Does early paternal involvement predict offspring developmental diagnoses?

PubMed

Jackson, Dylan B; Newsome, Jamie; Beaver, Kevin M

2016-12-01

A long line of research has illustrated that fathers play an important role in the development of their children. Few studies, however, have examined the impact of paternal involvement at the earliest stages of life on developmental diagnoses in childhood. The present study extends this line of research by exploring the possibility that paternal involvement prenatally, postnatally, and at the time of birth may influence offspring risk for various diagnoses in childhood. A quasi-experimental, propensity score matching design was used to create treatment and control groups to assess the relationship between paternal involvement at each stage of development and developmental diagnoses. Approximately 6000 children, and a subsample of fathers, who participated in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B). Activity, attention and learning, speech or language, and other diagnoses in early childhood, and overall number of diagnoses at 4years of age. We find no consistent evidence that low paternal involvement prenatally or postnatally increases the risk of various developmental diagnoses by age 4. However, children whose fathers were absent at the time of their birth were at significantly greater risk of incurring various developmental diagnoses, as well as a significantly greater number of developmental diagnoses. The findings expand our understanding of exactly how early paternal influence begins and the specific dimensions of early father behaviors that are related to the risk of various developmental diagnoses. Ultimately, these results have important implications concerning father involvement during the earliest stages of the life course. Copyright © 2016. Published by Elsevier Ireland Ltd.

Developmental Transcriptome Analysis and Identification of Genes Involved in Larval Metamorphosis of the Razor Clam, Sinonovacula constricta.

PubMed

Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale

2016-04-01

The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.

Identifying candidate genes affecting developmental time in Drosophila melanogaster: pervasive pleiotropy and gene-by-environment interaction

PubMed Central

Mensch, Julián; Lavagnino, Nicolás; Carreira, Valeria Paula; Massaldi, Ana; Hasson, Esteban; Fanara, Juan José

2008-01-01

Background Understanding the genetic architecture of ecologically relevant adaptive traits requires the contribution of developmental and evolutionary biology. The time to reach the age of reproduction is a complex life history trait commonly known as developmental time. In particular, in holometabolous insects that occupy ephemeral habitats, like fruit flies, the impact of developmental time on fitness is further exaggerated. The present work is one of the first systematic studies of the genetic basis of developmental time, in which we also evaluate the impact of environmental variation on the expression of the trait. Results We analyzed 179 co-isogenic single P[GT1]-element insertion lines of Drosophila melanogaster to identify novel genes affecting developmental time in flies reared at 25°C. Sixty percent of the lines showed a heterochronic phenotype, suggesting that a large number of genes affect this trait. Mutant lines for the genes Merlin and Karl showed the most extreme phenotypes exhibiting a developmental time reduction and increase, respectively, of over 2 days and 4 days relative to the control (a co-isogenic P-element insertion free line). In addition, a subset of 42 lines selected at random from the initial set of 179 lines was screened at 17°C. Interestingly, the gene-by-environment interaction accounted for 52% of total phenotypic variance. Plastic reaction norms were found for a large number of developmental time candidate genes. Conclusion We identified components of several integrated time-dependent pathways affecting egg-to-adult developmental time in Drosophila. At the same time, we also show that many heterochronic phenotypes may arise from changes in genes involved in several developmental mechanisms that do not explicitly control the timing of specific events. We also demonstrate that many developmental time genes have pleiotropic effects on several adult traits and that the action of most of them is sensitive to temperature during

Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

PubMed Central

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-01-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously

Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

PubMed

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-09-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored

Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

2008-07-01

Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some

Child Maltreatment and Children's Developmental Trajectories in Early- to Middle-Childhood

PubMed Central

Font, Sarah A.; Berger, Lawrence M.

2014-01-01

Associations between experiencing child maltreatment and adverse developmental outcomes are widely studied, yet conclusions regarding the extent to which effects are bidirectional, and whether they are likely causal, remain elusive. This study uses the Fragile Families and Child Well-Being study, a birth cohort of 4,898 children followed from birth through age 9. Hierarchical linear modeling and structural equation modeling are employed to estimate associations of maltreatment with cognitive and social-emotional well-being. Results suggest that effects of early childhood maltreatment emerge immediately, though developmental outcomes are also affected by newly occurring maltreatment over time. Additionally, findings indicate that children's early developmental scores predict their subsequent probability of experiencing maltreatment, though to a lesser extent than early maltreatment predicts subsequent developmental outcomes. PMID:25521556

Early developmental trajectories of preterm infants.

PubMed

Yaari, Maya; Mankuta, David; Harel-Gadassi, Ayelet; Friedlander, Edwa; Bar-Oz, Benjamin; Eventov-Friedman, Smadar; Maniv, Nimrod; Zucker, David; Yirmiya, Nurit

2017-11-04

Preterm infants are at risk for neuro-developmental impairments and atypical developmental trajectories. The aims of this study were to delineate early developmental trajectories of preterm and full-term infants. The cognitive, language, and motor development of 149 infants - 19 extremely preterm (EPT), 34 very preterm (VPT), 57 moderately preterm (MPT), and 39 full-term (FT) - was evaluated using Mullen Scales at 1, 4, 8, 12, and 18 months. Mixed models were applied to examine group differences. Gender, maternal education, and neurobehavior were included as predictors of developmental trajectories. The EPT and VPT infants achieved significantly lower scores than the FT infants in all domains, with a significantly increasing gap over time. The MPT infants' trajectories were more favorable than those of the EPT and VPT infants yet lower than the FT infants on the Visual Reception, Gross, and Fine Motor subscales. Male gender and lower maternal education were associated with lower scores that declined over time. Abnormal neonatal neurobehavior was associated lower Mullen scores and with less stability in scores over time. The EPT and VPT infants were found to have disadvantages across all domains. The MPT infants revealed more favorable developmental trajectories yet displayed vulnerability compared to the FT infants. Gender, maternal education, and neonatal neurobehavior are important in predicting the developmental outcomes of preterm infants. Copyright © 2017 Elsevier Ltd. All rights reserved.

CRISPR-Cas9 and CRISPR-Cpf1 mediated targeting of a stomatal developmental gene EPFL9 in rice.

PubMed

Yin, Xiaojia; Biswal, Akshaya K; Dionora, Jacqueline; Perdigon, Kristel M; Balahadia, Christian P; Mazumdar, Shamik; Chater, Caspar; Lin, Hsiang-Chun; Coe, Robert A; Kretzschmar, Tobias; Gray, Julie E; Quick, Paul W; Bandyopadhyay, Anindya

2017-05-01

CRISPR-Cas9/Cpf1 system with its unique gene targeting efficiency, could be an important tool for functional study of early developmental genes through the generation of successful knockout plants. The introduction and utilization of systems biology approaches have identified several genes that are involved in early development of a plant and with such knowledge a robust tool is required for the functional validation of putative candidate genes thus obtained. The development of the CRISPR-Cas9/Cpf1 genome editing system has provided a convenient tool for creating loss of function mutants for genes of interest. The present study utilized CRISPR/Cas9 and CRISPR-Cpf1 technology to knock out an early developmental gene EPFL9 (Epidermal Patterning Factor like-9, a positive regulator of stomatal development in Arabidopsis) orthologue in rice. Germ-line mutants that were generated showed edits that were carried forward into the T2 generation when Cas9-free homozygous mutants were obtained. The homozygous mutant plants showed more than an eightfold reduction in stomatal density on the abaxial leaf surface of the edited rice plants. Potential off-target analysis showed no significant off-target effects. This study also utilized the CRISPR-LbCpf1 (Lachnospiracae bacterium Cpf1) to target the same OsEPFL9 gene to test the activity of this class-2 CRISPR system in rice and found that Cpf1 is also capable of genome editing and edits get transmitted through generations with similar phenotypic changes seen with CRISPR-Cas9. This study demonstrates the application of CRISPR-Cas9/Cpf1 to precisely target genomic locations and develop transgene-free homozygous heritable gene edits and confirms that the loss of function analysis of the candidate genes emerging from different systems biology based approaches, could be performed, and therefore, this system adds value in the validation of gene function studies.

Laminarin improves developmental competence of porcine early stage embryos by inhibiting oxidative stress.

PubMed

Jiang, Hao; Liang, Shuang; Yao, Xue-Rui; Jin, Yong-Xun; Shen, Xing-Hui; Yuan, Bao; Zhang, Jia-Bao; Kim, Nam-Hyung

2018-04-23

Laminarin (LMA), a β-glucan mixture with good biocompatibility, improves the growth performance and immune response when used as food additives and nutraceuticals. The aim of the present research was to explore the effects of LMA on porcine early stage embryo development, as well as the underlying mechanisms. The results showed that the developmental competence of porcine early stage embryos was dramatically improved after LMA supplementation during the in vitro culture period. The presence of 20 μg/mL LMA during the in vitro culture period significantly improved cleavage rate, blastocyst formation rates, hatching rate, and total cell number in the blastocyst compared to that in the control group. Notably, LMA attenuated the intracellular reactive oxygen species generation induced by H 2 O 2 . Furthermore, LMA not only increased intracellular glutathione levels, but also ameliorated mitochondrial membrane potential. In addition, the expression of a zygotic genome activation related gene (YAP1), pluripotency-related genes (OCT4, NANOG, and SOX2), and hatching-related genes (COX2, GATA4, and ITGA5) were up-regulated following LMA supplementation during porcine early stage embryo development. These results demonstrate that LMA has beneficial effects on the development of porcine early stage embryos via regulation of oxidative stress. This evidence provides a novel method for embryo development improvement associated with exposure to LMA. Copyright © 2018 Elsevier Inc. All rights reserved.

Developmentally Appropriate Practice in Early Elementary Grade Schools in Bangkok, Thailand

ERIC Educational Resources Information Center

Saifah, Yotsawee

2012-01-01

The purposes of this study were (a) to examine early elementary grade teachers' developmentally appropriate beliefs and their teaching practices in public schools in Bangkok, (b) to explore the functioning of developmentally appropriate practice in the two chosen early elementary schools, and (c) to determine the factors that influence the…

Child maltreatment and children's developmental trajectories in early to middle childhood.

PubMed

Font, Sarah A; Berger, Lawrence M

2015-01-01

Associations between experiencing child maltreatment and adverse developmental outcomes are widely studied, yet conclusions regarding the extent to which effects are bidirectional, and whether they are likely causal, remain elusive. This study uses the Fragile Families and Child Wellbeing Study, a birth cohort of 4,898 children followed from birth through age 9. Hierarchical linear modeling and structural equation modeling are employed to estimate associations of maltreatment with cognitive and social-emotional well-being. Results suggest that effects of early childhood maltreatment emerge immediately, though developmental outcomes are also affected by newly occurring maltreatment over time. Additionally, findings indicate that children's early developmental scores predict their subsequent probability of experiencing maltreatment, though to a lesser extent than early maltreatment predicts subsequent developmental outcomes. © 2014 The Authors. Child Development © 2014 Society for Research in Child Development, Inc.

Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

PubMed

Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

2013-10-01

Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

Differential maturation of rhythmic clock gene expression during early development in medaka (Oryzias latipes).

PubMed

Cuesta, Ines H; Lahiri, Kajori; Lopez-Olmeda, Jose Fernando; Loosli, Felix; Foulkes, Nicholas S; Vallone, Daniela

2014-05-01

One key challenge for the field of chronobiology is to identify how circadian clock function emerges during early embryonic development. Teleosts such as the zebrafish are ideal models for studying circadian clock ontogeny since the entire process of development occurs ex utero in an optically transparent chorion. Medaka (Oryzias latipes) represents another powerful fish model for exploring early clock function with, like the zebrafish, many tools available for detailed genetic analysis. However, to date there have been no reports documenting circadian clock gene expression during medaka development. Here we have characterized the expression of key clock genes in various developmental stages and in adult tissues of medaka. As previously reported for other fish, light dark cycles are required for the emergence of clock gene expression rhythms in this species. While rhythmic expression of per and cry genes is detected very early during development and seems to be light driven, rhythmic clock and bmal expression appears much later around hatching time. Furthermore, the maturation of clock function seems to correlate with the appearance of rhythmic expression of these positive elements of the clock feedback loop. By accelerating development through elevated temperatures or by artificially removing the chorion, we show an earlier onset of rhythmicity in clock and bmal expression. Thus, differential maturation of key elements of the medaka clock mechanism depends on the developmental stage and the presence of the chorion.

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

PubMed

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

The developmental disruptions of serotonin signaling may involved in autism during early brain development.

PubMed

Yang, C-J; Tan, H-P; Du, Y-J

2014-05-16

Autism is a developmental disorder defined by the presence of a triad of communication, social and stereo typical behavioral characteristics with onset before 3years of age. In spite of the fact that there are potential environmental factors for autistic behavior, the dysfunction of serotonin during early development of the brain could be playing a role in this prevalence rise. Serotonin can modulate a number of developmental events, including cell division, neuronal migration, cell differentiation and synaptogenesis. Hyperserotonemia during fetal development results in the loss of serotonin terminals through negative feedback. The increased serotonin causes a decrease of oxytocin in the paraventricular nucleus of the hypothalamus and an increase in calcitonin gene-related peptide (CGRP) in the central nucleus of the amygdale, which are associated with social interactions and vital in autism. However, hyposerotonemia may be also relevant to the development of sensory as well as motor and cognitive faculties. And the paucity of placenta-derived serotonin should have potential importance when the pathogenesis of autism is considered. This review briefly summarized the developmental disruptions of serotonin signaling involved in the pathogenesis of autism during early development of the brain. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

PubMed Central

2009-01-01

second in basidiomata, confirming their distinctiveness. The number of transcripts of the gene for plerototolysin B increased in reddish-pink mycelium and indicated an activation of the initial basidiomata production even at this culturing stage. Expression of the glucose transporter gene increased in mycelium after the stress, coinciding with a decrease of adenylate cyclase gene transcription. This indicated that nutrient uptake can be an important signal to trigger fruiting in this fungus. Conclusion The identification of genes with increased expression in this phase of the life cycle of M. perniciosa opens up new possibilities of controlling fungus spread as well as of genetic studies of biological processes that lead to basidiomycete fruiting. This is the first comparative morphologic study of the early development both in vivo and in vitro of M. perniciosa basidiomata and the first description of genes expressed at this stage of the fungal life cycle. PMID:19653910

Developmentally dynamic genome: Evidence of genetic influences on increases and decreases in conduct problems from early childhood to adolescence

PubMed Central

Pingault, Jean-Baptiste; Rijsdijk, Frühling; Zheng, Yao; Plomin, Robert; Viding, Essi

2015-01-01

The development of conduct problems in childhood and adolescence is associated with adverse long-term outcomes, including psychiatric morbidity. Although genes constitute a proven factor of stability in conduct problems, less is known regarding their role in conduct problems’ developmental course (i.e. systematic age changes, for instance linear increases or decreases).Mothers rated conduct problems from age 4 to 16 years in 10,038 twin pairs from the Twins Early Development Study. Individual differences in the baseline level (.78; 95% CI: .68-.88) and the developmental course of conduct problems (.73; 95% CI: .60-.86) were under high and largely independent additive genetic influences. Shared environment made a small contribution to the baseline level but not to the developmental course of conduct problems. These results show that genetic influences not only contribute to behavioural stability but also explain systematic change in conduct problems. Different sets of genes may be associated with the developmental course versus the baseline level of conduct problems. The structure of genetic and environmental influences on the development of conduct problems suggests that repeated preventive interventions at different developmental stages might be necessary to achieve a long-term impact. PMID:25944445

Developmentally dynamic genome: Evidence of genetic influences on increases and decreases in conduct problems from early childhood to adolescence.

PubMed

Pingault, Jean-Baptiste; Rijsdijk, Frühling; Zheng, Yao; Plomin, Robert; Viding, Essi

2015-05-06

The development of conduct problems in childhood and adolescence is associated with adverse long-term outcomes, including psychiatric morbidity. Although genes constitute a proven factor of stability in conduct problems, less is known regarding their role in conduct problems' developmental course (i.e. systematic age changes, for instance linear increases or decreases).Mothers rated conduct problems from age 4 to 16 years in 10,038 twin pairs from the Twins Early Development Study. Individual differences in the baseline level (.78; 95% CI: .68-.88) and the developmental course of conduct problems (.73; 95% CI: .60-.86) were under high and largely independent additive genetic influences. Shared environment made a small contribution to the baseline level but not to the developmental course of conduct problems. These results show that genetic influences not only contribute to behavioural stability but also explain systematic change in conduct problems. Different sets of genes may be associated with the developmental course versus the baseline level of conduct problems. The structure of genetic and environmental influences on the development of conduct problems suggests that repeated preventive interventions at different developmental stages might be necessary to achieve a long-term impact.

The search for evolutionary developmental origins of aging in zebrafish: a novel intersection of developmental and senescence biology in the zebrafish model system.

PubMed

Kishi, Shuji

2011-09-01

Senescence may be considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena during the process of aging. We investigated whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We conducted experiments to isolate zebrafish mutants expressing an apparent senescence phenotype during embryogenesis (embryonic senescence). Some of the genes we thereby identified had already been associated with cellular senescence and chronological aging in other organisms, but many had not yet been linked to these processes. Complete loss-of-function of developmentally essential genes induce embryonic (or larval) lethality, whereas it seems like their partial loss-of-function (i.e., decrease-of-function by heterozygote or hypomorphic mutations) still remains sufficient to go through the early developmental process because of its adaptive plasticity or rather heterozygote advantage. However, in some cases, such partial loss-of-function of genes compromise normal homeostasis due to haploinsufficiency later in adult life having many environmental stress challenges. By contrast, any heterozygote-advantageous genes might gain a certain benefit(s) (much more fitness) by such partial loss-of-function later in life. Physiological senescence may evolutionarily arise from both genetic and epigenetic drifts as well as from losing adaptive developmental plasticity in face of stress signals from the external environment that interacts with functions of multiple genes rather than effects of only a single gene mutation or defect. Previously uncharacterized developmental genes may thus mediate the aging process and play a pivotal role in senescence. Moreover, unexpected senescence-related genes might also be involved in the early developmental process and

Mother-Child Interaction and Resilience in Children with Early Developmental Risk

PubMed Central

Fenning, Rachel M.; Baker, Jason K.

2014-01-01

Although prenatal and genetic factors make strong contributions to the emergence of intellectual disability (ID), children's early environment may have the potential to alter developmental trajectories and to foster resilience in children with early risk. The present study examined mother-child interaction and the promotion of competence in 50 children with early developmental delays. Three related but distinct aspects of mother-child interaction were considered: maternal technical scaffolding, maternal positive-sensitivity, and mother-child dyadic pleasure. Children were classified as exhibiting undifferentiated delays at age three based upon performance on developmental assessments and the absence of known genetic syndromes. Mother-child interaction was assessed at age four through observational ratings of structured laboratory tasks and through naturalistic home observations. ID was identified at age five using the dual criteria of clinically significant delays in cognitive functioning and adaptive behavior. Maternal technical scaffolding and dyadic pleasure each uniquely predicted reduced likelihood of later ID, beyond the contributions of children's early developmental level and behavioral functioning. Follow-up analyses suggested that mother-child interaction was primarily important to resilience in the area of adaptive behavior, with scaffolding and dyadic pleasure differentially associated with particular sub-domains. Implications for theories of intellectual disability and for family-based early intervention and prevention efforts are discussed. PMID:22662771

Cdx ParaHox genes acquired distinct developmental roles after gene duplication in vertebrate evolution.

PubMed

Marlétaz, Ferdinand; Maeso, Ignacio; Faas, Laura; Isaacs, Harry V; Holland, Peter W H

2015-08-01

The functional consequences of whole genome duplications in vertebrate evolution are not fully understood. It remains unclear, for instance, why paralogues were retained in some gene families but extensively lost in others. Cdx homeobox genes encode conserved transcription factors controlling posterior development across diverse bilaterians. These genes are part of the ParaHox gene cluster. Multiple Cdx copies were retained after genome duplication, raising questions about how functional divergence, overlap, and redundancy respectively contributed to their retention and evolutionary fate. We examined the degree of regulatory and functional overlap between the three vertebrate Cdx genes using single and triple morpholino knock-down in Xenopus tropicalis followed by RNA-seq. We found that one paralogue, Cdx4, has a much stronger effect on gene expression than the others, including a strong regulatory effect on FGF and Wnt genes. Functional annotation revealed distinct and overlapping roles and subtly different temporal windows of action for each gene. The data also reveal a colinear-like effect of Cdx genes on Hox genes, with repression of Hox paralogy groups 1 and 2, and activation increasing from Hox group 5 to 11. We also highlight cases in which duplicated genes regulate distinct paralogous targets revealing pathway elaboration after whole genome duplication. Despite shared core pathways, Cdx paralogues have acquired distinct regulatory roles during development. This implies that the degree of functional overlap between paralogues is relatively low and that gene expression pattern alone should be used with caution when investigating the functional evolution of duplicated genes. We therefore suggest that developmental programmes were extensively rewired after whole genome duplication in the early evolution of vertebrates.

Representing Ontogeny Through Ontology: A Developmental Biologist’s Guide to The Gene Ontology

PubMed Central

Hill, David P.; Berardini, Tanya Z.; Howe, Douglas G.; Van Auken, Kimberly M.

2010-01-01

Developmental biology, like many other areas of biology, has undergone a dramatic shift in the perspective from which developmental processes are viewed. Instead of focusing on the actions of a handful of genes or functional RNAs, we now consider the interactions of large functional gene networks and study how these complex systems orchestrate the unfolding of an organism, from gametes to adult. Developmental biologists are beginning to realize that understanding ontogeny on this scale requires the utilization of computational methods to capture, store and represent the knowledge we have about the underlying processes. Here we review the use of the Gene Ontology (GO) to study developmental biology. We describe the organization and structure of the GO and illustrate some of the ways we use it to capture the current understanding of many common developmental processes. We also discuss ways in which gene product annotations using the GO have been used to ask and answer developmental questions in a variety of model developmental systems. We provide suggestions as to how the GO might be used in more powerful ways to address questions about development. Our goal is to provide developmental biologists with enough background about the GO that they can begin to think about how they might use the ontology efficiently and in the most powerful ways possible. PMID:19921742

The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

PubMed

Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

2018-03-01

Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

Practitioner Review: Early Adversity and Developmental Disorders

ERIC Educational Resources Information Center

Taylor, Eric; Rogers, Jody Warner

2005-01-01

Background: Knowledge of genetic influences, on developmental disorders such as autism spectrum, attention deficit/hyperactivity disorder and learning disabilities, has increased the opportunities for understanding the influences of the early environment. Methods: This paper provides a selective, narrative review for clinicians of the effects of…

Research on Children's Play: Analysis of Developmental and Early Education Journals from 2005 to 2007

ERIC Educational Resources Information Center

Cheng, Mei-Fang; Johnson, James E.

2010-01-01

Our review examined four early childhood journals ("Early Child Development and Care," "Early Childhood Education Journal," "Journal of Research in Childhood Education," and "Early Childhood Research Quarterly") and four developmental science journals ("Child Development," "Developmental Psychology," "Journal of Applied Developmental…

Expression of glucocorticoid receptor and early growth response gene 1 during postnatal development of two inbred strains of mice exposed to early life stress.

PubMed

Navailles, Sylvia; Zimnisky, Ross; Schmauss, Claudia

2010-07-01

Early life stress can elicit profound changes in adult gene expression and behavior. One consequence of early life stress is a decreased expression of glucocorticoid receptors (GRs) in the frontal cortex and hippocampus. However, neither the time of onset nor the mechanism(s) leading to decreased GR expression during postnatal development are known. The present study used two inbred strains of mice that differ in their behavioral responsiveness to stress (Balb/c and C57Bl/6), exposed them to an established paradigm of early life stress (infant maternal separation), and measured their expression of frontal cortical and hippocampal GRs and the putative transcriptional activator of the GR gene, early growth response gene (egr)-1, at defined stages of postnatal development. In both strains, real-time RT-PCR experiments revealed that decreased expression of GR in adolescence and adulthood is, in fact, preceded by increased GR expression during early life stress exposure. Thus, the early life stress-induced disruption of the normal stress-hyporesponsive period during infancy is accompanied by increased GR expression. Moreover, chronic treatment with the antidepressant drug fluoxetine during adolescence or adulthood reversed the effect of early life stress on adult GR mRNA expression. In contrast to the strain-independent effect of early life stress on GR expression, however, changes in egr-1 expression occurred only in Balb/c mice, and unlike the biphasic developmental changes in GR mRNA expression, egr-1 mRNA was decreased throughout postnatal development. Moreover, there was no consistent overlap of anatomic regions affected by decreased GR and egr-1 protein expression. Thus, in Balb/c mice, changes in GR and egr-1 expression can independently contribute to the phenotypes resulting from early life stress exposure. These findings illustrate that the impact of early life stress on gene expression changes is modulated by the genetic background and that the persistent

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

PubMed Central

2012-01-01

Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2

Developmental Outcomes after Early Prefrontal Cortex Damage

ERIC Educational Resources Information Center

Eslinger, Paul J.; Flaherty-Craig, Claire V.; Benton, Arthur L.

2004-01-01

The neuropsychological bases of cognitive, social, and moral development are minimally understood, with a seemingly wide chasm between developmental theories and brain maturation models. As one approach to bridging ideas in these areas, we review 10 cases of early prefrontal cortex damage from the clinical literature, highlighting overall clinical…

RNAi screening of developmental toolkit genes: a search for novel wing genes in the red flour beetle, Tribolium castaneum.

PubMed

Linz, David M; Tomoyasu, Yoshinori

2015-01-01

The amazing array of diversity among insect wings offers a powerful opportunity to study the mechanisms guiding morphological evolution. Studies in Drosophila (the fruit fly) have identified dozens of genes important for wing development. These genes are often called candidate genes, serving as an ideal starting point to study wing development in other insects. However, we also need to explore beyond the candidate genes to gain a more comprehensive view of insect wing evolution. As a first step away from the traditional candidate genes, we utilized Tribolium (the red flour beetle) as a model and assessed the potential involvement of a group of developmental toolkit genes (embryonic patterning genes) in beetle wing development. We hypothesized that the highly pleiotropic nature of these developmental genes would increase the likelihood of finding novel wing genes in Tribolium. Through the RNA interference screening, we found that Tc-cactus has a less characterized (but potentially evolutionarily conserved) role in wing development. We also found that the odd-skipped family genes are essential for the formation of the thoracic pleural plates, including the recently discovered wing serial homologs in Tribolium. In addition, we obtained several novel insights into the function of these developmental genes, such as the involvement of mille-pattes and Tc-odd-paired in metamorphosis. Despite these findings, no gene we examined was found to have novel wing-related roles unique in Tribolium. These results suggest a relatively conserved nature of developmental toolkit genes and highlight the limited degree to which these genes are co-opted during insect wing evolution.

Early Developmental and Evolutionary Origins of Gene Body DNA Methylation Patterns in Mammalian Placentas

PubMed Central

Schroeder, Diane I.; Jayashankar, Kartika; Douglas, Kory C.; Thirkill, Twanda L.; York, Daniel; Dickinson, Pete J.; Williams, Lawrence E.; Samollow, Paul B.; Ross, Pablo J.; Bannasch, Danika L.; Douglas, Gordon C.; LaSalle, Janine M.

2015-01-01

Over the last 20-80 million years the mammalian placenta has taken on a variety of morphologies through both divergent and convergent evolution. Recently we have shown that the human placenta genome has a unique epigenetic pattern of large partially methylated domains (PMDs) and highly methylated domains (HMDs) with gene body DNA methylation positively correlating with level of gene expression. In order to determine the evolutionary conservation of DNA methylation patterns and transcriptional regulatory programs in the placenta, we performed a genome-wide methylome (MethylC-seq) analysis of human, rhesus macaque, squirrel monkey, mouse, dog, horse, and cow placentas as well as opossum extraembryonic membrane. We found that, similar to human placenta, mammalian placentas and opossum extraembryonic membrane have globally lower levels of methylation compared to somatic tissues. Higher relative gene body methylation was the conserved feature across all mammalian placentas, despite differences in PMD/HMDs and absolute methylation levels. Specifically, higher methylation over the bodies of genes involved in mitosis, vesicle-mediated transport, protein phosphorylation, and chromatin modification was observed compared with the rest of the genome. As in human placenta, higher methylation is associated with higher gene expression and is predictive of genic location across species. Analysis of DNA methylation in oocytes and preimplantation embryos shows a conserved pattern of gene body methylation similar to the placenta. Intriguingly, mouse and cow oocytes and mouse early embryos have PMD/HMDs but their placentas do not, suggesting that PMD/HMDs are a feature of early preimplantation methylation patterns that become lost during placental development in some species and following implantation of the embryo. PMID:26241857

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

Depression and Anxiety Symptoms: Onset, Developmental Course and Risk Factors during Early Childhood

ERIC Educational Resources Information Center

Cote, Sylvana M.; Boivin, Michel; Liu, Xuecheng; Nagin, Daniel S.; Zoccolillo, Mark; Tremblay, Richard E.

2009-01-01

Background: Depressive and anxiety disorders are among the top ten leading causes of disabilities. We know little, however, about the onset, developmental course and early risk factors for depressive and anxiety symptoms (DAS). Objective: Model the developmental trajectories of DAS during early childhood and to identify risk factors for atypically…

Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.

PubMed

Lee, M M; Schiefelbein, J

2001-05-01

The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

Conservation in the involvement of heterochronic genes and hormones during developmental transitions.

PubMed

Faunes, Fernando; Larraín, Juan

2016-08-01

Developmental transitions include molting in some invertebrates and the metamorphosis of insects and amphibians. While the study of Caenorhabditis elegans larval transitions was crucial to determine the genetic control of these transitions, Drosophila melanogaster and Xenopus laevis have been classic models to study the role of hormones in metamorphosis. Here we review how heterochronic genes (lin-4, let-7, lin-28, lin-41), hormones (dafachronic acid, ecdysone, thyroid hormone) and the environment regulate developmental transitions. Recent evidence suggests that some heterochronic genes also regulate transitions in higher organisms that they are controlled by hormones involved in metamorphosis. We also discuss evidence demonstrating that heterochronic genes and hormones regulate the proliferation and differentiation of embryonic and neural stem cells. We propose the hypothesis that developmental transitions are regulated by an evolutionary conserved mechanism in which heterochronic genes and hormones interact to control stem/progenitor cells proliferation, cell cycle exit, quiescence and differentiation and determine the proper timing of developmental transitions. Finally, we discuss the relevance of these studies to understand post-embryonic development, puberty and regeneration in humans. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

Learning abilities and disabilities: generalist genes in early adolescence.

PubMed

Davis, Oliver S P; Haworth, Claire M A; Plomin, Robert

2009-01-01

The new view of cognitive neuropsychology that considers not just case studies of rare severe disorders but also common disorders, as well as normal variation and quantitative traits, is more amenable to recent advances in molecular genetics, such as genome-wide association studies, and advances in quantitative genetics, such as multivariate genetic analysis. A surprising finding emerging from multivariate quantitative genetic studies across diverse learning abilities is that most genetic influences are shared: they are "generalist", rather than "specialist". We exploited widespread access to inexpensive and fast Internet connections in the United Kingdom to assess over 5000 pairs of 12-year-old twins from the Twins Early Development Study (TEDS) on four distinct batteries: reading, mathematics, general cognitive ability (g) and, for the first time, language. Genetic correlations remain high among all of the measured abilities, with language as highly correlated genetically with g as reading and mathematics. Despite developmental upheaval, generalist genes remain important into early adolescence, suggesting optimal strategies for molecular genetic studies seeking to identify the genes of small effect that influence learning abilities and disabilities.

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Dysfunctional Autism Risk Genes Cause Circuit-Specific Connectivity Deficits With Distinct Developmental Trajectories.

PubMed

Zerbi, Valerio; Ielacqua, Giovanna D; Markicevic, Marija; Haberl, Matthias Georg; Ellisman, Mark H; A-Bhaskaran, Arjun; Frick, Andreas; Rudin, Markus; Wenderoth, Nicole

2018-07-01

Autism spectrum disorders (ASD) are a set of complex neurodevelopmental disorders for which there is currently no targeted therapeutic approach. It is thought that alterations of genes regulating migration and synapse formation during development affect neural circuit formation and result in aberrant connectivity within distinct circuits that underlie abnormal behaviors. However, it is unknown whether deviant developmental trajectories are circuit-specific for a given autism risk-gene. We used MRI to probe changes in functional and structural connectivity from childhood to adulthood in Fragile-X (Fmr1-/y) and contactin-associated (CNTNAP2-/-) knockout mice. Young Fmr1-/y mice (30 days postnatal) presented with a robust hypoconnectivity phenotype in corticocortico and corticostriatal circuits in areas associated with sensory information processing, which was maintained until adulthood. Conversely, only small differences in hippocampal and striatal areas were present during early postnatal development in CNTNAP2-/- mice, while major connectivity deficits in prefrontal and limbic pathways developed between adolescence and adulthood. These findings are supported by viral tracing and electron micrograph approaches and define 2 clearly distinct connectivity endophenotypes within the autism spectrum. We conclude that the genetic background of ASD strongly influences which circuits are most affected, the nature of the phenotype, and the developmental time course of the associated changes.

Developmental Origins of Chronic Kidney Disease: Should We Focus on Early Life?

PubMed Central

Tain, You-Lin; Hsu, Chien-Ning

2017-01-01

Chronic kidney disease (CKD) is becoming a global burden, despite recent advances in management. CKD can begin in early life by so-called “developmental programming” or “developmental origins of health and disease” (DOHaD). Early-life insults cause structural and functional changes in the developing kidney, which is called renal programming. Epidemiological and experimental evidence supports the proposition that early-life adverse events lead to renal programming and make subjects vulnerable to developing CKD and its comorbidities in later life. In addition to low nephron endowment, several mechanisms have been proposed for renal programming. The DOHaD concept opens a new window to offset the programming process in early life to prevent the development of adult kidney disease, namely reprogramming. Here, we review the key themes on the developmental origins of CKD. We have particularly focused on the following areas: evidence from human studies support fetal programming of kidney disease; insight from animal models of renal programming; hypothetical mechanisms of renal programming; alterations of renal transcriptome in response to early-life insults; and the application of reprogramming interventions to prevent the programming of kidney disease. PMID:28208659

Early-life stress and reproductive cost: A two-hit developmental model of accelerated aging?

PubMed

Shalev, Idan; Belsky, Jay

2016-05-01

Two seemingly independent bodies of research suggest a two-hit model of accelerated aging, one highlighting early-life stress and the other reproduction. The first, informed by developmental models of early-life stress, highlights reduced longevity effects of early adversity on telomere erosion, whereas the second, informed by evolutionary theories of aging, highlights such effects with regard to reproductive cost (in females). The fact that both early-life adversity and reproductive effort are associated with shorter telomeres and increased oxidative stress raises the prospect, consistent with life-history theory, that these two theoretical frameworks currently informing much research are tapping into the same evolutionary-developmental process of increased senescence and reduced longevity. Here we propose a mechanistic view of a two-hit model of accelerated aging in human females through (a) early-life adversity and (b) early reproduction, via a process of telomere erosion, while highlighting mediating biological embedding mechanisms that might link these two developmental aging processes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Chromosomal Aneuploidies and Early Embryonic Developmental Arrest.

PubMed

Maurer, Maria; Ebner, Thomas; Puchner, Manuela; Mayer, Richard Bernhard; Shebl, Omar; Oppelt, Peter; Duba, Hans-Christoph

2015-01-01

Selecting the best embryo for transfer, with the highest chance of achieving a vital pregnancy, is a major goal in current in vitro fertilization (IVF) technology. The high rate of embryonic developmental arrest during IVF treatment is one of the limitations in achieving this goal. Chromosomal abnormalities are possibly linked with chromosomal arrest and selection against abnormal fertilization products. The objective of this study was to evaluate the frequency and type of chromosomal abnormalities in preimplantation embryos with developmental arrest. This cohort study included blastomeres of embryos with early developmental arrest that were biopsied and analyzed by fluorescence in-situ hybridization (FISH) with probes for chromosomes 13, 16, 18, 21 and 22. Forty-five couples undergoing IVF treatment were included, and 119 arrested embryos were biopsied. All probes were obtained from the Kinderwunsch Zentrum, Linz, Austria, between August 2009 and August 2011. Of these embryos, 31.6% were normal for all chromosomes tested, and 68.4% were abnormal. Eleven embryos were uniformly aneuploid, 20 were polyploid, 3 were haploid, 11 displayed mosaicism and 22 embryos exhibited chaotic chromosomal complement. Nearly 70% of arrested embryos exhibit chromosomal errors, making chromosomal abnormalities a major cause of embryonic arrest and may be a further explanation for the high developmental failure rates during culture of the embryos in the IVF setting.

Chromosomal Aneuploidies and Early Embryonic Developmental Arrest

PubMed Central

Maurer, Maria; Ebner, Thomas; Puchner, Manuela; Mayer, Richard Bernhard; Shebl, Omar; Oppelt, Peter; Duba, Hans-Christoph

2015-01-01

Background Selecting the best embryo for transfer, with the highest chance of achieving a vital pregnancy, is a major goal in current in vitro fertilization (IVF) technology. The high rate of embryonic developmental arrest during IVF treatment is one of the limitations in achieving this goal. Chromosomal abnormalities are possibly linked with chromosomal arrest and selection against abnormal fertilization products. The objective of this study was to evaluate the frequency and type of chromosomal abnormalities in preimplantation embryos with developmental arrest. Materials and Methods This cohort study included blastomeres of embryos with early developmental arrest that were biopsied and analyzed by fluorescence in-situ hybridization (FISH) with probes for chromosomes 13, 16, 18, 21 and 22. Forty-five couples undergoing IVF treatment were included, and 119 arrested embryos were biopsied. All probes were obtained from the Kinderwunsch Zentrum, Linz, Austria, between August 2009 and August 2011. Results Of these embryos, 31.6% were normal for all chromosomes tested, and 68.4% were abnormal. Eleven embryos were uniformly aneuploid, 20 were polyploid, 3 were haploid, 11 displayed mosaicism and 22 embryos exhibited chaotic chromosomal complement. Conclusion Nearly 70% of arrested embryos exhibit chromosomal errors, making chromosomal abnormalities a major cause of embryonic arrest and may be a further explanation for the high developmental failure rates during culture of the embryos in the IVF setting. PMID:26644858

Developmental Changes in the Early Child Lexicon in Mandarin Chinese

ERIC Educational Resources Information Center

Hao, Meiling; Liu, Youyi; Shu, Hua; Xing, Ailing; Jiang, Ying; Li, Ping

2015-01-01

In this paper we report a large-scale developmental study of early productive vocabulary acquisition by 928 Chinese-speaking children aged between 1;0 and 2;6, using the Early Vocabulary Inventory for Mandarin Chinese (Hao, Shu, Xing & Li, 2008). The results show that: (i) social words, especially words for people, are the predominant type of…

Alteration of gene expression by alcohol exposure at early neurulation.

PubMed

Zhou, Feng C; Zhao, Qianqian; Liu, Yunlong; Goodlett, Charles R; Liang, Tiebing; McClintick, Jeanette N; Edenberg, Howard J; Li, Lang

2011-02-21

We have previously demonstrated that alcohol exposure at early neurulation induces growth retardation, neural tube abnormalities, and alteration of DNA methylation. To explore the global gene expression changes which may underline these developmental defects, microarray analyses were performed in a whole embryo mouse culture model that allows control over alcohol and embryonic variables. Alcohol caused teratogenesis in brain, heart, forelimb, and optic vesicle; a subset of the embryos also showed cranial neural tube defects. In microarray analysis (accession number GSM9545), adopting hypothesis-driven Gene Set Enrichment Analysis (GSEA) informatics and intersection analysis of two independent experiments, we found that there was a collective reduction in expression of neural specification genes (neurogenin, Sox5, Bhlhe22), neural growth factor genes [Igf1, Efemp1, Klf10 (Tieg), and Edil3], and alteration of genes involved in cell growth, apoptosis, histone variants, eye and heart development. There was also a reduction of retinol binding protein 1 (Rbp1), and de novo expression of aldehyde dehydrogenase 1B1 (Aldh1B1). Remarkably, four key hematopoiesis genes (glycophorin A, adducin 2, beta-2 microglobulin, and ceruloplasmin) were absent after alcohol treatment, and histone variant genes were reduced. The down-regulation of the neurospecification and the neurotrophic genes were further confirmed by quantitative RT-PCR. Furthermore, the gene expression profile demonstrated distinct subgroups which corresponded with two distinct alcohol-related neural tube phenotypes: an open (ALC-NTO) and a closed neural tube (ALC-NTC). Further, the epidermal growth factor signaling pathway and histone variants were specifically altered in ALC-NTO, and a greater number of neurotrophic/growth factor genes were down-regulated in the ALC-NTO than in the ALC-NTC embryos. This study revealed a set of genes vulnerable to alcohol exposure and genes that were associated with neural tube

An Unbiased Assessment of the Role of Imprinted Genes in an Intergenerational Model of Developmental Programming

PubMed Central

Radford, Elizabeth J.; Isganaitis, Elvira; Jimenez-Chillaron, Josep; Schroeder, Joshua; Molla, Michael; Andrews, Simon; Didier, Nathalie; Charalambous, Marika; McEwen, Kirsten; Marazzi, Giovanna; Sassoon, David; Patti, Mary-Elizabeth; Ferguson-Smith, Anne C.

2012-01-01

Environmental factors during early life are critical for the later metabolic health of the individual and of future progeny. In our obesogenic environment, it is of great socioeconomic importance to investigate the mechanisms that contribute to the risk of metabolic ill health. Imprinted genes, a class of functionally mono-allelic genes critical for early growth and metabolic axis development, have been proposed to be uniquely susceptible to environmental change. Furthermore, it has also been suggested that perturbation of the epigenetic reprogramming of imprinting control regions (ICRs) may play a role in phenotypic heritability following early life insults. Alternatively, the presence of multiple layers of epigenetic regulation may in fact protect imprinted genes from such perturbation. Unbiased investigation of these alternative hypotheses requires assessment of imprinted gene expression in the context of the response of the whole transcriptome to environmental assault. We therefore analyse the role of imprinted genes in multiple tissues in two affected generations of an established murine model of the developmental origins of health and disease using microarrays and quantitative RT–PCR. We demonstrate that, despite the functional mono-allelicism of imprinted genes and their unique mechanisms of epigenetic dosage control, imprinted genes as a class are neither more susceptible nor protected from expression perturbation induced by maternal undernutrition in either the F1 or the F2 generation compared to other genes. Nor do we find any evidence that the epigenetic reprogramming of ICRs in the germline is susceptible to nutritional restriction. However, we propose that those imprinted genes that are affected may play important roles in the foetal response to undernutrition and potentially its long-term sequelae. We suggest that recently described instances of dosage regulation by relaxation of imprinting are rare and likely to be highly regulated. PMID:22511876

The developmental neurotoxicity of arsenic: cognitive and behavioral consequences of early life exposure.

PubMed

Tolins, Molly; Ruchirawat, Mathuros; Landrigan, Philip

2014-01-01

More than 200 million people worldwide are chronically exposed to arsenic. Arsenic is a known human carcinogen, and its carcinogenic and systemic toxicity have been extensively studied. By contrast, the developmental neurotoxicity of arsenic has been less well described. The aim of this review was to provide a comprehensive review of the developmental neurotoxicity of arsenic. We reviewed the published epidemiological and toxicological literature on the developmental neurotoxicity of arsenic. Arsenic is able to gain access to the developing brain and cause neurotoxic effects. Animal models link prenatal and early postnatal exposure to reduction in brain weight, reductions in numbers of glia and neurons, and alterations in neurotransmitter systems. Animal and in vitro studies both suggest that oxidative stress may be a mechanism of arsenic neurotoxicity. Fifteen epidemiological studies indicate that early life exposure is associated with deficits in intelligence and memory. These effects may occur at levels of exposure below current safety guidelines, and some neurocognitive consequences may become manifest only later in life. Sex, concomitant exposures, and timing of exposure appear to modify the developmental neurotoxicity of arsenic. Four epidemiological studies failed to show behavioral outcomes of arsenic exposure. The published literature indicates that arsenic is a human developmental neurotoxicant. Ongoing and future prospective birth cohort studies will allow more precise definition of the developmental consequences of arsenic exposure in early life. Copyright © 2014. Published by Elsevier Inc.

Dysfunctional Autism Risk Genes Cause Circuit-Specific Connectivity Deficits With Distinct Developmental Trajectories

PubMed Central

Ielacqua, Giovanna D; Markicevic, Marija; Haberl, Matthias Georg; Ellisman, Mark H; A-Bhaskaran, Arjun; Frick, Andreas; Rudin, Markus; Wenderoth, Nicole

2018-01-01

Abstract Autism spectrum disorders (ASD) are a set of complex neurodevelopmental disorders for which there is currently no targeted therapeutic approach. It is thought that alterations of genes regulating migration and synapse formation during development affect neural circuit formation and result in aberrant connectivity within distinct circuits that underlie abnormal behaviors. However, it is unknown whether deviant developmental trajectories are circuit-specific for a given autism risk-gene. We used MRI to probe changes in functional and structural connectivity from childhood to adulthood in Fragile-X (Fmr1−/y) and contactin-associated (CNTNAP2−/−) knockout mice. Young Fmr1−/y mice (30 days postnatal) presented with a robust hypoconnectivity phenotype in corticocortico and corticostriatal circuits in areas associated with sensory information processing, which was maintained until adulthood. Conversely, only small differences in hippocampal and striatal areas were present during early postnatal development in CNTNAP2−/− mice, while major connectivity deficits in prefrontal and limbic pathways developed between adolescence and adulthood. These findings are supported by viral tracing and electron micrograph approaches and define 2 clearly distinct connectivity endophenotypes within the autism spectrum. We conclude that the genetic background of ASD strongly influences which circuits are most affected, the nature of the phenotype, and the developmental time course of the associated changes. PMID:29901787

Characterization of Betula platyphylla gene transcripts associated with early development of male inflorescence.

PubMed

Xing, Lei; Liu, Xue-Mei

2012-02-01

Birch (Betula platyphylla), an eminent tree species in Northeast and Inner Mongolia of China, has been widely used in architecture, furniture, and paper making in recent years. In order to retrieve genes involved in early development of B. platyphylla male inflorescence, RNA populations extracted from early and late developmental stage were analyzed by cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique. Following amplification of 256 pairs of primer combinations, ~7000 fragments were generated, of which 350 transcripts expressing more in early stage than late. Of 350 specific transcripts, 198 clear and reproducible electrophoresis bands were retrieved and sequenced successfully, 74 of them (37%) showing significant homologies to known genes after GO annotation. Majority of the predicted gene products were involved in metabolism (24.56%), cellular process (27.19%), response to stimulus (11.4%) and cell growth (8.7%). Transcripts ME56, ME108, ME206 and ME310, representing metabolism, cellular process, response to stimulus and cell growth, respectively, were selected for further study to validate cDNA-AFLP expression patterns via RT-PCR and qRT-PCR analysis. RT-PCR and qRT-PCR expression pattern results were consistent with cDNA-AFLP analysis results.

Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

PubMed

May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

2009-07-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.

Early Identification of Developmental Delays through Surveillance, Screening, and Diagnostic Evaluation

ERIC Educational Resources Information Center

Pizur-Barnekow, Kris; Erickson, Stephanie; Johnston, Mark; Bass, Tamicah; Lucinski, Loraine; Bleuel, Dan

2010-01-01

Developmental and behavioral problems in young children are prevalent in the United States. While young children experience an increased prevalence of such problems, a lack of early identification services continues to exist. Not only are early identification services required under American law, such as the Individual with Disabilities Education…

Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

PubMed Central

2008-01-01

Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

Children's early helping in action: Piagetian developmental theory and early prosocial behavior.

PubMed

Hammond, Stuart I

2014-01-01

After a brief overview of recent research on early helping, outlining some central problems, and issues, this paper examines children's early helping through the lens of Piagetian moral and developmental theory, drawing on Piaget's "Moral Judgment of the Child" (Piaget, 1932/1997), "Play, Dreams, and Imitation in Childhood" (Piaget, 1945/1951), and the "Grasp of Consciousness" (Piaget, 1976). Piaget refers to a level of moral development in action that precedes heteronomous and autonomous moral reasoning. This action level allows children to begin to interact with people and objects. In his later work, Piaget explores the gradual construction of understanding from this activity level. Taken together, these elements of Piagetian theory provide a promising conceptual framework for understanding the development of early helping.

Differential Gene Susceptibility to Sperm DNA Damage: Analysis of Developmental Key Genes in Trout

PubMed Central

González-Rojo, Silvia; Fernández-Díez, Cristina; Guerra, Susana M.; Robles, Vanesa; Herraez, Maria Paz

2014-01-01

Sperm chromatin in mammals is packaged in different blocks associated to protamines (PDNA), histones (HDNA), or nuclear matrix proteins. Differential packaging has been related to early or late transcription and also to differential susceptibility to genotoxic damage. Genes located in the more accessible HDNA could be more susceptible to injuries than those located in PDNA, being potential biomarkers of paternal DNA damage. Fish sperm chromatin organization is much diversified, some species lacking protamines and some others totally depleted of histones. Analyzing genotoxic damage in a species homogeneously compacted with some sperm nuclear basic protein type, could help in deciphering the clues of differential susceptibility to damage. In the present study we analyzed in rainbow trout the differential susceptibility of nine genes to UV irradiation and H2O2 treatment. The absence of histones in the sperm nuclei was confirmed by Western blot. The chromatin fractionation in sensitive and resistant regions to PvuII (presumably HDNA-like and PDNA-like, respectively) revealed that the nine genes locate in the same resistant region. The number of lesions promoted was quantified using a qPCR approach. Location of 8-hydroxyguanosine (8-OHdG) was analyzed by immunocytochemistry and confocal microscopy. UV irradiation promoted similar number of lesions in all the analyzed genes and a homogenous distribution of 8-OHdG within the nuclei. 8-OHdG was located in the peripheral area of the nucleus after H2O2 treatment, which promoted a significantly higher number of lesions in developmental-related genes (8.76–10.95 lesions/10 kb) than in rDNA genes (1.05–1.67 lesions/10 kb). We showed for the first time, that differential susceptibility to damage is dependent on the genotoxic mechanism and relies on positional differences between genes. Sensitive genes were also analyzed in cryopreserved sperm showing a lower number of lesions than the previous treatments and a predominant

Early Adversity and Developmental Outcomes: Interaction Between Genetics, Epigenetics, and Social Experiences Across the Life Span.

PubMed

Champagne, Frances A

2010-09-01

Longitudinal studies in humans demonstrate the association between prenatal and postnatal experiences of adversity and long-term changes in neurodevelopment. These studies raise the question of how experiences become incorporated at a biological level to induce persistent changes in functioning. Laboratory studies using animal models and recent analyses in human cohorts implicate epigenetic mechanisms as a possible route through which these environmental effects are achieved. In particular, there is evidence that changes in DNA methylation are associated with early life experiences with consequences for gene expression and behavior. Despite the potential stability of DNA methylation, it is apparent that this epigenetic mark can be dynamically modified through pharmacological targeting and behavioral experiences. Developmental plasticity may also be achieved through modification of the juvenile environment. Although these juvenile experiences may lead to common endpoints, there is evidence suggesting that the effects of early and later life experiences may be achieved by different molecular pathways. This review discusses evidence for the role of epigenetic mechanisms in shaping developmental trajectories in response to early life experience as well as the potential plasticity that can occur beyond the perinatal period. These studies have implications for approaches to intervention and suggest the importance of considering individual differences in genetic and epigenetic vulnerability in developing treatment strategies. © The Author(s) 2010.

EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

PubMed Central

Brenner, Eric D; Katari, Manpreet S; Stevenson, Dennis W; Rudd, Stephen A; Douglas, Andrew W; Moss, Walter N; Twigg, Richard W; Runko, Suzan J; Stellari, Giulia M; McCombie, WR; Coruzzi, Gloria M

2005-01-01

Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate), female (megasporangiate), and vegetative organs (leaves) of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and pollen evolution, and to

Predictors of Developmental Outcomes of High-Risk and Developmentally Delayed Infants and Children Enrolled in a State Early Childhood Intervention Program

ERIC Educational Resources Information Center

Giannoni, Peggy P.; Kass, Philip H.

2012-01-01

A retrospective cohort study was conducted to identify child, maternal, family, and community factors associated with rate of developmental disability among children enrolled in the California Early Start Program. The cohort included 8,987 children considered at high risk for developmental disability due to medical risks and/or developmental…

Weighted gene co-expression network analysis reveals potential genes involved in early metamorphosis process in sea cucumber Apostichopus japonicus.

PubMed

Li, Yongxin; Kikuchi, Mani; Li, Xueyan; Gao, Qionghua; Xiong, Zijun; Ren, Yandong; Zhao, Ruoping; Mao, Bingyu; Kondo, Mariko; Irie, Naoki; Wang, Wen

2018-01-01

Sea cucumbers, one main class of Echinoderms, have a very fast and drastic metamorphosis process during their development. However, the molecular basis under this process remains largely unknown. Here we systematically examined the gene expression profiles of Japanese common sea cucumber (Apostichopus japonicus) for the first time by RNA sequencing across 16 developmental time points from fertilized egg to juvenile stage. Based on the weighted gene co-expression network analysis (WGCNA), we identified 21 modules. Among them, MEdarkmagenta was highly expressed and correlated with the early metamorphosis process from late auricularia to doliolaria larva. Furthermore, gene enrichment and differentially expressed gene analysis identified several genes in the module that may play key roles in the metamorphosis process. Our results not only provide a molecular basis for experimentally studying the development and morphological complexity of sea cucumber, but also lay a foundation for improving its emergence rate. Copyright © 2017 Elsevier Inc. All rights reserved.

Diversity & Developmentally Appropriate Practices: Challenges for Early Childhood Education.

ERIC Educational Resources Information Center

Mallory, Bruce L., Ed.; New, Rebecca S., Ed.

The current conceptualization of what is appropriate in early childhood education is overly narrow in its interpretation of the role of the teacher, and with respect to variations in cultural and developmental diversity. Based on this observation, this book discusses various issues surrounding diversity, inclusion, and appropriate early…

Trajectories of Early Childhood Developmental Skills and Early Adolescent Psychotic Experiences: Findings from the ALSPAC UK Birth Cohort.

PubMed

Hameed, Mohajer A; Lingam, Raghu; Zammit, Stanley; Salvi, Giovanni; Sullivan, Sarah; Lewis, Andrew J

2017-01-01

Objective: The aim of this study was to use prospective data from the Avon Longitudinal Study of Parents and Children (ALSPAC) to examine association between trajectories of early childhood developmental skills and psychotic experiences (PEs) in early adolescence. Method: This study examined data from n = 6790 children from the ALSPAC cohort who participated in a semi-structured interview to assess PEs at age 12. Child development was measured using parental report at 6, 18, 30, and 42 months of age using a questionnaire of items adapted from the Denver Developmental Screening Test - II. Latent class growth analysis was used to generate trajectories over time for measures of fine and gross motor development, social, and communication skills. Logistic regression was used to investigate associations between developmental trajectories in each of these early developmental domains and PEs at age 12. Results: The results provided evidence that decline rather than enduringly poor social (adjusted OR = 1.28, 95% CI = 1.10-1.92, p = 0.044) and communication skills (adjusted OR 1.12, 95% CI = 1.03-1.22, p = 0.010) is predictive of suspected or definite PEs in early adolescence, than those with stable and/or improving skills. Motor skills did not display the same pattern of association; although gender specific effects provided evidence that only declining pattern of fine motor skills was associated with suspected and definite PEs in males compared to females (interaction OR = 1.47, 95% CI = 1.09-1.97, p = 0.012). Conclusion: Findings suggest that decline rather than persistent impairment in social and communication skills were most predictive of PEs in early adolescence. Findings are discussed in terms of study's strengths, limitations, and clinical implications.

Trajectories of Early Childhood Developmental Skills and Early Adolescent Psychotic Experiences: Findings from the ALSPAC UK Birth Cohort

PubMed Central

Hameed, Mohajer A.; Lingam, Raghu; Zammit, Stanley; Salvi, Giovanni; Sullivan, Sarah; Lewis, Andrew J.

2018-01-01

Objective: The aim of this study was to use prospective data from the Avon Longitudinal Study of Parents and Children (ALSPAC) to examine association between trajectories of early childhood developmental skills and psychotic experiences (PEs) in early adolescence. Method: This study examined data from n = 6790 children from the ALSPAC cohort who participated in a semi-structured interview to assess PEs at age 12. Child development was measured using parental report at 6, 18, 30, and 42 months of age using a questionnaire of items adapted from the Denver Developmental Screening Test – II. Latent class growth analysis was used to generate trajectories over time for measures of fine and gross motor development, social, and communication skills. Logistic regression was used to investigate associations between developmental trajectories in each of these early developmental domains and PEs at age 12. Results: The results provided evidence that decline rather than enduringly poor social (adjusted OR = 1.28, 95% CI = 1.10–1.92, p = 0.044) and communication skills (adjusted OR 1.12, 95% CI = 1.03–1.22, p = 0.010) is predictive of suspected or definite PEs in early adolescence, than those with stable and/or improving skills. Motor skills did not display the same pattern of association; although gender specific effects provided evidence that only declining pattern of fine motor skills was associated with suspected and definite PEs in males compared to females (interaction OR = 1.47, 95% CI = 1.09–1.97, p = 0.012). Conclusion: Findings suggest that decline rather than persistent impairment in social and communication skills were most predictive of PEs in early adolescence. Findings are discussed in terms of study’s strengths, limitations, and clinical implications. PMID:29375433

Early Childhood Intervention and Early Childhood Special Education in Turkey within the Scope of the Developmental System Approach

ERIC Educational Resources Information Center

Diken, Ibrahim H.; Bayhan, Pinar; Turan, Figen; Sipal, R. Firat; Sucuoglu, Bulbin; Ceber-Bakkaloglu, Hatice; Gunel, Mintaze Kerem; Kara, Ozgun Kaya

2012-01-01

The purpose of this article was to provide an overview of early childhood intervention and early childhood special education (ECI/ECSE) services and practices in Turkey by using the Developmental System Approach (M. J. Guralnick, 2001). After pointing out the history of early childhood and ECI/ECSE services and current legislations with regard to…

[Effect of human oviductal embryotrophic factors on gene expression of mouse preimplantation embryos].

PubMed

Yao, Yuan-Qing; Lee, Kai-Fai; Xu, Jia-Seng; Ho, Pak-Chung; Yeung, Shu-Biu

2007-09-01

To investigate the effect of embryotrophic factors (ETF) from human oviductal cells on gene expression of mouse early developmental embryos and discuss the role of fallopian tube in early development of embryos. ETF was isolated from conditioned medium of human oviductal cell line by sequential liquid chromatographic systems. Mouse embryos were treated by ETF in vitro. Using differential display RT-PCR, the gene expression of embryos treated by ETF was compared with embryos without ETF treatment. The differentially expressed genes were separated, re-amplified, cloned and sequenced. Gene expression profiles of embryos with ETF treatment was different from embryos without this treatment. Eight differentially expressed genes were cloned and sequenced. These genes functioned in RNA degradation, synthesis, splicing, protein trafficking, cellular differentiation and embryo development. Embryotrophic factors from human oviductal cells affect gene expression of early developmental embryos. The human oviductal cells play wide roles in early developmental stages of embryos.

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

PubMed Central

Bartley, Glenn E; Ishida, Betty K

2003-01-01

Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

Maternal Obesity: Risks for Developmental Delays in Early Childhood.

PubMed

Duffany, Kathleen O'Connor; McVeigh, Katharine H; Kershaw, Trace S; Lipkind, Heather S; Ickovics, Jeannette R

2016-02-01

To assess the risk for neurodevelopmental delays for children of mothers who were obese (≥200 pounds) prior to pregnancy, and to characterize delays associated with maternal obesity among children referred to and found eligible to receive Early Intervention Program services. We conducted a retrospective cohort study (N = 541,816) using a population-based New York City data warehouse with linked birth and Early Intervention data. Risks for children suspected of a delay and 'significantly delayed', with two moderate or one severe delay, were calculated. Among the group of children eligible by delay for Early Intervention, analyses assessed risk for being identified with a moderate-to-severe delay across each of five functional domains as well as risks for multiple delays. Children of mothers who were obese were more likely to be suspected of a delay (adjusted RR 1.19 [CI 1.15-1.22]) and borderline association for 'significantly delayed' (adjusted RR 1.01 [CI 1.00-1.02). Among children eligible by delay, children of mothers who were obese evidenced an increased risk for moderate-to-severe cognitive (adjusted RR 1.04 [CI 1.02-1.07]) and physical (adjusted RR 1.04 [CI 1.01-1.08]) delays and for global developmental delay (adjusted RR 1.05 [CI 1.01-1.08]). Maternal obesity is associated with increased risk of developmental delay in offspring. Among children with moderate or severe delays, maternal obesity is associated with increased risk of cognitive and physical delays as well as with increased risk for global developmental delay. While causation remains uncertain, this adds to the growing body of research reporting an association between maternal obesity and neurodevelopmental delays in offspring.

Defining the developmental parameters of temper loss in early childhood: implications for developmental psychopathology

PubMed Central

Wakschlag, Lauren S.; Choi, Seung W.; Carter, Alice S.; Hullsiek, Heide; Burns, James; McCarthy, Kimberly; Leibenluft, Ellen; Briggs-Gowan, Margaret J.

2013-01-01

Background Temper modulation problems are both a hallmark of early childhood and a common mental health concern. Thus, characterizing specific behavioral manifestations of temper loss along a dimension from normative misbehaviors to clinically significant problems is an important step toward identifying clinical thresholds. Methods Parent-reported patterns of temper loss were delineated in a diverse community sample of preschoolers (n = 1,490). A developmentally sensitive questionnaire, the Multidimensional Assessment of Preschool Disruptive Behavior (MAP-DB), was used to assess temper loss in terms of tantrum features and anger regulation. Specific aims were: (a) document the normative distribution of temper loss in preschoolers from normative misbehaviors to clinically concerning temper loss behaviors, and test for sociodemographic differences; (b) use Item Response Theory (IRT) to model a Temper Loss dimension; and (c) examine associations of temper loss and concurrent emotional and behavioral problems. Results Across sociodemographic subgroups, a unidimensional Temper Loss model fit the data well. Nearly all (83.7%) preschoolers had tantrums sometimes but only 8.6% had daily tantrums. Normative misbehaviors occurred more frequently than clinically concerning temper loss behaviors. Milder behaviors tended to reflect frustration in expectable contexts, whereas clinically concerning problem indicators were unpredictable, prolonged, and/or destructive. In multivariate models, Temper Loss was associated with emotional and behavioral problems. Conclusions Parent reports on a developmentally informed questionnaire, administered to a large and diverse sample, distinguished normative and problematic manifestations of preschool temper loss. A developmental, dimensional approach shows promise for elucidating the boundaries between normative early childhood temper loss and emergent psychopathology. PMID:22928674

Developmental patterns of spatial ability: an early sex difference.

PubMed

Johnson, E S; Meade, A C

1987-06-01

Over 1,800 public school students (grades K-12, ages 6-18) took a battery of 7 spatial tests tailored to their respective developmental levels. Analyses of resulting data indicate that it is feasible to measure spatial ability throughout this developmental range with modified versions of adult paper-and-pencil tests, that a male advantage in spatial performance appears reliably by age 10, and that the magnitude of the advantage remains constant through age 18. Analysis of covariance suggests that an early female precocity in language skills may mask a male advantage in spatial ability during the primary school years. There is no indication of a sex difference in kindergarten children.

Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

PubMed

Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P

2012-03-01

The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

Copper induces expression and methylation changes of early development genes in Crassostrea gigas embryos.

PubMed

Sussarellu, Rossana; Lebreton, Morgane; Rouxel, Julien; Akcha, Farida; Rivière, Guillaume

2018-03-01

Copper contamination is widespread along coastal areas and exerts adverse effects on marine organisms such as mollusks. In the Pacific oyster, copper induces severe developmental abnormalities during early life stages; however, the underlying molecular mechanisms are largely unknown. This study aims to better understand whether the embryotoxic effects of copper in Crassostrea gigas could be mediated by alterations in gene expression, and the putative role of DNA methylation, which is known to contribute to gene regulation in early embryo development. For that purpose, oyster embryos were exposed to 4 nominal copper concentrations (0.1, 1, 10 and 20 μg L -1 Cu 2+ ) during early development assays. Embryotoxicity was monitored through the oyster embryo-larval bioassay at the D-larva stage 24 h post fertilization (hpf) and genotoxicity at gastrulation 7 hpf. In parallel, the relative expression of 15 genes encoding putative homeotic, biomineralization and DNA methylation proteins was measured at three developmental stages (3 hpf morula stage, 7 hpf gastrula stage, 24 hpf D-larvae stage) using RT-qPCR. Global DNA content in methylcytosine and hydroxymethylcytosine were measured by HPLC and gene-specific DNA methylation levels were monitored using MeDIP-qPCR. A significant increase in larval abnormalities was observed from copper concentrations of 10 μg L -1 , while significant genotoxic effects were detected at 1 μg L -1 and above. All the selected genes presented a stage-dependent expression pattern, which was impaired for some homeobox and DNA methylation genes (Notochord, HOXA1, HOX2, Lox5, DNMT3b and CXXC-1) after copper exposure. While global DNA methylation (5-methylcytosine) at gastrula stage didn't show significant changes between experimental conditions, 5-hydroxymethylcytosine, its degradation product, decreased upon copper treatment. The DNA methylation of exons and the transcript levels were correlated in control samples for HOXA1 but such

A Mobile Early Stimulation Program to Support Children with Developmental Delays in Brazil.

PubMed

Dias, Raquel da Luz; Silva, Kátia Cristina Correa Guimarães; Lima, Marcela Raquel de Oliveira; Alves, João Guilherme Bezerra; Abidi, Syed Sibte Raza

2018-01-01

Developmental delay is a deviation development from the normative milestones during the childhood and it may be caused by neurological disorders. Early stimulation is a standardized and simple technique to treat developmental delays in children (aged 0-3 years), allowing them to reach the best development possible and to mitigate neuropsychomotor sequelae. However, the outcomes of the treatment depending on the involvement of the family, to continue the activities at home on a daily basis. To empower and educate parents of children with neurodevelopmental delays to administer standardized early stimulation programs at home, we developed a mobile early stimulation program that provides timely and evidence-based clinical decision support to health professionals and a personalized guidance to parents about how to administer early stimulation to their child at home.

Effect of early addition of bone morphogenetic protein 5 (BMP5) to embryo culture medium on in vitro development and expression of developmentally important genes in bovine preimplantation embryos.

PubMed

García, Elina V; Miceli, Dora C; Rizo, Gabriela; Valdecantos, Pablo A; Barrera, Antonio D

2015-09-01

Previous studies have reported that bone morphogenetic protein 5 (BMP5) is differentially expressed in the isthmus of bovine oviducts and it is present in the oviductal fluid. However, the specific action of this factor is unknown. To evaluate whether BMP5 exerts some effect during early bovine embryo development, gene expression of BMP5, BMP receptors, and the effect of exogenous BMP5 on in vitro development and expression of developmentally important genes were assessed. In experiment 1, pools of embryos at two-cell, four-cell, eight-cell, and blastocyst stages, derived from in vitro fertilization, were collected for analysis of BMP5 and BMP receptors (BMPR1A, BMPR1B, and BMPR2) messenger RNA (mRNA) expression. On the basis of previous results, in experiment 2, presumptive zygotes were cultured for the first 48 hours after insemination in CR1aa medium assaying three different treatments: (1) control (CR1aa); (2) vehicle control (CR1aa + 0.04 mM HCl), and (3) BMP5 treatment (CR1aa + 100 ng/mL of BMP5). The cleavage rate was evaluated 48 hours after insemination (Day 2), and then, embryos were transferred to CR1aa + 10% fetal bovine serum. The blastocyst rate was determined on Day 7. In experiment 3, pools of embryos at two-cell, four-cell, eight-cell, and blastocyst stages, derived from control and BMP5-treated groups, were collected for analysis of ID2 (BMP target gene), OCT4, NANOG, and SOX2 (pluripotency genes) mRNA expression. BMP5 transcripts were not detectable in any of the embryonic stages examined, whereas the relative mRNA abundance of the three BMP receptors analyzed was greater in early embryo development stages before maternal-embryonic transition, raising the possibility of a direct effect of exogenous BMPs on the embryo during the first developmental period. Although early addition of 100 ng/mL of BMP5 to the embryo culture medium had no effect on the cleavage rate, a significantly higher proportion of cleaved embryos developed to the

Gene function in early mouse embryonic stem cell differentiation

PubMed Central

Sene, Kagnew Hailesellasse; Porter, Christopher J; Palidwor, Gareth; Perez-Iratxeta, Carolina; Muro, Enrique M; Campbell, Pearl A; Rudnicki, Michael A; Andrade-Navarro, Miguel A

2007-01-01

Background Little is known about the genes that drive embryonic stem cell differentiation. However, such knowledge is necessary if we are to exploit the therapeutic potential of stem cells. To uncover the genetic determinants of mouse embryonic stem cell (mESC) differentiation, we have generated and analyzed 11-point time-series of DNA microarray data for three biologically equivalent but genetically distinct mESC lines (R1, J1, and V6.5) undergoing undirected differentiation into embryoid bodies (EBs) over a period of two weeks. Results We identified the initial 12 hour period as reflecting the early stages of mESC differentiation and studied probe sets showing consistent changes of gene expression in that period. Gene function analysis indicated significant up-regulation of genes related to regulation of transcription and mRNA splicing, and down-regulation of genes related to intracellular signaling. Phylogenetic analysis indicated that the genes showing the largest expression changes were more likely to have originated in metazoans. The probe sets with the most consistent gene changes in the three cell lines represented 24 down-regulated and 12 up-regulated genes, all with closely related human homologues. Whereas some of these genes are known to be involved in embryonic developmental processes (e.g. Klf4, Otx2, Smn1, Socs3, Tagln, Tdgf1), our analysis points to others (such as transcription factor Phf21a, extracellular matrix related Lama1 and Cyr61, or endoplasmic reticulum related Sc4mol and Scd2) that have not been previously related to mESC function. The majority of identified functions were related to transcriptional regulation, intracellular signaling, and cytoskeleton. Genes involved in other cellular functions important in ESC differentiation such as chromatin remodeling and transmembrane receptors were not observed in this set. Conclusion Our analysis profiles for the first time gene expression at a very early stage of mESC differentiation, and

Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences

PubMed Central

Chandra, Govind; Chater, Keith F

2014-01-01

To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321

Efficient embryonic culture method for the Japanese striped snake, Elaphe quadrivirgata, and its early developmental stages.

PubMed

Matsubara, Yoshiyuki; Sakai, Atsushi; Kuroiwa, Atsushi; Suzuki, Takayuki

2014-10-01

The morphogenesis of snake embryos is an elusive yet fascinating research target for developmental biologists. However, few data exist on development of early snake embryo due to limited availability of pregnant snakes, and the need to harvest early stage embryos directly from pregnant snakes before oviposition without knowing the date of fertilization. We established an ex vivo culture method for early snake embryos using the Japanese striped snake, Elaphe quadrivirgata. This method, which we named "sausage-style (SS) culture", allows us to harvest snake embryos at specific stages for each experiment. Using this SS culture system, we calculated somite formation rate at early stages before oviposition. The average somite formation rate between 6/7 and 12/13 somite stages was 145.9 min, between 60/70 and 80/91 somite stages 42.4 min, and between 113-115 and 126/127 somite stages 71 min. Thus, somite formation rate that we observed during early snake embryogenesis was changed over time. We also describe a developmental staging series for E. quadrivirgata. This is the first report of a developmental series of early snake embryogenesis prior to oviposition by full-color images with high-resolution. We propose that the SS culture system is an easy method for treating early snake embryos ex vivo. © 2014 The Authors Development, Growth & Differentiation © 2014 Japanese Society of Developmental Biologists.

Gene knockdown by morpholino-modified oligonucleotides in the zebrafish model: applications for developmental toxicology

PubMed Central

Timme-Laragy, Alicia R.; Karchner, Sibel I.; Hahn, Mark E.

2014-01-01

Summary The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knock-down via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level, while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e. phenotypic anchoring). In this chapter we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use. PMID:22669659

[Developmental amnesia and early brain damage: neuropsychology and neuroimaging].

PubMed

Crespo-Eguilaz, N; Dominguez, P D; Vaquero, M; Narbona, J

2018-03-01

To contribute to neuropsychological profiling of developmental amnesia subsequent to bilateral damage to both hippocampi in early age. The total sample of 24 schoolchildren from both sexes is distributed in three groups: perinatal hypoxic-ischaemic encephalopathy and everyday complaints of memory in school age (n = 8); perinatal hypoxic-ischaemic encephalopathy without memory complaints (n = 7); and a group of typically developing (n = 9). All participants in every groups did have normal general intelligence and attention. Both clinical groups had, as another clinical consequence, spastic cerebral palsy (diplegia). Neuropsychological exam consisted on tests of general intelligence, attentional abilities, declarative memory and semantic knowledge. All participants had a brain magnetic resonance image and spectroscopy of hippocampi. Scheltens criteria were used for visual estimation of hippocampal atrophy. Parametric and non-parametric statistical contrasts were made. Despite preservation of semantic and procedural learning, declarative-episodic memory is impaired in the first group versus the other two groups. A significant proportion of bilateral hippocampal atrophy is only present in the first group versus the other two non-amnesic groups using Scheltens estimation on MRI. Two cases without evident atrophy did have diminished NAA/(Cho + Cr) index in both hippocampi. Taken together, these results contribute to delineate developmental amnesia as an specific impairment due to early partial bihippocampal damage, in agreement with previous studies. After diagnosis of developmental amnesia, a specific psychoeducational intervention must be made; also this impairment could be candidate for pharmacological trials in the future.

Autism in Early Childhood: An Unusual Developmental Course—Three Case Reports

PubMed Central

Cohen-Ophir, Michal; Castel-Deutsh, Tsophia; Tirosh, Emanuel

2012-01-01

Autistic spectrum disorder (ASD) is typically characterized by either an emerging and gradual course or developmental regression in early childhood. The versatile clinical course is progressively acknowledged in recent years. Children with developmental disorders in general are referred to the Child Development Center for a multidisciplinary assessment, investigation, treatment and followup. We report three infants with an initial diagnosis of developmental delays, recovery of normal development following intervention in a multidisciplinary center, and subsequent regression into classic autism following their discharge from the program. An extensive medical workup was noncontributory. This unusual presentation, to our knowledge not reported previously, should be recognized by professionals involved in child development and psychiatry. PMID:22937419

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

PubMed

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes

PubMed Central

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-01-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404

Childhood developmental vulnerabilities associated with early life exposure to infectious and noninfectious diseases and maternal mental illness.

PubMed

Green, Melissa J; Kariuki, Maina; Dean, Kimberlie; Laurens, Kristin R; Tzoumakis, Stacy; Harris, Felicity; Carr, Vaughan J

2017-12-26

Fetal exposure to infectious and noninfectious diseases may influence early childhood developmental functioning, on the path to later mental illness. Here, we investigated the effects of in utero exposure to maternal infection and noninfectious diseases during pregnancy on offspring developmental vulnerabilities at age 5 years, in the context of estimated effects for early childhood exposures to infectious and noninfectious diseases and maternal mental illness. We used population data for 66,045 children from an intergenerational record linkage study (the New South Wales Child Development Study), for whom a cross-sectional assessment of five developmental competencies (physical, social, emotional, cognitive, and communication) was obtained at school entry, using the Australian Early Development Census (AEDC). Child and maternal exposures to infectious or noninfectious diseases were determined from the NSW Ministry of Health Admitted Patients Data Collection (APDC) and maternal mental illness exposure was derived from both APDC and Mental Health Ambulatory Data collections. Multinomial logistic regression analyses were used to examine unadjusted and adjusted associations between these physical and mental health exposures and child developmental vulnerabilities at age 5 years. Among the physical disease exposures, maternal infectious diseases during pregnancy and early childhood infection conferred the largest associations with developmental vulnerabilities at age 5 years; maternal noninfectious illness during pregnancy also retained small but significant associations with developmental vulnerabilities even when adjusted for other physical and mental illness exposures and covariates known to be associated with early childhood development (e.g., child's sex, socioeconomic disadvantage, young maternal age, prenatal smoking). Among all exposures examined, maternal mental illness first diagnosed prior to childbirth conferred the greatest odds of developmental

An oscillopathic approach to developmental dyslexia: From genes to speech processing.

PubMed

Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio

2017-06-30

Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.

DEVELOPMENTAL CHANGES IN SEROTONIN SIGNALING: IMPLICATIONS FOR EARLY BRAIN FUNCTION, BEHAVIOR AND ADAPTATION

PubMed Central

BRUMMELTE, S.; GLANAGHY, E. MC; BONNIN, A.; OBERLANDER, T. F.

2017-01-01

The neurotransmitter serotonin (5-HT) plays a central role in brain development, regulation of mood, stress reactivity and risk of psychiatric disorders, and thus alterations in 5-HT signaling early in life have critical implications for behavior and mental health across the life span. Drawing on preclinical and emerging human evidence this narrative review paper will examine three key aspects when considering the consequences of early life changes in 5-HT: (1) developmental origins of variations of 5-HT signaling; (2) influence of genetic and epigenetic factors; and (3) preclinical and clinical consequences of 5-HT-related changes associated with antidepressant exposure (SSRIs). The developmental consequences of altered prenatal 5-HT signaling varies greatly and outcomes depend on an ongoing interplay between biological (genetic/epigenetic variations) and environmental factors, both pre and postnatally. Emerging evidence suggests that variations in 5-HT signaling may increase sensitivity to risky home environments, but may also amplify a positive response to a nurturing environment. In this sense, factors that change central 5-HT levels may act as ‘plasticity’ rather than ‘risk’ factors associated with developmental vulnerability. Understanding the impact of early changes in 5-HT levels offers critical insights that might explain the variations in early typical brain development that underlies behavioral risk. PMID:26905950

Developmental evolution: this side of paradise.

PubMed

Graham, A; McGonnell, I

1999-09-09

It has long been appreciated that the evolution of snakes involved the loss of limbs and axis elongation, but their developmental basis has been obscure. It has now been shown that alterations in the deployment of Hox genes and an early block in the formation of hindlimb primordia underpin these modifications.

Children’s early helping in action: Piagetian developmental theory and early prosocial behavior

PubMed Central

Hammond, Stuart I.

2014-01-01

After a brief overview of recent research on early helping, outlining some central problems, and issues, this paper examines children’s early helping through the lens of Piagetian moral and developmental theory, drawing on Piaget’s “Moral Judgment of the Child” (Piaget, 1932/1997), “Play, Dreams, and Imitation in Childhood” (Piaget, 1945/1951), and the “Grasp of Consciousness” (Piaget, 1976). Piaget refers to a level of moral development in action that precedes heteronomous and autonomous moral reasoning. This action level allows children to begin to interact with people and objects. In his later work, Piaget explores the gradual construction of understanding from this activity level. Taken together, these elements of Piagetian theory provide a promising conceptual framework for understanding the development of early helping. PMID:25101027

Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

PubMed

Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

2014-11-01

Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

[The Battelle developmental inventory screening test for early detection of developmental disorders in cerebral palsy].

PubMed

Moraleda-Barreno, E; Romero-López, M; Cayetano-Menéndez, M J

2011-12-01

Cerebral palsy is usually associated with motor, cognitive, and language deficits, and with other disorders that cause disability in daily living skills, personal independence, social interaction and academic activities. Early detection of these deficits in the clinical setting is essential to anticipate and provide the child with the necessary support for adapting to the environment in all possible areas. The main objective of this study is to demonstrate that these deficits can be detected at an early age and comprehensively through the use of a brief development scale. We studied 100 children between 4 and 70 months old, half of them with cerebral palsy and the other half without any disorder. All subjects were evaluated using the Battelle Developmental Inventory screening test. We compared the developmental quotients in both groups and between the subjects with different motor impairments, using a simple prospective ex post facto design. The test detected statistically significant differences between the clinical group and the control group at all age levels. Statistically significant differences were also found between tetraplegia and other motor disorders. There were no differences by gender. The deficit in development associated with cerebral palsy can be quantified at early ages through the use of a brief development scale, thus we propose that the systematic implementation of protocols with this screening tool would be helpful for treatment and early intervention. This would also help in anticipating and establishing the means for the multidisciplinary actions required, and could provide guidance to other health professionals, to provide adequate school, social, and family support,. Copyright © 2011 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Tackling the ‘dyslexia paradox’: reading brain and behavior for early markers of developmental dyslexia

PubMed Central

Ozernov-Palchik, Ola; Gaab, Nadine

2016-01-01

Developmental dyslexia is an unexplained inability to acquire accurate or fluent reading that affects approximately 5–17% of children. Dyslexia is associated with structural and functional alterations in various brain regions that support reading. Neuroimaging studies in infants and pre-reading children suggest that these alterations predate reading instruction and reading failure, supporting the hypothesis that variant function in dyslexia susceptibility genes lead to atypical neural migration and/or axonal growth during early, most likely in utero, brain development. Yet, dyslexia is typically not diagnosed until a child has failed to learn to read as expected (usually in second grade or later). There is emerging evidence that neuroimaging measures, when combined with key behavioral measures, can enhance the accuracy of identification of dyslexia risk in prereading children but its sensitivity, specificity, and cost-efficiency is still unclear. Early identification of dyslexia risk carries important implications for dyslexia remediation and the amelioration of the psychosocial consequences commonly associated with reading failure. PMID:26836227

Early Developmental Conditioning of Later Health and Disease: Physiology or Pathophysiology?

PubMed Central

Hanson, M. A.; Gluckman, P. D.

2014-01-01

Extensive experimental animal studies and epidemiological observations have shown that environmental influences during early development affect the risk of later pathophysiological processes associated with chronic, especially noncommunicable, disease (NCD). This field is recognized as the developmental origins of health and disease (DOHaD). We discuss the extent to which DOHaD represents the result of the physiological processes of developmental plasticity, which may have potential adverse consequences in terms of NCD risk later, or whether it is the manifestation of pathophysiological processes acting in early life but only becoming apparent as disease later. We argue that the evidence suggests the former, through the operation of conditioning processes induced across the normal range of developmental environments, and we summarize current knowledge of the physiological processes involved. The adaptive pathway to later risk accords with current concepts in evolutionary developmental biology, especially those concerning parental effects. Outside the normal range, effects on development can result in nonadaptive processes, and we review their underlying mechanisms and consequences. New concepts concerning the underlying epigenetic and other mechanisms involved in both disruptive and nondisruptive pathways to disease are reviewed, including the evidence for transgenerational passage of risk from both maternal and paternal lines. These concepts have wider implications for understanding the causes and possible prevention of NCDs such as type 2 diabetes and cardiovascular disease, for broader social policy and for the increasing attention paid in public health to the lifecourse approach to NCD prevention. PMID:25287859

Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.

2008-09-01

The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND)more » 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression ({>=} 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans.« less

Early developmental characteristics and features of major depressive disorder among child psychiatric patients in Hungary.

PubMed

Kapornai, Krisztina; Gentzler, Amy L; Tepper, Ping; Kiss, Eniko; Mayer, László; Tamás, Zsuzsanna; Kovacs, Maria; Vetró, Agnes

2007-06-01

We investigate the relations of early atypical characteristics (perinatal problems, developmental delay, and difficult temperament) and onset-age (as well as severity of) first major depressive disorder (MDD) and first internalizing disorder in a clinical sample of depressed children in Hungary. Participants were 371 children (ages 7-14) with MDD, and their biological mothers, recruited through multiple clinical sites. Diagnoses (via DSM-IV criteria) and onset dates of disorders were finalized "best estimate" psychiatrists, and based on multiple information sources. Mothers provided developmental data in a structured interview. Difficult temperament predicted earlier onset of MDD and first internalizing disorder, but its effect was ameliorated if the family was intact during early childhood. Further, the importance of difficult temperament decreased as a function of time. Perinatal problems and developmental delay did not impact onset ages of disorders, and none of the early childhood characteristics associated with MDD episode severity. Children with MDD may have added disadvantage of earlier onset if they had a difficult temperament in infancy. Because early temperament mirrors physiological reactivity and regulatory capacity, it can affect various areas of functioning related to psychopathology. Early caregiver stability may attenuate some adverse effects of difficult infant temperament.

Developmental Transcriptome of Aplysia californica

PubMed Central

HEYLAND, ANDREAS; VUE, ZER; VOOLSTRA, CHRISTIAN R.; MEDINA, MÓNICA; MOROZ, LEONID L.

2014-01-01

Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages—many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization—a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. PMID:21328528

The utility of early developmental assessments on understanding later nonverbal IQ in children who are deaf or hard of hearing.

PubMed

Meinzen-Derr, Jareen; Wiley, Susan; Phillips, Jannel; Altaye, Mekibib; Choo, Daniel I

2017-01-01

In children who are deaf or hard of hearing (DHH), it is helpful to have meaningful early measures of development in order to provide effective interventions and offer benchmarks that help recognize varied developmental trajectories. The main objective of this study was to compare results of an early developmental assessment prior to 3 years of age to later nonverbal IQ assessed between 3 and 6 years of age in children who are DHH. This study included children 3-6 years of age with bilateral permanent hearing who were enrolled in a prospective cohort study on developmental outcomes. As part of the study, children received the Leiter International Performance Scale-Revised, which provided a nonverbal Brief IQ, as well as standardized language assessment and behavioral checklists. Children were included in this analysis if they had received an early developmental assessment with the Gesell Developmental Schedules-Revised as part of a clinical visit with a developmental pediatrician. Correlation coefficients and multiple regression analysis were used to associate the scores on the Gesell (using a developmental quotient) with scores on the Leiter-R Brief IQ. Forty-five participants who enrolled in the observational study had available evaluation results from the Gesell and complete Brief IQ results from the Leiter-R. The adaptive domain of the Gesell had good correlation (r = 0.61, p < 0.0001) with the Brief IQ on the Leiter-R. Children who had stable developmental or intelligence classifications based on scores (<70, 70 to <85, 85 to <100, ≥100) over time were older (>24 months) at the early Gesell assessment. Degree of hearing loss or maternal education did not appear to confound the relationship between the Gesell and the Leiter-R. The adaptive domain of the Gesell Developmental Schedules - Revised administered in early childhood (under 3 years of age) has good correlation with the nonverbal Brief IQ on the Leiter International Performance Scale-R. Because

The Relation of Emotional Maltreatment to Early Adolescent Competence: Developmental Processes in a Prospective Study

ERIC Educational Resources Information Center

Shaffer, Anne; Yates, Tuppett M.; Egeland, Byron R.

2009-01-01

Objectives: This investigation examined developmental pathways between childhood emotional maltreatment and adaptational outcomes in early adolescence. This study utilized a developmental psychopathology perspective in adopting a multidimensional approach to the assessment of different forms of emotional maltreatment and later adjustment outcomes.…

Molecular and Chemical Genetic Approaches to Developmental Origins of Aging and Disease in Zebrafish

PubMed Central

Sasaki, Tomoyuki; Kishi, Shuji

2013-01-01

The incidence of diseases increases rapidly with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but mostly inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states in response to different environmental or genetic perturbations. On the one hand, we hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds of adaptive plasticity by chemical genetic approaches, we have been investigating whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during embryogenesis (“embryonic senescence”), subsequently showing shortened lifespan in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

Inference of developmental gene regulatory networks beyond classical model systems: new approaches in the post-genomic era.

PubMed

Fernandez-Valverde, Selene L; Aguilera, Felipe; Ramos-Díaz, René Alexander

2018-06-18

The advent of high-throughput sequencing technologies has revolutionized the way we understand the transformation of genetic information into morphological traits. Elucidating the network of interactions between genes that govern cell differentiation through development is one of the core challenges in genome research. These networks are known as developmental gene regulatory networks (dGRNs) and consist largely of the functional linkage between developmental control genes, cis-regulatory modules and differentiation genes, which generate spatially and temporally refined patterns of gene expression. Over the last 20 years, great advances have been made in determining these gene interactions mainly in classical model systems, including human, mouse, sea urchin, fruit fly, and worm. This has brought about a radical transformation in the fields of developmental biology and evolutionary biology, allowing the generation of high-resolution gene regulatory maps to analyse cell differentiation during animal development. Such maps have enabled the identification of gene regulatory circuits and have led to the development of network inference methods that can recapitulate the differentiation of specific cell-types or developmental stages. In contrast, dGRN research in non-classical model systems has been limited to the identification of developmental control genes via the candidate gene approach and the characterization of their spatiotemporal expression patterns, as well as to the discovery of cis-regulatory modules via patterns of sequence conservation and/or predicted transcription-factor binding sites. However, thanks to the continuous advances in high-throughput sequencing technologies, this scenario is rapidly changing. Here, we give a historical overview on the architecture and elucidation of the dGRNs. Subsequently, we summarize the approaches available to unravel these regulatory networks, highlighting the vast range of possibilities of integrating multiple technical

Characterization of the altered gene expression profile in early porcine embryos generated from parthenogenesis and somatic cell chromatin transfer.

PubMed

Zhou, Chi; Dobrinsky, John; Tsoi, Stephen; Foxcroft, George R; Dixon, Walter T; Stothard, Paul; Verstegen, John; Dyck, Michael K

2014-01-01

The in vitro production of early porcine embryos is of particular scientific and economic interest. In general, embryos produced from in vitro Assisted Reproductive Technologies (ART) manipulations, such as somatic cell chromatin transfer (CT) and parthenogenetic activation (PA), are less developmentally competent than in vivo-derived embryos. The mechanisms underlying the deficiencies of embryos generated from PA and CT have not been completely understood. To characterize the altered genes and gene networks in embryos generated from CT and PA, comparative transcriptomic analyses of in vivo (IVV) expanded blastocysts (XB), IVV hatched blastocyst (HB), PA XB, PA HB, and CT HB were performed using a custom microarray platform enriched for genes expressed during early embryonic development. Differential expressions of 1492 and 103 genes were identified in PA and CT HB, respectively, in comparison with IVV HB. The "eIF2 signalling", "mitochondrial dysfunction", "regulation of eIF4 and p70S6K signalling", "protein ubiquitination", and "mTOR signalling" pathways were down-regulated in PA HB. Dysregulation of notch signalling-associated genes were observed in both PA and CT HB. TP53 was predicted to be activated in both PA and CT HB, as 136 and 23 regulation targets of TP53 showed significant differential expression in PA and CT HB, respectively, in comparison with IVV HB. In addition, dysregulations of several critical pluripotency, trophoblast development, and implantation-associated genes (NANOG, GATA2, KRT8, LGMN, and DPP4) were observed in PA HB during the blastocyst hatching process. The critical genes that were observed to be dysregulated in CT and PA embryos could be indicative of underlying developmental deficiencies of embryos produced from these technologies.

Precursors of Adolescent Substance Use from Early Childhood and Early Adolescence: Testing a Developmental Cascade Model

PubMed Central

Sitnick, Stephanie; Shaw, Daniel S.; Hyde, Luke

2013-01-01

This study examined developmentally-salient risk and protective factors of adolescent substance use assessed during early childhood and early adolescence using a sample of 310 low-income boys. Child problem behavior and proximal family risk and protective factors (i.e., parenting, maternal depression) during early childhood, as well as child and family factors and peer deviant behavior during adolescence were explored as potential precursors to later substance use during adolescence using structural equation modeling. Results revealed that early childhood risk and protective factors (i.e., child externalizing problems, mothers’ depressive symptomatology, and nurturant parenting) were indirectly related to substance use at the age of 17 via risk and protective factors during early and middle adolescence (i.e., parental knowledge and externalizing problems). The implications of these findings for early prevention and intervention are discussed. PMID:24029248

Analysis of the Developmental Functioning of Early Intervention and Early Childhood Special Education Populations in Oregon. Issues & Answers. REL 2009-078

ERIC Educational Resources Information Center

Nave, Gary; Nishioka, Vicki; Burke, Arthur

2009-01-01

This study reports on the developmental functioning levels of children from birth through age 2 in early intervention services and children ages 3-5 in early childhood special education services at the time of entry into services, using data from the Oregon Early Childhood Assessment System. The assessment system contains data on the assessed…

DNA methylation at differentially methylated regions of imprinted genes is resistant to developmental programming by maternal nutrition

PubMed Central

Ivanova, Elena; Chen, Jian-Hua; Segonds-Pichon, Anne; Ozanne, Susan E.; Kelsey, Gavin

2012-01-01

The nutritional environment in which the mammalian fetus or infant develop is recognized as influencing the risk of chronic diseases, such as type 2 diabetes and hypertension, in a phenomenon that has become known as developmental programming. The late onset of such diseases in response to earlier transient experiences has led to the suggestion that developmental programming may have an epigenetic component, because epigenetic marks such as DNA methylation or histone tail modifications could provide a persistent memory of earlier nutritional states. One class of genes that has been considered a potential target or mediator of programming events is imprinted genes, because these genes critically depend upon epigenetic modifications for correct expression and because many imprinted genes have roles in controlling fetal growth as well as neonatal and adult metabolism. In this study, we have used an established model of developmental programming—isocaloric protein restriction to female mice during gestation or lactation—to examine whether there are effects on expression and DNA methylation of imprinted genes in the offspring. We find that although expression of some imprinted genes in liver of offspring is robustly and sustainably changed, methylation of the differentially methylated regions (DMRs) that control their monoallelic expression remains largely unaltered. We conclude that deregulation of imprinting through a general effect on DMR methylation is unlikely to be a common factor in developmental programming. PMID:22968513

Systematically labeling developmental stage-specific genes for the study of pancreatic β-cell differentiation from human embryonic stem cells.

PubMed

Liu, Haisong; Yang, Huan; Zhu, Dicong; Sui, Xin; Li, Juan; Liang, Zhen; Xu, Lei; Chen, Zeyu; Yao, Anzhi; Zhang, Long; Zhang, Xi; Yi, Xing; Liu, Meng; Xu, Shiqing; Zhang, Wenjian; Lin, Hua; Xie, Lan; Lou, Jinning; Zhang, Yong; Xi, Jianzhong; Deng, Hongkui

2014-10-01

The applications of human pluripotent stem cell (hPSC)-derived cells in regenerative medicine has encountered a long-standing challenge: how can we efficiently obtain mature cell types from hPSCs? Attempts to address this problem are hindered by the complexity of controlling cell fate commitment and the lack of sufficient developmental knowledge for guiding hPSC differentiation. Here, we developed a systematic strategy to study hPSC differentiation by labeling sequential developmental genes to encompass the major developmental stages, using the directed differentiation of pancreatic β cells from hPSCs as a model. We therefore generated a large panel of pancreas-specific mono- and dual-reporter cell lines. With this unique platform, we visualized the kinetics of the entire differentiation process in real time for the first time by monitoring the expression dynamics of the reporter genes, identified desired cell populations at each differentiation stage and demonstrated the ability to isolate these cell populations for further characterization. We further revealed the expression profiles of isolated NGN3-eGFP(+) cells by RNA sequencing and identified sushi domain-containing 2 (SUSD2) as a novel surface protein that enriches for pancreatic endocrine progenitors and early endocrine cells both in human embryonic stem cells (hESC)-derived pancreatic cells and in the developing human pancreas. Moreover, we captured a series of cell fate transition events in real time, identified multiple cell subpopulations and unveiled their distinct gene expression profiles, among heterogeneous progenitors for the first time using our dual reporter hESC lines. The exploration of this platform and our new findings will pave the way to obtain mature β cells in vitro.

Neonatal manipulation of oxytocin prevents lipopolysaccharide-induced decrease in gene expression of growth factors in two developmental stages of the female rat.

PubMed

Bakos, Jan; Lestanova, Zuzana; Strbak, Vladimir; Havranek, Tomas; Bacova, Zuzana

2014-10-01

Oxytocin production and secretion is important for early development of the brain. Long-term consequences of manipulation of oxytocin system might include changes in markers of brain plasticity - cytoskeletal proteins and neurotrophins. The aim of the present study was (1) to determine whether neonatal oxytocin administration affects gene expression of nestin, microtubule-associated protein-2 (MAP-2), brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the brain of two developmental stages of rat and (2) to evaluate whether neonatal oxytocin administration protects against lipopolysaccharide (LPS) induced inflammation. Neonatal oxytocin did not prevent a decrease of body weight in the LPS treated animals. Oxytocin significantly increased gene expression of BDNF in the right hippocampus in 21-day and 2-month old rats of both sexes. Gene expression of NGF and MAP-2 significantly increased in males treated with oxytocin. Both, growth factors and intermediate filament-nestin mRNA levels, were reduced in females exposed to LPS. Oxytocin treatment prevented a decrease in the gene expression of only growth factors. In conclusion, neonatal manipulation of oxytocin has developmental and sex-dependent effect on markers of brain plasticity. These results also indicate, that oxytocin may be protective against inflammation particularly in females. Copyright © 2014 Elsevier Ltd. All rights reserved.

Severe early-onset epileptic encephalopathy due to mutations in the KCNA2 gene: Expansion of the genotypic and phenotypic spectrum.

PubMed

Hundallah, Khaled; Alenizi, Asma'a; AlHashem, Amal; Tabarki, Brahim

2016-07-01

Recently, de novo loss- or gain-of-function mutations in the KCNA2 gene; have been described in individuals with epileptic encephalopathy, ataxia or intellectual disability. In this report, we describe a further case of KCNA2-early-onset epileptic encephalopathy. The patient presented since birth with intractable seizures, progressive microcephaly, developmental delay, and progressive brain atrophy. Whole-exome sequencing showed a novel de novo mutation in the KCNA2 gene: c.1120A > G (p.Thr374Ala). This case expands the genotypic and phenotypic disease spectrum of this genetic form of KCNA2-early onset epileptic encephalopathy. Copyright © 2016 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Developmental rate and behavior of early life stages of bighead carp and silver carp

USGS Publications Warehouse

Chapman, Duane C.; George, Amy E.

2011-01-01

The early life stages of Asian carp are well described by Yi and others (1988), but since these descriptions are represented by line drawings based only on live individuals and lacked temperature controls, further information on developmental time and stages is of use to expand understanding of early life stages of these species. Bighead carp and silver carp were cultured under two different temperature treatments to the one-chamber gas bladder stage, and a photographic guide is provided for bighead carp and silver carp embryonic and larval development, including notes about egg morphology and larval swimming behavior. Preliminary information on developmental time and hourly thermal units for each stage is also provided. Both carp species developed faster under warmer conditions. Developmental stages and behaviors are generally consistent with earlier works with the exception that strong vertical swimming immediately after hatching was documented in this report.

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Homologs of the Xenopus developmental gene DG42 are present in zebrafish and mouse and are involved in the synthesis of Nod-like chitin oligosaccharides during early embryogenesis.

PubMed

Semino, C E; Specht, C A; Raimondi, A; Robbins, P W

1996-05-14

The Xenopus developmental gene DG42 is expressed during early embryonic development, between the midblastula and neurulation stages. The deduced protein sequence of Xenopus DG42 shows similarity to Rhizobium Nod C, Streptococcus Has A, and fungal chitin synthases. Previously, we found that the DG42 protein made in an in vitro transcription/translation system catalyzed synthesis of an array of chitin oligosaccharides. Here we show that cell extracts from early Xenopus and zebrafish embryos also synthesize chitooligosaccharides. cDNA fragments homologous to DG42 from zebrafish and mouse were also cloned and sequenced. Expression of these homologs was similar to that described for Xenopus based on Northern and Western blot analysis. The Xenopus anti-DG42 antibody recognized a 63-kDa protein in extracts from zebrafish embryos that followed a similar developmental expression pattern to that previously described for Xenopus. The chitin oligosaccharide synthase activity found in extracts was inactivated by a specific DG42 antibody; synthesis of hyaluronic acid (HA) was not affected under the conditions tested. Other experiments demonstrate that expression of DG42 under plasmid control in mouse 3T3 cells gives rise to chitooligosaccharide synthase activity without an increase in HA synthase level. A possible relationship between our results and those of other investigators, which show stimulation of HA synthesis by DG42 in mammalian cell culture systems, is provided by structural analyses to be published elsewhere that suggest that chitin oligosaccharides are present at the reducing ends of HA chains. Since in at least one vertebrate system hyaluronic acid formation can be inhibited by a pure chitinase, it seems possible that chitin oligosaccharides serve as primers for hyaluronic acid synthesis.

Persistence of Early Emerging Aberrant Behavior in Children with Developmental Disabilities

ERIC Educational Resources Information Center

Green, Vanessa A.; O'Reilly, Mark; Itchon, Jonathan; Sigafoos, Jeff

2005-01-01

This study examined the persistence of early emerging aberrant behavior in 13 preschool children with developmental disabilities. The severity of aberrant behavior was assessed every 6 months over a 3-year period. Teachers completed the assessments using the Aberrant Behavior Checklist [Aman, M. G., & Singh, N. N. (1986). "Aberrant…

Prevention and early intervention for behaviour problems in children with developmental disabilities.

PubMed

Einfeld, Stewart L; Tonge, Bruce J; Clarke, Kristina S

2013-05-01

To review the recent evidence regarding early intervention and prevention studies for children with developmental disabilities and behaviour problems from 2011 to 2013. Recent advances in the field are discussed and important areas for future research are highlighted. Recent reviews and studies highlight the utility of antecedent interventions and skills training interventions for reducing behaviour problems. There is preliminary evidence for the effectiveness of parent training interventions when delivered in minimally sufficient formats or in clinical settings. Two recent studies have demonstrated the utility of behavioural interventions for children with genetic causes of disability. Various forms of behavioural and parent training interventions are effective at reducing the behaviour problems in children with developmental disabilities. However, research on prevention and early intervention continues to be relatively scarce. Further large-scale dissemination studies and effectiveness studies in clinical or applied settings are needed.

Early-developmental stress, repeatability, and canalization in a suite of physiological and behavioral traits in female zebra finches.

PubMed

Careau, Vincent; Buttemer, William A; Buchanan, Katherine L

2014-10-01

Adaptive developmental plasticity allows individuals experiencing poor environmental conditions in early life to adjust their life-history strategy in order to prioritize short-term fitness benefits and maximize reproductive output in challenging environments. Much research has been conducted to test whether such adoption of a "faster" life-history strategy is accompanied by concordant changes in behavior and physiology, with mixed results. As research in this field has focused on comparison of mean-level responses of treatment groups, few studies include repeated measures of response variables and the effect that developmental stress may have on repeatability per se. We investigated how early-developmental stress affects the mean expression of (and repeatability in) a variety of behavioral and physiological traits in female zebra finches. We predicted that: (1) individuals subjected to nutritional restriction in the nestling phase would have higher feeding and activity rates, with associated increases in hematocrit and basal metabolic rates (BMRs), (2) nutritional restriction in early life would alter adults' stress-induced corticosterone level, and (3) developmental stress would, respectively, influence the amount of among-individual and within-individual variation in behavioral and physiological traits, hence affecting the repeatability of these traits. In comparison to control females, stressed females did not differ in activity rate or stress-induced corticosterone level, but they did have higher levels of feeding, hematocrit, and BMR. Among-individual variance and repeatability were generally higher in stressed females than in controls. Finally, we found that developmental dietary restriction significantly reduced the amount of within-individual variance both in activity rate in the novel environment and in stress-induced corticosterone level. Our results not only confirm previous findings on the effect of early-developmental stress on BMR, but also extend

Gene knockdown by morpholino-modified oligonucleotides in the zebrafish (Danio rerio) model: applications for developmental toxicology.

PubMed

Timme-Laragy, Alicia R; Karchner, Sibel I; Hahn, Mark E

2012-01-01

The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knockdown via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e., phenotypic anchoring). In this chapter, we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use.

Developmental cascades: Externalizing, internalizing, and academic competence from middle childhood to early adolescence

PubMed Central

Moilanen, Kristin L.; Shaw, Daniel S.; Maxwell, Kari L.

2011-01-01

The current study was initiated to increase understanding of developmental cascades in childhood in a sample of at-risk boys (N = 291; 52% White). Mothers, teachers, and boys reported on boys’ externalizing problems, internalizing difficulties, and academic competence. Consistent with hypotheses regarding school-related transitions, high levels of externalizing problems were associated with both low levels of academic competence and high levels of internalizing problems during the early school-age period, and with elevations in internalizing problems during the transition to adolescence. Low levels of academic competence were associated with high levels of internalizing problems in middle childhood, and with high levels of externalizing problems during the transition from elementary school to middle school. Shared risk factors played a minimal role in these developmental cascades. Results suggest that there are cascading effects of externalizing problems and academic competence in childhood and early adolescence, and that some cascading effects are more likely to occur during periods of school-related transitions. Implications of developmental cascade effects for research and intervention are discussed. PMID:20576184

Early Maternal Alcohol Consumption Alters Hippocampal DNA Methylation, Gene Expression and Volume in a Mouse Model

PubMed Central

Marjonen, Heidi; Sierra, Alejandra; Nyman, Anna; Rogojin, Vladimir; Gröhn, Olli; Linden, Anni-Maija; Hautaniemi, Sampsa; Kaminen-Ahola, Nina

2015-01-01

The adverse effects of alcohol consumption during pregnancy are known, but the molecular events that lead to the phenotypic characteristics are unclear. To unravel the molecular mechanisms, we have used a mouse model of gestational ethanol exposure, which is based on maternal ad libitum ingestion of 10% (v/v) ethanol for the first 8 days of gestation (GD 0.5-8.5). Early neurulation takes place by the end of this period, which is equivalent to the developmental stage early in the fourth week post-fertilization in human. During this exposure period, dynamic epigenetic reprogramming takes place and the embryo is vulnerable to the effects of environmental factors. Thus, we hypothesize that early ethanol exposure disrupts the epigenetic reprogramming of the embryo, which leads to alterations in gene regulation and life-long changes in brain structure and function. Genome-wide analysis of gene expression in the mouse hippocampus revealed altered expression of 23 genes and three miRNAs in ethanol-exposed, adolescent offspring at postnatal day (P) 28. We confirmed this result by using two other tissues, where three candidate genes are known to express actively. Interestingly, we found a similar trend of upregulated gene expression in bone marrow and main olfactory epithelium. In addition, we observed altered DNA methylation in the CpG islands upstream of the candidate genes in the hippocampus. Our MRI study revealed asymmetry of brain structures in ethanol-exposed adult offspring (P60): we detected ethanol-induced enlargement of the left hippocampus and decreased volume of the left olfactory bulb. Our study indicates that ethanol exposure in early gestation can cause changes in DNA methylation, gene expression, and brain structure of offspring. Furthermore, the results support our hypothesis of early epigenetic origin of alcohol-induced disorders: changes in gene regulation may have already taken place in embryonic stem cells and therefore can be seen in different tissue

Stage-specific apoptosis, developmental delay, and embryonic lethality in mice homozygous for a targeted disruption in the murine Bloom's syndrome gene.

PubMed

Chester, N; Kuo, F; Kozak, C; O'Hara, C D; Leder, P

1998-11-01

Bloom's syndrome is a human autosomal genetic disorder characterized at the cellular level by genome instability and increased sister chomatid exchanges (SCEs). Clinical features of the disease include proportional dwarfism and a predisposition to develop a wide variety of malignancies. The human BLM gene has been cloned recently and encodes a DNA helicase. Mouse embryos homozygous for a targeted mutation in the murine Bloom's syndrome gene (Blm) are developmentally delayed and die by embryonic day 13.5. The fact that the interrupted gene is the homolog of the human BLM gene was confirmed by its homologous sequence, its chromosomal location, and by demonstrating high numbers of SCEs in cultured murine Blm-/- fibroblasts. The proportional dwarfism seen in the human is consistent with the small size and developmental delay (12-24 hr) seen during mid-gestation in murine Blm-/- embryos. Interestingly, the growth retardation in mutant embryos can be accounted for by a wave of increased apoptosis in the epiblast restricted to early post-implantation embryogenesis. Mutant embryos do not survive past day 13.5, and at this time exhibit severe anemia. Red blood cells and their precursors from Blm-/- embryos are heterogeneous in appearance and have increased numbers of macrocytes and micronuclei. Both the apoptotic wave and the appearance of micronuclei in red blood cells are likely cellular consequences of damaged DNA caused by effects on replicating or segregating chromosomes.

The lipodystrophic hotspot lamin A p.R482W mutation deregulates the mesodermal inducer T/Brachyury and early vascular differentiation gene networks.

PubMed

Briand, Nolwenn; Guénantin, Anne-Claire; Jeziorowska, Dorota; Shah, Akshay; Mantecon, Matthieu; Capel, Emilie; Garcia, Marie; Oldenburg, Anja; Paulsen, Jonas; Hulot, Jean-Sebastien; Vigouroux, Corinne; Collas, Philippe

2018-04-15

The p.R482W hotspot mutation in A-type nuclear lamins causes familial partial lipodystrophy of Dunnigan-type (FPLD2), a lipodystrophic syndrome complicated by early onset atherosclerosis. Molecular mechanisms underlying endothelial cell dysfunction conferred by the lamin A mutation remain elusive. However, lamin A regulates epigenetic developmental pathways and mutations could perturb these functions. Here, we demonstrate that lamin A R482W elicits endothelial differentiation defects in a developmental model of FPLD2. Genome modeling in fibroblasts from patients with FPLD2 caused by the lamin A R482W mutation reveals repositioning of the mesodermal regulator T/Brachyury locus towards the nuclear center relative to normal fibroblasts, suggesting enhanced activation propensity of the locus in a developmental model of FPLD2. Addressing this issue, we report phenotypic and transcriptional alterations in mesodermal and endothelial differentiation of induced pluripotent stem cells we generated from a patient with R482W-associated FPLD2. Correction of the LMNA mutation ameliorates R482W-associated phenotypes and gene expression. Transcriptomics links endothelial differentiation defects to decreased Polycomb-mediated repression of the T/Brachyury locus and over-activation of T target genes. Binding of the Polycomb repressor complex 2 to T/Brachyury is impaired by the mutated lamin A network, which is unable to properly associate with the locus. This leads to a deregulation of vascular gene expression over time. By connecting a lipodystrophic hotspot lamin A mutation to a disruption of early mesodermal gene expression and defective endothelial differentiation, we propose that the mutation rewires the fate of several lineages, resulting in multi-tissue pathogenic phenotypes.

Developmental Rainbow: Early Childhood Development Profile.

ERIC Educational Resources Information Center

Mahoney, Gerald; Mahoney, Frida

One of the most important skills of professionals who work with young children is the ability to assess developmental functioning through informal observation. This skill serves as the foundation for screening or identifying children in need of developmental services, conducting play-based developmental assessments, and helping parents to…

Infancy to Early Childhood: Genetic and Environmental Influences on Developmental Change.

ERIC Educational Resources Information Center

Emde, Robert N., Ed.; Hewitt, John K., Ed.

This book analyzes the MacArthur Longitudinal Twin Study, a collaborative study by leading developmental scientists and behavioral geneticists on the transition from infancy to early childhood. Part 1 of the book describes the twin method and procedures used and introduces the analytic strategies. Parts 2 through 4 present results related to…

Executive Function in Early Childhood: Longitudinal Measurement Invariance and Developmental Change

ERIC Educational Resources Information Center

Willoughby, Michael T.; Wirth, R. J.; Blair, Clancy B.

2012-01-01

This study tested the longitudinal measurement invariance and developmental changes of a newly developed battery of executive function (EF) tasks for use in early childhood. The battery was administered in the Family Life Project--a prospective longitudinal study (N = 1,292) of families who were oversampled from low-income and African American…

Small Steps: An Early Intervention Program for Children with Developmental Delays.

ERIC Educational Resources Information Center

Pieterse, Moira; And Others

This boxed set includes eight booklets of home activities for early intervention for young children with developmental delays. The first book provides an introduction to the program and its implementation, lists 23 resources, describes a videotape which supplements the booklets, and includes a glossary. Book 2 covers how to select goals for the…

Revisiting a Progressive Pedagogy. The Developmental-Interaction Approach. SUNY Series, Early Childhood Education: Inquiries and Insights.

ERIC Educational Resources Information Center

Nager, Nancy, Ed.; Shapiro, Edna K., Ed.

This book reviews the history of the developmental-interactive approach, a formulation rooted in developmental psychology and educational practice, progressively informing educational thinking since the early 20th century. The book describes and analyzes key assumptions and assesses the compatibility of new theoretical approaches, focuses on…

Priorities for Developmental Areas in Early Childhood Education: A Comparison of Parents' and Teachers' Priorities

ERIC Educational Resources Information Center

Sackes, Mesut

2013-01-01

The purpose of this study was to examine parents' and early childhood teachers' perceptions of the priorities for developmental areas targeted in the Turkish Early Childhood Education Curriculum for children aged 36-72 months. The sample of this study consisted of 1600 parents and 158 early childhood teachers. The study utilized a survey research…

Identification of High-Temperature-Responsive Genes in Cereals1[C][W

PubMed Central

Hemming, Megan N.; Walford, Sally A.; Fieg, Sarah; Dennis, Elizabeth S.; Trevaskis, Ben

2012-01-01

High temperature influences plant development and can reduce crop yields. We examined how ambient temperature influences reproductive development in the temperate cereals wheat (Triticum aestivum) and barley (Hordeum vulgare). High temperature resulted in rapid progression through reproductive development in long days, but inhibited early stages of reproductive development in short days. Activation of the long-day flowering response pathway through day-length-insensitive alleles of the PHOTOPERIOD1 gene, which result in high FLOWERING LOCUS T-like1 transcript levels, did not allow rapid early reproductive development at high temperature in short days. Furthermore, high temperature did not increase transcript levels of FLOWERING LOCUS T-like genes. These data suggest that genes or pathways other than the long-day response pathway mediate developmental responses to high temperature in cereals. Transcriptome analyses suggested a possible role for vernalization-responsive genes in the developmental response to high temperature. The MADS-box floral repressor HvODDSOC2 is expressed at elevated levels at high temperature in short days, and might contribute to the inhibition of early reproductive development under these conditions. FLOWERING PROMOTING FACTOR1-like, RNase-S-like genes, and VER2-like genes were also identified as candidates for high-temperature-responsive developmental regulators. Overall, these data suggest that rising temperatures might elicit different developmental responses in cereal crops at different latitudes or times of year, due to the interaction between temperature and day length. Additionally, we suggest that different developmental regulators might mediate the response to high temperature in cereals compared to Arabidopsis (Arabidopsis thaliana). PMID:22279145

The early stages of duplicate gene evolution

PubMed Central

Moore, Richard C.; Purugganan, Michael D.

2003-01-01

Gene duplications are one of the primary driving forces in the evolution of genomes and genetic systems. Gene duplicates account for 8–20% of the genes in eukaryotic genomes, and the rates of gene duplication are estimated at between 0.2% and 2% per gene per million years. Duplicate genes are believed to be a major mechanism for the establishment of new gene functions and the generation of evolutionary novelty, yet very little is known about the early stages of the evolution of duplicated gene pairs. It is unclear, for example, to what extent selection, rather than neutral genetic drift, drives the fixation and early evolution of duplicate loci. Analysis of recently duplicated genes in the Arabidopsis thaliana genome reveals significantly reduced species-wide levels of nucleotide polymorphisms in the progenitor and/or duplicate gene copies, suggesting that selective sweeps accompany the initial stages of the evolution of these duplicated gene pairs. Our results support recent theoretical work that indicates that fates of duplicate gene pairs may be determined in the initial phases of duplicate gene evolution and that positive selection plays a prominent role in the evolutionary dynamics of the very early histories of duplicate nuclear genes. PMID:14671323

Social visual engagement in infants and toddlers with autism: Early developmental transitions and a model of pathogenesis

PubMed Central

Klin, Ami; Shultz, Sarah; Jones, Warren

2014-01-01

Efforts to determine and understand the causes of autism are currently hampered by a large disconnect between recent molecular genetics findings that are associated with the condition and the core behavioral symptoms that define the condition. In this perspective piece, we propose a systems biology framework to bridge that gap between genes and symptoms. The framework focuses on basic mechanisms of socialization that are highly-conserved in evolution and are early-emerging in development. By conceiving of these basic mechanisms of socialization as quantitative endophenotypes, we hope to connect genes and behavior in autism through integrative studies of neurodevelopmental, behavioral, and epigenetic changes. These changes both lead to and are led by the accomplishment of specific social adaptive tasks in a typical infant's life. However, based on recent research that indicates that infants later diagnosed with autism fail to accomplish at least some of these tasks, we suggest that a narrow developmental period, spanning critical transitions from reflexive, subcortically-controlled visual behavior to interactional, cortically-controlled and social visual behavior be prioritized for future study. Mapping epigenetic, neural, and behavioral changes that both drive and are driven by these early transitions may shed a bright light on the pathogenesis of autism. PMID:25445180

Social visual engagement in infants and toddlers with autism: early developmental transitions and a model of pathogenesis.

PubMed

Klin, Ami; Shultz, Sarah; Jones, Warren

2015-03-01

Efforts to determine and understand the causes of autism are currently hampered by a large disconnect between recent molecular genetics findings that are associated with the condition and the core behavioral symptoms that define the condition. In this perspective piece, we propose a systems biology framework to bridge that gap between genes and symptoms. The framework focuses on basic mechanisms of socialization that are highly-conserved in evolution and are early-emerging in development. By conceiving of these basic mechanisms of socialization as quantitative endophenotypes, we hope to connect genes and behavior in autism through integrative studies of neurodevelopmental, behavioral, and epigenetic changes. These changes both lead to and are led by the accomplishment of specific social adaptive tasks in a typical infant's life. However, based on recent research that indicates that infants later diagnosed with autism fail to accomplish at least some of these tasks, we suggest that a narrow developmental period, spanning critical transitions from reflexive, subcortically-controlled visual behavior to interactional, cortically-controlled and social visual behavior be prioritized for future study. Mapping epigenetic, neural, and behavioral changes that both drive and are driven by these early transitions may shed a bright light on the pathogenesis of autism. Copyright © 2014 Elsevier Ltd. All rights reserved.

Xp22.3 genomic deletions involving the CDKL5 gene in girls with early onset epileptic encephalopathy.

PubMed

Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo

2010-04-01

Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.

Convergent occurrence of the developmental hourglass in plant and animal embryogenesis?

PubMed

Cridge, Andrew G; Dearden, Peter K; Brownfield, Lynette R

2016-04-01

The remarkable similarity of animal embryos at particular stages of development led to the proposal of a developmental hourglass. In this model, early events in development are less conserved across species but lead to a highly conserved 'phylotypic period'. Beyond this stage, the model suggests that development once again becomes less conserved, leading to the diversity of forms. Recent comparative studies of gene expression in animal groups have provided strong support for the hourglass model. How and why might such an hourglass pattern be generated? More importantly, how might early acting events in development evolve while still maintaining a later conserved stage? The discovery that an hourglass pattern may also exist in the embryogenesis of plants provides comparative data that may help us explain this phenomenon. Whether the developmental hourglass occurs in plants, and what this means for our understanding of embryogenesis in plants and animals is discussed. Models by which conserved early-acting genes might change their functional role in the evolution of gene networks, how networks buffer these changes, and how that might constrain, or confer diversity, of the body plan are also discused. Evidence of a morphological and molecular hourglass in plant and animal embryogenesis suggests convergent evolution. This convergence is likely due to developmental constraints imposed upon embryogenesis by the need to produce a viable embryo with an established body plan, controlled by the architecture of the underlying gene regulatory networks. As the body plan is largely laid down during the middle phases of embryo development in plants and animals, then it is perhaps not surprising this stage represents the narrow waist of the hourglass where the gene regulatory networks are the oldest and most robust and integrated, limiting species diversity and constraining morphological space. © The Author 2016. Published by Oxford University Press on behalf of the Annals of

Developmental commentary: individual and contextual influences on student-teacher relationships and children's early problem behaviors.

PubMed

Myers, Sonya S; Pianta, Robert C

2008-07-01

Understanding factors associated with children's early behavioral difficulties is of vital importance to children's school success, and to the prevention of future behavior problems. Although biological factors can influence the expression of certain behaviors, the probability of children exhibiting classroom behavior problems is intensified when they are exposed to multiple risk factors, particularly negative student-teacher interactions. Children who exhibit behavior problems during early childhood and the transition to kindergarten, without intervention, can be placed on a developmental trajectory for serious behavior problems in later grades. Using a developmental systems model, this commentary provides a conceptual framework for understanding the contributions of individual and contextual factors to the development of early student-teacher relationships. Parent, teacher, and student characteristics are discussed as they are related to shaping student-teacher interactions and children's adjustment to school.

Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2016-07-01

Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes

PubMed Central

Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

2018-01-01

Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203

The histone demethylase Jarid1b ensures faithful mouse development by protecting developmental genes from aberrant H3K4me3.

PubMed

Albert, Mareike; Schmitz, Sandra U; Kooistra, Susanne M; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C; Johansen, Jens V; Abarrategui, Iratxe; Helin, Kristian

2013-04-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications.

The Histone Demethylase Jarid1b Ensures Faithful Mouse Development by Protecting Developmental Genes from Aberrant H3K4me3

PubMed Central

Kooistra, Susanne M.; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C.; Johansen, Jens V.; Abarrategui, Iratxe; Helin, Kristian

2013-01-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications. PMID:23637629

Natural variation in gene expression in the early development of dauer larvae of Caenorhabditis elegans.

PubMed

Harvey, Simon C; Barker, Gary L A; Shorto, Alison; Viney, Mark E

2009-07-18

The free-living nematode Caenorhabditis elegans makes a developmental decision based on environmental conditions: larvae either arrest as dauer larva, or continue development into reproductive adults. There is natural variation among C. elegans lines in the sensitivity of this decision to environmental conditions; that is, there is variation in the phenotypic plasticity of dauer larva development. We hypothesised that these differences may be transcriptionally controlled in early stage larvae. We investigated this by microarray analysis of different C. elegans lines under different environmental conditions, specifically the presence and absence of dauer larva-inducing pheromone. There were substantial transcriptional differences between four C. elegans lines under the same environmental conditions. The expression of approximately 2,000 genes differed between genetically different lines, with each line showing a largely line-specific transcriptional profile. The expression of genes that are markers of larval moulting suggested that the lines may be developing at different rates. The expression of a total of 89 genes was putatively affected by dauer larva or non-dauer larva-inducing conditions. Among the upstream regions of these genes there was an over-representation of DAF-16-binding motifs. Under the same environmental conditions genetically different lines of C. elegans had substantial transcriptional differences. This variation may be due to differences in the developmental rates of the lines. Different environmental conditions had a rather smaller effect on transcription. The preponderance of DAF-16-binding motifs upstream of these genes was consistent with these genes playing a key role in the decision between development into dauer or into non-dauer larvae. There was little overlap between the genes whose expression was affected by environmental conditions and previously identified loci involved in the plasticity of dauer larva development.

Early Developmental Processes and the Continuity of Risk for Underage Drinking and Problem Drinking

PubMed Central

Donovan, John E.; Masten, Ann S.; Mattson, Margaret E.; Moss, Howard B.

2008-01-01

Developmental pathways to underage drinking emerge before the second decade of life. Nonetheless, many scientists, as well as the general public, continue to focus on proximal influences surrounding the initiation of drinking in adolescence, such as the social, behavioral, and genetic variables relating to availability and ease of acquisition of the drug, social reinforcement for its use, and individual differences in drug response. Over the past 20 years, a considerable body of evidence has accumulated on the early predictors and pathways of youthful alcohol use and abuse, often much earlier than the time of first drink. These early developmental influences involve numerous risk, vulnerability, promotive and protective processes. Some of these factors are not directly related to alcohol use per se, while others involve learning and expectancies about later drug use that are shaped by social experience. The salience of these factors-- identifiable in early childhood-- for understanding the course and development of adult alcohol and other drug use disorders is evident from the large and growing body of findings on their ability to predict these adult clinical outcomes. This review summarizes the evidence on early pathways toward and away from underage drinking, with a particular focus on the risk and protective factors, mediators and moderators of risk for underage drinking that become evident during the preschool and early school years. It is guided by a developmental perspective on the aggregation of risk and protection, and examines the contributions of biological, psychological, and social processes within the context of normal development. Implications of this evidence for policy, intervention, and future research are discussed. PMID:18381493

Developmental gene regulatory network architecture across 500 million years of echinoderm evolution

NASA Technical Reports Server (NTRS)

Hinman, Veronica F.; Nguyen, Albert T.; Cameron, R. Andrew; Davidson, Eric H.

2003-01-01

Evolutionary change in morphological features must depend on architectural reorganization of developmental gene regulatory networks (GRNs), just as true conservation of morphological features must imply retention of ancestral developmental GRN features. Key elements of the provisional GRN for embryonic endomesoderm development in the sea urchin are here compared with those operating in embryos of a distantly related echinoderm, a starfish. These animals diverged from their common ancestor 520-480 million years ago. Their endomesodermal fate maps are similar, except that sea urchins generate a skeletogenic cell lineage that produces a prominent skeleton lacking entirely in starfish larvae. A relevant set of regulatory genes was isolated from the starfish Asterina miniata, their expression patterns determined, and effects on the other genes of perturbing the expression of each were demonstrated. A three-gene feedback loop that is a fundamental feature of the sea urchin GRN for endoderm specification is found in almost identical form in the starfish: a detailed element of GRN architecture has been retained since the Cambrian Period in both echinoderm lineages. The significance of this retention is highlighted by the observation of numerous specific differences in the GRN connections as well. A regulatory gene used to drive skeletogenesis in the sea urchin is used entirely differently in the starfish, where it responds to endomesodermal inputs that do not affect it in the sea urchin embryo. Evolutionary changes in the GRNs since divergence are limited sharply to certain cis-regulatory elements, whereas others have persisted unaltered.

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

PubMed

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Exome Analysis Identified a Novel Mutation in the RBP4 Gene in a Consanguineous Pedigree with Retinal Dystrophy and Developmental Abnormalities

PubMed Central

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V.; Chavali, Venkata R. M.; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G. Bhanuprakash; Sieving, Paul A.; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism. PMID:23189188

Child Health, Developmental Plasticity, and Epigenetic Programming

PubMed Central

Feil, R.; Constancia, M.; Fraga, M.; Junien, C.; Carel, J.-C.; Boileau, P.; Le Bouc, Y.; Deal, C. L.; Lillycrop, K.; Scharfmann, R.; Sheppard, A.; Skinner, M.; Szyf, M.; Waterland, R. A.; Waxman, D. J.; Whitelaw, E.; Ong, K.; Albertsson-Wikland, K.

2011-01-01

Plasticity in developmental programming has evolved in order to provide the best chances of survival and reproductive success to the organism under changing environments. Environmental conditions that are experienced in early life can profoundly influence human biology and long-term health. Developmental origins of health and disease and life-history transitions are purported to use placental, nutritional, and endocrine cues for setting long-term biological, mental, and behavioral strategies in response to local ecological and/or social conditions. The window of developmental plasticity extends from preconception to early childhood and involves epigenetic responses to environmental changes, which exert their effects during life-history phase transitions. These epigenetic responses influence development, cell- and tissue-specific gene expression, and sexual dimorphism, and, in exceptional cases, could be transmitted transgenerationally. Translational epigenetic research in child health is a reiterative process that ranges from research in the basic sciences, preclinical research, and pediatric clinical research. Identifying the epigenetic consequences of fetal programming creates potential applications in clinical practice: the development of epigenetic biomarkers for early diagnosis of disease, the ability to identify susceptible individuals at risk for adult diseases, and the development of novel preventive and curative measures that are based on diet and/or novel epigenetic drugs. PMID:20971919

Correlations between Developmental Kindergarten Screenings and Early Reading Indicators One Year Later

ERIC Educational Resources Information Center

Coughlan-Mainard, Kelly A.

2012-01-01

School districts in the U.S. are mandated to identify young children with disabilities. Developmental screeners are typically used to screen for such skill deficits. Academic tests are used in older students. A significant challenge is identifying children with potential learning disabilities early in their school career. This study identifies a…

A comparative study of RNA and DNA as internal gene expression controls early in the developmental cycle of Chlamydia pneumoniae.

PubMed

Engström, Patrik; Bailey, Leslie; Onskog, Thomas; Bergström, Sven; Johansson, Jörgen

2010-03-01

Many microbial pathogens invade and proliferate within host cells and the molecular mechanism underlying this behavior is currently being revealed for several bacterial species. Testing clinically relevant antibacterial compounds and elucidating their effects on gene expression requires adequate controls, especially when studying genetically intractable organisms such as Chlamydia spp., for which various gene fusions cannot be constructed. Until now, relative mRNA levels in Chlamydia have been measured using different internal gene expression controls, including 16S rRNA, mRNAs, and DNA. Here, we compared the advantages and disadvantages of various internal expression controls during the early phase of Chlamydia pneumoniae development. The relative abundance of target mRNAs varied using the different internal control RNAs. This was partly due to variation in the transcript stability of the RNA species. Also, seven out of nine of the analyzed RNAs increased fivefold or more between 2 and 14 h postinfection, while the amount of DNA and number of cells remained essentially unaltered. Our results suggest that RNA should not be used as a gene expression control during the early phase of Chlamydia development, and that intrinsic bacterial DNA is preferable for that purpose because it is stable, abundant, and its relative amount is generally correlated with bacterial numbers.

Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

PubMed

Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

2016-07-07

During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. Copyright © 2016 Song et al.

Early PQQ supplementation has persistent long-term protective effects on developmental programming of hepatic lipotoxicity and inflammation in obese mice.

PubMed

Jonscher, Karen R; Stewart, Michael S; Alfonso-Garcia, Alba; DeFelice, Brian C; Wang, Xiaoxin X; Luo, Yuhuan; Levi, Moshe; Heerwagen, Margaret J R; Janssen, Rachel C; de la Houssaye, Becky A; Wiitala, Ellen; Florey, Garrett; Jonscher, Raleigh L; Potma, Eric O; Fiehn, Oliver; Friedman, Jacob E

2017-04-01

Nonalcoholic fatty liver disease (NAFLD) is widespread in adults and children. Early exposure to maternal obesity or Western-style diet (WD) increases steatosis and oxidative stress in fetal liver and is associated with lifetime disease risk in the offspring. Pyrroloquinoline quinone (PQQ) is a natural antioxidant found in soil, enriched in human breast milk, and essential for development in mammals. We investigated whether a supplemental dose of PQQ, provided prenatally in a mouse model of diet-induced obesity during pregnancy, could protect obese offspring from progression of NAFLD. PQQ treatment given pre- and postnatally in WD-fed offspring had no effect on weight gain but increased metabolic flexibility while reducing body fat and liver lipids, compared with untreated obese offspring. Indices of NAFLD, including hepatic ceramide levels, oxidative stress, and expression of proinflammatory genes ( Nos2 , Nlrp3 , Il6 , and Ptgs2 ), were decreased in WD PQQ-fed mice, concomitant with increased expression of fatty acid oxidation genes and decreased Pparg expression. Notably, these changes persisted even after PQQ withdrawal at weaning. Our results suggest that supplementation with PQQ, particularly during pregnancy and lactation, protects offspring from WD-induced developmental programming of hepatic lipotoxicity and may help slow the advancing epidemic of NAFLD in the next generation.-Jonscher, K. R., Stewart, M. S., Alfonso-Garcia, A., DeFelice, B. C., Wang, X. X., Luo, Y., Levi, M., Heerwagen, M. J. R., Janssen, R. C., de la Houssaye, B. A., Wiitala, E., Florey, G., Jonscher, R. L., Potma, E. O., Fiehn, O. Friedman, J. E. Early PQQ supplementation has persistent long-term protective effects on developmental programming of hepatic lipotoxicity and inflammation in obese mice. © FASEB.

Past climate change on Sky Islands drives novelty in a core developmental gene network and its phenotype.

PubMed

Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab

2015-09-04

A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our

Parental Divorce and Offspring Depressive Symptoms: Dutch Developmental Trends during Early Adolescence

ERIC Educational Resources Information Center

Oldehinkel, Albertine J.; Ormel, Johan; Veenstra, Rene; De Winter, Andrea F.; Verhulst, Frank C.

2008-01-01

In this study, we investigated if the association between parental divorce and depressive symptoms changes during early adolescence and if developmental patterns are similar for boys and girls. Data were collected in a prospective population cohort of Dutch adolescents (N = 2,149), aged 10 - 15 years. Outcome variables were self-reported and…

The Role of Maternal Depression in Accessing Early Intervention Services for Children with Developmental Delay

ERIC Educational Resources Information Center

Colgan, Siobhan Eileen

2012-01-01

This study investigated the relationship between maternal depression and children's access to early intervention services among a sample of children with developmental delay at age two who were determined to be eligible for early intervention services, were full term and of normal birth weight, and were not previously identified with any special…

Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans

PubMed Central

Ow, Maria C.; Nichitean, Alexandra M.; Dorus, Steve; Hall, Sarah E.

2018-01-01

Environmental stress during early development in animals can have profound effects on adult phenotypes via programmed changes in gene expression. Using the nematode C. elegans, we demonstrated previously that adults retain a cellular memory of their developmental experience that is manifested by differences in gene expression and life history traits; however, the sophistication of this system in response to different environmental stresses, and how it dictates phenotypic plasticity in adults that contribute to increased fitness in response to distinct environmental challenges, was unknown. Using transcriptional profiling, we show here that C. elegans adults indeed retain distinct cellular memories of different environmental conditions. We identified approximately 500 genes in adults that entered dauer due to starvation that exhibit significant opposite (“seesaw”) transcriptional phenotypes compared to adults that entered dauer due to crowding, and are distinct from animals that bypassed dauer. Moreover, we show that two-thirds of the genes in the genome experience a 2-fold or greater seesaw trend in gene expression, and based upon the direction of change, are enriched in large, tightly linked regions on different chromosomes. Importantly, these transcriptional programs correspond to significant changes in brood size depending on the experienced stress. In addition, we demonstrate that while the observed seesaw gene expression changes occur in both somatic and germline tissue, only starvation-induced changes require a functional GLP-4 protein necessary for germline development, and both programs require the Argonaute CSR-1. Thus, our results suggest that signaling between the soma and the germ line can generate phenotypic plasticity as a result of early environmental experience, and likely contribute to increased fitness in adverse conditions and the evolution of the C. elegans genome. PMID:29447162

The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

PubMed Central

Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

2013-01-01

Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

Altered cortical expression of GABA-related genes in schizophrenia: illness progression vs developmental disturbance.

PubMed

Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A

2015-01-01

Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Gene expression profiling at early organogenesis reveals both common and diverse mechanisms in foregut patterning

PubMed Central

Fagman, Henrik; Amendola, Elena; Parrillo, Luca; Zoppoli, Pietro; Marotta, Pina; Scarfò, Marzia; De Luca, Pasquale; de Carvalho, Denise Pires; Ceccarelli, Michele; De Felice, Mario; Di Lauro, Roberto

2011-01-01

The thyroid and lungs originate as neighboring bud shaped outgrowths from the midline of the embryonic foregut. When and how organ specific programs regulate development into structures of distinct shapes, positions and functions is incompletely understood. To characterize, at least in part, the genetic basis of these events, we have employed laser capture microdissection and microarray analysis to define gene expression in the mouse thyroid and lung primordia at E10.5. By comparing the transcriptome of each bud to that of the whole embryo as well as to each other, we broadly describe the genes that are preferentially expressed in each developing organ as well as those with an enriched expression common to both. The results thus obtained provide a valuable resource for further analysis of genes previously unrecognized to participate in thyroid and lung morphogenesis and to discover organ specific as well as common developmental mechanisms. As an initial step in this direction we describe a regulatory pathway involving the anti-apoptotic gene Bcl2 that controls cell survival in early thyroid development. PMID:21924257

Temporal variations in early developmental decisions: an engine of forebrain evolution.

PubMed

Bielen, H; Pal, S; Tole, S; Houart, C

2017-02-01

Tight control of developmental timing is pivotal to many major processes in developmental biology, such as patterning, fate specification, cell cycle dynamics, cell migration and connectivity. Temporal change in these ontogenetic sequences is known as heterochrony, a major force in the evolution of body plans and organogenesis. In the last 5 years, studies in fish and rodents indicate that heterochrony in signaling during early development generates diversity in forebrain size and complexity. Here, we summarize these findings and propose that, additionally to spatio-temporal tuning of neurogenesis, temporal and quantitative modulation of signaling events drive pivotal changes in shape, size and complexity of the forebrain across evolution, participating to the generation of diversity in animal behavior and emergence of cognition. Copyright © 2017 Elsevier Ltd. All rights reserved.

Trajectories of Physical Discipline: Early Childhood Antecedents and Developmental Outcomes

PubMed Central

Lansford, Jennifer E.; Criss, Michael M.; Dodge, Kenneth A.; Shaw, Daniel S.; Pettit, Gregory S.; Bates, John E.

2009-01-01

This study examined childhood antecedents and developmental outcomes associated with trajectories of mild and harsh parental physical discipline. Interview, questionnaire, and observational data were available from 499 children followed from age 5 to 16 and from 258 children in an independent sample followed from age 5 to 15. Analyses indicated distinct physical discipline trajectory groups that varied in frequency of physical discipline and rate of change. In both samples, family ecological disadvantage differentiated the trajectory groups; in the first sample, early child externalizing also differentiated the groups. Controlling for early childhood externalizing, the minimal/ceasing trajectory groups were associated with the lowest levels of subsequent adolescent antisocial behavior in both samples and with parent-adolescent positive relationship quality in the second sample. PMID:19765007

Trajectories of physical discipline: early childhood antecedents and developmental outcomes.

PubMed

Lansford, Jennifer E; Criss, Michael M; Dodge, Kenneth A; Shaw, Daniel S; Pettit, Gregory S; Bates, John E

2009-01-01

This study examined childhood antecedents and developmental outcomes associated with trajectories of mild and harsh parental physical discipline. Interview, questionnaire, and observational data were available from 499 children followed from ages 5 to 16 and from 258 children in an independent sample followed from ages 5 to 15. Analyses indicated distinct physical discipline trajectory groups that varied in frequency of physical discipline and rate of change. In both samples, family ecological disadvantage differentiated the trajectory groups; in the first sample, early child externalizing also differentiated the groups. Controlling for early childhood externalizing, the minimal/ceasing trajectory groups were associated with the lowest levels of subsequent adolescent antisocial behavior in both samples and with parent-adolescent positive relationship quality in the second sample.

Identification of nickel response genes in abnormal early developments of sea urchin by differential display polymerase chain reaction.

PubMed

Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun

2012-10-01

Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos. Copyright © 2012 Elsevier Inc. All rights reserved.

Skeletal Morphogenesis of Microbrachis and Hyloplesion (Tetrapoda: Lepospondyli), and Implications for the Developmental Patterns of Extinct, Early Tetrapods

PubMed Central

Olori, Jennifer C.

2015-01-01

The ontogeny of extant amphibians often is used as a model for that of extinct early tetrapods, despite evidence for a spectrum of developmental modes in temnospondyls and a paucity of ontogenetic data for lepospondyls. I describe the skeletal morphogenesis of the extinct lepospondyls Microbrachis pelikani and Hyloplesion longicostatum using the largest samples examined for either taxon. Nearly all known specimens were re-examined, allowing for substantial anatomical revisions that affect the scoring of characters commonly used in phylogenetic analyses of early tetrapods. The palate of H. longicostatum is re-interpreted and suggested to be more similar to that of M. pelikani, especially in the nature of the contact between the pterygoids. Both taxa possess lateral lines, and M. pelikani additionally exhibits branchial plates. However, early and rapid ossification of the postcranial skeleton, including a well-developed pubis and ossified epipodials, suggests that neither taxon metamorphosed nor were they neotenic in the sense of branchiosaurids and salamanders. Morphogenetic patterns in the foot suggest that digit 5 was developmentally delayed and the final digit to ossify in M. pelikani and H. longicostatum. Overall patterns of postcranial ossification may indicate postaxial dominance in limb and digit formation, but also more developmental variation in early tetrapods than has been appreciated. The phylogenetic position and developmental patterns of M. pelikani and H. longicostatum are congruent with the hypothesis that early tetrapods lacked metamorphosis ancestrally and that stem-amniotes exhibited derived features of development, such as rapid and complete ossification of the skeleton, potentially prior to the evolution of the amniotic egg. PMID:26083733

Social Problem-Solving in Early Childhood: Developmental Change and the Influence of Shyness

PubMed Central

Walker, Olga L.; Degnan, Kathryn A.; Fox, Nathan A.; Henderson, Heather A.

2013-01-01

The purpose of this study was to examine developmental change and the influence of shyness on social problem-solving (SPS). At 24, 36, and 48 months, children (N=570) were observed while interacting with an unfamiliar peer during an SPS task and at 24 months, maternal report of shyness was collected. Results showed that across the full sample, children displayed low but stable levels of withdrawn SPS and increasing levels of SPS competence over development. In addition, results showed that 24-month shyness was associated with high-increasing and high-decreasing withdrawn SPS trajectories compared to the low-increasing withdrawn SPS trajectory. Shyness was also associated with the low-increasing compared to the high-increasing SPS competence trajectory. Findings demonstrate the development of SPS competence over early childhood, as well as the influence of early shyness on this developmental course, with some shy children showing improvement in SPS skills and others continuing to show SPS difficulties over time. PMID:24039325

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

The Zebrafish Models to Explore Genetic and Epigenetic Impacts on Evolutionary Developmental Origins of Aging

PubMed Central

Kishi, Shuji

2014-01-01

Can we reset, reprogram, rejuvenate or reverse the organismal aging process? Certain genetic manipulations could at least reset and reprogram epigenetic dynamics beyond phenotypic plasticity and elasticity in cells, which can be further manipulated into organisms. However, in a whole complex aging organism, how can we rejuvenate intrinsic resources and infrastructures in an intact/noninvasive manner? The incidence of diseases increases exponentially with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but essentially inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena to rejuvenate over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states based on diverse epigenotypes, in response to intrinsic or extrinsic environmental cues and genetic perturbations. We hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds and windows of plasticity and its robustness by molecular genetic and chemical epigenetic approaches, we have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during their embryonic and/or larval stages (“embryonic/larval senescence”). Subsequently, at least some of these mutant animals were found to show shortened lifespan, while some others would be expected to live longer in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other

The International Society for Developmental Psychobiology Annual Meeting Symposium: Impact of Early Life Experiences on Brain and Behavioral Development

PubMed Central

Sullivan, Regina; Wilson, Donald A.; Feldon, Joram; Yee, Benjamin K.; Meyer, Urs; Richter-Levin, Gal; Avi, Avital; Michael, Tsoory; Gruss, Michael; Bock, Jörg; Helmeke, Carina; Braun, Katharina

2007-01-01

Decades of research in the area of developmental psychobiology have shown that early life experience alters behavioral and brain development, which canalizes development to suit different environments. Recent methodological advances have begun to identify the mechanisms by which early life experiences cause these diverse adult outcomes. Here we present four different research programs that demonstrate the intricacies of early environmental influences on behavioral and brain development in both pathological and normal development. First, an animal model of schizophrenia is presented that suggests prenatal immune stimulation influences the postpubertal emergence of psychosis-related behavior in mice. Second, we describe a research program on infant rats that demonstrates how early odor learning has unique characteristics due to the unique functioning of the infant limbic system. Third, we present work on the rodent Octodon degus, which shows that early paternal and/or maternal deprivation alters development of limbic system synaptic density that corresponds to heightened emotionality. Fourth, ajuvenile model of stress is presented that suggests this developmental period is important in determining adulthood emotional well being. The approach of each research program is strikingly different, yet all succeed in delineating a specific aspect of early development and its effects on infant and adult outcome that expands our understanding of the developmental impact of infant experiences on emotional and limbic system development. Together, these research programs suggest that the developing organism’s developmental trajectory is influenced by environmental factors beginning in the fetus and extending through adolescence, although the specific timing and nature of the environmental influence has unique impact on adult mental health. PMID:17016842

Molecular diagnosis of patients with epilepsy and developmental delay using a customized panel of epilepsy genes.

PubMed

Ortega-Moreno, Laura; Giráldez, Beatriz G; Soto-Insuga, Victor; Losada-Del Pozo, Rebeca; Rodrigo-Moreno, María; Alarcón-Morcillo, Cristina; Sánchez-Martín, Gema; Díaz-Gómez, Esther; Guerrero-López, Rosa; Serratosa, José M

2017-01-01

Pediatric epilepsies are a group of disorders with a broad phenotypic spectrum that are associated with great genetic heterogeneity, thus making sequential single-gene testing an impractical basis for diagnostic strategy. The advent of next-generation sequencing has increased the success rate of epilepsy diagnosis, and targeted resequencing using genetic panels is the a most cost-effective choice. We report the results found in a group of 87 patients with epilepsy and developmental delay using targeted next generation sequencing (custom-designed Haloplex panel). Using this gene panel, we were able to identify disease-causing variants in 17 out of 87 (19.5%) analyzed patients, all found in known epilepsy-associated genes (KCNQ2, CDKL5, STXBP1, SCN1A, PCDH19, POLG, SLC2A1, ARX, ALG13, CHD2, SYNGAP1, and GRIN1). Twelve of 18 variants arose de novo and 6 were novel. The highest yield was found in patients with onset in the first years of life, especially in patients classified as having early-onset epileptic encephalopathy. Knowledge of the underlying genetic cause provides essential information on prognosis and could be used to avoid unnecessary studies, which may result in a greater diagnostic cost-effectiveness.

Expression of genes involved in early cell fate decisions in human embryos and their regulation by growth factors.

PubMed

Kimber, S J; Sneddon, S F; Bloor, D J; El-Bareg, A M; Hawkhead, J A; Metcalfe, A D; Houghton, F D; Leese, H J; Rutherford, A; Lieberman, B A; Brison, D R

2008-05-01

Little is understood about the regulation of gene expression in human preimplantation embryos. We set out to examine the expression in human preimplantation embryos of a number of genes known to be critical for early development of the murine embryo. The expression profile of these genes was analysed throughout preimplantation development and in response to growth factor (GF) stimulation. Developmental expression of a number of genes was similar to that seen in murine embryos (OCT3B/4, CDX2, NANOG). However, GATA6 is expressed throughout preimplantation development in the human. Embryos were cultured in IGF-I, leukaemia inhibitory factor (LIF) or heparin-binding EGF-like growth factor (HBEGF), all of which are known to stimulate the development of human embryos. Our data show that culture in HBEGF and LIF appears to facilitate human embryo expression of a number of genes: ERBB4 (LIF) and LIFR and DSC2 (HBEGF) while in the presence of HBEGF no blastocysts expressed EOMES and when cultured with LIF only two out of nine blastocysts expressed TBN. These data improve our knowledge of the similarities between human and murine embryos and the influence of GFs on human embryo gene expression. Results from this study will improve the understanding of cell fate decisions in early human embryos, which has important implications for both IVF treatment and the derivation of human embryonic stem cells.

On Expression Patterns and Developmental Origin of Human Brain Regions.

PubMed

Kirsch, Lior; Chechik, Gal

2016-08-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

On Expression Patterns and Developmental Origin of Human Brain Regions

PubMed Central

Kirsch, Lior; Chechik, Gal

2016-01-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

Early Developmental Regression in Autism Spectrum Disorder: Evidence from an International Multiplex Sample

ERIC Educational Resources Information Center

Parr, Jeremy R.; Le Couteur, Ann; Baird, Gillian; Rutter, Michael; Pickles, Andrew; Fombonne, Eric; Bailey, Anthony J.

2011-01-01

The characteristics of early developmental regression (EDR) were investigated in individuals with ASD from affected relative pairs recruited to the International Molecular Genetic Study of Autism Consortium (IMGSAC). Four hundred and fifty-eight individuals with ASD were recruited from 226 IMGSAC families. Regression before age 36 months occurred…

Structure and function of the homeotic gene complex (HOM-C) in the beetle, Tribolium castaneum

NASA Technical Reports Server (NTRS)

Beeman, R. W.; Stuart, J. J.; Brown, S. J.; Denell, R. E.; Spooner, B. S. (Principal Investigator)

1993-01-01

The powerful combination of genetic, developmental and molecular approaches possible with the fruit fly, Drosophila melanogaster, has led to a profound understanding of the genetic control of early developmental events. However, Drosophila is a highly specialized long germ insect, and the mechanisms controlling its early development may not be typical of insects or Arthropods in general. The beetle, Tribolium castaneum, offers a similar opportunity to integrate high resolution genetic analysis with the developmental/molecular approaches currently used in other organisms. Early results document significant differences between insect orders in the functions of genes responsible for establishing developmental commitments.

Structure and function of the homeotic gene complex (HOM-C) in the beetle, Tribolium castaneum.

PubMed

Beeman, R W; Stuart, J J; Brown, S J; Denell, R E

1993-07-01

The powerful combination of genetic, developmental and molecular approaches possible with the fruit fly, Drosophila melanogaster, has led to a profound understanding of the genetic control of early developmental events. However, Drosophila is a highly specialized long germ insect, and the mechanisms controlling its early development may not be typical of insects or Arthropods in general. The beetle, Tribolium castaneum, offers a similar opportunity to integrate high resolution genetic analysis with the developmental/molecular approaches currently used in other organisms. Early results document significant differences between insect orders in the functions of genes responsible for establishing developmental commitments.

Early risk factors and developmental pathways to chronic high inhibition and social anxiety disorder in adolescence.

PubMed

Essex, Marilyn J; Klein, Marjorie H; Slattery, Marcia J; Goldsmith, H Hill; Kalin, Ned H

2010-01-01

Evidence suggests that chronic high levels of behavioral inhibition are a precursor of social anxiety disorder. The authors sought to identify early risk factors for, and developmental pathways to, chronic high inhibition among school-age children and the association of chronic high inhibition with social anxiety disorder by adolescence. A community sample of 238 children was followed from birth to grade 9. Mothers, teachers, and children reported on the children's behavioral inhibition from grades 1 to 9. Lifetime history of psychiatric disorders was available for the subset of 60 (25%) children who participated in an intensive laboratory assessment at grade 9. Four early risk factors were assessed: female gender; exposure to maternal stress during infancy and the preschool period; and at age 4.5 years, early manifestation of behavioral inhibition and elevated afternoon salivary cortisol levels. All four risk factors predicted greater and more chronic inhibition from grades 1 to 9, and together they defined two developmental pathways. The first pathway, in girls, was partially mediated by early evidence of behavioral inhibition and elevated cortisol levels at age 4.5 years. The second pathway began with exposure to early maternal stress and was also partially mediated by childhood cortisol levels. By grade 9, chronic high inhibition was associated with a lifetime history of social anxiety disorder. Chronic high levels of behavioral inhibition are associated with social anxiety disorder by adolescence. The identification of two developmental pathways suggests the potential importance of considering both sets of risk factors in developing preventive interventions for social anxiety disorder.

Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

PubMed

Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

2017-07-30

The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

Parsing the Effects Violence Exposure in Early Childhood: Modeling Developmental Pathways

PubMed Central

Carter, Alice S.; Ford, Julian D.

2012-01-01

Objective To prospectively examine pathways from early childhood violence exposure and trauma-related symptoms to school-age emotional health. Methods A longitudinal, birth cohort (N = 437) was assessed with parent reports of lifetime violence exposure and trauma-related symptoms at 3 years of age and later, internalizing and externalizing symptoms, and social competence at school age. Results Early family and neighborhood violence correlated significantly with early trauma-related symptoms and also significantly predicted school-age internalizing and externalizing symptoms and poorer competence, independent of sociodemographic risk and past-year violence exposure. Longitudinal pathways were significantly mediated by arousal and avoidance symptoms at 3 years of age, which increased risk for clinically significant emotional problems and lower competence at school age (adjusted odds ratios = 3.1–6.1, p < 0.01). Conclusions Trauma-related symptoms may mediate developmental pathways from early violence exposure to later emotional health. Interventions that prevent or reduce early trauma-related symptoms may ameliorate the long-term deleterious impact of violence exposure. PMID:21903730

Similar Developmental Trajectories in Autism and Asperger Syndrome: From Early Childhood to Adolescence

ERIC Educational Resources Information Center

Szatmari, Peter; Bryson, Susan; Duku, Eric; Vaccarella, Liezanne; Zwaigenbaum, Lonnie; Bennett, Teresa; Boyle, Michael H.

2009-01-01

Objective: The objective of this study was to chart the developmental trajectories of high-functioning children with autism spectrum disorders (ASD) from early childhood to adolescence using the presence and absence of structural language impairment (StrLI) as a way of differentiating autism from Asperger syndrome (AS). Method: Sixty-four…

Developmentally Appropriate Technology in Early Childhood (DATEC) in Botswana: In-Service Teachers' Perspectives

ERIC Educational Resources Information Center

Bose, Kabita

2009-01-01

Developmentally Appropriate Technology in Early Childhood (DATEC) aims to identify the most appropriate applications of Information and Communication Technology to support the development of children under eight years of age. Botswana has a unique spread of population density and deep-rooted socio-cultural values. There is a need to address the…

Context Matters: The Interrelatedness of Early Literacy Skills, Developmental Health, and Community Demographics

ERIC Educational Resources Information Center

Lesaux, Nonie K.; Vukovic, Rose K.; Hertzman, Clyde; Siegel, Linda S.

2007-01-01

Whereas the great majority of literacy research has been focused at the child level, this study examined the relationship between early literacy rates, developmental health of the population, and demographics in 23 school communities. The results showed that school-level literacy scores were related to the physical, social, and emotional maturity…

MOLECULAR AND MORPHOLOGICAL CHANGES IN ZEBRAFISH FOLLOWING TRANSIENT ETHANOL EXPOSURE DURING DEFINED DEVELOPMENTAL STAGES

PubMed Central

Zhang, Chengjin; Frazier, Jared M.; Chen, Hao; Liu, Yao; Lee, Ju-Ahng; Cole, Gregory J.

2014-01-01

Alcohol is a teratogen that has diverse effects on brain and craniofacial development, leading to a constellation of developmental disorders referred to as fetal alcohol spectrum disorder (FASD). The molecular basis of ethanol insult remains poorly understood, as does the relationship between molecular and behavioral changes as a consequence of prenatal ethanol exposure. Zebrafish embryos were exposed to a range of ethanol concentrations (0.5–5.0%) during defined developmental stages, and examined for morphological phenotypes characteristic of FASD. Embryos were also analyzed by in situ hybridization for changes in expression of defined cell markers for neural cell types that are sonic hedgehog-dependent. We show that transient binge-like ethanol exposures during defined developmental stages, such as early gastrulation and early neurulation, result in a range of phenotypes and changes in expression of Shh-dependent genes. The severity of fetal alcohol syndrome (FAS) morphological phenotypes, such as microphthalmia, depends on the embryonic stage and concentration of alcohol exposure, as does diminution of retinal Pax6a or forebrain and hindbrain GAD1 gene expression. We also show that changes in eye and brain morphology correlate with changes in Pax6a and GAD1 gene expression. Our results therefore show that transient binge-like ethanol exposures in zebrafish embryos produce the stereotypical morphological phenotypes of FAS, with the severity of phenotypes depending on the developmental stage and alcohol concentration of exposure. PMID:24929233

Finding Susceptibility Genes for Developmental Disorders of Speech: The Long and Winding Road.

ERIC Educational Resources Information Center

Felsenfeld, Susan

2002-01-01

This article explores the gene-finding process for developmental speech disorders (DSDs), specifically disorders of articulation/phonology and stuttering. It reviews existing behavioral genetic studies of these phenotypes, discusses roadblocks that may impede the molecular study of DSDs, and reviews the findings of the small number of molecular…

Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

PubMed

Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

2016-02-01

Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

PubMed

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

The gene expression database for mouse development (GXD): putting developmental expression information at your fingertips.

PubMed

Smith, Constance M; Finger, Jacqueline H; Kadin, James A; Richardson, Joel E; Ringwald, Martin

2014-10-01

Because molecular mechanisms of development are extraordinarily complex, the understanding of these processes requires the integration of pertinent research data. Using the Gene Expression Database for Mouse Development (GXD) as an example, we illustrate the progress made toward this goal, and discuss relevant issues that apply to developmental databases and developmental research in general. Since its first release in 1998, GXD has served the scientific community by integrating multiple types of expression data from publications and electronic submissions and by making these data freely and widely available. Focusing on endogenous gene expression in wild-type and mutant mice and covering data from RNA in situ hybridization, in situ reporter (knock-in), immunohistochemistry, reverse transcriptase-polymerase chain reaction, Northern blot, and Western blot experiments, the database has grown tremendously over the years in terms of data content and search utilities. Currently, GXD includes over 1.4 million annotated expression results and over 260,000 images. All these data and images are readily accessible to many types of database searches. Here we describe the data and search tools of GXD; explain how to use the database most effectively; discuss how we acquire, curate, and integrate developmental expression information; and describe how the research community can help in this process. Copyright © 2014 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists.

The Role of Developmental Screening Practices in Early Diagnosis of Autism Spectrum Disorders: An Analysis of All-Payer Claims Data in New Hampshire

ERIC Educational Resources Information Center

Humphreys, Betsy P.

2013-01-01

Universal developmental screening during pediatric well child care detects early delays in development and is a critical gateway to early intervention for young children at risk for Autism Spectrum Disorders (ASD). Developmental screening practices are highly variable, and few studies have examined screening utilization for children at risk for…

Multigeneration reproductive and developmental toxicity study of bar gene inserted into genetically modified potato on rats.

PubMed

Rhee, Gyu Seek; Cho, Dae Hyun; Won, Yong Hyuck; Seok, Ji Hyun; Kim, Soon Sun; Kwack, Seung Jun; Lee, Rhee Da; Chae, Soo Yeong; Kim, Jae Woo; Lee, Byung Mu; Park, Kui Lea; Choi, Kwang Sik

2005-12-10

Each specific protein has an individual gene encoding it, and a foreign gene introduced to a plant can be used to synthesize a new protein. The identification of potential reproductive and developmental toxicity from novel proteins produced by genetically modified (GM) crops is a difficult task. A science-based risk assessment is needed in order to use GM crops as a conventional foodstuff. In this study, the specific characteristics of GM food and low-level chronic exposure were examined using a five-generation animal study. In each generation, rats were fed a solid pellet containing 5% GM potato and non-GM potato for 10 wk prior to mating in order to assess the potential reproductive and developmental toxic effects. In the multigeneration animal study, there were no GM potato-related changes in body weight, food consumption, reproductive performance, and organ weight. Polymerase chain reaction (PCR) was carried out using extracted genomic DNA to examine the possibility of gene persistence in the organ tissues after a long-term exposure to low levels of GM feed. In each generation, the gene responsible for bar was not found in any of the reproductive organs of the GM potato-treated male and female rats, and the litter-related indexes did not show any genetically modified organism (GMO)-related changes. The results suggest that genetically modified crops have no adverse effects on the multigeneration reproductive-developmental ability.

Transcriptome Analysis and Discovery of Genes Relevant to Development in Bradysia odoriphaga at Three Developmental Stages.

PubMed

Gao, Huanhuan; Zhai, Yifan; Wang, Wenbo; Chen, Hao; Zhou, Xianhong; Zhuang, Qianying; Yu, Yi; Li, Rumei

2016-01-01

Bradysia odoriphaga (Diptera: Sciaridae) is the most important pest of Chinese chive (Allium tuberosum) in Asia; however, the molecular genetics are poorly understood. To explore the molecular biological mechanism of development, Illumina sequencing and de novo assembly were performed in the third-instar, fourth-instar, and pupal B. odoriphaga. The study resulted in 16.2 Gb of clean data and 47,578 unigenes (≥125 bp) contained in 7,632,430 contigs, 46.21% of which were annotated from non-redundant protein (NR), Gene Ontology (GO), Clusters of Orthologous Groups (COG), Eukaryotic Orthologous Groups (KOG), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. It was found that 19.67% of unigenes matched the homologous species mainly, including Aedes aegypti, Culex quinquefasciatus, Ceratitis capitata, and Anopheles gambiae. According to differentially expressed gene (DEG) analysis, 143, 490, and 309 DEGs were annotated as involved in the developmental process in the GO database respectively, in the comparisons of third-instar and fourth-instar larvae, third-instar larvae and pupae, and fourth-instar larvae and pupae. Twenty-five genes were closely related to these processes, including developmental process, reproduction process, and reproductive organs development and programmed cell death (PCD). The information of unigenes assembled in B. odoriphaga through transcriptome and DEG analyses could provide a detailed genetic basis and regulated information for elaborating the developmental mechanism from the larval, pre-pupal to pupal stages of B. odoriphaga.

In vivo loss of function study reveals the short stature homeobox-containing (shox) gene plays indispensable roles in early embryonic growth and bone formation in zebrafish.

PubMed

Sawada, Rie; Kamei, Hiroyasu; Hakuno, Fumihiko; Takahashi, Shin-Ichiro; Shimizu, Toshiaki

2015-02-01

Congenital loss of the SHOX gene is considered to be a genetic cause of short stature phenotype in Turner syndrome and Leri-Weill dyschondrosteosis patients. Though SHOX expression initiates during early fetal development, little is known about the embryonic roles of SHOX. The evolutionary conservation of the zebrafish shox gene and the convenience of the early developmental stages for analyses make zebrafish a preferred model. Here, we characterized structure, expression, and developmental roles of zebrafish shox through a loss-of-function approach. We found a previously undiscovered Shox protein that has both a homeodomain and an OAR-domain in zebrafish. The shox transcript emerged during the segmentation period and it increased in later stages. The predominant domains of shox expression were mandibular arch, pectoral fin, anterior notochord, rhombencephalon, and mesencephalon, suggesting that Shox is involved in bone and neural development. Translational blockade of Shox mRNA by an antisense morpholino oligo delayed embryonic growth, which was restored by the co-overexpression of morpholino-resistant Shox mRNA. At later stages, impaired Shox expression markedly delayed the calcification process in the anterior vertebral column and craniofacial bones. Our data demonstrate evolutionarily conserved Shox plays roles in early embryonic growth and in later bone formation. © 2014 Wiley Periodicals, Inc.

Interdisciplinary Early Intervention for Developmentally Delayed Infants and Young Children: A Family-Oriented Approach.

ERIC Educational Resources Information Center

Russell, Fay F.; And Others

Intended to help developers of early intervention programs for children with developmental disabilities, the book provides philosophy, methods, and procedures based on experiences of the Child Development Center of the University of Tennessee Center for Health Sciences. The first section presents a program description including information on…

RNA-sequencing analysis reveals abundant developmental stage-specific and immunity-related genes in the pollen beetle Meligethes aeneus.

PubMed

Vogel, H; Badapanda, C; Knorr, E; Vilcinskas, A

2014-02-01

The pollen beetle (Meligethes aeneus) is a major pest of oilseed rape (Brassica napus) and other cruciferous crops in Europe. Pesticide-resistant pollen beetle populations are emerging, increasing the economic impact of this species. We isolated total RNA from the larval and adult stages, the latter either naïve or immunized by injection with bacteria and yeast. High-throughput RNA sequencing (RNA-Seq) was carried out to establish a comprehensive transcriptome catalogue and to screen for developmental stage-specific and immunity-related transcripts. We assembled the transcriptome de novo by combining sequence tags from all developmental stages and treatments. Gene expression data based on normalized read counts revealed several functional gene categories that were differentially expressed between larvae and adults, particularly genes associated with digestion and detoxification that were induced in larvae, and genes associated with reproduction and environmental signalling that were induced in adults. We also identified many genes associated with microbe recognition, immunity-related signalling and defence effectors, such as antimicrobial peptides (AMPs) and lysozymes. Digital gene expression analysis revealed significant differences in the profile of AMPs expressed in larvae, naïve adults and immune-challenged adults, providing insight into the steady-state differences between developmental stages and the complex transcriptional remodelling that occurs following the induction of immunity. Our data provide insight into the adaptive mechanisms used by phytophagous insects and could lead to the development of more effective control strategies for insect pests. © 2013 The Royal Entomological Society.

Effects of early developmental conditions on innate immunity are only evident under favourable adult conditions in zebra finches

NASA Astrophysics Data System (ADS)

de Coster, Greet; Verhulst, Simon; Koetsier, Egbert; de Neve, Liesbeth; Briga, Michael; Lens, Luc

2011-12-01

Long-term effects of unfavourable conditions during development can be expected to depend on the quality of the environment experienced by the same individuals during adulthood. Yet, in the majority of studies, long-term effects of early developmental conditions have been assessed under favourable adult conditions only. The immune system might be particularly vulnerable to early environmental conditions as its development, maintenance and use are thought to be energetically costly. Here, we studied the interactive effects of favourable and unfavourable conditions during nestling and adult stages on innate immunity (lysis and agglutination scores) of captive male and female zebra finches ( Taeniopygia guttata). Nestling environmental conditions were manipulated by a brood size experiment, while a foraging cost treatment was imposed on the same individuals during adulthood. This combined treatment showed that innate immunity of adult zebra finches is affected by their early developmental conditions and varies between both sexes. Lysis scores, but not agglutination scores, were higher in individuals raised in small broods and in males. However, these effects were only present in birds that experienced low foraging costs. This study shows that the quality of the adult environment may shape the long-term consequences of early developmental conditions on innate immunity, as long-term effects of nestling environment were only evident under favourable adult conditions.

Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.

PubMed

Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R

2018-06-01

Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.

Epigenetic mechanisms in developmental programming of adult disease

PubMed Central

Chen, Man; Zhang, Lubo

2011-01-01

Adverse insults during intrauterine life can result in permanent changes in the physiology and metabolism of the offspring, which in turn leads to an increased risk of disease in adulthood. This is an adaptational response by the fetus to changes in the environmental signals that it receives during early life to ensure its survival and prepare itself for postnatal life. Increasing evidence suggests that the epigenetic regulation of gene expression patterns has a crucial role in the developmental programming of adult disease. This review summarizes recent studies of epigenetic mechanisms and focuses particularly on studies that explore identifiable epigenetic biomarkers in the promoters of specific disease-associated genes. Such biomarkers would enable early recognition of children who might be at risk of developing adult disease with fetal origins. PMID:21945859

Swimming speed alteration in the early developmental stages of Paracentrotus lividus sea urchin as ecotoxicological endpoint.

PubMed

Morgana, Silvia; Gambardella, Chiara; Falugi, Carla; Pronzato, Roberto; Garaventa, Francesca; Faimali, Marco

2016-04-01

Behavioral endpoints have been used for decades to assess chemical impacts at concentrations unlikely to cause mortality. With recently developed techniques, it is possible to investigate the swimming behavior of several organisms under laboratory conditions. The aims of this study were: i) assessing for the first time the feasibility of swimming speed analysis of the early developmental stage sea urchin Paracentrotus lividus by an automatic recording system ii) investigating any Swimming Speed Alteration (SSA) on P. lividus early stages exposed to a chemical reference; iii) identifying the most suitable stage for SSA test. Results show that the swimming speed of all the developmental stages was easily recorded. The swimming speed was inhibited as a function of toxicant concentration. Pluteus were the most appropriate stage for evaluating SSA in P. lividus as ecotoxicological endpoint. Finally, swimming of sea urchin early stages represents a sensitive endpoint to be considered in ecotoxicological investigations. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cord blood gene expression supports that prenatal exposure to perfluoroalkyl substances causes depressed immune functionality in early childhood.

PubMed

Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit

2016-01-01

Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances.

Genetic identification of female Cannabis sativa plants at early developmental stage.

PubMed

Techen, Natascha; Chandra, Suman; Lata, Hemant; Elsohly, Mahmoud A; Khan, Ikhlas A

2010-11-01

Sequence-characterized amplified region (SCAR) markers were used to identify female plants at an early developmental stage in four different varieties of Cannabis sativa. Using the cetyl trimethylammonium bromide (CTAB) method, DNA was isolated from two-week-old plants of three drug-type varieties (Terbag W1, Terbag K2, and Terbag MX) and one fiber-type variety (Terbag Fedora A7) of C. sativa grown under controlled environmental conditions through seeds. Attempts to use MADC2 (male-associated DNA from Cannabis sativa) primers as a marker to identify the sex of Cannabis sativa plants were successful. Amplification of genomic DNA using MADC2-F and MADC2-R primers produced two distinct fragments, one with a size of approximately 450 bp for female plants and one for male plants with a size of approximately 300 bp. After harvesting the tissues for DNA extraction, plants were subjected to a flowering photoperiod (i.e., 12-h light cycle), and the appearance of flowers was compared with the DNA analysis. The results of the molecular analysis were found to be concordant with the appearance of male or female flowers. The results of this study represent a quick and reliable technique for the identification of sex in Cannabis plants using SCAR markers at a very early developmental stage. © Georg Thieme Verlag KG Stuttgart · New York.

Comparative Transcriptomic Characterization of the Early Development in Pacific White Shrimp Litopenaeus vannamei

PubMed Central

Wei, Jiankai; Zhang, Xiaojun; Yu, Yang; Huang, Hao; Li, Fuhua; Xiang, Jianhai

2014-01-01

Penaeid shrimp has a distinctive metamorphosis stage during early development. Although morphological and biochemical studies about this ontogeny have been developed for decades, researches on gene expression level are still scarce. In this study, we have investigated the transcriptomes of five continuous developmental stages in Pacific white shrimp (Litopenaeus vannamei) with high throughput Illumina sequencing technology. The reads were assembled and clustered into 66,815 unigenes, of which 32,398 have putative homologues in nr database, 14,981 have been classified into diverse functional categories by Gene Ontology (GO) annotation and 26,257 have been associated with 255 pathways by KEGG pathway mapping. Meanwhile, the differentially expressed genes (DEGs) between adjacent developmental stages were identified and gene expression patterns were clustered. By GO term enrichment analysis, KEGG pathway enrichment analysis and functional gene profiling, the physiological changes during shrimp metamorphosis could be better understood, especially histogenesis, diet transition, muscle development and exoskeleton reconstruction. In conclusion, this is the first study that characterized the integrated transcriptomic profiles during early development of penaeid shrimp, and these findings will serve as significant references for shrimp developmental biology and aquaculture research. PMID:25197823

Vicissitudes of Children's Mathematical Knowledge: Implications of Developmental Research for Early Childhood Mathematics Education

ERIC Educational Resources Information Center

Sophian, Catherine

2013-01-01

Hachey's (2013) article celebrates a revolution that is taking place in early childhood mathematics education, fueled in part by developmental research demonstrating the mathematical capabilities of young children. At the same time, Hachey notes that the mathematics revolution she describes is not yet complete. In this commentary, the author…

Caregiver Descriptions of the Developmental Skills of Infants and Toddlers Entering Early Intervention Services

ERIC Educational Resources Information Center

Scarborough, Anita A.; Hebbeler, Kathleen M.; Simeonsson, Rune J.; Spiker, Donna

2007-01-01

The present study was conducted to describe the developmental skills of a national sample of infants and toddlers at entry into early intervention services. Caregivers were asked about their child's skills during a telephone interview. Summary values were derived from descriptions of motor, communication, independence, and cognitive skills. More…

Developmental predictors of inattention-hyperactivity from pregnancy to early childhood.

PubMed

Foulon, Stéphanie; Pingault, Jean-Baptiste; Larroque, Béatrice; Melchior, Maria; Falissard, Bruno; Côté, Sylvana M

2015-01-01

The objective of the study was to characterize the developmental sequence of pre- and postnatal risk factors for inattention-hyperactivity symptoms in preschoolers. Longitudinal data came from a French population based birth cohort study (EDEN; N = 1311 mother-child pairs followed from the pregnancy onwards). Inattention-hyperactivity symptoms were assessed with the Strengths and Difficulties Questionnaire when participating children were 3 years of age. Potential risk factors were classified in four domains (fetal exposures and child somatic characteristics, child temperament, child neurodevelopmental status, psychosocial environment) and four periods (before pregnancy, prenatal/birth, infancy, toddlerhood). Their role as potential moderator or mediator was tested with path analysis to determine the developmental sequence. A low family socioeconomic status before pregnancy was the main environmental risk factor for inattention-hyperactivity symptoms at 3 years, and its effect occurred via two pathways. The first was a risk pathway, where lower SES was associated with higher maternal depression and anxiety during pregnancy; then to higher maternal and child distress and dysregulation in infancy; and in turn to higher levels of inattention-hyperactivity at 3 years. The second was a protective pathway, where higher SES was associated with longer duration of breastfeeding during infancy; then to better child neurodevelopmental status in toddlerhood; and in turn to lower levels of inattention-hyperactivity at 3 years. This study identified psychosocial factors at several developmental periods that represent potential targets for preventing the emergence of inattention-hyperactivity symptoms in early childhood.

Commonly dysregulated genes in murine APL cells

PubMed Central

Yuan, Wenlin; Payton, Jacqueline E.; Holt, Matthew S.; Link, Daniel C.; Watson, Mark A.; DiPersio, John F.; Ley, Timothy J.

2007-01-01

To identify genes that are commonly dysregulated in a murine model of acute promyelocytic leukemia (APL), we first defined gene expression patterns during normal murine myeloid development; serial gene expression profiling studies were performed with primary murine hematopoietic progenitors that were induced to undergo myeloid maturation in vitro with G-CSF. Many genes were reproducibly expressed in restricted developmental “windows,” suggesting a structured hierarchy of expression that is relevant for the induction of developmental fates and/or differentiated cell functions. We compared the normal myeloid developmental transcriptome with that of APL cells derived from mice expressing PML-RARα under control of the murine cathepsin G locus. While many promyelocyte-specific genes were highly expressed in all APL samples, 116 genes were reproducibly dysregulated in many independent APL samples, including Fos, Jun, Egr1, Tnf, and Vcam1. However, this set of commonly dysregulated genes was expressed normally in preleukemic, early myeloid cells from the same mouse model, suggesting that dysregulation occurs as a “downstream” event during disease progression. These studies suggest that the genetic events that lead to APL progression may converge on common pathways that are important for leukemia pathogenesis. PMID:17008535

Expression of growth hormone gene during early development of Siberian sturgeon (Acipenser baerii)

PubMed Central

Abdolahnejad, Zeinab; Pourkazemi, Mohammad; Khoshkholgh, Majid Reza; Yarmohammadi, Mahtab

2015-01-01

The mRNA expression of growth hormone (GH) gene in early development stages of Siberian sturgeon was investigated using RT-PCR method. Samples were collected from unfertilized eggs up to 50 days post hatched (dph) larvae in 11 different times. Ribosomal protein L6 (RPL6) transcripts were used as the internal standard during quantification of GH mRNA expression. The results showed that the GH mRNA could be observed in the eyed eggs and even at unfertilized eggs of Siberian sturgeon. The highest amounts of GH mRNA were found at 25 and 50 dph larvae, while the lowest levels were detected at 1 and 3 dph larvae stage. These findings suggest that, the GH mRNA play a key role during developmental stages of Siberian sturgeon. PMID:27844010

Blood gene expression profiling of an early acetaminophen response.

PubMed

Bushel, P R; Fannin, R D; Gerrish, K; Watkins, P B; Paules, R S

2017-06-01

Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4 g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing, and 12 genes were detected with expression profiles significantly altered within 24 h. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure, and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration.

Blood Gene Expression Profiling of an Early Acetaminophen Response

PubMed Central

Bushel, Pierre R.; Fannin, Rick D.; Gerrish, Kevin; Watkins, Paul B.; Paules, Richard S.

2018-01-01

Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing and 12 genes were detected with expression profiles significantly altered within 24 hrs. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration. PMID:26927286

DIAGNOSTIC CLASSIFICATION OF MENTAL HEALTH AND DEVELOPMENTAL DISORDERS OF INFANCY AND EARLY CHILDHOOD DC:0-5: SELECTIVE REVIEWS FROM A NEW NOSOLOGY FOR EARLY CHILDHOOD PSYCHOPATHOLOGY.

PubMed

Zeanah, Charles H; Carter, Alice S; Cohen, Julie; Egger, Helen; Gleason, Mary Margaret; Keren, Miri; Lieberman, Alicia; Mulrooney, Kathleen; Oser, Cindy

2016-09-01

The Diagnostic Classification of Mental Health and Developmental Disorders of Infancy and Early Childhood: Revised Edition (DC:0-5; ZERO TO THREE) is scheduled to be published in 2016. The articles in this section are selective reviews that have been undertaken as part of the process of refining and updating the nosology. They provide the rationales for new disorders, for disorders that had not been included previously in the Diagnostic Classification of Mental Health and Developmental Disorders of Infancy and Early Childhood: Revised Edition (DC:0-3R; ZERO TO THREE, 2005), and for changes in how certain types of disorders are conceptualized. © 2016 Michigan Association for Infant Mental Health.

Latent Class Analysis of Early Developmental Trajectory in Baby Siblings of Children with Autism

ERIC Educational Resources Information Center

Landa, Rebecca J.; Gross, Alden L.; Stuart, Elizabeth A.; Bauman, Margaret

2012-01-01

Background: Siblings of children with autism (sibs-A) are at increased genetic risk for autism spectrum disorders (ASD) and milder impairments. To elucidate diversity and contour of early developmental trajectories exhibited by sibs-A, regardless of diagnostic classification, latent class modeling was used. Methods: Sibs-A (N = 204) were assessed…

Developmental toxicity of PAH mixtures in fish early life stages. Part II: adverse effects in Japanese medaka.

PubMed

Le Bihanic, Florane; Clérandeau, Christelle; Le Menach, Karyn; Morin, Bénédicte; Budzinski, Hélène; Cousin, Xavier; Cachot, Jérôme

2014-12-01

In aquatic environments, polycyclic aromatic hydrocarbons (PAHs) mostly occur as complex mixtures, for which risk assessment remains problematic. To better understand the effects of PAH mixture toxicity on fish early life stages, this study compared the developmental toxicity of three PAH complex mixtures. These mixtures were extracted from a PAH-contaminated sediment (Seine estuary, France) and two oils (Arabian Light and Erika). For each fraction, artificial sediment was spiked at three different environmental concentrations roughly equivalent to 0.5, 4, and 10 μg total PAH g(-1) dw. Japanese medaka embryos were incubated on these PAH-spiked sediments throughout their development, right up until hatching. Several endpoints were recorded at different developmental stages, including acute endpoints, morphological abnormalities, larvae locomotion, and genotoxicity (comet and micronucleus assays). The three PAH fractions delayed hatching, induced developmental abnormalities, disrupted larvae swimming activity, and damaged DNA at environmental concentrations. Differences in toxicity levels, likely related to differences in PAH proportions, were highlighted between fractions. The Arabian Light and Erika petrogenic fractions, containing a high proportion of alkylated PAHs and low molecular weight PAHs, were more toxic to Japanese medaka early life stages than the pyrolytic fraction. This was not supported by the toxic equivalency approach, which appeared unsuitable for assessing the toxicity of the three PAH fractions to fish early life stages. This study highlights the potential risks posed by environmental mixtures of alkylated and low molecular weight PAHs to early stages of fish development.

Parenting and the development of effortful control from early childhood to early adolescence: A transactional developmental model.

PubMed

Tiberio, Stacey S; Capaldi, Deborah M; Kerr, David C R; Bertrand, Maria; Pears, Katherine C; Owen, Lee

2016-08-01

Poor effortful control is a key temperamental factor underlying behavioral problems. The bidirectional association of child effortful control with both positive parenting and negative discipline was examined from ages approximately 3 to 13-14 years, involving five time points, and using data from parents and children in the Oregon Youth Study-Three Generational Study (N = 318 children from 150 families). Based on a dynamic developmental systems approach, it was hypothesized that there would be concurrent associations between parenting and child effortful control and bidirectional effects across time from each aspect of parenting to effortful control and from effortful control to each aspect of parenting. It was also hypothesized that associations would be more robust in early childhood, from ages 3 to 7 years, and would diminish as indicated by significantly weaker effects at the older ages, 11-12 to 13-14 years. Longitudinal feedback or mediated effects were also tested. The findings supported (a) stability in each construct over multiple developmental periods; (b) concurrent associations, which were significantly weaker at the older ages; (c) bidirectional effects, consistent with the interpretation that at younger ages children's effortful control influenced parenting, whereas at older child ages, parenting influenced effortful control; and (d) a transactional effect, such that maternal parenting in late childhood was a mechanism explaining children's development of effortful control from middle childhood to early adolescence.

Parenting and the Development of Effortful Control from Early Childhood to Early Adolescence: A Transactional Developmental Model

PubMed Central

Capaldi, Deborah M.; Kerr, David C. R.; Bertrand, Maria; Pears, Katherine C.; Owen, Lee

2016-01-01

Poor effortful control is a key temperamental factor underlying behavioral problems. The bidirectional association of child effortful control with both positive parenting and negative discipline was examined from ages approximately 3 to 13–14 years, involving 5 time points, and using data from parents and children in the Oregon Youth Study-Three Generational Study (N = 318 children from 150 families). Based on a dynamic developmental systems approach, it was hypothesized that there would be concurrent associations between parenting and child effortful control and bidirectional effects across time from each aspect of parenting to effortful control and from effortful control to each aspect of parenting. It was also hypothesized that associations would be more robust in early childhood, from ages 3 to 7 years, and would diminish as indicated by significantly weaker effects at the older ages, 11–12 to 13–14 years. Longitudinal feedback or mediated effects were also tested. Findings supported (a) stability in each construct over multiple developmental periods; (b) concurrent associations, which were significantly weaker at the older ages; (c) bidirectional effects, consistent with the interpretation that at younger ages children’s effortful control influenced parenting, whereas at older child ages, parenting influenced effortful control; and (d) a transactional effect, such that maternal parenting in late childhood was a mechanism explaining children’s development of effortful control from midchildhood to early adolescence. PMID:27427809

Developmental Exposure to Diethylstilbestrol Alters Uterine Gene Expression That May Be Associated With Uterine Neoplasia Later in Life

PubMed Central

Newbold, Retha R.; Jefferson, Wendy N.; Grissom, Sherry F.; Padilla-Banks, Elizabeth; Snyder, Ryan J.; Lobenhofer, Edward K.

2008-01-01

Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 μg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 μg/kg/d) on days 1–5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose–responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17β estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. PMID:17394237

Developmental exposure to diethylstilbestrol alters uterine gene expression that may be associated with uterine neoplasia later in life.

PubMed

Newbold, Retha R; Jefferson, Wendy N; Grissom, Sherry F; Padilla-Banks, Elizabeth; Snyder, Ryan J; Lobenhofer, Edward K

2007-09-01

Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 microg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 microg/kg/d) on days 1-5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose-responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17beta estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. (c) 2007 Wiley-Liss, Inc.

Early nodule senescence is activated in symbiotic mutants of pea (Pisum sativum L.) forming ineffective nodules blocked at different nodule developmental stages.

PubMed

Serova, Tatiana A; Tsyganova, Anna V; Tsyganov, Viktor E

2018-04-03

Plant symbiotic mutants are useful tool to uncover the molecular-genetic mechanisms of nodule senescence. The pea (Pisum sativum L.) mutants SGEFix - -1 (sym40), SGEFix - -3 (sym26), and SGEFix - -7 (sym27) display an early nodule senescence phenotype, whereas the mutant SGEFix - -2 (sym33) does not show premature degradation of symbiotic structures, but its nodules show an enhanced immune response. The nodules of these mutants were compared with each other and with those of the wild-type SGE line using seven marker genes that are known to be activated during nodule senescence. In wild-type SGE nodules, transcript levels of all of the senescence-associated genes were highest at 6 weeks after inoculation (WAI). The senescence-associated genes showed higher transcript abundance in mutant nodules than in wild-type nodules at 2 WAI and attained maximum levels in the mutant nodules at 4 WAI. Immunolocalization analyses showed that the ethylene precursor 1-aminocyclopropane-1-carboxylate accumulated earlier in the mutant nodules than in wild-type nodules. Together, these results showed that nodule senescence was activated in ineffective nodules blocked at different developmental stages in pea lines that harbor mutations in four symbiotic genes.

Similar developmental trajectories in autism and Asperger syndrome: from early childhood to adolescence.

PubMed

Szatmari, Peter; Bryson, Susan; Duku, Eric; Vaccarella, Liezanne; Zwaigenbaum, Lonnie; Bennett, Teresa; Boyle, Michael H

2009-12-01

The objective of this study was to chart the developmental trajectories of high-functioning children with autism spectrum disorders (ASD) from early childhood to adolescence using the presence and absence of structural language impairment (StrLI) as a way of differentiating autism from Asperger syndrome (AS). Sixty-four high-functioning children with ASD were ascertained at 4-6 years of age from several different regional diagnostic and treatment centers. At 6-8 years of age, the ADI-R and the Test of Oral Language Development were used to define an autism group (those with StrLI at 6-8 years of age) and an AS group (those without StrLI). Growth curve analysis was then used to chart the developmental trajectories of these children on measures of autistic symptoms, and adaptive skills in communication, daily living and socialization. Differentiating the ASD group in terms of the presence/absence of StrLI provided a better explanation of the variation in growth curves than not differentiating high-functioning ASD children. The two groups had similar developmental trajectories but the group without StrLI (the AS group) was functioning better and had fewer autistic symptoms than the group with StrLI (the autism group) on all measures across time. The differences in outcome could not be explained by non-verbal IQ or change in early language skills. Distinguishing between autism and Asperger syndrome based on the presence or absence of StrLI appears to be a clinically useful way of classifying ASD sub-types.

Mutation of the XIST gene upregulates expression of X-linked genes but decreases the developmental rates of cloned male porcine embryos.

PubMed

Yang, Yang; Wu, Dan; Liu, Dewu; Shi, Junsong; Zhou, Rong; He, Xiaoyan; Quan, Jianping; Cai, Gengyuan; Zheng, Enqin; Wu, Zhenfang; Li, Zicong

2017-06-01

XIST is an X-linked, non-coding gene responsible for the cis induction of X-chromosome inactivation (XCI). Knockout of the XIST allele on an active X chromosome abolishes erroneous XCI and enhances the in vivo development of cloned mouse embryos by more than 10-fold. This study aimed to investigate whether a similar manipulation would improve cloning efficiency in pigs. A male, porcine kidney cell line containing an EGFP insert in exon 1 of the XIST gene, resulting in a knockout allele (XIST-KO), was generated by homologous recombination using transcription activator-like effector nucleases (TALENs). The expression of X-linked genes in embryos cloned from the XIST-KO kidney cells was significantly higher than in male embryos cloned from wild-type (WT) kidney cells, but remained lower than that of in vivo fertilization-produced counterparts. The XIST-KO cloned embryos also had a significantly lower blastocyst rate and a reduced full-term development rate compared to cloned WT embryos. These data suggested that while mutation of a XIST gene can partially rescue abnormal XCI, it cannot improve the developmental efficiency of cloned male porcine embryos-a deficiency that may be caused by incomplete rescue of abnormal XCI and/or by long-term drug selection of the XIST-KO nuclear donor cells, which might adversely affect the developmental efficiency of embryos created from them. © 2017 Wiley Periodicals, Inc.

20-Hydroxyecdysone (20E) Primary Response Gene E75 Isoforms Mediate Steroidogenesis Autoregulation and Regulate Developmental Timing in Bombyx*

PubMed Central

Li, Kang; Tian, Ling; Guo, Zhongjian; Guo, Sanyou; Zhang, Jianzhen; Gu, Shi-Hong; Palli, Subba R.; Cao, Yang; Li, Sheng

2016-01-01

The temporal control mechanisms that precisely control animal development remain largely elusive. The timing of major developmental transitions in insects, including molting and metamorphosis, is coordinated by the steroid hormone 20-hydroxyecdysone (20E). 20E involves feedback loops to maintain pulses of ecdysteroid biosynthesis leading to its upsurge, whereas the underpinning molecular mechanisms are not well understood. Using the silkworm Bombyx mori as a model, we demonstrated that E75, the 20E primary response gene, mediates a regulatory loop between ecdysteroid biosynthesis and 20E signaling. E75 isoforms A and C directly bind to retinoic acid receptor-related response elements in Halloween gene promoter regions to induce gene expression thus promoting ecdysteroid biosynthesis and developmental transition, whereas isoform B antagonizes the transcriptional activity of isoform A/C through physical interaction. As the expression of E75 isoforms is differentially induced by 20E, the E75-mediated regulatory loop represents a fine autoregulation of steroidogenesis, which contributes to the precise control of developmental timing. PMID:27365399

Developmental changes in automatic rule-learning mechanisms across early childhood.

PubMed

Mueller, Jutta L; Friederici, Angela D; Männel, Claudia

2018-06-27

Infants' ability to learn complex linguistic regularities from early on has been revealed by electrophysiological studies indicating that 3-month-olds, but not adults, can automatically detect non-adjacent dependencies between syllables. While different ERP responses in adults and infants suggest that both linguistic rule learning and its link to basic auditory processing undergo developmental changes, systematic investigations of the developmental trajectories are scarce. In the present study, we assessed 2- and 4-year-olds' ERP indicators of pitch discrimination and linguistic rule learning in a syllable-based oddball design. To test for the relation between auditory discrimination and rule learning, ERP responses to pitch changes were used as predictor for potential linguistic rule-learning effects. Results revealed that 2-year-olds, but not 4-year-olds, showed ERP markers of rule learning. Although, 2-year-olds' rule learning was not dependent on differences in pitch perception, 4-year-old children demonstrated a dependency, such that those children who showed more pronounced responses to pitch changes still showed an effect of rule learning. These results narrow down the developmental decline of the ability for automatic linguistic rule learning to the age between 2 and 4 years, and, moreover, point towards a strong modification of this change by auditory processes. At an age when the ability of automatic linguistic rule learning phases out, rule learning can still be observed in children with enhanced auditory responses. The observed interrelations are plausible causes for age-of-acquisition effects and inter-individual differences in language learning. © 2018 John Wiley & Sons Ltd.

Developmental Predictors of Inattention-Hyperactivity from Pregnancy to Early Childhood

PubMed Central

Foulon, Stéphanie; Pingault, Jean-Baptiste; Melchior, Maria; Falissard, Bruno; Côté, Sylvana M.

2015-01-01

Objective The objective of the study was to characterize the developmental sequence of pre- and postnatal risk factors for inattention-hyperactivity symptoms in preschoolers. Materials and Methods Longitudinal data came from a French population based birth cohort study (EDEN; N = 1311 mother-child pairs followed from the pregnancy onwards). Inattention-hyperactivity symptoms were assessed with the Strengths and Difficulties Questionnaire when participating children were 3 years of age. Potential risk factors were classified in four domains (fetal exposures and child somatic characteristics, child temperament, child neurodevelopmental status, psychosocial environment) and four periods (before pregnancy, prenatal/birth, infancy, toddlerhood). Their role as potential moderator or mediator was tested with path analysis to determine the developmental sequence. Results A low family socioeconomic status before pregnancy was the main environmental risk factor for inattention-hyperactivity symptoms at 3 years, and its effect occurred via two pathways. The first was a risk pathway, where lower SES was associated with higher maternal depression and anxiety during pregnancy; then to higher maternal and child distress and dysregulation in infancy; and in turn to higher levels of inattention-hyperactivity at 3 years. The second was a protective pathway, where higher SES was associated with longer duration of breastfeeding during infancy; then to better child neurodevelopmental status in toddlerhood; and in turn to lower levels of inattention-hyperactivity at 3 years. Discussion This study identified psychosocial factors at several developmental periods that represent potential targets for preventing the emergence of inattention-hyperactivity symptoms in early childhood. PMID:25938453

Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

PubMed

Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

2014-01-01

Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

The phenotype of the CRINKLY4 deletion mutant of Physcomitrella patens suggests a broad role in developmental regulation in early land plants.

PubMed

Demko, Viktor; Ako, Eugene; Perroud, Pierre-François; Quatrano, Ralph; Olsen, Odd-Arne

2016-07-01

Deletion of the ancestral gene of the land plant multigene family of receptor like kinase CR4 in Physcomitrella patens demonstrates involvement in developmental control of gametophytic and sporophytic organs. The CRINKLY4 (CR4) family of receptor kinases in angiosperms consists of three clades, one including CR4, the CR4-related CCR1 and CCR2, a second including CCR3 and CCR4 family members, and a third and more distant clade. In addition to crinkly leaves in maize, which gave rise to the mutant gene name, CR4 is implicated in ovule, embryo, flower and root development in Arabidopsis thaliana. In root tips of the same species the module including a CLAVATA3/ESR-related protein, an Arabidopsis CR4, a CLAVATA1 and a WUSCHEL-related homeobox 5 (CLE40-ACR4-CLV1-WOX5) is implicated in meristem cell regulation. In embryos and shoots, CR4 acts together with A. thaliana MERISTEM LAYER 1 and PROTODERMAL FACTOR 2 to promote A. thaliana epidermis differentiation. Phylogenetic analysis has demonstrated that early land plants, e.g. mosses carry a single ancestral CR4 gene, together with genes encoding the other members of the CLE40-ACR4-CLV1-WOX5 signaling module. Here we show that CR4 serves as a broad regulator of morphogenesis both in gametophyte phyllids, archegonia and in sporophyte epidermis of the moss Physcomitrella patens. The phenotype of the CR4 deletion mutant in moss provides insight into the role of the ancestral CR4 gene as a regulator of development in early land plants.

Developmentally Appropriate Technology Practice: Exploring Myths and Perceptions of Early Childhood and Instructional Technology Professionals

ERIC Educational Resources Information Center

Blake, Sally; Winsor, Denise; Burkett, Candice; Allen, Lee

2011-01-01

The integration of technology in early childhood classrooms has become a controversial issue among professionals in this field. One issue which may influence technology in these classrooms may be perceptions of what is developmentally appropriate practice (DAP). This article explores perceptions about technology and age appropriate recommendations…

Early Risk Factors of Overweight Developmental Trajectories during Middle Childhood

PubMed Central

Pryor, Laura E.; Brendgen, Mara; Tremblay, Richard E.; Pingault, Jean-Baptiste; Liu, Xuecheng; Dubois, Lise; Touchette, Evelyne; Falissard, Bruno; Boivin, Michel; Côté, Sylvana M.

2015-01-01

Background Research is needed to identify early life risk factors associated with different developmental paths leading to overweight by adolescence. Objectives To model heterogeneity in overweight development during middle childhood and identify factors associated with differing overweight trajectories. Methods Data was drawn from the Quebec Longitudinal Study of Child Development (QLSCD; 1998-2010). Trained research assistants measured height and weight according to a standardized protocol and conducted yearly home interviews with the child’s caregiver (mother in 98% of cases). Information on several putative early life risk factors for the development of overweight were obtained, including factors related to the child’s perinatal, early behavioral family and social environment. Group-based trajectories of the probability of overweight (6-12 years) were identified with a semiparametric method (n=1678). Logistic regression analyses were used to identify early risk factors (5 months- 5 years) associated with each trajectory. Results Three trajectories of overweight were identified: “early-onset overweight” (11.0 %), “late-onset overweight” (16.6%) and “never overweight” (72.5%). Multinomial analyses indicated that children in the early and late-onset group, compared to the never overweight group, had 3 common types of risk factors: parental overweight, preschool overweight history, and large size for gestational age. Maternal overprotection (OR= 1.12, CI: 1.01-1.25), short nighttime sleep duration (OR=1.66, CI: 1.07-2.57), and immigrant status (OR=2.01, CI: 1.05-3.84) were factors specific to the early-onset group. Finally, family food insufficiency (OR=1.81, CI: 1.00-3.28) was weakly associated with membership in the late-onset trajectory group. Conclusions The development of overweight in childhood follows two different trajectories, which have common and distinct risk factors that could be the target of early preventive interventions. PMID

Developmental amnesia associated with early hypoxic-ischaemic injury.

PubMed

Gadian, D G; Aicardi, J; Watkins, K E; Porter, D A; Mishkin, M; Vargha-Khadem, F

2000-03-01

We recently reported on three young patients with severe impairments of episodic memory resulting from brain injury sustained early in life. These findings have led us to hypothesize that such impairments might be a previously unrecognized consequence of perinatal hypoxic-ischaemic injury. Neuropsychological and quantitative magnetic resonance investigations were carried out on five young patients, all of whom had suffered hypoxic-ischaemic episodes at or shortly after birth. All five patients showed severe impairments of episodic memory (memory for events), with relative preservation of semantic memory (memory for facts). However, none had any of the major neurological deficits that are typically associated with hypoxic-ischaemic injury, and all attended mainstream schools. Quantitative magnetic resonance investigations revealed severe bilateral hippocampal atrophy in all cases. As a group, the patients also showed bilateral reductions in grey matter in the regions of the putamen and the ventral part of the thalamus. On the basis of their clinical histories and the pattern of magnetic resonance findings, we attribute the patients' pathology and associated memory impairments primarily to hypoxic-ischaemic episodes sustained very early in life. We suggest that the degree of hypoxia-ischaemia was sufficient to produce selective damage to particularly vulnerable regions of the brain, notably the hippocampi, but was not sufficient to result in the more severe neurological and cognitive deficits that can follow hypoxic-ischaemic injury. The impairments in episodic memory may be difficult to recognize, particularly in early childhood, but this developmental amnesia can have debilitating consequences, both at home and at school, and may preclude independent life in adulthood.

A Conserved Core of Programmed Cell Death Indicator Genes Discriminates Developmentally and Environmentally Induced Programmed Cell Death in Plants.

PubMed

Olvera-Carrillo, Yadira; Van Bel, Michiel; Van Hautegem, Tom; Fendrych, Matyáš; Huysmans, Marlies; Simaskova, Maria; van Durme, Matthias; Buscaill, Pierre; Rivas, Susana; Coll, Nuria S.; Coppens, Frederik; Maere, Steven; Nowack, Moritz K.

2015-12-01

A plethora of diverse programmed cell death (PCD) processes has been described in living organisms. In animals and plants, different forms of PCD play crucial roles in development, immunity, and responses to the environment. While the molecular control of some animal PCD forms such as apoptosis is known in great detail, we still know comparatively little about the regulation of the diverse types of plant PCD. In part, this deficiency in molecular understanding is caused by the lack of reliable reporters to detect PCD processes. Here, we addressed this issue by using a combination of bioinformatics approaches to identify commonly regulated genes during diverse plant PCD processes in Arabidopsis (Arabidopsis thaliana). Our results indicate that the transcriptional signatures of developmentally controlled cell death are largely distinct from the ones associated with environmentally induced cell death. Moreover, different cases of developmental PCD share a set of cell death-associated genes. Most of these genes are evolutionary conserved within the green plant lineage, arguing for an evolutionary conserved core machinery of developmental PCD. Based on this information, we established an array of specific promoter-reporter lines for developmental PCD in Arabidopsis. These PCD indicators represent a powerful resource that can be used in addition to established morphological and biochemical methods to detect and analyze PCD processes in vivo and in planta. © 2015 American Society of Plant Biologists. All Rights Reserved.

Caffeine induces high expression of cyp-35A family genes and inhibits the early larval development in Caenorhabditis elegans.

PubMed

Min, Hyemin; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

2015-03-01

Intake of caffeine during pregnancy can cause retardation of fetal development. Although the significant influence of caffeine on animal development is widely recognized, much remains unknown about its mode of action because of its pleiotropic effects on living organisms. In the present study, by using Caenorhabditis elegans as a model organism, the effects of caffeine on development were examined. Brood size, embryonic lethality, and percent larval development were investigated, and caffeine was found to inhibit the development of C. elegans at most of the stages in a dosage-dependent fashion. Upon treatment with 30 mM caffeine, the majority (86.1 ± 3.4%) of the L1 larvae were irreversibly arrested without further development. In contrast, many of the late-stage larvae survived and grew to adults when exposed to the same 30 mM caffeine. These results suggest that early-stage larvae are more susceptible to caffeine than later-stage larvae. To understand the metabolic responses to caffeine treatment, the levels of expression of cytochrome P450 (cyp) genes were examined with or without caffeine treatment using comparative micro-array, and it was found that the expression of 24 cyp genes was increased by more than 2-fold (p < 0.05). Among them, induction of the cyp-35A gene family was the most prominent. Interestingly, depletion of the cyp-35A family genes one-by-one or in combination through RNA interference resulted in partial rescue from early larval developmental arrest caused by caffeine treatment, suggesting that the high-level induction of cyp-35A family genes can be fatal to the development of early-stage larvae.

Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early developmental defects in the hematopoietic lineage.

PubMed

Tulpule, Asmin; Lensch, M William; Miller, Justine D; Austin, Karyn; D'Andrea, Alan; Schlaeger, Thorsten M; Shimamura, Akiko; Daley, George Q

2010-04-29

Fanconi anemia (FA) is a genetically heterogeneous, autosomal recessive disorder characterized by pediatric bone marrow failure and congenital anomalies. The effect of FA gene deficiency on hematopoietic development in utero remains poorly described as mouse models of FA do not develop hematopoietic failure and such studies cannot be performed on patients. We have created a human-specific in vitro system to study early hematopoietic development in FA using a lentiviral RNA interference (RNAi) strategy in human embryonic stem cells (hESCs). We show that knockdown of FANCA and FANCD2 in hESCs leads to a reduction in hematopoietic fates and progenitor numbers that can be rescued by FA gene complementation. Our data indicate that hematopoiesis is impaired in FA from the earliest stages of development, suggesting that deficiencies in embryonic hematopoiesis may underlie the progression to bone marrow failure in FA. This work illustrates how hESCs can provide unique insights into human development and further our understanding of genetic disease.

Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.

PubMed

Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad

2015-04-13

Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing

Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.

PubMed

Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M

2016-11-01

We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mothers of children with developmental disabilities: stress in early and middle childhood.

PubMed

Azad, Gazi; Blacher, Jan; Marcoulides, George A

2013-10-01

Using a sample of 219 families of children with (n=94) and without (n=125) developmental disabilities, this study examined the longitudinal perspectives of maternal stress in early (ages 3-5) and middle childhood (ages 6-13) and its relationship to mothers' and children's characteristics. Multivariate latent curve models indicated that maternal stress remained high and stable with minimal individual variation in early childhood, but declined with significant individual variation in middle childhood. Maternal stress at the beginning of middle childhood was associated with earlier maternal stress, as well as children's behavioral problems and social skills. The trajectory of maternal stress across middle childhood was related to children's behavioral problems. Implications for interventions are discussed. Copyright © 2013. Published by Elsevier Ltd.

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

Gene expression profiles of Vibrio parahaemolyticus in the early stationary phase.

PubMed

Meng, L; Alter, T; Aho, T; Huehn, S

2015-09-01

Vibrio (V.) parahaemolyticus is an aquatic bacterium capable of causing foodborne gastroenteritis. In the environment or the food chain, V. parahaemolyticus cells are usually forced into the stationary phase, the common phase for bacterial survival in the environment. So far, little is known about whole genomic expression of V. parahaemolyticus in the early stationary phase compared with the exponential growth phase. We performed whole transcriptomic profiling of V. parahaemolyticus cells in both phases (exponential and early stationary phase). Our data showed in total that 172 genes were induced in early stationary phase, while 61 genes were repressed in early stationary phase compared with the exponential phase. Three functional categories showed stable gene expression in the early stationary phase. Eleven functional categories showed that up-regulation of genes was dominant over down-regulation in the early stationary phase. Although genes related to endogenous metabolism were repressed in the early stationary phase, massive regulation of gene expression occurred in the early stationary phase, indicating the expressed gene set of V. parahaemolyticus in the early stationary phase impacts environmental survival. Vibrio (V.) parahaemolyticus is one of the main bacterial causes of foodborne intestinal infections. This bacterium usually is forced into stationary phase in the environment, which includes, e.g. seafood. When bacteria are in stationary phase, physiological changes can lead to a resistance to many stresses, including physical and chemical challenges during food processing. To the best of our knowledge, highlighting the whole genome expression changes in the early stationary phase compared with exponential phase, as well as the investigation of physiological changes of V. parahaemolyticus such as the survival mechanism in the stationary phase has been the very first study in this field. © 2015 The Society for Applied Microbiology.

Rbm20-deficient cardiogenesis reveals early disruption of RNA processing and sarcomere remodeling establishing a developmental etiology for dilated cardiomyopathy.

PubMed

Beraldi, Rosanna; Li, Xing; Martinez Fernandez, Almudena; Reyes, Santiago; Secreto, Frank; Terzic, Andre; Olson, Timothy M; Nelson, Timothy J

2014-07-15

Dilated cardiomyopathy (DCM) due to mutations in RBM20, a gene encoding an RNA-binding protein, is associated with high familial penetrance, risk of progressive heart failure and sudden death. Although genetic investigations and physiological models have established the linkage of RBM20 with early-onset DCM, the underlying basis of cellular and molecular dysfunction is undetermined. Modeling human genetics using a high-throughput pluripotent stem cell platform was herein designed to pinpoint the initial transcriptome dysfunction and mechanistic corruption in disease pathogenesis. Tnnt2-pGreenZeo pluripotent stem cells were engineered to knockdown Rbm20 (shRbm20) to determine the cardiac-pathogenic phenotype during cardiac differentiation. Intracellular Ca(2+) transients revealed Rbm20-dependent alteration in Ca(2+) handling, coinciding with known pathological splice variants of Titin and Camk2d genes by Day 24 of cardiogenesis. Ultrastructural analysis demonstrated elongated and thinner sarcomeres in the absence of Rbm20 that is consistent with human cardiac biopsy samples. Furthermore, Rbm20-depleted transcriptional profiling at Day 12 identified Rbm20-dependent dysregulation with 76% of differentially expressed genes linked to known cardiac pathology ranging from primordial Nkx2.5 to mature cardiac Tnnt2 as the initial molecular aberrations. Notably, downstream consequences of Rbm20-depletion at Day 24 of differentiation demonstrated significant dysregulation of extracellular matrix components such as the anomalous overexpression of the Vtn gene. By using the pluripotent stem cell platform to model human cardiac disease according to a stage-specific cardiogenic roadmap, we established a new paradigm of familial DCM pathogenesis as a developmental disorder that is patterned during early cardiogenesis and propagated with cellular mechanisms of pathological cardiac remodeling. © The Author 2014. Published by Oxford University Press. All rights reserved. For

Developmental Neurotoxicity of Methamidophos in the Embryo-Larval Stages of Zebrafish.

PubMed

He, Xiaowei; Gao, Jiawei; Dong, Tianyu; Chen, Minjian; Zhou, Kun; Chang, Chunxin; Luo, Jia; Wang, Chao; Wang, Shoulin; Chen, Daozhen; Zhou, Zuomin; Tian, Ying; Xia, Yankai; Wang, Xinru

2016-12-28

Methamidophos is a representative organophosphate insecticide. The knowledge of its developmental neurotoxicity is limited, especially for zebrafish in the early stages of their life. Four hour post-fertilization (hpf) zebrafish embryos were exposed to several environmentally relevant concentrations of methamidophos (0, 25, and 500 μg/L) for up to 72 hpf. Locomotor behavior was then studied in the zebrafish larvae at this timepoint. Acridine orange (AO) staining was carried out in the zebrafish larvae, and the mRNA levels of genes associated with neural development ( mbp and syn2a ) were analyzed by reverse transcription-polymerase chain reaction (RT-PCR). The number of escape responders for mechanical stimulation was significantly decreased in exposed groups. AO staining showed noticeable signs of apoptosis mainly in the brain. In addition, the mRNA levels of mbp and syn2a were both significantly down-regulated in exposed groups. Our study provides the first evidence that methamidophos exposure can cause developmental neurotoxicity in the early stages of zebrafish life, which may be caused by the effect of methamidophos on neurodevelopmental genes and the activation of cell apoptosis in the brain.

Arabidopsis HEAT SHOCK TRANSCRIPTION FACTORA1b regulates multiple developmental genes under benign and stress conditions.

PubMed

Albihlal, Waleed S; Obomighie, Irabonosi; Blein, Thomas; Persad, Ramona; Chernukhin, Igor; Crespi, Martin; Bechtold, Ulrike; Mullineaux, Philip M

2018-05-19

In Arabidopsis thaliana, HEAT SHOCK TRANSCRIPTION FACTORA1b (HSFA1b) controls resistance to environmental stress and is a determinant of reproductive fitness by influencing seed yield. To understand how HSFA1b achieves this, we surveyed its genome-wide targets (ChIP-seq) and its impact on the transcriptome (RNA-seq) under non-stress (NS), heat stress (HS) in the wild type, and in HSFA1b-overexpressing plants under NS. A total of 952 differentially expressed HSFA1b-targeted genes were identified, of which at least 85 are development associated and were bound predominantly under NS. A further 1780 genes were differentially expressed but not bound by HSFA1b, of which 281 were classified as having development-associated functions. These genes are indirectly regulated through a hierarchical network of 27 transcription factors (TFs). Furthermore, we identified 480 natural antisense non-coding RNA (cisNAT) genes bound by HSFA1b, defining a further mode of indirect regulation. Finally, HSFA1b-targeted genomic features not only harboured heat shock elements, but also MADS box, LEAFY, and G-Box promoter motifs. This revealed that HSFA1b is one of eight TFs that target a common group of stress defence and developmental genes. We propose that HSFA1b transduces environmental cues to many stress tolerance and developmental genes to allow plants to adjust their growth and development continually in a varying environment.

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

Downregulation of immediate-early genes linking to suppression of neuronal plasticity in rats after 28-day exposure to glycidol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akane, Hirotoshi; Saito, Fumiyo; Shiraki, Ayako

2014-09-01

We previously found that the 28-day oral toxicity study of glycidol at 200 mg/kg/day in rats resulted in axonopathy in both the central and peripheral nervous systems and aberrations in the late-stage of hippocampal neurogenesis targeting the process of neurite extension. To capture the neuronal parameters in response to glycidol toxicity, these animals were subjected to region-specific global gene expression profiling in four regions of cerebral and cerebellar architectures, followed by immunohistochemical analysis of selected gene products. Expression changes of genes related to axonogenesis and synaptic transmission were observed in the hippocampal dentate gyrus, cingulate cortex and cerebellar vermis atmore » 200 mg/kg showing downregulation in most genes. In the corpus callosum, genes related to growth, survival and functions of glial cells fluctuated their expression. Immunohistochemically, neurons expressing gene products of immediate-early genes, i.e., Arc, Fos and Jun, decreased in their number in the dentate granule cell layer, cingulate cortex and cerebellar vermis. We also applied immunohistochemical analysis in rat offspring after developmental exposure to glycidol through maternal drinking water. The results revealed increases of Arc{sup +} neurons at 1000 ppm and Fos{sup +} neurons at ≥ 300 ppm in the dentate granule cell layer of offspring only at the adult stage. These results suggest that glycidol suppressed neuronal plasticity in the brain after 28-day exposure to young adult animals, in contrast to the operation of restoration mechanism to increase neuronal plasticity at the adult stage in response to aberrations in neurogenesis after developmental exposure. - Highlights: • Neuronal toxicity parameters after 28-day glycidol treatment were examined in rats. • Region-specific global gene expression profiling was conducted in brain regions. • Cortical tissues downregulated genes on axonogenesis and synaptic transmission. • Cortical

Specific subpopulations of hypothalamic leptin receptor-expressing neurons mediate the effects of early developmental leptin receptor deletion on energy balance.

PubMed

Rupp, Alan C; Allison, Margaret B; Jones, Justin C; Patterson, Christa M; Faber, Chelsea L; Bozadjieva, Nadejda; Heisler, Lora K; Seeley, Randy J; Olson, David P; Myers, Martin G

2018-06-06

To date, early developmental ablation of leptin receptor (LepRb) expression from circumscribed populations of hypothalamic neurons (e.g., arcuate nucleus (ARC) Pomc- or Agrp-expressing cells) has only minimally affected energy balance. In contrast, removal of LepRb from at least two large populations (expressing vGat or Nos1) spanning multiple hypothalamic regions produced profound obesity and metabolic dysfunction. Thus, we tested the notion that the total number of leptin-responsive hypothalamic neurons (rather than specific subsets of cells with a particular molecular or anatomical signature) subjected to early LepRb deletion might determine energy balance. We generated new mouse lines deleted for LepRb in ARC Ghrh Cre neurons or in Htr2c Cre neurons (representing roughly half of all hypothalamic LepRb neurons, distributed across many nuclei). We compared the phenotypes of these mice to previously-reported models lacking LepRb in Pomc, Agrp, vGat or Nos1 cells. The early developmental deletion of LepRb from vGat or Nos1 neurons produced dramatic obesity, but deletion of LepRb from Pomc, Agrp, Ghrh, or Htr2c neurons minimally altered energy balance. Although early developmental deletion of LepRb from known populations of ARC neurons fails to substantially alter body weight, the minimal phenotype of mice lacking LepRb in Htr2c cells suggests that the phenotype that results from early developmental LepRb deficiency depends not simply upon the total number of leptin-responsive hypothalamic LepRb cells. Rather, specific populations of LepRb neurons must play particularly important roles in body energy homeostasis; these as yet unidentified LepRb cells likely reside in the DMH. Copyright © 2018 The Authors. Published by Elsevier GmbH.. All rights reserved.

Maternally inherited npm2 mRNA is crucial for egg developmental competence in zebrafish.

PubMed

Bouleau, Aurélien; Desvignes, Thomas; Traverso, Juan Martin; Nguyen, Thaovi; Chesnel, Franck; Fauvel, Christian; Bobe, Julien

2014-08-01

The molecular mechanisms underlying and determining egg developmental competence remain poorly understood in vertebrates. Nucleoplasmin (Npm2) is one of the few known maternal effect genes in mammals, but this maternal effect has never been demonstrated in nonmammalian species. A link between developmental competence and the abundance of npm2 maternal mRNA in the egg was previously established using a teleost fish model for egg quality. The importance of maternal npm2 mRNA for egg developmental competence remains unknown in any vertebrate species. In the present study, we aimed to characterize the contribution of npm2 maternal mRNA to early developmental success in zebrafish using a knockdown strategy. We report here the oocyte-specific expression of npm2 and maternal inheritance of npm2 mRNA in zebrafish eggs. The knockdown of the protein translated from this maternal mRNA results in developmental arrest before the onset of epiboly and subsequent embryonic death, a phenotype also observed in embryos lacking zygotic transcription. Npm2 knockdown also results in impaired transcription of the first-wave zygotic genes. Our results show that npm2 is also a maternal effect gene in a nonmammalian vertebrate species and that maternally inherited npm2 mRNA is crucial for egg developmental competence. We also show that de novo protein synthesis from npm2 maternal mRNA is critical for developmental success beyond the blastula stage and required for zygotic genome activation. Finally, our results suggest that npm2 maternal mRNA is an important molecular factor of egg quality in fish and possibly in all vertebrates. © 2014 by the Society for the Study of Reproduction, Inc.

Putative synaptic genes defined from a Drosophila whole body developmental transcriptome by a machine learning approach.

PubMed

Pazos Obregón, Flavio; Papalardo, Cecilia; Castro, Sebastián; Guerberoff, Gustavo; Cantera, Rafael

2015-09-15

Assembly and function of neuronal synapses require the coordinated expression of a yet undetermined set of genes. Although roughly a thousand genes are expected to be important for this function in Drosophila melanogaster, just a few hundreds of them are known so far. In this work we trained three learning algorithms to predict a "synaptic function" for genes of Drosophila using data from a whole-body developmental transcriptome published by others. Using statistical and biological criteria to analyze and combine the predictions, we obtained a gene catalogue that is highly enriched in genes of relevance for Drosophila synapse assembly and function but still not recognized as such. The utility of our approach is that it reduces the number of genes to be tested through hypothesis-driven experimentation.

Early augmented language intervention for children with developmental delays: potential secondary motor outcomes.

PubMed

Whitmore, Ani S; Romski, Mary Ann; Sevcik, Rose A

2014-09-01

This exploratory study examined the potential secondary outcome of an early augmented language intervention that incorporates speech-generating devices (SGD) on motor skill use for children with developmental delays. The data presented are from a longitudinal study by Romski and colleagues. Toddlers in the augmented language interventions were either required (Augmented Communication-Output; AC-O) or not required (Augmented Communication-Input; AC-I) to use the SGD to produce an augmented word. Three standardized assessments and five event-based coding schemes measured the participants' language abilities and motor skills. Toddlers in the AC-O intervention used more developmentally appropriate motor movements and became more accurate when using the SGD to communicate than toddlers in the AC-I intervention. AAC strategies, interventionist/parent support, motor learning opportunities, and physical feedback may all contribute to this secondary benefit of AAC interventions that use devices.

Moving beyond Screen Time: Redefining Developmentally Appropriate Technology Use in Early Childhood Education. Policy Brief

ERIC Educational Resources Information Center

Daugherty, Lindsay; Dossani, Rafiq; Johnson, Erin-Elizabeth; Wright, Cameron

2014-01-01

Conversations about what constitutes "developmentally appropriate" use of technology in early childhood education have, to date, focused largely on a single, blunt measure--screen time--that fails to capture important nuances, such as what type of media a child is accessing and whether technology use is taking place solo or with peers.…

Developmental transcriptome analysis and identification of genes involved in formation of intestinal air-breathing function of Dojo loach, Misgurnus anguillicaudatus

PubMed Central

Luo, Weiwei; Cao, Xiaojuan; Xu, Xiuwen; Huang, Songqian; Liu, Chuanshu; Tomljanovic, Tea

2016-01-01

Dojo loach, Misgurnus anguillicaudatus is a freshwater fish species of the loach family Cobitidae, using its posterior intestine as an accessory air-breathing organ. Little is known about the molecular regulatory mechanisms in the formation of intestinal air-breathing function of M. anguillicaudatus. Here high-throughput sequencing of mRNAs was performed from six developmental stages of posterior intestine of M. anguillicaudatus: 4-Dph (days post hatch) group, 8-Dph group, 12-Dph group, 20-Dph group, 40-Dph group and Oyd (one-year-old) group. These six libraries were assembled into 81300 unigenes. Totally 40757 unigenes were annotated. Subsequently, 35291 differentially expressed genes (DEGs) were scanned among different developmental stages and clustered into 20 gene expression profiles. Finally, 15 key pathways and 25 key genes were mined, providing potential targets for candidate gene selection involved in formation of intestinal air-breathing function in M. anguillicaudatus. This is the first report of developmental transcriptome of posterior intestine in M. anguillicaudatus, offering a substantial contribution to the sequence resources for this species and providing a deep insight into the formation mechanism of its intestinal air-breathing function. This report demonstrates that M. anguillicaudatus is a good model for studies to identify and characterize the molecular basis of accessory air-breathing organ development in fish. PMID:27545457

Early developmental gene enhancers affect subcortical volumes in the adult human brain.

PubMed

Becker, Martin; Guadalupe, Tulio; Franke, Barbara; Hibar, Derrek P; Renteria, Miguel E; Stein, Jason L; Thompson, Paul M; Francks, Clyde; Vernes, Sonja C; Fisher, Simon E

2016-05-01

Genome-wide association screens aim to identify common genetic variants contributing to the phenotypic variability of complex traits, such as human height or brain morphology. The identified genetic variants are mostly within noncoding genomic regions and the biology of the genotype-phenotype association typically remains unclear. In this article, we propose a complementary targeted strategy to reveal the genetic underpinnings of variability in subcortical brain volumes, by specifically selecting genomic loci that are experimentally validated forebrain enhancers, active in early embryonic development. We hypothesized that genetic variation within these enhancers may affect the development and ultimately the structure of subcortical brain regions in adults. We tested whether variants in forebrain enhancer regions showed an overall enrichment of association with volumetric variation in subcortical structures of >13,000 healthy adults. We observed significant enrichment of genomic loci that affect the volume of the hippocampus within forebrain enhancers (empirical P = 0.0015), a finding which robustly passed the adjusted threshold for testing of multiple brain phenotypes (cutoff of P < 0.0083 at an alpha of 0.05). In analyses of individual single nucleotide polymorphisms (SNPs), we identified an association upstream of the ID2 gene with rs7588305 and variation in hippocampal volume. This SNP-based association survived multiple-testing correction for the number of SNPs analyzed but not for the number of subcortical structures. Targeting known regulatory regions offers a way to understand the underlying biology that connects genotypes to phenotypes, particularly in the context of neuroimaging genetics. This biology-driven approach generates testable hypotheses regarding the functional biology of identified associations. Hum Brain Mapp 37:1788-1800, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

ERIC Educational Resources Information Center

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

Early neural disruption and auditory processing outcomes in rodent models: implications for developmental language disability

PubMed Central

Fitch, R. Holly; Alexander, Michelle L.; Threlkeld, Steven W.

2013-01-01

Most researchers in the field of neural plasticity are familiar with the “Kennard Principle,” which purports a positive relationship between age at brain injury and severity of subsequent deficits (plateauing in adulthood). As an example, a child with left hemispherectomy can recover seemingly normal language, while an adult with focal injury to sub-regions of left temporal and/or frontal cortex can suffer dramatic and permanent language loss. Here we present data regarding the impact of early brain injury in rat models as a function of type and timing, measuring long-term behavioral outcomes via auditory discrimination tasks varying in temporal demand. These tasks were created to model (in rodents) aspects of human sensory processing that may correlate—both developmentally and functionally—with typical and atypical language. We found that bilateral focal lesions to the cortical plate in rats during active neuronal migration led to worse auditory outcomes than comparable lesions induced after cortical migration was complete. Conversely, unilateral hypoxic-ischemic (HI) injuries (similar to those seen in premature infants and term infants with birth complications) led to permanent auditory processing deficits when induced at a neurodevelopmental point comparable to human “term,” but only transient deficits (undetectable in adulthood) when induced in a “preterm” window. Convergent evidence suggests that regardless of when or how disruption of early neural development occurs, the consequences may be particularly deleterious to rapid auditory processing (RAP) outcomes when they trigger developmental alterations that extend into subcortical structures (i.e., lower sensory processing stations). Collective findings hold implications for the study of behavioral outcomes following early brain injury as well as genetic/environmental disruption, and are relevant to our understanding of the neurologic risk factors underlying developmental language disability in

Developmental and Communication Disorders in Children with Intellectual Disability: The Place Early Intervention for Effective Inclusion

ERIC Educational Resources Information Center

Jacob, Udeme Samuel; Olisaemeka, Angela Nneka; Edozie, Isioma Sitamalife

2015-01-01

The paper attempts to discuss the place of intervention in the developmental and communication disorders of children with intellectual disability for the purpose of providing effective inclusion programme. The definition of early intervention was stated, areas affected by children communication disorder such as language comprehension, fluency,…

Developmental constraints shape the evolution of the nematode mid-developmental transition.

PubMed

Zalts, Harel; Yanai, Itai

2017-03-27

Evolutionary theory assumes that genetic variation is uniform and gradual in nature, yet morphological and gene expression studies have revealed that different life-stages exhibit distinct levels of cross-species conservation. In particular, a stage in mid-embryogenesis is highly conserved across species of the same phylum, suggesting that this stage is subject to developmental constraints, either by increased purifying selection or by a strong mutational bias. An alternative explanation, however, holds that the same 'hourglass' pattern of variation may result from increased positive selection at the earlier and later stages of development. To distinguish between these scenarios, we examined gene expression variation in a population of the nematode Caenorhabditis elegans using an experimental design that eliminated the influence of positive selection. By measuring gene expression for all genes throughout development in 20 strains, we found that variations were highly uneven throughout development, with a significant depletion during mid-embryogenesis. In particular, the family of homeodomain transcription factors, whose expression generally coincides with mid-embryogenesis, evolved under high constraint. Our data further show that genes responsible for the integration of germ layers during morphogenesis are the most constrained class of genes. Together, these results provide strong evidence for developmental constraints as the mechanism underlying the hourglass model of animal evolution. Understanding the pattern and mechanism of developmental constraints provides a framework to understand how evolutionary processes have interacted with embryogenesis and led to the diversity of animal life on Earth.

Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

PubMed

Biedler, James K; Tu, Zhijian

2010-07-08

The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start

Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

PubMed

Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

2016-01-01

An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also

Expansion of TALE homeobox genes and the evolution of spiralian development.

PubMed

Morino, Yoshiaki; Hashimoto, Naoki; Wada, Hiroshi

2017-12-01

Spiralians, including molluscs, annelids and platyhelminths, share a unique development process that includes the typical geometry of early cleavage and early segregation of cell fate in blastomeres along the animal-vegetal axis. However, the molecular mechanisms underlying this early cell fate segregation are largely unknown. Here, we report spiralian-specific expansion of the three-amino-acid loop extension (TALE) class of homeobox genes. During early development, some of these TALE genes are expressed in staggered domains along the animal-vegetal axis in the limpet Nipponacmea fuscoviridis and the polychaete Spirobranchus kraussii. Inhibition or overexpression of these genes alters the developmental fate of blastomeres, as predicted by the gene expression patterns. These results suggest that the expansion of novel TALE genes plays a critical role in the establishment of a novel cell fate segregation mechanism in spiralians.

Early developmental trajectories of number knowledge and math achievement from 4 to 10 years: Low-persistent profile and early-life predictors.

PubMed

Garon-Carrier, Gabrielle; Boivin, Michel; Lemelin, Jean-Pascal; Kovas, Yulia; Parent, Sophie; Séguin, Jean R; Vitaro, Frank; Tremblay, Richard E; Dionne, Ginette

2018-06-01

Little is known about the development of number knowledge (NK) and the antecedents of low-persistent NK profiles in early childhood. We documented the developmental trajectories of NK across the transition from preschool to elementary school, their predictive validity with respect to later math achievement, and the child and family early-life factors associated with low NK profiles. Children's NK was assessed four times at regular intervals between the ages 4 and 7 years in a large, representative population-based sample. Developmental trajectories of NK were established for 1597 children. These children were also assessed with respect to several features of their family environment at 5, 17, and 29 months, as well as their cognitive skills at age 41 months. Analyses revealed a best-fitting 4-trajectory model, characterized by Low-Increasing (10% of the children), Moderate-Increasing (39%), Moderate-Fast Increasing (32%) and High-Increasing (19%) groups. Children of these trajectory groups differed significantly with respect to math achievement at ages 8 and 10 years, with the Low-Increasing group persistently scoring lower than the other groups throughout these years. Children of Low-Increasing NK group were from household of lower income and father with low educational background, poorer early cognitive development, and more importantly, reduced visual-spatial skills and memory-span. Children displaying reduced cognitive abilities and impoverished living conditions early in life are at greater risk of low NK throughout late preschool and school entry, with ensuing difficulties in math achievement. They deserve early preventive attention to help alleviate later mathematic difficulties. Copyright © 2018 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsieh, Ru-Lan

Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) weremore » measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA

The mid-developmental transition and the evolution of animal body plans

PubMed Central

Cole, Alison G.; Winter, Eitan; Mostov, Natalia; Khair, Sally; Senderovich, Naftalie; Kovalev, Ekaterina; Silver, David H.; Feder, Martin; Fernandez-Valverde, Selene L.; Nakanishi, Nagayasu; Simmons, David; Simakov, Oleg; Larsson, Tomas; Liu, Shang-Yun; Jerafi-Vider, Ayelet; Yaniv, Karina; Ryan, Joseph F.; Martindale, Mark Q.; Rink, Jochen C.; Arendt, Detlev; Degnan, Sandie M.; Degnan, Bernard M.; Hashimshony, Tamar; Yanai, Itai

2016-01-01

Animals are grouped into ~35 ‘phyla’ based upon the notion of distinct body plans1–4. Morphological and molecular analyses have revealed that a stage in the middle of development—known as the phylotypic period—is conserved among species within some phyla5–9. Although these analyses provide evidence for their existence, phyla have also been criticized as lacking an objective definition, and consequently based on arbitrary groupings of animals10. Here we compare the developmental transcriptomes of ten species, each annotated to a different phylum, with a wide range of life histories and embryonic forms. We find that in all ten species, development comprises the coupling of early and late phases of conserved gene expression. These phases are linked by a divergent ‘mid-developmental transition’ that uses species-specific suites of signalling pathways and transcription factors. This mid-developmental transition overlaps with the phylotypic period that has been defined previously for three of the ten phyla, suggesting that transcriptional circuits and signalling mechanisms active during this transition are crucial for defining the phyletic body plan and that the mid-developmental transition may be used to define phylotypic periods in other phyla. Placing these observations alongside the reported conservation of mid-development within phyla, we propose that a phylum may be defined as a collection of species whose gene expression at the mid-developmental transition is both highly conserved among them, yet divergent relative to other species. PMID:26886793

Prenatal exposure to disaster-related traumatic stress and developmental trajectories of temperament in early childhood: Superstorm Sandy pregnancy study.

PubMed

Zhang, Wei; Rajendran, Khushmand; Ham, Jacob; Finik, Jackie; Buthmann, Jessica; Davey, Kei; Pehme, Patricia M; Dana, Kathryn; Pritchett, Alexandra; Laws, Holly; Nomura, Yoko

2018-07-01

Little is known about the impact of prenatal maternal stress (PNMS) on the developmental trajectory of temperament and few studies have been able to incorporate a natural disaster as a quasi-experimental stressor. The current study investigated PNMS related to Superstorm Sandy ('Sandy'), a hurricane that struck the New York metropolitan area in October 2012, in terms of objective exposure during pregnancy, subjective stress reaction as assessed by maternal symptoms of post-traumatic stress, and their impact on the developmental changes in temperament during early childhood. A subsample of 318 mother-child dyads was drawn from the Stress in Pregnancy Study. Temperament was measured at 6, 12, 18, and 24 months of age. Objective exposure was associated with greater High-Intensity Pleasure, Approach, Perceptual Sensitivity and Fearfulness, but lower Cuddliness and Duration of Orientation at 6 months. Objective exposure and its interaction with subjective stress reaction predicted developmental changes in temperament. In particular, objective exposure was linked to greater increases in Activity Level but decreases in High-Intensity Pleasure, Approach, and Fearfulness. The combination of objective exposure and subjective stress reaction was also associated with greater increases in Activity Level. Temperament was measured solely via maternal report. Trimester-specific effects of Sandy on temperament were not examined. This is the first study to examine the effects of prenatal maternal exposure to a natural disaster on trajectories of early childhood temperament. Findings suggest that both objective stress exposure and subjective stress reaction in-utero predict developmental trajectories of temperament in early childhood. Copyright © 2018 Elsevier B.V. All rights reserved.

Developmental plasticity of growth and digestive efficiency in dependence of early-life food availability

PubMed Central

Kotrschal, Alexander; Szidat, Sönke; Taborsky, Barbara

2014-01-01

Nutrition is a potent mediator of developmental plasticity. If food is scarce, developing organisms may invest into growth to outgrow size-dependent mortality (short-term benefit) and/or into an efficient digestion system (long-term benefit). We investigated this potential trade-off, by determining the influence of food availability on juvenile body and organ growth, and on adult digestive efficiency in the cichlid fish Simochromis pleurospilus. We reared two groups of fish at constant high or low food rations, and we switched four other groups between these two rations at an early and late juvenile period. We measured juvenile growth and organ sizes at different developmental stages and determined adult digestive efficiency. Fish kept at constant, high rations grew considerably faster than low-food fish. Nevertheless, S. pleurospilus partly buffered the negative effects of low food availability by developing heavier digestive organs, and they were therefore more efficient in digesting their food as adults. Results of fish exposed to a ration switch during either the early or late juvenile period suggest (i) that the ability to show compensatory growth after early exposure to low food availability persists during the juvenile period, (ii) that digestive efficiency is influenced by varying juvenile food availability during the late juvenile phase and (iii) that the efficiency of the adult digestive system is correlated with the growth rate during a narrow time window of juvenile period. PMID:25866430

Divergence of developmental trajectories is triggered interactively by early social and ecological experience in a cooperative breeder

PubMed Central

Bohn, Lena; Oberhummer, Evelyne

2017-01-01

Cooperative breeders feature the highest level of social complexity among vertebrates. Environmental constraints foster the evolution of this form of social organization, selecting for both well-developed social and ecological competences. Cooperative breeders pursue one of two alternative social trajectories: delaying reproduction to care for the offspring of dominant breeders or dispersing early to breed independently. It is yet unclear which ecological and social triggers determine the choice between these alternatives and whether diverging developmental trajectories exist in cooperative vertebrates predisposing them to dispersal or philopatry. Here we experimentally reared juveniles of cooperatively breeding cichlid fish by varying the social environment and simulated predation threat in a two-by-two factorial long-term experiment. First, we show that individuals develop specialized behavioral competences, originating already in the early postnatal phase. Second, these specializations predisposed individuals to pursue different developmental trajectories and either to disperse early or to extend philopatry in adulthood. Thus, our results contrast with the proposition that social specializations in early ontogeny should be restricted to eusocial species. Importantly, social and ecological triggers were both required for the generation of divergent life histories. Our results thus confirm recent predictions from theoretical models that organisms should combine relevant information from different environmental cues to develop integrated phenotypes. PMID:29078289

Predicting neuroblastoma using developmental signals and a logic-based model.

PubMed

Kasemeier-Kulesa, Jennifer C; Schnell, Santiago; Woolley, Thomas; Spengler, Jennifer A; Morrison, Jason A; McKinney, Mary C; Pushel, Irina; Wolfe, Lauren A; Kulesa, Paul M

2018-07-01

Genomic information from human patient samples of pediatric neuroblastoma cancers and known outcomes have led to specific gene lists put forward as high risk for disease progression. However, the reliance on gene expression correlations rather than mechanistic insight has shown limited potential and suggests a critical need for molecular network models that better predict neuroblastoma progression. In this study, we construct and simulate a molecular network of developmental genes and downstream signals in a 6-gene input logic model that predicts a favorable/unfavorable outcome based on the outcome of the four cell states including cell differentiation, proliferation, apoptosis, and angiogenesis. We simulate the mis-expression of the tyrosine receptor kinases, trkA and trkB, two prognostic indicators of neuroblastoma, and find differences in the number and probability distribution of steady state outcomes. We validate the mechanistic model assumptions using RNAseq of the SHSY5Y human neuroblastoma cell line to define the input states and confirm the predicted outcome with antibody staining. Lastly, we apply input gene signatures from 77 published human patient samples and show that our model makes more accurate disease outcome predictions for early stage disease than any current neuroblastoma gene list. These findings highlight the predictive strength of a logic-based model based on developmental genes and offer a better understanding of the molecular network interactions during neuroblastoma disease progression. Copyright © 2018. Published by Elsevier B.V.

Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

PubMed

Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

2016-02-01

Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Profiles of mRNA expression of related genes in the duck hypothalamus-pituitary growth axis during embryonic and early post-hatch development.

PubMed

Hu, Yan; Liu, Hongxiang; Song, Chi; Xu, Wenjuan; Ji, Gaige; Zhu, Chunhong; Shu, Jingting; Li, Huifang

2015-03-15

In this study, the ontogeny of body and liver weight and the pattern of related gene mRNA expression in the hypothalamus-pituitary growth axis (HPGA) of two different duck breeds (Anas platyrhynchos domestica) were compared during embryonic and post-hatch development. Duck hypothalamic growth hormone release hormone (GHRH), somatostatin (SS), pituitary growth hormone (GH), liver growth hormone receptor (GHR) and insulin-like growth factor-I (IGF-1) mRNA were first detected on the 13th embryonic day. During early duck development, SS maintained a lower expression status, whereas the other four genes exhibited highly significant variations in an age-specific manner. Highly significant breed specificity was observed with respect to hepatic IGF-1 mRNA expression, which showed a significant breed-age interaction effect. Compared with previous studies on chickens, significant species differences were observed regarding the mRNA expression of bird embryonic HPGA-related genes. During early development, highly significant breed and age specificity were observed with respect to developmental changes in body and liver weight, and varying degrees of significant linear correlation were found between these performances and the mRNA expression of HPGA-related genes in the duck HPGA. These results suggest that different genetic backgrounds may lead to differences in duck growth and HPGA-related gene mRNA expression, and the differential mRNA expression of related genes in the duck HPGA may be particularly important in the early growth of ducks. Furthermore, hepatic IGF-1 mRNA expression presented highly significant breed specificity, and evidence suggests the involvement of hepatic IGF-1 in mediating genetic effects on embryo and offspring growth in ducks. Copyright © 2015 Elsevier B.V. All rights reserved.

Interactions of sex and early life social experiences at two developmental stages shape nonapeptide receptor profiles.

PubMed

Hiura, Lisa C; Ophir, Alexander G

2018-05-31

Early life social experiences are critical to behavioral and cognitive development, and can have a tremendous influence on developing social phenotypes. Most work has focused on outcomes of experiences at a single stage of development (e.g., perinatal, or post-weaning). Few studies have assessed the impact of social experience at multiple developmental stages and across sex. Oxytocin and vasopressin are profoundly important for modulating social behavior and these nonapeptide systems are highly sensitive to developmental social experience, particularly in brain areas important for social behavior. We investigated whether oxytocin receptor (OTR) and vasopressin receptor (V1aR) distributions of prairie voles (Microtus ochrogaster) change as a function of parental composition within the natal nest or social composition after weaning. We raised pups either in the presence or absence of their fathers. At weaning, offspring were housed either individually or with a same-sex sibling. We also examined whether changes in receptor distributions are sexually dimorphic because the impact of the developmental environment on the nonapeptide system could be sex-dependent. We found that differences in nonapeptide receptor expression were region-, sex-, and rearing condition-specific, indicating a high level of complexity in the ways that early life experiences shape the social brain. We found many more differences in V1aR density compared to OTR density, indicating that nonapeptide receptors demonstrate differential levels of neural plasticity and sensitivity to environmental and biological variables. Our data highlight that critical factors including biological sex and multiple experiences across the developmental continuum interact in complex ways to shape the social brain. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Temporal and developmental requirements for the Prader–Willi imprinting center

PubMed Central

DuBose, Amanda J.; Smith, Emily Y.; Johnstone, Karen A.; Resnick, James L.

2012-01-01

Imprinted gene expression associated with Prader–Willi syndrome (PWS) and Angelman syndrome (AS) is controlled by two imprinting centers (ICs), the PWS-IC and the AS-IC. The PWS-IC operates in cis to activate transcription of genes that are expressed exclusively from the paternal allele. We have created a conditional allele of the PWS-IC to investigate its developmental activity. Deletion of the paternal PWS-IC in the embryo before implantation abolishes expression of the paternal-only genes in the neonatal brain. Surprisingly, deletion of the PWS-IC in early brain progenitors does not affect the subsequent imprinted status of PWS/AS genes in the newborn brain. These results indicate that the PWS-IC functions to protect the paternal epigenotype at the epiblast stage of development but is dispensable thereafter. PMID:22331910

Developmental Hypothyroidism Reduces the Expression of ...

EPA Pesticide Factsheets

Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,

Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan.

PubMed

Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei

2017-04-15

Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G+G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08-2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. Copyright © 2017 Elsevier Inc. All rights reserved.

Selection of reliable reference genes for normalization of quantitative RT-PCR from different developmental stages and tissues in amphioxus

PubMed Central

Zhang, Qi-Lin; Zhu, Qian-Hua; Liao, Xin; Wang, Xiu-Qiang; Chen, Tao; Xu, Han-Ting; Wang, Juan; Yuan, Ming-Long; Chen, Jun-Yuan

2016-01-01

Amphioxus is a closest living proxy to the ancestor of cephalochordates with vertebrates, and key animal for novel understanding in the evolutionary origin of vertebrate body plan, genome, tissues and immune system. Reliable analyses using quantitative real-time PCR (qRT-PCR) for answering these scientific questions is heavily dependent on reliable reference genes (RGs). In this study, we evaluated stability of thirteen candidate RGs in qRT-PCR for different developmental stages and tissues of amphioxus by four independent (geNorm, NormFinder, BestKeeper and deltaCt) and one comparative algorithms (RefFinder). The results showed that the top two stable RGs were the following: (1) S20 and 18 S in thirteen developmental stages, (2) EF1A and ACT in seven normal tissues, (3) S20 and L13 in both intestine and hepatic caecum challenged with lipopolysaccharide (LPS), and (4) S20 and EF1A in gill challenged with LPS. The expression profiles of two target genes (EYA and HHEX) in thirteen developmental stages were used to confirm the reliability of chosen RGs. This study identified optimal RGs that can be used to accurately measure gene expression under these conditions, which will benefit evolutionary and functional genomics studies in amphioxus. PMID:27869224

Silencing of genes involved in Anaplasma marginale-tick interactions affects the pathogen developmental cycle in Dermacentor variabilis.

PubMed

Kocan, Katherine M; Zivkovic, Zorica; Blouin, Edmour F; Naranjo, Victoria; Almazán, Consuelo; Mitra, Ruchira; de la Fuente, José

2009-07-16

The cattle pathogen, Anaplasma marginale, undergoes a developmental cycle in ticks that begins in gut cells. Transmission to cattle occurs from salivary glands during a second tick feeding. At each site of development two forms of A. marginale (reticulated and dense) occur within a parasitophorous vacuole in the host cell cytoplasm. However, the role of tick genes in pathogen development is unknown. Four genes, found in previous studies to be differentially expressed in Dermacentor variabilis ticks in response to infection with A. marginale, were silenced by RNA interference (RNAi) to determine the effect of silencing on the A. marginale developmental cycle. These four genes encoded for putative glutathione S-transferase (GST), salivary selenoprotein M (SelM), H+ transporting lysosomal vacuolar proton pump (vATPase) and subolesin. The impact of gene knockdown on A. marginale tick infections, both after acquiring infection and after a second transmission feeding, was determined and studied by light microscopy. Silencing of these genes had a different impact on A. marginale development in different tick tissues by affecting infection levels, the densities of colonies containing reticulated or dense forms and tissue morphology. Salivary gland infections were not seen in any of the gene-silenced ticks, raising the question of whether these ticks were able to transmit the pathogen. The results of this RNAi and light microscopic analyses of tick tissues infected with A. marginale after the silencing of genes functionally important for pathogen development suggest a role for these molecules during pathogen life cycle in ticks.

Associations of Early Developmental Milestones with Adult Intelligence

ERIC Educational Resources Information Center

Flensborg-Madsen, Trine; Mortensen, Erik L.

2018-01-01

The study investigated whether age at attainment of 20 developmental milestones within the areas of language, walking, eating, dressing, social interaction, and toilet training was associated with adult intelligence. Mothers of 821 children of the Copenhagen Perinatal Cohort recorded 20 developmental milestones at a 3-year examination, and all…

Developmental regulation of ecdysone receptor (EcR) and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera)

PubMed Central

Mello, Tathyana R. P.; Aleixo, Aline C.; Pinheiro, Daniel G.; Nunes, Francis M. F.; Bitondi, Márcia M. G.; Hartfelder, Klaus; Barchuk, Angel R.; Simões, Zilá L. P.

2014-01-01

Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH), control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E) application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD) of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1). EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g., miR-133 and miR-375), as well honeybee-specific ones (e.g., miR-3745 and miR-3761). Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect. PMID:25566327

Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

PubMed Central

Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

2017-01-01

Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

Developmental Pathways Are Blueprints for Designing Successful Crops.

PubMed

Trevaskis, Ben

2018-01-01

Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene-gene or gene-environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted.

Transcriptome analysis on the exoskeleton formation in early developmetal stages and reconstruction scenario in growth-moulting in Litopenaeus vannamei.

PubMed

Gao, Yi; Wei, Jiankai; Yuan, Jianbo; Zhang, Xiaojun; Li, Fuhua; Xiang, Jianhai

2017-04-24

Exoskeleton construction is an important issue in shrimp. To better understand the molecular mechanism of exoskeleton formation, development and reconstruction, the transcriptome of the entire developmental process in Litopenaeus vannamei, including nine early developmental stages and eight adult-moulting stages, was sequenced and analysed using Illumina RNA-seq technology. A total of 117,539 unigenes were obtained, with 41.2% unigenes predicting the full-length coding sequence. Gene Ontology, Clusters of Orthologous Group (COG), the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and functional annotation of all unigenes gave a better understanding of the exoskeleton developmental process in L. vannamei. As a result, more than six hundred unigenes related to exoskeleton development were identified both in the early developmental stages and adult-moulting. A cascade of sequential expression events of exoskeleton-related genes were summarized, including exoskeleton formation, regulation, synthesis, degradation, mineral absorption/reabsorption, calcification and hardening. This new insight on major transcriptional events provide a deep understanding for exoskeleton formation and reconstruction in L. vannamei. In conclusion, this is the first study that characterized the integrated transcriptomic profiles cover the entire exoskeleton development from zygote to adult-moulting in a crustacean, and these findings will serve as significant references for exoskeleton developmental biology and aquaculture research.

Two single-nucleotide polymorphisms of the RELN gene and symptom-based and developmental deficits among children and adolescents with autistic spectrum disorders in the Tianjin, China.

PubMed

Wang, Geng-Fu; Ye, Sheng; Gao, Lei; Han, Yu; Guo, Xuan; Dong, Xiao-Peng; Su, Yuan-Yuan; Zhang, Xin

2018-05-10

Increasing evidence has revealed that genetic variants in Reelin (RELN) gene, especially single-nucleotide polymorphisms (SNPs), correlate with autistic spectrum disorders (ASD) risk; however, no consensus have been reached. This study aimed to provide additional evidence for the association between two SNPs of RELN (i.e., rs736707, rs2229864) and ASD risk, as well as the relationship between RELN gene and symptom-based and developmental deficits of ASD patients in Chinese Han children and adolescents. 157 ASD subjects and 256 typical development (TD) controls were genotyped by TaqMan® genotyping assay. ASD patients were assessed by Childhood Autism Rating Scale (CARS), Autism Behavior Checklist (ABC), and Early Childhood Development Questionnaire (ECDQ). We found that SNP rs2229864 was associated with the genetic predisposition of ASD, whereas a negative association between SNP rs2229864 and symptom-based and developmental features was detected. In contrast, RELN rs736707 correlated with the sensory subscale of the ABC, the relating subscale of the ABC and the total score of ABC, although we did not detect a significant association between SNP rs736707 and ASD risk. Furthermore, a significant rs736707-rs2229864 haplotype was detected. Individuals with a CC haplotype were more likely to have ASD, but individuals with a CT haplotype had more chance be TD controls. Further studies using more samples and including more gene variants in RELN are warranted to confirm our results. Copyright © 2018 Elsevier B.V. All rights reserved.

Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

PubMed Central

Hall, F. Scott; Perona, Maria T. G.

2012-01-01

This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

Developmental delay and emotion dysregulation: Predicting parent-child conflict across early to middle childhood.

PubMed

Marquis, Willa A; Noroña, Amanda N; Baker, Bruce L

2017-04-01

Cumulative risk research has increased understanding of how multiple risk factors impact various socioemotional and interpersonal outcomes across the life span. However, little is known about risk factors for parent-child conflict early in development, where identifying predictors of change could be highly salient for intervention. Given their established association with parent-child conflict, child developmental delay (DD) and emotion dysregulation were examined as predictors of change in conflict across early to middle childhood (ages 3 to 7 years). Participants (n = 211) were part of a longitudinal study examining the development of psychopathology in children with or without DD. Level of parent-child conflict was derived from naturalistic home observations, whereas child dysregulation was measured using an adapted CBCL-Emotion Dysregulation Index. PROCESS was used to examine the conditional interactive effects of delay status (typically developing, DD) and dysregulation on change in conflict from child ages 3 to 5 and 5 to 7 years. Across both of these timeframes, parent-child conflict increased only for families of children with both DD and high dysregulation, providing support for an interactive risk model of parent-child conflict. Findings are considered in the context of developmental transitions, and implications for intervention are discussed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Developmental delay and emotion dysregulation: Predicting parent-child conflict across early to middle childhood

PubMed Central

Marquis, Willa A.; Noroña, Amanda N.; Baker, Bruce L.

2016-01-01

Cumulative risk research has increased understanding of how multiple risk factors impact various socioemotional and interpersonal outcomes across the life span. However, little is known about risk factors for parent-child conflict early in development, where identifying predictors of change could be highly salient for intervention. Given their established association with parent-child conflict, child developmental delay (DD) and emotion dysregulation were examined as predictors of change in conflict across early to middle childhood (ages 3 to 7 years). Participants (n=211) were part of a longitudinal study examining the development of psychopathology in children with or without DD. Level of parent-child conflict was derived from naturalistic home observations, while child dysregulation was measured using an adapted CBCL-Emotion Dysregulation Index. PROCESS was used to examine the conditional interactive effects of delay status (typically developing, DD) and dysregulation on change in conflict from child ages 3 to 5 and 5 to 7 years. Across both of these timeframes, parent-child conflict increased only for families of children with both DD and high dysregulation, providing support for an interactive risk model of parent-child conflict. Findings are considered in the context of developmental transitions, and implications for intervention are discussed. PMID:28054804

The effects of early positive parenting and developmental delay status on child emotion dysregulation.

PubMed

Norona, A N; Baker, B L

2017-02-01

Emotion regulation has been identified as a robust predictor of adaptive functioning across a variety of domains (Aldao et al. ). Furthermore, research examining early predictors of competence and deficits in ER suggests that factors internal to the individual (e.g. neuroregulatory reactivity, behavioural traits and cognitive ability) and external to the individual (e.g. caregiving styles and explicit ER training) contribute to the development of ER (Calkins ). Many studies have focused on internal sources or external sources; however, few have studied them simultaneously within one model, especially in studies examining children with developmental delays (DD). Here, we addressed this specific research gap and examined the contributions of one internal factor and one external factor on emotion dysregulation outcomes in middle childhood. Specifically, our current study used structural equation modelling (SEM) to examine prospective, predictive relationships between DD status, positive parenting at age 4 years and child emotion dysregulation at age 7 years. Participants were 151 families in the Collaborative Family Study, a longitudinal study of young children with and without DD. A positive parenting factor was composed of sensitivity and scaffolding scores from mother-child interactions at home and in the research centre at child age 4 years. A child dysregulation factor was composed of a dysregulation code from mother-child interactions and a parent-report measure of ER and lability/negativity at age 7 years. Finally, we tested the hypothesis that positive parenting would mediate the relationship between DD and child dysregulation. Mothers of children with DD exhibited fewer sensitive and scaffolding behaviours compared with mothers of typically developing children, and children with DD were more dysregulated on all measures of ER. SEM revealed that both DD status and early positive parenting predicted emotion dysregulation in middle childhood. Furthermore

Increasing pre-kindergarten early literacy skills in children with developmental disabilities and delays.

PubMed

Pears, Katherine C; Kim, Hyoun K; Fisher, Philip A; Yoerger, Karen

2016-08-01

Two hundred and nine children receiving early childhood special education services for developmental disabilities or delays who also had behavioral, social, or attentional difficulties were included in a study of an intervention to increase school readiness, including early literacy skills. Results showed that the intervention had a significant positive effect on children's literacy skills from baseline to the end of summer before the start of kindergarten (d=.14). The intervention also had significant indirect effects on teacher ratings of children's literacy skills during the fall of their kindergarten year (β=.09). Additionally, when scores were compared to standard benchmarks, a greater percentage of the children who received the intervention moved from being at risk for reading difficulties to having low risk. Overall, this study demonstrates that a school readiness intervention delivered prior to the start of kindergarten may help increase children's early literacy skills. Copyright © 2016 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

Comparative gene expression analysis of bovine nuclear-transferred embryos with different developmental potential by cDNA microarray and real-time PCR to determine genes that might reflect calf normality.

PubMed

Kato, Yoko; Li, Xiangping; Amarnath, Dasari; Ushizawa, Koichi; Hashizume, Kazuyoshi; Tokunaga, Tomoyuki; Taniguchi, Masanori; Tsunoda, Yukio

2007-01-01

Placental abnormalities are the main factor in the high incidence of somatic cell clone abnormalities. The expression of several trophoblast cell-specific molecules is enhanced during gestational days 7 to 14. To determine the possible genes whose expression patterns might reflect calf normality, we first compared the gene expression profiles on day 15 between in vitro-fertilized (IVF) embryos and two types of somatic cell nuclear-transferred embryos with either a high (FNT) or low (CNT) incidence of neonatal abnormalities using a cDNA microarray containing 16 of 21 placenta-specific genes developed from tissues collected across gestation. To identify significant genes from the screening of day 15 embryos, genes with a less than two-fold difference in expression between IVF and CNT embryos, and those with a greater than two-fold difference between IVF and FNT and between CNT and FNT were considered to contribute to clone abnormalities. These two comparisons revealed 18 down-regulated and 18 upregulated genes of the 1722 genes examined. We then examined the expression levels of 10 genes with known functions in eight-cell and blastocyst-stage embryos by real-time PCR. The mRNA expression pattern of interferon (IFN)-tau, a trophectoderm-related gene, differed between IVF, CNT, and FNT eight-cell embryos; few or none of the IVF or CNT eight-cell embryos expressed IFN-tau mRNA, but all eight-cell FNT embryos expressed IFN-tau. IFN-tau mRNA expression was significantly higher in IVF blastocysts, however, than in nuclear-transferred blastocysts. Average IFN-tau mRNA expression in FNT blastocysts was not different from that in CNT blastocysts, due to one CNT blastocyst with high expression. The precise relation between early expression of IFN-tau mRNA and inferior developmental potential in cloned embryos should be examined further.

Latent class analysis of early developmental trajectory in baby siblings of children with autism.

PubMed

Landa, Rebecca J; Gross, Alden L; Stuart, Elizabeth A; Bauman, Margaret

2012-09-01

Siblings of children with autism (sibs-A) are at increased genetic risk for autism spectrum disorders (ASD) and milder impairments. To elucidate diversity and contour of early developmental trajectories exhibited by sibs-A, regardless of diagnostic classification, latent class modeling was used. Sibs-A (N = 204) were assessed with the Mullen Scales of Early Learning from age 6 to 36 months. Mullen T scores served as dependent variables. Outcome classifications at age 36 months included: ASD (N = 52); non-ASD social/communication delay (broader autism phenotype; BAP; N = 31); and unaffected (N = 121). Child-specific patterns of performance were studied using latent class growth analysis. Latent class membership was then related to diagnostic outcome through estimation of within-class proportions of children assigned to each diagnostic classification. A 4-class model was favored. Class 1 represented accelerated development and consisted of 25.7% of the sample, primarily unaffected children. Class 2 (40.0% of the sample), was characterized by normative development with above-average nonverbal cognitive outcome. Class 3 (22.3% of the sample) was characterized by receptive language, and gross and fine motor delay. Class 4 (12.0% of the sample), was characterized by widespread delayed skill acquisition, reflected by declining trajectories. Children with an outcome diagnosis of ASD were spread across Classes 2, 3, and 4. Results support a category of ASD that involves slowing in early non-social development. Receptive language and motor development is vulnerable to early delay in sibs-A with and without ASD outcomes. Non-ASD sibs-A are largely distributed across classes depicting average or accelerated development. Developmental trajectories of motor, language, and cognition appear independent of communication and social delays in non-ASD sibs-A. © 2012 The Authors. Journal of Child Psychology and Psychiatry © 2012 Association for Child and Adolescent Mental Health.

Latent Class Analysis of Early Developmental Trajectory in Baby Siblings of Children with Autism

PubMed Central

Landa, Rebecca J.; Gross, Alden L.; Stuart, Elizabeth A.; Bauman, Margaret

2012-01-01

Background Siblings of children with autism (sibs-A) are at increased genetic risk for autism spectrum disorders (ASD) and milder impairments. To elucidate diversity and contour of early developmental trajectories exhibited by sibs-A, regardless of diagnostic classification, latent class modeling was used. Methods Sibs-A (n=204) were assessed with the Mullen Scales of Early Learning from age 6–36 months. Mullen T scores served as dependent variables. Outcome classifications at age 36 months included: ASD (n=52); non-ASD social/communication delay (broader autism phenotype; BAP) (n=31); and unaffected (n=121). Child-specific patterns of performance were studied using latent class growth analysis. Latent class membership was then related to diagnostic outcome through estimation of within-class proportions of children assigned to each diagnostic classification. Results A 4-class model was favored. Class 1 represented accelerated development and consisted of 25.7% of the sample, primarily unaffected children. Class 2 (40.0% of the sample), was characterized by normative development with above-average nonverbal cognitive outcome. Class 3 (22.3% of the sample) was characterized by receptive language, and gross and fine motor delay. Class 4 (12.0% of the sample), was characterized by widespread delayed skill acquisition, reflected by declining trajectories. Children with an outcome diagnosis of ASD were spread across Classes 2, 3, and 4. Conclusions Results support a category of ASD that involves slowing in early non-social development. Receptive language and motor development is vulnerable to early delay in sibs-A with and without ASD outcomes. Non-ASD sibs-A are largely distributed across classes depicting average or accelerated development. Developmental trajectories of motor, language, and cognition appear independent of communication and social delays in non-ASD sibs-A. PMID:22574686

Early neurotrophic pharmacotherapy rescues developmental delay and Alzheimer’s-like memory deficits in the Ts65Dn mouse model of Down syndrome

PubMed Central

Kazim, Syed Faraz; Blanchard, Julie; Bianchi, Riccardo; Iqbal, Khalid

2017-01-01

Down syndrome (DS), caused by trisomy 21, is the most common genetic cause of intellectual disability and is associated with a greatly increased risk of early-onset Alzheimer’s disease (AD). The Ts65Dn mouse model of DS exhibits several key features of the disease including developmental delay and AD-like cognitive impairment. Accumulating evidence suggests that impairments in early brain development caused by trisomy 21 contribute significantly to memory deficits in adult life in DS. Prenatal genetic testing to diagnose DS in utero, provides the novel opportunity to initiate early pharmacological treatment to target this critical period of brain development. Here, we report that prenatal to early postnatal treatment with a ciliary neurotrophic factor (CNTF) small-molecule peptide mimetic, Peptide 021 (P021), rescued developmental delay in pups and AD-like hippocampus-dependent memory impairments in adult life in Ts65Dn mice. Furthermore, this treatment prevented pre-synaptic protein deficit, decreased glycogen synthase kinase-3beta (GSK3β) activity, and increased levels of synaptic plasticity markers including brain derived neurotrophic factor (BNDF) and phosphorylated CREB, both in young (3-week-old) and adult (~ 7-month-old) Ts65Dn mice. These findings provide novel evidence that providing neurotrophic support during early brain development can prevent developmental delay and AD-like memory impairments in a DS mouse model. PMID:28368015

Developmental imaging: the avian embryo hatches to the challenge.

PubMed

Kulesa, Paul M; McKinney, Mary C; McLennan, Rebecca

2013-06-01

The avian embryo provides a multifaceted model to study developmental mechanisms because of its accessibility to microsurgery, fluorescence cell labeling, in vivo imaging, and molecular manipulation. Early two-dimensional planar growth of the avian embryo mimics human development and provides unique access to complex cell migration patterns using light microscopy. Later developmental events continue to permit access to both light and other imaging modalities, making the avian embryo an excellent model for developmental imaging. For example, significant insights into cell and tissue behaviors within the primitive streak, craniofacial region, and cardiovascular and peripheral nervous systems have come from avian embryo studies. In this review, we provide an update to recent advances in embryo and tissue slice culture and imaging, fluorescence cell labeling, and gene profiling. We focus on how technical advances in the chick and quail provide a clearer understanding of how embryonic cell dynamics are beautifully choreographed in space and time to sculpt cells into functioning structures. We summarize how these technical advances help us to better understand basic developmental mechanisms that may lead to clinical research into human birth defects and tissue repair. Copyright © 2013 Wiley Periodicals, Inc.

Drosophila caspases involved in developmentally regulated programmed cell death of peptidergic neurons during early metamorphosis.

PubMed

Lee, Gyunghee; Wang, Zixing; Sehgal, Ritika; Chen, Chun-Hong; Kikuno, Keiko; Hay, Bruce; Park, Jae H

2011-01-01

A great number of obsolete larval neurons in the Drosophila central nervous system are eliminated by developmentally programmed cell death (PCD) during early metamorphosis. To elucidate the mechanisms of neuronal PCD occurring during this period, we undertook genetic dissection of seven currently known Drosophila caspases in the PCD of a group of interneurons (vCrz) that produce corazonin (Crz) neuropeptide in the ventral nerve cord. The molecular death program in the vCrz neurons initiates within 1 hour after pupariation, as demonstrated by the cytological signs of cell death and caspase activation. PCD was significantly suppressed in dronc-null mutants, but not in null mutants of either dredd or strica. A double mutation lacking both dronc and strica impaired PCD phenotype more severely than did a dronc mutation alone, but comparably to a triple dredd/strica/dronc mutation, indicating that dronc is a main initiator caspase, while strica plays a minor role that overlaps with dronc's. As for effector caspases, vCrz PCD requires both ice and dcp-1 functions, as they work cooperatively for a timely removal of the vCrz neurons. Interestingly, the activation of the Ice and Dcp-1 is not solely dependent on Dronc and Strica, implying an alternative pathway to activate the effectors. Two remaining effector caspase genes, decay and damm, found no apparent functions in the neuronal PCD, at least during early metamorphosis. Overall, our work revealed that vCrz PCD utilizes dronc, strica, dcp-1, and ice wherein the activation of Ice and Dcp-1 requires a novel pathway in addition to the initiator caspases.

Developmental alterations in anxiety and cognitive behavior in serotonin transporter mutant mice.

PubMed

Sakakibara, Yasufumi; Kasahara, Yoshiyuki; Hall, F Scott; Lesch, Klaus-Peter; Murphy, Dennis L; Uhl, George R; Sora, Ichiro

2014-10-01

A promoter variant of the serotonin transporter (SERT) gene is known to affect emotional and cognitive regulation. In particular, the "short" allelic variant is implicated in the etiology of multiple neuropsychiatric disorders. Heterozygous (SERT(+/-)) and homozygous (SERT(-/-)) SERT mutant mice are valuable tools for understanding the mechanisms of altered SERT levels. Although these genetic effects are well investigated in adulthood, the developmental trajectory of altered SERT levels for behavior has not been investigated. We assessed anxiety-like and cognitive behaviors in SERT mutant mice in early adolescence and adulthood to examine the developmental consequences of reduced SERT levels. Spine density of pyramidal neurons was also measured in corticolimbic brain regions. Adult SERT(-/-) mice exhibited increased anxiety-like behavior, but these differences were not observed in early adolescent SERT(-/-) mice. Conversely, SERT(+/-) and SERT(-/-) mice did display higher spontaneous alternation during early adolescence and adulthood. SERT(+/-) and SERT(-/-) also exhibited greater neuronal spine densities in the orbitofrontal but not the medial prefrontal cortices. Adult SERT(-/-) mice also showed an increased spine density in the basolateral amygdala. Developmental alterations of the serotonergic system caused by genetic inactivation of SERT can have different influences on anxiety-like and cognitive behaviors through early adolescence into adulthood, which may be associated with changes of spine density in the prefrontal cortex and amygdala. The altered maturation of serotonergic systems may lead to specific age-related vulnerabilities to psychopathologies that develop during adolescence.

An Annotated Bibliography of Some Recent Articles That Correlate with the Sewall Early Education Developmental Program (SEED).

ERIC Educational Resources Information Center

Jackson, Janice; Flamboe, Thomas C.

The annotated bibliography contains approximately 110 references (1969-1976) of articles related to the Sewall Early Education Developmental Program. Entries are arranged alphabetically by author within the following seven topic areas: social emotional, gross motor, fine motor, adaptive reasoning, speech and language, feeding and dressing and…

Gene regulatory network architecture in different developmental contexts influences the genetic basis of morphological evolution.

PubMed

Kittelmann, Sebastian; Buffry, Alexandra D; Franke, Franziska A; Almudi, Isabel; Yoth, Marianne; Sabaris, Gonzalo; Couso, Juan Pablo; Nunes, Maria D S; Frankel, Nicolás; Gómez-Skarmeta, José Luis; Pueyo-Marques, Jose; Arif, Saad; McGregor, Alistair P

2018-05-01

Convergent phenotypic evolution is often caused by recurrent changes at particular nodes in the underlying gene regulatory networks (GRNs). The genes at such evolutionary 'hotspots' are thought to maximally affect the phenotype with minimal pleiotropic consequences. This has led to the suggestion that if a GRN is understood in sufficient detail, the path of evolution may be predictable. The repeated evolutionary loss of larval trichomes among Drosophila species is caused by the loss of shavenbaby (svb) expression. svb is also required for development of leg trichomes, but the evolutionary gain of trichomes in the 'naked valley' on T2 femurs in Drosophila melanogaster is caused by reduced microRNA-92a (miR-92a) expression rather than changes in svb. We compared the expression and function of components between the larval and leg trichome GRNs to investigate why the genetic basis of trichome pattern evolution differs in these developmental contexts. We found key differences between the two networks in both the genes employed, and in the regulation and function of common genes. These differences in the GRNs reveal why mutations in svb are unlikely to contribute to leg trichome evolution and how instead miR-92a represents the key evolutionary switch in this context. Our work shows that variability in GRNs across different developmental contexts, as well as whether a morphological feature is lost versus gained, influence the nodes at which a GRN evolves to cause morphological change. Therefore, our findings have important implications for understanding the pathways and predictability of evolution.

Generation of a transgenic medaka (Oryzias latipes) strain for visualization of nuclear dynamics in early developmental stages.

PubMed

Inoue, Takanobu; Iida, Atsuo; Maegawa, Shingo; Sehara-Fujisawa, Atsuko; Kinoshita, Masato

2016-12-01

In this study, we verified nuclear transport activity of an artificial nuclear localization signal (aNLS) in medaka fish (Oryzias latipes). We generated a transgenic medaka strain expresses the aNLS tagged enhanced green fluorescent protein (EGFP) driven by a medaka beta-actin promoter. The aNLS-EGFP was accumulated in the nuclei of somatic tissues and yolk nuclei of oocytes, but undetectable in the spermatozoa. The fluorescent signal was observed from immediately after fertilization by a maternal contribution. Furthermore, male and female pronuclei were visualized in fertilized eggs, and nuclear dynamics of pronuclear fusion and subsequent cleavage were captured by time-lapse imaging. In contrast, SV40NLS exhibited no activity of nuclear transport in early embryos. In conclusion, the aNLS possesses a strong nuclear localization activity and is a useful probe for fluorescent observation of the pronuclei and nuclei in early developmental stage of medaka. © 2016 Japanese Society of Developmental Biologists.

Biomarkers of adult and developmental neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slikker, William; Bowyer, John F.

2005-08-07

Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessarymore » for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations.« less

A 3-dimensional human embryonic stem cell (hESC)-derived model to detect developmental neurotoxicity of nanoparticles.

PubMed

Hoelting, Lisa; Scheinhardt, Benjamin; Bondarenko, Olesja; Schildknecht, Stefan; Kapitza, Marion; Tanavde, Vivek; Tan, Betty; Lee, Qian Yi; Mecking, Stefan; Leist, Marcel; Kadereit, Suzanne

2013-04-01

Nanoparticles (NPs) have been shown to accumulate in organs, cross the blood-brain barrier and placenta, and have the potential to elicit developmental neurotoxicity (DNT). Here, we developed a human embryonic stem cell (hESC)-derived 3-dimensional (3-D) in vitro model that allows for testing of potential developmental neurotoxicants. Early central nervous system PAX6(+) precursor cells were generated from hESCs and differentiated further within 3-D structures. The 3-D model was characterized for neural marker expression revealing robust differentiation toward neuronal precursor cells, and gene expression profiling suggested a predominantly forebrain-like development. Altered neural gene expression due to exposure to non-cytotoxic concentrations of the known developmental neurotoxicant, methylmercury, indicated that the 3-D model could detect DNT. To test for specific toxicity of NPs, chemically inert polyethylene NPs (PE-NPs) were chosen. They penetrated deep into the 3-D structures and impacted gene expression at non-cytotoxic concentrations. NOTCH pathway genes such as HES5 and NOTCH1 were reduced in expression, as well as downstream neuronal precursor genes such as NEUROD1 and ASCL1. FOXG1, a patterning marker, was also reduced. As loss of function of these genes results in severe nervous system impairments in mice, our data suggest that the 3-D hESC-derived model could be used to test for Nano-DNT.

Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

PubMed

Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

2016-05-01

The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Developmental programming: interaction between prenatal BPA and postnatal overfeeding on cardiac tissue gene expression in female sheep

PubMed Central

Koneva, LA; Vyas, AK; McEachin, RC; Puttabyatappa, M; H-S, Wang; Sartor, MA; Padmanabhan, V

2017-01-01

Epidemiologic studies and studies in rodents point to potential risks from developmental exposure to BPA on cardiometabolic diseases. Furthermore, it is becoming increasingly evident that the manifestation and severity of adverse outcomes is the result of interaction between developmental insults and the prevailing environment. Consistent with this premise, recent studies in sheep found prenatal BPA treatment prevented the adverse effects of postnatal obesity in inducing hypertension. The gene networks underlying these complex interactions are not known. mRNA-seq of myocardium was performed on four groups of four female sheep to assess the effects of prenatal BPA exposure, postnatal overfeeding and their interaction on gene transcription, pathway perturbations and functional effects. The effects of prenatal exposure to BPA, postnatal overfeeding, and prenatal BPA with postnatal overfeeding all resulted in transcriptional changes (85–141 significant differentially expressed genes). Although the effects of prenatal BPA and postnatal overfeeding did not involve dysregulation of many of the same genes, they affected a remarkably similar set of biological pathways. Furthermore, an additive or synergistic effect was not found in the combined treatment group, but rather prenatal BPA treatment led to a partial reversal of the effects of overfeeding alone. Many genes previously known to be affected by BPA and involved in obesity, hypertension, or heart disease were altered following these treatments, and AP-1, EGR1, and EGFR were key hubs affected by BPA and/or overfeeding. PMID:28079927

The Effect of Early Childhood Developmental Program Attendance on Future School Enrollment in Rural North India

ERIC Educational Resources Information Center

Hazarika, Gautam; Viren, Vejoya

2013-01-01

This paper examines the effect of prior participation in early childhood developmental programs, considered endogenous, upon 7-18 years olds' school enrollment in rural North India. Analyses by age group of data from the World Bank's 1997-98 Survey of Living Conditions in Uttar Pradesh and Bihar reveal that 7-10 year olds, 11-14 year olds, and…

Developmental pathways from childhood conduct problems to early adult depression: findings from the ALSPAC cohort.

PubMed

Stringaris, Argyris; Lewis, Glyn; Maughan, Barbara

2014-07-01

Pathways from early-life conduct problems to young adult depression remain poorly understood. To test developmental pathways from early-life conduct problems to depression at age 18. Data (n = 3542) came from the Avon Longitudinal Study of Parents and Children (ALSPAC). Previously derived conduct problem trajectories (ages 4-13 years) were used to examine associations with depression from ages 10 to 18 years, and the role of early childhood factors as potential confounders. Over 43% of young adults with depression in the ALSPAC cohort had a history of child or adolescent conduct problems, yielding a population attributable fraction of 0.15 (95% CI 0.08-0.22). The association between conduct problems and depression at age 18 was considerable even after adjusting for prior depression (odds ratio 1.55, 95% CI 1.24-1.94). Early-onset persistent conduct problems carried the highest risk for later depression. Irritability characterised depression for those with a history of conduct problems. Early-life conduct problems are robustly associated with later depressive disorder and may be useful targets for early intervention. Royal College of Psychiatrists.

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

PubMed Central

Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

2013-01-01

Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

Neurogenetics of developmental dyslexia: from genes to behavior through brain neuroimaging and cognitive and sensorial mechanisms

PubMed Central

Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F

2017-01-01

Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging–genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging–genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging–genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of ‘biologically at-risk’ children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach. PMID:28045463

Copy-number variations are enriched for neurodevelopmental genes in children with developmental coordination disorder.

PubMed

Mosca, Stephen J; Langevin, Lisa Marie; Dewey, Deborah; Innes, A Micheil; Lionel, Anath C; Marshall, Christian C; Scherer, Stephen W; Parboosingh, Jillian S; Bernier, Francois P

2016-12-01

Developmental coordination disorder is a common neurodevelopment disorder that frequently co-occurs with other neurodevelopmental disorders including attention-deficit hyperactivity disorder (ADHD). Copy-number variations (CNVs) have been implicated in a number of neurodevelopmental and psychiatric disorders; however, the proportion of heritability in developmental coordination disorder (DCD) attributed to CNVs has not been explored. This study aims to investigate how CNVs may contribute to the genetic architecture of DCD. CNV analysis was performed on 82 extensively phenotyped Canadian children with DCD, with or without co-occurring ADHD and/or reading disorder, and 2988 healthy European controls using identical genome-wide SNP microarrays and CNV calling algorithms. An increased rate of large and rare genic CNVs (p=0.009) was detected, and there was an enrichment of duplications spanning brain-expressed genes (p=0.039) and genes previously implicated in other neurodevelopmental disorders (p=0.043). Genes and loci of particular interest in this group included: GAP43, RBFOX1, PTPRN2, SHANK3, 16p11.2 and distal 22q11.2. Although no recurrent CNVs were identified, 26% of DCD cases, where sample availability permitted segregation analysis, were found to have a de novo rare CNV. Of the inherited CNVs, 64% were from a parent who also had a neurodevelopmental disorder. These findings suggest that there may be shared susceptibility genes for DCD and other neurodevelopmental disorders and highlight the need for thorough phenotyping when investigating the genetics of neurodevelopmental disorders. Furthermore, these data provide compelling evidence supporting a genetic basis for DCD, and further implicate rare CNVs in the aetiology of neurodevelopmental disorders. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Relations of Early Motor Skills on Age and Socialization, Communication, and Daily Living in Young Children With Developmental Disabilities.

PubMed

MacDonald, Megan; Ross, Samantha; McIntyre, Laura Lee; Tepfer, Amanda

2017-04-01

Young children with developmental disabilities experience known deficits in salient child behaviors, such as social behaviors, communication, and aspects of daily living, behaviors that generally improve with chronological age. The purpose of this study was to examine the mediating effects of motor skills on relations of age and salient child behaviors in a group of young children with developmental disabilities, thus tapping into the potential influences of motor skills in the development of salient child behaviors. One hundred thirteen young children with developmental disabilities participated in this study. Independent mediation analysis, with gender as a moderator between the mediating and outcome variable, indicated that motor skills meditated relations between age and socialization, communication, and daily living skills in young male children with developmental disabilities, but not female participants. Findings suggest motor skill content needs to be considered in combination with other child behaviors commonly focused on in early intervention.

Abnormal electroretinogram associated with developmental brain anomalies.

PubMed Central

Cibis, G W; Fitzgerald, K M

1995-01-01

PURPOSE: We have encountered abnormal ERGs associated with optic nerve hypoplasia, macular, optic nerve and chorioretinal colobomata and developmental brain anomalies. Brain anomalies include cortical dysgenesis, lissencephaly, porencephaly, cerebellar and corpus callosum hypoplasia. We describe six exemplar cases. METHODS: Scotopic and photopic ERGs adherent to international standards were performed as well as photopic ERGs to long-duration stimuli. CT or MRI studies were also done. The ERGs were compared to age-matched normal control subjects. RESULTS: ERG changes include reduced amplitude b-waves to blue and red stimuli under scotopic testing conditions. Implicit times were often delayed. The photopic responses also showed reduced amplitude a- and b-waves with implicit time delays. The long-duration photopic ERG done in one case shows attenuation of both ON- and OFF-responses. CONCLUSIONS: Common underlying developmental genetic or environmental unifying casualties are speculated to be at fault in causing these cases of associated retinal and brain abnormalities. No single etiology is expected. Multiple potential causes acting early in embryogenesis effecting neuronal induction, migration and differentiation are theorized. These occur at a time when brain and retinal cells are sufficiently undifferentiated to be similarly effected. We call these cases examples of Brain Retina Neuroembryodysgenesis (BRNED). Homeobox and PAX genes with global neuronal developmental influences are gene candidates to unify the observed disruption of brain and retinal cell development. The ERG can provide a valuable clinical addition in understanding and ultimately classifying these disorders. Images FIGURE 1 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 PMID:8719676

Heterozygous truncation mutations of the SMC1A gene cause a severe early onset epilepsy with cluster seizures in females: Detailed phenotyping of 10 new cases.

PubMed

Symonds, Joseph D; Joss, Shelagh; Metcalfe, Kay A; Somarathi, Suresh; Cruden, Jamie; Devlin, Anita M; Donaldson, Alan; DiDonato, Nataliya; Fitzpatrick, David; Kaiser, Frank J; Lampe, Anne K; Lees, Melissa M; McLellan, Ailsa; Montgomery, Tara; Mundada, Vivek; Nairn, Lesley; Sarkar, Ajoy; Schallner, Jens; Pozojevic, Jelena; Parenti, Ilaria; Tan, Jeen; Turnpenny, Peter; Whitehouse, William P; Zuberi, Sameer M

2017-04-01

The phenotype of seizure clustering with febrile illnesses in infancy/early childhood is well recognized. To date the only genetic epilepsy consistently associated with this phenotype is PCDH19, an X-linked disorder restricted to females, and males with mosaicism. The SMC1A gene, which encodes a structural component of the cohesin complex is also located on the X chromosome. Missense variants and small in-frame deletions of SMC1A cause approximately 5% of Cornelia de Lange Syndrome (CdLS). Recently, protein truncating mutations in SMC1A have been reported in five females, all of whom have been affected by a drug-resistant epilepsy, and severe developmental impairment. Our objective was to further delineate the phenotype of SMC1A truncation. Female cases with de novo truncation mutations in SMC1A were identified from the Deciphering Developmental Disorders (DDD) study (n = 8), from postmortem testing of an affected twin (n = 1), and from clinical testing with an epilepsy gene panel (n = 1). Detailed information on the phenotype in each case was obtained. Ten cases with heterozygous de novo mutations in the SMC1A gene are presented. All 10 mutations identified are predicted to result in premature truncation of the SMC1A protein. All cases are female, and none had a clinical diagnosis of CdLS. They presented with onset of epileptic seizures between <4 weeks and 28 months of age. In the majority of cases, a marked preponderance for seizures to occur in clusters was noted. Seizure clusters were associated with developmental regression. Moderate or severe developmental impairment was apparent in all cases. Truncation mutations in SMC1A cause a severe epilepsy phenotype with cluster seizures in females. These mutations are likely to be nonviable in males. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

The developmental genetics of biological robustness

PubMed Central

Mestek Boukhibar, Lamia; Barkoulas, Michalis

2016-01-01

Background Living organisms are continuously confronted with perturbations, such as environmental changes that include fluctuations in temperature and nutrient availability, or genetic changes such as mutations. While some developmental systems are affected by such challenges and display variation in phenotypic traits, others continue consistently to produce invariable phenotypes despite perturbation. This ability of a living system to maintain an invariable phenotype in the face of perturbations is termed developmental robustness. Biological robustness is a phenomenon observed across phyla, and studying its mechanisms is central to deciphering the genotype–phenotype relationship. Recent work in yeast, animals and plants has shown that robustness is genetically controlled and has started to reveal the underlying mechinisms behind it. Scope and Conclusions Studying biological robustness involves focusing on an important property of developmental traits, which is the phenotypic distribution within a population. This is often neglected because the vast majority of developmental biology studies instead focus on population aggregates, such as trait averages. By drawing on findings in animals and yeast, this Viewpoint considers how studies on plant developmental robustness may benefit from strict definitions of what is the developmental system of choice and what is the relevant perturbation, and also from clear distinctions between gene effects on the trait mean and the trait variance. Recent advances in quantitative developmental biology and high-throughput phenotyping now allow the design of targeted genetic screens to identify genes that amplify or restrict developmental trait variance and to study how variation propagates across different phenotypic levels in biological systems. The molecular characterization of more quantitative trait loci affecting trait variance will provide further insights into the evolution of genes modulating developmental robustness. The

Gelatinous drop-like corneal dystrophy in a child with developmental delay: clinicopathological features and exclusion of the M1S1 gene.

PubMed

Akhtar, S; Bron, A J; Qin, X; Creer, R C; Guggenheim, J A; Meek, K M

2005-02-01

Gelatinous drop-like corneal dystrophy (GDLD) is an early-onset, autosomal recessive condition characterised by amyloid deposits within the cornea. We report the histopathological and molecular genetic findings in a Caucasian child with GDLD who also exhibited global developmental delay. Bilateral lamellar keratoplasty was carried out at age 6 and 7 years. Tissue was fixed for light and electron microscopy, including immunoelectronmicroscopy. The coding region of the M1S1 gene was screened for mutations in the affected proband and available relatives, using DNA extracted from mouthwashes. Nodular deposits, which were present subepithelially and in the central superficial stroma, stained typically for amyloid with PAS and Congo red. A nodular deposit of amyloid, together with large amounts of lactoferrin and sparse amounts of keratoepithelin (betaig-h3), was present in the central superficial stroma, causing destruction of Bowman's layer and elevation of the thinned, degenerate epithelium. Around the deposit zone, the stroma exhibited large numbers of thick filamentous proteoglycan deposits. While the affected child was homozygous for a novel A1133 C single-nucleotide polymorphism (SNP) that resulted in an aspartic acid to alanine substitution at position 173 of the M1S1 coding sequence, this polymorphism was also found at relatively high frequency in a sample of normal controls, enabling exclusion of the M1S1 gene as the disease locus. Increased epithelial permeability in GDLD may be explained in part by an altered membrane permeability of the superficial epithelial cells. An association with developmental delay has not been reported previously.

Early BrdU-responsive genes constitute a novel class of senescence-associated genes in human cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Minagawa, Sachi; Nakabayashi, Kazuhiko; Fujii, Michihiko

2005-04-01

We identified genes that immediately respond to 5-bromodeoxyuridine (BrdU) in SUSM-1, an immortal fibroblastic line, with DNA microarray and Northern blot analysis. At least 29 genes were found to alter gene expression greater than twice more or less than controls within 36 h after addition of BrdU. They took several different expression patterns upon addition of BrdU, and the majority showed a significant alteration within 12 h. When compared among SUSM-1, HeLa, and TIG-7 normal human fibroblasts, 19 genes behaved similarly upon addition of BrdU. In addition, 14 genes, 9 of which are novel as regards senescence, behaved similarly inmore » senescent TIG-7 cells. The genes do not seem to have a role in proliferation or cell cycle progression. These results suggest that the early BrdU-responsive genes represent early signs of cellular senescence and can be its new biomarkers.« less

Reduce, reuse, and recycle: developmental evolution of trait diversification.

PubMed

Preston, Jill C; Hileman, Lena C; Cubas, Pilar

2011-03-01

A major focus of evolutionary developmental (evo-devo) studies is to determine the genetic basis of variation in organismal form and function, both of which are fundamental to biological diversification. Pioneering work on metazoan and flowering plant systems has revealed conserved sets of genes that underlie the bauplan of organisms derived from a common ancestor. However, the extent to which variation in the developmental genetic toolkit mirrors variation at the phenotypic level is an active area of research. Here we explore evidence from the angiosperm evo-devo literature supporting the frugal use of genes and genetic pathways in the evolution of developmental patterning. In particular, these examples highlight the importance of genetic pleiotropy in different developmental modules, thus reducing the number of genes required in growth and development, and the reuse of particular genes in the parallel evolution of ecologically important traits.

Utility of Small Animal Models of Developmental Programming.

PubMed

Reynolds, Clare M; Vickers, Mark H

2018-01-01

Any effective strategy to tackle the global obesity and rising noncommunicable disease epidemic requires an in-depth understanding of the mechanisms that underlie these conditions that manifest as a consequence of complex gene-environment interactions. In this context, it is now well established that alterations in the early life environment, including suboptimal nutrition, can result in an increased risk for a range of metabolic, cardiovascular, and behavioral disorders in later life, a process preferentially termed developmental programming. To date, most of the mechanistic knowledge around the processes underpinning development programming has been derived from preclinical research performed mostly, but not exclusively, in laboratory mouse and rat strains. This review will cover the utility of small animal models in developmental programming, the limitations of such models, and potential future directions that are required to fully maximize information derived from preclinical models in order to effectively translate to clinical use.

A Burst of miRNA Innovation in the Early Evolution of Butterflies and Moths

PubMed Central

Quah, Shan; Hui, Jerome H.L.; Holland, Peter W.H.

2015-01-01

MicroRNAs (miRNAs) are involved in posttranscriptional regulation of gene expression. Because several miRNAs are known to affect the stability or translation of developmental regulatory genes, the origin of novel miRNAs may have contributed to the evolution of developmental processes and morphology. Lepidoptera (butterflies and moths) is a species-rich clade with a well-established phylogeny and abundant genomic resources, thereby representing an ideal system in which to study miRNA evolution. We sequenced small RNA libraries from developmental stages of two divergent lepidopterans, Cameraria ohridella (Horse chestnut Leafminer) and Pararge aegeria (Speckled Wood butterfly), discovering 90 and 81 conserved miRNAs, respectively, and many species-specific miRNA sequences. Mapping miRNAs onto the lepidopteran phylogeny reveals rapid miRNA turnover and an episode of miRNA fixation early in lepidopteran evolution, implying that miRNA acquisition accompanied the early radiation of the Lepidoptera. One lepidopteran-specific miRNA gene, miR-2768, is located within an intron of the homeobox gene invected, involved in insect segmental and wing patterning. We identified cubitus interruptus (ci) as a likely direct target of miR-2768, and validated this suppression using a luciferase assay system. We propose a model by which miR-2768 modulates expression of ci in the segmentation pathway and in patterning of lepidopteran wing primordia. PMID:25576364

Validation of reference genes for real-time quantitative PCR normalization in soybean developmental and germinating seeds.

PubMed

Li, Qing; Fan, Cheng-Ming; Zhang, Xiao-Mei; Fu, Yong-Fu

2012-10-01

Most of traditional reference genes chosen for real-time quantitative PCR normalization were assumed to be ubiquitously and constitutively expressed in vegetative tissues. However, seeds show distinct transcriptomes compared with the vegetative tissues. Therefore, there is a need for re-validation of reference genes in samples of seed development and germination, especially for soybean seeds. In this study, we aimed at identifying reference genes suitable for the quantification of gene expression level in soybean seeds. In order to identify the best reference genes for soybean seeds, 18 putative reference genes were tested with various methods in different seed samples. We combined the outputs of both geNorm and NormFinder to assess the expression stability of these genes. The reference genes identified as optimums for seed development were TUA5 and UKN2, whereas for seed germination they were novel reference genes Glyma05g37470 and Glyma08g28550. Furthermore, for total seed samples it was necessary to combine four genes of Glyma05g37470, Glyma08g28550, Glyma18g04130 and UKN2 [corrected] for normalization. Key message We identified several reference genes that stably expressed in soybean seed developmental and germinating processes.

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism

PubMed Central

Tanaka, Akemi J.; Cho, Megan T.; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A.; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N.; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K.; Anderson, Ilse J.; Sacoto, Maria J. Guillen; Schnur, Rhonda E.; Chung, Wendy K.

2017-01-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3. PMID:29162653

Developmental and Spatial Expression of sir2 Genes in the Cellular Slime Mold Dictyostelium discoideum.

PubMed

Katayama, Takahiro; Yasukawa, Hiro

2008-01-01

The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.

Morphological and histomorphological structures of testes and ovaries in early developmental stages of the silkworm, Bombyx mori.

PubMed

Sakai, Hiroki; Kirino, Yohei; Katsuma, Susumu; Aoki, Fugaku; Suzuki, Masataka G

2016-01-01

The gonad develops as a testis in male or an ovary in female. In the silkworm, B. mori , little is known about testis and ovary in the embryonic stages and early larval stages. In this study, we performed morphological and histomorphological observations of ovaries and testes from the late embryonic stage to the 1st instar larval stage. Results obtained with lack of accurate information on sex of examined individuals may be misleading, thus we performed phenotypic observations of gonads by utilizing sex-limited strain that enables us to easily discriminate female embryos from male ones based on those egg colors. In testis, four testicular follicles were clearly observed in the testis at the first instar larval stage, and boundary layers were formed between the testicular follicles. At the late embryonic stage, the testis consisted of four testicular follicles, while the boundary layers were still obscure. In ovary, four ovarioles were easily recognizable in the ovary at the first instar larval stage, and boundary layers were formed between the ovarioles. However, in the late embryonic stage, it was quite difficult to identify four ovarioles. Morphological characteristics were almost similar between testis and ovary in early developmental stages. Our present study demonstrates that the most reliable difference between testis and ovary in early developmental stages is the attaching point of the duct. Formation and development of the duct may be sensitive to the sex-determining signal and display sexual dimorphism in early embryonic stages.

Early childhood adversity, toxic stress, and the role of the pediatrician: translating developmental science into lifelong health.

PubMed

Garner, Andrew S; Shonkoff, Jack P

2012-01-01

Advances in a wide range of biological, behavioral, and social sciences are expanding our understanding of how early environmental influences (the ecology) and genetic predispositions (the biologic program) affect learning capacities, adaptive behaviors, lifelong physical and mental health, and adult productivity. A supporting technical report from the American Academy of Pediatrics (AAP) presents an integrated ecobiodevelopmental framework to assist in translating these dramatic advances in developmental science into improved health across the life span. Pediatricians are now armed with new information about the adverse effects of toxic stress on brain development, as well as a deeper understanding of the early life origins of many adult diseases. As trusted authorities in child health and development, pediatric providers must now complement the early identification of developmental concerns with a greater focus on those interventions and community investments that reduce external threats to healthy brain growth. To this end, AAP endorses a developing leadership role for the entire pediatric community-one that mobilizes the scientific expertise of both basic and clinical researchers, the family-centered care of the pediatric medical home, and the public influence of AAP and its state chapters-to catalyze fundamental change in early childhood policy and services. AAP is committed to leveraging science to inform the development of innovative strategies to reduce the precipitants of toxic stress in young children and to mitigate their negative effects on the course of development and health across the life span.

Early Developmental Disturbances of Cortical Inhibitory Neurons: Contribution to Cognitive Deficits in Schizophrenia

PubMed Central

Volk, David W.; Lewis, David A.

2014-01-01

Cognitive dysfunction is a disabling and core feature of schizophrenia. Cognitive impairments have been linked to disturbances in inhibitory (gamma-aminobutyric acid [GABA]) neurons in the prefrontal cortex. Cognitive deficits are present well before the onset of psychotic symptoms and have been detected in early childhood with developmental delays reported during the first year of life. These data suggest that the pathogenetic process that produces dysfunction of prefrontal GABA neurons in schizophrenia may be related to altered prenatal development. Interestingly, adult postmortem schizophrenia brain tissue studies have provided evidence consistent with a disease process that affects different stages of prenatal development of specific subpopulations of prefrontal GABA neurons. Prenatal ontogeny (ie, birth, proliferation, migration, and phenotypic specification) of distinct subpopulations of cortical GABA neurons is differentially regulated by a host of transcription factors, chemokine receptors, and other molecular markers. In this review article, we propose a strategy to investigate how alterations in the expression of these developmental regulators of subpopulations of cortical GABA neurons may contribute to the pathogenesis of cortical GABA neuron dysfunction and consequently cognitive impairments in schizophrenia. PMID:25053651

Developmental programming: Interaction between prenatal BPA and postnatal overfeeding on cardiac tissue gene expression in female sheep.

PubMed

Koneva, L A; Vyas, A K; McEachin, R C; Puttabyatappa, M; Wang, H-S; Sartor, M A; Padmanabhan, V

2017-01-01

Epidemiologic studies and studies in rodents point to potential risks from developmental exposure to BPA on cardiometabolic diseases. Furthermore, it is becoming increasingly evident that the manifestation and severity of adverse outcomes is the result of interaction between developmental insults and the prevailing environment. Consistent with this premise, recent studies in sheep found prenatal BPA treatment prevented the adverse effects of postnatal obesity in inducing hypertension. The gene networks underlying these complex interactions are not known. mRNA-seq of myocardium was performed on four groups of four female sheep to assess the effects of prenatal BPA exposure, postnatal overfeeding and their interaction on gene transcription, pathway perturbations and functional effects. The effects of prenatal exposure to BPA, postnatal overfeeding, and prenatal BPA with postnatal overfeeding all resulted in transcriptional changes (85-141 significant differentially expressed genes). Although the effects of prenatal BPA and postnatal overfeeding did not involve dysregulation of many of the same genes, they affected a remarkably similar set of biological pathways. Furthermore, an additive or synergistic effect was not found in the combined treatment group, but rather prenatal BPA treatment led to a partial reversal of the effects of overfeeding alone. Many genes previously known to be affected by BPA and involved in obesity, hypertension, or heart disease were altered following these treatments, and AP-1, EGR1, and EGFR were key hubs affected by BPA and/or overfeeding. Environ. Mol. Mutagen. 58:4-18, 2017. © 2016 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

PubMed

Kück, Ulrich

2005-10-01

Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

Post-natal myogenic and adipogenic developmental

PubMed Central

Konings, Gonda; van Weeghel, Michel; van den Hoogenhof, Maarten MG; Gijbels, Marion; van Erk, Arie; Schoonderwoerd, Kees; van den Bosch, Bianca; Dahlmans, Vivian; Calis, Chantal; Houten, Sander M; Misteli, Tom

2011-01-01

A-type lamins are a major component of the nuclear lamina. Mutations in the LMNA gene, which encodes the A-type lamins A and C, cause a set of phenotypically diverse diseases collectively called laminopathies. While adult LMNA null mice show various symptoms typically associated with laminopathies, the effect of loss of lamin A/C on early post-natal development is poorly understood. Here we developed a novel LMNA null mouse (LMNAGT−/−) based on genetrap technology and analyzed its early post-natal development. We detect LMNA transcripts in heart, the outflow tract, dorsal aorta, liver and somites during early embryonic development. Loss of A-type lamins results in severe growth retardation and developmental defects of the heart, including impaired myocyte hypertrophy, skeletal muscle hypotrophy, decreased amounts of subcutaneous adipose tissue and impaired ex vivo adipogenic differentiation. These defects cause death at 2 to 3 weeks post partum associated with muscle weakness and metabolic complications, but without the occurrence of dilated cardiomyopathy or an obvious progeroid phenotype. Our results indicate that defective early post-natal development critically contributes to the disease phenotypes in adult laminopathies. PMID:21818413

Developmental instability of gynodioecious Teucrium lusitanicum

USGS Publications Warehouse

Alados, C.L.; Navarro, T.; Cabezudo, B.; Emlen, J.M.; Freeman, C.

1998-01-01

Developmental instability was assessed in two geographical races of Teucrium lusitanicum using morphometric measures of vegetative and reproductive structures. T. lusitanicum is a gynodioecious species. Male sterile (female) individuals showed greater developmental instability at all sites. Plants located inland had higher developmental instability of vegetative characters and lower developmental instability of reproductive characters than coastal plants. These results support the contentions that (1) developmental instability is affected more by the disruption of co-adapted gene complexes than by lower heterozygosity, and (2) different habitat characteristics result in the differential response of vegetative and reproductive structures.

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

Early life experience contributes to the developmental programming of depressive-like behaviour, neuroinflammation and oxidative stress.

PubMed

Réus, Gislaine Z; Fernandes, Gabrielly C; de Moura, Airam B; Silva, Ritele H; Darabas, Ana Caroline; de Souza, Thays G; Abelaira, Helena M; Carneiro, Celso; Wendhausen, Diogo; Michels, Monique; Pescador, Bruna; Dal-Pizzol, Felipe; Macêdo, Danielle S; Quevedo, João

2017-12-01

This study used an animal model of depression induced by maternal care deprivation (MCD) to investigate whether depressive behaviour, neuroinflammation and oxidative stress were underlying factors in developmental programming after early life stress. At postnatal days (PND) 20, 30, 40, and 60, individual subsets of animals were evaluated in behavioural tests and then euthanized to assess cytokine levels and oxidative stress parameters in the prefrontal cortex (PFC), hippocampus and serum. The results showed that MCD did not induce behavioural changes at PND 30 and 40. However, at PND 20 and 60, the rats displayed a depressive-like behaviour in the forced swimming test, without changes in locomotor spontaneous activity. In the brain and serum, the levels of pro-inflammatory cytokines (interleukin-1β (IL-1β), interleukin-6 (IL-6) and tumour necrosis factor-α (TNF-α)) were increased, and the anti-inflammatory cytokine (interleukin-10) level was reduced throughout developmental programming (PND 20, 30, 40 and 60). Protein carbonyl levels increased in the brain at PND 30, 40 and 60. Superoxide dismutase (SOD) activity was decreased during all developmental programming phases evaluated in the brain. Catalase (CAT) activity was decreased at PND 20, 40 and 60 in the brain. Our results revealed that "critical episodes" in early life stressful events are able to induce behavioural alterations that persist into adulthood and can stimulate inflammation and oxidative damage in both central and peripheral systems, which are required for distinct patterns of resilience against psychiatric disorders later in life. Copyright © 2017 Elsevier Ltd. All rights reserved.

Developmental Pathways Are Blueprints for Designing Successful Crops

PubMed Central

Trevaskis, Ben

2018-01-01

Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene–gene or gene–environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted. PMID:29922318

Expression profiling of the mouse early embryo: Reflections and Perspectives

PubMed Central

Ko, Minoru S. H.

2008-01-01

Laboratory mouse plays important role in our understanding of early mammalian development and provides invaluable model for human early embryos, which are difficult to study for ethical and technical reasons. Comprehensive collection of cDNA clones, their sequences, and complete genome sequence information, which have been accumulated over last two decades, have provided even more advantages to mouse models. Here the progress in global gene expression profiling in early mouse embryos and, to some extent, stem cells are reviewed and the future directions and challenges are discussed. The discussions include the restatement of global gene expression profiles as snapshot of cellular status, and subsequent distinction between the differentiation state and physiological state of the cells. The discussions then extend to the biological problems that can be addressed only through global expression profiling, which include: bird’s-eye view of global gene expression changes, molecular index for developmental potency, cell lineage trajectory, microarray-guided cell manipulation, and the possibility of delineating gene regulatory cascades and networks. PMID:16739220

Interdyad differences in early mother-infant face-to-face communication: real-time dynamics and developmental pathways.

PubMed

Lavelli, Manuela; Fogel, Alan

2013-12-01

A microgenetic research design with a multiple case study method and a combination of quantitative and qualitative analyses was used to investigate interdyad differences in real-time dynamics and developmental change processes in mother-infant face-to-face communication over the first 3 months of life. Weekly observations of 24 mother-infant dyads with analyses performed dyad by dyad showed that most dyads go through 2 qualitatively different developmental phases of early face-to-face communication: After a phase of mutual attentiveness, mutual engagement begins in Weeks 7-8, with infant smiling and cooing bidirectionally linked with maternal mirroring. This gives rise to sequences of positive feedback that, by the 3rd month, dynamically stabilizes into innovative play routines. However, when there is a lack of bidirectional positive feedback between infant and maternal behaviors, and a lack of permeability of the early communicative patterns to incorporate innovations, the development of the mutual engagement phase is compromised. The findings contribute both to theories of relationship change processes and to clinical work with at-risk mother-infant interactions. PsycINFO Database Record (c) 2013 APA, all rights reserved.

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

Targeting Developmental Pathways: The Achilles Heel of Cancer?

PubMed

Dempke, Wolfram C M; Fenchel, Klaus; Uciechowski, Peter; Chevassut, Timothy

2017-01-01

Developmental pathways (e.g., Notch, Hippo, Hedgehog, Wnt, and TGF-β/BMP/FGF) are networks of genes that act co-ordinately to establish the body plan, and disruptions of genes in one pathway can have effects in related pathways and may result in serious dysmorphogenesis or cancer. Interestingly, all developmental pathways are highly conserved cell signalling systems present in almost all multicellular organisms. In addition, they have a crucial role in cell proliferation, apoptosis, differentiation, and finally in organ development. Of note, almost all of these pathways promote oncogenesis through synergistic associations with the Hippo signalling pathway, and several lines of evidence have also indicated that these pathways (e.g., Wnt/β-catenin) may be implicated in checkpoint inhibitor resistance (e.g., CTLA-4, PD-1, and PD-L1). Since Notch inhibition in vivo results in partial loss of its stemness features such as self-renewal, chemoresistance, invasive and migratory potential, and tumorigenesis, these highly conserved developmental pathways are regarded as being critical for regulation of self-renewal in both embryonic and adult stem cells and hence are likely to be implicated in the maintenance of cancer stem cells. Many small molecules are currently in preclinical and early clinical development, and only two compounds are approved for treatment of advanced or metastatic basal cell carcinoma (vismodegib and sonidegib). Furthermore, therapeutic targeting of cancer stem cells using drugs that disrupt activated developmental pathways may also represent an attractive strategy that is potentially relevant to many types of malignancy, notably blood cancers, where the evidence for leukaemia stem cells is well established. Future work will hopefully pave the way for the development of new strategies for targeting these pervasive oncogenic pathways. © 2017 S. Karger AG, Basel.

Developmental pathways from childhood conduct problems to early adult depression: findings from the ALSPAC cohort

PubMed Central

Stringaris, Argyris; Lewis, Glyn; Maughan, Barbara

2014-01-01

Background Pathways from early-life conduct problems to young adult depression remain poorly understood. Aims To test developmental pathways from early-life conduct problems to depression at age 18. Method Data (n = 3542) came from the Avon Longitudinal Study of Parents and Children (ALSPAC). Previously derived conduct problem trajectories (ages 4-13 years) were used to examine associations with depression from ages 10 to 18 years, and the role of early childhood factors as potential confounders. Results Over 43% of young adults with depression in the ALSPAC cohort had a history of child or adolescent conduct problems, yielding a population attributable fraction of 0.15 (95% CI 0.08-0.22). The association between conduct problems and depression at age 18 was considerable even after adjusting for prior depression (odds ratio 1.55, 95% CI 1.24-1.94). Early-onset persistent conduct problems carried the highest risk for later depression. Irritability characterised depression for those with a history of conduct problems. Conclusions Early-life conduct problems are robustly associated with later depressive disorder and may be useful targets for early intervention. PMID:24764545

Developmental Trajectories of Early Communication Skills

ERIC Educational Resources Information Center

Maatta, Sira; Laakso, Marja-Leena; Tolvanen, Asko; Ahonen, Timo; Aro, Tuija

2012-01-01

Purpose: This study focused on developmental trajectories of prelinguistic communication skills and their connections to later parent-reported language difficulties. Method: The participants represent a subset of a community-based sample of 508 children. Data include parent reports of prelinguistic communication skills at 12, 15, 18, and 21 months…

Early object labels: the case for a developmental lexical principles framework.

PubMed

Golinkoff, R M; Mervis, C B; Hirsh-Pasek, K

1994-02-01

Universally, object names make up the largest proportion of any word type found in children's early lexicons. Here we present and critically evaluate a set of six lexical principles (some previously proposed and some new) for making object label learning a manageable task. Overall, the principles have the effect of reducing the amount of information that language-learning children must consider for what a new word might mean. These principles are constructed by children in a two-tiered developmental sequence, as a function of their sensitivity to linguistic input, contextual information, and social-interactional cues. Thus, the process of lexical acquisition changes as a result of the particular principles a given child has at his or her disposal. For children who have only the principles of the first tier (reference, extendibility, and object scope), word learning has a deliberate and laborious look. The principles of the second tier (categorical scope, novel name-nameless category' or N3C, and conventionality) enable the child to acquire many new labels rapidly. The present unified account is argued to have a number of advantages over treating such principles separately and non-developmentally. Further, the explicit recognition that the acquisition and operation of these principles is influenced by the child's interpretation of both linguistic and non-linguistic input is seen as an advance.

Longitudinal effects of developmental bisphenol A and variable diet exposures on epigenetic drift in mice.

PubMed

Kochmanski, Joseph; Marchlewicz, Elizabeth H; Savidge, Matthew; Montrose, Luke; Faulk, Christopher; Dolinoy, Dana C

2017-03-01

Environmental factors, including exogenous exposures and nutritional status, can affect DNA methylation across the epigenome, but effects of exposures on age-dependent epigenetic drift remain unclear. Here, we tested the hypothesis that early-life exposure to bisphenol A (BPA) and/or variable diet results in altered epigenetic drift, as measured longitudinally via target loci methylation in paired mouse tail tissue (3 wks/10 mos old). Methylation was quantified at two repetitive elements (LINE-1, IAP), two imprinted genes (Igf2, H19), and one non-imprinted gene (Esr1) in isogenic mice developmentally exposed to Control, Control+BPA (50μg/kg diet), Mediterranean, Western, Mediterranean+BPA, or Western+BPA diets. Across age, methylation levels significantly (p<0.050) decreased at LINE-1, IAP, and H19, and increased at Esr1. Igf2 demonstrated Western-specific changes in early-life methylation (p=0.027), and IAP showed marginal negative modification of drift in Western (p=0.058) and Western+BPA (p=0.051). Thus, DNA methylation drifts across age, and developmental nutritional exposures can alter age-related methylation patterns. Copyright © 2016 Elsevier Inc. All rights reserved.

Punishment insensitivity in early childhood: A developmental, dimensional approach

PubMed Central

Nichols, Sara R.; Briggs-Gowan, Margaret; Estabrook, Ryne; Burns, James; Kestler, Jacqueline; Berman, Grace; Henry, David; Wakschlag, Lauren

2014-01-01

Impairment in learning from punishment ("punishment insensitivity") is an established feature of severe antisocial behavior in adults and youth but it has not been well studied as a developmental phenomenon. In early childhood, differentiating a normal:abnormal spectrum of punishment insensitivity is key for distinguishing normative misbehavior from atypical manifestations. This study employed a novel measure, the Multidimensional Assessment Profile of Disruptive Behavior (MAPDB), to examine the distribution, dimensionality, and external validity of punishment insensitivity in a large, demographically diverse community sample of preschoolers (three-five years) recruited from pediatric clinics (N=1,855). Caregivers completed surveys from which a seven-item Punishment Insensitivity scale was derived. Findings indicated that Punishment Insensitivity behaviors are relatively common in young children, with at least 50% of preschoolers exhibiting them sometimes. Item response theory analyses revealed a Punishment Insensitivity spectrum. Items varied along a severity continuum: most items needed to occur "Often" in order to be severe and behaviors that were qualitatively atypical or intense were more severe. Although there were item-level differences across sociodemographic groups, these were small. Construct, convergent, and divergent validity were demonstrated via association to low concern for others and noncompliance, motivational regulation, and a disruptive family context. Incremental clinical utility was demonstrated in relation to impairment. Early childhood punishment insensitivity varies along a severity continuum and is atypical when it predominates. Implications for understanding the phenomenology of emergent disruptive behavior are discussed. PMID:25425187

Punishment Insensitivity in Early Childhood: A Developmental, Dimensional Approach.

PubMed

Nichols, Sara R; Briggs-Gowan, Margaret J; Estabrook, Ryne; Burns, James L; Kestler, Jacqueline; Berman, Grace; Henry, David B; Wakschlag, Lauren S

2015-08-01

Impairment in learning from punishment ("punishment insensitivity") is an established feature of severe antisocial behavior in adults and youth but it has not been well studied as a developmental phenomenon. In early childhood, differentiating a normal: abnormal spectrum of punishment insensitivity is key for distinguishing normative misbehavior from atypical manifestations. This study employed a novel measure, the Multidimensional Assessment Profile of Disruptive Behavior (MAP-DB), to examine the distribution, dimensionality, and external validity of punishment insensitivity in a large, demographically diverse community sample of preschoolers (3-5 years) recruited from pediatric clinics (N = 1,855). Caregivers completed surveys from which a seven-item Punishment Insensitivity scale was derived. Findings indicated that Punishment Insensitivity behaviors are relatively common in young children, with at least 50 % of preschoolers exhibiting them sometimes. Item response theory analyses revealed a Punishment Insensitivity spectrum. Items varied along a severity continuum: most items needed to occur "Often" in order to be severe and behaviors that were qualitatively atypical or intense were more severe. Although there were item-level differences across sociodemographic groups, these were small. Construct, convergent, and divergent validity were demonstrated via association to low concern for others and noncompliance, motivational regulation, and a disruptive family context. Incremental clinical utility was demonstrated in relation to impairment. Early childhood punishment insensitivity varies along a severity continuum and is atypical when it predominates. Implications for understanding the phenomenology of emergent disruptive behavior are discussed.

Interpersonal Callousness from Childhood to Adolescence: Developmental Trajectories and Early Risk Factors.

PubMed

Byrd, Amy L; Hawes, Samuel W; Loeber, Rolf; Pardini, Dustin A

2018-01-01

Youth with a callous interpersonal style, consistent with features of adult psychopathy (e.g., lack of guilt, deceitful), are at risk for exhibiting severe and protracted antisocial behaviors. However, no studies have examined changes that occur in interpersonal callousness (IC) from childhood to adolescence, and little is known about the influence of early child, social, and contextual factors on trajectories of IC. The current study examined distinct patterns of IC across childhood and adolescence and associations with early risk factors. Participants were an at-risk sample of 503 boys (56% African American) assessed annually from around ages 7-15. Analyses examined child (anger dysregulation, fearfulness), social (peer, family, maltreatment), and contextual (psychosocial adversity) factors associated with teacher-reported IC trajectories across childhood and adolescence. Using latent class growth analysis, five trajectories of IC were identified (early-onset chronic, childhood-limited, adolescent-onset, moderate, low). Approximately 10% of boys followed an early-onset chronic trajectory, and a roughly equal percent of youth followed childhood-limited trajectory (10%) or an adolescent-onset trajectory (12%) of IC across development. Specifically, half of the boys with high IC in childhood did not continue to exhibit significant levels of these features into adolescence, whereas an equal proportion of youth with low IC in childhood demonstrated increasing levels during the transition to adolescence. Boys in the early-onset chronic group were characterized by the most risk factors and were differentiated from those with childhood-limited and adolescent-onset IC only by higher conduct problems, fearlessness, and emotional abuse/neglect. Findings are discussed in terms of developmental models of IC and several avenues for early targeted interventions.

Transcriptome analysis at four developmental stages of grape berry (Vitis vinifera cv. Shiraz) provides insights into regulated and coordinated gene expression

PubMed Central

2012-01-01

Background Vitis vinifera berry development is characterised by an initial phase where the fruit is small, hard and acidic, followed by a lag phase known as veraison. In the final phase, berries become larger, softer and sweeter and accumulate an array of organoleptic compounds. Since the physiological and biochemical makeup of grape berries at harvest has a profound impact on the characteristics of wine, there is great interest in characterising the molecular and biophysical changes that occur from flowering through veraison and ripening, including the coordination and temporal regulation of metabolic gene pathways. Advances in deep-sequencing technologies, combined with the availability of increasingly accurate V. vinifera genomic and transcriptomic data, have enabled us to carry out RNA-transcript expression analysis on a global scale at key points during berry development. Results A total of 162 million 100-base pair reads were generated from pooled Vitis vinifera (cv. Shiraz) berries sampled at 3-weeks post-anthesis, 10- and 11-weeks post-anthesis (corresponding to early and late veraison) and at 17-weeks post-anthesis (harvest). Mapping reads from each developmental stage (36-45 million) onto the NCBI RefSeq transcriptome of 23,720 V. vinifera mRNAs revealed that at least 75% of these transcripts were detected in each sample. RNA-Seq analysis uncovered 4,185 transcripts that were significantly upregulated at a single developmental stage, including 161 transcription factors. Clustering transcripts according to distinct patterns of transcription revealed coordination in metabolic pathways such as organic acid, stilbene and terpenoid metabolism. From the phenylpropanoid/stilbene biosynthetic pathway at least 46 transcripts were upregulated in ripe berries when compared to veraison and immature berries, and 12 terpene synthases were predominantly detected only in a single sample. Quantitative real-time PCR was used to validate the expression pattern of 12

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Gut Microbiome Developmental Patterns in Early Life of Preterm Infants: Impacts of Feeding and Gender

PubMed Central

Xu, Wanli; Janton, Susan; Henderson, Wendy A.; Matson, Adam; McGrath, Jacqueline M.; Maas, Kendra; Graf, Joerg

2016-01-01

Gut microbiota plays a key role in multiple aspects of human health and disease, particularly in early life. Distortions of the gut microbiota have been found to correlate with fatal diseases in preterm infants, however, developmental patterns of gut microbiome and factors affecting the colonization progress in preterm infants remain unclear. The purpose of this prospective longitudinal study was to explore day-to-day gut microbiome patterns in preterm infants during their first 30 days of life in the neonatal intensive care unit (NICU) and investigate potential factors related to the development of the infant gut microbiome. A total of 378 stool samples were collected daily from 29 stable/healthy preterm infants. DNA extracted from stool was used to sequence the V4 region of the 16S rRNA gene region for community analysis. Operational taxonomic units (OTUs) and α-diversity of the community were determined using QIIME software. Proteobacteria was the most abundant phylum, accounting for 54.3% of the total reads. Result showed shift patterns of increasing Clostridium and Bacteroides, and decreasing Staphylococcus and Haemophilus over time during early life. Alpha-diversity significantly increased daily in preterm infants after birth and linear mixed-effects models showed that postnatal days, feeding types and gender were associated with the α-diversity, p< 0.05–0.01. Male infants were found to begin with a low α-diversity, whereas females tended to have a higher diversity shortly after birth. Female infants were more likely to have higher abundance of Clostridiates, and lower abundance of Enterobacteriales than males during early life. Infants fed mother’s own breastmilk (MBM) had a higher diversity of gut microbiome and significantly higher abundance in Clostridiales and Lactobacillales than infants fed non-MBM. Permanova also showed that bacterial compositions were different between males and females and between MBM and non-MBM feeding types. In conclusion

Gut Microbiome Developmental Patterns in Early Life of Preterm Infants: Impacts of Feeding and Gender.

PubMed

Cong, Xiaomei; Xu, Wanli; Janton, Susan; Henderson, Wendy A; Matson, Adam; McGrath, Jacqueline M; Maas, Kendra; Graf, Joerg

2016-01-01

Gut microbiota plays a key role in multiple aspects of human health and disease, particularly in early life. Distortions of the gut microbiota have been found to correlate with fatal diseases in preterm infants, however, developmental patterns of gut microbiome and factors affecting the colonization progress in preterm infants remain unclear. The purpose of this prospective longitudinal study was to explore day-to-day gut microbiome patterns in preterm infants during their first 30 days of life in the neonatal intensive care unit (NICU) and investigate potential factors related to the development of the infant gut microbiome. A total of 378 stool samples were collected daily from 29 stable/healthy preterm infants. DNA extracted from stool was used to sequence the V4 region of the 16S rRNA gene region for community analysis. Operational taxonomic units (OTUs) and α-diversity of the community were determined using QIIME software. Proteobacteria was the most abundant phylum, accounting for 54.3% of the total reads. Result showed shift patterns of increasing Clostridium and Bacteroides, and decreasing Staphylococcus and Haemophilus over time during early life. Alpha-diversity significantly increased daily in preterm infants after birth and linear mixed-effects models showed that postnatal days, feeding types and gender were associated with the α-diversity, p< 0.05-0.01. Male infants were found to begin with a low α-diversity, whereas females tended to have a higher diversity shortly after birth. Female infants were more likely to have higher abundance of Clostridiates, and lower abundance of Enterobacteriales than males during early life. Infants fed mother's own breastmilk (MBM) had a higher diversity of gut microbiome and significantly higher abundance in Clostridiales and Lactobacillales than infants fed non-MBM. Permanova also showed that bacterial compositions were different between males and females and between MBM and non-MBM feeding types. In conclusion

Young Children with Developmental Delays as Young Adults: Predicting Developmental and Personal-Social Outcomes

ERIC Educational Resources Information Center

Bernheimer, Lucinda P.; Keogh, Barbara K.; Guthrie, Donald

2006-01-01

We report on a 20-year follow-up of 30 children with developmental delays identified at age 3. Our purpose was to assess the relationship of early indicators of delay to cognitive and personal-social status in young adulthood. Predictors were Developmental and Personal-Social factors derived from standardized tests and parent questionnaires…

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

PubMed

Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

2002-07-26

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

CHEMICAL PRIORITIZATION FOR DEVELOPMENTAL ...

EPA Pesticide Factsheets

Defining a predictive model of developmental toxicity from in vitro and high-throughput screening (HTS) assays can be limited by the availability of developmental defects data. ToxRefDB (www.epa.gov/ncct/todrefdb) was built from animal studies on data-rich environmental chemicals, and has been used as an anchor for predictive modeling of ToxCast™ data. Scaling to thousands of untested chemicals requires another approach. ToxPlorer™ was developed as a tool to query and extract specific facts about defined biological entities from the open scientific literature and to coherently synthesize relevant knowledge about relationships, pathways and processes in toxicity. Here, we investigated the specific application of ToxPlorer to weighting HTS assay targets for relevance to developmental defects as defined in the literature. First, we systemically analyzed 88,193 Pubmed abstracts selected by bulk query using harmonized terminology for 862 developmental endpoints (www.devtox.net) and 364,334 dictionary term entities in our VT-KB (virtual tissues knowledgebase). We specifically focused on entities corresponding to genes/proteins mapped across of >500 ToxCast HTS assays. The 88,193 devtox abstracts mentioned 244 gene/protein entities in an aggregated total of ~8,000 occurrences. Each of the 244 assays was scored and weighted by the number of devtox articles and relevance to developmental processes. This score was used as a feature for chemical prioritization by Toxic

Dynamic changes in the interchromosomal interaction of early histone gene loci during development of sea urchin.

PubMed

Matsushita, Masaya; Ochiai, Hiroshi; Suzuki, Ken-Ichi T; Hayashi, Sayaka; Yamamoto, Takashi; Awazu, Akinori; Sakamoto, Naoaki

2017-12-15

The nuclear positioning and chromatin dynamics of eukaryotic genes are closely related to the regulation of gene expression, but they have not been well examined during early development, which is accompanied by rapid cell cycle progression and dynamic changes in nuclear organization, such as nuclear size and chromatin constitution. In this study, we focused on the early development of the sea urchin Hemicentrotus pulcherrimus and performed three-dimensional fluorescence in situ hybridization of gene loci encoding early histones (one of the types of histone in sea urchin). There are two non-allelic early histone gene loci per sea urchin genome. We found that during the morula stage, when the early histone gene expression levels are at their maximum, interchromosomal interactions were often formed between the early histone gene loci on separate chromosomes and that the gene loci were directed to locate to more interior positions. Furthermore, these interactions were associated with the active transcription of the early histone genes. Thus, such dynamic interchromosomal interactions may contribute to the efficient synthesis of early histone mRNA during the morula stage of sea urchin development. © 2017. Published by The Company of Biologists Ltd.

Full Transcriptome Analysis of Early Dorsoventral Patterning in Zebrafish

PubMed Central

Horváth, Balázs; Molnár, János; Nagy, István; Tóth, Gábor; Wilson, Stephen W.; Varga, Máté

2013-01-01

Understanding the molecular interactions that lead to the establishment of the major body axes during embryogenesis is one of the main goals of developmental biology. Although the past two decades have revolutionized our knowledge about the genetic basis of these patterning processes, the list of genes involved in axis formation is unlikely to be complete. In order to identify new genes involved in the establishment of the dorsoventral (DV) axis during early stages of zebrafish embryonic development, we employed next generation sequencing for full transcriptome analysis of normal embryos and embryos lacking overt DV pattern. A combination of different statistical approaches yielded 41 differentially expressed candidate genes and we confirmed by in situ hybridization the early dorsal expression of 32 genes that are transcribed shortly after the onset of zygotic transcription. Although promoter analysis of the validated genes suggests no general enrichment for the binding sites of early acting transcription factors, most of these genes carry “bivalent” epigenetic histone modifications at the time when zygotic transcription is initiated, suggesting a “poised” transcriptional status. Our results reveal some new candidates of the dorsal gene regulatory network and suggest that a plurality of the earliest upregulated genes on the dorsal side have a role in the modulation of the canonical Wnt pathway. PMID:23922899

Developmental Regulation of Genes Encoding Universal Stress Proteins in Schistosoma mansoni

PubMed Central

Isokpehi, Raphael D.; Mahmud, Ousman; Mbah, Andreas N.; Simmons, Shaneka S.; Avelar, Lívia; Rajnarayanan, Rajendram V.; Udensi, Udensi K.; Ayensu, Wellington K.; Cohly, Hari H.; Brown, Shyretha D.; Dates, Centdrika R.; Hentz, Sonya D.; Hughes, Shawntae J.; Smith-McInnis, Dominique R.; Patterson, Carvey O.; Sims, Jennifer N.; Turner, Kelisha T.; Williams, Baraka S.; Johnson, Matilda O.; Adubi, Taiwo; Mbuh, Judith V.; Anumudu, Chiaka I.; Adeoye, Grace O.; Thomas, Bolaji N.; Nashiru, Oyekanmi; Oliveira, Guilherme

2011-01-01

The draft nuclear genome sequence of the snail-transmitted, dimorphic, parasitic, platyhelminth Schistosoma mansoni revealed eight genes encoding proteins that contain the Universal Stress Protein (USP) domain. Schistosoma mansoni is a causative agent of human schistosomiasis, a severe and debilitating Neglected Tropical Disease (NTD) of poverty, which is endemic in at least 76 countries. The availability of the genome sequences of Schistosoma species presents opportunities for bioinformatics and genomics analyses of associated gene families that could be targets for understanding schistosomiasis ecology, intervention, prevention and control. Proteins with the USP domain are known to provide bacteria, archaea, fungi, protists and plants with the ability to respond to diverse environmental stresses. In this research investigation, the functional annotations of the USP genes and predicted nucleotide and protein sequences were initially verified. Subsequently, sequence clusters and distinctive features of the sequences were determined. A total of twelve ligand binding sites were predicted based on alignment to the ATP-binding universal stress protein from Methanocaldococcus jannaschii. In addition, six USP sequences showed the presence of ATP-binding motif residues indicating that they may be regulated by ATP. Public domain gene expression data and RT-PCR assays confirmed that all the S. mansoni USP genes were transcribed in at least one of the developmental life cycle stages of the helminth. Six of these genes were up-regulated in the miracidium, a free-swimming stage that is critical for transmission to the snail intermediate host. It is possible that during the intra-snail stages, S. mansoni gene transcripts for universal stress proteins are low abundant and are induced to perform specialized functions triggered by environmental stressors such as oxidative stress due to hydrogen peroxide that is present in the snail hemocytes. This report serves to catalyze the

DEVELOPMENTAL DIVERSITY OF AMPHIBIANS

PubMed Central

Elinson, Richard P.; del Pino, Eugenia M.

2011-01-01

The current model amphibian, Xenopus laevis, develops rapidly in water to a tadpole which metamorphoses into a frog. Many amphibians deviate from the X. laevis developmental pattern. Among other adaptations, their embryos develop in foam nests on land or in pouches on their mother’s back or on a leaf guarded by a parent. The diversity of developmental patterns includes multinucleated oogenesis, lack of RNA localization, huge non-pigmented eggs, and asynchronous, irregular early cleavages. Variations in patterns of gastrulation highlight the modularity of this critical developmental period. Many species have eliminated the larva or tadpole and directly develop to the adult. The wealth of developmental diversity among amphibians coupled with the wealth of mechanistic information from X. laevis permit comparisons that provide deeper insights into developmental processes. PMID:22662314

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance.

PubMed

Rath, Martin F; Rohde, Kristian; Klein, David C; Møller, Morten

2013-06-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell.

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance

PubMed Central

Rath, Martin F.; Rohde, Kristian; Klein, David C.; Møller, Morten

2012-01-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell. PMID:23076630

Large-scale gene expression profiling data for the model moss Physcomitrella patens aid understanding of developmental progression, culture and stress conditions.

PubMed

Hiss, Manuel; Laule, Oliver; Meskauskiene, Rasa M; Arif, Muhammad A; Decker, Eva L; Erxleben, Anika; Frank, Wolfgang; Hanke, Sebastian T; Lang, Daniel; Martin, Anja; Neu, Christina; Reski, Ralf; Richardt, Sandra; Schallenberg-Rüdinger, Mareike; Szövényi, Peter; Tiko, Theodhor; Wiedemann, Gertrud; Wolf, Luise; Zimmermann, Philip; Rensing, Stefan A

2014-08-01

The moss Physcomitrella patens is an important model organism for studying plant evolution, development, physiology and biotechnology. Here we have generated microarray gene expression data covering the principal developmental stages, culture forms and some environmental/stress conditions. Example analyses of developmental stages and growth conditions as well as abiotic stress treatments demonstrate that (i) growth stage is dominant over culture conditions, (ii) liquid culture is not stressful for the plant, (iii) low pH might aid protoplastation by reduced expression of cell wall structure genes, (iv) largely the same gene pool mediates response to dehydration and rehydration, and (v) AP2/EREBP transcription factors play important roles in stress response reactions. With regard to the AP2 gene family, phylogenetic analysis and comparison with Arabidopsis thaliana shows commonalities as well as uniquely expressed family members under drought, light perturbations and protoplastation. Gene expression profiles for P. patens are available for the scientific community via the easy-to-use tool at https://www.genevestigator.com. By providing large-scale expression profiles, the usability of this model organism is further enhanced, for example by enabling selection of control genes for quantitative real-time PCR. Now, gene expression levels across a broad range of conditions can be accessed online for P. patens. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Thermally induced chronic developmental stress in coho salmon: Integrating measures of mortality, early growth and fluctuating asymmetry

USGS Publications Warehouse

Campbell, W.B.; Emlen, J.M.; Hershberger, W.K.

1998-01-01

Developmental stability, or homeostasis, facilitates the production of consistent phenotypes by buffering against stress. Fluctuating asymmetry is produced by developmental instability and is manifested as small random departures from bilateral symmetry. Increased fluctuating asymmetry is thought to parallel compromised fitness, in part, because stress promotes energy dissipation. Compensatory energy expenditures within the organism are required to complete development, thus promoting instability through reductions in homeostasis. Increased heterozygosity may enhance developmental stability by reducing energy dissipation from stress through increased metabolic efficiency, possibly by providing greater flexibility in metabolic pathways. Traditionally, fluctuating asymmetry has been used as a bioindicator of chronic stress, provided that selective mortality of less fit individuals did not reduce stress-mediated increases in fluctuating asymmetry to background levels produced by natural developmental error, or create data inconsistencies such as higher asymmetry in groups exposed to lower stress. Unfortunately, absence of selective mortality and its effects, while often assumed, can be difficult to substantiate. We integrated measures of early growth, mortality, fluctuating asymmetry (mandibular pores, pectoral finrays, pelvic finrays, and gillrakers on the upper and lower arms of the first branchial arch) and directional asymmetry (branchiostegal rays) to assess chronic thermal stress (fluctuating temperatures as opposed to ambient temperatures) in developing eggs from two different coho salmon (Oncorhynchus kisutch) stocks and their reciprocal hybrids. Hybridization provided insight on the capacity of heterozygosity to reduce stress during development. Although egg losses were consistently higher in crosses exposed to fluctuating temperatures, egg mortality was predominantly a function of maternal stock of origin. Post-hatch losses were higher in crosses exposed to

Early-postnatal changes in adiposity and lipids profile by transgenerational developmental programming in swine with obesity/leptin resistance.

PubMed

Gonzalez-Bulnes, Antonio; Astiz, Susana; Ovilo, Cristina; Lopez-Bote, Clemente J; Sanchez-Sanchez, Raul; Perez-Solana, Maria L; Torres-Rovira, Laura; Ayuso, Miriam; Gonzalez, Jorge

2014-10-01

Maternal malnutrition during pregnancy, both deficiency and excess, induces changes in the intrauterine environment and the metabolic status of the offspring, playing a key role in the growth, status of fitness/obesity and appearance of metabolic disorders during postnatal life. There is increasing evidence that these effects may not be only limited to the first generation of descendants, the offspring directly exposed to metabolic challenges, but to subsequent generations. This study evaluated, in a swine model of obesity/leptin resistance, the existence and extent of transgenerational developmental programming effects. Pre- and postnatal development, adiposity and metabolic features were assessed in the second generation of piglets, descendant of sows exposed to either undernutrition or overnutrition during pregnancy. The results indicated that these piglets exhibited early-postnatal increases in adiposity and disturbances in lipid profiles compatible with the early prodrome of metabolic syndrome, with liver tissue also displaying evidence of paediatric liver disease. These features indicative of early-life metabolic disorders were more evident in the males that were descended from overfed grandmothers and during the transition from milk to solid feeding. Thus, this study provides evidence supporting transgenerational developmental programming and supports the necessity for the development of strategies for avoiding the current epidemics of childhood overweight and obesity. © 2014 Society for Endocrinology.

Developmental Constraints in a Wild Primate

PubMed Central

Lea, Amanda J.; Altmann, Jeanne; Alberts, Susan C.; Tung, Jenny

2015-01-01

Early-life experiences can dramatically affect adult traits. However, the evolutionary origins of such early-life effects are debated. The predictive adaptive response hypothesis argues that adverse early environments prompt adaptive phenotypic adjustments that prepare animals for similar challenges in adulthood. In contrast, the developmental constraints hypothesis argues that early adversity is generally costly. To differentiate between these hypotheses, we studied two sets of wild female baboons: those born during low-rainfall, low-quality years and those born during normal-rainfall, high-quality years. For each female, we measured fertility-related fitness components during years in adulthood that matched and mismatched her early conditions. We found support for the developmental constraints hypothesis: females born in low-quality environments showed greater decreases in fertility during drought years than females born in high-quality environments, even though drought years matched the early conditions of females born in low-quality environments. Additionally, we found that females born in low-quality years to high-status mothers did not experience reduced fertility during drought years. These results indicate that early ecological adversity did not prepare individuals to cope with ecological challenges in later life. Instead, individuals that experienced at least one high-quality early environment—either ecological or social—were more resilient to ecological stress in later life. Together, these data suggest that early adversity carries lifelong costs, which is consistent with the developmental constraints hypothesis. PMID:25996865

Developmental Regulation of Diacylglycerol Acyltransferase Family Gene Expression in Tung Tree Tissues

PubMed Central

Cao, Heping; Shockey, Jay M.; Klasson, K. Thomas; Chapital, Dorselyn C.; Mason, Catherine B.; Scheffler, Brian E.

2013-01-01

Diacylglycerol acyltransferases (DGAT) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes. We previously cloned DGAT1 and DGAT2 genes of tung tree (Vernicia fordii), whose novel seed TAGs are useful in a wide range of industrial applications. The objective of this study was to understand the developmental regulation of DGAT family gene expression in tung tree. To this end, we first cloned a tung tree gene encoding DGAT3, a putatively soluble form of DGAT that possesses 11 completely conserved amino acid residues shared among 27 DGAT3s from 19 plant species. Unlike DGAT1 and DGAT2 subfamilies, DGAT3 is absent from animals. We then used TaqMan and SYBR Green quantitative real-time PCR, along with northern and western blotting, to study the expression patterns of the three DGAT genes in tung tree tissues. Expression results demonstrate that 1) all three isoforms of DGAT genes are expressed in developing seeds, leaves and flowers; 2) DGAT2 is the major DGAT mRNA in tung seeds, whose expression profile is well-coordinated with the oil profile in developing tung seeds; and 3) DGAT3 is the major form of DGAT mRNA in tung leaves, flowers and immature seeds prior to active tung oil biosynthesis. These results suggest that DGAT2 is probably the major TAG biosynthetic isoform in tung seeds and that DGAT3 gene likely plays a significant role in TAG metabolism in other tissues. Therefore, DGAT2 should be a primary target for tung oil engineering in transgenic organisms. PMID:24146944

Developmental neurogenetics and neuro-ophthalmology.

PubMed

Bennett, Jeffrey L

2002-12-01

The field of developmental neurogenetics has burgeoned over the past decade. Through the combined efforts of developmental biologists, geneticists, and clinicians, genetic defects resulting in neuro-ophthalmic disorders such as holoprosencephaly, microphthalmia, dominant optic atrophy, and optic nerve colobomas have been identified and characterized at the molecular level. Experimental studies in model organisms are continuing to identify novel genes critical for ocular and central nervous system development. Mutations in some of these genes have revealed a spectrum of pathology similar to that observed in septo-optic dysplasia, Möebius syndrome, and Duane retraction syndrome. This review examines our current knowledge of the molecular genetics of neuro-ophthalmic disease and focuses on several candidate genes for afferent and efferent visual system disorders.

Studying Individual Plant AOX Gene Functionality in Early Growth Regulation: A New Approach.

PubMed

Arnholdt-Schmitt, Birgit; Patil, Vinod Kumar

2017-01-01

AOX1 and AOX2 genes are thought to play different physiological roles. Whereas AOX1 is typically expected to associate to stress and growth responses, AOX2 was more often found to be linked to development and housekeeping functions. However, this view is questioned by several adverse observations. For example, co-regulated expression for DcAOX1 and DcAOX2a genes was recently reported during growth induction in carrot (Daucus carota L.). Early expression peaks for both genes during the lag phase of growth coincided with a critical time point for biomass prediction, a result achieved by applying calorespirometry. The effect of both AOX family member genes cannot easily be separated. However, separate functional analysis is required in order to identify important gene-specific polymorphisms or patterns of polymorphisms for functional marker development and its use in breeding. Specifically, a methodology is missing that enables studying functional effects of individual genes or polymorphisms/polymorphic patterns on early growth regulation.This protocol aims to provide the means for identifying plant alternative oxidase (AOX) gene variants as functional markers for early growth regulation. Prerequisite for applying this protocol is available Schizosaccharomyces pombe strains that were transformed with individual AOX genes following published protocols from Anthony Moore's group (Albury et al., J Biol Chem 271:17062-17066, 1996; Affourtit et al., J Biol Chem 274:6212-6218, 1999). The novelty of the present protocol comes by modifying yeast cell densities in a way that allows studying critical qualitative and quantitative effects of AOX gene variants (isoenzymes or polymorphic genes) during the early phase of growth. Calorimetry is used as a novel tool to confirm differences obtained by optical density measurements in early growth regulation by metabolic phenotyping (released heat rates). This protocol enables discriminating between AOX genes that inhibit growth and

Ciona intestinalis as a Marine Model System to Study Some Key Developmental Genes Targeted by the Diatom-Derived Aldehyde Decadienal

PubMed Central

Lettieri, Anna; Esposito, Rosaria; Ianora, Adrianna; Spagnuolo, Antonietta

2015-01-01

The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes) induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD) using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes. PMID:25789602

Identification and Characterization of Candidate Chemosensory Gene Families from Spodoptera exigua Developmental Transcriptomes

PubMed Central

Liu, Nai-Yong; Zhang, Ting; Ye, Zhan-Feng; Li, Fei; Dong, Shuang-Lin

2015-01-01

Insect chemosensory genes have been considered as potential molecular targets to develop alternative strategies for pest control. However, in Spodoptera exigua, a seriously polyphagous agricultural pest, only a small part of such genes have been identified and characterized to date. Here, using a bioinformatics screen a total of 79 chemosensory genes were identified from a public transcriptomic data of different developmental stages (eggs, 1st to 5th instar larvae, pupae, female and male adults), including 34 odorant binding proteins (OBPs), 20 chemosensory proteins (CSPs), 22 chemosensory receptors (10 odorant receptors (ORs), six gustatory receptors (GRs) and six ionotropic receptors (IRs)) and three sensory neuron membrane proteins (SNMPs). Notably, a new group of lepidopteran SNMPs (SNMP3 group) was found for the first time in S. exigua, and confirmed in four other moth species. Further, reverse transcription PCR (RT-PCR) and quantitative real time PCR (qPCR) were employed respectively to validate the sequences and determine the expression patterns of 69 identified chemosensory genes regarding to sexes, tissues and stages. Results showed that 67 of these genes could be detected and reconstructed in at least one tissue tested. Further, 60 chemosensory genes were expressed in adult antennae and 52 in larval heads with the antennae, whereas over half of the genes were also detected in non-olfactory tissues like egg and thorax. Particularly, S. exigua OBP2 showed a predominantly larval head-biased expression, and functional studies further indicated its potentially olfactory roles in guiding food searching of larvae. This work suggests functional diversities of S. exigua chemosensory genes and could greatly facilitate the understanding of olfactory system in S. exigua and other lepidopteran species. PMID:26221071

Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

PubMed

Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

2018-06-01

Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

Teaching the Standards Is Developmentally Appropriate Practice: Strategies for Incorporating the Sociopolitical Dimension of DAP in Early Childhood Teaching

ERIC Educational Resources Information Center

Goldstein, Lisa S.

2008-01-01

Many early childhood practitioners in the U.S. are experiencing tension between their desire to offer students developmentally appropriate learning experiences and their obligation to teach the academic knowledge and skills mandated by their states. However, careful examination of the DAP guidelines' definition of culturally appropriate practice…

Preservice Early Childhood Educators' and Elementary Teachers' Perspectives on Including Young Children with Developmental Disabilities: A Mixed Methods Analysis

ERIC Educational Resources Information Center

Frankel, Elaine B.; Hutchinson, Nancy L.; Burbidge, Julie; Minnes, Patricia

2014-01-01

This mixed methods study reports on the perspectives of 143 preservice early childhood educators (ECE) and 208 elementary teacher candidates (TC) on teaching children with developmental disabilities and delays (DDD) in inclusive classrooms. A questionnaire was administered which included items on demographic characteristics, experience, knowledge,…

Missing the Boat with Technology Usage in Early Childhood Settings: A 21st Century View of Developmentally Appropriate Practice

ERIC Educational Resources Information Center

Parette, Howard P.; Quesenberry, Amanda C.; Blum, Craig

2010-01-01

Technology use permeates virtually all aspects of twenty-first century society, though its integration in early childhood settings and recognition as a developmentally appropriate practice remains problematic. A position is taken that education professionals may be "missing the boat" by not embracing technology usage as a developmentally…

Early Blindness Results in Developmental Plasticity for Auditory Motion Processing within Auditory and Occipital Cortex

PubMed Central

Jiang, Fang; Stecker, G. Christopher; Boynton, Geoffrey M.; Fine, Ione

2016-01-01

Early blind subjects exhibit superior abilities for processing auditory motion, which are accompanied by enhanced BOLD responses to auditory motion within hMT+ and reduced responses within right planum temporale (rPT). Here, by comparing BOLD responses to auditory motion in hMT+ and rPT within sighted controls, early blind, late blind, and sight-recovery individuals, we were able to separately examine the effects of developmental and adult visual deprivation on cortical plasticity within these two areas. We find that both the enhanced auditory motion responses in hMT+ and the reduced functionality in rPT are driven by the absence of visual experience early in life; neither loss nor recovery of vision later in life had a discernable influence on plasticity within these areas. Cortical plasticity as a result of blindness has generally be presumed to be mediated by competition across modalities within a given cortical region. The reduced functionality within rPT as a result of early visual loss implicates an additional mechanism for cross modal plasticity as a result of early blindness—competition across different cortical areas for functional role. PMID:27458357

The presence of MWCNTs reduces developmental toxicity of PFOS in early life stage of zebrafish.

PubMed

Wang, Shutao; Zhuang, Changlu; Du, Jia; Wu, Chuan; You, Hong

2017-03-01

Both carbon nanotubes (CNTs) and perfluorooctane sulfonate (PFOS) are used widely. There is considerable concern regarding their ecotoxicity. CNTs might interact with PFOS in water and result in different impacts compared with those after single exposures. To our knowledge, the developmental toxicity of PFOS in the presence of multi-walled carbon nanotubes (MWCNTs) in the early life stage of zebrafish (from 3 h post fertilization (hpf) to 96 hpf) was investigated for the first time in this study. The embryos and larvae were exposed to PFOS (0.2, 0.4, 0.8, and 1.6 mg/L), MWCNTs (50 mg/L), and a mixture of both. Compared with PFOS exposure, the adverse effects induced by PFOS on the hatching rate of zebrafish embryos and the heart rate and body length of zebrafish larvae were reduced in the presence of MWCNTs, and mortality and malformation were also alleviated. In addition, zebrafish larvae exposed to PFOS showed decreased activities of superoxide dismutase, catalase, and glutathione peroxidase, as well as decreased levels of reactive oxygen species and malondialdehyde, in the presence of MWCNTs, indicating that oxidative stress and lipid peroxidation was relieved. Thus, the presence of MWCNTs reduces the developmental toxicity of PFOS in the early life stage of zebrafish. Copyright © 2016 Elsevier Ltd. All rights reserved.

An early ethylene up-regulated gene encoding a calmodulin-binding protein involved in plant senescence and death

NASA Technical Reports Server (NTRS)

Yang, T.; Poovaiah, B. W.

2000-01-01

35S-Labeled calmodulin (CaM) was used to screen a tobacco anther cDNA library. A positive clone (NtER1) with high homology to an early ethylene-up-regulated gene (ER66) in tomato, and an Arabidopsis homolog was isolated and characterized. Based on the helical wheel projection, a 25-mer peptide corresponding to the predicted CaM-binding region of NtER1 (amino acids 796-820) was synthesized. The gel-mobility shift assay showed that the peptide formed a stable complex with CaM only in the presence of Ca(2+). CaM binds to NtER1 with high affinity (K(d) approximately 12 nm) in a calcium-dependent manner. Tobacco flowers at different stages of development were treated with ethylene or with 1-methylcyclopropene for 2 h before treating with ethylene. Northern analysis showed that the NtER1 was rapidly induced after 15 min of exposure to ethylene. However, the 2-h 1-methylcyclopropene treatment totally blocked NtER1 expression in flowers at all stages of development, suggesting that NtER1 is an early ethylene-up-regulated gene. The senescing leaves and petals had significantly increased NtER1 induction as compared with young leaves and petals, implying that NtER1 is developmentally regulated and acts as a trigger for senescence and death. This is the first documented evidence for the involvement of Ca(2+)/CaM-mediated signaling in ethylene action.

Early gene expression during natural spinal cord regeneration in the salamander Ambystoma mexicanum.

PubMed

Monaghan, James R; Walker, John A; Page, Robert B; Putta, Srikrishna; Beachy, Christopher K; Voss, S Randal

2007-04-01

In contrast to mammals, salamanders have a remarkable ability to regenerate their spinal cord and recover full movement and function after tail amputation. To identify genes that may be associated with this greater regenerative ability, we designed an oligonucleotide microarray and profiled early gene expression during natural spinal cord regeneration in Ambystoma mexicanum. We sampled tissue at five early time points after tail amputation and identified genes that registered significant changes in mRNA abundance during the first 7 days of regeneration. A list of 1036 statistically significant genes was identified. Additional statistical and fold change criteria were applied to identify a smaller list of 360 genes that were used to describe predominant expression patterns and gene functions. Our results show that a diverse injury response is activated in concert with extracellular matrix remodeling mechanisms during the early acute phase of natural spinal cord regeneration. We also report gene expression similarities and differences between our study and studies that have profiled gene expression after spinal cord injury in rat. Our study illustrates the utility of a salamander model for identifying genes and gene functions that may enhance regenerative ability in mammals.

Impact of early developmental fluoride exposure on the peripheral pain sensitivity in mice.

PubMed

Ma, Jing; Liu, Fei; Liu, Peng; Dong, Ying-Ying; Chu, Zheng; Hou, Tie-Zhou; Dang, Yong-Hui

2015-12-01

Consumption of high concentration of fluoride in the drinking water would cause the fluorosis and chronic pain. Similar pain syndrome appeared in the patients in fluoride therapy of osteoporotic. The aim of the current study was to examine whether exposing immature mice to fluoride would modify the peripheral pain sensitivity or even cause a pain syndrome. We gave developmental fluoride exposure to mice in different concentration (0mg/L, 50mg/L and 100mg/L) and evaluated their basal pain threshold. Von Frey hair test, hot plate test and formalin test were conducted to examine the mechanical, thermal nociceptive threshold and inflammatory pain, respectively. In addition, the expression of hippocampal brain-derived neurotrophic factor (BDNF) was also evaluated by Western blotting. Hyperalgesia in fluoride exposure mice was exhibited in the Von Frey hair test, hot plate test and formalin test. Meanwhile, the expression of BDNF was significantly higher than that of control group. The results suggest that early developmental fluoride exposure may lower the basal pain threshold and be associated with the increasing of BDNF expression in hippocampus. Copyright © 2015 Elsevier Ltd. All rights reserved.

Strong early seed-specific gene regulatory region

DOEpatents

Broun, Pierre; Somerville, Chris

1999-01-01

Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

Strong early seed-specific gene regulatory region

DOEpatents

Broun, Pierre; Somerville, Chris

2002-01-01

Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

Developmental Trajectories of Social Skills during Early Childhood and Links to Parenting Practices in a Japanese Sample.

PubMed

Takahashi, Yusuke; Okada, Kensuke; Hoshino, Takahiro; Anme, Tokie

2015-01-01

This study used data from a nationwide survey in Japan to model the developmental course of social skills during early childhood. The goals of this study were to identify longitudinal profiles of social skills between 2 and 5 years of age using a group-based trajectory approach, and to investigate whether and to what extent parenting practices at 2 years of age predicted developmental trajectories of social skills during the preschool period. A relatively large sample of boys and girls (N > 1,000) was assessed on three social skill dimensions (Cooperation, Self-control, and Assertion) at four time points (ages 2, 3, 4, and 5), and on four parenting practices (cognitive and emotional involvement, avoidance of restriction and punishment, social stimulation, and social support for parenting) at age 2. The results indicated that for each social skill dimension, group-based trajectory models identified three distinct trajectories: low, moderate, and high. Multinomial regression analysis revealed that parenting practice variables showed differential contributions to development of child social skills. Specifically, Cooperation and Assertion were promoted by cognitive and emotional involvement, Self-control by social stimulation, and Assertion by avoidance of restriction and punishment. Abundant social support for parenting was not associated with higher child social skills trajectories. We found heterogeneity in developmental profiles of social skills during the preschool ages, and we identified parenting practices that contributed to different patterns of social skills development. We discussed the implications of higher-quality parenting practices on the improvement of child social skills across early childhood.

Developmental Trajectories of Social Skills during Early Childhood and Links to Parenting Practices in a Japanese Sample

PubMed Central

Takahashi, Yusuke; Okada, Kensuke; Hoshino, Takahiro; Anme, Tokie

2015-01-01

This study used data from a nationwide survey in Japan to model the developmental course of social skills during early childhood. The goals of this study were to identify longitudinal profiles of social skills between 2 and 5 years of age using a group-based trajectory approach, and to investigate whether and to what extent parenting practices at 2 years of age predicted developmental trajectories of social skills during the preschool period. A relatively large sample of boys and girls (N > 1,000) was assessed on three social skill dimensions (Cooperation, Self-control, and Assertion) at four time points (ages 2, 3, 4, and 5), and on four parenting practices (cognitive and emotional involvement, avoidance of restriction and punishment, social stimulation, and social support for parenting) at age 2. The results indicated that for each social skill dimension, group-based trajectory models identified three distinct trajectories: low, moderate, and high. Multinomial regression analysis revealed that parenting practice variables showed differential contributions to development of child social skills. Specifically, Cooperation and Assertion were promoted by cognitive and emotional involvement, Self-control by social stimulation, and Assertion by avoidance of restriction and punishment. Abundant social support for parenting was not associated with higher child social skills trajectories. We found heterogeneity in developmental profiles of social skills during the preschool ages, and we identified parenting practices that contributed to different patterns of social skills development. We discussed the implications of higher-quality parenting practices on the improvement of child social skills across early childhood. PMID:26267439

Developmental Programming and Endocrine Disruptor Effects on Reproductive Neuroendocrine Systems

PubMed Central

Gore, Andrea C.

2009-01-01

The ability of a species to reproduce successfully requires the careful orchestration of developmental processes during critical time points, particularly the late embryonic and early postnatal periods. This article begins with a brief presentation of the evidence for how gonadal steroid hormones exert these imprinting effects upon the morphology of sexually differentiated hypothalamic brain regions, the mechanisms underlying these effects, and their implications in adulthood. Then, I review the evidence that aberrant exposure to hormonally-active substances such as exogenous endocrine-disrupting chemicals (EDCs), may result in improper hypothalamic programming, thereby decreasing reproductive success in adulthood. The field of endocrine disruption has shed new light on the discipline of basic reproductive neuroendocrinology through studies on how early life exposures to EDCs may alter gene expression via non-genomic, epigenetic mechanisms, including DNA methylation and histone acetylation. Importantly, these effects may be transmitted to future generations if the germline is affected via transgenerational, epigenetic actions. By understanding the mechanisms by which natural hormones and xenobiotics affect reproductive neuroendocrine systems, we will gain a better understanding of normal developmental processes, as well as to develop the potential ability to intervene when development is disrupted. PMID:18394690

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Regulation of nucleosome positioning by a CHD Type III chromatin remodeler and its relationship to developmental gene expression in Dictyostelium.

PubMed

Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J

2017-04-01

Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.

The Positive Impact of Early Intervention for Children with Developmental Delays, Gestational Cocaine Exposure, and Co-Occurring Risk Factors

ERIC Educational Resources Information Center

Ullery, Mary Anne; Katz, Lynne

2017-01-01

This article examined transition rates of young children (n = 102) from an early intervention program at the Linda Ray Intervention Program (LRIP) who had documented developmental delays and co-occurring prenatal drug exposure often coupled with verified child maltreatment. Findings indicated that there was significant group improvement from…

Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

PubMed

Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

2016-12-01

To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

Exposure to mercuric chloride induces developmental damage, oxidative stress and immunotoxicity in zebrafish embryos-larvae.

PubMed

Zhang, Qun-Fang; Li, Ying-Wen; Liu, Zhi-Hao; Chen, Qi-Liang

2016-12-01

Mercury (Hg) is a widespread environmental pollutant that can produce severe negative effects on fish even at very low concentrations. However, the mechanisms underlying inorganic Hg-induced oxidative stress and immunotoxicity in the early development stage of fish still need to be clarified. In the present study, zebrafish (Danio rerio) embryos were exposed to different concentrations of Hg 2+ (0, 1, 4 and 16μg/L; added as mercuric chloride, HgCl 2 ) from 2h post-fertilization (hpf) to 168hpf. Developmental parameters and total Hg accumulation were monitored during the exposure period, and antioxidant status and the mRNA expression of genes related to the innate immune system were examined at 168hpf. The results showed that increasing Hg 2+ concentration and time significantly increased total Hg accumulation in zebrafish embryos-larvae. Exposure to 16μg/L Hg 2+ caused developmental damage, including increased mortality and malformation, decreased body length, and delayed hatching period. Meanwhile, HgCl 2 exposure (especially in the 16μg/L Hg 2+ group) induced oxidative stress affecting antioxidant enzyme (CAT, GST and GPX) activities, endogenous GSH and MDA contents, as well as the mRNA levels of genes (cat1, sod1, gstr, gpx1a, nrf2, keap1, hsp70 and mt) encoding antioxidant proteins. Moreover, the transcription levels of several representative genes (il-1β, il-8, il-10, tnfα2, lyz and c3) involved in innate immunity were up-regulated by HgCl 2 exposure, suggesting that inorganic Hg had the potential to induce immunotoxicity. Taken together, the present study provides evidence that waterborne HgCl 2 exposure can induce developmental impairment, oxidative stress and immunotoxicity in the early development stage of fish, which brings insights into the toxicity mechanisms of inorganic Hg in fish. Copyright © 2016 Elsevier B.V. All rights reserved.

Transcriptomic profile of leg muscle during early growth in chicken

PubMed Central

Zhang, Genxi; Li, Tingting; Ling, Jiaojiao; Zhang, Xiangqian; Wang, Jinyu

2017-01-01

The early growth pattern, especially the age of peak growth, of broilers affects the time to market and slaughter weight, which in turn affect the profitability of the poultry industry. However, the underlying mechanisms regulating chicken growth and development have rarely been studied. This study aimed to identify candidate genes involved in chicken growth and investigated the potential regulatory mechanisms of early growth in chicken. RNA sequencing was applied to compare the transcriptomes of chicken muscle tissues at three developmental stages during early growth. In total, 978 differentially expressed genes (DEGs) (fold change ≥ 2; false discovery rate < 0.05) were detected by pairwise comparison. Functional analysis showed that the DEGs are mainly involved in the processes of cell growth, muscle development, and cellular activities (such as junction, migration, assembly, differentiation, and proliferation). Many of the DEGs are well known to be related to chicken growth, such as MYOD1, GH, IGF2BP2, IGFBP3, SMYD1, CEBPB, FGF2, and IGFBP5. KEGG pathway analysis identified that the DEGs were significantly enriched in five pathways (P < 0.1) related to growth and development: extracellular matrix–receptor interaction, focal adhesion, tight junction, insulin signaling pathway, and regulation of the actin cytoskeleton. A total of 42 DEGs assigned to these pathways are potential candidate genes inducing the difference in growth among the three developmental stages, such as MYH10, FGF2, FGF16, FN1, CFL2, MAPK9, IRS1, PHKA1, PHKB, and PHKG1. Thus, our study identified a series of genes and several pathways that may participate in the regulation of early growth in chicken. These results should serve as an important resource revealing the molecular basis of chicken growth and development. PMID:28291821

Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

NASA Technical Reports Server (NTRS)

Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

1995-01-01

Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

Gene expression profiles reveal key genes for early diagnosis and treatment of adamantinomatous craniopharyngioma.

PubMed

Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing

2018-04-23

Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis

Developmental Toxicity of the Organic Fraction from Hydraulic Fracturing Flowback and Produced Waters to Early Life Stages of Zebrafish ( Danio rerio).

PubMed

He, Yuhe; Sun, Chenxing; Zhang, Yifeng; Folkerts, Erik J; Martin, Jonathan W; Goss, Greg G

2018-03-20

Hydraulic fracturing (HF) has emerged as a major recovery method of unconventional oil and gas reservoirs and concerns have been raised regarding the environmental impact of releases of Flowback and Produced Water (FPW) to aquatic ecosystems. To investigate potential effects of HF-FPW on fish embryo development, HF-FPW samples were collected from two different wells and the organic fractions were isolated from both aqueous and particle phases to eliminate the confounding effects of high salinity. Each organic extract was characterized by non-target analysis with HPLC-Orbitrap-MS, with targeted analysis for polycyclic aromatic hydrocarbons provided as markers of petroleum-affected water. The organic profiles differed between samples, including PAHs and alkyl PAHs, and major substances identified by non-target analysis included polyethylene glycols, alkyl ethoxylates, octylphenol ethoxylates, and other high molecular weight (C 49-79 ) ethylene oxide polymeric material. Zebrafish embryos were exposed to various concentrations of FPW organic extracts to investigate acute (7-day) and developmental toxicity in early life stages. The acute toxicity (LD 50 ) of the extracted FPW fractions ranged from 2.8× to 26× the original organic content. Each extracted FPW fraction significantly increased spinal malformation, pericardial edema, and delayed hatch in exposed embryos and altered the expression of a suite of target genes related to biotransformation, oxidative stress, and endocrine-mediation in developing zebrafish embryos. These results provide novel information on the variation of organic profiles and developmental toxicity among different sources and fractions of HF-FPWs.

Developmental decoupling of alternative phenotypes: insights from the transcriptomes of horn-polyphenic beetles

PubMed Central

Snell-Rood, Emilie C.; Cash, Amy; Han, Mira V.; Kijimoto, Teiya; Andrews, Justen; Moczek, Armin P.

2010-01-01

Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the hypothesis of developmental decoupling, where alternate morphs result from evolutionarily independent developmental pathways. We address this assumption through a microarray study that tests whether differences in gene expression between alternate morphs are as divergent as those between sexes, a classic example of developmental decoupling. We then examine whether genes with morph-biased expression are less conserved than genes with shared expression between morphs, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are to some extent developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined. PMID:20731717

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression

Developmental milestones record

MedlinePlus

... in the early years is to follow your child's development. Most parents also watch for different milestones. Talk ... child's provider if you have concerns about your child's development. Closely watching a "checklist" or calendar of developmental ...

Accelerated Evolution of Developmentally Biased Genes in the Tetraphenic Ant Cardiocondyla obscurior.

PubMed

Schrader, Lukas; Helanterä, Heikki; Oettler, Jan

2017-03-01

Plastic gene expression underlies phenotypic plasticity and plastically expressed genes evolve under different selection regimes compared with ubiquitously expressed genes. Social insects are well-suited models to elucidate the evolutionary dynamics of plastic genes for their genetically and environmentally induced discrete polymorphisms. Here, we study the evolution of plastically expressed genes in the ant Cardiocondyla obscurior-a species that produces two discrete male morphs in addition to the typical female polymorphism of workers and queens. Based on individual-level gene expression data from 28 early third instar larvae, we test whether the same evolutionary dynamics that pertain to plastically expressed genes in adults also pertain to genes with plastic expression during development. In order to quantify plasticity of gene expression over multiple contrasts, we develop a novel geometric measure. For genes expressed during development, we show that plasticity of expression is positively correlated with evolutionary rates. We furthermore find a strong correlation between expression plasticity and expression variation within morphs, suggesting a close link between active and passive plasticity of gene expression. Our results support the notion of relaxed selection and neutral processes as important drivers in the evolution of adaptive plasticity. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

PubMed

Tanaka, Akemi J; Cho, Megan T; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K; Anderson, Ilse J; Sacoto, Maria J Guillen; Schnur, Rhonda E; Chung, Wendy K

2017-11-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 ( EBF3 ) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3 . © 2017 Tanaka et al.; Published by Cold Spring Harbor Laboratory Press.

Developmentally regulated, alternative splicing of the Rpn10 gene generates multiple forms of 26S proteasomes

PubMed Central

Kawahara, Hiroyuki; Kasahara, Masanori; Nishiyama, Atsuya; Ohsumi, Keita; Goto, Tetsuya; Kishimoto, Takeo; Saeki, Yasushi; Yokosawa, Hideyoshi; Shimbara, Naoki; Murata, Shigeo; Chiba, Tomoki; Suzuki, Koichi; Tanaka, Keiji

2000-01-01

The 26S proteasome is a multisubunit protein- destroying machinery that degrades ubiquitin-tagged proteins. To date only a single species of Rpn10, which possibly functions as a multiubiquitin chain-binding subunit, has been identified in various organisms. Here we report that mouse Rpn10 mRNAs occur in at least five distinct forms, named Rpn10a to Rpn10e, and that they are generated from a single gene by developmentally regulated, alternative splicing. Rpn10a is ubiquitously expressed, whereas Rpn10e is expressed only in embryos, with the highest levels of expression in the brain. Both forms of Rpn10 are components of the 26S proteasome, with an apparently similar affinity for multiubiquitylated [125I]lysozyme in vitro. However, they exert markedly divergent effects on the destruction of B-type cyclin in Xenopus egg extracts. Thus, the 26S proteasome occurs in at least two functionally distinct forms: one containing a ubiquitously expressed Rpn10a and the other a newly identified, embryo-specific Rpn10e. While the former is thought to perform proteolysis constitutively in a wide variety of cells, the latter may play a specialized role in early embryonic development. PMID:10921894

Developmental Deltamethrin Exposure Causes Persistent Changes in Dopaminergic Gene Expression, Neurochemistry, and Locomotor Activity in Zebrafish

PubMed Central

Kung, Tiffany S.; Richardson, Jason R.; Cooper, Keith R.; White, Lori A.

2015-01-01

Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25–0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3–72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. PMID:25912032

Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

USGS Publications Warehouse

Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

2012-01-01

Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.