloísio Oro; Henrique, Guilherme Elias Pessanha; Nóbilo, Mauro Antônio de Arruda; Consani, Rafael Leonardo Xediek; Correr-Sobrinho, Lourenço; Mesquita, Marcelo Ferraz


    This study evaluated the influence of retorque on loosening torque (Lt) of prosthetic screws in implant-supported dentures with different fit levels. Ten mandibular implant-supported dentures were fabricated and then 20 cast models were then prepared using prosthetic structures to create 2 fit levels: passive fit (Pf) and misfit (Mf). Two tightening techniques were also evaluated: initial torque only (T1); and initial torque and retorque after 10 min (T2). Gold or titanium screws were used, resulting in 4 groups to each one: Pf/T1, Pf/T2, Mf/T1, Mf/T2. The Lt was measured 24 h after the tightening torque using digital torque meter. Data were analyzed statistically by two-way ANOVA and Tukey's test (alpha=0.05), separately for each screw material. For titanium screws, no significant difference (p>0.05) was found between Pf/T1 and Pf/T2, or between Pf/T2 and Mf/T2. However, statistically significant difference (p<0.05) was found between Pf/T1 and Mf/T1, and between Mf/T1 and Mf/T2. Mf reduced the Lt using T1, while and T2 increased the Lt for Mf. Retorque and fit were shown to have no significant influence on the Lt of the gold screws. Retorque application made insignificant the misfit effect on the Lt of the titanium screws, suggesting that this procedure should be performed routinely during the screw tightening in multi-unit dentures.

  3. A CT scan protocol for the detection of radiographic loosening of the glenoid component after total shoulder arthroplasty

    PubMed Central


    Background and purpose It is difficult to evaluate glenoid component periprosthetic radiolucencies in total shoulder arthroplasties (TSAs) using plain radiographs. This study was performed to evaluate whether computed tomography (CT) using a specific patient position in the CT scanner provides a better method for assessing radiolucencies in TSA. Methods Following TSA, 11 patients were CT scanned in a lateral decubitus position with maximum forward flexion, which aligns the glenoid orientation with the axis of the CT scanner. Follow-up CT scanning is part of our routine patient care. Glenoid component periprosthetic lucency was assessed according to the Molé score and it was compared to routine plain radiographs by 5 observers. Results The protocol almost completely eliminated metal artifacts in the CT images and allowed accurate assessment of periprosthetic lucency of the glenoid fixation. Positioning of the patient within the CT scanner as described was possible for all 11 patients. A radiolucent line was identified in 54 of the 55 observed CT scans and osteolysis was identified in 25 observations. The average radiolucent line Molé score was 3.4 (SD 2.7) points with plain radiographs and 9.5 (SD 0.8) points with CT scans (p = 0.001). The mean intra-observer variance was lower in the CT scan group than in the plain radiograph group (p = 0.001). Interpretation The CT scan protocol we used is of clinical value in routine assessment of glenoid periprosthetic lucency after TSA. The technique improves the ability to detect and monitor radiolucent lines and, therefore, possibly implant loosening also. PMID:24286563

  4. Aseptic meningitis outbreak associated with echovirus 30 among high school football players--Los Angeles County, California, 2014.


    Croker, Curtis; Civen, Rachel; Keough, Kathleen; Ngo, Van; Marutani, Amy; Schwartz, Benjamin


    On August 4, 2014, the Acute Communicable Disease Control Program of the Los Angeles County Department of Public Health received a report of three aseptic meningitis cases among football players at a county high school. An investigation was conducted to determine the extent of the outbreak, identify potential exposures, and recommend control measures. An outbreak-associated aseptic meningitis case was defined as an illness of any team or family member with onset during July 28-August 11 with 1) cerebrospinal fluid pleocytosis and negative bacterial culture or 2) an emergency department visit with headache, fever, and stiff neck. Ten cases were identified; nine in males, and one in a female; patient ages ranged from 13 to 17 years. All the patients sought care at an emergency department, and five were hospitalized, resulting in 12 total hospital days. All 10 patients have recovered. Eight patients were football players, and two were siblings of football players. The most affected subgroup was the junior varsity football team, with seven cases out of 57 players (attack rate = 12.3%); the relative risk for aseptic meningitis was higher among players who were linemen than among those who were not linemen (relative risk = 5.4 [p = 0.03]). Of the 10 patients, eight tested positive by polymerase chain reaction for enterovirus, and two were not tested. Echovirus testing was performed at the California Viral and Rickettsial Disease Laboratory. Of the eight specimens testing positive for enterovirus, seven tested positive for echovirus 30, and one specimen could not be typed because of insufficient quantity.

  5. Laboratory diagnosis and genetic analysis of a family clustering outbreak of aseptic meningitis due to echovirus 30

    PubMed Central

    Ye, Hongyan; Yan, Juying; Xie, Guoliang; Cui, Dawei; Yu, Fei; Wang, Yiyin; Yang, Xianzhi; Zhou, Fangman; Zhang, Yanjun; Tian, Xueli; Chen, Yu


    Echovirus 30 (E30) is a major pathogen associated with aseptic meningitis. In the summer of 2014, a family clustering aseptic meningitis outbreak occurred in urban–rural fringe of Ningbo city in Zhejiang Province in China. To identify the etiologic agent, specimens were tested by cell culture and reverse transcriptase–polymerase chain reaction. Pathogenic examination confirmed that the outbreak is caused by E30. The first case is a 6-year-old child, who studied in kindergarten in local, suffered from headache and fever. Same symptoms appeared in his parents, aunts, and other six relatives continuously. Meanwhile, vomiting occurred in majority of the patients and diarrhea in parts of them. White blood cells in cerebrospinal fluid (CSF) exceeded normal range in all patients. Protein levels in CSF were above normal range in half of the patients. Glucose levels in CSF were within normal range in all patients. We isolated six strains E30 in the stool specimens of patients, and carried out sequencing analysis to VP1 region. Sequencing results showed that 100% sequence identity was seen in both nucleotide and amino acid levels. Phylogenetic analysis discovered that isolate in this study was grouped into sublineage D2 together with sequences isolated from other areas of China in the 2000s and 2010s. Our study is the first family clustering outbreak of aseptic meningitis caused by E30 in Zhejiang Province in China. It is essential to establish an enterovirus molecular surveillance system in China to prevent mass outbreaks in Zhejiang. PMID:27646838

  6. Recent outbreak of aseptic meningitis in Italy due to Echovirus 30 and phylogenetic relationship with other European circulating strains.


    Milia, Maria Grazia; Cerutti, Francesco; Gregori, Gabriella; Burdino, Elisa; Allice, Tiziano; Ruggiero, Tina; Proia, Maria; De Rosa, Giulia; Enrico, Eugenia; Lipani, Filippo; Di Perri, Giovanni; Ghisetti, Valeria


    Enteroviruses (EVs) are common human viral pathogens, causing a variety of diseases, including aseptic meningitis. Recently, EV aseptic meningitis outbreaks have been reported across Europe, but, in Italy, knowledge of recent EV molecular epidemiology is very limited. We report an outbreak of EV aseptic meningitis in 10 adults in North-Western Italy, from October to November 2012. Patients were parents or close relatives of children <5 years old attending the same class of a nursery school, suffering from a mild febrile upper respiratory disease. Phylogenetic relationship with other European circulating strains was analyzed updating E30 circulation in Italy in recent years. EVs were detected from cerebrospinal fluid (CSF) specimens with a real-time reverse transcription polymerase chain reaction and virus isolation was achieved from rectal and pharyngeal swabs. For cluster definition and phylogenetic studies, viral VP1 region was directly amplified and sequenced from CSF. EVs were identified in CSF from all patients and from rectal and pharyngeal swabs in 7 of them. Direct sequencing of CSF revealed the presence of the same Echovirus 30 (E30) in all patients and phylogenetic analysis identified it as a diverging clade within E30 genotype VII, the most recent strain circulating in UK, Finland and Denmark since 2006. Molecular techniques allowed the rapid identification and typing of E30 from CSF. Phylogenetic analysis revealed that the cluster might be due to a new E30 variant within the genotype VII currently circulating in Europe, thus updating the epidemiology of EV circulation in Italy. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Laboratory investigation and phylogenetic analysis of enteroviruses involved in an aseptic meningitis outbreak in Greece during the summer of 2007.


    Logotheti, Maria; Pogka, Vasiliki; Horefti, Elina; Papadakos, Konstantinos; Giannaki, Maria; Pangalis, Anastasia; Sgouras, Dionyssios; Mentis, Andreas


    Aseptic meningitis is the most commonly observed CNS infection and is mainly attributed to Non-Polio Enteroviruses (EV). Identification and genetic analysis of the EV involved in the recent aseptic meningitis outbreak which occurred in Greece, during the summer of 2007. In total, 213 CSF and faecal samples were examined for EV presence by culture, while enteroviral RNA detection was performed by nucleic acid sequence-based amplification assay (NASBA). EV strains were typed by seroneutralization, as well as nested RT-PCR followed by VP1-2A gene partial sequencing. Phylogenetic analysis was carried out for the identification of the genetic relatedness among the isolated EV strains. EV detection rate in CSF and faecal samples was 43.9% and 70.8%, respectively. EV serotyping and VP1 region analysis revealed the predominance of echovirus 4 (ECV4) serotype and the circulation of ECV6, 9, 14, 25, Coxsackie A6, A15, A24 and Coxsackie B1 serotypes. All ECV4 isolates presented a 98.7% similarity in nucleotide sequence, with a Spanish ECV4 strain, isolated during a meningitis outbreak in 2006. It is the first time that ECV4 is associated with an aseptic meningitis outbreak in Greece, during which 9 different EV serotypes were co-circulating. All Greek ECV4 isolates were closely related to the Spanish ECV4 strain. Genetic analysis of the VP1 gene can significantly contribute to the revelation of the endemic EV strains circulation pattern and their phylogenetic relationship with enteroviruses involved in epidemics of distant geographical areas at different time periods.

  8. Tumor necrosis factor α level in cerebrospinal fluid for bacterial and aseptic meningitis: a diagnostic meta-analysis.


    Lv, S; Zhao, J; Zhang, J; Kwon, S; Han, M; Bian, R; Fu, H; Zhang, Y; Pan, H


    In our previous study, tumor necrosis factor α (TNF-α) was identified as an effective target for sepsis patients (Int J Clin Pract, 68, 2014, 520). TNF-α in cerebrospinal fluid (CSF) was also investigated for its utility in the differential diagnosis of bacterial and aseptic meningitis. However, there has been neither definite nor convincing evidence so far. Here the overall diagnostic accuracy of TNF-α in differentiation between bacterial and aseptic meningitis was evaluated through the meta-analysis of diagnostic tests. The sensitivity, specificity and other measures of accuracy were pooled using random effect models. Summary receiver operating characteristic curves were used to assess overall test performance. Publication bias was evaluated using funnel plots, and sensitivity analysis was also introduced. A total of 21 studies involving bacterial meningitis (678) and aseptic meningitis (694) involved a total of 1372 patients. The pooled sensitivity and specificity for the TNF-α test were 0.83 [95% confidence interval (CI) 0.80-0.86, I(2)  = 65.1] and 0.92 (95% CI 0.89-0.94, I(2)  = 61.8), respectively. The positive likelihood ratio was 12.05 (95% CI 7.41-19.60, I(2)  = 36.5), the negative likelihood ratio was 0.17 (95% CI 0.13-0.24, I(2)  = 59.4), and TNF-α was significantly associated with bacterial meningitis, with a diagnostic odds ratio of 49.84 (95% CI 28.53-87.06, I(2)  = 47.9). The overall accuracy of the TNF-α test was very high with the area under the curve 0.9317. Publication bias was absent, and sensitivity analysis suggested that our results were highly stable. Our meta-analysis suggested that TNF-α could be recommended as a useful marker for diagnosis of bacterial meningitis and differential diagnosis between bacterial and aseptic meningitis with high sensitivity and specificity. Thus, hospitals should be encouraged to conduct TNF-α tests in CSF after lumbar puncture. © 2014 The Author(s) European Journal of Neurology © 2014 EAN.

  9. Clinical, epidemiological and etiological studies of adult aseptic meningitis: Report of 11 cases with varicella zoster virus meningitis.


    Takeshima, Shinichi; Shiga, Yuji; Himeno, Takahiro; Tachiyama, Keisuke; Kamimura, Teppei; Kono, Ryuhei; Takemaru, Makoto; Takeshita, Jun; Shimoe, Yutaka; Kuriyama, Masaru


    We treated 11 cases (52.7 ± 14.9 years, all male) with varicella zoster virus (VZV) meningitis and 437 cases with adult aseptic meningitis from 2004 to 2016. The incidence rate of adult VZV meningitis in the cases with aseptic meningitis was 2.5%. Herpes zoster infections are reported to have occurred frequently in summer and autumn. VZV meningitis also occurred frequently in the similar seasons, in our patients. The diagnoses were confirmed in 9 cases with positive VZV-DNA in the cerebrospinal fluid and in 2 cases with high VZV-IgG indexes (> 2.0). For diagnosis confirmation, the former test was useful for cases within a week of disease onset, and the latter index was useful for cases after a week of disease onset. Zoster preceded the meningitis in 8 cases, while the meningitis preceded zoster in 1 case, and 2 cases did not have zoster (zoster sine herpete). Two patients were carriers of the hepatitis B virus, 1 patient was administered an influenza vaccine 4 days before the onset of meningitis, and 1 patient was orally administered prednisolone for 2 years, for treatment. Their immunological activities might have been suppressed. The neurological complications included trigeminal neuralgia, facial palsy (Ramsay Hunt syndrome), glossopharyngeal neuralgia, and Elsberg syndrome. Because the diseases in some patients can become severe, they require careful treatment.

  10. An In Vitro Evaluation of the Loosening of Different Interchangeable Abutments in Internal-Connection-Type Implants.


    Park, Ji-Man; Baek, Chang-Hyun; Heo, Seong-Joo; Kim, Seong-Kyun; Koak, Jai-Young; Kim, Shin-Koo; Belser, Urs C

    The aim of this study was to compare the loosening of interchangeable one-piece abutments connected to internal-connection-type implants after cyclic loading. Four implant abutment groups (n = 7 in each group) with Straumann tissue-level implants were assessed: Straumann solid abutment (group S), Southern Implants solid abutment (group SI), Implant Direct straight abutment (group ID), and Blue Sky Bio regular platform abutment (group BSB). The implant was firmly held in a special jig to ensure fixation. Abutment screws were tightened to manufacturers' recommended torque with a digital torque gauge. The hemispherical loading members were fabricated for the load cell of a universal testing machine to evenly distribute the force on the specimens and to fulfill the ISO 14801:2007 standard. A cyclic loading of 25 N at 30 degrees to the implant's long axis was applied for a duty of a half million cycles. Tightening torques were measured prior to the loading. Removal torques were measured after cyclic loading. The data were analyzed with one-way analysis of variance (ANOVA), and the significance level was set at P < .05. The mean removal torques after cyclic loading were 34.0 ± 1.1 Ncm (group S), 25.0 ± 1.5 Ncm (group SI), 23.9 ± 2.1 Ncm (group ID), and 27.9 ± 1.3 Ncm (group BSB). Removal torques of each group were statistically different in the order of group S > group BSB > groups SI and ID (P < .05). The mean reduction rates were -2.9% ± 3.2% (group S), -21.9% ± 4.8% (group SI), -20.2% ± 7.2% (group ID), and -6.9% ± 4.3% (group BSB) after a half million cycles, respectively. Reduction rates of groups S and BSB were statistically lower than those of groups SI and ID (P < .01). The standard deviation of group S was lower than group BSB. The removal torque of the original Straumann abutment was significantly higher than those of the copy abutments. The reduction rate of the groups S and BSB abutments was lower than those of the other copy abutments.

  11. Aseptic Freeze-Dried versus Sterile Wet-Packaged Human Cadaveric Acellular Dermal Matrix in Immediate Tissue Expander Breast Reconstruction: A Propensity Score Analysis.


    Hanson, Summer E; Meaike, Jesse D; Selber, Jesse C; Liu, Jun; Li, Liang; Hassid, Victor J; Baumann, Donald P; Butler, Charles E; Garvey, Patrick B


    Although multiple acellular dermal matrix sources exist, it is unclear how its processing impacts complication rates. The authors compared complications between two preparations of human cadaveric acellular dermal matrix (freeze dried and ready-to-use) in immediate tissue expander breast reconstruction to analyze the effect of processing on complications. The authors retrospectively reviewed all alloplastic breast reconstructions with freeze-dried or ready-to-use human acellular dermal matrices between 2006 and 2016. The primary outcome measure was surgical-site occurrence defined as seroma, skin dehiscence, surgical-site infection, or reconstruction failure. The two groups were compared before and after propensity score matching. The authors included 988 reconstructions (freeze-dried, 53.8 percent; ready-to-use, 46.2 percent). Analysis of 384 propensity score-matched pairs demonstrated a slightly higher rate of surgical-site occurrence (21.4 percent versus 16.7 percent; p = 0.10) and surgical-site infection (9.6 percent versus 7.8 percent; p = 0.13) in the freeze-dried group than in the ready-to-use group, but the difference was not significant. However, failure was significantly higher for the freeze-dried versus ready-to-use group (7.8 percent versus 4.4 percent; p = 0.050). This is the largest study comparing the outcomes of alloplastic breast reconstruction using human acellular dermal matrix materials prepared by different methods. The authors demonstrated higher early complications with aseptic, freeze-dried matrix than with sterile ready-to-use matrix; reconstructive failure was the only outcome to achieve statistical significance. The authors conclude that acellular dermal matrix preparation has an independent impact on patient outcomes in their comparison of one company's product. Therapeutic, III.

  12. Early polyethylene wear and osteolysis with ABG acetabular cups (7- to 12-year follow-up).


    Badhe, Sachin; Livesley, Peter


    We reviewed 81 consecutive ABG I primary total hip replacements implanted in 72 patients between January 1993 and December 1998. The mean follow-up was 8.2 (range 7-12) years. There was significant polyethylene wear and osteolysis associated with the acetabular cup . The cumulative survival of the cup with revision being the end point at 8.2 years was 95.1% (95% CI: 92-97.6%). However, the cumulative survival of the cup with revision and aseptic loosening together was 72% (95% CI: 61-78%) and survival of the acetabular liner for wear was 62% (95% CI: 48-74%). Stem survival with revision being the end point was 100%. In spite of significant radiological failures of the cups, most patients remained asymptomatic. Though results of the ABG stems in this series were good, we advocate a regular follow-up of all these hips in view of the poor outcome of the cups.

  13. [Clinical effect modified Chevron osteotomy combined with lateral tissue loosening in treating mild-moderate hallux valgus through internal signal approach].


    Chen, Xue-Qiang; Wu, Qun-Feng; Dong, Wei-Qin; Yu, Li-Xin; Li, Xiong-Feng


    To explore clinical effect of modified Chevron osteotomy combined with lateral tissue loosening for the treatment of mild-moderate hallux valgus through internal signal approach. From July 2015 to June 2016, 26 patients with mild-moderate hallux valgus treated with modified Chevron osteotomy combined with lateral tissue loosening through internal signal approach, including 2 males and 24 females aged from 45 to 65 years old with an average of(54.6±4.8) years old;the courses of diseases ranged from 1 to 5 months with an average of (7.5±3.3) months. Hallux valgus angle(HVA), inter metatarsal angle(IMA) were measured at 12 months after operation, and AOFAS score was applied to evaluate clinical effect before and after operation. All incisions were healed at stage I. No incision occurred infection, metatarsal necrosis and recurrence of hallux valgus deformity. Two patients occurred skin numbness caused by musculocutaneous nerve injury. Twenty-six patients were followed up from 6 to 12 months with an average of(9.12±2.06) months. HVA, IMA were(30.01±3.71)°, (14.00±1.50)° before operation and(9.41±4.16)°, (7.00±0.60)° after operation, which had significant difference. There was statistical significance in AOFAS score before operation 54.77±9.59 and after operation 92.73±5.47, and 19 cases obtained excellent results and 7 moderate. Modified Chevron osteotomy combined with full thread headless pressure screw fixation and lateral tissue loosening for the treatment of mild-moderate hallux valgus has advantages of excellent exposure, simple operation, stable fixation, rapid recovery. Akin osteotomy with internal capsulorrhaphy were used with lateral loosening and could recover soft tissue balance between lateral and internal, and could receive satisfied clinical effects. Copyright© 2018 by the China Journal of Orthopaedics and Traumatology Press.

  14. Intramedullary nailing for the treatment of aseptic femoral shaft non-unions after plating failure: effectiveness and timing.


    Megas, Panagiotis; Syggelos, Spyros A; Kontakis, Georgios; Giannakopoulos, Andreas; Skouteris, Georgios; Lambiris, Elias; Panagiotopoulos, Elias


    This retrospective, multicentre study aimed to evaluate reamed intramedullary nailing (IMN) for the treatment of 30 cases of aseptic femoral shaft non-union after plating failure. Following nailing, 29 non-unions had healed by a mean 7.93 months. In one case a hypertrophic non-union required renailing after 8 months, using a nail of greater diameter, and united within five further months. Healing times were not related to whether the fracture was open or closed, the type non-union or the type of fracture. The delay from the initial plating to intramedullary nailing had a statistically significant effect on healing time and final outcome. This treatment is cost effective and should be implemented as soon as the non-union is diagnosed.

  15. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.


    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  16. Alopecic and Aseptic Nodules of the Scalp/Pseudocyst of the Scalp: Clinicopathological and Therapeutic Analyses in 11 Korean Patients.


    Seol, Jung Eun; Park, In Ho; Kim, Do Hyeong; Park, So Hee; Kang, Jeong Nan; Kim, Hyojin; Seo, Jong Keun


    Alopecic and aseptic nodule of the scalp (AANS) is a rare disease entity first reported in 1992 as pseudocyst of the scalp (PCS). Controversy exists regarding the histopathology and etiology of reported cases. We performed this study to analyze the clinical and histopathologic features of AANS/PCS in Korean patients. A retrospective review of medical records from 2008 to 2013 at Inje University Busan Paik Hospital was performed. Eleven patients were enrolled. All patients were male, and their mean age was 21.6 years. Most patients had a solitary nodule (10/11) located predominantly on the vertex. The mean nodule size was 20 mm. Inflammatory cell infiltration in the deep dermis was a histologic feature of AANS/PCS. Eight patients showed granulomatous infiltration. All patients were treated with short-term antibiotics and intralesional steroid injection. Our results suggest that dermatologists should consider AANS when diagnosing an alopecic nodule on the scalp. © 2015 S. Karger AG, Basel.

  17. Genetic characterization of a Coxsackie A9 virus associated with aseptic meningitis in Alberta, Canada in 2010

    PubMed Central


    Background An unusually high incidence of aseptic meningitis caused by enteroviruses was noted in Alberta, Canada between March and October 2010. Sequence based typing was performed on the enterovirus positive samples to gain a better understanding of the molecular characteristics of the Coxsackie A9 (CVA-9) strain responsible for most cases in this outbreak. Methods Molecular typing was performed by amplification and sequencing of the VP2 region. The genomic sequence of one of the 2010 outbreak isolates was compared to a CVA-9 isolate from 2003 and the prototype sequence to study genetic drift and recombination. Results Of the 4323 samples tested, 213 were positive for enteroviruses (4.93%). The majority of the positives were detected in CSF samples (n = 157, 73.71%) and 81.94% of the sequenced isolates were typed as CVA-9. The sequenced CVA-9 positives were predominantly (94.16%) detected in patients ranging in age from 15 to 29 years and the peak months for detection were between March and October. Full genome sequence comparisons revealed that the CVA-9 viruses isolated in Alberta in 2003 and 2010 were highly homologous to the prototype CVA-9 in the structural VP1, VP2 and VP3 regions but divergent in the VP4, non-structural and non-coding regions. Conclusion The increase in cases of aseptic meningitis was associated with enterovirus CVA-9. Sequence divergence between the prototype strain of CVA-9 and the Alberta isolates suggests genetic drifting and/or recombination events, however the sequence was conserved in the antigenic regions determined by the VP1, VP2 and VP3 genes. These results suggest that the increase in CVA-9 cases likely did not result from the emergence of a radically different immune escape mutant. PMID:23521862

  18. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.


    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan


    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  19. [Study on the etiological and molecular characteristics of aseptic meningitis epidemic in Zhejiang Province in 2002-2004].


    Yan, Ju-Ying; Lu, Yi-Yu; Xu, Chang-Ping; Yu, Zhao; Gong, Li-Ming; Chen, Yin; Zhang, Yan-Jun


    In order to confirm the cause of the outbreak of aseptic meningitis in Zhejiang Province in 2002-2004, trace the pathogen and analyze the molecular characteristics, 271 cerebrospinal fluid (CSF) and faeces specimens were collected from suspected patients. The virus strains from the specimens were isolated with RD and Hep-2 cell lines. The VP1 and VP4/VP2 genes of the isolated viruses were sequenced, and their phylogenetic and homology trees were also constructed. Of the total 271 samples, 78 Echovirus type 30 (E30) strains were isolated. All of the complete VP1 genes in 31 sequenced virus isolates of E30 were composed of 876 nt without any insertion or deletion, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 84.7%-86.3% and 92.1%-94.2% between the 31 Zhejiang strains and the prototype strain Bastianni of E30, and 87.1%-99.4% and 96.2%-100% among the 31 Zhejiang strains, respectively. The Zhejiang strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. In G genotype, the Shangdong and Jiangsu E30 strains in 2003 among domestic strains and Ukraine E30 strain in 1999 among overseas strains had maximum similarity with the Zhejiang strains, while H genotype had maximum similarity with the Korea E30 strains in 2008. The phylogenetic tree of the VP4/VP2 genes was similar to that of VP1 gene. The results indicated that the outbreak of aseptic meningitis in Zhejiang Provinec in 2002-2004 was caused by the G and H genotypes of E30 strains existing simultaneously. The H genotype was a new variant strain, which was first isolated in Zhejiang Province in 2002.

  20. Effect of cement washout on loosening of abutment screws and vice versa in screw- and cement- retained implant-supported dental prosthesis

    PubMed Central

    Kim, Seok-Gyu; Son, Mee-Kyoung


    PURPOSE The purpose of this study was to examine the abutment screw stability of screw- and cement-retained implant-supported dental prosthesis (SCP) after simulated cement washout as well as the stability of SCP cements after complete loosening of abutment screws. MATERIALS AND METHODS Thirty-six titanium CAD/CAM-made implant prostheses were fabricated on two implants placed in the resin models. Each prosthesis is a two-unit SCP: one screw-retained and the other cemented. After evaluating the passive fit of each prosthesis, all implant prostheses were randomly divided into 3 groups: screwed and cemented SCP (Control), screwed and noncemented SCP (Group 1), unscrewed and cemented SCP (Group 2). Each prosthesis in Control and Group 1 was screwed and/or cemented, and the preloading reverse torque value (RTV) was evaluated. SCP in Group 2 was screwed and cemented, and then unscrewed (RTV=0) after the cement was set. After cyclic loading was applied, the postloading RTV was measured. RTV loss and decementation ratios were calculated for statistical analysis. RESULTS There was no significant difference in RTV loss ratio between Control and Group 1 (P=.16). No decemented prosthesis was found among Control and Group 2. CONCLUSION Within the limits of this in vitro study, the stabilities of SCP abutment screws and cement were not significantly changed after simulated cement washout or screw loosening. PMID:26140172

  1. Evaluating the Sensitivity of a Media-Fill Challenge Test Under Various Situations as a Reliable Method for Recommended Aseptic Technique Competency Assessment

    PubMed Central

    Moody, Colleen A.; Eckel, Stephen F.; Amerine, Lindsey B.


    Background: Microbial contamination of compounded medications is a serious concern within hospital pharmacies as it can lead to severe patient injury. The United States Pharmacopeia <797> mandates that pharmacy personnel responsible for preparing compounded sterile preparations must annually demonstrate competency in aseptic technique by performing a media-fill challenge test. Objective: The purpose of this study is to evaluate the sensitivity of a commonly used media-fill test through proper and improper compounding techniques. Methods: Two aseptically trained pharmacy technicians performed media-fill challenge testing by carrying out 5 separate manipulations 5 times each for a total of 25 trials. Sterile vials, syringes, and intravenous bags were prepared. The first manipulation followed best-practice aseptic technique and sterile compounding procedures. Each of the following 4 manipulations removed one aspect of best-practice aseptic technique. The prepared products were incubated at 20°C to 25°C. A positive result for microbial contamination is indicated by visible turbidity within the vials, syringes, and intravenous bags at the following check points: 24 hours, 72 hours, 7 days, 14 days, 21 days, and >30 days. Results: Twenty-five trials, each containing 10 distinct admixtures, resulted in a total of 250 compounded preparations. No single preparation showed signs of turbidity, sedimentation, or visible microbial growth at any of the 6 checkpoints yielding a 0% contamination rate. However, the positive controls inoculated with bacteria did have positive microbial growth results. Conclusion: A more sensitive test needs to be developed to provide assurances that all poor aseptic practices are detected in compounding personnel.

  2. Teaching aseptic technique for central venous access under ultrasound guidance: a randomized trial comparing didactic training alone to didactic plus simulation-based training.


    Latif, Rana K; Bautista, Alexander F; Memon, Saima B; Smith, Elizabeth A; Wang, Chenxi; Wadhwa, Anupama; Carter, Mary B; Akca, Ozan


    Our goal was to determine whether simulation combined with didactic training improves sterile technique during ultrasound (US)-guided central venous catheter (CVC) insertion compared with didactic training alone among novices. We hypothesized that novices who receive combined didactic and simulation-based training would perform similarly to experienced residents in aseptic technique, knowledge, and perception of comfort during US-guided CVC insertion on a simulator. Seventy-two subjects were enrolled in a randomized, controlled trial of an educational intervention. Fifty-four novices were randomized into either the didactic group or the simulation combined with didactic group. Both groups received didactic training but the simulation combined with didactic group also received simulation-based CVC insertion training. Both groups were tested by demonstrating US-guided CVC insertion on a simulator. Aseptic technique was scored on 8 steps as "yes/no" and also using a 7-point Likert scale with 7 being "excellent technique" by a rater blinded to subject randomization. After initial testing, the didactic group was offered simulation-based training and retesting. Both groups also took a pre- and posttraining test of knowledge and rated their comfort with US and CVC insertion pre- and posttraining on a 5-point Likert scale. Subsequently, 18 experienced residents also took the test of knowledge, rated their comfort level, and were scored while performing aseptic US-guided CVC insertion using a simulator. The simulation combined with didactic group achieved a 167% (95% confidence interval [CI] 133%-167%) incremental increase in yes/no scores and 115% (CI 112%-127%) incremental increase in Likert scale ratings on aseptic technique compared with novices in the didactic group. Compared with experienced residents, simulation combined with didactic trained novices achieved an increase in aseptic scores with a 33.3% (CI 16.7%-50%) increase in yes/no ratings and a 20% (CI 13

  3. Soft-tissue allografts terminally sterilized with an electron beam are biomechanically equivalent to aseptic, nonsterilized tendons.


    Elenes, Egleide Y; Hunter, Shawn A


    Allograft safety is contingent on effective sterilization. However, current sterilization methods have been associated with decreased biomechanical strength and higher failure rates of soft-tissue allografts. In this study, electron beam (e-beam) sterilization was explored as an alternative sterilization method to preserve biomechanical integrity. We hypothesized that e-beam sterilization would not significantly alter the biomechanical properties of tendon allograft compared with aseptic, nonsterilized controls and gamma-irradiated grafts. Separate sets of forty fresh-frozen tibialis tendon allografts (four from each of ten donors) and forty bisected bone-patellar tendon-bone (BTB) allografts (four from each of ten donors) were randomly assigned to four study groups. One group received a 17.1 to 21.0-kGy gamma radiation dose; two other groups were sterilized with an e-beam at either a high (17.1 to 21.0-kGy) or low (9.2 to 12.2-kGy) dose. A fourth group served as nonsterilized controls. Each graft was cyclically loaded to 200 N of tension for 2000 cycles at a frequency of 2 Hz, allowed to relax for five minutes, and then tested in tension until failure at a 100%/sec strain rate. One-way analysis of variance testing was used to identify significant differences. Tibialis tendons sterilized with both e-beam treatments and with gamma irradiation exhibited values for cyclic tendon elongation, maximum load, maximum displacement, stiffness, maximum stress, maximum strain, and elastic modulus that were not significantly different from those of nonsterilized controls. BTB allografts sterilized with the high e-beam dose and with gamma irradiation were not significantly different in cyclic tendon elongation, maximum load, maximum displacement, stiffness, maximum stress, maximum strain, and elastic modulus from nonsterilized controls. BTB allografts sterilized with the e-beam at the lower dose were significantly less stiff than nonsterilized controls (p = 0.014) but did not

  4. Survivorship analysis of failure pattern after revision total hip arthroplasty.


    Retpen, J B; Varmarken, J E; Jensen, J S


    Failure, defined as established indication for or performed re-revision of one or both components, was analyzed using survivorship methods in 306 revision total hip arthroplasties. The longevity of revision total hip arthroplasties was inferior to that of previously reported primary total hip arthroplasties. The overall survival curve was two-phased, with a late failure period associated with aseptic loosening of one or both components and an early failure period associated with causes of failure other than loosening. Separate survival curves for aseptic loosening of femoral and acetabular components showed late and almost simultaneous decline, but with a tendency toward a higher rate of failure for the femoral component. No differences in survival could be found between the Stanmore, Lubinus standard, and Lubinus long-stemmed femoral components. A short interval between the index operation and the revision and intraoperative and postoperative complications were risk factors for early failure. Young age was a risk factor for aseptic loosening of the femoral component. Intraoperative fracture of the femoral shaft was not a risk factor for secondary loosening. No difference in survival was found between primary cemented total arthroplasty and primary noncemented hemiarthroplasty.

  5. Invited Commentary: Continuing to Loosen the Constraints on Epidemiology in an Age of Change-A Comment on McMichael's "Prisoners of the Proximate".


    Galea, Sandro


    Published in 1999, McMichael's "Prisoners of the Proximate: Loosening the Constraints on Epidemiology in an Age of Change" (Am J Epidemiol. 1999;149(10):887-897) outlined an exciting vision for epidemiology as the field that that can help us better understand the drivers of population health so that we may intervene, paving the way for healthier populations. McMichael's paper remains today what it was when it was first published: clear, thoughtful, provocative, and usefully prescriptive in its call to action. McMichael identified 4 constraints facing epidemiology. The field has risen to this challenge and addressed some of these constraints. I discuss how successful (or not) we have been in addressing each of these 4 challenges. © The Author 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail:

  6. Prognostic factors for bacterial cultures positive for Propionibacterium acnes and other organisms in a large series of revision shoulder arthroplasties performed for stiffness, pain, or loosening.


    Pottinger, Paul; Butler-Wu, Susan; Neradilek, Moni Blazej; Merritt, Andrew; Bertelsen, Alexander; Jette, Jocelyn L; Warme, Winston J; Matsen, Frederick A


    Propionibacterium acnes has been grown on culture in half of the reported cases of chronic infection associated with shoulder arthroplasty. The presence of this organism can be overlooked because its subtle presentation may not suggest the need for culture or because, in contrast to many orthopaedic infections, multiple tissue samples and weeks of culture incubation are often necessary to recover this organism. Surgical decisions regarding implant revision and antibiotic therapy must be made before the results of intraoperative cultures are known. In the present study, we sought clinically relevant prognostic evidence that could help to guide treatment decisions. We statistically correlated preoperative and intraoperative observations on 193 shoulder arthroplasty revisions that were performed because of pain, loosening, or stiffness with the results of a Propionibacterium acnes-specific culture protocol. Regression models were used to identify factors predictive of a positive culture for Propionibacterium acnes. One hundred and eight of the 193 revision arthroplasties were associated with positive cultures; 70% of the positive cultures demonstrated growth of Propionibacterium acnes. The rate of positive cultures per shoulder increased with the number of culture specimens obtained from each shoulder. Fifty-five percent of the positive cultures required observation for more than one week. Male sex, humeral osteolysis, and cloudy fluid were each associated with significant increases of ≥ 600% in the likelihood of obtaining a positive Propionibacterium acnes culture. Humeral loosening, glenoid wear, and membrane formation were associated with significant increases of >300% in the likelihood of obtaining a positive Propionibacterium acnes culture. Preoperative and intraoperative factors can be used to help to predict the risk of a positive culture for Propionibacterium acnes. This evidence is clinically relevant to decisions regarding prosthesis removal or retention

  7. Canine serum C-reactive protein as a quantitative marker of the inflammatory stimulus of aseptic elective soft tissue surgery.


    Kjelgaard-Hansen, Mads; Strom, Henriette; Mikkelsen, Lars F; Eriksen, Thomas; Jensen, Asger L; Luntang-Jensen, Michael


    C-reactive protein (CRP) is an established serum marker for the presence of systemic inflammation in dogs. Results from previous experimental and clinical studies suggest that CRP concentrations also quantitatively reflect the degree and progress of an inflammatory process, suggesting its use for inflammation monitoring. The objective was to investigate whether the canine CRP response in serum correlates with the amount of trauma and the consequent inflammatory response after 3 standard aseptic soft-tissue surgical procedures in 3 groups of dogs. A total of 24 client-owned intact female dogs of various breeds were enrolled in a clinical study with random allocation into 2 surgical groups, for either conventional, open-approach ovariohysterectomy (OVH; n = 14) or laparoscopic assisted OVH (n = 10). In addition, a group of 8 male Beagles from a laboratory animal facility underwent vasectomy, serving as the third and mildest surgical trauma group. Serum CRP was measured pre- and at 4, 8, 12, 23, and 27 hours postsurgery. Cumulative concentration over time and point concentrations of CRP were correlated with the surgical trauma impact level. There was a significant surgery trauma-related difference in cumulative CRP concentrations among the 3 groups, and also in the 12 hours postsurgery concentration. The CRP response varied according to the degree of surgical trauma on 3 standardized levels, thus supporting the use of canine serum concentrations of CRP as an inflammatory activity indicator and monitoring marker. © 2013 American Society for Veterinary Clinical Pathology.

  8. Aseptic cure of pulmonary paracoccidioidomycosis can be achieved after a previous subcutaneous immunization of susceptible but not resistant mice.


    Arruda, Celina; Vaz, Celidéia A C; Calich, Vera L G


    The murine model of paracoccidioidomycosis, the most important South American endemic mycosis, mimics the human disease: resistance is associated with preserved cellular immunity while T-cell anergy is related with susceptibility. In the present study we asked whether a previous s.c. infection which induces strong cellular immunity would protect mice against a lethal pulmonary challenge. It was found that susceptible but not resistant mice developed immunoprotection and aseptic cure of infection. Immunoprotection led to reversal of DTH anergy, increased levels of antibodies and pulmonary IL-12, IL-2 and IL-4 indicating a balanced type 1/type 2 response. On the contrary, no marked differences in A/Sn infection and immunity were observed. Depletion experiments showed that immunoprotection required the cooperative action of CD4(+) and CD8(+) T cells in association with IFN-gamma and IL-12. Altogether, these observations demonstrated that susceptible hosts can develop sterilizing immunity and defined the main immunological requirements to control secondary paracoccidioidomycosis.

  9. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.


    Haydary, J; Susa, D; Dudáš, J


    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. The unsuspected prosthetic joint infection : incidence and consequences of positive intra-operative cultures in presumed aseptic knee and hip revisions.


    Jacobs, A M E; Bénard, M; Meis, J F; van Hellemondt, G; Goosen, J H M


    Positive cultures are not uncommon in cases of revision total knee and hip arthroplasty (TKA and THA) for presumed aseptic causes. The purpose of this study was to assess the incidence of positive intra-operative cultures in presumed aseptic revision of TKA and THA, and to determine whether the presence of intra-operative positive cultures results in inferior survival in such cases. A retrospective cohort study was assembled with 679 patients undergoing revision knee (340 cases) or hip arthroplasty (339 cases) for presumed aseptic causes. For all patients three or more separate intra-operative cultures were obtained. Patients were diagnosed with a previously unsuspected prosthetic joint infection (PJI) if two or more cultures were positive with the same organism. Records were reviewed for demographic details, pre-operative laboratory results and culture results. The primary outcome measure was infection-free implant survival at two years. The incidence of unsuspected PJI was 27 out of 340 (7.9%) in TKA and 41 out of 339 (12.1%) in THA. Following revision TKA, the rate of infection-free implant survival in patients with an unsuspected PJI was 88% (95% confidence intervals (CI) 60 to 97) at two years compared with 98% (95% CI 94 to 99) in patients without PJI (p = 0.001). After THA, the rate of survival was similar in those with unsuspected PJI (92% (95% CI 73 to 98) at two years) and those without (94% (95% CI 89 to 97), p = 0.31). Following revision of TKA and THA for aseptic diagnoses, around 10% of cases were found to have positive cultures. In the knee, such cases had inferior infection-free survival at two years compared with those with negative cultures; there was no difference between the groups following THA. Cite this article: Bone Joint J 2017;99-B:1482-9. ©2017 The British Editorial Society of Bone & Joint Surgery.

  11. No demonstrable association between the Leningrad-Zagreb mumps vaccine strain and aseptic meningitis in a large clinical trial in Egypt.


    Sharma, H J; Oun, S Aly; Bakr, S S Abou; Kapre, S V; Jadhav, S S; Dhere, R M; Bhardwaj, S


    To address the claim that the Leningrad-Zagreb (L-Z) mumps vaccine strain is causally associated with aseptic meningitis, a prospective, post-marketing safety study was conducted with a measles-mumps-rubella vaccine (MMR) (TRESIVAC(R); Serum Institute of India Ltd., Pune, India), which uses the L-Z strain as its mumps component in Egypt. In all, 453 119 children (65 423 children aged 16-24 months and 329 211 children aged 5-7 years) received MMR. The control groups which, as a result of local health regulations, were slightly younger than vaccinees, comprised 12 253 and 46 232 children, respectively. Using questionnaires, the parents recorded solicited local, systemic and neurological adverse events for up to 42 days post-vaccination. All data were analysed externally on an intention-to-treat basis by individuals not participating in the study. Local and/or systemic reactions were reported in a small percentage of participants, with pain, fever and parotitis being the most common signs among vaccinees in both age groups. No case of aseptic meningitis, encephalitis, anaphylaxis or convulsions was observed in any participant. Thus, in this series of more than 450 000 Egyptian children, the L-Z mumps vaccine strain in this vaccine did not cause aseptic meningitis. The vaccine is considerably cheaper than Western competitors and a valid alternative to other MMR vaccines.

  12. A comparative study of the incidence of aseptic meningitis in symptomatic natural mumps patients and monovalent mumps vaccine recipients in Japan.


    Nagai, Takao; Okafuji, Teruo; Miyazaki, Chiaki; Ito, Yuhei; Kamada, Makoto; Kumagai, Takuji; Yuri, Kenji; Sakiyama, Hiroshi; Miyata, Akiko; Ihara, Toshiaki; Ochiai, Hitoshi; Shimomura, Kunihisa; Suzuki, Eitaro; Torigoe, Sadayoshi; Igarashi, Masahiro; Kase, Tetsuo; Okuno, Yoshinobu; Nakayama, Tetsuo


    To compare the incidence of aseptic meningitis associated with symptomatic natural mumps infection and in mumps vaccine recipients, we conducted a prospective comparative study. Consecutive samples of 1051 children with mumps were enrolled by 10 pediatricians and 21,465 vaccine recipients by 143 pediatric primary care practitioners, from January 1, 2000 to January 1, 2003. Parents used a daily diary to record symptoms during the period of illness (15 days) or 30-day period following immunization. Mumps infection was confirmed by virus isolation and/or detection of mumps virus genome in salivary and CSF samples. The incidence of aseptic meningitis was 13/1051 (1.24%) in patients with symptomatic natural mumps infection and was estimated to be 0.7-1.1% of overall infection in considering asymptomatic infection, and 10/21,465 (0.05%) in vaccine recipients. Although aseptic meningitis is a clear side effect of the mumps vaccine, the incidence is considerably lower than among those with symptomatic natural infection. Our results provide an informative data for consideration to resume mumps vaccine as a part of routine immunization schedule for Japanese children.

  13. [Clinical, epidemiological, and etiological studies of adult aseptic meningitis: a report of 12 cases of herpes simplex meningitis, and a comparison with cases of herpes simplex encephalitis].


    Himeno, Takahiro; Shiga, Yuji; Takeshima, Shinichi; Tachiyama, Keisuke; Kamimura, Teppei; Kono, Ryuhei; Takemaru, Makoto; Takeshita, Jun; Shimoe, Yutaka; Kuriyama, Masaru


    We treated 437 cases of adult aseptic meningitis and 12 cases (including 2 recurrent patients; age, 31.8 ± 8.9 years; 7 females) of herpes simplex meningitis from 2004 to 2016. The incidence rate of adult herpes simplex meningitis in the cases with aseptic meningitis was 2.7%. One patient was admitted during treatment of genital herpes, but no association was observed between genital herpes and herpes simplex meningitis in the other cases. The diagnoses were confirmed in all cases as the cerebrospinal fluid (CSF) was positive for herpes simplex virus (HSV)-DNA. For diagnosis confirmation, the DNA test was useful after 2-7 days following initial disease onset. Among other types of aseptic meningitis, the patients with herpes simplex meningitis showed relatively high white blood cell counts and relatively high CSF protein and high CSF cell counts. CSF cells showed mononuclear cell dominance from the initial stage of the disease. During same period, we also experienced 12 cases of herpes simplex encephalitis and 21 cases of non-hepatic acute limbic encephalitis. Notably, the patients with herpes simplex meningitis were younger and their CSF protein and cells counts were higher than those of the patients with herpes simplex encephalitis.

  14. Molecular diagnosis of echovirus 30 as the etiological agent in an outbreak of aseptic meningitis in Panama: May-June 2008.


    Martinez, Alexander A; Castillo, Juan; Sanchez, Mirla C; Zaldivar, Yamitzel; Mendoza, Yaxelis; Tribaldos, Maribel; Acosta, Pablo; Smith, Rebecca E; Pascale, Juan Miguel


    Aseptic meningitis outbreaks are commonly caused by viral pathogens with enterovirus a common etiological agent. Between May and June of 2008, an outbreak of 173 cases of aseptic meningitis occurred in the Chiriqui Province of Panama. Molecular techniques were used to identify the etiological agent. Cerebrospinal fluid (CSF) samples from 75 patients were received at the Gorgas Memorial Institute for Health Studies.  RNA extraction and one-step RT-PCR were performed on each sample to determine the presence of enterovirus.  Thirty-four samples which were positive for enterovirus were subject to group-specific PCR, sequencing, and phylogenetic analysis to identify the etiological agent of the outbreak. The CSF of 58 subjects was found positive for the enterovirus family using RT-PCR. Thirty-four samples were found to belong to the enterovirus B group. Phylogenetic analysis of four successfully sequenced samples revealed echovirus 30 as the etiological agent. Echovirus 30 is reported as the likely cause of an outbreak of aseptic meningitis in Panama, the first since the 1980s.

  15. Herpes simplex virus type 2-associated recurrent aseptic meningitis (Mollaret's meningitis) with a recurrence after 11-year interval: a case report.


    Nakamura, Yoshitsugu; Nakajima, Hideto; Kano, Yosuke; Unoda, Kiichi; Ishida, Shimon; Kimura, Fumiharu


    A 55-year-old woman was diagnosed with aseptic meningitis at the age of 43 and 44. She developed sudden fever and headache, and she showed nuchal rigidity. Cerebrospinal fluid examination revealed pleocytosis (cell count 208/mm 3 ) and was positive for herpes simplex virus type 2 (HSV-2) DNA by PCR. Acyclovir was started on the first day of admission, and she was complete recovery. Preserved cerebrospinal fluid specimen from aseptic meningitis at the age of 44 was also positive for HSV-2 DNA by PCR. She was diagnosed with HSV-2 associated recurrent aseptic meningitis (Mollaret's meningitis) with a recurrence after 11-year interval. She repeatedly relapsed genital herpes after 44 years old and she was treated with valacyclovir whenever genital herpes relapses. But she showed no genital herpes at the onset of meningitis. Because HSV-2 is one of the most significant causes of recurrent meningitis, we would like to stress that HSV-2 infection and antiviral therapy should always be kept in mind for a recurrent meningitis case.

  16. Particle Disease: A Current Review of the Biological Mechanisms in Periprosthetic Osteolysis After Hip Arthroplasty

    PubMed Central

    Sukur, Erhan; Akman, Yunus Emre; Ozturkmen, Yusuf; Kucukdurmaz, Fatih


    Background: Inflammatory responses to wear debris cause osteolysis that leads to aseptic prosthesis loosening and hip arthroplasty failure. Although osteolysis is usually associated with aseptic loosening, it is rarely seen around stable implants. Aseptic implant loosening is a simple radiologic phenomenon, but a complex immunological process. Particulate debris produced by implants most commonly causes osteolysis, and this is called particle-associated periprosthetic osteolysis (PPO). Objective: The objective of this review is to outline the features of particle-associated periprosthetic osteolysis to allow the physician to recognise this condition and commence early treatment, thereby optimizing patient outcome. Methods: A thorough literature search was performed using available databases, including Pubmed, to cover important research published covering particle-associated PPO. Results: Although osteolysis causes bone resorption, clinical, animal, and in vitro studies of particle bioreactivity suggest that particle-associated PPO represents the culmination of several biological reactions of many cell types, rather than being caused solely by the osteoclasts. The biological activity is highly dependent on the characteristics and quantity of the wear particles. Conclusion: Despite advances in total hip arthroplasty (THA), particle-associated PPO and aseptic loosening continue to be major factors that affect prosthetic joint longevity. Biomarkers could be exploited as easy and objective diagnostic and prognostic targets that would enable testing for osteolysis after THA. Further research is needed to identify new biomarkers in PPO. A comprehensive understanding of the underlying biological mechanisms is crucial for developing new therapeutic interventions to reverse or suppress biological responses to wear particles. PMID:27499822

  17. Influence of the antiseptic agents polyhexanide and octenidine on FL cells and on healing of experimental superficial aseptic wounds in piglets. A double-blind, randomised, stratified, controlled, parallel-group study.


    Kramer, A; Roth, B; Müller, G; Rudolph, P; Klöcker, N


    The main target of the combination of octenidine with phenoxyethanol (Octenisept) is the antisepsis of acute wounds, whereas polyhexanide combined with polyethylene glycol in Ringer solution (Lavasept) is the agent of choice for antisepsis of chronic wounds and burns. Because comparative data for both agents on the effects on wound healing are lacking, we investigated the influence of preparations based on polyhexanide and octenidine versus placebo (Ringer solution) in experimental superficial aseptic skin wounds (n = 108) of 20 mm diameter, using a double-blind, randomised, stratified, controlled, parallel-group design in piglets. Computerised planimetry and histopathological methods were used for the assessment of wound healing. Histologically, no significant differences could be verified at any time between the 3 groups. However, in the early phase (day 9 after wounding), the octenidine-based product retarded wound contraction to a significantly greater extent than placebo and polyhexanide, whereas in the later phase (days 18 and 28), polyhexanide promoted contraction significantly more than did placebo and octenidine. The consequence is complete wound closure after 22.9 days using polyhexanide, in comparison to the placebo after 24.1 days (p < 0.05) and octenidine after 28.3 days (no statistical difference to placebo). This may be explained by the better tolerance of polyhexanide in vitro, which was demonstrated with dose and time dependence in cytotoxicity tests on human amnion cells. Copyright 2004 S. Karger AG, Basel

  18. The EmulSiv filter removes microbial contamination from propofol but is not a substitute for aseptic technique.


    Hall, Wendy C E; Jolly, Donald T; Hrazdil, Jiri; Galbraith, John C; Greacen, Maria; Clanachan, Alexander S


    To evaluate the ability of the EmulSiv filter (EF) to remove extrinsic microbial contaminants from propofol. Aliquots of Staphylococcus aureus (S. aureus), Candida albicans (C. albicans), Klebsiella pneumoniae (K. pneumoniae), Moraxella osloensis (M. osloensis), Enterobacter agglomerans (E. agglomerans), Escherichia coli (E. coli), Serratia marcescens (S. marcescens), Moraxella catarrhalis (M. catarrhalis), Haemophilus influenzae (H. influenzae) and Campylobacter jejuni (C. jejuni) were inoculated into vials containing 20 mL of sterile propofol. The unfiltered inoculated propofol solutions served as controls. Ten millilitres and 20 mL samples of the inoculated propofol were filtered through the EF. All solutions were then subplated onto three culture plates using a precision 1 micro L calibrated platinum loop and incubated. The number of colony forming units (CFU) were counted. Data were analyzed using a one-sample t test, and a P value of less than 0.05 was selected as the level of statistical significance. The EF was able to completely remove CFU of S. aureus, C. albicans, K. pneumoniae, M. osloensis, E. agglomerans, E. coli, S. marcescens, and M. catarrhalis (P < 0.05). A small number of H. influenzae CFU were able to evade filtration in both the 10 mL and 20 mL samples. C. jejuni CFU were able to evade filtration in only the 10 mL sample. The EF removes the majority of microbial contaminates from propofol with the exception of H. influenzae and C. jejuni. Although the EF is capable of removing most of the microbial contamination produced by H. influenzae and C. jejuni, a few CFU are capable of evading filtration. Consequently, even the use of a filter capable of removing microbial contaminants is not a substitute for meticulous aseptic technique and prompt administration when propofol is used.

  19. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.


    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie


    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  20. Syphilitic aseptic meningitis


    ... R, Blaser MJ, eds. Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, Updated Edition . 8th ... R, Blaser MJ, eds. Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, Updated Edition . 8th ...

  1. Optimizing and developing a continuous separation system for the wet process separation of aluminum and polyethylene in aseptic composite packaging waste.


    Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi


    The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Comparative study suggests that human bone morphogenetic proteins have no influence on the outcome of operative treatment of aseptic clavicle non-unions.


    von Rüden, Christian; Morgenstern, Mario; Friederichs, Jan; Augat, Peter; Hackl, Simon; Woltmann, Alexander; Bühren, Volker; Hierholzer, Christian


    The purpose of this study was to evaluate the clinical and radiological outcome following compression plate fixation in combination with autologous bone grafting, with and without additional application of recombinant human bone morphogenetic protein (rhBMP) for treatment of aseptic clavicle non-union. Between April 2004 and April 2015, 82 patients were treated for clavicle fracture and had developed aseptic clavicle non-union. Seventy-three out of 82 patients were available for follow-up at least one year after revision surgery; among them, 27 women and 46 men, with a median age of 49 (range, 19-86) years. Forty-five patients received compression plate osteosynthesis with autologous bone grafting, and 28 patients obtained compression plate fixation with autologous bone grafting and additional application of rhBMP-2 (3/28 patients) or rhBMP-7 (25/28 patients). Seventy out of 73 non-unions (96 %) healed within 12 months after revision surgery. Functional outcome according to the DASH Outcome Measure (with rhBMP, 33.16 ± 1.17 points; without rhBMP, 30.58 ± 2.12 points [mean ± SEM]; p = 0.81), non-union healing (p = 0.86), time interval between revision surgery and bone healing (p = 0.37), as well as post-operative complications, did not demonstrate relevant differences between the treatment groups and were not age-dependent. Functional and radiological results demonstrate that successful healing of aseptic clavicle non-union is dependent on radical resection of non-union tissue, restoration of length of the shoulder girdle and application of stable locking-plate osteosynthesis in combination with autologous bone grafting, but not dependent on application of additional rhBMP.

  3. Experiences of Indian Health Workers Using WhatsApp for Improving Aseptic Practices With Newborns: Exploratory Qualitative Study.


    Pahwa, Parika; Lunsford, Sarah; Livesley, Nigel


    Quality improvement (QI) involves the following 4 steps: (1) forming a team to work on a specific aim, (2) analyzing the reasons for current underperformance, (3) developing changes that could improve care and testing these changes using plan-do-study-act cycles (PDSA), and (4) implementing successful interventions to sustain improvements. Teamwork and group discussion are key for effective QI, but convening in-person meetings with all staff can be challenging due to workload and shift changes. Mobile technologies can support communication within a team when face-to-face meetings are not possible. WhatsApp, a mobile messaging platform, was implemented as a communication tool by a neonatal intensive care unit (NICU) team in an Indian tertiary hospital seeking to reduce nosocomial infections in newborns. This exploratory qualitative study aimed to examine experiences with WhatsApp as a communication tool among improvement team members and an external coach to improve adherence to aseptic protocols. Ten QI team members and the external coach were interviewed on communication processes and approaches and thematically analyzed. The WhatsApp transcript for the implementation period was also included in the analysis. WhatsApp was effective for disseminating information, including guidance on QI and clinical practice, and data on performance indicators. It was not effective as a platform for group discussion to generate change ideas or analyze the performance indicator data. The decision of who to include in the WhatsApp group and how members engaged in the group may have reinforced existing hierarchies. Using WhatsApp created a work environment in which members were accessible all the time, breaking down barriers between personal and professional time. The continual influx of messages was distracting to some respondents, and how respondents managed these messages (eg, using the silent function) may have influenced their perceptions of WhatsApp. The coach used WhatsApp to

  4. Experiences of Indian Health Workers Using WhatsApp for Improving Aseptic Practices With Newborns: Exploratory Qualitative Study

    PubMed Central

    Livesley, Nigel


    Background Quality improvement (QI) involves the following 4 steps: (1) forming a team to work on a specific aim, (2) analyzing the reasons for current underperformance, (3) developing changes that could improve care and testing these changes using plan-do-study-act cycles (PDSA), and (4) implementing successful interventions to sustain improvements. Teamwork and group discussion are key for effective QI, but convening in-person meetings with all staff can be challenging due to workload and shift changes. Mobile technologies can support communication within a team when face-to-face meetings are not possible. WhatsApp, a mobile messaging platform, was implemented as a communication tool by a neonatal intensive care unit (NICU) team in an Indian tertiary hospital seeking to reduce nosocomial infections in newborns. Objective This exploratory qualitative study aimed to examine experiences with WhatsApp as a communication tool among improvement team members and an external coach to improve adherence to aseptic protocols. Methods Ten QI team members and the external coach were interviewed on communication processes and approaches and thematically analyzed. The WhatsApp transcript for the implementation period was also included in the analysis. Results WhatsApp was effective for disseminating information, including guidance on QI and clinical practice, and data on performance indicators. It was not effective as a platform for group discussion to generate change ideas or analyze the performance indicator data. The decision of who to include in the WhatsApp group and how members engaged in the group may have reinforced existing hierarchies. Using WhatsApp created a work environment in which members were accessible all the time, breaking down barriers between personal and professional time. The continual influx of messages was distracting to some respondents, and how respondents managed these messages (eg, using the silent function) may have influenced their perceptions of

  5. Adjacent-Level Hypermobility and Instrumented-Level Fatigue Loosening With Titanium and PEEK Rods for a Pedicle Screw System: An In Vitro Study.


    Agarwal, Aakas; Ingels, Marcel; Kodigudla, Manoj; Momeni, Narjes; Goel, Vijay; Agarwal, Anand K


    Adjacent-level disease is a common iatrogenic complication seen among patients undergoing spinal fusion for low back pain. This is attributed to the postsurgical differences in stiffness between the spinal levels, which result in abnormal forces, stress shielding, and hypermobility at the adjacent levels. In addition, as most patients undergoing these surgeries are osteoporotic, screw loosening at the index level is a complication that commonly accompanies adjacent-level disease. Recent studies indicate that a rod with lower rigidity than that of titanium may help to overcome these detrimental effects at the adjacent level. The present study was conducted in vitro using 12 L1-S1 specimens divided into groups of six, with each group instrumented with either titanium rods or PEEK (polyetheretherketone) rods. The test protocol included subjecting intact specimens to pure moments of 10 Nm in extension and flexion using an FS20 Biomechanical Spine Test System (Applied Test Systems) followed by hybrid moments on the instrumented specimens to achieve the same L1-S1 motion as that of the intact specimens. During the protocol's later phase, the L4-L5 units from each specimen were segmented for cyclic loading followed by postfatigue kinematic analysis to highlight the differences in motion pre- and postfatigue. The objectives included the in vitro comparison of (1) the adjacent-level motion before and after instrumentation with PEEK and titanium rods and (2) the pre- and postfatigue motion at the instrumented level with PEEK and titanium rods. The results showed that the adjacent levels above the instrumentation caused increased flexion and extension with both PEEK and titanium rods. The postfatigue kinematic data showed that the motion at the instrumented level (L4-L5) increased significantly in both flexion and extension compared to prefatigue motion in titanium groups. However, there was no significant difference in motion between the pre- and postfatigue data in the PEEK

  6. The risk of aseptic meningitis associated with the Leningrad-Zagreb mumps vaccine strain following mass vaccination with measles-mumps-rubella vaccine, Rio Grande do Sul, Brazil, 1997.


    da Silveira, Claudio Marcos; Kmetzsch, Claudete Iris; Mohrdieck, Renate; Sperb, Alethea Fagundes; Prevots, D Rebecca


    Few data are available on the risk of aseptic meningitis following vaccination with the Leningrad-Zagreb (L-Z) strain of mumps vaccine. In 1997 the mumps vaccine was introduced into the state of Rio Grande do Sul in Brazil through mass vaccination with mumps-measles-rubella (MMR), targeting children aged 1-11 years. Five municipalities used exclusively MMR vaccine containing the L-Z strain of mumps. An outbreak of aseptic meningitis was observed shortly after the mass campaign. To estimate the risk of aseptic meningitis associated with this strain, we analysed vaccination and meningitis case surveillance data from the selected municipalities. A case of vaccine-associated aseptic meningitis was defined as one with a pleocytosis of 10-1,500 leukocytes/ml and occurring within 15-35 days after vaccine receipt. We estimated a risk of 2.9 cases per 10,000 doses of L-Z administered, equivalent to 1 case per 3,390 doses administered. The overall risk of aseptic meningitis following the campaign was increased 12.2-fold (95% CI: 6.0-24.7) compared with the same period in 1995-1996. Following the mass campaign, the incidence of mumps declined 93% during 1998-2000. Vaccination with the L-Z strain of mumps vaccine as part of a mass campaign was associated with a significantly increased risk of aseptic meningitis. Decisions about type of mumps vaccine and mumps vaccination strategies must consider vaccine safety issues in addition to other criteria.

  7. Iterative co-creation for improved hand hygiene and aseptic techniques in the operating room: experiences from the safe hands study.


    Erichsen Andersson, Annette; Frödin, Maria; Dellenborg, Lisen; Wallin, Lars; Hök, Jesper; Gillespie, Brigid M; Wikström, Ewa


    Hand hygiene and aseptic techniques are essential preventives in combating hospital-acquired infections. However, implementation of these strategies in the operating room remains suboptimal. There is a paucity of intervention studies providing detailed information on effective methods for change. This study aimed to evaluate the process of implementing a theory-driven knowledge translation program for improved use of hand hygiene and aseptic techniques in the operating room. The study was set in an operating department of a university hospital. The intervention was underpinned by theories on organizational learning, culture and person centeredness. Qualitative process data were collected via participant observations and analyzed using a thematic approach. Doubts that hand-hygiene practices are effective in preventing hospital acquired infections, strong boundaries and distrust between professional groups and a lack of psychological safety were identified as barriers towards change. Facilitated interprofessional dialogue and learning in "safe spaces" worked as mechanisms for motivation and engagement. Allowing for the free expression of different opinions, doubts and viewing resistance as a natural part of any change was effective in engaging all professional categories in co-creation of clinical relevant solutions to improve hand hygiene. Enabling nurses and physicians to think and talk differently about hospital acquired infections and hand hygiene requires a shift from the concept of one-way directed compliance towards change and learning as the result of a participatory and meaning-making process. The present study is a part of the Safe Hands project, and is registered with (ID: NCT02983136 ). Date of registration 2016/11/28, retrospectively registered.

  8. Dietary phytosterols modulate T-helper immune response but do not induce apparent anti-inflammatory effects in a mouse model of acute, aseptic inflammation.


    Calpe-Berdiel, Laura; Escolà-Gil, Joan Carles; Benítez, Sonia; Bancells, Cristina; González-Sastre, Francesc; Palomer, Xavier; Blanco-Vaca, Francisco


    Although most studies have focused on the cholesterol-lowering activity of phytosterols, other biological actions have been ascribed to these plant sterol compounds, one of which is a potential immune modulatory effect. To gain insight into this issue, we used a mouse model of acute, aseptic inflammation induced by a single subcutaneous turpentine injection. Hypercholesterolemic apolipoprotein E-deficient (apoE(-/-)) mice, fed with or without a 2% phytosterol supplement, were treated with turpentine or saline and euthanized 48 h later. No differences were observed in spleen lymphocyte subsets between phytosterol- and control-fed apoE(-/-) mice. However, cultured spleen lymphocytes of apoE(-/-) mice fed with phytosterols and treated with turpentine showed increased IL-2 and IFN-gamma secretion (T-helper type1, Th1 lymphocyte cytokines) compared with turpentine-treated, control-fed animals. In contrast, there was no change in Th2 cytokines IL-4 and IL-10. Phytosterols also inhibit intestinal cholesterol absorption in wild-type C57BL/6J mice but, in this case, without decreasing plasma cholesterol. Spleen lymphocytes of turpentine-treated C57BL/6J mice fed with phytosterols also showed increased IL-2 production, but IFN-gamma, IL-4 and IL-10 production was unchanged. The Th1/Th2 ratio was significantly increased both in phytosterol-fed apoE(-/-) and C57BL/6J mice. We conclude that phytosterols modulate the T-helper immune response in vivo, in part independently of their hypocholesterolemic effect in a setting of acute, aseptic inflammation. Further study of phytosterol effects on immune-based diseases characterized by an exacerbated Th2 response is thus of interest.

  9. Why Do Medial Unicompartmental Knee Arthroplasties Fail Today?


    van der List, Jelle P; Zuiderbaan, Hendrik A; Pearle, Andrew D


    Failure rates are higher in medial unicompartmental knee arthroplasty (UKA) than total knee arthroplasty. To improve these failure rates, it is important to understand why medial UKA fail. Because individual studies lack power to show failure modes, a systematic review was performed to assess medial UKA failure modes. Furthermore, we compared cohort studies with registry-based studies, early with midterm and late failures and fixed-bearing with mobile-bearing implants. Databases of PubMed, EMBASE, and Cochrane and annual registries were searched for medial UKA failures. Studies were included when they reported >25 failures or when they reported early (<5 years), midterm (5-10 years), or late failures (>10 years). Thirty-seven cohort studies (4 level II studies and 33 level III studies) and 2 registry-based studies were included. A total of 3967 overall failures, 388 time-dependent failures, and 1305 implant design failures were identified. Aseptic loosening (36%) and osteoarthritis (OA) progression (20%) were the most common failure modes. Aseptic loosening (26%) was most common early failure mode, whereas OA progression was more commonly seen in midterm and late failures (38% and 40%, respectively). Polyethylene wear (12%) and instability (12%) were more common in fixed-bearing implants, whereas pain (14%) and bearing dislocation (11%) were more common in mobile-bearing implants. This level III systematic review identified aseptic loosening and OA progression as the major failure modes. Aseptic loosening was the main failure mode in early years and mobile-bearing implants, whereas OA progression caused most failures in late years and fixed-bearing implants. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Impact of an aseptic procedure for breaking the integrity of the urinary drainage system on the development of catheter-associated urinary tract infections in the intensive care unit.


    Powers, Jan


    Catheter associated urinary tract infections (CAUTI) are a common complication in the hospital, especially in intensive care units (ICU). These infections are directly linked to the use of an indwelling urinary catheter. One commonly identified factor related to the development of CAUTI has been thought to be violating the integrity of the closed drainage system. However, a paucity of research exists to support or refute this practice. The primary purpose of this observational study was to assess if there is a relationship between CAUTI incidence and breaking the closed drainage system using an aseptic procedure. A process improvement effort was developed to ensure an aseptic technique was utilised when there was a need to break the integrity of the urinary drainage system. Because this was a new practice and not supported by the Centres for Disease Control (CDC) recommendations, this change in practice was evaluated as an observational study. In an eight month period there were 53 documented breaks in the urinary drainage system. There were 28 total cases of CAUTI overall during this same time period. Only four patients with a system break developed a CAUTI (7.5%). In almost 93% of the patients where aseptic technique was used for breaks in the drainage system, there was no occurrence of CAUTI. A follow-up evaluation was performed after a year of this practice in three adult ICUs. During this three month evaluation period, there were 47 documented cases of breaking this system using aseptic technique. Of the patients who had a documented break in their drainage system, none developed subsequent CAUTIs. One commonly identified factor related to the development of CAUTI has been thought to be violating the integrity of the closed drainage system. However, a paucity of research exists to support or refute this practice. This observational study found that utilising an aseptic technique to break the integrity system did not result in an associated increase in CAUTI

  11. Molecular detection and genotyping of enteroviruses from CSF samples of patients with suspected sepsis-like illness and/or aseptic meningitis from 2012 to 2015 in West Bank, Palestine.


    Dumaidi, Kamal; Al-Jawabreh, Amer


    Human enteroviruses (HEVs) are the most frequently reported cause of aseptic meningitis with or without CSF pleocytosis in childhood. Rapid detection and genotype of HEVs is essential to determine the causative agent and variant causing sepsis-like illness and/or aseptic meningitis. To investigate the molecular epidemiology of enteroviruses (EVs) among patients with sepsis-like illness and/or aseptic meningitis admitted to three major hospitals in West Bank, Palestine from 2012 to 2015. During the study period, 356 CSF samples were collected from patients with sepsis-like illness and/or aseptic meningitis. Two RT-nested PCR assays targeting a partial part of 5'UTR for direct diagnosis and the VP1 region for genotyping by sequence analysis of the viral genome were used. HEV RNA was detected in 66 of 356 (18.5%) of CSF samples. Age distribution showed that 64% (42/66) were infants (<1 year), 18% were children between 1 and 5 years old, 12% were children between 5 and 10 years old, and 6% were more than 10 years old. Of the 66 EV cases, 12 were successfully genotyped. Five different EV genotypes were identified. All of them belonged to HEV-B species. The study showed that echovirus 6 genotype accounted for 42% of the sequenced cases. The HEV infections in the present study tended to show slight seasonal pattern with more cases occurring during spring and summer, yet still significant numbers were also reported in fall and winter seasons. HEV was isolated from a significant number of children with sepsis-like illness and/or aseptic meningitis. In addition, the molecular method utilized for direct diagnosis and genotyping of HEV from CSF revealed that more than one HEV type circulated in the West Bank, Palestine during the study period.

  12. Molecular detection and genotyping of enteroviruses from CSF samples of patients with suspected sepsis-like illness and/or aseptic meningitis from 2012 to 2015 in West Bank, Palestine

    PubMed Central

    Dumaidi, Kamal; Al-Jawabreh, Amer


    Background Human enteroviruses (HEVs) are the most frequently reported cause of aseptic meningitis with or without CSF pleocytosis in childhood. Rapid detection and genotype of HEVs is essential to determine the causative agent and variant causing sepsis-like illness and/or aseptic meningitis. Aim To investigate the molecular epidemiology of enteroviruses (EVs) among patients with sepsis-like illness and/or aseptic meningitis admitted to three major hospitals in West Bank, Palestine from 2012 to 2015. Methods During the study period, 356 CSF samples were collected from patients with sepsis-like illness and/or aseptic meningitis. Two RT-nested PCR assays targeting a partial part of 5'UTR for direct diagnosis and the VP1 region for genotyping by sequence analysis of the viral genome were used. Results HEV RNA was detected in 66 of 356 (18.5%) of CSF samples. Age distribution showed that 64% (42/66) were infants (<1 year), 18% were children between 1 and 5 years old, 12% were children between 5 and 10 years old, and 6% were more than 10 years old. Of the 66 EV cases, 12 were successfully genotyped. Five different EV genotypes were identified. All of them belonged to HEV-B species. The study showed that echovirus 6 genotype accounted for 42% of the sequenced cases. The HEV infections in the present study tended to show slight seasonal pattern with more cases occurring during spring and summer, yet still significant numbers were also reported in fall and winter seasons. Conclusion HEV was isolated from a significant number of children with sepsis-like illness and/or aseptic meningitis. In addition, the molecular method utilized for direct diagnosis and genotyping of HEV from CSF revealed that more than one HEV type circulated in the West Bank, Palestine during the study period. PMID:28225788

  13. Early polyethylene wear and osteolysis with ABG acetabular cups (7- to 12-year follow-up)

    PubMed Central

    Livesley, Peter


    We reviewed 81 consecutive ABG I primary total hip replacements implanted in 72 patients between January 1993 and December 1998. The mean follow-up was 8.2 (range 7–12) years. There was significant polyethylene wear and osteolysis associated with the acetabular cup .The cumulative survival of the cup with revision being the end point at 8.2 years was 95.1% (95% CI: 92–97.6%). However, the cumulative survival of the cup with revision and aseptic loosening together was 72% (95% CI: 61–78%) and survival of the acetabular liner for wear was 62% (95% CI: 48–74%). Stem survival with revision being the end point was 100%. In spite of significant radiological failures of the cups, most patients remained asymptomatic. Though results of the ABG stems in this series were good, we advocate a regular follow-up of all these hips in view of the poor outcome of the cups. PMID:16283307

  14. Survival of primary condylar-constrained total knee arthroplasty at a minimum of 7 years.


    Maynard, Lance M; Sauber, Timothy J; Kostopoulos, Vasileios K; Lavigne, Gregory S; Sewecke, Jeffrey J; Sotereanos, Nicholas G


    The purpose of the present study is to retrospectively analyze clinical and radiographic outcomes in primary constrained condylar knee arthroplasty at a minimum follow-up of 7 years. Given the concern for early aseptic loosening in constrained implants, we focused on this outcome. Our cohort consists of 127 constrained condylar knees. The mean age of patients in the study was 68.3 years, with a mean follow-up of 110.7 months. The diagnosis was primary osteoarthritis in 92%. There were four periprosthetic distal femur fractures, with a rate of revision of 0.8%. No implants were revised for aseptic loosening. Kaplan-Meier survivorship analysis with removal of any component as the end point revealed that the 10-year rate of survival of the primary CCK was 97.6% (95% CI, 94%-100%). Copyright © 2014. Published by Elsevier Inc.

  15. Sensory Characteristics and Consumer Acceptance of Frozen Cooked Rice by a Rapid Freezing Process Compared to Homemade and Aseptic Packaged Cooked Rice

    PubMed Central

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong


    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars–IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p<0.05) in IM and SD cultivars. The differences in sensory characteristics between the FCR and ACR were larger than the equivalent differences between the FCR and HCR. Overall consumer acceptance ratings for FCR in overall aspect, appearance, aroma, and texture were not significantly different compared to those for HCR (p>0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  16. Aseptic surgical preparation for upper eyelid blepharoplasty via full-face octenidine antiseptic without antibiotic medication shows effective prophylaxis against post-surgical wound infection.


    Matiasek, Johannes; Kienzl, Philip; Otti, Gerlinde R; Turk, Bela R; Djedovic, Gabriel; Rieger, Ulrich M


    Blepharoplasty is the third most common plastic surgical procedure in the USA. Due to the emergence of multiresistant bacteria, optimising the antiseptic procedure is crucial. Choice of antiseptics plays an important role as they may cause skin irritation and colouring of disinfected areas. In this study, the use of the aqueous antiseptic octenisept ® (octenidine) was evaluated in the outcome of blepharoplasties: incidence of wound dehiscence; haematoma; and infection in correlation with gender, medication, smoking habits and time of year. This retrospective surveillance study included 352 patients (median age 58·3 years). Skin disinfection was performed thrice prior to blepharoplasty. Sutures were removed on day 6. None of the patients suffered from wound infection. The total rate of wound dehiscence was 6·3%, with a higher ratio among male patients. Smokers and patients on anticoagulant medication showed a significantly higher incidence of wound dehiscence. Throughout the year, rates of wound dehiscence were highest in summer. Aseptic surgical preparation for blepharoplasty via full-face scrub with octenisept ® without oral antibiotic prophylaxis is well tolerated, with no report of wound infection, which may improve antibiotic stewardship as well as patient comfort. Elective upper eyelid blepharoplasty may ideally be performed in winter. © 2017 Inc and John Wiley & Sons Ltd.

  17. What features of educational interventions lead to competence in aseptic insertion and maintenance of CV catheters in acute care? BEME Guide No. 15.


    Cherry, M Gemma; Brown, Jeremy M; Neal, Timothy; Ben Shaw, Nigel


    Up to 6000 patients per year in England acquire a central venous catheter (CVC)-related bloodstream infection (Shapey et al. 2008 ). Implementation of Department of Health guidelines through educational interventions has resulted in significant and sustained reductions in CVC-related blood stream infections (Pronovost et al. 2002), and cost (Hu et al. 2004 ). This review aimed to determine the features of structured educational interventions that impact on competence in aseptic insertion technique and maintenance of CV catheters by healthcare workers. We looked at changes in infection control behaviour of healthcare workers, and considered changes in service delivery and the clinical welfare of patients involved, provided they were related directly to the delivery method of the educational intervention. A total of 9968 articles were reviewed, of which 47 articles met the inclusion criteria. Findings suggest implications for practice: First, educational interventions appear to have the most prolonged and profound effect when used in conjunction with audit, feedback, and availability of new clinical supplies consistent with the content of the education provided. Second, educational interventions will have a greater impact if baseline compliance to best practice is low. Third, repeated sessions, fed into daily practice, using practical participation appear to have a small, additional effect on practice change when compared to education alone. Active involvement from healthcare staff, in conjunction with the provision of formal responsibilities and motivation for change, may change healthcare worker practice.

  18. Elucidation of Echovirus 30's Origin and Transmission during the 2012 Aseptic Meningitis Outbreak in Guangdong, China, through Continuing Environmental Surveillance

    PubMed Central

    Lu, Jing; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen


    An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804

  19. Pathogenesis of coxsackievirus B2 in mice: characterization of clinical isolates of the coxsackievirus B2 from patients with myocarditis and aseptic meningitis in Korea.


    Hong, Jiyoung; Kang, Bunghak; Yeo, Sanggu; Jee, Youngmee; Park, Jae-Hak


    Group B coxsackieviruses (CVBs) are a group of common human pathogens producing various clinical symptoms. Although the virology of CVB is well known, there is limited information on viral pathogenesis and the relationship between clinical symptoms and viral phenotype, particularly for CVB type 2 (CVB2). In 2004 in Korea, two CVB2 strains were isolated: CB2/04/279 from stool of an acute myocarditis patient with heart failure and CB2/04/243 from an aseptic meningitis patient. In this study, a high degree of homology was observed between the CB2/04/279 and CB2/04/243 full genome sequences. The two Korean CVB2 isolates had 93.1% homology compared to 82.1%-82.5% nucleotide sequence identity with the cardiovirulence-associated reference CVB strain Ohio-1 (CVB/O). CVB2-induced pathogenesis was analyzed, focusing on virus-induced pathology of various tissues in 4-week-old BALB/c inbred male mice. Myocarditis developed and extensive pancreatic inflammation was observed in all mice infected with CB2/04/279 or CVB/O, but not in animals infected with CB2/04/243. This is the first report of the full-genomic sequence and pathogenesis of the CVB2 strain isolated from an acute myocarditis patient in Korea.

  20. High diagnostic yield by CSF-PCR for entero- and herpes simplex viruses and TBEV serology in adults with acute aseptic meningitis in Stockholm.


    Franzen-Rohl, Elisabeth; Larsson, Kenny; Skoog, Eva; Tiveljung-Lindell, Annika; Grillner, Lena; Aurelius, Elisabeth; Glimåker, Martin


    Acute aseptic meningitis (AAM) affects 10-20/100,000 inhabitants per years in Sweden. Up to the beginning of the 1980s the diagnoses were made by virus isolation and/or determination of viral antibodies in serum. The development of PCR for detection of viruses in CSF samples has increased the sensitivity and diagnostic efficiency considerably. We investigated the aetiology of AAM and the diagnostic efficiency in an adult population in Stockholm, using a limited first-line combination of microbiological assays. CSF and serum samples, consecutively collected in 419 patients with clinical symptoms of AAM in northern Stockholm during 1999-2004, were included. PCR assays for herpes simplex virus (HSV) DNA and enterovirus (EV) RNA in the CSF as well as ELISA for IgM in serum to tick-borne encephalitis virus (TBEV) were performed routinely. A viral diagnosis was obtained in 255 of the 419 cases (62%) with these routinely performed assays. Clinical findings in combination with additional diagnostic tests resulted in an overall aetiological yield of 72%. EV was the major causative agent (27%) followed by TBEV (21%) and HSV-2 (19%). We conclude that consistent use of CSF-PCR for EV and HSV and TBEV serology established a diagnosis in the majority of AAM patients.

  1. Monocystis julkae sp.nov., (Protista: Apicomplexa: Monocystidae) a new aseptate gregarine species of the genus Monocystis Stein, 1848 obtain from an Indian Earthworm, Eutyphoeus kherai, Julka, 1978.


    Bhowmik, Biplab; Bandyopadhyay, P K


    During the course of a biodiversity survey of the endoparasitic aseptate gregarines in the Malda district of West Bengal, India, seminal vesicles of the earthworm, Eutyphoeus kherai , Julka 1978 were found to be infested with a new species, Monocystis julkae sp.nov., of the genus, Monocystis Stein (Arch Anat Phys Med 181-223, 1848). The trophozoite is elongated but slightly constricted posteriorly. A tail like protrusion appears in the posterior end. Anterior end is rather wider than the posterior one. The whole body size of the trophozoite measures 102.2-184.0 (126.7 ± 19.9) µm × 40.9-81.8 (58.2 ± 10.0) µm. Size of the nucleus ranges from 10.2 to 16.3 (11.9 ± 1.9) µm × 8.1-12.2 (8.8 ± 1.2) µm. The gametocysts are ovoidal containing two unequal gametocytes. Diameter of it measures 61.3-98.1 (75.8 ± 8.6) µm. Oocysts are navicular and measures 6.9-10.0 (8.7 ± 0.9) µm × 3.0-4.6 (4.3 ± 0.4) µm.

  2. An improved, low-cost, hydroponic system for growing Arabidopsis and other plant species under aseptic conditions.


    Alatorre-Cobos, Fulgencio; Calderón-Vázquez, Carlos; Ibarra-Laclette, Enrique; Yong-Villalobos, Lenin; Pérez-Torres, Claudia-Anahí; Oropeza-Aburto, Araceli; Méndez-Bravo, Alfonso; González-Morales, Sandra-Isabel; Gutiérrez-Alanís, Dolores; Chacón-López, Alejandra; Peña-Ocaña, Betsy-Anaid; Herrera-Estrella, Luis


    Hydroponics is a plant growth system that provides a more precise control of growth media composition. Several hydroponic systems have been reported for Arabidopsis and other model plants. The ease of system set up, cost of the growth system and flexibility to characterize and harvest plant material are features continually improved in new hydroponic system reported. We developed a hydroponic culture system for Arabidopsis and other model plants. This low cost, proficient, and novel system is based on recyclable and sterilizable plastic containers, which are readily available from local suppliers. Our system allows a large-scale manipulation of seedlings. It adapts to different growing treatments and has an extended growth window until adult plants are established. The novel seed-holder also facilitates the transfer and harvest of seedlings. Here we report the use of our hydroponic system to analyze transcriptomic responses of Arabidopsis to nutriment availability and plant/pathogen interactions. The efficiency and functionality of our proposed hydroponic system is demonstrated in nutrient deficiency and pathogenesis experiments. Hydroponically grown Arabidopsis seedlings under long-time inorganic phosphate (Pi) deficiency showed typical changes in root architecture and high expression of marker genes involved in signaling and Pi recycling. Genome-wide transcriptional analysis of gene expression of Arabidopsis roots depleted of Pi by short time periods indicates that genes related to general stress are up-regulated before those specific to Pi signaling and metabolism. Our hydroponic system also proved useful for conducting pathogenesis essays, revealing early transcriptional activation of pathogenesis-related genes.

  3. An improved, low-cost, hydroponic system for growing Arabidopsis and other plant species under aseptic conditions

    PubMed Central


    Background Hydroponics is a plant growth system that provides a more precise control of growth media composition. Several hydroponic systems have been reported for Arabidopsis and other model plants. The ease of system set up, cost of the growth system and flexibility to characterize and harvest plant material are features continually improved in new hydroponic system reported. Results We developed a hydroponic culture system for Arabidopsis and other model plants. This low cost, proficient, and novel system is based on recyclable and sterilizable plastic containers, which are readily available from local suppliers. Our system allows a large-scale manipulation of seedlings. It adapts to different growing treatments and has an extended growth window until adult plants are established. The novel seed-holder also facilitates the transfer and harvest of seedlings. Here we report the use of our hydroponic system to analyze transcriptomic responses of Arabidopsis to nutriment availability and plant/pathogen interactions. Conclusions The efficiency and functionality of our proposed hydroponic system is demonstrated in nutrient deficiency and pathogenesis experiments. Hydroponically grown Arabidopsis seedlings under long-time inorganic phosphate (Pi) deficiency showed typical changes in root architecture and high expression of marker genes involved in signaling and Pi recycling. Genome-wide transcriptional analysis of gene expression of Arabidopsis roots depleted of Pi by short time periods indicates that genes related to general stress are up-regulated before those specific to Pi signaling and metabolism. Our hydroponic system also proved useful for conducting pathogenesis essays, revealing early transcriptional activation of pathogenesis-related genes. PMID:24649917

  4. Superimposition of maximal stress and necrosis areas at the top of the femoral head in hip aseptic osteonecrosis.


    Escudier, J-C; Ollivier, M; Donnez, M; Parratte, S; Lafforgue, P; Argenson, J-N


    Recent reports described possible mechanical factors in the development and aggravation of osteonecrosis of the femoral head (OFH), but these have yet to be confirmed on dedicated mechanical study. We therefore developed a 3D finite element model based on in-vivo data from patients with incipient OFH, with a view to determining whether the necrosis area was superimposed on the maximal stress area on the femoral head. The location of the necrosis area is determined by stress on the femoral head. All patients from the rheumatology department with early stage OFH in our center were investigated. Analysis of CT scans showed stress distribution on the head by 3D finite elements models, enabling determination of necrosis volume within the maximal stress area and of the percentage intersection of necrosis within the stress area (%I n/s: necrosis volume in stress area divided by total stress area volume and multiplied by 100) and of stress within the necrosis area (%I s/n: stress volume in necrosis area divided by total necrosis area volume and multiplied by 100). Nineteen of the 161 patients assessed retrospectively for the period between 2006 and 2015 had incipient unilateral OFH, 10 of whom (4 right, 6 left) had CT scans of sufficient quality for inclusion. Mean age was 52 years (range, 37-81 years). Mean maximal stress was 1.63MPa, mean maximal exported stress volume was 2,236.9 mm 3 and mean necrosis volume 6,291.1 mm 3 . Mean %I n/s was 83% and mean %I s/n 35%, with no significant differences according to gender, age, side or stress volume. There was a strong inverse correlation between necrosis volume and %I s/n (R 2 =-0.92) and a strong direct correlation between exported stress volume and %I s/n (R 2 =0.55). %I s/n was greater in small necrosis (<7,000mm 3 ). OFH seems to develop within the maximal stress area on the femoral head. The present results need confirmation by larger-scale studies. We consider it essential to take account of these mechanical parameters

  5. Recurrent fever of unknown origin (FUO): aseptic meningitis, hepatosplenomegaly, pericarditis and a double quotidian fever due to juvenile rheumatoid arthritis (JRA).


    Cunha, Burke A; Hage, Jean E; Nouri, Yelda


    Fever of unknown origin (FUO) has been defined as a fever of ≥101°F that persists for 3 weeks or more. It is not readily diagnosed after 1 week of intensive in-hospital testing or after intensive outpatient or inpatient testing. Fevers of unknown origin may be caused by infectious diseases, malignancies, collagen vascular diseases, or a variety of miscellaneous disorders. The relative distribution of causes of FUOs is partly age-related. In the elderly, the preponderance of FUOs is attributable to neoplastic and infectious etiologies, whereas in children, collagen vascular diseases, neoplasms, and viral infectious disease predominate. The diagnostic approach to FUOs depends on a careful analysis of the history, physical findings, and laboratory tests. Most patients with FUOs exhibit localizing findings that should direct the diagnostic workup and limit diagnostic possibilities. The most perplexing causes of FUOs involve those without specific diagnostic tests, e.g., juvenile rheumatoid arthritis (JRA) or adult Still's disease. In a young adult with FUO, if all of the cardinal symptoms are present, JRA may present either a straightforward or an elusive diagnosis, if key findings are absent or if the diagnosis goes unsuspected. We present a 19-year-old man with a recurrent FUO. His illness began 3 years before admission and has recurred twice since. In the past, he did not manifest arthralgias, arthritis, or a truncal rash. On admission, he presented with an FUO with hepatosplenomegaly, aseptic meningitis, and pericarditis. An extensive diagnostic workup ruled out lymphoma and leukemia. Moreover, a further extensive workup eliminated infectious causes of FUO appropriate to his clinical presentation, ie, tuberculosis, histoplasmosis, brucellosis, Q fever, typhoid fever, Epstein-Barr virus, infectious mononucleosis, cytomegalovirus, human herpes virus (HHV)-6, babesiosis, ehrlichiosis, viral hepatitis, and Whipple's disease. The diagnosis of JRA was based on the

  6. Oral immunization with Escherichia coli K-12 of the fifth instar larvae of the silkworm, Bombyx mori, reared on an artificial diet under completely aseptic conditions.


    Ichimori, H; Yuhki, T; Mori, H; Matsubara, F; Sumida, M


    1. Effect of oral administration of live or formalin-treated Escherichia coli (E. coli) K-12 to the fifth instar, days 1 and 3 larvae of the silkworm, Bombyx mori, on induction of antibacterial activity in the haemolymph was investigated using the silkworms reared on an artificial diet under completely aseptic conditions. 2. When live E. coli was administered to the male day 1 larvae, low but significant antibacterial activity of 3.8 mm was detectable in the haemolymph of one individual at 48 hr after immunization. The proportion of the larvae to express antibacterial activity increased thereafter and at 120 hr after immunization, all three individuals showed antibacterial activity. In day 3 male larvae, activity was detectable at 48 and 72 hr after immunization. 3. When formalin-treated E. coli was orally administered to days 1 and 3 male larvae, no activity was detectable at any time post-immunization. 4. In the second experiment, when day 1 larvae, females and males were orally immunized with live E. coli, only females showed antibacterial activity in the haemolymph, beginning from 24 hr after immunization and up to 96 hr. 5. Removal of an antibiotic, chloramphenicol, from ingredients of an artificial diet was required for induction of antibacterial activity with oral administration of live E. coli. 6. When live E. coli that grows at pH 9.0 was selected and used for oral immunization, antibacterial activity was induced both in females and males at 72 hr after immunization and the activity was observed at 96 hr. 7. These results suggest that establishment of oral immunization with live E. coli in the silkworm larvae requires multiplication of E. coli in the midgut lumen and possibly its colonization on the luminal surface.

  7. Cell-based Assay System for Predicting Bone Regeneration in Patient Affected by Aseptic Nonunion and Treated with Platelet Rich Fibrin.


    Perut, Francesca; Dallari, Dante; Rani, Nicola; Baldini, Nicola; Granchi, Donatella

    Regenerative strategies based on the use of platelet concentrates as an autologous source of growth factors (GF) has been proposed to promote the healing of long bone nonunions. However, the relatively high failure rate stimulates interest in growing knowledge and developing solutions to obtain the best results from the regenerative approach. In this study we evaluated whether a cell-based assay system could be able to recognize patients who will benefit or not from the use of autologous platelet preparations. The autologous serum was used in culture medium to promote the osteogenic differentiation of normal bone-marrow stromal cells (BMSC). Blood samples were collected from 16 patients affected by aseptic long bone nonunion who were candidates to the treatment with autologous platelet-rich fibrin. The osteoinductive effect was detected by measuring the BMSC proliferation, the mineralization activity, and the expression of bone-related genes. Serum level of basic fibroblast growth factor (bFGF) was considered as a representative marker of the delivery of osteogenic GFs from platelets. Laboratory results were related to the characteristics of the disease before the treatment and to the outcome at 12 months. Serum samples from "good responders" showed significantly higher levels of bFGF and were able to induce a significantly higher proliferation of BMSC, while no significant differences were observed in terms of osteoblast differentiation. BMSC-based assay could be a useful tool to recognize patients who have a low probability to benefit from the use of autologous platelet concentrate to promote the healing of long bone nonunion.

  8. BMP-2/PLGA delayed-release microspheres composite graft, selection of bone particulate diameters, and prevention of aseptic inflammation for bone tissue engineering.


    Ji, Ye; Xu, Gong Ping; Zhang, Zhi Peng; Xia, Jing Jun; Yan, Jing Long; Pan, Shang Ha


    Autogenous bone grafts are widely used in the repair of bone defects. Growth factors such as bone morphogenetic protein 2 (BMP-2) can induce bone regeneration and enhance bone growth. The combination of an autogenous bone graft and BMP-2 may provide a better osteogenic effect than either treatment alone, but BMP-2 is easily inactivated in body fluid. The objective of this study was to develop a technique that can better preserve the in vivo activity of BMP-2 incorporated in bone grafts. In this study, we first prepared BMP-2/poly(lactic-co-glycolic acid) (PLGA) delayed-release microspheres, and then combined collagen, the delayed-release microspheres, and rat autologous bone particulates to form four groups of composite grafts with different combinations: collagen in group A; collagen combined with bone particulates in group B; collagen combined with BMP-2/PLGA delayed-release microspheres in group C; and collagen combined with both bone particulates and BMP-2/PLGA delayed-release microspheres in group D. The four groups of composite grafts were implanted into the gluteus maximus pockets in rats. The ectopic osteogenesis and ALP level in group D (experimental group) were compared with those in groups A, B, and C (control groups) to study whether it had higher osteogenic capability. Results showed that the composite graft design increased the utility of BMP-2 and reduced the required dose of BMP-2 and volume of autologous bone. The selection of bone particulate diameter had an impact on the osteogenetic potential of bone grafts. Collagen prevented the occurrence of aseptic inflammation and improved the osteoinductivity of BMP-2. These results showed that this composite graft design is effective and feasible for use in bone repair.

  9. Rapid detection of enterovirus in cerebrospinal fluid by a fully-automated PCR assay is associated with improved management of aseptic meningitis in adult patients.


    Giulieri, Stefano G; Chapuis-Taillard, Caroline; Manuel, Oriol; Hugli, Olivier; Pinget, Christophe; Wasserfallen, Jean-Blaise; Sahli, Roland; Jaton, Katia; Marchetti, Oscar; Meylan, Pascal


    Enterovirus (EV) is the most frequent cause of aseptic meningitis (AM). Lack of microbiological documentation results in unnecessary antimicrobial therapy and hospitalization. To assess the impact of rapid EV detection in cerebrospinal fluid (CSF) by a fully-automated PCR (GeneXpert EV assay, GXEA) on the management of AM. Observational study in adult patients with AM. Three groups were analyzed according to EV documentation in CSF: group A = no PCR or negative PCR (n=17), group B = positive real-time PCR (n = 20), and group C = positive GXEA (n = 22). Clinical, laboratory and health-care costs data were compared. Clinical characteristics were similar in the 3 groups. Median turn-around time of EV PCR decreased from 60 h (IQR (interquartile range) 44-87) in group B to 5h (IQR 4-11) in group C (p<0.0001). Median duration of antibiotics was 1 (IQR 0-6), 1 (0-1.9), and 0.5 days (single dose) in groups A, B, and C, respectively (p < 0.001). Median length of hospitalization was 4 days (2.5-7.5), 2 (1-3.7), and 0.5 (0.3-0.7), respectively (p < 0.001). Median hospitalization costs were $5458 (2676-6274) in group A, $2796 (2062-5726) in group B, and $921 (765-1230) in group C (p < 0.0001). Rapid EV detection in CSF by a fully-automated PCR improves management of AM by significantly reducing antibiotic use, hospitalization length and costs. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Widespread circulation of a new echovirus 30 variant causing aseptic meningitis and non-specific viral illness, South-East France, 2013.


    Nougairede, Antoine; Bessaud, Mael; Thiberville, Simon-Djamel; Piorkowski, Geraldine; Ninove, Laetitia; Zandotti, Christine; Charrel, Remi N; Guilhem, Noel; de Lamballerie, Xavier


    Human enteroviruses (HEVs) are major cause of aseptic meningitis. A new outbreak of E-30 occurred between April and September 2013 in Marseille, South-East France. Better understand what happen locally when an E-30 outbreak occurs. Laboratory data (identification and characterization of circulating E-30 strains by partial/complete genome sequencing) were analyzed together with clinical data from emergency ward of the public hospital of Marseille. Compared with data from previous years, we observed an excess of HEV infections between April and September 2013. A total of 202 patients were tested positive of which 79% (160/202) had a cerebrospinal fluid tested positive. Because we performed genotyping using clinical specimens, we obtained representative molecular data related to patients tested positive and found a majority (105/119) of echoviruses 30 (E-30). Phylogenetic analysis revealed that E-30 circulating in Europe since 2000 belong to a unique lineage and showed at the intra-genogroup level the temporal circulation of E-30. Molecular data also indicated that majority of E-30 detected (92%) were almost identical. Compared with data from previous years, this outbreak was finally associated with an excess of patients admitted to an emergency ward for meningitis but also for non-specific viral illness. Our data provide new insights into microevolution of E-30: almost all E-30 emerged from local circulation of one parental virus. Moreover, our findings showed that HEV outbreaks cause an excess of emergency ward consultations but probably also an excess of consultations to general practitioners who receive majority of the non-specific viral illness. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Incidence and clinical features of herpes simplex viruses (1 and 2) and varicella-zoster virus infections in an adult Korean population with aseptic meningitis or encephalitis.


    Choi, Rihwa; Kim, Gyeong-Moon; Jo, Ik Joon; Sim, Min Seob; Song, Keun Jeong; Kim, Byoung Joon; Na, Duk L; Huh, Hee Jae; Kim, Jong-Won; Ki, Chang-Seok; Lee, Nam Yong


    Since there are limited data on the incidence and clinical findings of central nervous system (CNS) infection by three α-herpesviruses including human herpes simplex virus 1 (HSV-1), HSV-2 and varicella-zoster virus (VZV) in Korea, a retrospective analysis of clinical data and polymerase chain reaction (PCR) results was performed in patients who presented with suspicion of acute viral meningitis and/or encephalitis at the emergency department of a tertiary referral hospital in Seoul, Korea. During the 3-year study period, a total of 224 cerebrospinal fluid (CSF) samples from 224 patients were examined. Among the 224 patients, 135 (60.3%) patients were identified as having aseptic meningitis (n = 70, 51.9%), encephalitis (n = 41, 30.4%) or meningoencephalitis (n = 24, 17.8%) at discharge. Twenty-four (17.8%) patients were identified as having VZV meningitis (n = 16, 11.9%), VZV meningoencephalitis (n = 2, 1.5%), HSV-2 meningitis (n = 4, 3.0%), or HSV-1 encephalitis (n = 2, 1.5%). Of the 24 patients infected with the three herpesviruses, immunocompromised patients accounted for 33.3% (n = 8). Skin rashes were observed in half (n = 9) of the patients with VZV, and none with HSV-1 or HSV-2. One patient with VZV meningitis and four patients with brain parenchymal involvement had neurologic sequelae. In conclusion, three herpesviruses are important causative agents of CNS infectious disease with significant morbidity in adults, regardless of the immunologic status. Therefore, CSF should be examined for HSV-1, HSV-2, and VZV using sensitive diagnostic methods in all cases of adult patients with clinical manifestations of CNS disease in order to identify the correct etiology and to determine appropriate therapy. © 2014 Wiley Periodicals, Inc.

  12. Treatment of Aseptic Necrosis of the Lunate Bone (Kienböck Disease) Using a Nickel–Titanium Memory Alloy Arthrodesis Concentrator

    PubMed Central

    Xu, Yongqing; Li, Chuan; Zhou, Tianhua; Su, Yongyue; He, Xiaoqing; Fan, Xinyu; Zhu, Yueliang


    Abstract Avascular necrosis of the lunate bone (Kienböck disease) is caused by loss of blood supply of the bone. This study aimed to evaluate the efficacy and safety of a novel nickel–titanium (Ni–Ti) memory alloy arthrodesis concentrator in the treatment of this disease. A consecutive 24 patients with stage IIIb aseptic lunate necrosis were treated with scapho-trapezio-trapezoeid (STT) arthrodesis using a Ni–Ti arthrodesis concentrator from August 2008 to December 2012. Wrist pain, grip strength, carpal height, and scapholunate angle were measured and compared before and after the surgery. The wrist functions were evaluated using the Mayo scale. Patients were followed up for a mean of 12 months (range, 6–24 months). Grip strength of the affected side was significantly improved after the surgery (18 ± 4.74 kg vs. 30.21 ± 7.14 kg, P < 0.0001). Wrist pain score was significantly decreased from 5.88 ± 0.9 to 0.5 ± 0.51 (P < 0.0001). Carpal height and Mayo score were also significantly increased after the surgery (P < 0.0001). Scapholunate angle was significantly decreased after the surgery (68.38 ± 7.28° vs. 49.91 ± 4.28°, P < 0.0001). No implant breakage, loose implant, wound infection, or nonunion occurred. STT arthrodesis is effective for the treatment of stage IIIb lunate necrosis. The Ni–Ti memory alloy arthrodesis concentrator is a convenient tool for STT arthrodesis with excellent and reliable results. PMID:26496298

  13. Vapor Phase Hydrogen Peroxide Sanitization of an Isolator for Aseptic Filling of Monoclonal Antibody Drug Product - Hydrogen Peroxide Uptake and Impact on Protein Quality.


    Hubbard, Aaron; Reodl, Thomas; Hui, Ada; Knueppel, Stephanie; Eppler, Kirk; Lehnert, Siegfried; Maa, Yuh-Fun


    A monoclonal antibody drug product (DP) manufacturing process was transferred to a different production site, where aseptic filling took place within an isolator that was sanitized using vapor phase hydrogen peroxide (VPHP). A quality-by-design approach was applied for study design to understand the impact of VPHP uptake in the isolator on DP quality. A combination of small-scale and manufacturing-scale studies was performed to evaluate the sensitivity of the monoclonal antibody to hydrogen peroxide (H2O2) as well as VPHP uptake mechanisms during the filling process. The acceptable H2O2 level was determined to be 100 ng/mL for the antibody in the H2O2 spiking study; protein oxidation was observed above this threshold. The most prominent sources of VPHP uptake were identified to be via the silicone tubing assembly (associated with the peristaltic pumps) and open, filled vials. Silicone tubing, an effective depot to H2O2, could absorb VPHP during different stages of the filling process and discharge H2O2 into the DP solution during filling interruptions. A small-scale isolator model, established to simulate manufacturing-scale conditions, was a useful tool in understanding H2O2 uptake in relation to tubing dimensions and VPHP concentration in the isolator air (or atmosphere). Although the tubing assembly had absorbed a substantial amount of VPHP during the decontamination phase, the majority of H2O2 could be removed during tubing cleaning and sterilization in the subsequent isolator aeration phase, demonstrating that H2O2 in the DP solution is taken up primarily via atmospheric VPHP residues in the isolator during filling. Picarro sensor monitoring suggested that the validated VPHP aeration process generates reproducible residual VPHP profiles in isolator air, thus allowing small-scale studies to provide more relevant recommendations on tubing size and interruption time limits for commercial manufacturing. The recommended process parameters were demonstrated to be

  14. Enhancing global vaccine pharmacovigilance: Proof-of-concept study on aseptic meningitis and immune thrombocytopenic purpura following measles-mumps containing vaccination

    PubMed Central

    Perez-Vilar, Silvia; Weibel, Daniel; Sturkenboom, Miriam; Black, Steven; Maure, Christine; Castro, Jose Luis; Bravo-Alcántara, Pamela; Dodd, Caitlin N.; Romio, Silvana A.; de Ridder, Maria; Nakato, Swabra; Molina-León, Helvert Felipe; Elango, Varalakshmi; Zuber, Patrick L.F.


    New vaccines designed to prevent diseases endemic in low and middle-income countries (LMICs) are now being introduced without prior record of utilization in countries with robust pharmacovigilance systems. To address this deficit, our objective was to demonstrate feasibility of an international hospital-based network for the assessment of potential epidemiological associations between serious and rare adverse events and vaccines in any setting. This was done through a proof-of-concept evaluation of the risk of immune thrombocytopenic purpura (ITP) and aseptic meningitis (AM) following administration of the first dose of measles-mumps-containing vaccines using the self-controlled risk interval method in the primary analysis. The World Health Organization (WHO) selected 26 sentinel sites (49 hospitals) distributed in 16 countries of the six WHO regions. Incidence rate ratios (IRR) of 5.0 (95% CI: 2.5-9.7) for ITP following first dose of measles-containing vaccinations, and of 10.9 (95% CI: 4.2-27.8) for AM following mumps-containing vaccinations were found. The strain-specific analyses showed significantly elevated ITP risk for measles vaccines containing Schwarz (IRR: 20.7; 95% CI: 2.7-157.6), Edmonston-Zagreb (IRR: 11.1; 95% CI: 1.4-90.3), and Enders´Edmonston (IRR: 8.5; 95% CI: 1.9-38.1) strains. A significantly elevated AM risk for vaccines containing the Leningrad-Zagreb mumps strain (IRR: 10.8; 95% CI: 1.3-87.4) was also found. This proof-of-concept study has shown, for the first time, that an international hospital-based network for the investigation of rare vaccine adverse events, using common standardized procedures and with high participation of LMICs, is feasible, can produce reliable results, and has the potential to characterize differences in risk between vaccine strains. The completion of this network by adding large reference hospitals, particularly from tropical countries, and the systematic WHO-led implementation of this approach, should permit the

  15. Enhancing global vaccine pharmacovigilance: Proof-of-concept study on aseptic meningitis and immune thrombocytopenic purpura following measles-mumps containing vaccination.


    Perez-Vilar, Silvia; Weibel, Daniel; Sturkenboom, Miriam; Black, Steven; Maure, Christine; Castro, Jose Luis; Bravo-Alcántara, Pamela; Dodd, Caitlin N; Romio, Silvana A; de Ridder, Maria; Nakato, Swabra; Molina-León, Helvert Felipe; Elango, Varalakshmi; Zuber, Patrick L F


    New vaccines designed to prevent diseases endemic in low and middle-income countries (LMICs) are now being introduced without prior record of utilization in countries with robust pharmacovigilance systems. To address this deficit, our objective was to demonstrate feasibility of an international hospital-based network for the assessment of potential epidemiological associations between serious and rare adverse events and vaccines in any setting. This was done through a proof-of-concept evaluation of the risk of immune thrombocytopenic purpura (ITP) and aseptic meningitis (AM) following administration of the first dose of measles-mumps-containing vaccines using the self-controlled risk interval method in the primary analysis. The World Health Organization (WHO) selected 26 sentinel sites (49 hospitals) distributed in 16 countries of the six WHO regions. Incidence rate ratios (IRR) of 5.0 (95% CI: 2.5-9.7) for ITP following first dose of measles-containing vaccinations, and of 10.9 (95% CI: 4.2-27.8) for AM following mumps-containing vaccinations were found. The strain-specific analyses showed significantly elevated ITP risk for measles vaccines containing Schwarz (IRR: 20.7; 95% CI: 2.7-157.6), Edmonston-Zagreb (IRR: 11.1; 95% CI: 1.4-90.3), and Enders'Edmonston (IRR: 8.5; 95% CI: 1.9-38.1) strains. A significantly elevated AM risk for vaccines containing the Leningrad-Zagreb mumps strain (IRR: 10.8; 95% CI: 1.3-87.4) was also found. This proof-of-concept study has shown, for the first time, that an international hospital-based network for the investigation of rare vaccine adverse events, using common standardized procedures and with high participation of LMICs, is feasible, can produce reliable results, and has the potential to characterize differences in risk between vaccine strains. The completion of this network by adding large reference hospitals, particularly from tropical countries, and the systematic WHO-led implementation of this approach, should permit the

  16. Satisfactory Results of the Exeter Revision Femoral Stem Used for Primary Total Hip Arthroplasty.


    Desy, Nicholas M; Johnson, Joshua D; Sierra, Rafael J


    The Exeter cemented femoral stem has demonstrated excellent clinical and radiographic outcomes as well as long-term survivorship free from aseptic loosening. A shorter revision stem (125 mm) with a 44 offset became available for the purpose of cement-in-cement revision situations. In certain cases, this shorter revision stem may be used for various primary total hip arthroplasties (THAs) where the standard length stem would require distally reaming the femoral canal. We sought to report on the early to midterm results of this specific stem when used for primary THA regarding (1) clinical and radiographic outcomes, (2) complications, and (3) survivorship. Twenty-nine patients (33 hips) underwent a hybrid THA using the smaller revision Exeter cemented femoral stem. Twenty-five patients (28 hips) had at least 2 years of follow-up and were assessed for clinical and radiographic outcomes. All 33 hips were included in the analysis of complications and survivorship. The Kaplan-Meier survivorship was performed using revision for all causes and for aseptic loosening as the end points. The average clinical follow-up was 4 years (range, 2-7). Harris Hip Scores improved from a mean preoperative value of 56 (range, 23-96) to 90 (range, 51-100) at the latest follow-up. All patients demonstrated superior cement mantles with no signs of loosening. One patient suffered a B2 periprosthetic fracture and 1 patient experienced 2 episodes of instability. The 5-year Kaplan-Meier survivorship was 96.7% for all causes of revision and was 100% using aseptic loosening as the end point. The shorter Exeter revision cemented femoral stem has favorable early to midterm clinical and radiographic outcomes when used for primary THA with a low complication rate and is a viable option in patients with narrow femoral canals where uncemented stem fixation is not desired. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. NMR-monitored titration of acid-stress bacterial chaperone HdeA reveals that Asp and Glu charge neutralization produces a loosened dimer structure in preparation for protein unfolding and chaperone activation

    PubMed Central

    Garrison, McKinzie A; Crowhurst, Karin A


    HdeA is a periplasmic chaperone found in several gram-negative pathogenic bacteria that are linked to millions of cases of dysentery per year worldwide. After the protein becomes activated at low pH, it can bind to other periplasmic proteins, protecting them from aggregation when the bacteria travel through the stomach on their way to colonize the intestines. It has been argued that one of the major driving forces for HdeA activation is the protonation of aspartate and glutamate side chains. The goal for this study, therefore, was to investigate, at the atomic level, the structural impact of this charge neutralization on HdeA during the transition from near-neutral conditions to pH 3.0, in preparation for unfolding and activation of its chaperone capabilities. NMR spectroscopy was used to measure pKa values of Asp and Glu residues and monitor chemical shift changes. Measurements of R2/R1 ratios from relaxation experiments confirm that the protein maintains its dimer structure between pH 6.0 and 3.0. However, calculated correlation times and changes in amide protection from hydrogen/deuterium exchange experiments provide evidence for a loosening of the tertiary and quaternary structures of HdeA; in particular, the data indicate that the dimer structure becomes progressively weakened as the pH decreases. Taken together, these results provide insight into the process by which HdeA is primed to unfold and carry out its chaperone duties below pH 3.0, and it also demonstrates that neutralization of aspartate and glutamate residues is not likely to be the sole trigger for HdeA dissociation and unfolding. PMID:24375557

  18. Early Intervention.

    ERIC Educational Resources Information Center

    Nathanson, Jeanne H., Ed.


    This theme issue focuses on early intervention. The four articles presented on this theme are: (1) "Deaf Infants, Hearing Mothers: A Research Report" (Kathryn P. Meadow-Orlans, and others), reporting findings on effects of auditory loss on early development; (2) "Maintaining Involvement of Inner City Families in Early Intervention Programs through…

  19. Proximal femoral bone loss and increased rate of fracture with a proximally hydroxyapatite-coated femoral component.


    Radl, R; Aigner, C; Hungerford, M; Pascher, A; Windhager, R


    We performed a retrospective analysis of the clinical and radiological outcomes of total hip replacement using an uncemented femoral component proximally coated with hydroxyapatite. Of 136 patients, 118 who had undergone 124 primary total hip replacements were available for study. Their mean age was 66.5 years (19 to 90) and the mean follow-up was 5.6 years (4.25 to 7.25). At the final follow-up the mean Harris hip score was 92 (47.7 to 100). Periprosthetic femoral fractures, which occurred in seven patients (5.6%), were treated by osteosynthesis in six and conservatively in one. We had to revise five femoral components, one because of aseptic loosening, one because of septic loosening and three because of periprosthetic fracture. At the final follow-up there were definite signs of aseptic loosening in two patients. Radiologically, proximal femoral bone loss in Gruen zones I and VI was evident in 96.8% of hips, while bone hypertrophy in zones III and V was seen in 64.7%. In 24 hips (20.2%) the mean subsidence of the stem was 3.7 mm which occurred within the first 12 postoperative weeks. This indicated poor initial stability, which might have been aggravated by early weight-bearing. The high rate of failure in our study suggests that proximal femoral bone loss affects the long-term survival of the replacement.

  20. [Early results in the treatment of Legg-Calvé-Perthes disease using intra-articular injections of aqueous propolis extract].


    Przybylski, J; Scheller, S


    Authors presented results in conservative treatment of 54 cases of hip joint with aseptic necrosis of thigh bone. In 22 hips, excluding the typical conservative treatment, EEP injections were given. However, in the remaining 32, different forms of relieve were used. The obtained results in the first group (A) confirm the purpose of enrichment in conservative treatment by adapting intra- articular injections of EEP especially in advanced stages of necrosis (III-IV period of illness) and also in those whose parents did not express their consent on surgery in the early stage of the illness.

  1. Early Rockets


    In addition to Dr. Robert Goddard's pioneering work, American experimentation in rocketry prior to World War II grew, primarily in technical societies. This is an early rocket motor designed and developed by the American Rocket Society in 1932.

  2. Comparative uptake of ¹⁸F-FEN-DPAZn2, ¹⁸F-FECH, ¹⁸F-fluoride, and ¹⁸F-FDG in fibrosarcoma and aseptic inflammation.


    Liang, Xiang; Tang, Ganghua; Wang, Hongliang; Hu, Kongzhen; Tang, Xiaolan; Nie, Dahong; Sun, Ting; Huang, Tingting


    The aim of this study is to evaluate uptake of 2-(18)F-fluoroethyl-bis(zinc(II)-dipicolylamine) ((18)F-FEN-DPAZn2) as a promising cell death imaging agent, a choline analog (18)F-fluoroethylcholine ((18)F-FECH), (18)F-fluoride as a bone imaging agent, and a glucose analog 2-(18)F-fluoro-2-deoxy-d-glucose ((18)F-FDG) in the combined S180 fibrosarcoma and turpentine-induced inflammation mice models. The results showed that (18)F-FDG had the highest tumor-to-blood uptake ratio and tumor-to-muscle ratio, and high inflammation-to-blood ratio and inflammation-to-muscle ratio. (18)F -FECH showed moderate tumor-to-blood ratio and tumor-to-muscle ratio, and low inflammation-to-blood ratio and inflammation-to-muscle ratio. However, accumulation of (18)F FEN-DPAZn2 in tumor was similar to that in normal muscle. Also, (18)F-FEN-DPAZn2 and (18)F-fluoride exhibited the best selectivity to inflammation. (18)F-FECH positron emission tomography (PET) imaging demonstrates some advantages over (18)F-FDG PET for the differentiation of tumor from inflammation. (18)F FEN-DPAZn2 and (18)F-fluoride can be used for PET imaging of aseptic inflammation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Cementless fixation of "isoelastic" hip endoprostheses manufactured from plastic materials.


    Morscher, E W; Dick, W


    Nine years of clinical experience with an "isoelastic" shaft prosthesis manufactured using polyacetal resin reveal that for the transmission of forces from the pelvis through the femoral head and neck into the femoral shaft, some rigidity of the proximal part of the prosthesis is necessary. The object is to eliminate micromovements, which lead to bone resorption and implant loosening. However, elasticity greater than that present in metallic implants prevents stress concentrations and disuse stress protection atrophy of the bone. Greater elasticity of the prosthesis, which can be achieved by plastic materials, makes possible a more even, harmonious distribution of the forces transmitted from the implant to the bone and vice versa. A more elastic implant can also act as a better shock absorber than a rigid one. The results in 627 cementless polyethylene cups after a maximum observation period of 5.5 years reveal good incorporation and no aseptic loosening. Especially favorable results occurred in 61 cases by replacing loosened cemented cups with bone grafts and cementless polyethylene cups. On the femoral shaft side too high an elasticity in the proximal part of the prosthesis led to bone resorption and loosening with the first model of the prosthesis. By reinforcing the proximal part of the femoral component, much better results were obtained. The isoelastic femoral shaft, however, is in an early stage of experimentation.

  4. Early Rockets


    During the 19th century, rocket enthusiasts and inventors began to appear in almost every country. Some people thought these early rocket pioneers were geniuses, and others thought they were crazy. Claude Ruggieri, an Italian living in Paris, apparently rocketed small animals into space as early as 1806. The payloads were recovered by parachute. As depicted here by artist Larry Toschik, French authorities were not always impressed with rocket research. They halted Ruggieri's plans to launch a small boy using a rocket cluster. (Reproduced from a drawing by Larry Toschik and presented here courtesy of the artist and Motorola Inc.)

  5. Early diagnosis of orthopedic implant failure using macromolecular imaging agents.


    Ren, Ke; Dusad, Anand; Zhang, Yijia; Purdue, P Edward; Fehringer, Edward V; Garvin, Kevin L; Goldring, Steven R; Wang, Dong


    To develop and evaluate diagnostic tools for early detection of wear particle-induced orthopaedic implant loosening. N-(2-Hydroxypropyl)methacrylamide (HPMA) copolymer was tagged with a near infrared dye and used to detect the inflammation induced by polymethylmethacrylate (PMMA) particles in a murine peri-implant osteolysis model. It was established by inserting an implant into the distal femur and challenging with routine PMMA particles infusion. The osteolysis was evaluated by micro-CT and histological analysis at different time points. Significant peri-implant osteolysis was found 3-month post PMMA particle challenge by micro-CT and histological analysis. At 1-month post challenge, when there was no significant peri-implant bone loss, the HPMA copolymer-near infrared dye conjugate was found to specifically target the femur with PMMA particles deposition, but not the contralateral control femur with phosphate buffered saline (PBS) infusion. The results from this study demonstrate the feasibility of utilizing the macromolecular diagnostic agent to detect particle-induced peri-implant inflammation prior to the development of detectable osteolysis. Recognition of this early pathological event would provide the window of opportunity for prevention of peri-implant osteolysis and subsequent orthopaedic implant failure.

  6. Freud's Rat Man from the perspective of an early-life variant of the Oedipus complex.


    Osman, Marvin P


    In the spirit of Freud's invitation to other investigators to elaborate on his "Notes Upon a Case of Obsessional Neurosis" (1909), the author offers additional and differing views on the case of the Rat Man (Dr. Ernst Langer). These views have been informed by the evolution of psychoanalysis over the past 100 years, especially by the perspective provided by an early-life variant on the Oedipus complex (Osman 2000). The author postulates that an important reason for the happy conclusion of this analysis, surprising for its brevity, was that it expedited a mourning process that released a primitive bond to the patient's father, and also, in doing so, facilitated the emergence of a less encumbered and more individuated identity. While accomplishing this, constricting bonds to his late sister Katherine and to his mother were loosened as well.

  7. Early Rockets


    Test firing of a Redstone Missile at Redstone Test Stand in the early 1950's. The Redstone was a high-accuracy, liquid-propelled, surface-to-surface missile developed by the von Braun Team under the management of the U.S. Army. The Redstone was the first major rocket development program in the United States.

  8. Early Math.

    ERIC Educational Resources Information Center

    Van Nuys, Ute Elisabeth


    Presents reviews of the following mathematics software designed to teach young children counting, number recognition, visual discrimination, matching, addition, and subtraction skills; Stickybear Numbers, Learning with Leeper, Getting Ready to Read and Add, Counting Parade, Early Games for Young Children, Charlie Brown's 1,2,3's, Let's Go Fishing,…

  9. Early Childhood.

    ERIC Educational Resources Information Center

    Peters, Donald L.; Willis, Sherry L.

    This book summarizes theory and discusses major issues pertaining to child development in the early childhood years. Chapter I provides an introduction to the conceptual framework and major theories of child development. Chapter II deals with motor, sensory, and perceptual development. Chapter III focuses on the cognitive-developmental theory of…

  10. Early Rockets


    During the early introduction of rockets to Europe, they were used only as weapons. Enemy troops in India repulsed the British with rockets. Later, in Britain, Sir William Congreve developed a rocket that could fire to about 9,000 feet. The British fired Congreve rockets against the United States in the War of 1812.

  11. Early Rockets


    In the 19th Century, experiments in America, Europe, and elsewhere attempted to build postal rockets to deliver mail from one location to another. The idea was more novel than successful. Many stamps used in these early postal rockets have become collector's items.

  12. Occurrence of molds on laminated paperboard for aseptic packaging, selection of the most hydrogen peroxide- and heat-resistant isolates and determination of their thermal death kinetics in sterile distilled water.


    Delgado, Denise Aparecida; de Souza Sant'ana, Anderson; de Massaguer, Pilar Rodriguez


    This study aimed at enumerating molds (heat-labile and heat-resistant) on the surface of paperboard material to be filled with tomato pulps through an aseptic system and at determining the most heat- and hydrogen peroxide-resistant strains. A total of 118 samples of laminated paperboard before filling were collected, being 68 before and 50 after the hydrogen peroxide bath. Seven molds, including heat-resistant strains (Penicillium variotii and Talaromyces flavus) with counts ranging between 0.71 and 1.02 CFU/cm(2) were isolated. P. variotii was more resistant to hydrogen peroxide than T. flavus and was inactivated after heating at 85 °C/15 min. When exposed to 35 % hydrogen peroxide at 25 °C, T. flavus (F5E2) and N. fischeri (control) were less resistant than P. variotti (F1A1). P. citrinum (F7E2) was shown to be as resistant as P. variotti. The D values (the time to cause one logarithmic cycle reduction in a microbial population at a determined temperature) for spores of P. variotii (F1A1) and N. fischeri (control) with 4 months of age at 85 and 90 °C were 3.9 and 4.5 min, respectively. Although the contamination of packages was low, the presence of heat- and chemical-resistant molds may be of concern for package sterility and product stability during shelf-life. To our knowledge, this is the first report that focuses on the isolation of molds, including heat-resistant ones, contaminating paperboard packaging material and on estimating their resistance to the chemical and physical processes used for packaging sterilization.

  13. Early Risers

    ERIC Educational Resources Information Center

    Asquith, Chistina


    In this article, the author features Bard High School Early College, the first public school in the country to offer a free, full-time college curriculum--and all the credits that go with it--to high schoolers. In Bard's four-year program, students race through high school requirements in 9th and 10th grades, then take college courses in 11th and…

  14. Lessons learnt from early failure of a patient trial with a polymer-on-polymer resurfacing hip arthroplasty

    PubMed Central

    Van Susante, Job L C; Verdonschot, Nico; Bom, L Paul A; Tomaszewski, Pawel; Campbell, Pat; Ebramzadeh, Edward; Schreurs, B Wim


    Background and purpose Hip resurfacing (HR) is a treatment option promoted for hip arthritis in young and active patients. However, adverse reactions to metal are a concern and the search for non-metallic bearing options proceeds. We present the first clinical study performed in patients using a newly developed hydrophilic polymer-on-polymer hip resurfacing device. Patients and methods After performing extensive hip simulator tests, biocompatibility testing and animal tests (ISO 14242-1,3; 10993-3,4,5,10,11), approval was obtained from the IRB committee to enroll 15 patients in the first clinical study in humans using this experimental polymer-on-polymer hip resurfacing device. All surgeries were done by 2 experienced hip resurfacing surgeons. Clinical scores and standard radiographs as well as routine MRIs were obtained at regular intervals. Results The surgical technique proved feasible with successful implantation of the new device using PMMA cement fixation on both sides without complications. Postoperative imaging revealed a well-positioned and well-fixed polymer resurfacing hip arthroplasty in all 4 initial cases. All 4 patients were free of pain and had good function for the first 2 months. However, in all 4 cases early cup loosening occurred between 8 and 11 weeks after surgery, necessitating immediate closure of the study. All 4 patients had a reoperation and were revised to a conventional THA. Retrieval analyses confirmed early cup loosening at the implant–cement interface in all 4 cases. The femoral components remained well attached to the cement. The periprosthetic tissues showed only small amounts of polymeric wear debris and there was only a very mild inflammatory reaction to this. Interpretation Early cup loosening mandated a premature arrest of this study. After additional laboratory testing this failure mode was found to be the result of a small, yet measurable contraction in the cup size after exposing these implants to biological fluid divalent

  15. Lessons learnt from early failure of a patient trial with a polymer-on-polymer resurfacing hip arthroplasty.


    Van Susante, Job L C; Verdonschot, Nico; Bom, L Paul A; Tomaszewski, Pawel; Campbell, Pat; Ebramzadeh, Edward; Schreurs, B Wim


    Background and purpose - Hip resurfacing (HR) is a treatment option promoted for hip arthritis in young and active patients. However, adverse reactions to metal are a concern and the search for non-metallic bearing options proceeds. We present the first clinical study performed in patients using a newly developed hydrophilic polymer-on-polymer hip resurfacing device. Patients and methods - After performing extensive hip simulator tests, biocompatibility testing and animal tests (ISO 14242-1,3; 10993-3,4,5,10,11), approval was obtained from the IRB committee to enroll 15 patients in the first clinical study in humans using this experimental polymer-on-polymer hip resurfacing device. All surgeries were done by 2 experienced hip resurfacing surgeons. Clinical scores and standard radiographs as well as routine MRIs were obtained at regular intervals. Results - The surgical technique proved feasible with successful implantation of the new device using PMMA cement fixation on both sides without complications. Postoperative imaging revealed a well-positioned and well-fixed polymer resurfacing hip arthroplasty in all 4 initial cases. All 4 patients were free of pain and had good function for the first 2 months. However, in all 4 cases early cup loosening occurred between 8 and 11 weeks after surgery, necessitating immediate closure of the study. All 4 patients had a reoperation and were revised to a conventional THA. Retrieval analyses confirmed early cup loosening at the implant-cement interface in all 4 cases. The femoral components remained well attached to the cement. The periprosthetic tissues showed only small amounts of polymeric wear debris and there was only a very mild inflammatory reaction to this. Interpretation - Early cup loosening mandated a premature arrest of this study. After additional laboratory testing this failure mode was found to be the result of a small, yet measurable contraction in the cup size after exposing these implants to biological fluid

  16. Does incineration turn infectious waste aseptic?


    Kanemitsu, K; Inden, K; Kunishima, H; Ueno, K; Hatta, M; Gunji, Y; Watanabe, I; Kaku, M


    Incineration of infectious waste is considered to be biologically safe. We performed basic experiments to confirm that bacillus spores are killed by incineration in a muffle furnace. Biological samples containing 10(6) spores of Bacillus stearothermophilus were placed in stainless steel Petri dishes and then into hot furnaces. The furnace temperature and duration of incineration were 300 degrees C for 15 min, 300 degrees C for 30 min, 500 degrees C for 15 min, 500 degrees C for 30 min and 1100 degrees C for 3 min. We confirmed that all spores of B. stearothermophilus were killed at each of these settings. The effect of incineration seems to be equivalent to that of sterilization, based on the satisfactory sterilization assurance level of 10(-6).

  17. Early Rockets


    This photograph is of the engine for the Redstone rocket. The Redstone ballistic missile was a high-accuracy, liquid-propelled, surface-to-surface missile developed by the Army Ballistic Missile Agency, Redstone Arsenal, in Huntsville, Alabama, under the direction of Dr. von Braun. The Redstone engine was a modified and improved version of the Air Force's Navaho cruise missile engine of the late forties. The A-series, as this would be known, utilized a cylindrical combustion chamber as compared with the bulky, spherical V-2 chamber. By 1951, the Army was moving rapidly toward the design of the Redstone missile, and the production was begun in 1952. Redstone rockets became the "reliable workhorse" for America's early space program. As an example of its versatility, the Redstone was utilized in the booster for Explorer 1, the first American satellite, with no major changes to the engine or missile.

  18. Early Rockets


    The image depicts Redstone missile being erected. The Redstone ballistic missile was a high-accuracy, liquid-propelled, surface-to-surface missile developed by Army Ballistic Missile Agency, Redstone Arsenal, in Huntsville, Alabama, under the direction of Dr. von Braun. The Redstone engine was a modified and improved version of the Air Force's Navaho cruise missile engine of the late forties. The A-series, as this would be known, utilized a cylindrical combustion chamber as compared with the bulky, spherical V-2 chamber. By 1951, the Army was moving rapidly toward the design of the Redstone missile, and the production was begun in 1952. Redstone rockets became the "reliable workhorse" for America's early space program. As an example of the versatility, Redstone was utilized in the booster for Explorer 1, the first American satellite, with no major changes to the engine or missile

  19. Early Rockets


    Redstone missile No. 1002 on the launch pad at Cape Canaveral, Florida, on May 16, 1958. The Redstone ballistic missile was a high-accuracy, liquid-propelled, surface-to-surface missile developed by the Army Ballistic Missile Agency, Redstone Arsenal, in Huntsville, Alabama, under the direction of Dr. von Braun. The Redstone engine was a modified and improved version of the Air Force's Navaho cruise missile engine of the late forties. The A-series, as this would be known, utilized a cylindrical combustion chamber as compared with the bulky, spherical V-2 chamber. By 1951, the Army was moving rapidly toward the design of the Redstone missile, and production was begun in 1952. Redstone rockets became the "reliable workhorse" for America's early space program. As an example of the versatility, Redstone was utilized in the booster for Explorer 1, the first American satellite, with no major changes to the engine or missile

  20. RSA prediction of high failure rate for the uncoated Interax TKA confirmed by meta-analysis.


    Pijls, Bart G; Nieuwenhuijse, Marc J; Schoones, Jan W; Middeldorp, Saskia; Valstar, Edward R; Nelissen, Rob G H H


    In a previous radiostereometric (RSA) trial the uncoated, uncemented, Interax tibial components showed excessive migration within 2 years compared to HA-coated and cemented tibial components. It was predicted that this type of fixation would have a high failure rate. The purpose of this systematic review and meta-analysis was to investigate whether this RSA prediction was correct. We performed a systematic review and meta-analysis to determine the revision rate for aseptic loosening of the uncoated and cemented Interax tibial components. 3 studies were included, involving 349 Interax total knee arthroplasties (TKAs) for the comparison of uncoated and cemented fixation. There were 30 revisions: 27 uncoated and 3 cemented components. There was a 3-times higher revision rate for the uncoated Interax components than that for cemented Interax components (OR = 3; 95% CI: 1.4-7.2). This meta-analysis confirms the prediction of a previous RSA trial. The uncoated Interax components showed the highest migration and turned out to have the highest revision rate for aseptic loosening. RSA appears to enable efficient detection of an inferior design as early as 2 years postoperatively in a small group of patients.

  1. [Tumor prostheses : Important in modern revision arthroplasty].


    Hillmann, A; Ipach, I


    Due to demographic aging, an increasing number of revision arthroplasty procedures is expected during upcoming years. While the use of a megaprosthesis for bone reconstruction after tumor resection is gold standard, this type of prosthesis still meets with reservation in the field of revision arthroplasty because of numerous risk factors. The purpose of this article is to present the importance of modular megaprostheses in revision arthroplasty, taking into consideration the risks of periprosthetic infection, aseptic loosening, material failure, and hip dislocation. Because of improvements in the field of megaprostheses during the last 30 years, the risks after implantation of this type of prosthesis have significantly decreased. The risk of periprosthetic infection has been reduced about 1/3 by the use of silver surface coating. Improvements in stem design, cement technique, and the additional use of locking screws have minimized the risk of aseptic loosening. Improvements in material composition have reduced the risk of material failure. The risk of hip dislocation could also be minimized by careful tissue preparation and appropriate suture technique. There is no need for the conservative use of megaprostheses in revision arthroplasty. There are many benefits in the use of megaprostheses in multimorbid patients (i.e., reduced operating time, the possibility of early full weight bearing, and a reduced risk of periprosthetic infection by the use of silver surface coating) instead of complex bone reconstruction during revision arthroplasty.

  2. Triangular osteosynthesis of vertically unstable sacrum fractures: a new concept allowing early weight-bearing.


    Schildhauer, T A; Josten, Ch; Muhr, G


    Presentation of a new triangular osteosynthesis technique that permits early weight-bearing in vertically unstable sacral fractures. : Retrospective evaluation of a consecutive series. Level I trauma center. Thirty-four patients, twenty-eight of whom were poly-traumatized, all with vertically unstable sacral fractures. This group included eight women and twenty-six men, with a mean age of thirty-five years. Average time between trauma and definite operation was thirteen days (range 0 to 28 days). All patients underwent triangular osteosynthesis using a combination of a vertical vertebro-pelvic distraction osteosynthesis (pedicle screw system) and a transverse fixation of the sacrum fracture with either iliosacral screws or trans-sacral plating. Immediate postoperative weight-bearing was permitted postoperatively. Nineteen patients were treated with early progressive weight-bearing and advanced to full weight-bearing, on average, after twenty-three days (range 8 to 70 days). Three of the thirty-four patients (9 percent) experienced loosening of hardware, including two patients (6 percent) who required secondary intervention because of loss of the original reduction. Further complications included one pulmonary embolism (3 percent), one iatrogenic nerve lesion (3 percent), one wound necrosis (3 percent), and two local infections (6 percent). Triangular osteosynthesis is a demanding procedure that can be performed on vertically unstable sacral fractures to allow early progressive weight-bearing with an acceptable complication rate.

  3. Evaluation of the BioVigilant IMD-A, a novel optical spectroscopy technology for the continuous and real-time environmental monitoring of viable and nonviable particles. Part II. Case studies in environmental monitoring during aseptic filling, intervention assessments, and glove integrity testing in manufacturing isolators.


    Miller, Michael J; Walsh, Michael R; Shrake, Jerry L; Dukes, Randall E; Hill, Daniel B


    This paper describes the use of the BioVigilant IMD-A, a real-time and continuous monitoring technology based on optical spectroscopy, to simultaneously and instantaneously detect, size, and enumerate both viable and nonviable particles in a variety of filling and transfer isolator environments during an aseptic fill, transfer of sterilized components, and filling interventions. Continuous monitoring of three separate isolators for more than 16 h and representing more than 28 m3 of air per isolator (under static conditions) yielded a mean viable particle count of zero (0) per cubic meter. Although the mean count per cubic meter was zero, the detection of very low levels of single viable particles was randomly observed in each of these sampling runs. No viable particles were detected during the manual transfer of sterilized components from transfer isolators into a filling isolator, and similar results were observed during an aseptic fill, a filling needle change-out procedure, and during disassembly, movement, and reassembly of a vibrating stopper bowl. During the continuous monitoring of a sample transfer port and a simulated mousehole, no viable particles were detected; however, when the sampling probe was inserted beyond the isolator-room interface, the IMD-A instantaneously detected and enumerated both viable and nonviable particles originating from the surrounding room. Data from glove pinhole studies showed no viable particles being observed, although significant viable particles were immediately detected when the gloves were removed and a bare hand was allowed to introduce microorganisms into the isolator. The IMD-A technology offers the industry an unprecedented advantage over growth-based bioaerosol samplers for monitoring the state of microbiological control in pharmaceutical manufacturing environments, and represents significant progress toward the acceptance of microbiology process analytical technology solutions for the industry.

  4. Loosening the Reins: How Flexibility Policies Contribute to Student Achievement.

    ERIC Educational Resources Information Center

    Education Commission of the States, Denver, CO.

    Many states give individual schools the authority to make decisions in response to local conditions while still meeting state and district goals. Providing flexibility to local decision-makers is also a potential means for improving student achievement. This report provides a snapshot of several states' recent experiences with flexibility and…

  5. Chapter 5: Loosening compacted soils on mined lands

    B. Strahm; R. Sweigard; J. Burger; D. Graves; C. Zipper; C. Barton; J. Skousen; P. Angel


    Successful surface coal mining businesses must move earth materials efficiently, so mining operations today depend on large and heavy equipment (Fig. 5-1). Track dozers and haul trucks used for mining can weigh more than 100 tons each. Wheel loaders and loaded haul trucks often exceed 200 tons. The mining industry has learned that successful reforestation of reclaimed...

  6. Early Childhood Systems: Transforming Early Learning

    ERIC Educational Resources Information Center

    Kagan, Sharon Lynn, Ed.; Kauertz, Kristie, Ed.


    In this seminal volume, leading authorities strategize about how to create early childhood systems that transcend politics and economics to serve the needs of all young children. The authors offer different interpretations of the nature of early childhood systems, discuss the elements necessary to support their development, and examine how…

  7. [Bone cement adhesion on ceramic surfaces - surface activation of retention surfaces of knee prostheses by atmospheric plasma versus thermal surface treatment].


    Marx, B; Marx, R; Reisgen, U; Wirtz, D


    CoCrMo alloys are contraindicated for allergy sufferers. For these patients, uncemented and cemented prostheses made of titanium alloy are indicated. Knee prostheses machined from that alloy, however, may have poor tribological behaviour, especially in relation to UHMWPE inlays. Therefore, for knee replacement cemented high-strength oxide ceramic prostheses are suitable for allergy sufferers and in cases of particle-induced aseptic loosening. For adhesion of bone cement, the ceramic surface, however, only exposes inefficient mechanical retention spots as compared with a textured metal surface. Undercuts generated by corundum blasting which in the short-term are highly efficient on a CoCrMo surface are not possible on a ceramic surface due to the brittleness of ceramics. Textures due to blasting may initiate cracks which will weaken the strength of a ceramic prosthesis. Due to the lack of textures mechanical retention is poor or even not existent. Micromotions are promoted and early aseptic loosening is predictable. Instead silicoating of the ceramic surface will allow specific adhesion and result in better hydrolytic stability of bonding thereby preventing early aseptic loosening. Silicoating, however, presupposes a clean and chemically active surface which can be achieved by atmospheric plasma or thermal surface treatment. In order to evaluate the effectiveness of silicoating the bond strengths of atmospheric plasma versus thermal surface treated and silicate layered ZPTA surfaces were compared with "as-fired" surfaces by utilising TiAlV probes (diameter 6 mm) for traction-adhesive strength tests. After preparing samples for traction-adhesive strength tests (sequence: ceramic substrate, silicate and silane, protective lacquer [PolyMA], bone cement, TiAlV probe) they were aged for up to 150 days at 37 °C in Ringer's solution. The bond strengths observed for all ageing intervals were well above 20 MPa and much higher and more hydrolytically stable for

  8. Reasons for revision of failed hemiarthroplasty: Are there any differences between unipolar and bipolar?


    Iamthanaporn, Khanin; Chareancholvanich, Keerati; Pornrattanamaneewong, Chaturong


    Hemiarthroplasty (HA) is an effective procedure for treatment of femoral neck fracture. However, it is debatable whether unipolar or bipolar HA is the most suitable implant. The purpose of this study was to compare the causes of failure and longevity in both types of HA. We retrospectively reviewed 133 cases that underwent revision surgery of HA between 2002 and 2012. The causes of revision surgery were identified and stratified into early (≤ 5 years) failure and late (> 5 years) failure. Survival analyses were performed for each implant type. The common causes for revision were aseptic loosening (49.6%), infection (22.6%) and acetabular erosion (15.0%). Unipolar and bipolar HA were not different in causes for revision, but the unipolar group had a statistically significantly higher number of acetabular erosion events compared with the bipolar group (p = 0.002). In the early period, 24 unipolar HA (52.9%) and 28 bipolar HA (34.1%) failed. There were no statistically significant differences in the numbers of revised HA in each period between the two groups (p = 0.138). The median survival times in the unipolar and bipolar groups were 84.0 ± 24.5 and 120.0 ± 5.5 months, respectively. However, the survival times of both implants were not statistically significantly different. Aseptic loosening was the most common reason for revision surgery after hemiarthroplasty surgery in early and late failures. Unipolar and bipolar hemiarthroplasty were not different in terms of causes of failure and survivorship except bipolar hemiarthroplasty had many fewer acetabular erosion events.

  9. Reframing Early Childhood Leadership

    ERIC Educational Resources Information Center

    Stamopoulos, Elizabeth


    Rapid changes in Australian education have intensified the role of early childhood leaders and led to unprecedented challenges. The Australian Curriculum (ACARA, 2011), mandated Australian "National Quality Framework" (NQF) for Early Childhood Education & Care (DEEWR, 2010b) and the "National Early Years Learning Framework"…

  10. Operative treatment of hip fractures in patients receiving hemodialysis.


    Tosun, Bilgehan; Atmaca, Halil; Gok, Umit


    Fifteen hips in 13 patients with hip fracture were treated in patients receiving hemodialysis for chronic renal failure. There were four intertrochanteric and 11 femoral neck fractures. 10 of the 11 femoral neck fractures and one of the four intertrochanteric fractures were treated with cemented bipolar hemiarthroplasty. Two intertrochanteric fractures fixed with sliding compression screws. External fixation was used for stabilization in two patients who had femoral neck and intertrochanteric fractures. Two intertrochanteric fractures that were treated with sliding hip screw showed radiological union postoperatively at the 6th month. Of the 11 hemiarthroplasty, four hips developed aseptic loosening (36%). According to Harris hip score grading system, three (37.5%) poor, two (25%) fair, two (25%) good and one (12.5%) case had excellent outcome in the hemiarthroplasty group. The survival of dialysis patients with a hip fracture is markedly reduced. Initial treatment of hemiarthroplasty allows early mobilization and prevents revision surgery.

  11. The Role of Presepsin Obtained from Tracheal Aspirates in the Diagnosis of Early Onset Pneumonia in Intubated Newborns.


    Savić, Dragana; Simović, Aleksandra; Marković, Slavica; Kostić, Gordana; Vuletić, Biljana; Radivojević, Snezana; Lišanin, Marina; Igrutinović, Zoran; Pavlović, Radisa


    To investigate the role of presepsin obtained from tracheal aspirate of intubated newborns in the diagnosis of early neonatal pneumonia. A cross-sectional observational study was performed on 60 intubated newborns during the two-year period. Tracheal aspirate for examination was taken in aseptic conditions in usual toilets, by lavage with 2 ml of 0.9% NaCl in Mucus suction set. On the same day, presepsin (blood) was measured. There were 34 newborns in the examined group (with pneumonia) and 26 in the control group. Patient groups were similar regarding demographic characteristics related to gender and Apgar score. The coefficients of simple linear correlation revealed the statistically significant connection between presepsin (from tracheal aspirate) and birth body weight, presepsin (plasma), maternal infection and pneumonia. Significant differences in the values of presepsin (from tracheal aspirate) (p < 0.001) and birth body weight (p = 0.036) were found. In intubated newborns, measurements of presepsin obtained from tracheal aspirate suggested that it can be used as a complementary marker in diagnosing early onset neonatal pneumonia.

  12. Hypersensitivity reactions to metal implants: laboratory options.


    Carossino, Anna Maria; Carulli, Christian; Ciuffi, Simone; Carossino, Roberto; Zappoli Thyrion, Giorgia Donata; Zonefrati, Roberto; Innocenti, Massimo; Brandi, Maria Luisa


    All implant compounds undergo an electrochemical process when in contact with biological fluids, as well as mechanical corrosion due to abrasive wear, with production of metal debris that may inhibit repair processes. None of the commonly-used methods can diagnose implant allergies when used singly, therefore a panel of tests should be performed on allergic patients as pre-operative screening, or when a postoperative metal sensitisation is suspected. We analysed patients with painful prostheses and subjects prone to allergies using the Patch Test in comparison with the Lymphocyte Transformation Test. Cytokine production was evaluated to identify prognostic markers for early diagnosis of aseptic loosening. Metal debris endocytosis and cytoskeletal rearrangement was visualised by confocal microscopy. Our results demonstrate that the Lymphocyte Transformation Test can identify patients who have a predisposition to develop allergic reactions and can confirm the diagnosis of hypersensitivity in patients with painful prostheses. The prevalence of a Th2-cytokine pattern may be used to identify predisposition to the development of allergic diseases, while the selective presence of osteoclastogenic cytokines may be used as predictor of a negative outcome in patients with painful prosthesis. The hypothesis of the prognostic value of these cytokines as early markers of aseptic loosening is attractive, but its confirmation would require extensive testing. The Lymphocyte Transformation Test is the most suitable method for testing systemic allergies. We suggest that the combined use of the Patch Test and the Lymphocyte Transformation Test, associated with cytokine detection in selected patients, could provide a useful tool for preventive evaluation of immune reactivity in patients undergoing primary joint replacement surgery, and for clinical monitoring of the possible onset of a metal sensitization in patients with implanted devices.

  13. Waterford Early Reading Program.

    ERIC Educational Resources Information Center

    Education Commission of the States, Denver, CO.

    This paper provides an overview of the Waterford Early Reading Program (WERP), which is designed to shift teaching and learning away from remediation and failure to prevention, early achievement, and sustained growth for every student. WERP includes three levels of instruction: emergent, beginning, and fluent readers. It targets pre-K through…

  14. Early College High Schools

    ERIC Educational Resources Information Center

    Dessoff, Alan


    For at-risk students who stand little chance of going to college, or even finishing high school, a growing number of districts have found a solution: Give them an early start in college while they still are in high school. The early college high school (ECHS) movement that began with funding from the Bill and Melinda Gates Foundation 10 years ago…

  15. Early Childhood Education.

    ERIC Educational Resources Information Center

    Elkind, David

    In five sections, this paper explores dimensions of early childhood education: schooling generally construed as nonparental instruction in knowledge, values, and skills. Section 1 looks at some of the factors which have contributed to the rapid growth of early childhood education in modern times. Section 2 briefly highlights the contributions of…

  16. Rethinking Early Childhood Education

    ERIC Educational Resources Information Center

    Pelo, Ann, Ed.


    "Rethinking Early Childhood Education" is alive with the conviction that teaching young children involves values and vision. This anthology collects inspiring stories about social justice teaching with young children. Included here is outstanding writing from childcare teachers, early-grade public school teachers, scholars, and parents.…

  17. Early Retirement Payoff

    ERIC Educational Resources Information Center

    Fitzpatrick, Maria D.; Lovenheim, Michael F.


    As public budgets have grown tighter over the past decade, states and school districts have sought ways to control the growth of spending. One increasingly common strategy employed to rein in costs is to offer experienced teachers with high salaries financial incentives to retire early. Although early retirement incentive (ERI) programs have been…

  18. Early Pregnancy Loss


    ... known pregnancies. What causes early pregnancy loss? About one half of cases of early pregnancy loss are caused by a ... do not show any signs of an infection, one option is to wait and let the ... may take longer in some cases. Another option is to take medication that helps ...

  19. Rethinking Early Education

    ERIC Educational Resources Information Center

    Celeste, Eric


    The National Association for the Education of Young Children (NAEYC) says in its current policy paper that, for high-quality early education to exist outside of tiny islands across the country, the following must be addressed: (1) teacher preparation; (2) ongoing professional learning; and (3) disparity in early education teacher pay. To achieve…

  20. [Knee arthrodesis performed with intramedullary nailing technique in failed total knee replacement--a preliminary report].


    Gaździk, Tadeusz Szymon; Kotas-Strzoda, Justyna; Bozek, Marek


    Knee arthrodesis is the method of choice in treatment of failed total knee replacement. It is recommended when revisory total knee replacement is impossible. The authors present 2 cases of knee fusions using intramedullary nails after prosthesis loosening (1 aseptic, 1 septic). In both cases good results were achieved, with no complications observed during convalescence.

  1. [Possibilities of follow-up imaging after implantation of a carbon fiber-reinforced hip prosthesis].


    Krüger, T; Alter, C; Reichel, H; Birke, A; Hein, W; Spielmann, R P


    There are many problems in the radiological diagnosis of aseptic loosening in total hip arthroplasty. Computed tomography (CT) and magnetic resonance tomography (MRT) are not usable for metallic implants (stainless steel, cobalt alloy, titanium alloy). From April 1993 to December 1993 15 CFRP non-cemented hip prostheses have been implanted. In a prospective clinical study plane radiographs, CT and MRT have been analysed. Three stems were revised (1 femoral fracture, 1 severe thigh pain, 1 aseptic loosening). CFRP are not visible in plane radiographs. There was a complete (two-third of the cases) or nearly complete (one-third of the cases) small sclerotic interface between the prosthesis and the bone, these were apparent in CT and MRT in stable implant cases and did not have any clinical correlations. The small sclerotic interface is quite different in comparison to so called "Reactive Lines". In one case of aseptic loosening there was an interposition of soft tissue between prosthesis and bone in MRT and CT. CFRP inaugurates new diagnostic possibilities in aseptic loosening of hip prosthesis and in tumour surgery too.

  2. Humeral windows in revision total elbow arthroplasty.


    Peach, Chris A; Salama, Amir; Stanley, David


    The use of cortical windows for revision elbow arthroplasty has not previously been widely reported. Their use aids safe revision of a well fixed humeral prosthesis and can be used in the setting of dislocation, periprosthetic fracture or aseptic loosening of the ulnar component. We describe our technique and results of cortical windows in the distal humerus for revision elbow arthroplasty surgery.

  3. Anterior total hip arthroplasty using a metaphyseal bone-sparing stem: component alignment and early complications.


    Ahmed, Mohammed M; Otto, Thomas J; Moed, Berton R


    Limited-incision total hip arthroplasty (THA) preserves hip abductors, posterior capsule, and external rotators potentially diminishing dislocation risk. However, potential complications also exist, such as component malposition. Specific implants have been manufactured that enhance compatibility with this technique, while preserving metaphyseal bone; however, little data exists documenting early complications and component position. The purpose was to evaluate primary THA using a curved, bone-sparing stem inserted through the anterior approach with respect to component alignment and early complications. In a retrospective analysis of 108 cases, the surgical technique was outlined and the occurrence of intraoperative fractures, postoperative dislocations, infection, and limb length inequality was determined. Femoral stem and acetabular cup alignment was quantified using the initial postoperative radiographs. Patient follow-up averaged 12.9 (range 2 to 36) months. There were eight (7.4 %) complications requiring revision surgery in three (2.8 %) patients with three (2.8 %) infections and three (2.8 %) dislocations. Intraoperative complications included one calcar fracture above the lesser trochanter. Leg length inequality >5 mm was present in three (2.8 %) patients. Radiographic analysis showed that femoral neutral alignment was achieved in 95 hips (88.0 %). All femoral stems demonstrated satisfactory fit and fill and no evidence of subsidence, osteolysis, or loosening. An average abduction angle of 44.8° (± 5.3) and average cup anteversion of 16.2° (± 4.2) were also noted. Although the technique with this implant and approach is promising, it does not appear to offer important advantages over standard techniques. However, the findings merit further, long-term study.

  4. Earth's early biosphere

    NASA Technical Reports Server (NTRS)

    Des Marais, D. J.


    Understanding our own early biosphere is essential to our search for life elsewhere, because life arose on Earth very early and rocky planets shared similar early histories. The biosphere arose before 3.8 Ga ago, was exclusively unicellular and was dominated by hyperthermophiles that utilized chemical sources of energy and employed a range of metabolic pathways for CO2 assimilation. Photosynthesis also arose very early. Oxygenic photosynthesis arose later but still prior to 2.7 Ga. The transition toward the modern global environment was paced by a decline in volcanic and hydrothermal activity. These developments allowed atmospheric O2 levels to increase. The O2 increase created new niches for aerobic life, most notably the more advanced Eukarya that eventually spawned the megascopic fauna and flora of our modern biosphere.

  5. Supporting Early Learning Act

    THOMAS, 113th Congress

    Rep. Himes, James A. [D-CT-4


    House - 06/13/2014 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  6. Early Learning Innovation Act

    THOMAS, 111th Congress

    Rep. Himes, James A. [D-CT-4


    House - 12/08/2009 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  7. Early Life Stages

    EPA Pesticide Factsheets

    Childhood should be viewed as a sequence of lifestages, from birth through infancy and adolescence. When assessing early life risks, consideration is given to risks resulting from fetal exposure via the pregnant mother, as well as postnatal exposures.

  8. Mercury's Early Geologic History

    NASA Astrophysics Data System (ADS)

    Denevi, B. W.; Ernst, C. M.; Klima, R. L.; Robinson, M. S.


    A combination of geologic mapping, compositional information, and geochemical models are providing a better understanding of Mercury's early geologic history, and allow us to place it in the context of the Moon and the terrestrial planets.

  9. Early Learning Alignment Act

    THOMAS, 111th Congress

    Rep. Altmire, Jason [D-PA-4


    House - 11/18/2010 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Colorado Early Childhood Study.

    ERIC Educational Resources Information Center

    Colorado State Dept. of Education, Denver. Planning and Evaluation Unit.

    The Colorado State Board of Education allocated Title IV-V funds in 1975 for a study of the status of early childhood education in Colorado. The purposes of the study were to: (1) gather data relevant to early childhood education on the status of all children from birth through age 5; (2) identify needs of children of this age within the state;…

  11. Redefining early gastric cancer.


    Barreto, Savio G; Windsor, John A


    The problem is that current definitions of early gastric cancer allow the inclusion of regional lymph node metastases. The increasing use of endoscopic submucosal dissection to treat early gastric cancer is a concern because regional lymph nodes are not addressed. The aim of the study was thus to critically evaluate current evidence with regard to tumour-specific factors associated with lymph node metastases in "early gastric cancer" to develop a more precise definition and improve clinical management. A systematic and comprehensive search of major reference databases (MEDLINE, EMBASE, PubMed and the Cochrane Library) was undertaken using a combination of text words "early gastric cancer", "lymph node metastasis", "factors", "endoscopy", "surgery", "lymphadenectomy" "mucosa", "submucosa", "lymphovascular invasion", "differentiated", "undifferentiated" and "ulcer". All available publications that described tumour-related factors associated with lymph node metastases in early gastric cancer were included. The initial search yielded 1494 studies, of which 42 studies were included in the final analysis. Over time, the definition of early gastric cancer has broadened and the indications for endoscopic treatment have widened. The mean frequency of lymph node metastases increased on the basis of depth of infiltration (mucosa 6% vs. submucosa 28%), presence of lymphovascular invasion (absence 9% vs. presence 53%), tumour differentiation (differentiated 13% vs. undifferentiated 34%) and macroscopic type (elevated 13% vs. flat 26%) and tumour diameter (≤2 cm 8% vs. >2 cm 25%). There is a need to re-examine the diagnosis and staging of early gastric cancer to ensure that patients with one or more identifiable risk factor for lymph node metastases are not denied appropriate chemotherapy and surgical resection.

  12. Hip resurfacing: a large, US single-surgeon series.


    Brooks, P J


    Hip resurfacing has been proposed as an alternative to traditional total hip arthroplasty in young, active patients. Much has been learned following the introduction of metal-on-metal resurfacing devices in the 1990s. The triad of a well-designed device, implanted accurately, in the correct patient has never been more critical than with these implants. Following Food and Drug Administration approval in 2006, we studied the safety and effectiveness of one hip resurfacing device (Birmingham Hip Resurfacing) at our hospital in a large, single-surgeon series. We report our early to mid-term results in 1333 cases followed for a mean of 4.3 years (2 to 5.7) using a prospective, observational registry. The mean patient age was 53.1 years (12 to 84); 70% were male and 91% had osteoarthritis. Complications were few, including no dislocations, no femoral component loosening, two femoral neck fractures (0.15%), one socket loosening (0.08%), three deep infections (0.23%), and three cases of metallosis (0.23%). There were no destructive pseudotumours. Overall survivorship at up to 5.7 years was 99.2%. Aseptic survivorship in males under the age of 50 was 100%. We believe this is the largest United States series of a single surgeon using a single resurfacing system. ©2016 The British Editorial Society of Bone & Joint Surgery.

  13. Early cosmology constrained

    NASA Astrophysics Data System (ADS)

    Verde, Licia; Bellini, Emilio; Pigozzo, Cassio; Heavens, Alan F.; Jimenez, Raul


    We investigate our knowledge of early universe cosmology by exploring how much additional energy density can be placed in different components beyond those in the ΛCDM model. To do this we use a method to separate early- and late-universe information enclosed in observational data, thus markedly reducing the model-dependency of the conclusions. We find that the 95% credibility regions for extra energy components of the early universe at recombination are: non-accelerating additional fluid density parameter ΩMR < 0.006 and extra radiation parameterised as extra effective neutrino species 2.3 < Neff < 3.2 when imposing flatness. Our constraints thus show that even when analyzing the data in this largely model-independent way, the possibility of hiding extra energy components beyond ΛCDM in the early universe is seriously constrained by current observations. We also find that the standard ruler, the sound horizon at radiation drag, can be well determined in a way that does not depend on late-time Universe assumptions, but depends strongly on early-time physics and in particular on additional components that behave like radiation. We find that the standard ruler length determined in this way is rs = 147.4 ± 0.7 Mpc if the radiation and neutrino components are standard, but the uncertainty increases by an order of magnitude when non-standard dark radiation components are allowed, to rs = 150 ± 5 Mpc.

  14. Magnesium inference screw supports early graft incorporation with inhibition of graft degradation in anterior cruciate ligament reconstruction

    NASA Astrophysics Data System (ADS)

    Cheng, Pengfei; Han, Pei; Zhao, Changli; Zhang, Shaoxiang; Zhang, Xiaonong; Chai, Yimin


    Patients after anterior cruciate ligament (ACL) reconstruction surgery commonly encounters graft failure in the initial phase of rehabilitation. The inhibition of graft degradation is crucial for the successful reconstruction of the ACL. Here, we used biodegradable high-purity magnesium (HP Mg) screws in the rabbit model of ACL reconstruction with titanium (Ti) screws as a control and analyzed the graft degradation and screw corrosion using direct pull-out tests, microCT scanning, and histological and immunohistochemical staining. The most noteworthy finding was that tendon graft fixed by HP Mg screws exhibited biomechanical properties substantially superior to that by Ti screws and the relative area of collagen fiber at the tendon-bone interface was much larger in the Mg group, when severe graft degradation was identified in the histological analysis at 3 weeks. Semi-quantitative immunohistochemical results further elucidated that the MMP-13 expression significantly decreased surrounding HP Mg screws with relatively higher Collagen II expression. And HP Mg screws exhibited uniform corrosion behavior without displacement or loosening in the femoral tunnel. Therefore, our results demonstrated that Mg screw inhibited graft degradation and improved biomechanical properties of tendon graft during the early phase of graft healing and highlighted its potential in ACL reconstruction.

  15. Magnesium inference screw supports early graft incorporation with inhibition of graft degradation in anterior cruciate ligament reconstruction

    PubMed Central

    Cheng, Pengfei; Han, Pei; Zhao, Changli; Zhang, Shaoxiang; Zhang, Xiaonong; Chai, Yimin


    Patients after anterior cruciate ligament (ACL) reconstruction surgery commonly encounters graft failure in the initial phase of rehabilitation. The inhibition of graft degradation is crucial for the successful reconstruction of the ACL. Here, we used biodegradable high-purity magnesium (HP Mg) screws in the rabbit model of ACL reconstruction with titanium (Ti) screws as a control and analyzed the graft degradation and screw corrosion using direct pull-out tests, microCT scanning, and histological and immunohistochemical staining. The most noteworthy finding was that tendon graft fixed by HP Mg screws exhibited biomechanical properties substantially superior to that by Ti screws and the relative area of collagen fiber at the tendon-bone interface was much larger in the Mg group, when severe graft degradation was identified in the histological analysis at 3 weeks. Semi-quantitative immunohistochemical results further elucidated that the MMP-13 expression significantly decreased surrounding HP Mg screws with relatively higher Collagen II expression. And HP Mg screws exhibited uniform corrosion behavior without displacement or loosening in the femoral tunnel. Therefore, our results demonstrated that Mg screw inhibited graft degradation and improved biomechanical properties of tendon graft during the early phase of graft healing and highlighted its potential in ACL reconstruction. PMID:27210585

  16. Early Intervention in Psychosis

    PubMed Central

    McGorry, Patrick D.


    Abstract Early intervention for potentially serious disorder is a fundamental feature of healthcare across the spectrum of physical illness. It has been a major factor in the reductions in morbidity and mortality that have been achieved in some of the non-communicable diseases, notably cancer and cardiovascular disease. Over the past two decades, an international collaborative effort has been mounted to build the evidence and the capacity for early intervention in the psychotic disorders, notably schizophrenia, where for so long deep pessimism had reigned. The origins and rapid development of early intervention in psychosis are described from a personal and Australian perspective. This uniquely evidence-informed, evidence-building and cost-effective reform provides a blueprint and launch pad to radically change the wider landscape of mental health care and dissolve many of the barriers that have constrained progress for so long. PMID:25919380

  17. [Early flat colorectal cancer].


    Castelletto, R H; Chiarenza, C; Ottino, A; Garay, M L


    We report three cases of flat early colorectal carcinoma which were detected during the examination of 51 surgical specimens of colorectal resection. Two of them were endoscopically diagnosed, but the smallest one was not seen in the luminal instrumental examination. From the bibliographic analysis and our own experience we deduce the importance of flat lesions in the development of early colorectal carcinoma, either originated from pre-existent adenoma or de novo. Flat variants of adenoma, and presumably flush or depressed ones, must be considered as important factors in the early sequence adenoma-cancer. An appropriate endoscopic equipment with employment of additional staining techniques (such as carmine indigo and methylene blue) and the correct investigation during inflation-deflation procedures facilitates the identification of small lesions, their eradication and prevention from advanced forms of colorectal carcinoma.

  18. Cognitive Development in Early Readers.

    ERIC Educational Resources Information Center

    Briggs, Chari; Elkind, David

    Some studies of early readers are discussed. It is pointed out that study of early readers has relevance for practical and theoretical issues in psychology and education. Of interest in this document are the following questions: (1) Are there any special talents or traits distinguishing early from non-early readers? (2) Do children who read early…

  19. Early College Entrance in Australia

    ERIC Educational Resources Information Center

    Jung, Jae Yup; Young, Marie; Gross, Miraca U. M.


    Early college entry is an educational intervention that is being increasingly used in Australia. Following a review of the current Australian literature on early college entry, an overview is provided of the characteristics of, and the procedures associated with, one formal Australian early college entry program (the Early Admission for…

  20. Early Adolescent Ego Development.

    ERIC Educational Resources Information Center

    James, Michael A.


    Presented are the theoretical characteristics of social identity in early adolescence (ages 10 to 15). It is suggested that no longer is identity thought to begin with adolescence, but may have its beginnings in the preteen years. The article draws heavily on Eriksonian concepts. (Editor/KC)

  1. Early Childhood Development.

    ERIC Educational Resources Information Center

    Koh, Edgar, Ed.


    Focused on early childhood development, this "UNICEF Intercom" asserts that developmental programs should aim to give children a fair chance at growth beyond survival. First presented are moral, scientific, social equity, economic, population, and programatic arguments for looking beyond the fundamental objective of saving young lives.…

  2. Early Screening Inventory (ESI).

    ERIC Educational Resources Information Center

    Welge-Crow, Patricia; And Others


    The Early Screening Inventory is designed to identify English- or Spanish-speaking children, ages 4-6, who may need special education services. The instrument measures the ability to acquire new skills in the areas of visual-motor/adaptive, language/cognition, and gross-motor/body-awareness. This paper describes administration, summation of data,…

  3. Preventing Early Learning Failure.

    ERIC Educational Resources Information Center

    Sornson, Bob, Ed.

    Noting that thousands of young children with the capacity to experience school success do not because they are unprepared for school learning activities, have experienced physical or emotional setbacks that cause them to be at risk for early learning failure, have never experienced limits on their behavior, or have mild sensory or motor deficits,…

  4. Early Program Development


    This 1971 artist's concept shows a Nuclear Shuttle and an early Space Shuttle docked with an Orbital Propellant Depot. As envisioned by Marshall Space Flight Center Program Development persornel, an orbital modular propellant storage depot, supplied periodically by the Space Shuttle or Earth-to-orbit fuel tankers, would be critical in making available large amounts of fuel to various orbital vehicles and spacecraft.

  5. Early Program Development


    This artist's concept from 1970 shows a Nuclear Shuttle docked to an Orbital Propellant Depot and an early Space Shuttle. As envisioned by Marshall Space Flight Center Program Development plarners, the Nuclear Shuttle, in either manned or unmanned mode, would deliver payloads to lunar orbit or other destinations then return to Earth orbit for refueling and additonal missions.

  6. Early Childhood Trauma

    ERIC Educational Resources Information Center

    National Child Traumatic Stress Network, 2010


    Early childhood trauma generally refers to the traumatic experiences that occur to children aged 0-6. Because infants' and young children's reactions may be different from older children's, and because they may not be able to verbalize their reactions to threatening or dangerous events, many people assume that young age protects children from the…

  7. Early Program Development


    As part of the Space Task Group's recommendations for more commonality and integration in America's space program, Marshall Space Flight Center engineers proposed an orbiting propellant storage facility to augment Space Shuttle missions. In this artist's concept from 1969 an early version of the Space Shuttle is shown refueling at the facility.

  8. Early Developments, 1998.

    ERIC Educational Resources Information Center

    Little, Loyd, Ed.


    This document consists of the two 1998 issues of a journal reporting new research in early child development conducted by the Frank Porter Graham Child Development Center at the University of North Carolina at Chapel Hill. In the Spring 1998 issue, articles highlight the Center's diverse cross-cultural projects and global research, training and…

  9. Creativity: The Early Years

    ERIC Educational Resources Information Center

    Shade, Rick; Shade, Patti Garrett


    There is a myth that some people are creative and others are not. However, all children are born creative. They love to explore, ask questions, and are incredibly imaginative. Parents are key in nurturing their child's creativity in the early years. This article offers resources and strategies parents can use at different ages and stages (newborn,…

  10. Early malignant syphilis*

    PubMed Central

    Ortigosa, Yara Martins; Bendazzoli, Paulo Salomão; Barbosa, Angela Marques; Ortigosa, Luciena Cegatto Martins


    Early malignant syphilis is a rare and severe variant of secondary syphilis. It is clinically characterized by lesions, which can suppurate and be accompanied by systemic symptoms such as high fever, asthenia, myalgia, and torpor state. We report a diabetic patient with characteristic features of the disease showing favorable evolution of the lesions after appropriate treatment. PMID:28300925

  11. Early Childhood Military Education?

    ERIC Educational Resources Information Center

    Pelo, Ann


    Does the country's national security rely on top-quality early childhood education? Yes, say the military leaders of Mission: Readiness, an organization led by retired military commanders that promotes investment in education, child health, and parenting support. Actually, the generals are right, but for all the wrong reasons. The generals' aim is…

  12. Early Childhood Education.

    ERIC Educational Resources Information Center

    Advocate, 1995


    This special theme issue of the journal "The Advocate," offers articles on early interventions for preschoolers with special needs, including three articles in Spanish. Contents include: "Providing An Orientation for Life" (Galen D. Kirkland); "AFC Fights Cuts in Education at 'Speak Out' Rally" (Nadine Renazile);…

  13. Early Humour Production

    ERIC Educational Resources Information Center

    Hoicka, Elena; Akhtar, Nameera


    The current studies explored early humour as a complex socio-cognitive phenomenon by examining 2- and 3-year-olds' humour production with their parents. We examined whether children produced novel humour, whether they cued their humour, and the types of humour produced. Forty-seven parents were interviewed, and videotaped joking with their…

  14. Understanding Early Years Policy

    ERIC Educational Resources Information Center

    Baldock, Peter; Fitzgerald, Damien; Kay, Janet


    The book is about policy in the area of early years services and that phrase may need some clarification. For the most part, therefore, this book deals with nursery schools and classes and with services provided by full day care nurseries, pre-schools, creches, childminders, after-school clubs and holiday play schemes. This book begins with…

  15. Early Childhood Indicators.

    ERIC Educational Resources Information Center

    Bartlett, Kathy; Zimanyi, Louise


    Recognizing the need to identify the level, nature, and impact of Early Childhood Care and Development (ECCD) programs on children and their families, this theme issue of "Coordinators' Notebook" seeks to complement and further the international efforts at collecting information on ECCD for use at national and international levels.…

  16. Early Indian People.

    ERIC Educational Resources Information Center

    Doermann, Elisabeth


    Using bits and pieces of the past such as charred bits of wood from campfires, broken pieces of clay pots, stone spearpoints and arrowheads, and shell or copper ornaments, the archaeologist tries to put together the story of early Indian people in the Minnesota region. A short story, one of eight articles, re-creates the kill of an Itasca bison…

  17. Early Identification of Autism

    PubMed Central

    Webb, Sara Jane; Jones, Emily J.H.


    In the first year of life, infants who later go on to develop autistic spectrum disorders (ASD) may exhibit subtle disruptions in social interest and attention, communication, temperament, and head circumference growth that occur prior to the onset of clinical symptoms. These disruptions may reflect the early course of ASD development and may also contribute to the later development of clinical symptoms through alterations in the child’s experience of his or her environment. By age 2, developmental precursors of autism symptoms can be used to diagnose children reliably, and by age 3, the diagnosis is thought to be relatively stable. The downward extension of the autism diagnosis poses important questions for therapists in designing interventions that are applicable for infants who demonstrate early risk factors. We review current knowledge of the early signs of ASD in the infancy period (0–12 months) and the manifestation of symptoms in toddlerhood (12– 36 months), noting the importance of considering the variability in onset and trajectory of ASD. Finally, we consider the implications of this emerging research for those who work or interact with young children, including the importance of early monitoring and the development and evaluation of age-appropriate interventions. PMID:28090148

  18. Socket position determines hip resurfacing 10-year survivorship.


    Amstutz, Harlan C; Le Duff, Michel J; Johnson, Alicia J


    Modern metal-on-metal hip resurfacing arthroplasty designs have been used for over a decade. Risk factors for short-term failure include small component size, large femoral head defects, low body mass index, older age, high level of sporting activity, and component design, and it is established there is a surgeon learning curve. Owing to failures with early surgical techniques, we developed a second-generation technique to address those failures. However, it is unclear whether the techniques affected the long-term risk factors. We (1) determined survivorship for hips implanted with the second-generation cementing technique; (2) identified the risk factors for failure in these patients; and (3) determined the effect of the dominant risk factors on the observed modes of failure. We retrospectively reviewed the first 200 hips (178 patients) implanted using our second-generation surgical technique, which consisted of improvements in cleaning and drying the femoral head before and during cement application. There were 129 men and 49 women. Component orientation and contact patch to rim distance were measured. We recorded the following modes of failure: femoral neck fracture, femoral component loosening, acetabular component loosening, wear, dislocation, and sepsis. The minimum followup was 25 months (mean, 106.5 months; range, 25-138 months). Twelve hips were revised. Kaplan-Meier survivorship was 98.0% at 5 years and 94.3% at 10 years. The only variable associated with revision was acetabular component position. Contact patch to rim distance was lower in hips that dislocated, were revised for wear, or were revised for acetabular loosening. The dominant modes of failure were related to component wear or acetabular component loosening. Acetabular component orientation, a factor within the surgeon's control, determines the long-term success of our current hip resurfacing techniques. Current techniques have changed the modes of failure from aseptic femoral failure to wear

  19. Early cosmology constrained


    Verde, Licia; Jimenez, Raul; Bellini, Emilio

    We investigate our knowledge of early universe cosmology by exploring how much additional energy density can be placed in different components beyond those in the ΛCDM model. To do this we use a method to separate early- and late-universe information enclosed in observational data, thus markedly reducing the model-dependency of the conclusions. We find that the 95% credibility regions for extra energy components of the early universe at recombination are: non-accelerating additional fluid density parameter Ω{sub MR} < 0.006 and extra radiation parameterised as extra effective neutrino species 2.3 < N {sub eff} < 3.2 when imposing flatness. Our constraintsmore » thus show that even when analyzing the data in this largely model-independent way, the possibility of hiding extra energy components beyond ΛCDM in the early universe is seriously constrained by current observations. We also find that the standard ruler, the sound horizon at radiation drag, can be well determined in a way that does not depend on late-time Universe assumptions, but depends strongly on early-time physics and in particular on additional components that behave like radiation. We find that the standard ruler length determined in this way is r {sub s} = 147.4 ± 0.7 Mpc if the radiation and neutrino components are standard, but the uncertainty increases by an order of magnitude when non-standard dark radiation components are allowed, to r {sub s} = 150 ± 5 Mpc.« less

  20. [The spectrum of histomorphological findings related to joint endoprosthetics].


    Morawietz, L; Krenn, V


    Approximately 230,000 total hip and 170,000 knee joint endoprostheses are implanted in Germany annually of which approximately 10% (i.e. 40,000 interventions per year) are cases of revision surgery. These interventions involve removal of a previously implanted prosthesis which has resulted in complaints and replacement with a new prosthesis. There are manifold reasons for revision surgery, the most common indication being so-called endoprosthesis loosening, which is subdivided into septic and aseptic loosening. Histomorphological studies revealed that periprosthetic tissue from endoprosthesis loosening can be classified into four types (I) wear-particle induced type, (II) infectious type, (III) combined type and (IV) fibrous type. Types I and IV represent aseptic loosening and types II and III septic loosening. Recently, the topic of implant allergy has emerged. The detection of cellular, mostly perivascular lymphocytic infiltrates is discussed as being a sign of an allergic tissue reaction. It has most frequently been observed in type I periprosthetic membranes with a dense load of metal wear, which occurs with metal-on-metal bearings. Apart from endoprosthesis loosening, arthrofibrosis is another complication of joint endoprosthetics and can cause pain and impaired function. Histopathologically, arthrofibrosis can be evaluated by a three-tiered grading system. Furthermore, bone pathologies, such as ossification, osteopenia or osteomyelitis can occur as complications of joint endoprosthetics. This review gives an overview of the whole spectrum of pathological findings in joint endoprosthetics and offers a comprehensive and standardized classification system for routine histopathological diagnostics.

  1. Radiographic evaluation of short-stem press-fit total shoulder arthroplasty: short-term follow-up.


    Casagrande, Danielle J; Parks, Di L; Torngren, Travis; Schrumpf, Mark A; Harmsen, Samuel M; Norris, Tom R; Kelly, James D


    Humeral loosening is an uncommon etiology for revision shoulder arthroplasty. We aimed to evaluate the radiographic and clinical outcomes of a short-stem press-fit humeral component after primary total shoulder arthroplasty. We reviewed our patient database, from January 2008 to December 2011, for primary total shoulder arthroplasties performed with a short-stem press-fit humeral component. Radiographs and clinical outcomes were evaluated in the immediate postoperative period and at the most recent follow-up, with at least 24 months of data for all patients. There were 73 shoulders that met our inclusion criteria, but 4 underwent revision before 2 years' follow-up. Only 1 of these 4 was revised for aseptic humeral loosening. Sixty-nine shoulders had at least 24 months of radiographic follow-up, and 62 had radiographic and clinical follow-up. Of the 69 shoulders, 5 underwent revision for humeral loosening: 1 for aseptic loosening and 4 for infection. Two other shoulders with humeral loosening were asymptomatic, and the patients refused revision surgery. The overall revision rate for humeral loosening was 8.2% (6 of 73 shoulders). Radiolucent zones of any size were seen in 71.0%, with 8.7% of these shoulders identified as having humeral stems at risk of future loosening. Significant improvements were made in most of the measured clinical outcomes. A high percentage of radiolucency was seen around the short-stem press-fit humeral components evaluated in this study at short-term follow-up. The overall rates of loosening and revision for the humeral implant examined in this study are higher than those noted in other recent studies evaluating press-fit stems. The cause of radiolucency and humeral loosening for this implant is not fully understood. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  2. Samuel Goudsmit - Early Influences

    NASA Astrophysics Data System (ADS)

    Goudsmit, Esther


    Samuel Goudsmit, born in 1902 in The Hague, Netherlands, earned his Ph.D. at the University of Leiden in 1926 with Paul Ehrenfest. The present talk will describe some aspects of his background and early formative years in order to provide context for the broad range of his professional life. Sam belonged to a large tribe of paternal and maternal uncles, aunts and first cousins; including his parents, grandparents and sister Ro, they numbered forty. Sam was the first of the tribe to be educated beyond high school. Early interests as a child and later as a university student in the Netherlands prefigured his significant and diverse contributions in several realms including not only physics but also teaching, Egyptology and scientific Intelligence. Bibliographic sources will include: The American Institute of Physics' Oral History Transcripts and photographs from the Emilio Segre visual archives, memoirs and conversations of those who knew Sam and also letters to his daughter, Esther.

  3. Early Childhood Caries

    PubMed Central

    Kawashita, Yumiko; Kitamura, Masayasu; Saito, Toshiyuki


    Dental caries is one of the most common childhood diseases, and people continue to be susceptible to it throughout their lives. Although dental caries can be arrested and potentially even reversed in its early stages, it is often not self-limiting and progresses without proper care until the tooth is destroyed. Early childhood caries (ECC) is often complicated by inappropriate feeding practices and heavy infection with mutans streptococci. Such children should be targeted with a professional preventive program that includes oral hygiene instructions for mothers or caregivers, along with fluoride and diet counseling. However, these strategies alone are not sufficient to prevent dental caries in high-risk children; prevention of ECC also requires addressing the socioeconomic factors that face many families in which ECC is endemic. The aim of this paper is to systematically review information about ECC and to describe why many children are suffering from dental caries. PMID:22007218



    Ivanov, A.E.


    Inflammation in the lungs of irradiated rabbits at the site of turpentine injection has much in common with the inflammatory changes arising in other tissues and organs during local irradiation or acute radiation sickness. The fact that the inflammatory changes under different conditions of irradiation are similar in type regardless of the character of the inflammatory agent suggests that the phenomenon has a common mechanism. The absence of polymorphonuclear (eosinophtlic) leukocytes from inflammatory foci in irradiated rabbits is due not only to the developing leukopenia, but also to a disturbance of the leukocyte emigration process into the inflammatory focus. Inmore » irradiated rabbits in cortrast to the controls, the normal arrangement of the fibrous structures is preserved in the necrotic lung tissue at the site of turpentine injection. In animals with severe acute radiation sickness induced by external irradiation in sublethal doses, the ability of the organism to respond to introduction of an inflammatory agent by an increase in the number of leukocytes in the blood and by a rise of the body temperature is to some extent preserved. (auth)« less

  5. Gravity, chromosomes, and organized development in aseptically cultured plant cells

    NASA Technical Reports Server (NTRS)

    Krikorian, Abraham D.


    The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.

  6. Sterility Testing of Prototype Plastic Aseptic Docking Tubes

    DTIC Science & Technology


    Bacillus stearothermophilus CL21. AmerRACT (Coat~e- aeids uIf 8" niev teIi by block n"Unbee) Fifty-nine pairs of sterile docking tabs, manufactured...of Bacillus stearothermophilus , _J sealed, and flushed with sterile culture medium. Twenty five percent of the LA_.. seals failed because of...were similarly attached to sterile tubes of Becton Dickenson supplemented peptone broth. A 25 ul aliquot of Bacillus stearothermophilus spores (Ix]O

  7. Early bioenergetic evolution

    PubMed Central

    Sousa, Filipa L.; Thiergart, Thorsten; Landan, Giddy; Nelson-Sathi, Shijulal; Pereira, Inês A. C.; Allen, John F.; Lane, Nick; Martin, William F.


    Life is the harnessing of chemical energy in such a way that the energy-harnessing device makes a copy of itself. This paper outlines an energetically feasible path from a particular inorganic setting for the origin of life to the first free-living cells. The sources of energy available to early organic synthesis, early evolving systems and early cells stand in the foreground, as do the possible mechanisms of their conversion into harnessable chemical energy for synthetic reactions. With regard to the possible temporal sequence of events, we focus on: (i) alkaline hydrothermal vents as the far-from-equilibrium setting, (ii) the Wood–Ljungdahl (acetyl-CoA) pathway as the route that could have underpinned carbon assimilation for these processes, (iii) biochemical divergence, within the naturally formed inorganic compartments at a hydrothermal mound, of geochemically confined replicating entities with a complexity below that of free-living prokaryotes, and (iv) acetogenesis and methanogenesis as the ancestral forms of carbon and energy metabolism in the first free-living ancestors of the eubacteria and archaebacteria, respectively. In terms of the main evolutionary transitions in early bioenergetic evolution, we focus on: (i) thioester-dependent substrate-level phosphorylations, (ii) harnessing of naturally existing proton gradients at the vent–ocean interface via the ATP synthase, (iii) harnessing of Na+ gradients generated by H+/Na+ antiporters, (iv) flavin-based bifurcation-dependent gradient generation, and finally (v) quinone-based (and Q-cycle-dependent) proton gradient generation. Of those five transitions, the first four are posited to have taken place at the vent. Ultimately, all of these bioenergetic processes depend, even today, upon CO2 reduction with low-potential ferredoxin (Fd), generated either chemosynthetically or photosynthetically, suggesting a reaction of the type ‘reduced iron → reduced carbon’ at the beginning of bioenergetic evolution

  8. PHOBOS, the Early Years

    NASA Astrophysics Data System (ADS)

    Stephans, George S. F.; Back, B. B.; Baker, M. D.; Barton, D. S.; Betts, R. R.; Ballintijn, M.; Bickley, A. A.; Bindel, R.; Budzanowski, A.; Busza, W.; Carroll, A.; Decowski, M. P.; Garcia, E.; George, N.; Gulbrandsen, K.; Gushue, S.; Halliwell, C.; Hamblen, J.; Heintzelman, G. A.; Henderson, C.; Hofman, D. J.; Hollis, R. S.; Holynski, R.; Holzman, B.; Iordanova, A.; Johnson, E.; Kane, J. L.; Katzy, J.; Khan, N.; Kucewicz, W.; Kulinich, P.; Kuo, C. M.; Lin, W. T.; Manly, S.; McLeod, D.; Michalowski, J.; Mignerey, A. C.; Nouicer, R.; Olszewski, A.; Pak, R.; Park, I. C.; Pernegger, H.; Reed, C.; Remsberg, L. P.; Reuter, M.; Roland, C.; Roland, G.; Rosenberg, L.; Sagerer, J.; Sarin, P.; Sawicki, P.; Skulski, W.; Steadman, S. G.; Steinberg, P.; Stephans, G. S. F.; Stodulski, M.; Sukhanov, A.; Tang, J.-L.; Teng, R.; Trzupek, A.; Vale, C.; van Nieuwenhuizen, G. J.; Verdier, R.; Wadsworth, B.; Wolfs, F. L. H.; Wosiek, B.; Wozniak, K.; Wuosmaa, A. H.; Wyslouch, B.


    The PHOBOS detector, one of the two small experiments at RHIC, focuses on measurements of charged particle multiplicity over almost the full phase space and identified particles near mid-rapidity. Results will be presented from the early RHIC gold--gold runs at nucleon--nucleon center of mass energies of 56 and 130 GeV as well as the recently concluded run at the full RHIC energy of 200 GeV.

  9. Coaching in Early Mathematics.


    Germeroth, Carrie; Sarama, Julie


    Falling scores in math have prompted a renewed interest in math instruction at early ages. By their own admission, early childhood educators are generally underprepared and not always comfortable teaching math. Professional development (PD) in early mathematics is widely considered a main way to increase teachers' skills and efficacy (e.g., Guskey, 2000; Hyson & Woods, 2014; Munby, Russell, & Martin, 2001; Piasta, Logan, Pelatti, Capps, & Petrill, 2015; Richardson & Placier, 2001; Sarama, Clements, Wolfe, & Spitler, 2016; Sarama & DiBiase, 2004; Zaslow, 2014). However, it has been documented that stand-alone PD is not as effective in changing practice (e.g., Biancarosa & Bryk, 2011; Garet et al., 2008; Guskey, 2000; Hyson & Woods, 2014; Institute of Medicine and National Research Council, 2015; Joyce & Showers, 2002; Zaslow, 2014). Site-embedded ongoing support in the form of coaching or mentoring has been shown to be critical for successful implementation (Neuman & Cunningham, 2009; Powell, Diamond, Burchinal, & Koehler, 2010). In this chapter, we describe coaching models and abstract characteristics of effective coaching from the research. With this background, we provide an in-depth view of the coaching aspect of two large empirical studies in early mathematics. We introduce the theoretical framework from which the coaching models for these projects were developed and describe the research on which they were based. We then summarize how the planned models were instantiated and challenges to their implementation within each project. In the final section, we summarize what we have learned and described implications and challenges for the field. © 2017 Elsevier Inc. All rights reserved.

  10. Hands of early primates.


    Boyer, Doug M; Yapuncich, Gabriel S; Chester, Stephen G B; Bloch, Jonathan I; Godinot, Marc


    Questions surrounding the origin and early evolution of primates continue to be the subject of debate. Though anatomy of the skull and inferred dietary shifts are often the focus, detailed studies of postcrania and inferred locomotor capabilities can also provide crucial data that advance understanding of transitions in early primate evolution. In particular, the hand skeleton includes characteristics thought to reflect foraging, locomotion, and posture. Here we review what is known about the early evolution of primate hands from a comparative perspective that incorporates data from the fossil record. Additionally, we provide new comparative data and documentation of skeletal morphology for Paleogene plesiadapiforms, notharctines, cercamoniines, adapines, and omomyiforms. Finally, we discuss implications of these data for understanding locomotor transitions during the origin and early evolutionary history of primates. Known plesiadapiform species cannot be differentiated from extant primates based on either intrinsic hand proportions or hand-to-body size proportions. Nonetheless, the presence of claws and a different metacarpophalangeal [corrected] joint form in plesiadapiforms indicate different grasping mechanics. Notharctines and cercamoniines have intrinsic hand proportions with extremely elongated proximal phalanges and digit rays relative to metacarpals, resembling tarsiers and galagos. But their hand-to-body size proportions are typical of many extant primates (unlike those of tarsiers, and possibly Teilhardina, which have extremely large hands). Non-adapine adapiforms and omomyids exhibit additional carpal features suggesting more limited dorsiflexion, greater ulnar deviation, and a more habitually divergent pollex than observed plesiadapiforms. Together, features differentiating adapiforms and omomyiforms from plesiadapiforms indicate increased reliance on vertical prehensile-clinging and grasp-leaping, possibly in combination with predatory behaviors in

  11. Guideline for Early Interventions

    DTIC Science & Technology


    desensitization and reprocessing ( EMDR ) as a early mental health intervention, following mass violence and disasters, is a treatment of choice over other...village. Military operations take place under the eye of the world and are surrounded by high political attention. International missions far exceed...consistently reduce risks of later post-traumatic stress disorder or related adjustment difficulties. • There is no evidence that eye movement

  12. Early anaerobic metabolisms

    PubMed Central

    Canfield, Don E; Rosing, Minik T; Bjerrum, Christian


    Before the advent of oxygenic photosynthesis, the biosphere was driven by anaerobic metabolisms. We catalogue and quantify the source strengths of the most probable electron donors and electron acceptors that would have been available to fuel early-Earth ecosystems. The most active ecosystems were probably driven by the cycling of H2 and Fe2+ through primary production conducted by anoxygenic phototrophs. Interesting and dynamic ecosystems would have also been driven by the microbial cycling of sulphur and nitrogen species, but their activity levels were probably not so great. Despite the diversity of potential early ecosystems, rates of primary production in the early-Earth anaerobic biosphere were probably well below those rates observed in the marine environment. We shift our attention to the Earth environment at 3.8 Gyr ago, where the earliest marine sediments are preserved. We calculate, consistent with the carbon isotope record and other considerations of the carbon cycle, that marine rates of primary production at this time were probably an order of magnitude (or more) less than today. We conclude that the flux of reduced species to the Earth surface at this time may have been sufficient to drive anaerobic ecosystems of sufficient activity to be consistent with the carbon isotope record. Conversely, an ecosystem based on oxygenic photosynthesis was also possible with complete removal of the oxygen by reaction with reduced species from the mantle. PMID:17008221

  13. Early intervention for psychosis

    PubMed Central

    Marshall, Max; Rathbone, John


    Background Proponents of early intervention have argued that outcomes might be improved if more therapeutic efforts were focused on the early stages of schizophrenia or on people with prodromal symptoms. Early intervention in schizophrenia has two elements that are distinct from standard care: early detection, and phase-specific treatment (phase-specific treatment is a psychological, social or physical treatment developed, or modified, specifically for use with people at an early stage of the illness). Early detection and phase-specific treatment may both be offered as supplements to standard care, or may be provided through a specialised early intervention team. Early intervention is now well established as a therapeutic approach in America, Europe and Australasia. Objectives To evaluate the effects of: (a) early detection; (b) phase-specific treatments; and (c) specialised early intervention teams in the treatment of people with prodromal symptoms or first-episode psychosis. Search methods We searched the Cochrane Schizophrenia Group Trials Register (March 2009), inspected reference lists of all identified trials and reviews and contacted experts in the field. Selection criteria We included all randomised controlled trials (RCTs) designed to prevent progression to psychosis in people showing prodromal symptoms, or to improve outcome for people with first-episode psychosis. Eligible interventions, alone and in combination, included: early detection, phase-specific treatments, and care from specialised early intervention teams. We accepted cluster-randomised trials but excluded non-randomised trials. Data collection and analysis We reliably selected studies, quality rated them and extracted data. For dichotomous data, we estimated relative risks (RR), with the 95% confidence intervals (CI). Where possible, we calculated the number needed to treat/harm statistic (NNT/H) and used intention-to-treat analysis (ITT). Main results Studies were diverse, mostly small

  14. Infusing Early Childhood Mental Health into Early Intervention Services

    ERIC Educational Resources Information Center

    Grabert, John C.


    This article describes the process of enhancing early childhood mental health awareness and skills in non-mental health staff. The author describes a pilot training model, conducted the U.S. Army's Early Intervention Services, that involved: (a) increasing early childhood mental health knowledge through reflective readings, (b) enhancing…

  15. Early Life Exposures and Cancer

    Early-life events and exposures have important consequences for cancer development later in life, however, epidemiological studies of early-life factors and cancer development later in life have had significant methodological challenges.

  16. Why Recruits Separate Early

    DTIC Science & Technology


    our sample were reportedly unable to adjust to the military environment due to social or emotional immaturity. This problem was especially prevalent...Table 9. Table 9 REASONS FOR EARLY SEPARATION 1. Mental health. Phobias , suicide threats and attempts, emotional immaturity, and personality and...hliurfl’lutf t’ htrtiuug tht .’ plinittol piioL’m.9 evIn’ thfll I b’ r i’lli. vre’.Ilv ifao~ , ýI ill it](- rv ’: 111nil tln1 (i~..󈧏 4 P A W4.11

  17. Early Childhood Home Visiting.


    Duffee, James H; Mendelsohn, Alan L; Kuo, Alice A; Legano, Lori A; Earls, Marian F


    High-quality home-visiting services for infants and young children can improve family relationships, advance school readiness, reduce child maltreatment, improve maternal-infant health outcomes, and increase family economic self-sufficiency. The American Academy of Pediatrics supports unwavering federal funding of state home-visiting initiatives, the expansion of evidence-based programs, and a robust, coordinated national evaluation designed to confirm best practices and cost-efficiency. Community home visiting is most effective as a component of a comprehensive early childhood system that actively includes and enhances a family-centered medical home. Copyright © 2017 by the American Academy of Pediatrics.

  18. Treat early, treat appropriately.


    Liebl, Andreas; Rutten, Guy; Abraira, Carlos


    The treatment of type 2 diabetes is shifting from secondary specialist centres to the primary care setting. However, for this shift to be sustainable and successful, primary care physicians (PCPs) must effectively provide aspects of diabetes care traditionally supplied by specialists. In particular, the early and appropriate use of insulin in type 2 diabetes will increasingly become the responsibility of PCPs. This review examines how patients with type 2 diabetes are currently managed across several European countries, and explores the evidence around insulin use in type 2 diabetes and the implications for primary care. 2010 Primary Care Diabetes Europe. Published by Elsevier Ltd.. All rights reserved.

  19. Early modern mathematical instruments.


    Bennett, Jim


    In considering the appropriate use of the terms "science" and "scientific instrument," tracing the history of "mathematical instruments" in the early modern period is offered as an illuminating alternative to the historian's natural instinct to follow the guiding lights of originality and innovation, even if the trail transgresses contemporary boundaries. The mathematical instrument was a well-defined category, shared across the academic, artisanal, and commercial aspects of instrumentation, and its narrative from the sixteenth to the eighteenth century was largely independent from other classes of device, in a period when a "scientific" instrument was unheard of.

  20. Early Program Development


    This 1969 artist's concept illustrates the use of three major elements of NASA's Integrated program, as proposed by President Nixon's Space Task Group. In Phases I and II, a Space Tug with a manipulator-equipped crew module removes a cargo module from an early Space Shuttle Orbiter and docks with it. In Phases III and IV, the Space Tug with attached cargo module flys toward a Nuclear Shuttle. As a result of the Space Task Group's recommendations for more commonality and integration in the American space program, Marshall Space Flight Center engineers studied many of the spacecraft depicted here.

  1. Crowdsourced earthquake early warning

    PubMed Central

    Minson, Sarah E.; Brooks, Benjamin A.; Glennie, Craig L.; Murray, Jessica R.; Langbein, John O.; Owen, Susan E.; Heaton, Thomas H.; Iannucci, Robert A.; Hauser, Darren L.


    Earthquake early warning (EEW) can reduce harm to people and infrastructure from earthquakes and tsunamis, but it has not been implemented in most high earthquake-risk regions because of prohibitive cost. Common consumer devices such as smartphones contain low-cost versions of the sensors used in EEW. Although less accurate than scientific-grade instruments, these sensors are globally ubiquitous. Through controlled tests of consumer devices, simulation of an Mw (moment magnitude) 7 earthquake on California’s Hayward fault, and real data from the Mw 9 Tohoku-oki earthquake, we demonstrate that EEW could be achieved via crowdsourcing. PMID:26601167

  2. Crowdsourced earthquake early warning.


    Minson, Sarah E; Brooks, Benjamin A; Glennie, Craig L; Murray, Jessica R; Langbein, John O; Owen, Susan E; Heaton, Thomas H; Iannucci, Robert A; Hauser, Darren L


    Earthquake early warning (EEW) can reduce harm to people and infrastructure from earthquakes and tsunamis, but it has not been implemented in most high earthquake-risk regions because of prohibitive cost. Common consumer devices such as smartphones contain low-cost versions of the sensors used in EEW. Although less accurate than scientific-grade instruments, these sensors are globally ubiquitous. Through controlled tests of consumer devices, simulation of an M w (moment magnitude) 7 earthquake on California's Hayward fault, and real data from the M w 9 Tohoku-oki earthquake, we demonstrate that EEW could be achieved via crowdsourcing.

  3. Early Psoriatic Arthritis.


    McHugh, Neil John


    Skin psoriasis is a major risk factor for the development of psoriatic arthritis. Recent studies have shown that delayed diagnosis is associated with long-term adverse outcomes. Screening questionnaires have revealed a potential burden of undiagnosed disease. Lifestyle factors and genetic and soluble biomarkers have come under scrutiny as risk factors. Imaging modalities may have an important role in detecting early change. With more effective treatments, it may be possible to prevent significant joint damage and associated disability. However, the precise nature of accurate and cost-effective screening strategies remains to be determined. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Crowdsourced earthquake early warning

    Minson, Sarah E.; Brooks, Benjamin A.; Glennie, Craig L.; Murray, Jessica R.; Langbein, John O.; Owen, Susan E.; Heaton, Thomas H.; Iannucci, Robert A.; Hauser, Darren L.


    Earthquake early warning (EEW) can reduce harm to people and infrastructure from earthquakes and tsunamis, but it has not been implemented in most high earthquake-risk regions because of prohibitive cost. Common consumer devices such as smartphones contain low-cost versions of the sensors used in EEW. Although less accurate than scientific-grade instruments, these sensors are globally ubiquitous. Through controlled tests of consumer devices, simulation of an Mw (moment magnitude) 7 earthquake on California’s Hayward fault, and real data from the Mw 9 Tohoku-oki earthquake, we demonstrate that EEW could be achieved via crowdsourcing.

  5. Early Childhood Workforce Index, 2016

    ERIC Educational Resources Information Center

    Whitebook, Marcy; McLean, Caitlin; Austin, Lea J. E.


    The State of the Early Childhood Workforce (SECW) Initiative is a groundbreaking multi-year project to shine a steady spotlight on the nation's early childhood workforce. The SECW Initiative is designed to challenge entrenched ideas and policies that maintain an inequitable and inadequate status quo for early educators and for the children and…

  6. Value-Added Early Learning

    ERIC Educational Resources Information Center

    Dichter, Harriet


    Elected state leaders often prioritize economic prosperity and competitiveness, which provides an important opportunity too rarely taken for investing in early education. In 2003, Pennsylvania recognized the connection between early education and the economy, and smartly embraced early learning as part of its economic prosperity and…

  7. Early Reading and Concrete Operations.

    ERIC Educational Resources Information Center

    Polk, Cindy L. Howes; Goldstein, David


    Indicated that early readers are more likely to be advanced in cognitive development than are nonearly-reading peers. After one year of formal reading instruction, early readers maintained their advantage in reading achievement. Measures of concrete operations were found to predict reading achievement for early and nonearly readers. (Author/DB)

  8. The Effectiveness of Early Intervention.

    ERIC Educational Resources Information Center

    Guralnick, Michael J., Ed.

    This book reviews research on the effectiveness of early intervention for children with disabilities or who are at risk. Program factors for children at risk and with disabilities, the effects of early intervention on different types of disabilities, and the outcomes of early intervention are explored. Chapters include: "Second-Generation Research…

  9. Early Attrition among Suicidal Clients

    ERIC Educational Resources Information Center

    Surgenor, P. W. G.; Meehan, V.; Moore, A.


    The study aimed to identify the level of suicidal ideation in early attrition clients and their reasons for the early termination of their therapy. The cross-sectional design involved early attrition clients (C[subscript A]) who withdrew from therapy before their second session (n = 61), and continuing clients who (C[subscript C]) progressed…

  10. Early Childhood Special Music Education

    ERIC Educational Resources Information Center

    Darrow, Alice-Ann


    The process of early intervention is a critical component of Early Childhood Special Music Education. Early intervention is the process of providing services, education, and support to young children who have disabilities or to children who are at-risk of developing needs that may affect their physical, cognitive, or emotional development. The…

  11. Early diagnosis in glaucoma.


    Garway-Heath, David F


    This chapter reviews the evidence for the clinical application of vision function tests and imaging devices to identify early glaucoma, and sets out a scheme for the appropriate use and interpretation of test results in screening/case-finding and clinic settings. In early glaucoma, signs may be equivocal and the diagnosis is often uncertain. Either structural damage or vision function loss may be the first sign of glaucoma; neither one is consistently apparent before the other. Quantitative tests of visual function and measurements of optic-nerve head and retinal nerve fiber layer anatomy are useful to either raise or lower the probability that glaucoma is present. The posttest probability for glaucoma may be calculated from the pretest probability and the likelihood ratio of the diagnostic criterion, and the output of several diagnostic devices may be combined to achieve a final probability. However, clinicians need to understand how these diagnostic devices make their measurements, so that the validity of each test result can be adequately assessed. Only then should the result be used, together with the patient history and clinical examination, to derive a diagnosis.

  12. Early Earth slab stagnation

    NASA Astrophysics Data System (ADS)

    Agrusta, R.; Van Hunen, J.


    At present day, the Earth's mantle exhibits a combination of stagnant and penetrating slabs within the transition zone, indicating a intermittent convection mode between layered and whole-mantle convection. Isoviscous thermal convection calculations show that in a hotter Earth, the natural mode of convection was dominated by double-layered convection, which may imply that slabs were more prone to stagnate in the transition zone. Today, slab penetration is to a large extent controlled by trench mobility for a plausible range of lower mantle viscosity and Clapeyron slope of the mantle phase transitions. Trench mobility is, in turn, governed by slab strength and density and upper plate forcing. In this study, we systematically investigate the slab-transition zone internation in the Early Earth, using 2D self-consistent numerical subduction models. Early Earth's higher mantle temperature facilitates decoupling between the plates and the underlying asthenosphere, and may result in slab sinking almost without trench retreat. Such behaviour together with a low resistance of a weak lower mantle may allow slabs to penetrate. The ability of slab to sink into the lower mantle throughout Earth's history may have important implications for Earth's evolution: it would provide efficient mass and heat flux through the transition zone therefore provide an efficient way to cool and mix the Earth's mantle.

  13. Use of an absorbable membrane to position biologically inductive materials in the periprosthetic space of cemented joints.


    DiResta, Gene R; Brown, Holly; Aiken, Sean; Doty, Steven; Schneider, Robert; Wright, Timothy; Healey, John H


    A device is presented that positions ultrahigh molecular weight polyethylene (UHMWPE) debris against periprosthetic bone surfaces. This can facilitate the study of aseptic loosening associated with cemented joint prostheses by speeding the appearance of this debris within the periprosthetic space. The device, composed of a 100 microm thick bioabsorbable membrane impregnated with 1.4 x 10(9) sub-micron particles of UHMWPE debris, is positioned on the endosteum of the bone prior to the insertion of the cemented orthopedic implant. An in vitro pullout study and an in vivo canine pilot study were performed to investigate its potential to accelerate "time to aseptic loosening" of cemented prosthetic joints. Pullout studies characterized the influence of the membrane on initial implant fixation. The tensile stresses (mean+/ required to withdraw a prosthesis cemented into canine femurs with and without the membrane were 1.15+/-0.3 and 1.54+/-0.01 MPa, respectively; these findings were not significantly different (p > 0.4). The in vivo pilot study, involving five dogs, was performed to evaluate the efficacy of the debris to accelerate loosening in a canine cemented hip arthroplasty. Aseptic loosening and lameness occurred within 12 months, quicker than the 30 months reported in a retrospective clinical review of canine hip arthroplasty.

  14. Primary hybrid THA using a polymethyl methacrylate-precoated stem: A single-center experience with a 10-year minimum follow-up.


    Kim, Wanlim; Yoon, Pil Whan; Kwak, Hong Suk; Yoo, Jeong Joon; Kim, Hee Joong; Yoon, Kang Sup


    The high failure rate of cemented femoral components in the 1970s facilitated the improvement of the cementing technique and surface finishes such as polymethylmethacrylate (PMMA)-precoated stems, reporting a survival rate of >95% at 10 years from some studies. However, controversy persists regarding whether precoated femoral stems are associated with a longer revision-free prosthesis survival. The purpose of this study was to evaluate the clinical and radiological outcomes of PMMA-precoated femoral stems, and analyze factors associated with implant survival. We retrospectively reviewed 73 primary hybrid total hip arthroplasties performed using PMMA-precoated femoral stems. The mean age of the patients was 61 years. During the mean follow-up period of 13 years, 18 hips (24.7%) underwent aseptic loosening, and all of the loosened stems were subjected to revision surgery 8.8 years (range 4.6-15.5 years) from the index surgery. Younger age and poor cementing were significantly associated with aseptic loosening (P = 0.013 and P < 0.001, respectively). However, the aseptic loosening rate was also high at 13.1% even with a good cementing technique. In conclusion, the PMMA-precoated stem failed to show expected advantages and needs to be replaced with other surface finish stem designs. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1300-1306, 2017. © 2016 Wiley Periodicals, Inc.

  15. [In-patient (early) rehabilitation].


    Wallesch, Claus-W; Lautenschläger, Sindy


    It is difficult to develop the financing and hospital provision of interventions for early rehabilitation within the diagnosis-related group (DRG) system. In addition to a range of partially rehabilitative complex interventions, the system recognizes three main forms of early rehabilitative interventions: geriatric, neurological/neurosurgical, and interdisciplinary and others. In this article, the appropriate definitions and cost-effectiveness of these procedures are analyzed and compared. The early rehabilitative interventions are characterized by constant cooperation in the therapeutic team, especially neurological early rehabilitation through the incorporation of nursing as a therapeutic profession. Whereas geriatric and neurological early rehabilitation are reflected in the DRG system, the former provided in many general hospitals and the latter mainly in specialized institutions, interdisciplinary early rehabilitation has only occasionally been represented in the DRG system so far. If all acute in-patients who require early rehabilitation should receive such an intervention, an additional fee must be implemented for this this interdisciplinary service.

  16. AWBATTM: Early Clinical Experience

    PubMed Central

    Vandenberg, Victoria B.


    Objective: The purpose of this article is to describe the early clinical experience with AWBAT. Methods: Burn patients requiring (1) donor sites or (2) treatment of a superficial burn wound injury were treated. A total of 45 patients with 69 distinct wounds were included. AWBATTM-D was evaluated in donor sites and AWBATTM-S was evaluated in superficial partial-thickness burns. Days to healing, pain, hematoma/seroma formation, and infection were noted. Ease of application, adherence, transparency, and physical adaptability details were collected. Results: Average period to healing of donor sites treated with AWBAT-D (n=22 patients with n=26 wounds) was 11.2 days, σ =1.95, with a range of 8–15 days and a median of 11 days. Pain rating at 24 hours was 1.2, σ =0.43 (n=18) and at 48 hours mean was 1.2, σ =0.46 (n=15). Average period to healing of superficial burns treated with AWBAT-S (n=15 patients with n=18 wounds) was 8.1 days, σ =2.48, with a range of 5–13 days and a median of 7 days. Pain rating at 24 hours was 1.5, σ =0.85 (n=10) and at 48 hours mean was 1.75, σ =0.89 (n=8). There was zero incidence of hematoma/seroma. No infections were seen. Results indicate that AWBAT was easily applied with good initial adherence. It was noted to be transparent, conformant, and pliable. Discussion: Early experience demonstrates that AWBAT performs well on donor sites and superficial partial-thickness burns and delivers the desired attributes of a temporary skin substitute including good adherence, infection control, transparency, adapatability, and pain control. PMID:20361005

  17. AWBAT: early clinical experience.


    Vandenberg, Victoria B


    The purpose of this article is to describe the early clinical experience with AWBAT. Burn patients requiring (1) donor sites or (2) treatment of a superficial burn wound injury were treated. A total of 45 patients with 69 distinct wounds were included. AWBAT-D was evaluated in donor sites and AWBAT-S was evaluated in superficial partial-thickness burns. Days to healing, pain, hematoma/seroma formation, and infection were noted. Ease of application, adherence, transparency, and physical adaptability details were collected. Average period to healing of donor sites treated with AWBAT-D (n=22 patients with n=26 wounds) was 11.2 days, sigma =1.95, with a range of 8-15 days and a median of 11 days. Pain rating at 24 hours was 1.2, sigma =0.43 (n=18) and at 48 hours mean was 1.2, sigma =0.46 (n=15). Average period to healing of superficial burns treated with AWBAT-S (n=15 patients with n=18 wounds) was 8.1 days, sigma =2.48, with a range of 5-13 days and a median of 7 days. Pain rating at 24 hours was 1.5, sigma =0.85 (n=10) and at 48 hours mean was 1.75, sigma =0.89 (n=8). There was zero incidence of hematoma/seroma. No infections were seen. Results indicate that AWBAT was easily applied with good initial adherence. It was noted to be transparent, conformant, and pliable. Early experience demonstrates that AWBAT performs well on donor sites and superficial partial-thickness burns and delivers the desired attributes of a temporary skin substitute including good adherence, infection control, transparency, adapatability, and pain control.

  18. Early clinical effects of the Dynesys system plus transfacet decompression through the Wiltse approach for the treatment of lumbar degenerative diseases

    PubMed Central

    Liu, Chao; Wang, Lei; Tian, Ji-wei


    Background This study investigated early clinical effects of Dynesys system plus transfacet decompression through the Wiltse approach in treating lumbar degenerative diseases. Material/Methods 37 patients with lumbar degenerative disease were treated with the Dynesys system plus transfacet decompression through the Wiltse approach. Results Results showed that all patients healed from surgery without severe complications. The average follow-up time was 20 months (9–36 months). Visual Analogue Scale and Oswestry Disability Index scores decreased significantly after surgery and at the final follow-up. There was a significant difference in the height of the intervertebral space and intervertebral range of motion (ROM) at the stabilized segment, but no significant changes were seen at the adjacent segments. X-ray scans showed no instability, internal fixation loosening, breakage, or distortion in the follow-up. Conclusions The Dynesys system plus transfacet decompression through the Wiltse approach is a therapeutic option for mild lumbar degenerative disease. This method can retain the structure of the lumbar posterior complex and the motion of the fixed segment, reduce the incidence of low back pain, and decompress the nerve root. PMID:24859831

  19. Consequences of early childbearing.


    Monroy De Velasco, A


    By 2000, developing countries will have an estimated 1 billion adolescents who are physically old enough to reproduce themselves but far too young to be responsible, healthy parents of healthy children. Governments must become involved in the issues surrounding adolescent pregnancy and both custom and the laws must change to reflect the needs of young people. The consequences of early childbearing are felt by society as well as the families directly affected. The incidence of births to very young women, both married and unmarried is growing; each year approximately 13 million children are born to young mothers. The percentage of live births to mothers under the age of 20 ranges from 20% in some African and Caribbean countries, to 10-15% in many Latin American countries, 5-10% in Asia, and 1% in Japan. Increased out-of-wedlock adolescent pregnancy is due to many factors: earlier sexual maturity from better childhood health and nutrition, a trend toward later marriage, increased opportunity for opposite sex interaction in schools and in the labor force, and rapid urbanization which weakens traditional family structures and social and cultural controls. Early childbirth is especially dangerous for adolescents and their infants. Compared to women between the ages of 20-35, pregnant women under 20 are at a greater risk for death and disease including bleeding during pregnancy, toxemia, hemorrhage, prolonged and difficult labor, severe anemia, and disability. Life-long social and economic disadvantages may be a consequence of teenage birth. Educational and career opportunities may be limited, as may be opportunities for marriage. Teen mothers tend to have larger completed family sizes, shorter birth intervals resulting in both poorer health status for the family, and a more severe level of poverty. The children also suffer; teens mothers have a higher incidence of low birth weight infants which is associated with birth injuries, serious childhood illness, and mental and

  20. The Early Experiments

    NASA Astrophysics Data System (ADS)

    Garvey, Gerald


    Stuart Freedman obtained his PhD at Berkley with an experimental thesis providing very strong evidence against theories requiring local hidden variables. He then came to Princeton in 1972 and began collaboration on a search for second-class currents. These measurements are quite difficult as the effects are the order of 1%, demonstrating Freedman's drive to take on hard but important experiments. After carrying out some relatively standard nuclear physics measurements he moved on to Stanford in 1976. There, Freedman was involved in identifying measurements sensitive to the existence of light axions. He also carried out searches for various exotica that might be produced from cosmic rays or the SLAC beam stop. During this time he was collaborating with us at Argonne investigating nuclear parity violation and time-like axial beta decay. In 1982 Freedman came to Argonne where he worked on fundamental issues in neutron beta decay. He also initiated what was to become one of his trademarks, demonstrating that surprising peaks in the e^+-e^- spectrum observed in very heavy ion collisions were spurious. He further launched his first neutrino oscillation experiment. This period of early research was marked by a remarkable diversity of subject matter and approach.

  1. Biosignatures of early earths

    NASA Technical Reports Server (NTRS)

    Pilcher, Carl B.


    A major goal of NASA's Origins Program is to find habitable planets around other stars and determine which might harbor life. Determining whether or not an extrasolar planet harbors life requires an understanding of what spectral features (i.e., biosignatures) might result from life's presence. Consideration of potential biosignatures has tended to focus on spectral features of gases in Earth's modern atmosphere, particularly ozone, the photolytic product of biogenically produced molecular oxygen. But life existed on Earth for about 1(1/2) billion years before the buildup of atmospheric oxygen. Inferred characteristics of Earth's earliest biosphere and studies of modern microbial ecosystems that share some of those characteristics suggest that organosulfur compounds, particularly methanethiol (CH(3)SH, the sulfur analog of methanol), may have been biogenic products on early Earth. Similar production could take place on extrasolar Earth-like planets whose biota share functional chemical characteristics with Earth life. Since methanethiol and related organosulfur compounds (as well as carbon dioxide) absorb at wavelengths near or overlapping the 9.6-microm band of ozone, there is potential ambiguity in interpreting a feature around this wavelength in an extrasolar planet spectrum.

  2. Early physics results.


    Jenni, Peter


    For the past year, experiments at the Large Hadron Collider (LHC) have started exploring physics at the high-energy frontier. Thanks to the superb turn-on of the LHC, a rich harvest of initial physics results have already been obtained by the two general-purpose experiments A Toroidal LHC Apparatus (ATLAS) and the Compact Muon Solenoid (CMS), which are the subject of this report. The initial data have allowed a test, at the highest collision energies ever reached in a laboratory, of the Standard Model (SM) of elementary particles, and to make early searches Beyond the Standard Model (BSM). Significant results have already been obtained in the search for the Higgs boson, which would establish the postulated electro-weak symmetry breaking mechanism in the SM, as well as for BSM physics such as Supersymmetry (SUSY), heavy new particles, quark compositeness and others. The important, and successful, SM physics measurements are giving confidence that the experiments are in good shape for their journey into the uncharted territory of new physics anticipated at the LHC.

  3. Biosignatures of early earths.


    Pilcher, Carl B


    A major goal of NASA's Origins Program is to find habitable planets around other stars and determine which might harbor life. Determining whether or not an extrasolar planet harbors life requires an understanding of what spectral features (i.e., biosignatures) might result from life's presence. Consideration of potential biosignatures has tended to focus on spectral features of gases in Earth's modern atmosphere, particularly ozone, the photolytic product of biogenically produced molecular oxygen. But life existed on Earth for about 1(1/2) billion years before the buildup of atmospheric oxygen. Inferred characteristics of Earth's earliest biosphere and studies of modern microbial ecosystems that share some of those characteristics suggest that organosulfur compounds, particularly methanethiol (CH(3)SH, the sulfur analog of methanol), may have been biogenic products on early Earth. Similar production could take place on extrasolar Earth-like planets whose biota share functional chemical characteristics with Earth life. Since methanethiol and related organosulfur compounds (as well as carbon dioxide) absorb at wavelengths near or overlapping the 9.6-microm band of ozone, there is potential ambiguity in interpreting a feature around this wavelength in an extrasolar planet spectrum.

  4. Early Childhood Diplomacy: Policy Planning for Early Childhood Development

    ERIC Educational Resources Information Center

    Vargas-Barón, Emily; Diehl, Kristel


    Children who are well nurtured, appropriately cared for, and provided with positive learning opportunities in their early years have a better chance of becoming healthy and productive citizens of nations and of the world. This article reviews the art and science of policy planning for early childhood development (ECD) from a diplomacy perspective.…

  5. Early Attachment Relationships and the Early Childhood Curriculum

    ERIC Educational Resources Information Center

    Cortazar, Alejandra; Herreros, Francisca


    This article explores the relationship between attachment theory and the early childhood curriculum. During the first years of life children develop early attachment relationships with their primary caregivers. These attachment relationships, either secure or insecure, will shape children's socio-emotional development. In the USA, the predominant…

  6. Wyoming Early Childhood Readiness Standards.

    ERIC Educational Resources Information Center

    Wyoming State Dept. of Education, Cheyenne.

    Because children entering kindergarten come with a variety of preschool and home experiences, and accordingly, with varying levels of school readiness, the Wyoming Early Childhood Readiness Standards have been developed to provide a more consistent definition of school readiness. The goal for the Standards is to provide early childhood educators…

  7. Promoting Health in Early Childhood

    ERIC Educational Resources Information Center

    Rossin-Slater, Maya


    Children who are healthy early in life--from conception to age five--not only grow up to be healthier adults, they are also better educated, earn more, and contribute more to the economy. The United States lags behind other advanced countries in early childhood health, threatening both the health of future generations and the nation's long-term…

  8. Invest in Early Childhood Education

    ERIC Educational Resources Information Center

    Kagan, Sharon Lynn; Reid, Jeanne L.


    The history of American early education is one of changing roles and goals. As federal engagement in early childhood has shifted in response to social, political, and economic needs, few policy efforts have focused on long-term planning or coordination. The authors identify the appropriate roles of federal, state, and local governments and make 13…

  9. Oaklahoma: Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012


    The Oklahoma Early Childhood Program uses public and private funds to enhance and expand high quality early care and education opportunities for children birth through age 3. The George Kaiser Family Foundation initiated the pilot in 2006 by matching state general revenue with private donations. Since that time, other private funders and providers…

  10. Biological aspects of early osteoarthritis.


    Madry, Henning; Luyten, Frank P; Facchini, Andrea


    Early OA primarily affects articular cartilage and involves the entire joint, including the subchondral bone, synovial membrane, menisci and periarticular structures. The aim of this review is to highlight the molecular basis and histopathological features of early OA. Selective review of literature. Risk factors for developing early OA include, but are not limited to, a genetic predisposition, mechanical factors such as axial malalignment, and aging. In early OA, the articular cartilage surface is progressively becoming discontinuous, showing fibrillation and vertical fissures that extend not deeper than into the mid-zone of the articular cartilage, reflective of OARSI grades 1.0-3.0. Early changes in the subchondral bone comprise a progressive increase in subchondral plate and subarticular spongiosa thickness. Early OA affects not only the articular cartilage and the subchondral bone but also other structures of the joint, such as the menisci, the synovial membrane, the joint capsule, ligaments, muscles and the infrapatellar fat pad. Genetic markers or marker combinations may become useful in the future to identify early OA and patients at risk. The high socioeconomic impact of OA suggests that a better insight into the mechanisms of early OA may be a key to develop more targeted reconstructive therapies at this first stage of the disease. Systematic review, Level II.

  11. 75 FR 20830 - Early Learning

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... meetings and written submissions, is seeking input from State agencies responsible for early learning and... intervention service providers and other providers of services to young children), students, technical... receive all written submissions of comments on the four early learning topics on or before 5 p.m...

  12. Nebraska: Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012


    Since 1999, Nebraska's Early Head Start Infant/Toddler Quality Initiative has supported Early Head Start (EHS) and community child care partnerships to improve the quality and professionalism of infant and toddler care. EHS programs apply to receive funding to establish partnerships with center-based or home-based child care.The initiative has…

  13. Teachers in Early Childhood Policy

    ERIC Educational Resources Information Center

    Kilderry, Anna


    This paper examines teacher accountability and authority in early childhood policy. It reports on data from a study that investigated the influences affecting early childhood teacher decision-making at the preschool level in Victoria, Australia. Using a question raised by Ball "Where are the teachers in all this [policy]?" provided a…

  14. Early Childhood Inclusion in Spain

    ERIC Educational Resources Information Center

    Giné, Climent; Balcells-Balcells, Anna; Cañadas, Margarita; Paniagua, Gema


    This article describes early childhood inclusion in educational settings in Spain. First, we address the legislative framework of preschool education in Spain and offer a brief analysis of some relevant issues, including the current situation of early childhood education and inclusion at this stage. Second, current policies and practices relating…

  15. Missouri: Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012


    Missouri's Early Head Start/Child Care Partnership Project expands access to Early Head Start (EHS) services for children birth to age 3 by developing partnerships between federal Head Start, EHS contractors, and child care providers. Head Start and EHS contractors that participate in the initiative provide services through community child care…

  16. Arizona Early Childhood Education Standards.

    ERIC Educational Resources Information Center

    Arizona State Dept. of Education, Phoenix.

    In an effort to provide a sound basis for educational accountability for preschool programs, the Arizona Early Childhood Education (ECE) Standards were developed as a framework for literacy-based programs for 3- and 4-year-olds and to provide parents with a basic understanding of indicators of early learning. These standards, to be adopted by…

  17. Unlocking the Future: Early Literacy.

    ERIC Educational Resources Information Center

    Blair, Leslie Asher, Ed.


    This newsletter of the Southwest Educational Development Laboratory (SEDL)contains a collection of articles which discuss various aspects of early literacy. Articles in the newsletter are: "Introduction: Reading Instruction, a Key to the Future"; "Ensuring Early Literacy through Coherent Instruction" (Leslie Blair);…

  18. Early Childhood Education in Taiwan.

    ERIC Educational Resources Information Center

    Barclay, Lisa K.


    Describes early childhood education in Taiwan, focusing on living patterns and child care arrangements, the position of the individual within the family and community, and the application of cultural norms to early childhood education. Compares the behavior of Chinese preschool children to that of American preschool children. (RJC)

  19. [Comparison of early clinical effects of two hip prosthesis designs between ceramics to ceramics and metal to polyethylene].


    Yang, Li-qing; Li, Xi; Fu, Qin; Wang, Cheng


    To retrospectively study early therapeutic effects of the ceramics to ceramics prosthesis design in treating hip disease. From October 2007 to September 2010, 42 patients (44 hips) with hip disease underwent replacement of total hip. Hip prosthesis designs included the Pinnacle ceramics to ceramics and the Duraloc metal to polyethylene,produced by DePuy Company, all were non-bone cement type of artificial hip joint. Twenty patients (22 hips) were performed with ceramics to ceramics total hip prosthesis (CoC group, there were 12 males and 8 females, aged from 21 to 49 years) and 22 patients (22 hips) were performed with metal to polyethylene total hip prosthesis (MoP group, there were 13 males and 9 females, aged from 42 to 55 years). All the surgical approachs were posterolateral, and the routine anticoagulation and the corresponding functional exercise were performed after operation. The follow-up time was 6 months at least including clinical and radiographic observation. Measured the motion of joint and evaluated the function of hip joint according to Harris classification. All clinical effects were satisfactory and no dislocation ,loosening,infection, deep venous thrombosis and other complications occurred. There was no statistical significance in Harris scoring and the motion of joint between two groups before and after operation (P>0.05). The clinical effect of ceramics to ceramics prosthesis design in improving clinical symptoms and the motion of joint is coordinate with metal to polyethylene total hip prosthesis, however, its advantages and long-term efficacy need further observing. The ceramics to ceramics prosthesis design may be a good choice for the young patients with hip disease because of its good wear resistance.

  20. Early osteoarthritis of the knee.


    Madry, Henning; Kon, Elizaveta; Condello, Vincenzo; Peretti, Giuseppe M; Steinwachs, Matthias; Seil, Romain; Berruto, Massimo; Engebretsen, Lars; Filardo, Giuseppe; Angele, Peter


    There is an increasing awareness on the importance in identifying early phases of the degenerative processes in knee osteoarthritis (OA), the crucial period of the disease when there might still be the possibility to initiate treatments preventing its progression. Early OA may show a diffuse and ill-defined involvement, but also originate in the cartilage surrounding a focal lesion, thus necessitating a separate assessment of these two entities. Early OA can be considered to include a maximal involvement of 50 % of the cartilage thickness based on the macroscopic ICRS classification, reflecting an OARSI grade 4. The purpose of this paper was to provide an updated review of the current status of the diagnosis and definition of early knee OA, including the clinical, radiographical, histological, MRI, and arthroscopic definitions and biomarkers. Based on current evidence, practical classification criteria are presented. As new insights and technologies become available, they will further evolve to better define and treat early knee OA.

  1. Growth hormone and early treatment.


    Antoniazzi, F; Cavarzere, P; Gaudino, R


    Growth hormone (GH) treatment is approved by the US Food and Drug Administration (FDA) not only for GH deficiency (GHD) but also for other childhood growth disorders with growth failure and/or short stature. GHD is the most frequent endocrine disorder presenting with short stature in childhood. During neonatal period, metabolic effects due to congenital GHD require a prompt replacement therapy to avoid possible life-threatening complications. In childhood and adolescence, growth impairment is the most evident effect of GHD and early treatment has the aim of restore normal growth and to reach normal adult height. We reassume in this review the conditions causing GHD and the diagnostic challenge to reach an early diagnosis, and an early treatment, necessary to obtain the best results. Finally, we summarize results obtained in clinical studies about pediatric patients with GHD treated at an early age, in which a marked early catch-up growth and a normalization of adult height were obtained.

  2. Why total knees fail-A modern perspective review.


    Lum, Zachary C; Shieh, Alvin K; Dorr, Lawrence D


    Historically, the most common mechanism of total knee arthroplasty (TKA) failures included aseptic loosening, instability and malalignment. As polyethylene production improved, modes of failure from polyethylene wear and subsequent osteolysis became less prevalent. Newer longitudinal studies report that infection has become the primary acute cause of failure with loosening and instability remaining as the overall greatest reasons for revision. Clinical database and worldwide national registries confirm these reports. With an increasing amount of TKA operations performed in the United States, and with focus on value-based healthcare, it is imperative to understand why total knees fail.

  3. Early Diagnosis and Early Intervention in Cerebral Palsy

    PubMed Central

    Hadders-Algra, Mijna


    This paper reviews the opportunities and challenges for early diagnosis and early intervention in cerebral palsy (CP). CP describes a group of disorders of the development of movement and posture, causing activity limitation that is attributed to disturbances that occurred in the fetal or infant brain. Therefore, the paper starts with a summary of relevant information from developmental neuroscience. Most lesions underlying CP occur in the second half of gestation, when developmental activity in the brain reaches its summit. Variations in timing of the damage not only result in different lesions but also in different neuroplastic reactions and different associated neuropathologies. This turns CP into a heterogeneous entity. This may mean that the best early diagnostics and the best intervention methods may differ for various subgroups of children with CP. Next, the paper addresses possibilities for early diagnosis. It discusses the predictive value of neuromotor and neurological exams, neuroimaging techniques, and neurophysiological assessments. Prediction is best when complementary techniques are used in longitudinal series. Possibilities for early prediction of CP differ for infants admitted to neonatal intensive care and other infants. In the former group, best prediction is achieved with the combination of neuroimaging and the assessment of general movements, in the latter group, best prediction is based on carefully documented milestones and neurological assessment. The last part reviews early intervention in infants developing CP. Most knowledge on early intervention is based on studies in high-risk infants without CP. In these infants, early intervention programs promote cognitive development until preschool age; motor development profits less. The few studies on early intervention in infants developing CP suggest that programs that stimulate all aspects of infant development by means of family coaching are most promising. More research is urgently needed



    David Storm; Govanon Nongbri; Steve Decanio


    The overall objective of this project is the three phase development of an Early Entrance Coproduction Plant (EECP) which uses petroleum coke to produce at least one product from at least two of the following three categories: (1) electric power (or heat), (2) fuels, and (3) chemicals using ChevronTexaco's proprietary gasification technology. The objective of Phase I is to determine the feasibility and define the concept for the EECP located at a specific site; develop a Research, Development, and Testing (RD&T) Plan to mitigate technical risks and barriers; and prepare a Preliminary Project Financing Plan. The objective of Phase IImore » is to implement the work as outlined in the Phase I RD&T Plan to enhance the development and commercial acceptance of coproduction technology. The objective of Phase III is to develop an engineering design package and a financing and testing plan for an EECP located at a specific site. The project's intended result is to provide the necessary technical, economic, and environmental information needed by industry to move the EECP forward to detailed design, construction, and operation. The partners in this project are Texaco Energy Systems LLC or TES (a subsidiary of ChevronTexaco), General Electric (GE), Praxair, and Kellogg Brown & Root (KBR) in addition to the U.S. Department of Energy (DOE). TES is providing gasification technology and Fischer-Tropsch (F-T) technology developed by Rentech, Inc., GE is providing combustion turbine technology, Praxair is providing air separation technology, and KBR is providing engineering. During Phase I, a design basis for the Fischer-Tropsch Synthesis section was developed based on limited experience with the specified feed gas and operating conditions. The objective of this Task in Phase II RD&T work was to confirm the performance of the F-T reactor at the set design conditions. Although much of the research, development, and testing work were done by TES outside of this project, several

  5. Early College, Early Success: Early College High School Initiative Impact Study

    ERIC Educational Resources Information Center

    Berger, Andrea; Turk-Bicakci, Lori; Garet, Michael; Song, Mengli; Knudson, Joel; Haxton, Clarisse; Zeiser, Kristina; Hoshen, Gur; Ford, Jennifer; Stephan, Jennifer; Keating, Kaeli; Cassidy, Lauren


    In 2002, the Bill & Melinda Gates Foundation launched the Early College High School Initiative (ECHSI) with the primary goal of increasing the opportunity for underserved students to earn a postsecondary credential. To achieve this goal, Early Colleges provide underserved students with exposure to, and support in, college while they are in…

  6. Implementing Obstetric Early Warning Systems.


    Friedman, Alexander M; Campbell, Mary L; Kline, Carolyn R; Wiesner, Suzanne; D'Alton, Mary E; Shields, Laurence E


    Severe maternal morbidity and mortality are often preventable and obstetric early warning systems that alert care providers of potential impending critical illness may improve maternal safety. While literature on outcomes and test characteristics of maternal early warning systems is evolving, there is limited guidance on implementation. Given current interest in early warning systems and their potential role in care, the 2017 Society for Maternal-Fetal Medicine (SMFM) Annual Meeting dedicated a session to exploring early warning implementation across a wide range of hospital settings. This manuscript reports on key points from this session. While implementation experiences varied based on factors specific to individual sites, common themes relevant to all hospitals presenting were identified. Successful implementation of early warnings systems requires administrative and leadership support, dedication of resources, improved coordination between nurses, providers, and ancillary staff, optimization of information technology, effective education, evaluation of and change in hospital culture and practices, and support in provider decision-making. Evolving data on outcomes on early warning systems suggest that maternal risk may be reduced. To effectively reduce maternal, risk early warning systems that capture deterioration from a broad range of conditions may be required in addition to bundles tailored to specific conditions such as hemorrhage, thromboembolism, and hypertension.

  7. Morphogenesis of early stage melanoma

    NASA Astrophysics Data System (ADS)

    Chatelain, Clément; Amar, Martine Ben


    Melanoma early detection is possible by simple skin examination and can insure a high survival probability when successful. However it requires efficient methods for identifying malignant lesions from common moles. This paper provides an overview first of the biological and physical mechanisms controlling melanoma early evolution, and then of the clinical tools available today for detecting melanoma in vivo at an early stage. It highlights the lack of diagnosis methods rationally linking macroscopic observables to the microscopic properties of the tissue, which define the malignancy of the tumor. The possible inputs of multiscale models for improving these methods are shortly discussed.

  8. [Treatment of open tile type C pelvic fractures by open reduction and internal fixation through anterior and posterior approaches at early stage].


    Li, Baichuan


    To explore the effectiveness of open reduction and internal fixation through anterior and posterior approaches in treatment of open Tile type C pelvic fractures at early stage. Between January 2009 and April 2012, 12 patients with open Tile C pelvic fractures were treated. There were 7 males and 5 females, aged 6-53 years (median, 31 years). Of 12 cases, 4 were classified as Tile type C1, 6 as Tile type C2, and 2 as Tile type C3; 5 were rated as Gustilo type II and 7 as Gustilo type III. The injury severity score was 18-57 (mean, 37.2). The interval of injury and admission ranged from 15 minutes to 3 days (median, 50 minutes). The debridement and external fixation were performed at first stage; then open reduction and internal fixation were used through anterior approach (reconstruction plate) and posterior approach (cannulated lag screws). The vacuum sealing drainage was performed during treatment until the wounds healed. Delayed healing of incison was obtained in 12 cases because of wound infection. Anatomical reduction or approximate anatomical reduction was achieved in all 12 cases. The patients were followed up 3-39 months (median, 18 months). No loosening of internal fixation or fracture displacement was observed during follow-up. The fracture healing time was 7-13 weeks (mean, 9.7 weeks). At last follow-up, according to the Matta standard, the outcome was excellent in 10 cases and good in 2 cases; according to Majeed score, the results were excellent in 9 cases, good in 1, and poor in 2. Early internal fixation operation of open Tile type C pelvic fractures can effectively restore the pelvic anatomical structure and stability, reduce the complication, and achieve satisfactory effectiveness.

  9. [Early management of cerebrovascular accidents].


    Libot, Jérômie; Guillon, Benoit


    A cerebrovascular accident requires urgent diagnosis and treatment.The management of a stroke must be early and adapted in order to improve the overall clinical outcome and lower the risk of mortality.

  10. Administrative Problems of Early Immersion.

    ERIC Educational Resources Information Center

    McGillivray, W. R.


    Administrative problems that have been solved or accepted during eight years of early immersion programs are discussed including choosing locations, staffing, costs, logistics, and the need for suitable pupil progress reporting. (JMF)

  11. Depression at an Early Age.

    ERIC Educational Resources Information Center

    Alper, Joseph


    Addresses the crisis associated with adolescent affective disorders and probes potential genetics, environmental, and physiological factors. Reviews case examples of depression, eating disorders, and suicide among youths. States clinical implications and advocates early diagnosis and treatment. (ML)

  12. Overview of Early Transfer Guidance

    EPA Pesticide Factsheets

    To implement Congressionally mandated action, the U.S. Environmental Protection Agency (EPA) has issued guidance on the transfer of federal property contaminated with hazardous wastes, before cleanup completion. This eplains the early transfer process

  13. FAA Loran early implementation project

    DOT National Transportation Integrated Search


    The Early Implementation Project (EIP), established by FAA Administrator Admiral : Donald C. Engen, was the initial step in the process of Loran integration into the : National Airsace System (NAS). The EIP was designed to give the FAA and the Loran ...

  14. Starting Early Starting Right Act

    THOMAS, 111th Congress

    Rep. Baldwin, Tammy [D-WI-2


    House - 02/23/2010 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  15. Rural Early Education Access Act

    THOMAS, 111th Congress

    Rep. Hare, Phil [D-IL-17


    House - 05/14/2009 Referred to the Subcommittee on Early Childhood, Elementary, and Secondary Education. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  16. NASA Early Career Fellowship Program

    NASA Astrophysics Data System (ADS)

    Smith, H. D.


    The Early Career Fellowship program was established in 2005 to facilitate the integration of outstanding early career planetary science researchers into established research funding programs by providing tools and experience useful to maintain a successful research program. Executing a successful research program requires a few key elements such as: successful proposal writing; adequate (paid) research time; management of a laboratory; collaboration and networking; frequent and high-quality publications; and adequate start-up equipment funds. These elements may be particularly critical for early career researchers searching for a tenure- track or equivalent position. The Early Career Fellowship program recognizes the importance of these skills and provides extra funding and resources to begin a successful research program. For consideration into The Early Career Fellowship program, the candidate needs to be the P. I. or Science P.I. of a funded research proposal from one of the participating R&A program areas, be within 7 years of earning a PhD, hold a non-tenure track position, and indicate the early career candidacy when submitting the research proposal. If the research proposal is funded and the discipline scientist nominates the candidate as an early career fellow, the candidate is then considered a Fellow and eligible to propose for Step 2. Upon obtaining a tenure-track equivalent position the Fellow submits a Step 2 proposal for up to one hundred thousand dollars in start-up funds. Start-up funds may be used for salary; undergraduate and/or graduate research assistants; supplies and instrument upgrades; travel to conferences, meetings, and advisory groups; time and travel for learning new skills; publication page charges; books and journal subscriptions; computer time and/or specialized software; and other justified research-specific needs. The early career fellowship program provides resources that a more established scientist would have acquired allowing

  17. Early Intervention in Bipolar Disorder.


    Vieta, Eduard; Salagre, Estela; Grande, Iria; Carvalho, André F; Fernandes, Brisa S; Berk, Michael; Birmaher, Boris; Tohen, Mauricio; Suppes, Trisha


    Bipolar disorder is a recurrent disorder that affects more than 1% of the world population and usually has its onset during youth. Its chronic course is associated with high rates of morbidity and mortality, making bipolar disorder one of the main causes of disability among young and working-age people. The implementation of early intervention strategies may help to change the outcome of the illness and avert potentially irreversible harm to patients with bipolar disorder, as early phases may be more responsive to treatment and may need less aggressive therapies. Early intervention in bipolar disorder is gaining momentum. Current evidence emerging from longitudinal studies indicates that parental early-onset bipolar disorder is the most consistent risk factor for bipolar disorder. Longitudinal studies also indicate that a full-blown manic episode is often preceded by a variety of prodromal symptoms, particularly subsyndromal manic symptoms, therefore supporting the existence of an at-risk state in bipolar disorder that could be targeted through early intervention. There are also identifiable risk factors that influence the course of bipolar disorder, some of them potentially modifiable. Valid biomarkers or diagnosis tools to help clinicians identify individuals at high risk of conversion to bipolar disorder are still lacking, although there are some promising early results. Pending more solid evidence on the best treatment strategy in early phases of bipolar disorder, physicians should carefully weigh the risks and benefits of each intervention. Further studies will provide the evidence needed to finish shaping the concept of early intervention. AJP AT 175 Remembering Our Past As We Envision Our Future April 1925: Interpretations of Manic-Depressive Phases Earl Bond and G.E. Partridge reviewed a number of patients with manic-depressive illness in search of a unifying endo-psychic conflict. They concluded that understanding either phase of illness was "elusive" and

  18. Early presentation of primary glioblastoma.


    Faguer, R; Tanguy, J-Y; Rousseau, A; Clavreul, A; Menei, P


    Clinical and neuroimaging findings of glioblastomas (GBM) at an early stage have rarely been described and those tumors are most probably under-diagnosed. Furthermore, their genetic alterations, to our knowledge, have never been previously reported. We report the clinical as well as neuroimaging findings of four early cases of patients with GBM. In our series, early stage GBM occurred at a mean age of 57 years. All patients had seizures as their first symptom. In all early stages, MRI showed a hyperintense signal on T2-weighted sequences and an enhancement on GdE-T1WI sequences. A hyperintense signal on diffusion sequences with a low ADC value was also found. These early observed occurrences of GBM developed rapidly and presented the MRI characteristics of classic GBM within a few weeks. The GBM size was multiplied by 32 in one month. Immunohistochemical analysis indicated the de novo nature of these tumors, i.e. absence of mutant IDH1 R132H protein expression, which is a diagnostic marker of low-grade diffuse glioma and secondary GBM. A better knowledge of early GBM presentation would allow a more suitable management of the patients and may improve their prognosis. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  19. Natural course of early COPD.


    Rhee, Chin Kook; Kim, Kyungjoo; Yoon, Hyoung Kyu; Kim, Jee-Ae; Kim, Sang Hyun; Lee, Sang Haak; Park, Yong Bum; Jung, Ki-Suck; Yoo, Kwang Ha; Hwang, Yong Il


    Few studies have examined the natural course of early COPD. The aim of this study was to observe the natural course of early COPD patients. We also aimed to analyze medical utilization and costs for early COPD during a 6-year period. Patients with early COPD were selected from Korean National Health and Nutrition Examination Survey (KNHANES) data. We linked the KNHANES data of patients with early COPD to National Health Insurance data. A total of 2,397 patients were enrolled between 2007 and 2012. The mean forced expiratory volume in 1 second (FEV 1 ) was 78.6%, and the EuroQol five dimensions questionnaire (EQ-5D) index value was 0.9. In total, 110 patients utilized health care for COPD in 2007, and this number increased to 179 in 2012. The total mean number of days used per person increased from 4.9 in 2007 to 7.8 in 2012. The total medical cost per person also increased from 248.8 US dollar (USD) in 2007 to 780.6 USD in 2013. A multiple linear regression revealed that age, lower body mass index, lower FEV 1 (%), and lower EQ-5D score were significantly associated with medical costs. Even in early COPD patients, some of them eventually progressed and utilized health care for COPD.

  20. [Autism: An early neurodevelopmental disorder].


    Bonnet-Brilhault, F


    With approximately 67 million individuals affected worldwide, autism spectrum disorder (ASD) is the fastest growing neurodevelopmental disorder (United Nations, 2011), with a prevalence estimated to be 1/100. In France ASD affects approximately 600,000 individuals (from childhood to adulthood, half of whom are also mentally retarded), who thus have a major handicap in communication and in adapting to daily life, which leads autism to be recognized as a national public health priority. ASD is a neurodevelopmental disorder that affects several domains (i.e., socio-emotional, language, sensori-motor, executive functioning). These disorders are expressed early in life with an age of onset around 18 months. Despite evidence suggesting a strong genetic link with ASD, the genetic determinant remains unclear. The clinical picture is characterized by impairments in social interaction and communication and the presence of restrictive and repetitive behaviors (DSM-5, ICD-10). However, in addition to these two main dimensions there is significant comorbidity between ASD and other neurodevelopmental disorders such as attention deficit hyperactivity disorder or with genetic and medical conditions. One of the diagnostic features of ASD is its early emergence: symptoms must begin in early childhood for a diagnosis to be given. Due to brain plasticity, early interventions are essential to facilitate clinical improvement. Therefore, general practitioners and pediatricians are on the front line to detect early signs of ASD and to guide both medical explorations and early rehabilitation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. An in vivo study on the effect of coating stability on osteointegration performance of collagen/hyaluronic acid multilayer modified titanium implants.


    Ao, Haiyong; Zong, Jiajia; Nie, Yanjiao; Wan, Yizao; Zheng, Xiebin


    Aseptic loosening of implant is one of the main causes of Ti-based implant failure. In our previous work, a novel stable collagen/hyaluronic acid (Col/HA) multilayer modified titanium coatings (TCs) was developed by layer-by-layer (LBL) covalent immobilization technique, which showed enhanced biological properties compared with TCs that were physically absorbed with Col/HA multilayer in vitro . In this study, a rabbit model with femur condyle defect was employed to compare the osteointegration performance of them. Results indicated that Col/HA multilayer with favourable stability could better facilitate osteogenesis around implants and bone-implant contact. The Col/HA multilayer covalent-immobilized TC may reduce aseptic loosening of implant.


    PubMed Central

    Gallo, Jiri; Goodman, Stuart B.; Konttinen, Yrjö T.; Wimmer, Markus A.; Holinka, Martin


    Aseptic loosening and other wear-related complications are one of the most frequent late reasons for revision of total knee arthroplasty (TKA). Periprosthetic osteolysis (PPOL) predates aseptic loosening in many cases indicating the clinical significance of this pathogenic mechanism. A variety of implant-, surgery-, and host-related factors have been delineated to explain the development of PPOL. These factors influence the development of PPOL due to changes in mechanical stresses within the vicinity of the prosthetic device, excessive wear of the polyethylene liner, and joint fluid pressure and flow acting on the peri-implant bone. The process of aseptic loosening is initially governed by factors such as implant/limb alignment, device fixation quality, and muscle coordination/strength. Later large numbers of wear particles detached from TKAs trigger and perpetuate particle disease, as highlighted by progressive growth of inflammatory/granulomatous tissue around the joint cavity. An increased accumulation of osteoclasts at the bone-implant interface, an impairment of osteoblast function, mechanical stresses, and an increased production of joint fluid contribute to bone resorption and subsequent loosening of the implant. In addition, hypersensitivity and adverse reactions to metal debris may contribute to aseptic TKA failure but should be determined more precisely. Patient activity level appears to be the most important factor when the long-term development of PPOL is considered. Surgical technique, implant design, and material factors are the most important preventative factors because they influence both the generation of wear debris and excessive mechanical stresses. New generations of bearing surfaces and designs for TKA should carefully address these important issues in extensive preclinical studies. Currently, there is little evidence that PPOL can be prevented with pharmacological interventions. PMID:23669623

  3. [The development of research in tribology of artificial joints].


    Dai, Zhendong; Gong, Juanqing


    Aseptic loosening of the prosthesis is a major form for the failure of artificial joints, which results in the conglomeration of wear particles at the bone-implant interface. This paper briefly reviews the recent development of tribology of artificial joints preserving good lubrication, enhancing the wear resistance of materials for the joints, reducing the generation of sensitive-size particles and depressing the debris-tissue reactions. Suggestion for improvement in the design of artificial joints is presented.

  4. Debonding of porous coating of a threaded acetabular component: retrieval analysis.


    Łapaj, Łukasz; Markuszewski, Jacek; Rybak, Tomasz; Wierusz-Kozłowska, Małgorzata


    This report presents a case of debonding of plasma sprayed porous titanium coating from a threaded acetabular component which caused aseptic loosening of the implant. Weight bearing after delamination caused abrasive damage of the acetabular shell, and particles of the coating embedded in the acetabular liner. Microscopic examination of periprosthetic tissues showed presence of metal particles and macrophage infiltration. Despite microscopic examination of the retrieved component the cause of debonding remains unclear. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Treatment of early Parkinson's disease.


    Pahwa, Rajesh; Lyons, Kelly E


    This review summarizes currently available treatment options and treatment strategies, investigational treatments, and the importance of exercise for early Parkinson's disease. The available treatment options for early Parkinson's disease have changed little in the past decade and include carbidopa/levodopa, dopamine agonists, and monoamine oxidase type B (MAO-B) inhibitors. However, we discuss changes in treatment strategies, including dosing and the use of combination therapy used in an attempt to reduce or delay the appearance of motor complications and other adverse events. We will also review several investigational treatments that have shown promise for the treatment of early Parkinson's disease, including a new extended release formulation of carbidopa/levodopa (IPX066), safinamide which inhibits MAO-B, dopamine uptake and glutamate and pardoprunox which is a 5HT-1A agonist and a partial dopamine agonist. Finally, we discuss recent studies focusing on exercise as an important component in the management of early Parkinson's disease. Advances in the management of early Parkinson's disease include evolving treatment strategies, new investigational treatments, and earlier implementation of various forms of exercise.

  6. Telomere lengthening early in development.


    Liu, Lin; Bailey, Susan M; Okuka, Maja; Muñoz, Purificación; Li, Chao; Zhou, Lingjun; Wu, Chao; Czerwiec, Eva; Sandler, Laurel; Seyfang, Andreas; Blasco, Maria A; Keefe, David L


    Stem cells and cancer cells maintain telomere length mostly through telomerase. Telomerase activity is high in male germ line and stem cells, but is low or absent in mature oocytes and cleavage stage embryos, and then high again in blastocysts. How early embryos reset telomere length remains poorly understood. Here, we show that oocytes actually have shorter telomeres than somatic cells, but their telomeres lengthen remarkably during early cleavage development. Moreover, parthenogenetically activated oocytes also lengthen their telomeres, thus the capacity to elongate telomeres must reside within oocytes themselves. Notably, telomeres also elongate in the early cleavage embryos of telomerase-null mice, demonstrating that telomerase is unlikely to be responsible for the abrupt lengthening of telomeres in these cells. Coincident with telomere lengthening, extensive telomere sister-chromatid exchange (T-SCE) and colocalization of the DNA recombination proteins Rad50 and TRF1 were observed in early cleavage embryos. Both T-SCE and DNA recombination proteins decrease in blastocyst stage embryos, whereas telomerase activity increases and telomeres elongate only slowly. We suggest that telomeres lengthen during the early cleavage cycles following fertilization through a recombination-based mechanism, and that from the blastocyst stage onwards, telomerase only maintains the telomere length established by this alternative mechanism.

  7. [Early mobilization. Competencies, responsibilities, milestones].


    Nydahl, P; Dewes, M; Dubb, R; Filipovic, S; Hermes, C; Jüttner, F; Kaltwasser, A; Klarmann, S; Klas, K; Mende, H; Rothaug, O; Schuchhardt, D


    Early mobilization is an evident, interprofessional concept to improve the outcome of intensive care patients. It reduces psychocognitive deficits and delirium and attenuates a general deconditioning, including atrophy of the respiratory pump and skeletal muscles. In this regard the interdisciplinary approach of early mobilization, taking into account different levels of mobilization, appears to be beneficial. The purpose of this study was to explore opinions on collaboration and tasks between different professional groups. During the 25th Bremen Conference on Intensive Medicine and Nursing on 20 February 2015, a questionnaire survey was carried out among the 120 participants of the German Early Mobilization Network meeting. In all, 102 questionnaires were analyzed. Most participants reported on the interdisciplinarity of the approach, but none of the tasks and responsibilities concerning early mobilization can be assigned to a single professional group. The practical implementation of mobilizing orally intubated patients may require two registered nurses as well as a physical therapist. Implementation in daily practice seems to be heterogeneous. There is no consensus regarding collaboration, competencies, and responsibilities with respect to early mobilization of intensive care patients. The approach to date has been characterized by a lack of interprofessional communication, which may lead to an inefficient use of the broad and varied base of knowledge and experienceof the different professions.

  8. Rat Models and Identification of Candidate Early Serum Biomarkers of Battlefield Traumatic Brain Injury

    DTIC Science & Technology


    brain injury) All surgeries were performed using aseptic technique. Animals were checked for pain /distress immediately prior to anesthesia/surgery... Pain /distress checks were performed at 3, 6, 12, 24, 36, 48, 60, and 72 hours post-injury. Fluid Percussion Injury (FPI) For animals in the...NIH), and Neurobehavioral Scale (NBS). The criteria used to obtain the scores are detailed in Tables 2 and 3. As an additional endpoint, we also

  9. Early traumatic events in psychopaths.


    Borja, Karina; Ostrosky, Feggy


    The relationship between diverse early traumatic events and psychopathy was studied in 194 male inmates. Criminal history transcripts were revised, and clinical interviews were conducted to determine the level of psychopathy using the Psychopathy Checklist-Revised (PCL-R) Form, and the Early Trauma Inventory was applied to assess the incidence of abuse before 18 years of age. Psychopathic inmates presented a higher victimization level and were more exposed to certain types of intended abuse than sociopathic inmates, while the sum of events and emotional abuse were associated with the PCL-R score. Our studies support the influence of early adverse events in the development of psychopathic offenders. © 2013 American Academy of Forensic Sciences.

  10. Early recognition of growth abnormalities permitting early intervention

    Normal growth is a sign of good health. Monitoring for growth disturbances is fundamental to children's health care. Early detection and diagnosis of the causes of short stature allows management of underlying medical conditions, optimizing attainment of good health and normal adult height. This rev...

  11. Do Early Outs Work Out? Teacher Early Retirement Incentive Plans.

    ERIC Educational Resources Information Center

    Brown, Herb R.; Repa, J. Theodore


    School districts offer teacher early retirement incentive plans (TERIPs) as an opportunity to hire less expensive teachers, reduce fringe benefits costs, and eliminate teaching positions. Discusses reasons for teachers to accept TERIP, and describes a computer model that allows school officials to calculate and compare costs incurred if an…

  12. Brachytherapy in early prostate cancer--early experience.


    Jose, B O; Bailen, J L; Albrink, F H; Steinbock, G S; Cornett, M S; Benson, D C; Schmied, W K; Medley, R N; Spanos, W J; Paris, K J; Koerner, P D; Gatenby, R A; Wilson, D L; Meyer, R


    Use of brachytherapy with radioactive seeds in the management of early prostate cancer is commonly used in the United States. The early experience has been reported from the prostate treatment centers in Seattle for the last 10 years. In this manuscript we are reporting our early experience of 150 radioactive seed implantations in early stage prostate cancer using either Iodine 125 or Palladium 103 seeds. The average age of the patient is 66 years and the median Gleason score is 5.4 with a median PSA of 6. A brief description of the evolution of the treatment of prostate cancer as well as the preparation for the seed implantation using the volume study with ultrasound of the prostate, pubic arch study using CT scan of the pelvis and the complete planning using the treatment planning computers are discussed. We also have described the current technique which is used in our experience based on the Seattle guidelines. We plan a follow-up report with the results of the studies with longer follow-up.

  13. Early Literacy and Early Numeracy: The Value of Including Early Literacy Skills in the Prediction of Numeracy Development

    ERIC Educational Resources Information Center

    Purpura, David J.; Hume, Laura E.; Sims, Darcey M.; Lonigan, Cristopher J.


    The purpose of this study was to examine whether early literacy skills uniquely predict early numeracy skills development. During the first year of the study, 69 3- to 5-year-old preschoolers were assessed on the Preschool Early Numeracy Skills (PENS) test and the Test of Preschool Early Literacy Skills (TOPEL). Participants were assessed again a…

  14. Biomechanics of Early Cardiac Development

    PubMed Central

    Goenezen, Sevan; Rennie, Monique Y.


    Biomechanics affect early cardiac development, from looping to the development of chambers and valves. Hemodynamic forces are essential for proper cardiac development, and their disruption leads to congenital heart defects. A wealth of information already exists on early cardiac adaptations to hemodynamic loading, and new technologies, including high resolution imaging modalities and computational modeling, are enabling a more thorough understanding of relationships between hemodynamics and cardiac development. Imaging and modeling approaches, used in combination with biological data on cell behavior and adaptation, are paving the road for new discoveries on links between biomechanics and biology and their effect on cardiac development and fetal programming. PMID:22760547

  15. Early and late retirement exits.


    Brougham, Ruby R; Walsh, David A


    The current study proposes that personal need fulfillment (relatedness, generativity, identity, growth, and finances) predicts early and late retirement intentions. The personal needs of 160 full-time older employees were measured by personal goals, job satisfactions, job characteristics, and intrinsic motivation. Results suggest that the personal needs fulfilled by job employment remain important in retirement. The expectation for personal need fulfillment for identity, growth, and relatedness shifts from work to retirement for those who intend to retire early. The results are discussed in terms of the need for greater study of the relationship between expectations of personal need fulfillment, worker self-concept, and retirement decisions.

  16. Early Planetary Differentiation: Comparative Planetology

    NASA Technical Reports Server (NTRS)

    Jones, John H.


    We currently have extensive data for four different terrestrial bodies of the inner solar system: Earth, the Moon, Mars, and the Eucrite Parent Body [EPB]. All formed early cores; but all(?) have mantles with elevated concentrations of highly sidero-phile elements, suggestive of the addition of a late "veneer". Two appear to have undergone extensive differentiation consistent with a global magma ocean. One appears to be inconsistent with a simple model of "low-pressure" chondritic differentiation. Thus, there seems to be no single, simple paradigm for understand-ing early differentiation.

  17. Effects of Prosthesis Stem Tapers on Stress Distribution of Cemented Hip Arthroplasty

    NASA Astrophysics Data System (ADS)

    Abdullah, Abdul Halim; Nor, Mohd Asri Mohd; Saman, Alias Mohd; Tamin, Mohd Nasir; Kadir, Mohammed Rafiq Abdul


    Aseptic loosening effects are critical issues in encouraging long term stability of cemented hip arthroplasty. Stress shielding is believed to be an important factor that contributes to the aseptic loosening problems. The numerous changes in the prosthesis stem design are intended to minimize the stress shielding and aseptic loosening problems and to improve the long term performance of the implants. In this study, the stress distribution in cemented hip arthroplasty is established using finite element method. The taper of the prosthesis is designed to be 3° at anterior/posterior, 3° at medial/lateral and 10° from wide lateral to narrow medial. Major muscle loads and contact forces are simulated for walking (toe-off phase) and stair climbing load cases. Effects of prosthesis stem tapers on the resulting stress distribution are investigated. Results show that compressive stress dominates in the medial plane while tensile stress in the lateral plane of the femur. The corresponding stress levels of intact femur for walking and stair-climbing load cases are 22 and 29 MPa, respectively. The magnitude of Tresca stress for the THA femur in stair-climbing load case remains higher in the region of 85 MPa while the walking load case induces around 40 MPa. The stress range in the straight and single taper stem prosthesis is lower than 260 MPa, while localized Tresca stress is in the order of the yield strength of Ti-6Al-4V alloy for double and triple taper stem design.

  18. Assessment of modified gold surfaced titanium implants on skeletal fixation

    PubMed Central

    Zainali, Kasra; Danscher, Gorm; Jakobsen, Thomas; Baas, Jorgen; Møller, Per; Bechtold, Joan E.; Soballe, Kjeld


    Noncemented implants are the primary choice for younger patients undergoing total hip replacements. However, the major concern in this group of patients regarding revision is the concern from wear particles, periimplant inflammation, and subsequently aseptic implant loosening. Macrophages have been shown to liberate gold ions through the process termed dissolucytosis. Furthermore, gold ions are known to act in an anti-inflammatory manner by inhibiting cellular NF-κB-DNA binding. The present study investigated whether partial coating of titanium implants could augment early osseointegration and increase mechanical fixation. Cylindrical porous coated Ti-6Al-4V implants partially coated with metallic gold were inserted in the proximal region of the humerus in ten canines and control implants without gold were inserted in contralateral humerus. Observation time was 4 weeks. Biomechanical push out tests and stereological histomorphometrical analyses showed no statistically significant differences in the two groups. The unchanged parameters are considered an improvement of the coating properties, as a previous complete gold-coated implant showed inferior mechanical fixation and reduced osseointegration compared to control titanium implants in a similar model. Since sufficient early mechanical fixation is achieved with this new coating, it is reasonable to investigate the implant further in long-term studies. PMID:22847873

  19. Assessment of modified gold surfaced titanium implants on skeletal fixation.


    Zainali, Kasra; Danscher, Gorm; Jakobsen, Thomas; Baas, Jorgen; Møller, Per; Bechtold, Joan E; Soballe, Kjeld


    Noncemented implants are the primary choice for younger patients undergoing total hip replacements. However, the major concern in this group of patients regarding revision is the concern from wear particles, periimplant inflammation, and subsequently aseptic implant loosening. Macrophages have been shown to liberate gold ions through the process termed dissolucytosis. Furthermore, gold ions are known to act in an anti-inflammatory manner by inhibiting cellular NF-κB-DNA binding. The present study investigated whether partial coating of titanium implants could augment early osseointegration and increase mechanical fixation. Cylindrical porous coated Ti-6Al-4V implants partially coated with metallic gold were inserted in the proximal region of the humerus in ten canines and control implants without gold were inserted in contralateral humerus. Observation time was 4 weeks. Biomechanical push out tests and stereological histomorphometrical analyses showed no statistically significant differences in the two groups. The unchanged parameters are considered an improvement of the coating properties, as a previous complete gold-coated implant showed inferior mechanical fixation and reduced osseointegration compared to control titanium implants in a similar model. Since sufficient early mechanical fixation is achieved with this new coating, it is reasonable to investigate the implant further in long-term studies. Copyright © 2012 Wiley Periodicals, Inc.

  20. The minimal invasive direct anterior approach in combination with large heads in total hip arthroplasty - is dislocation still a major issue? a case control study.


    Hoell, Steffen; Sander, Marius; Gosheger, Georg; Ahrens, Helmut; Dieckmann, Ralf; Hauschild, Gregor


    There have been increasing numbers of publications in recent years on minimally invasive surgery (MIS) for total hip arthroplasty (THA), reporting results with the use of different head sizes, tribologic and functional outcomes. This study presents the results and early complication rates after THA using the direct anterior approach (DAA) in combination with head sizes ≥ 36 mm. A total of 113 patients with THA were included in the study. The Harris Hip Score (HHS) was determined, a radiographic evaluation was carried out, and complications were recorded. The minimum follow-up period was 2 years (means 35 ± 7 months). The HHS improved from 43.6 (± 12) to 88.2 (± 14; P < 0.01). One early infection occurred, one periprosthetic fracture, and three cases of aseptic stem loosening. No incorrect positioning of the implants was observed, and there were no dislocations. THA with the minimally invasive DAA in combination with large heads is associated with good to very good functional results in the majority of cases. The complication rates are not increased. The rate of dislocation mainly as an complication of the first two years can be markedly reduced in particular.

  1. Cross-linked compared with historical polyethylene in THA: an 8-year clinical study.


    Geerdink, Carel H; Grimm, Bernd; Vencken, Wendy; Heyligers, Ide C; Tonino, Alphons J


    Wear particle-induced osteolysis is a major cause of aseptic loosening in THA. Increasing wear resistance of polyethylene (PE) occurs by increasing the cross-link density and early reports document low wear rates with such implants. To confirm longer-term reductions in wear we compared cross-linked polyethylene (irradiation in nitrogen, annealing) with historical polyethylene (irradiation in air) in a prospective, randomized clinical study involving 48 patients who underwent THAs with a minimum followup of 7 years (mean, 8 years; range, 7-9 years). The insert material was the only variable. The Harris hip score, radiographic signs of osteolysis, and polyethylene wear were recorded annually. Twenty-three historical and 17 moderately cross-linked polyethylene inserts were analyzed (five patients died, three were lost to followup). At 8 years, the wear rate was lower for cross-linked polyethylene (0.088 +/- 0.03 mm/year) than for the historical polyethylene (0.142 +/- 0.07 mm/year). This reduction (38%) did not diminish with time (33% at 5 years). Acetabular cyst formation was less frequent (39% versus 12%), affected fewer DeLee and Charnley zones (17% versus 4%), and was less severe for the cross-linked polyethylene. The only revision was for an aseptically loose cup in the historical polyethylene group. Moderately cross-linked polyethylene maintained its wear advantage with time and produced less osteolysis, showing no signs of aging at mid-term followup. Level I, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

  2. 10-year results of the uncemented Allofit press-fit cup in young patients.


    Streit, Marcus R; Weiss, Stefan; Andreas, Franziska; Bruckner, Thomas; Walker, Tilman; Kretzer, J Philippe; Ewerbeck, Volker; Merle, Christian


    Uncemented acetabular components in primary total hip arthroplasty (THA) are commonly used today, but few studies have evaluated their survival into the second decade in young and active patients. We report on a minimum 10-year follow-up of an uncemented press-fit acetabular component that is still in clinical use. We examined the clinical and radiographic results of our first 121 consecutive cementless THAs using a cementless, grit-blasted, non-porous, titanium alloy press-fit cup (Allofit; Zimmer Inc., Warsaw, IN) without additional screw fixation in 116 patients. Mean age at surgery was 51 (21-60) years. Mean time of follow-up evaluation was 11 (10-12) years. At final follow-up, 8 patients had died (8 hips), and 1 patient (1 hip) was lost to follow-up. 3 hips in 3 patients had undergone acetabular revision, 2 for deep infection and 1 for aseptic acetabular loosening. There were no impending revisions at the most recent follow-up. We did not detect periacetabular osteolysis or loosening on plain radiographs in those hips that were evaluated radiographically (n = 90; 83% of the hips available at a minimum of 10 years). Kaplan-Meier survival analysis using revision of the acetabular component for any reason (including isolated inlay revisions) as endpoint estimated the 11-year survival rate at 98% (95% CI: 92-99). Uncemented acetabular fixation using the Allofit press-fit cup without additional screws was excellent into early in the second decade in this young and active patient cohort. The rate of complications related to the liner and to osteolysis was low.

  3. Surface Functionalization of Orthopedic Titanium Implants with Bone Sialoprotein

    PubMed Central

    Ritz, Ulrike; Ackermann, Angelika; Anthonissen, Joris; Kaufmann, Kerstin B.; Brendel, Christian; Götz, Hermann; Rommens, Pol M.; Hofmann, Alexander


    Orthopedic implant failure due to aseptic loosening and mechanical instability remains a major problem in total joint replacement. Improving osseointegration at the bone-implant interface may reduce micromotion and loosening. Bone sialoprotein (BSP) has been shown to enhance bone formation when coated onto titanium femoral implants and in rat calvarial defect models. However, the most appropriate method of BSP coating, the necessary level of BSP coating, and the effect of BSP coating on cell behavior remain largely unknown. In this study, BSP was covalently coupled to titanium surfaces via an aminosilane linker (APTES), and its properties were compared to BSP applied to titanium via physisorption and untreated titanium. Cell functions were examined using primary human osteoblasts (hOBs) and L929 mouse fibroblasts. Gene expression of specific bone turnover markers at the RNA level was detected at different intervals. Cell adhesion to titanium surfaces treated with BSP via physisorption was not significantly different from that of untreated titanium at any time point, whereas BSP application via covalent coupling caused reduced cell adhesion during the first few hours in culture. Cell migration was increased on titanium disks that were treated with higher concentrations of BSP solution, independent of the coating method. During the early phases of hOB proliferation, a suppressive effect of BSP was observed independent of its concentration, particularly when BSP was applied to the titanium surface via physisorption. Although alkaline phosphatase activity was reduced in the BSP-coated titanium groups after 4 days in culture, increased calcium deposition was observed after 21 days. In particular, the gene expression level of RUNX2 was upregulated by BSP. The increase in calcium deposition and the stimulation of cell differentiation induced by BSP highlight its potential as a surface modifier that could enhance the osseointegration of orthopedic implants. Both

  4. Choctaw Culture Early Education Activities.

    ERIC Educational Resources Information Center

    Brescia, William, Ed.; Reeves, Carolyn, Ed.; Skinner, Linda, Ed.

    An effort to better prepare Choctaw youngsters for kindergarten, the Choctaw Culture Early Education Program developed a resource of 58 activities adapted to meet the needs of Choctaw 3- and 4-year olds. The activities are divided into four sections pertaining to getting started, relating to five project publications (How the Flowers Came to Be,…

  5. Reduplication Facilitates Early Word Segmentation

    ERIC Educational Resources Information Center

    Ota, Mitsuhiko; Skarabela, Barbora


    This study explores the possibility that early word segmentation is aided by infants' tendency to segment words with repeated syllables ("reduplication"). Twenty-four nine-month-olds were familiarized with passages containing one novel reduplicated word and one novel non-reduplicated word. Their central fixation times in response to…

  6. Bullying in Early Educational Settings

    ERIC Educational Resources Information Center

    Kirves, Laura; Sajaniemi, Nina


    The aim of this research was to study the prevalence of bullying in early educational settings in Finnish kindergartens. In addition, the study investigated whether bullying in kindergartens differs from school bullying and what forms bullying takes among under-school-age children. Two kinds of data were collected for the study: data from a survey…

  7. Music Experiences in Early Childhood.

    ERIC Educational Resources Information Center

    Andress, Barbara

    This book presents a program of music experiences for young children (3-5-year-olds) which focuses on an experiential discovery approach to music, rather than on imposing ideas and a repertoire on the child. Early sections of the book discuss the importance of the child-centered music program, its process and characteristics, and the role of the…

  8. The Integrated Early Childhood Curriculum.

    ERIC Educational Resources Information Center

    Krogh, Suzanne

    This textbook provides an outline of an integrated curriculum for early childhood education. Part 1 discusses the human element in school: the child and the teacher and child development. Part 2 contains the curriculum itself and covers the subjects of language, mathematics, science, social studies, art, music, and movement. Guidelines provide…

  9. Maine: Early Head Start Initiatives

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012


    Maine has two initiatives that build on Early Head Start (EHS). The first initiative, Fund for a Healthy Maine, has since 2001 provided tobacco settlement money to existing Head Start and EHS programs to expand the number of children who receive full-day, full-year services. Local programs have the option of using these funds for EHS, depending on…

  10. Minnesota: Early Head Start Initiatiive

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012


    Minnesota provides supplemental state funding to existing federal Head Start and Early Head Start (EHS) grantees to increase their capacity to serve additional infants, toddlers, and pregnant women. The initiative was started in 1997 when the state legislature earmarked $1 million of the general state Head Start supplemental funds for children…

  11. Early Diagnosis of Breast Cancer.


    Wang, Lulu


    Early-stage cancer detection could reduce breast cancer death rates significantly in the long-term. The most critical point for best prognosis is to identify early-stage cancer cells. Investigators have studied many breast diagnostic approaches, including mammography, magnetic resonance imaging, ultrasound, computerized tomography, positron emission tomography and biopsy. However, these techniques have some limitations such as being expensive, time consuming and not suitable for young women. Developing a high-sensitive and rapid early-stage breast cancer diagnostic method is urgent. In recent years, investigators have paid their attention in the development of biosensors to detect breast cancer using different biomarkers. Apart from biosensors and biomarkers, microwave imaging techniques have also been intensely studied as a promising diagnostic tool for rapid and cost-effective early-stage breast cancer detection. This paper aims to provide an overview on recent important achievements in breast screening methods (particularly on microwave imaging) and breast biomarkers along with biosensors for rapidly diagnosing breast cancer.

  12. Physical Education in Early Childhood

    ERIC Educational Resources Information Center

    Stork, Steve; Sanders, Stephen W.


    This article examines the incidence and quality of physical activity instruction during early childhood. Although the positive effect of physical activity on the cognitive, social, and physical development of young children is generally acknowledged, there is little emphasis nationally on ensuring appropriate physical educational experiences…

  13. Early Childhood: Child, Teacher, Parent

    ERIC Educational Resources Information Center

    Baroody, Christie


    The field of early childhood holds promising keys to unlocking many of the mysteries in learning. Educators in the field, given the right tools, have the potential to have a profound impact on the long-term success of their students. The design of this curriculum comes directly out of the incredible possibilities set in motion while exploring…

  14. Early Signs of Entrepreneurial Giftedness

    ERIC Educational Resources Information Center

    Shavinina, Larisa V.


    Although successful entrepreneurship is important for the economic prosperity of any society, one should acknowledge that entrepreneurial giftedness is terra incognita from a research viewpoint. This article analyzes early manifestations of entrepreneurial giftedness in the cases of Richard Branson, Michael Dell, and Bill Gates and thus opens a…

  15. Early Childhood Inclusion in Croatia

    ERIC Educational Resources Information Center

    Ljubešic, Marta; Šimleša, Sanja


    This article explains early childhood inclusion in Croatia from its beginnings up to challenges in current policy and practice. The first preschool education for children with disabilities dates back to the 1980s and was provided in special institutions. In the last 10 years, mainstream kindergartens have been enrolling children with disabilities…

  16. The Early Intervention Family Alliance

    ERIC Educational Resources Information Center

    Romanick, Roxane


    In late 2005, individuals from across the country traveled to attend the national Office of Special Education Conference on Early Childhood in Washington, DC. Connected by networking at the conference, a group of parents with children with special needs left committed to collaboratively formulate a plan to create a family-centered and…

  17. Early Lessons in Restructuring Schools.

    ERIC Educational Resources Information Center

    Lieberman, Ann; And Others

    Restructuring schools has become a rallying cry among educators. It aims to create schools that are more centered on learner's needs for active, experiential, cooperative, and culturally connected learning opportunities supportive of individual talents and learning styles. This report is based on an early evaluation of the process of restructuring…

  18. The Early Years: "Life" Science

    ERIC Educational Resources Information Center

    Ashbrook, Peggy


    Talking about death as part of a life cycle is often ignored or spoken about in hushed tones in early childhood. Books with "life cycle" in the title often do not include the death of the living organism in the information about the cycle. The concept of a complete life cycle does not appear in "A Framework for K-12 Science…

  19. The Early Study Abroad Trend

    ERIC Educational Resources Information Center

    Ly, Phuong


    A growing number of South Korean students are going to an English-speaking country as teenagers to escape from the grueling, test-oriented Korean schools in hopes of gaining entry into American universities. American colleges and universities are starting to see more of these "early study abroad students," as they are called in South…

  20. Early and Late Retirement Exits

    ERIC Educational Resources Information Center

    Brougham, Ruby R.; Walsh, David A.


    The current study proposes that personal need fulfillment (relatedness, generativity, identity, growth, and finances) predicts early and late retirement intentions. The personal needs of 160 full-time older employees were measured by personal goals, job satisfactions, job characteristics, and intrinsic motivation. Results suggest that the personal…

  1. Language in Early Childhood Education.

    ERIC Educational Resources Information Center

    Cazden, Courtney B., Ed.

    Eight articles about oral language education for preschool children are presented. They are: (1) a point of view on oral language education--"Suggestions from Studies of Early Language Acquisition,""Language Programs for Young Children: Notes from England and Wales," and "The Issue of Structure," by Courtney Cazden; (2) suggestions for curriculum…

  2. Vantage point - Early warning flaws.


    Swinden, Donna


    USING AN EARLY warning score (EWS) system should improve the detection of acutely deteriorating patients. Under such a system, a score is allocated to each of six physiological measurements including respiratory rate and oxygen saturations, which are aggregated to produce an overall score. An aggregated score of seven or higher prompts nursing staff to refer a patient for emergency assessment.

  3. IDEA and Early Childhood Inclusion.

    ERIC Educational Resources Information Center

    Smith, Barbara J.; Rapport, Mary Jane K.

    This paper discusses 1997 amendments to the Individuals with Disabilities Education Act (IDEA) that promote the inclusion of children with disabilities in general early childhood education settings. The evolution of inclusion policy is explored and changes in disability terminology are described. Amended provisions are then explained and include:…

  4. Boys' Bodies in Early Childhood

    ERIC Educational Resources Information Center

    Drummond, Murray


    This paper is based on qualitative research data from a project investigating early childhood boys' constructions of masculinities in relation to sport, health and the body. The focus group data, with 33 boys, has been collected in each of the boys' first three years at school. It is part of the data that will be collected over eight years with…

  5. Teaching Caregivers in Early Intervention

    ERIC Educational Resources Information Center

    Sawyer, Brook E.; Campbell, Philippa H.


    The overarching research aim of this study was to examine learning opportunities available for caregivers during early intervention sessions. Of specific interest were providers' purposeful (i.e., explicit) teaching behaviors and opportunities from which caregivers might learn incidentally. Relations between teaching behaviors, caregiver…

  6. FUNdamental Movement in Early Childhood.

    ERIC Educational Resources Information Center

    Campbell, Linley


    Noting that the development of fundamental movement skills is basic to children's motor development, this booklet provides a guide for early childhood educators in planning movement experiences for children between 4 and 8 years. The booklet introduces a wide variety of appropriate practices to promote movement skill acquisition and increased…

  7. Early Children's Literature and Aging

    ERIC Educational Resources Information Center

    McGuire, Sandra L.


    Increased longevity is a worldwide phenomenon placing emphasis on the need for preparation for life's later years. Today's children will be the older adults of tomorrow. A resource that can help to educate them about aging and prepare them for the long life ahead is early children's literature (Preschool-Primary). This literature can provide…

  8. An early Cambrian greenhouse climate.


    Hearing, Thomas W; Harvey, Thomas H P; Williams, Mark; Leng, Melanie J; Lamb, Angela L; Wilby, Philip R; Gabbott, Sarah E; Pohl, Alexandre; Donnadieu, Yannick


    The oceans of the early Cambrian (~541 to 509 million years ago) were the setting for a marked diversification of animal life. However, sea temperatures-a key component of the early Cambrian marine environment-remain unconstrained, in part because of a substantial time gap in the stable oxygen isotope (δ 18 O) record before the evolution of euconodonts. We show that previously overlooked sources of fossil biogenic phosphate have the potential to fill this gap. Pristine phosphatic microfossils from the Comley Limestones, UK, yield a robust δ 18 O signature, suggesting sea surface temperatures of 20° to 25°C at high southern paleolatitudes (~65°S to 70°S) between ~514 and 509 million years ago. These sea temperatures are consistent with the distribution of coeval evaporite and calcrete deposits, peak continental weathering rates, and also our climate model simulations for this interval. Our results support an early Cambrian greenhouse climate comparable to those of the late Mesozoic and early Cenozoic, offering a framework for exploring the interplay between biotic and environmental controls on Cambrian animal diversification.

  9. Early Childhood Intervention in China

    ERIC Educational Resources Information Center

    Zheng, Yuzhu; Maude, Susan P.; Brotherson, Mary Jane


    With rapid economic development and increasing awareness of the importance of early childhood intervention (ECI), China is re-examining its social and educational practices for young children with disabilities. This re-examination may have a significant impact on young children with disabilities in China. It may also set an example for other…

  10. The Early Years: Integrating Design

    ERIC Educational Resources Information Center

    Ashbrook, Peggy; Nellor, Sue


    Engineering is such a common part of children's work in early childhood programs that teachers can simply look around the room to identify examples where students have engaged in engineering practices. This article presents a classroom activity that integrates engineering design by building on the everyday problems that young children encounter in…


    ERIC Educational Resources Information Center



  12. The Climate of Early Mars

    NASA Astrophysics Data System (ADS)

    Wordsworth, Robin D.


    The nature of the early martian climate is one of the major unanswered questions of planetary science. Key challenges remain, but a new wave of orbital and in situ observations and improvements in climate modeling have led to significant advances over the past decade. Multiple lines of geologic evidence now point to an episodically warm surface during the late Noachian and early Hesperian periods 3-4 Ga. The low solar flux received by Mars in its first billion years and inefficiency of plausible greenhouse gases such as CO2 mean that the steady-state early martian climate was likely cold. A denser CO2 atmosphere would have caused adiabatic cooling of the surface and hence migration of water ice to the higher-altitude equatorial and southern regions of the planet. Transient warming caused melting of snow and ice deposits and a temporarily active hydrological cycle, leading to erosion of the valley networks and other fluvial features. Precise details of the warming mechanisms remain unclear, but impacts, volcanism, and orbital forcing all likely played an important role. The lack of evidence for glaciation across much of Mars's ancient terrain suggests the late Noachian surface water inventory was not sufficient to sustain a northern ocean. Though mainly inhospitable on the surface, early Mars may nonetheless have presented significant opportunities for the development of microbial life.

  13. Curriculum in Early Childhood Education.

    ERIC Educational Resources Information Center

    Bernard Van Leer Foundation, The Hague (Netherlands).

    At a seminar on Compensatory Early Childhood Education held in Jerusalem in the fall of 1972 the idea of compensatory education and its viability in cross cultural terms was examined in conjunction with a critical review of the whole notion of social and cultural disadvantage. Twenty-two participants from international governmental organizations…

  14. The Early Years: Mixing Materials

    ERIC Educational Resources Information Center

    Ashbrook, Peggy


    Engaging children's interest, inspiring active exploration of materials, and fostering cooperation between children and adults is the best way to promote the construction of knowledge. Some popular early childhood activities can be expanded to provide experiences and time for children to build on their prior knowledge. This column discusses…

  15. Early Learning Theories Made Visible

    ERIC Educational Resources Information Center

    Beloglovsky, Miriam; Daly, Lisa


    Go beyond reading about early learning theories and see what they look like in action in modern programs and teacher practices. With classroom vignettes and colorful photographs, this book makes the works of Jean Piaget, Erik Erikson, Lev Vygotsky, Abraham Maslow, John Dewey, Howard Gardner, and Louise Derman-Sparks visible, accessible, and easier…

  16. Regional Early Childhood Policy Review

    ERIC Educational Resources Information Center

    Evans, Judith


    The UNESCO-UNICEF joint regional policy review project was launched in September 2006 with the aim to support the countries of Asia-Pacific region in meeting the first goal of Education For All (EFA) on Early Childhood Care and Education (ECCE) by identifying, documenting and sharing good practices as well as constraints and challenges in early…

  17. Maryland Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012


    Since 2000, Maryland has provided state supplemental funds to Head Start and Early Head Start (EHS) programs to improve access. Local EHS programs may use funds, through child care partnerships, to extend the EHS day or year. Maryland's approach to building on EHS includes: (1) Increase the capacity of existing Head Start and EHS programs to…

  18. Handbook of Early Childhood Education

    ERIC Educational Resources Information Center

    Pianta, Robert C., Ed.


    Comprehensive and authoritative, this forward-thinking book reviews the breadth of current knowledge about early education and identifies important priorities for practice and policy. Robert C. Pianta and his associates bring together foremost experts to examine what works in promoting all children's school readiness and social-emotional…

  19. Early Childhood Inclusion in Australia

    ERIC Educational Resources Information Center

    Kemp, Coral R.


    From the introduction of early intervention services in Australian in the mid-1970s, the families of children with intellectual and multiple disabilities have been encouraged to enroll their children in local preschools and childcare centers. Children with disabilities have also accessed a range of alternatives to full inclusion, such as reverse…

  20. Early Childhood Educator's Nutrition Handbook.

    ERIC Educational Resources Information Center

    Olson, Christine; And Others

    This nutrition handbook is designed to provide enough information on nutrition and food habits to enable early childhood educators to add a nutrition dimension to children's learning activities. Topics covered are the role of nutrition in growth during the preschool years; nutrients and their functions; selecting a healthy diet; common nutritional…

  1. ABCs of Early Mathematics Experiences

    ERIC Educational Resources Information Center

    Hensen, Laurie E.


    Children begin to develop mathematical thinking before they enter school. Art, baking, playing with blocks, counting numbers, games, puzzles, singing, playing with pretend money, water play all these early mathematical experiences help the children to learn in the elementary school years.

  2. Kansas: Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012


    Kansas Early Head Start (KEHS) provides comprehensive services following federal Head Start Program Performance Standards for pregnant women and eligible families with children from birth to age 4. KEHS was implemented in 1998 using Child Care and Development Block Grant (CCDBG) quality set-aside dollars augmented by a transfer of federal…

  3. Do Schools Begin Too Early?

    ERIC Educational Resources Information Center

    Edwards, Finley


    School start times vary considerably, both across the nation and within individual communities, with some schools beginning earlier than 7:30 a.m. and others after 9:00 a.m. Proponents of later start times, who have received considerable media attention in recent years, argue that many students who have to wake up early for school do not get…

  4. Early Career Teacher Professional Learning

    ERIC Educational Resources Information Center

    McCormack, Ann; Gore, Jennifer; Thomas, Kaye


    Becoming a teacher requires not only the development of a professional identity but the construction of professional knowledge and practice through continued professional learning. This study tracked a sample group of 16 early career teachers through their first year of teaching. The participants were encouraged to write about their experiences in…

  5. HPLC: Early and Recent Perspectives.

    ERIC Educational Resources Information Center

    Karger, Barry L.


    Provides a perspective on what it was like in the early days of high-performance liquid chromatography (HPLC) and several of the key developments. Focuses on the advances in HPLC generally, and more specifically for the biological sciences, that were necessary for the method to reach the preeminent stage of today. Contains 20 references. (JRH)

  6. Films in Early Childhood Education.

    ERIC Educational Resources Information Center

    Cooke, Gary, Comp.

    This annotated bibliography provides descriptions of films concerning child development and various approaches to early childhood education. Some are for classroom use, and others are intended as guides and resource materials for teachers. Attachments give addresses and phone numbers of film distributors and addresses, managers and phone number of…

  7. Creative Abilities in Early Childhood

    ERIC Educational Resources Information Center

    Prieto, Maria Dolores; Parra, Joaquin; Ferrando, Mercedes; Ferrandiz, Carmen; Bermejo, Maria Rosario; Sanchez, Cristina


    The aim of this study is to explore creativity in Spanish children during their early years and to explore differences regarding gender and age. We have used a sample of 285 children between five and seven years old. To measure their creativity we used the Torrance Test of Creative Thinking (TTCT). We have used the test of figured expression that…

  8. Early Childhood Inclusion in Israel

    ERIC Educational Resources Information Center

    Al-Yagon, Michal; Aram, Dorit; Margalit, Malka


    This article describes conceptual aspects, current policies and practices, and research representing the Israeli perspective regarding early childhood inclusion (ECI) at preschool ages (3-6 years). We review legislative, historical, attitudinal, philosophical, practical, empirical, and cultural issues regarding ECI in Israel. Finally, we focus on…

  9. Suicidal Behavior among Early Adolescents.

    ERIC Educational Resources Information Center

    Gover, F. Jill

    There is a great deal of concern about teenage suicide. This study obtained a prevalence rate of suicidal behaviors among non-psychiatric early adolescents (ages 11-16) and investigated personal and family variables that may characterize the young teenagers who report varying degrees of suicidal behavior. A self-report questionnaire was…

  10. Documentary Elements in Early Films.

    ERIC Educational Resources Information Center

    Sanderson, Richard A.

    Focusing on documentary elements, this study examines the film content and film techniques of 681 motion pictures produced in the United States prior to 1904. Analysis of films by type, subject matter, and trends in subject matter shows that one-third of the early films are documentary in type and three-fourths of the films use subject matter of a…

  11. Early Childhood Education in Scandinavia.

    ERIC Educational Resources Information Center

    Austin, Gilbert R.; Dittman, Laura

    This article discusses the move toward greater equality of educational opportunity in Scandinavia with particular emphasis on early childhood education. The increasing demand for preschool education in Denmark, Finland, Norway and Sweden is related to low birth rates together with increased employment of women and the general demand for equality…

  12. The Early Childhood Coaching Handbook

    ERIC Educational Resources Information Center

    Rush, Dathan D.; Shelden, M'Lisa L.


    Evidence-based and highly effective, "coaching" helps early childhood practitioners support other professionals and families as they enhance existing knowledge, develop new skills, and promote healthy development of young children. This hands-on guide shows professionals how to conduct skillful coaching in any setting--home, school, or community.…

  13. Loosening up and Letting Go: Circulating Technology in Support of a Merged Organization

    ERIC Educational Resources Information Center

    Furlong, Katherine


    Lafayette College is an undergraduate, private liberal arts and engineering school in Easton, Pennsylvania. In 2005, Lafayette rededicated its newly renovated library, complete with shared library/instructional technology facilities and a media studio. As originally envisioned, instructional technology (ITech) would have its own separate service…

  14. Comparative Analysis of Screw Loosening With Prefabricated Abutments and Customized CAD/CAM Abutments.


    Paek, Janghyun; Woo, Yi-Hyung; Kim, Hyeong-Seob; Pae, Ahran; Noh, Kwantae; Lee, Hyeonjong; Kwon, Kung-Rock


    The aim of this study was to determine the stability of computer-aided design and manufacturing (CAD/CAM) and prefabricated abutment by measuring removal torque before and after cyclic loading. Three types of fixture and 2 types of abutments were used. Removable torque was measured after cyclic loading for 5000 cycles between 25 and 250 N for each group. The same procedure was performed twice. First, removal torque values (Newton centimeter) were measured for stock versus custom abutments as follows: group 1: 27.17 versus 26.67, group 2: 26.27 versus 26.33, and group 3: 37.33 versus 36.67. Second removal torque values (Newton centimeter) were also measured: group 1: 23 versus 23.5, group 2: 22.5 versus 22.33, and group 3: 32.67 versus 32.5. There was no significant difference between the stock and custom abutments in either the first or second removal torque values and also no significant difference among initial tightening torque, first or second removal torque (P > 0.05). With precise control of CAD/CAM abutments, good screw joint stability can be achieved.

  15. Evaluation of screw loosening on new abutment screws and after successive tightening.


    Barbosa, Gustavo Seabra; Silva-Neto, João Paulo da; Simamoto-Júnior, Paulo Cezar; Neves, Flávio Domingues das; Mattos, Maria da Gloria Chiarello de; Ribeiro, Ricardo Faria


    This study evaluated the loss of the torque applied after use of new screws and after successive tightening. Four infrastructures (IE), using UCLA castable abutment type, were cast in cobalt-chromium alloy and new abutment screws (G1) were used in a first moment. Subsequently, the same abutment screws were used a second time (G2) and more than two times (G3). The values of the torques applied and detorques were measured with a digital torque wrench to obtain the values of initial tightening loss (%). Data were analyzed by ANOVA and Tukey's test (?=0.05). Significant differences were observed between the G1 (50.71% ± 11.36) and G2 (24.01% ± 3.33) (p=0.000) and between G1 (50.71% ± 11.36) and G3 (25.60% ± 4.64) (p=0.000). There was no significant difference between G2 and G3 (p=0.774). Within the limitations of the study, it may be concluded that the percentage of the initial torque loss is lower when screws that already suffered the application of an initial torque were used, remaining stable after application of successive torques.

  16. The influence of abutment angulation on screw loosening of implants in the anterior maxilla.


    Ha, Chun-Yeo; Lim, Yung-Jun; Kim, Myung-Joo; Choi, Jung-Han


    This study compared the removal torque values (RTVs) of different abutments (straight, angled, and gold premachined UCLA-type) in external- and internal-hex implants after dynamic cyclic loading with the clinical situation of the anterior maxilla simulated. An ideal cast of a maxilla with a missing right central incisor was fabricated in dental stone, and an implant analog was embedded in this model at a 15-degree angle labial to the long axis of the left central incisor. Thirty external-hex and 30 internal-hex implants were used. A total of 10 straight abutments, 10 angled abutments, and 10 gold premachined UCLA-type abutments of each system and 60 abutment screws were tested. Initial RTVs were measured after each assembly was tightened to 30 Ncm. Straight abutments and angled abutments were prepared and gold-premachined UCLA-type abutments were waxed and cast with low-fusing gold alloy for the central incisor. RTVs were then measured again. After each assembly was tightened, a metal crown was temporarily cemented. After cyclic loading of 20 to 200 N was applied 1 million times, RTVs were measured for a third time. Statistical analysis (alpha = .05) was performed to evaluate the results. The angled abutment group showed significantly higher RTVs than the straight abutment and gold premachined UCLA-type abutment groups in external-hex implants. However, no significant difference in RTVs was found among abutments in internal-hex implants. The time of analysis of RTV was found to significantly influence mean RTVs. Mean RTVs of external- and internal-hex implants showed significant differences. Within the limitations of this study, there were significant differences in RTVs among different abutment groups in external-hex implants. There were no significant differences in RTVs among different abutment groups in internal-hex implants.

  17. Imaging monitored loosening of dense fibrous tissues using high-intensity pulsed ultrasound

    NASA Astrophysics Data System (ADS)

    Yeh, Chia-Lun; Li, Pai-Chi; Shih, Wen-Pin; Huang, Pei-Shin; Kuo, Po-Ling


    Pulsed high-intensity focused ultrasound (HIFU) is proposed as a new alternative treatment for contracture of dense fibrous tissue. It is hypothesized that the pulsed-HIFU can release the contracted tissues by attenuating tensile stiffness along the fiber axis, and that the stiffness reduction can be quantitatively monitored by change of B-mode images. Fresh porcine tendons and ligaments were adapted to an ex vivo model and insonated with pulsed-HIFU for durations ranging from 5 to 30 min. The pulse length was 91 µs with a repetition frequency of 500 Hz, and the peak rarefactional pressure was 6.36 MPa. The corresponding average intensities were kept around 1606 W cm-2 for ISPPA and 72.3 W cm-2 for ISPTA. B-mode images of the tissues were acquired before and after pulsed-HIFU exposure, and the changes in speckle intensity and organization were analyzed. The tensile stiffness of the HIFU-exposed tissues along the longitudinal axis was examined using a stretching machine. Histology examinations were performed by optical and transmission electron microscopy. Pulsed-HIFU exposure significantly decreased the tensile stiffness of the ligaments and tendons. The intensity and organization of tissue speckles in the exposed region were also decreased. The speckle changes correlated well with the degree of stiffness alteration. Histology examinations revealed that pulsed-HIFU exposure probably damages tissues via a cavitation-mediated mechanism. Our results suggest that pulsed-HIFU with a low duty factor is a promising tool for developing new treatment strategies for orthopedic disorders.

  18. [Early career of Michael Sendivogius].


    Prinke, Rafał T


    One of the most influential alchemical authors of the early modern period was Michael Sendivogius whose early life is shrouded in mystery. He may be labelled the most famous Polish scientific writer between Copernicus and Marie Skłodowska-Curie, but because of the difficulties involved in researching the biography of any alchemist, there has been relatively little interest in him among Polish historians. The early work of Roman Bugaj (author of the still fundamental monograph) and Włodzimierz Hubicki (who made his research available to the international community) has been continued only by the English-born Zbigniew Szydło and the author of this article. The roots of many legends about Sendivogius were three mid-17th century short biographies, none of which is trustworthy, so it is crucial to verify the received myth and the version constructed in the 1960's and 1970's with primary sources and evidence from the recent "new historiography of alchemy". The present article examines them in the light of newly discovered sources and reinterpretation of the old ones. The genealogy of the Sedzimir family is discussed at length to show that Sendivogius most probably was not its member but only a pretender in order to assume (or prove) the status of a nobleman. Several possible hypotheses about his origins are presented. He is known to have studied at three universities (Leipzig, Vienna and Altdorf) but authors of early panegyrics dedicated to Sendivogius list more universities which he may have attended. The most interesting is that of Cambridge, listed as the first one, because practically no Poles or Czechs went there at the time. Finally, his marriage to Veronica Stiebar, a wealthy widow of a Franconian knightly family, and her interesting family relationships (links to Erasmus, Camerarius, Paracelsus and the original Doctor Faustus) are discussed. The period covered is that before Sendivogius moved to Prague in about 1597, having already been a courtier of Rudolf II

  19. Freshwater Fossil Pearls from the Nihewan Basin, Early Early Pleistocene.


    Li, Su-Ping; Yao, Pei-Yi; Li, Jin-Feng; Ferguson, David Kay; Min, Long-Rui; Chi, Zhen-Qing; Wang, Yong; Yao, Jian-Xin; Sha, Jin-Geng


    Fossil blister pearls attached to the shells of an Anodonta mollusk from China, early Early Pleistocene, are reported here for the first time. The pearls were investigated in detail using a variety of methods. Micro-CT scanning of the fossil pearls was carried out to discover the inner structure and the pearl nucleus. Using CTAn software, changes in the gray levels of the biggest pearl, which reflect the changing density of the material, were investigated. The results provide us with some clues on how these pearls were formed. Sand grains, shell debris or material with a similar density could have stimulated the development of these pearls. X-ray diffraction analysis of one fossil pearl and the shell to which it was attached reveals that only aragonite exists in both samples. The internal structures of our fossil shells and pearls were investigated using a Scanning Electron Microscope. These investigations throw some light on pearl development in the past.

  20. Famines in Africa: is early warning early enough?

    PubMed Central

    Kim, Jeeyon Janet; Guha-Sapir, Debarati


    Following the second Sahelian famine in 1984–1985, major investments were made to establish Early Warning Systems. These systems help to ensure that timely warnings and vulnerability information are available to decision makers to anticipate and avert food crises. In the recent crisis in the Horn of Africa, alarming levels of acute malnutrition were documented from March 2010, and by August 2010, an impending food crisis was forecast. Despite these measures, the situation remained unrecognised, and further deteriorated causing malnutrition levels to grow in severity and scope. By the time the United Nations officially declared famine on 20 July 2011, and the humanitarian community sluggishly went into response mode, levels of malnutrition and mortality exceeded catastrophic levels. At this time, an estimated 11 million people were in desperate and immediate need for food. With warnings of food crises in the Sahel, South Sudan, and forecast of the drought returning to the Horn, there is an immediate need to institutionalize change in the health response during humanitarian emergencies. Early warning systems are only effective if they trigger an early response. PMID:22745628