Science.gov

Sample records for early gene expression

  1. A gene expression atlas of early craniofacial development.

    PubMed

    Brunskill, Eric W; Potter, Andrew S; Distasio, Andrew; Dexheimer, Phillip; Plassard, Andrew; Aronow, Bruce J; Potter, S Steven

    2014-07-15

    We present a gene expression atlas of early mouse craniofacial development. Laser capture microdissection (LCM) was used to isolate cells from the principal critical microregions, whose development, differentiation and signaling interactions are responsible for the construction of the mammalian face. At E8.5, as migrating neural crest cells begin to exit the neural fold/epidermal ectoderm boundary, we examined the cranial mesenchyme, composed of mixed neural crest and paraxial mesoderm cells, as well as cells from adjacent neuroepithelium. At E9.5 cells from the cranial mesenchyme, overlying olfactory placode/epidermal ectoderm, and underlying neuroepithelium, as well as the emerging mandibular and maxillary arches were sampled. At E10.5, as the facial prominences form, cells from the medial and lateral prominences, the olfactory pit, multiple discrete regions of underlying neuroepithelium, the mandibular and maxillary arches, including both their mesenchymal and ectodermal components, as well as Rathke's pouch, were similarly sampled and profiled using both microarray and RNA-seq technologies. Further, we performed single cell studies to better define the gene expression states of the early E8.5 pioneer neural crest cells and paraxial mesoderm. Taken together, and analyzable by a variety of biological network approaches, these data provide a complementing and cross validating resource capable of fueling discovery of novel compartment specific markers and signatures whose combinatorial interactions of transcription factors and growth factors/receptors are responsible for providing the master genetic blueprint for craniofacial development. PMID:24780627

  2. A Gene Expression Atlas of Early Craniofacial Development

    PubMed Central

    Brunskill, Eric W.; Potter, Andrew S.; Distasio, Andrew; Dexheimer, Phillip; Plassard, Andrew; Aronow, Bruce J.; Potter, S. Steven

    2014-01-01

    We present a gene expression atlas of early mouse craniofacial development. Laser capture microdissection (LCM) was used to isolate cells from the principal critical micro-regions, whose development, differentiation and signaling interactions are responsible for the construction of the mammalian face. At E8.5, as migrating neural crest cells begin to exit the neural fold/epidermal ectoderm boundary, we examined the cranial mesenchyme, composed of mixed neural crest and paraxial mesoderm cells, as well as cells from adjacent neuroepithelium. At E9.5 cells from the cranial mesenchyme, overlying olfactory placode/epidermal ectoderm, and underlying neuroepithelium, as well as the emerging mandibular and maxillary arches were sampled. At E10.5, as the facial prominences form, cells from the medial and lateral prominences, the olfactory pit, multiple discrete regions of underlying neuroepithelium, the mandibular and maxillary arches, including both their mesenchymal and ectodermal components, as well as Rathke’s pouch, were similarly sampled and profiled using both microarray and RNA-seq technologies. Further, we performed single cell studies to better define the gene expression states of the early E8.5 pioneer neural crest cells and paraxial mesoderm. Taken together, and analyzable by a variety of biological network approaches, these data provide a complementing and cross-validating resource capable of fueling discovery of novel compartment specific markers and signatures whose combinatorial interactions of transcription factors and growth factors/receptors are responsible for providing the master genetic blueprint for craniofacial development. PMID:24780627

  3. Gene Expression Changes and Early Events in Cotton Fibre Development

    PubMed Central

    Lee, Jinsuk J.; Woodward, Andrew W.; Chen, Z. Jeffrey

    2007-01-01

    Background Cotton is the dominant source of natural textile fibre and a significant oil crop. Cotton fibres, produced by certain species in the genus Gossypium, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. Cotton fibre development is delineated into four distinct and overlapping developmental stages: fibre initiation, elongation, secondary wall biosynthesis and maturation. Scope Recent advances in gene expression studies are beginning to provide new insights into a better understanding of early events in cotton fibre development. Fibre cell development is a complex process involving many pathways, including various signal transduction and transcriptional regulation components. Several analyses using expressed sequence tags and microarray have identified transcripts that preferentially accumulate during fibre development. These studies, as well as complementation and overexpression experiments using cotton genes in arabidopsis and tobacco, indicate some similar molecular events between trichome development from the leaf epidermis and fibre development from the ovule epidermis. Specifically, MYB transcription factors regulate leaf trichome development in arabidopsis and may regulate seed trichome development in cotton. In addition, transcript profiling and ovule culture experiments both indicate that several phytohormones and other signalling pathways mediate cotton fibre development. Auxin and gibberellins promote early stages of fibre initiation; ethylene- and brassinosteroid-related genes are up-regulated during the fibre elongation phase; and genes associated with calmodulin and calmodulin-binding proteins are up-regulated in fibre initials. Additional genomic data, mutant and functional analyses, and genome mapping studies promise to reveal the critical factors mediating cotton fibre cell development. PMID:17905721

  4. Influence of Isoflurane on Immediate-Early Gene Expression

    PubMed Central

    Bunting, Kristopher M.; Nalloor, Rebecca I.; Vazdarjanova, Almira

    2016-01-01

    Background: Anterograde amnesia is a hallmark effect of volatile anesthetics. Isoflurane is known to affect both the translation and transcription of plasticity-associated genes required for normal memory formation in many brain regions. What is not known is whether isoflurane anesthesia prevents the initiation of transcription or whether it halts transcription already in progress. We tested the hypothesis that general anesthesia with isoflurane prevents learning-induced initiation of transcription of several memory-associated immediate-early genes (IEGs) correlated with amnesia; we also assessed whether it stops transcription initiated prior to anesthetic administration. Methods: Using a Tone Fear Conditioning paradigm, rats were trained to associate a tone with foot-shock. Animals received either no anesthesia, anesthesia immediately after training, or anesthesia before, during, and after training. Animals were either sacrificed after training or tested 24 h later for long-term memory. Using Cellular Compartment Analysis of Temporal Activity by Fluorescence in situ Hybridization (catFISH), we examined the percentage of neurons expressing the IEGs Arc/Arg3.1 and Zif268/Egr1/Ngfi-A/Krox-24 in the dorsal hippocampus, primary somatosensory cortex, and primary auditory cortex. Results: On a cellular level, isoflurane administered at high doses (general anesthesia) prevented initiation of transcription, but did not stop transcription of Arc and Zif268 mRNA initiated prior to anesthesia. On a behavioral level, the same level of isoflurane anesthesia produced anterograde amnesia for fear conditioning when administered before and during training, but did not produce retrograde amnesia when administered immediately after training. Conclusion: General anesthesia with isoflurane prevents initiation of learning-related transcription but does not stop ongoing transcription of two plasticity-related IEGs, Arc and Zif268, a pattern of disruption that parallels the effects of

  5. Early pregnancy peripheral blood gene expression and risk of preterm delivery: a nested case control study

    PubMed Central

    2009-01-01

    Background Preterm delivery (PTD) is a significant public health problem associated with greater risk of mortality and morbidity in infants and mothers. Pathophysiologic processes that may lead to PTD start early in pregnancy. We investigated early pregnancy peripheral blood global gene expression and PTD risk. Methods As part of a prospective study, ribonucleic acid was extracted from blood samples (collected at 16 weeks gestational age) from 14 women who had PTD (cases) and 16 women who delivered at term (controls). Gene expressions were measured using the GeneChip® Human Genome U133 Plus 2.0 Array. Student's T-test and fold change analysis were used to identify differentially expressed genes. We used hierarchical clustering and principle components analysis to characterize signature gene expression patterns among cases and controls. Pathway and promoter sequence analyses were used to investigate functions and functional relationships as well as regulatory regions of differentially expressed genes. Results A total of 209 genes, including potential candidate genes (e.g. PTGDS, prostaglandin D2 synthase 21 kDa), were differentially expressed. A set of these genes achieved accurate pre-diagnostic separation of cases and controls. These genes participate in functions related to immune system and inflammation, organ development, metabolism (lipid, carbohydrate and amino acid) and cell signaling. Binding sites of putative transcription factors such as EGR1 (early growth response 1), TFAP2A (transcription factor AP2A), Sp1 (specificity protein 1) and Sp3 (specificity protein 3) were over represented in promoter regions of differentially expressed genes. Real-time PCR confirmed microarray expression measurements of selected genes. Conclusions PTD is associated with maternal early pregnancy peripheral blood gene expression changes. Maternal early pregnancy peripheral blood gene expression patterns may be useful for better understanding of PTD pathophysiology and PTD risk

  6. Gene expression profiling in spleens of deoxynivalenol-exposed mice: immediate early genes as primary targets.

    PubMed

    Kinser, Shawn; Jia, Qunshan; Li, Maioxing; Laughter, Ashley; Cornwell, Paul; Corton, J Christopher; Pestka, James

    2004-09-24

    signaling, were increased, while Jun kinase 2 (JNK2) was decreased. Taken together, data suggest that DON upregulated the expression of multiple immediate early genes, many of which are likely to contribute to the complex immunological effects reported for this and other trichothecenes.

  7. Early Experiences Can Alter Gene Expression and Affect Long-Term Development. Working Paper #10

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2010

    2010-01-01

    New scientific research shows that environmental influences can actually affect whether and how genes are expressed. Thus, the old ideas that genes are "set in stone" or that they alone determine development have been disproven. In fact, scientists have discovered that early experiences can determine how genes are turned on and off and even…

  8. Differentially expressed protein-coding genes and long noncoding RNA in early-stage lung cancer.

    PubMed

    Li, Ming; Qiu, Mantang; Xu, Youtao; Mao, Qixing; Wang, Jie; Dong, Gaochao; Xia, Wenjia; Yin, Rong; Xu, Lin

    2015-12-01

    Due to the application of low-dose computed tomography screening, more and more early-stage lung cancers have been diagnosed. Thus, it is essential to characterize the gene expression profile of early-stage lung cancer to develop potential biomarkers for early diagnosis and therapeutic targets. Here, we analyzed microarray data of 181 early-stage lung cancer patients. By comparing gene expression between different tumor and lymph node metastasis stages, we identified various differentially expressed protein-coding genes and long noncoding RNA (lncRNA) in the comparisons of T2 vs. T2 and N1- vs. N0-stage lung cancer. Functional analyses revealed that these differentially expressed genes were enriched in various tumorigenesis or metastasis-related pathways. Survival analysis indicated that two protein-coding genes, C7 and SCN7A, were significantly associated survival of lung cancer. Notably, a novel lncRNA, LINC00313, was highly expressed in both T2- and N1-stage lung cancers. On the other hand, LINC00313 was also upregulated in lung cancer and metastasized lung cancer tissues, compared with adjacent lung tissues and primary lung cancer tissues. Additionally, higher expression level of LINC00313 indicated poor prognosis of lung cancer (hazard ratio = 0.658). Overall, we characterized the expression profiles of protein-coding genes and lncRNA in early-stage lung cancer and found that LINC00313 could be a biomarker for lung cancer.

  9. Genome-Wide Analysis of Gene Expression during Early Arabidopsis Flower Development

    PubMed Central

    Wellmer, Frank; Alves-Ferreira, Márcio; Dubois, Annick; Riechmann, José Luis; Meyerowitz, Elliot M

    2006-01-01

    Detailed information about stage-specific changes in gene expression is crucial for the understanding of the gene regulatory networks underlying development. Here, we describe the global gene expression dynamics during early flower development, a key process in the life cycle of a plant, during which floral patterning and the specification of floral organs is established. We used a novel floral induction system in Arabidopsis, which allows the isolation of a large number of synchronized floral buds, in conjunction with whole-genome microarray analysis to identify genes with differential expression at distinct stages of flower development. We found that the onset of flower formation is characterized by a massive downregulation of genes in incipient floral primordia, which is followed by a predominance of gene activation during the differentiation of floral organs. Among the genes we identified as differentially expressed in the experiment, we detected a significant enrichment of closely related members of gene families. The expression profiles of these related genes were often highly correlated, indicating similar temporal expression patterns. Moreover, we found that the majority of these genes is specifically up-regulated during certain developmental stages. Because co-expressed members of gene families in Arabidopsis frequently act in a redundant manner, these results suggest a high degree of functional redundancy during early flower development, but also that its extent may vary in a stage-specific manner. PMID:16789830

  10. Gene Expression Analysis for the Identification of Genes Involved in Early Tumour Development

    NASA Astrophysics Data System (ADS)

    Forte, Stefano; Scarpulla, Salvatore; Lagana, Alessandro; Memeo, Lorenzo; Gulisano, Massimo

    Prostatic tissues can undergo to cancer insurgence and prostate cancer is one of the most common types of malignancies affecting adult men in the United States. Primary adenocarcinoma of the seminal vesi-cles (SVCA) is a very rare neoplasm with only 48 histologically confirmed cases reported in the European and United States literature. Prostatic tissues, seminal vesicles and epididymis belongs all to the same microenvironment, shows a very close morphology and share the same embryological origin. Despite these common features the rate of cancer occurrence is very different. The understanding of molecular differences between non neoplastic prostatic tissues and non neoplastic epididymis or seminal vesicles may suggest potential mechanisms of resistance to tumour occurrence. The comparison of expression patterns of non neoplastic prostatic and seminal vesicles tissues to identify differentially expressed genes can help researchers in the identification of biological actors involved in the early stages of the tumour development.

  11. A new set of differentially expressed signaling genes is early expressed in coffee leaf rust race II incompatible interaction.

    PubMed

    Diola, Valdir; Brito, Giovani G; Caixeta, Eveline T; Pereira, Luiz F P; Loureiro, Marcelo E

    2013-08-01

    defense genes: early expression of signaling genes support the hypothesis that higher expression of the signaling components up regulates the defense genes identified. Additionally the increased gene expression of these two gene sets is associated with a single monogenic resistance trait to to leaf coffee rust in the interaction characterized here.

  12. Gene Expression Analyses of Subchondral Bone in Early Experimental Osteoarthritis by Microarray

    PubMed Central

    Chen, YuXian; Shen, Jun; Lu, HuaDing; Zeng, Chun; Ren, JianHua; Zeng, Hua; Li, ZhiFu; Chen, ShaoMing; Cai, DaoZhang; Zhao, Qing

    2012-01-01

    Osteoarthritis (OA) is a degenerative joint disease that affects both cartilage and bone. A better understanding of the early molecular changes in subchondral bone may help elucidate the pathogenesis of OA. We used microarray technology to investigate the time course of molecular changes in the subchondral bone in the early stages of experimental osteoarthritis in a rat model. We identified 2,234 differentially expressed (DE) genes at 1 week, 1,944 at 2 weeks and 1,517 at 4 weeks post-surgery. Further analyses of the dysregulated genes indicated that the events underlying subchondral bone remodeling occurred sequentially and in a time-dependent manner at the gene expression level. Some of the identified dysregulated genes that were identified have suspected roles in bone development or remodeling; these genes include Alp, Igf1, Tgf β1, Postn, Mmp3, Tnfsf11, Acp5, Bmp5, Aspn and Ihh. The differences in the expression of these genes were confirmed by real-time PCR, and the results indicated that our microarray data accurately reflected gene expression patterns characteristic of early OA. To validate the results of our microarray analysis at the protein level, immunohistochemistry staining was used to investigate the expression of Mmp3 and Aspn protein in tissue sections. These analyses indicate that Mmp3 protein expression completely matched the results of both the microarray and real-time PCR analyses; however, Aspn protein expression was not observed to differ at any time. In summary, our study demonstrated a simple method of separation of subchondral bone sample from the knee joint of rat, which can effectively avoid bone RNA degradation. These findings also revealed the gene expression profiles of subchondral bone in the rat OA model at multiple time points post-surgery and identified important DE genes with known or suspected roles in bone development or remodeling. These genes may be novel diagnostic markers or therapeutic targets for OA. PMID:22384228

  13. Characterization and embryonic expression of four amphioxus Frizzled genes with important functions during early embryogenesis.

    PubMed

    Qian, Guanghui; Li, Guang; Chen, Xiaoying; Wang, Yiquan

    2013-12-01

    The Wnt signaling pathway plays crucial roles in the embryonic patterning of all metazoans. Recent studies on Wnt genes in amphioxus have shed important insights into the evolution of the vertebrate Wnt gene family and their functions. Nevertheless, the potential roles of Wnt family receptors encoded by Frizzled (Fz) genes in amphioxus embryonic development remain to be investigated. In the present study, we identified four amphioxus Fz genes-AmphiFz1/2/7, AmphiFz4, AmphiFz5/8, and AmphiFz9/10-and analyzed their expression patterns during amphioxus embryogenesis. We found that these four Fz genes were maternally expressed and might be involved in early animal-vegetal axis establishment. The AmphiFz1/2/7 transcripts were detected in the central dorsal neural plate, mesoderm, the Hatschek's pit, and rim of the mouth, whereas those of AmphiFz4 were detected in the mesoderm, pharyngeal endoderm, and entire gut region. AmphiFz5/8 was exclusively expressed in the anterior-most region, whereas AmphiFz9/10 was expressed in the neural plate, somites, and tail bud. The dynamic and diverse expression patterns of amphioxus Fz genes suggest that these genes are not only associated with early embryonic axis establishment but also are involved in the development of several organs in amphioxus.

  14. Characterization and embryonic expression of four amphioxus Frizzled genes with important functions during early embryogenesis.

    PubMed

    Qian, Guanghui; Li, Guang; Chen, Xiaoying; Wang, Yiquan

    2013-12-01

    The Wnt signaling pathway plays crucial roles in the embryonic patterning of all metazoans. Recent studies on Wnt genes in amphioxus have shed important insights into the evolution of the vertebrate Wnt gene family and their functions. Nevertheless, the potential roles of Wnt family receptors encoded by Frizzled (Fz) genes in amphioxus embryonic development remain to be investigated. In the present study, we identified four amphioxus Fz genes-AmphiFz1/2/7, AmphiFz4, AmphiFz5/8, and AmphiFz9/10-and analyzed their expression patterns during amphioxus embryogenesis. We found that these four Fz genes were maternally expressed and might be involved in early animal-vegetal axis establishment. The AmphiFz1/2/7 transcripts were detected in the central dorsal neural plate, mesoderm, the Hatschek's pit, and rim of the mouth, whereas those of AmphiFz4 were detected in the mesoderm, pharyngeal endoderm, and entire gut region. AmphiFz5/8 was exclusively expressed in the anterior-most region, whereas AmphiFz9/10 was expressed in the neural plate, somites, and tail bud. The dynamic and diverse expression patterns of amphioxus Fz genes suggest that these genes are not only associated with early embryonic axis establishment but also are involved in the development of several organs in amphioxus. PMID:24012522

  15. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies

    PubMed Central

    Kosinová, Lucie; Cahová, Monika; Fábryová, Eva; Týcová, Irena; Koblas, Tomáš; Leontovyč, Ivan; Saudek, František; Kříž, Jan

    2016-01-01

    The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3) in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0–120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48–120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information from 48 hrs

  16. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

    PubMed

    Kosinová, Lucie; Cahová, Monika; Fábryová, Eva; Týcová, Irena; Koblas, Tomáš; Leontovyč, Ivan; Saudek, František; Kříž, Jan

    2016-01-01

    The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3) in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information from 48 hrs onwards.

  17. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

    PubMed

    Kosinová, Lucie; Cahová, Monika; Fábryová, Eva; Týcová, Irena; Koblas, Tomáš; Leontovyč, Ivan; Saudek, František; Kříž, Jan

    2016-01-01

    The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3) in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information from 48 hrs onwards

  18. Alarm pheromone induces immediate-early gene expression and slow behavioral response in honey bees.

    PubMed

    Alaux, Cédric; Robinson, Gene E

    2007-07-01

    Primer and releaser pheromones are molecules used for communication that induce species-specific responses. In contrast to primer pheromones, it is not known whether the quicker-acting releaser pheromones can affect brain gene expression. We show here that isopentyl acetate (IPA), a releaser pheromone that communicates alarm in honey bees, not only provokes a quick defensive response but also influences behavior for a longer period of time and affects brain gene expression. Exposure to IPA affected behavioral responsiveness to subsequent exposures to IPA and induced the expression of the immediate early gene and transcription factor c-Jun in the antennal lobes. Our findings blur the long-standing distinction between primer and releaser pheromone and highlight the pervasiveness of environmental regulation of brain gene expression. PMID:17505874

  19. Analysis on Gene Expression Profile in Oncospheres and Early Stage Metacestodes from Echinococcus multilocularis

    PubMed Central

    Dang, Zhisheng; Suzuki, Yutaka; Horiuchi, Terumi; Yagi, Kinpei; Kouguchi, Hirokazu; Irie, Takao; Kim, Kyeongsoon; Oku, Yuzaburo

    2016-01-01

    Alveolar echinococcosis is a worldwide zoonosis of great public health concern. Analysis of genome data for Echinococcus multilocularis has identified antigen families that can be used in diagnostic assays and vaccine development. However, little gene expression data is available for antigens of the egg and early larval stages. To address this information gap, we used a Next-Generation Sequencing approach to investigate three different stages (non-activated and activated oncospheres, and early stage metacestodes) of E. multilocularis (Nemuro strain). Transcriptome data analysis revealed that some diagnostic antigen gp50 isoforms and the antigen Eg95 family dominated in activated oncospheres, and the antigen B family dominated in early stage metacestodes. Furthermore, heat shock proteins and antigen II/3 are constantly expressed in the three stages. The expression pattern of various known antigens in E. multilocularis may give fundamental information for choosing candidate genes used in diagnosis and vaccine development. PMID:27092774

  20. Analysis on Gene Expression Profile in Oncospheres and Early Stage Metacestodes from Echinococcus multilocularis.

    PubMed

    Huang, Fuqiang; Dang, Zhisheng; Suzuki, Yutaka; Horiuchi, Terumi; Yagi, Kinpei; Kouguchi, Hirokazu; Irie, Takao; Kim, Kyeongsoon; Oku, Yuzaburo

    2016-04-01

    Alveolar echinococcosis is a worldwide zoonosis of great public health concern. Analysis of genome data for Echinococcus multilocularis has identified antigen families that can be used in diagnostic assays and vaccine development. However, little gene expression data is available for antigens of the egg and early larval stages. To address this information gap, we used a Next-Generation Sequencing approach to investigate three different stages (non-activated and activated oncospheres, and early stage metacestodes) of E. multilocularis (Nemuro strain). Transcriptome data analysis revealed that some diagnostic antigen gp50 isoforms and the antigen Eg95 family dominated in activated oncospheres, and the antigen B family dominated in early stage metacestodes. Furthermore, heat shock proteins and antigen II/3 are constantly expressed in the three stages. The expression pattern of various known antigens in E. multilocularis may give fundamental information for choosing candidate genes used in diagnosis and vaccine development. PMID:27092774

  1. Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

    PubMed Central

    Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

    2000-01-01

    Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

  2. EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHOLORACETC ACID

    EPA Science Inventory

    EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    Dichloroacetic acid COCA) is a major by-product ofwater disinfection by cWorination. Several
    studies have shown that DCA induces liver tumors in rodents when administered in drinkmg wate...

  3. EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    EPA Science Inventory

    EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    Dichloroacetic acid (DCA) is a major by-product of water disinfection by chlorination. Several studies have shown that DCA induces liver tumors in rodents when administered in drinking wate...

  4. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.

    PubMed

    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona

    2009-12-15

    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  5. Differential expression of CaMK-II genes during early zebrafish embryogenesis.

    PubMed

    Rothschild, Sarah C; Lister, James A; Tombes, Robert M

    2007-01-01

    CaMK-II is a highly conserved Ca(2+)/calmodulin-dependent protein kinase expressed throughout the lifespan of all vertebrates. During early development, CaMK-II regulates cell cycle progression and "non-canonical" Wnt-dependent convergent extension. In the zebrafish, Danio rerio, CaMK-II activity rises within 2 hr after fertilization. At the time of somite formation, zygotic expression from six genes (camk2a1, camk2b1, camk2g1, camk2g2, camk2d1, camk2d2) results in a second phase of increased activity. Zebrafish CaMK-II genes are 92-95% identical to their human counterparts in the non-variable regions. During the first three days of development, alternative splicing yields at least 20 splice variants, many of which are unique. Whole-mount in situ hybridization reveals that camk2g1 comprises the majority of maternal expression. All six genes are expressed strongly in ventral regions at the 18-somite stage. Later, camk2a1 is expressed in anterior somites, heart, and then forebrain. Camk2b1 is expressed in somites, mid- and forebrain, gut, retina, and pectoral fins. Camk2g1 appears strongly along the midline and then in brain, gut, and pectoral fins. Camk2g2 is expressed early in the midbrain and trunk and exhibits the earliest retinal expression. Camk2d1 is elevated early at somite boundaries, then epidermal tissue, while camk2d2 is expressed in discrete anterior locations, steadily increasing along either side of the dorsal midline and then throughout the brain, including the retina. These findings reveal a complex pattern of CaMK-II gene expression consistent with pleiotropic roles during development. PMID:17103413

  6. Pyrosequencing of Haliotis diversicolor Transcriptomes: Insights into Early Developmental Molluscan Gene Expression

    PubMed Central

    Huang, Zi-Xia; Chen, Zhi-Sen; Ke, Cai-Huan; Zhao, Jing; You, Wei-Wei; Zhang, Jie; Dong, Wei-Ting; Chen, Jun

    2012-01-01

    Background The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. Methodology/Principal Findings In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the ‘lock system’ in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM) structures within the earliest postlarvae. Conclusion This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level. PMID:23236463

  7. Polymorphic core promoter GA-repeats alter gene expression of the early embryonic developmental genes.

    PubMed

    Valipour, E; Kowsari, A; Bayat, H; Banan, M; Kazeminasab, S; Mohammadparast, S; Ohadi, M

    2013-12-01

    Protein complexes that bind to 'GAGA' DNA elements are necessary to replace nucleosomes to create a local chromatin environment that facilitates a variety of site-specific regulatory responses. Three to four elements are required for the disruption of a preassembled nucleosome. We have previously identified human protein-coding gene core promoters that are composed of exceptionally long GA-repeats. The functional implication of those GA-repeats is beginning to emerge in the core promoter of the human SOX5 gene, which is involved in multiple developmental processes. In the current study, we analyze the functional implication of GA-repeats in the core promoter of two additional genes, MECOM and GABRA3, whose expression is largely limited to embryogenesis. We report a significant difference in gene expression as a result of different alleles across those core promoters in the HEK-293 cell line. Across-species homology check for the GABRA3 GA-repeats revealed that those repeats are evolutionary conserved in mouse and primates (p<1 × 10(-8)). The MECOM core promoter GA-repeats are also conserved in numerous species, of which human has the longest repeat and complexity. We propose a novel role for GA-repeat core promoters to regulate gene expression in the genes involved in development and evolution.

  8. Early changes in gene expression profiles of hepatic GVHD uncovered by oligonucleotide microarrays.

    PubMed

    Ichiba, Tamotsu; Teshima, Takanori; Kuick, Rork; Misek, David E; Liu, Chen; Takada, Yuichiro; Maeda, Yoshinobu; Reddy, Pavan; Williams, Debra L; Hanash, Samir M; Ferrara, James L M

    2003-07-15

    The liver, skin, and gastrointestinal tract are major target organs of acute graft-versus-host disease (GVHD), the major complication of allogeneic bone marrow transplantation (BMT). In order to gain a better understanding of acute GVHD in the liver, we compared the gene expression profiles of livers after experimental allogeneic and syngeneic BMT using oligonucleotide microarray. At 35 days after allogeneic BMT when hepatic GVHD was histologically evident, genes related to cellular effectors and acute-phase proteins were up-regulated, whereas genes largely related to metabolism and endocrine function were down-regulated. At day 7 after BMT before the development of histologic changes in the liver, interferon gamma (IFN-gamma)-inducible genes, major histocompatibility (MHC) class II molecules, and genes related to leukocyte trafficking had been up-regulated. Immunohistochemistry demonstrated that expression of IFN-gamma protein itself was increased in the spleen but not in hepatic tissue. These results suggest that the increased expression of genes associated with the attraction and activation of donor T cells induced by IFN-gamma early after BMT is important in the initiation of hepatic GVHD in this model and provide new potential molecular targets for early detection and intervention of acute GVHD.

  9. Differential gene expression profile in bovine blastocysts resulting from hyperglycemia exposure during early cleavage stages.

    PubMed

    Cagnone, Gaël L M; Dufort, Isabelle; Vigneault, Christian; Sirard, Marc-André

    2012-02-01

    To understand the compromised survival of embryos derived from assisted reproductive techniques, transcriptome survey of early embryonic development has shown the impact of in vitro culture environment on gene expression in bovine or other living species. However, how the differentially expressed genes translate into developmentally compromised embryos is unresolved. We therefore aimed to characterize transcriptomic markers expressed by bovine blastocysts cultured in conditions that are known to impair embryo development. As increasing glucose concentrations has been shown to be stressful for early cleavage stages of mammalian embryos and to decrease subsequent blastocyst survival, in vitro-matured/fertilized bovine zygotes were cultured in control (0.2 mM) or high-glucose (5 mM) conditions until the 8- to 16-cell stage, and then transferred to control media until they reached the blastocyst stage. The concentration of 5 mM glucose was chosen as a stress treatment because there was a significant effect on blastocyst rate without the treatment's being lethal as with 10 mM. Microarray analysis revealed gene expression differences unrelated to embryo sex or hatching. Overrepresented processes among differentially expressed genes in treated blastocysts were extracellular matrix signalling, calcium signaling, and energy metabolism. On a pathophysiological level, higher glucose treatment impacts pathways associated with diabetes and tumorigenesis through genes controlling the Warburg effect, i.e., emphasis on use of anaerobic glycolysis rather than oxidative phosphorylation. These results allowed us to conclude that disruption of in vitro preattachment development is concomitant with gene expression modifications involved in metabolic control.

  10. Global Gene Expression Profiling of Individual Human Oocytes and Embryos Demonstrates Heterogeneity in Early Development

    PubMed Central

    Zeef, Leo; Kimber, Susan J.; Brison, Daniel R.

    2013-01-01

    Early development in humans is characterised by low and variable embryonic viability, reflected in low fecundity and high rates of miscarriage, relative to other mammals. Data from assisted reproduction programmes provides additional evidence that this is largely mediated at the level of embryonic competence and is highly heterogeneous among embryos. Understanding the basis of this heterogeneity has important implications in a number of areas including: the regulation of early human development, disorders of pregnancy, assisted reproduction programmes, the long term health of children which may be programmed in early development, and the molecular basis of pluripotency in human stem cell populations. We have therefore investigated global gene expression profiles using polyAPCR amplification and microarray technology applied to individual human oocytes and 4-cell and blastocyst stage embryos. In order to explore the basis of any variability in detail, each developmental stage is replicated in triplicate. Our data show that although transcript profiles are highly stage-specific, within each stage they are relatively variable. We describe expression of a number of gene families and pathways including apoptosis, cell cycle and amino acid metabolism, which are variably expressed and may be reflective of embryonic developmental competence. Overall, our data suggest that heterogeneity in human embryo developmental competence is reflected in global transcript profiles, and that the vast majority of existing human embryo gene expression data based on pooled oocytes and embryos need to be reinterpreted. PMID:23717564

  11. Expression of Immune-Related Genes during Loach (Misgurnus anguillicaudatus) Embryonic and Early Larval Development

    PubMed Central

    Lee, Jang Wook; Kim, Jung Eun; Goo, In Bon; Hwang, Ju-Ae; Im, Jea Hyun; Choi, Hye-Sung; Lee, Jeong-Ho

    2015-01-01

    Early life stage mortality in fish is one of the problems faced by loach aquaculture. However, our understanding of immune system in early life stage fish is still incomplete, and the information available is restricted to a few fish species. In the present work, we investigated the expression of immune-related transcripts in loach during early development. In fishes, recombination-activating gene 1 (RAG-1) and sacsin (SACS) have been considered as immunological function. In this study, the expression of the both genes was assessed throughout the early developmental stages of loach using real-time PCR method. maRAG-1 mRNA was first detected in 0 dph, observed the increased mostly until 40 dph. Significant expression of maRAG-1 was detected in 0 to 40 dph. These patterns of expression may suggest that the loach start to develop its function after hatching. On the other hand, maSACS was detected in unfertilized oocyte to molura stages and 0 to 40 dph. maSACS mRNA transcripts were detected in unfertilized oocytes, suggesting that they are maternally transferred. PMID:26973969

  12. Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors

    PubMed Central

    Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

  13. Tightly regulated expression of Autographa californica multicapsid nucleopolyhedrovirus immediate early genes emerges from their interactions and possible collective behaviors.

    PubMed

    Ono, Chikako; Sato, Masanao; Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network.

  14. Expression of Putative Immune Response Genes during Early Ontogeny in the Coral Acropora millepora

    PubMed Central

    Puill-Stephan, Eneour; Seneca, François O.; Miller, David J.; van Oppen, Madeleine J. H.; Willis, Bette L.

    2012-01-01

    Background Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Methodology/Principal Findings Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A.millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Conclusions/Significance Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of

  15. Early embryonic failure: Expression and imprinted status of candidate genes on human chromosome 21

    SciTech Connect

    Sherman, L.S.; Bennett, P.R.; Moore, G.E.

    1994-09-01

    Two cases of maternal uniparental (hetero)disomy for human chromosome 21 (mUPD21) have been identified in a systematic search for UPD in 23 cases of early embryonic failure (EEF). Bi-parental origin of the other chromosome pairs was confirmed using specific VNTR probes or dinucleotide repeat analysis. Both maternally and paternally derived isochromosomes 21q have previously been identified in two individuals with normal phenotypes. Full UPD21 has a different mechanism of origin than uniparental isochromosome 21q and its effect on imprinted genes and phenotypic outcome will therefore not necessarily be the same. EEF associated with mUPD21 suggests that developmentally important genes on HSA 21 may be imprinted such that they are only expressed from either the maternally or paternally derived alleles. We have searched for monoallelic expression of candidate genes on HSA 21 in human pregnancy (CBS, IFNAR, COL6A1) using intragenic DNA polymorphisms. These genes were chosen either because their murine homologues lie in imprinted regions or because they are potentially important in embryogenesis. Once imprinted candidate genes have been identified, their methylation status and expression in normal, early embryonic failure and uniparental disomy 21 pregnancies will be studied. At the same time, a larger number of cases of EEF are being examined to further investigate the incidence of UPD21 in this group.

  16. Early expressed genes showing a dichotomous developing pattern in the lancelet embryo.

    PubMed

    Yasui, K; Saiga, H; Wang, Y; Zhang, P J; Semba, I

    2001-04-01

    Lancelets (amphioxus), although showing the most similar anatomical features to vertebrates, never develop a vertebrate-like head but rather several structures specific to this animal. The lancelet anatomical specificity seems to be traceable to early developmental stages, such as the vertebrate dorsal and anterior-posterior determinations. The BMP and Wnt proteins play important roles in establishing the early basis of the dorsal structures and the head in vertebrates. The early behavior of BMP and Wnt may be also related to the specific body structures of lancelets. The expression patterns of a dpp-related gene, Bbbmp2/4, and two wnt-related genes, Bbwnt7 and Bbwnt8, have been studied in comparison with those of brachyury and Hnf-3beta class genes. The temporal expression patterns of these genes are similar to those of vertebrates; Bbbmp2/4 and Bbwnt8 are first expressed in the invaginating primitive gut and the equatorial region, respectively, at the initial gastrula stage. However, spatial expression pattern of Bbbmp2/4 differs significantly from the vertebrate cognates. It is expressed in the mid-dorsal inner layer of gastrulae and widely in the anterior region, in which vertebrates block BMP signaling. The present study suggests that the lancelet embryo may have two distinct developmental domains from the gastrula stage, the domains of which coincide later with the lateral diverticular and the somitocoelomic regions. The embryonic origin of the anterior-specific structures in lancelets corresponds to the anterior domain where Bbbmp2/4 is continuously expressed.

  17. Expression of immediate early genes after treatment of human astrocytoma cells with radiation and taxol

    SciTech Connect

    Gubits, R.M.; Geard, C.R.; Schiff, P.B.

    1993-10-20

    The promising chemotherapeutic agent, taxol, has been shown to sensitize the G18 line of human astrocytoma cells to ionizing radiation. The present studies were performed to identify specific changes in gene expression associated with this altered sensitivity. The products of immediate early genes, which are induced transiently in cells in response to a variety of treatments, including growth factors, neurotransmitters, and irradiation with UV light or X rays, are thought to initiate a cascade of genetic responses to alterations in cellular environment. The present results demonstrate a dramatic attenuation in one immediate early gene response in association with a treatment that enhances radiosensitivity in a refractory human brain tumor line. 22 refs., 5 figs., 1 tab.

  18. Global gene expression analysis of early response to chemotherapy treatment in ovarian cancer spheroids

    PubMed Central

    L'Espérance, Sylvain; Bachvarova, Magdalena; Tetu, Bernard; Mes-Masson, Anne-Marie; Bachvarov, Dimcho

    2008-01-01

    Background Chemotherapy (CT) resistance in ovarian cancer (OC) is broad and encompasses diverse unrelated drugs, suggesting more than one mechanism of resistance. To better understand the molecular mechanisms controlling the immediate response of OC cells to CT exposure, we have performed gene expression profiling in spheroid cultures derived from six OC cell lines (OVCAR3, SKOV3, TOV-112, TOV-21, OV-90 and TOV-155), following treatment with 10,0 μM cisplatin, 2,5 μM paclitaxel or 5,0 μM topotecan for 72 hours. Results Exposure of OC spheroids to these CT drugs resulted in differential expression of genes associated with cell growth and proliferation, cellular assembly and organization, cell death, cell cycle control and cell signaling. Genes, functionally involved in DNA repair, DNA replication and cell cycle arrest were mostly overexpressed, while genes implicated in metabolism (especially lipid metabolism), signal transduction, immune and inflammatory response, transport, transcription regulation and protein biosynthesis, were commonly suppressed following all treatments. Cisplatin and topotecan treatments triggered similar alterations in gene and pathway expression patterns, while paclitaxel action was mainly associated with induction of genes and pathways linked to cellular assembly and organization (including numerous tubulin genes), cell death and protein synthesis. The microarray data were further confirmed by pathway and network analyses. Conclusion Most alterations in gene expression were directly related to mechanisms of the cytotoxics actions in OC spheroids. However, the induction of genes linked to mechanisms of DNA replication and repair in cisplatin- and topotecan-treated OC spheroids could be associated with immediate adaptive response to treatment. Similarly, overexpression of different tubulin genes upon exposure to paclitaxel could represent an early compensatory effect to this drug action. Finally, multicellular growth conditions that are

  19. Gene Expression Analysis Reveals the Cell Cycle and Kinetochore Genes Participating in Ischemia Reperfusion Injury and Early Development in Kidney

    PubMed Central

    Barrera-Chimal, Jonatan; Bobadilla, Norma A.; Park, Peter J.; Vaidya, Vishal S.

    2011-01-01

    Background The molecular mechanisms that mediate the ischemia-reperfusion (I/R) injury in kidney are not completely understood. It is also largely unknown whether such mechanisms overlap with those governing the early development of kidney. Methodology/Principal Findings We performed gene expression analysis to investigate the transcriptome changes during regeneration after I/R injury in the rat (0 hr, 6 hr, 24 hr, and 120 hr after reperfusion) and early development of mouse kidney (embryonic day 16 p.c. and postnatal 1 and 7 day). Pathway analysis revealed a wide spectrum of molecular functions that may participate in the regeneration and developmental processes of kidney as well as the functional association between them. While the genes associated with cell cycle, immunity, inflammation, and apoptosis were globally activated during the regeneration after I/R injury, the genes encoding various transporters and metabolic enzymes were down-regulated. We also observed that these injury-associated molecular functions largely overlap with those of early kidney development. In particular, the up-regulation of kinases and kinesins with roles in cell division was common during regeneration and early developmental kidney as validated by real-time PCR and immunohistochemistry. Conclusions In addition to the candidate genes whose up-regulation constitutes an overlapping expression signature between kidney regeneration and development, this study lays a foundation for studying the functional relationship between two biological processes. PMID:21980527

  20. Sexually dimorphic gene expressions in eels: useful markers for early sex assessment in a conservation context

    PubMed Central

    Geffroy, Benjamin; Guilbaud, Florian; Amilhat, Elsa; Beaulaton, Laurent; Vignon, Matthias; Huchet, Emmanuel; Rives, Jacques; Bobe, Julien; Fostier, Alexis; Guiguen, Yann; Bardonnet, Agnès

    2016-01-01

    Environmental sex determination (ESD) has been detected in a range of vertebrate reptile and fish species. Eels are characterized by an ESD that occurs relatively late, since sex cannot be histologically determined before individuals reach 28 cm. Because several eel species are at risk of extinction, assessing sex at the earliest stage is a crucial management issue. Based on preliminary results of RNA sequencing, we targeted genes susceptible to be differentially expressed between ovaries and testis at different stages of development. Using qPCR, we detected testis-specific expressions of dmrt1, amh, gsdf and pre-miR202 and ovary-specific expressions were obtained for zar1, zp3 and foxn5. We showed that gene expressions in the gonad of intersexual eels were quite similar to those of males, supporting the idea that intersexual eels represent a transitional stage towards testicular differentiation. To assess whether these genes would be effective early molecular markers, we sampled juvenile eels in two locations with highly skewed sex ratios. The combined expression of six of these genes allowed the discrimination of groups according to their potential future sex and thus this appears to be a useful tool to estimate sex ratios of undifferentiated juvenile eels. PMID:27658729

  1. Expression dynamics of WOX genes mark cell fate decisions during early embryonic patterning in Arabidopsis thaliana.

    PubMed

    Haecker, Achim; Gross-Hardt, Rita; Geiges, Bernd; Sarkar, Ananda; Breuninger, Holger; Herrmann, Marita; Laux, Thomas

    2004-02-01

    During embryonic pattern formation, the main body axes are established and cells of different developmental fates are specified from a single-cell zygote. Despite the fundamental importance of this process, in plants, the underlying mechanisms are largely unknown. We show that expression dynamics of novel WOX (WUSCHEL related homeobox) gene family members reveal early embryonic patterning events in Arabidopsis. WOX2 and WOX8 are co-expressed in the egg cell and zygote and become confined to the apical and basal daughter cells of the zygote, respectively, by its asymmetric division. WOX2 not only marks apical descendants of the zygote, but is also functionally required for their correct development, suggesting that the asymmetric division of the plant zygote separates determinants of apical and basal cell fates. WOX9 expression is initiated in the basal daughter cell of the zygote and subsequently shifts into the descendants of the apical daughter apparently in response to signaling from the embryo proper. Expression of WOX5 shows that identity of the quiescent center is initiated very early in the hypophyseal cell, and highlights molecular and developmental similarities between the stem cell niches of root and shoot meristems. Together, our data suggest that during plant embryogenesis region-specific transcription programs are initiated very early in single precursor cells and that WOX genes play an important role in this process.

  2. Regulation of Cat1 gene expression in the scutellum of maize during early sporophytic development.

    PubMed Central

    Chandlee, J M; Scandalios, J G

    1984-01-01

    A regulatory element has been identified in maize that appears to exert an effect specifically on Cat1 gene expression in the scutellum of maize during early sporophytic development. Cat1 encodes CAT-1 catalase, one of two forms of catalase expressed in the scutellum during this developmental time period. Density-labeling experiments indicate that the regulatory element influences the overall levels of CAT-1 protein synthesis in the scutellum but has no effect on CAT-2 protein synthesis. Immunoprecipitation experiments of in vitro translation products suggest that this element has an effect on the level of translatable Cat1 mRNA associated with the scutellar polysomes. The element exhibits additive inheritance and is tissue and time specific in its action. This element, therefore, meets all the criteria of a regulatory gene and has been designated Car2. The element acts to regulate the temporal expression of the Cat1 structural locus in maize. Images PMID:6589635

  3. Expression of immediate-early genes in the dorsal cochlear nucleus in salicylate-induced tinnitus.

    PubMed

    Hu, Shou-Sen; Mei, Ling; Chen, Jian-Yong; Huang, Zhi-Wu; Wu, Hao

    2016-02-01

    Spontaneous neuronal activity in dorsal cochlear nucleus (DCN) may be involved in the physiological processes underlying salicylate-induced tinnitus. As a neuronal activity marker, immediate-early gene (IEG) expression, especially activity-dependent cytoskeletal protein (Arc/Arg3.1) and the early growth response gene-1 (Egr-1), appears to be highly correlated with sensory-evoked neuronal activity. However, their relationships with tinnitus induced by salicylate have rarely been reported in the DCN. In this study, we assessed the effect of acute and chronic salicylate treatment on the expression of N-methyl D-aspartate receptor subunit 2B (NR2B), Arg3.1, and Egr-1. We also observed ultrastructural alterations in the DCN synapses in an animal model of tinnitus. Levels of mRNA and protein expression of NR2B and Arg3.1 were increased in rats that were chronically administered salicylate (200 mg/kg, twice daily for 3, 7, or 14 days). These levels returned to baseline 14 days after cessation of treatment. However, no significant changes were observed in Egr-1 gene expression in any groups. Furthermore, rats subjected to long-term salicylate administration showed more presynaptic vesicles, thicker and longer postsynaptic densities, and increased synaptic interface curvature. Alterations of Arg3.1 and NR2B may be responsible for the changes in the synaptic ultrastructure. These changes confirm that salicylate can cause neural plasticity changes at the DCN level. PMID:25636249

  4. Prediction of Disease Severity in Patients with Early Rheumatoid Arthritis by Gene Expression Profiling

    PubMed Central

    Liu, Zheng; Sokka, Tuulikki; Maas, Kevin; Olsen, Nancy J.; Aune, Thomas M.

    2009-01-01

    In order to test the ability of peripheral blood gene expression profiles to predict future disease severity in patients with early rheumatoid arthritis (RA), a group of 17 patients (1 ± 0.2 years disease duration) was evaluated at baseline for gene expression profiles. Disease status was evaluated after a mean of 5 years using an index combining pain, global and recoded MHAQ scores. Unsupervised and supervised algorithms identified “predictor genes” whose combined expression levels correlated with follow-up disease severity scores. Unsupervised clustering algorithms separated patients into two branches. The only significant difference between these two groups was the disease severity score; demographic variables and medication usage were not different. Supervised T-Test analysis identified 19 “predictor genes” of future disease severity. Results were validated in an independent cohort of subjects of established RA with using Support Vector Machines and K-Nearest-Neighbor Classification. Our study demonstrates that peripheral blood gene expression profiles may be a useful tool to predict future disease severity in patients with early and established RA. PMID:20948566

  5. Abnormal energy regulation in early life: childhood gene expression may predict subsequent chronic mountain sickness

    PubMed Central

    Huicho, Luis; Xing, Guoqiang; Qualls, Clifford; Rivera-Ch, María; Gamboa, Jorge L; Verma, Ajay; Appenzeller, Otto

    2008-01-01

    Background Life at altitude depends on adaptation to ambient hypoxia. In the Andes, susceptibility to chronic mountain sickness (CMS), a clinical condition that occurs to native highlanders or to sea level natives with prolonged residence at high altitude, remains poorly understood. We hypothesized that hypoxia-associated gene expression in children of men with CMS might identify markers that predict the development of CMS in adults. We assessed distinct patterns of gene expression of hypoxia-responsive genes in children of highland Andean men, with and without CMS. Methods We compared molecular signatures in children of highland (HA) men with CMS (n = 10), without CMS (n = 10) and in sea level (SL) children (n = 20). Haemoglobin, haematocrit, and oxygen saturation were measured. Gene expression in white cells was assessed at HA and then, in the same subjects, within one hour of arrival at sea level. Results HA children showed higher expression levels of genes regulated by HIF (hypoxia inducible factor) and lower levels of those involved in glycolysis and in the tricarboxilic acid (TCA) cycle. Pyruvate dehydrogenase kinase 1(PDK1) and HIF prolyl hydroxylase 3 (HPH3) mRNA expressions were lowest in children of CMS fathers at altitude. At sea level the pattern of gene expression in the 3 children's groups was indistinguishable. Conclusion The molecular signatures of children of CMS patients show impaired adaptation to hypoxia. At altitude children of CMS fathers had defective coupling between glycolysis and mitochondria TCA cycle, which may be a key mechanism/biomarker for adult CMS. Early biologic markers of disease susceptibility in Andeans might impact health services and social planning. PMID:18954447

  6. BEST: a novel computational approach for comparing gene expression patterns from early stages of Drosophila melanogaster development.

    PubMed

    Kumar, Sudhir; Jayaraman, Karthik; Panchanathan, Sethuraman; Gurunathan, Rajalakshmi; Marti-Subirana, Ana; Newfeld, Stuart J

    2002-12-01

    Embryonic gene expression patterns are an indispensable part of modern developmental biology. Currently, investigators must visually inspect numerous images containing embryonic expression patterns to identify spatially similar patterns for inferring potential genetic interactions. The lack of a computational approach to identify pattern similarities is an impediment to advancement in developmental biology research because of the rapidly increasing amount of available embryonic gene expression data. Therefore, we have developed computational approaches to automate the comparison of gene expression patterns contained in images of early stage Drosophila melanogaster embryos (prior to the beginning of germ-band elongation); similarities and differences in gene expression patterns in these early stages have extensive developmental effects. Here we describe a basic expression search tool (BEST) to retrieve best matching expression patterns for a given query expression pattern and a computational device for gene interaction inference using gene expression pattern images and information on the associated genotypes and probes. Analysis of a prototype collection of Drosophila gene expression pattern images is presented to demonstrate the utility of these methods in identifying biologically meaningful matches and inferring gene interactions by direct image content analysis. In particular, the use of BEST searches for gene expression patterns is akin to that of BLAST searches for finding similar sequences. These computational developmental biology methodologies are likely to make the great wealth of embryonic gene expression pattern data easily accessible and to accelerate the discovery of developmental networks.

  7. Lhx9 gene expression during early limb development in mice requires the FGF signalling pathway.

    PubMed

    Yang, Yisheng; Wilson, Megan J

    2015-01-01

    Lhx9 is a member of the LIM-homeodomain gene family necessary for the correct development of many organs including gonads, limbs, heart and the nervous system. In the context of limb development, Lhx9 has been implicated as an integrator for Fibroblast growth factor (FGF) and Sonic hedgehog (Shh) signalling required for proximal-distal (PD) and anterior-posterior (AP) development of the limb. Three splice variants of the Lhx9 transcript are expressed during development, two of which are predicted to act in a dominant negative fashion, competing with the DNA binding version of Lhx9 for binding to cofactors via the LIM-domain. We examined the expression pattern for the three alternative splice forms of Lhx9; Lhx9α, Lhx9β and Lhx9c during early limb development. We have found that of the three Lhx9 isoforms, only Lhx9α and Lhx9c (intact homeodomain) are expressed during early limb development, each with their own distinct expression pattern. Additionally we determined that Lhx9 expression overlaps with FGF10 expression in the developing limb bud mesenchyme. Limb bud explant cultures, in the presence of signalling pathway inhibitors, also indicated that Lhx9 mRNA expression in the limb bud was dependent on FGF signalling. PMID:26220830

  8. Fibrotic gene expression coexists with alveolar proteinosis in early indium lung.

    PubMed

    Noguchi, Shuhei; Eitoku, Masamitsu; Kiyosawa, Hidenori; Suganuma, Narufumi

    2016-08-01

    Occupational inhalation of indium compounds can cause the so-called "indium lung disease". Most affected individuals show pulmonary alveolar proteinosis (PAP) and fibrotic interstitial lung disease. In animal experiments, inhalation of indium tin oxide or indium oxide has been shown to cause lung damage. However, the mechanisms by which indium compounds lead to indium lung disease remain unknown. In this study, we constructed a mouse model of indium lung disease and analyzed gene expression in response to indium exposure. Indium oxide (In2O3, 10 mg/kg, primary particle size <100 nm) was administered intratracheally to C57BL/6 mice (male, 8 weeks of age) twice a week for 8 weeks. Four weeks after the final instillation, histopathological analysis exhibited periodic acid-Schiff positive material in the alveoli, characteristic of PAP. Comprehensive gene expression analysis by RNA-Seq, however, revealed expression of fibrosis-related genes, such as surfactant associated protein D, surfactant associated protein A1, mucin 1, and collagen type I and III, was significantly increased, indicating that fibrotic gene expression progresses in early phase of indium lung. These data supported the latest hypothesis that PAP occurs as an acute phase response and is replaced by fibrosis after long-term latency.

  9. Regulation of X-linked gene expression during early mouse development by Rlim

    PubMed Central

    Wang, Feng; Shin, JongDae; Shea, Jeremy M; Yu, Jun; Bošković, Ana; Byron, Meg; Zhu, Xiaochun; Shalek, Alex K; Regev, Aviv; Lawrence, Jeanne B; Torres, Eduardo M; Zhu, Lihua J; Rando, Oliver J; Bach, Ingolf

    2016-01-01

    Mammalian X-linked gene expression is highly regulated as female cells contain two and male one X chromosome (X). To adjust the X gene dosage between genders, female mouse preimplantation embryos undergo an imprinted form of X chromosome inactivation (iXCI) that requires both Rlim (also known as Rnf12) and the long non-coding RNA Xist. Moreover, it is thought that gene expression from the single active X is upregulated to correct for bi-allelic autosomal (A) gene expression. We have combined mouse genetics with RNA-seq on single mouse embryos to investigate functions of Rlim on the temporal regulation of iXCI and Xist. Our results reveal crucial roles of Rlim for the maintenance of high Xist RNA levels, Xist clouds and X-silencing in female embryos at blastocyst stages, while initial Xist expression appears Rlim-independent. We find further that X/A upregulation is initiated in early male and female preimplantation embryos. DOI: http://dx.doi.org/10.7554/eLife.19127.001 PMID:27642011

  10. Interrupted genes in extremophilic archaea: mechanisms of gene expression in early organisms.

    PubMed

    Cobucci-Ponzano, Beatrice; Rossi, Mosè; Moracci, Marco

    2006-12-01

    Extremophilic Archaea populate biotopes previously considered inaccessible for life. This feature, and the possibility that they are the extant forms of life closest to the last common ancestor, make these organisms excellent candidates for the study of evolution on Earth and stimulate the exobiological research in planets previously considered totally inhospitable. Among the other aspects of the physiology of these organisms, the study of the molecular genetics of extremophilic Archaea can give hints on how the genetic information is transmitted and propagated in ancient forms of life. We review here the expression of interrupted genes in a recently discovered nanoarchaeon and the mechanisms of reprogrammed genetic decoding in Archaea.

  11. Expression of early growth response gene-1 in precancerous lesions of gastric cancer

    PubMed Central

    Park, Seon-Young; Kim, Ji-Young; Lee, Su-Mi; Chung, Jin Ook; Lee, Kyung-Hwa; Jun, Chung-Hwan; Park, Chang-Hwan; Kim, Hyun-Soo; Choi, Sung-Kyu; Rew, Jong-Sun; Jung, Young-Do; Lee, Yong Han

    2016-01-01

    Several studies have demonstrated a correlation between the expression of early growth response gene-1 (EGR-1) and the progression of gastric cancers at advanced stages. However, the effects of EGR-1 expression on human gastric cancer progression, particularly on precancerous lesions, have not been investigated. In this study, we evaluate EGR-1 expression levels in target mucosa from patients with early gastric cancer and precancerous lesions, and assess whether EGR-1 expression affects the oncogenic phenotypes of human gastric cancer cells. EGR-1 protein levels were measured in tissues from subjects with normal mucosa (n=6), low-grade dysplasia (n=6), high-grade dysplasia (n=4) and adenocarcinoma (n=3) using enzyme-linked immunosorbent assay and immunohistochemistry analyses. We also investigated the role of EGR-1 in tumor cell behavior by transiently expressing a dominant active EGR-1 variant in cultured cells. A positive correlation was observed between EGR-1 expression and gastric carcinogenesis (P=0.016). Furthermore, there was an increase in nuclear and cytoplasmic expression of EGR-1 in accordance with the histological grade (P for trends=0.003 and 0.003, respectively), and a positive association between the sum of the nuclear and cytoplasmic EGR-1 expression values and the histological grade (P=0.003). In addition, transient overexpression of EGR-1 enhanced cell proliferation, stimulated cell migration, and promoted the phosphorylation of p38 MAPK and AKT in gastric cancer cells in vitro. Our findings demonstrate that EGR-1 may contribute to the early stages of gastric carcinogenesis via the alteration of tumor cell behaviors. PMID:27698846

  12. Expression of early growth response gene-1 in precancerous lesions of gastric cancer

    PubMed Central

    Park, Seon-Young; Kim, Ji-Young; Lee, Su-Mi; Chung, Jin Ook; Lee, Kyung-Hwa; Jun, Chung-Hwan; Park, Chang-Hwan; Kim, Hyun-Soo; Choi, Sung-Kyu; Rew, Jong-Sun; Jung, Young-Do; Lee, Yong Han

    2016-01-01

    Several studies have demonstrated a correlation between the expression of early growth response gene-1 (EGR-1) and the progression of gastric cancers at advanced stages. However, the effects of EGR-1 expression on human gastric cancer progression, particularly on precancerous lesions, have not been investigated. In this study, we evaluate EGR-1 expression levels in target mucosa from patients with early gastric cancer and precancerous lesions, and assess whether EGR-1 expression affects the oncogenic phenotypes of human gastric cancer cells. EGR-1 protein levels were measured in tissues from subjects with normal mucosa (n=6), low-grade dysplasia (n=6), high-grade dysplasia (n=4) and adenocarcinoma (n=3) using enzyme-linked immunosorbent assay and immunohistochemistry analyses. We also investigated the role of EGR-1 in tumor cell behavior by transiently expressing a dominant active EGR-1 variant in cultured cells. A positive correlation was observed between EGR-1 expression and gastric carcinogenesis (P=0.016). Furthermore, there was an increase in nuclear and cytoplasmic expression of EGR-1 in accordance with the histological grade (P for trends=0.003 and 0.003, respectively), and a positive association between the sum of the nuclear and cytoplasmic EGR-1 expression values and the histological grade (P=0.003). In addition, transient overexpression of EGR-1 enhanced cell proliferation, stimulated cell migration, and promoted the phosphorylation of p38 MAPK and AKT in gastric cancer cells in vitro. Our findings demonstrate that EGR-1 may contribute to the early stages of gastric carcinogenesis via the alteration of tumor cell behaviors.

  13. Expression Pattern of Early Growth Response Gene 1 during Olive Flounder (Paralichthys olivaceus) Embryonic Development

    PubMed Central

    Yang, Hyun; Lee, Jeong-Ho; Noh, Jae Koo; Kim, Hyun Chul; Park, Choul-Ji; Park, Jong-Won; Kim, Kyung-Kil

    2014-01-01

    The early growth response protein 1 (Egr-1) is a widely reported zinc finger protein and a well known transcription factor encoded by the Egr-1 gene, which plays key roles in many aspects of vertebrate embryogenesis and in adult vertebrates. The Egr-1 expression is important in the formation of the gill vascular system in flounders, which develops during the post-hatching phase and is essential for survival during the juvenile period. However, the complete details of Egr-1 expression during embryo development in olive flounder are not available. We assessed the expression patterns of Egr-1 during the early development of olive flounders by using reverse transcription polymerase chain reaction (RT-PCR) analysis. Microscopic observations showed that gill filament formation corresponded with the Egr-1 expression. Thus, we showed that Egr-1 plays a vital role in angiogenesis in the gill filaments during embryogenesis. Further, Egr-1 expression was found to be strong at 5 days after hatching (DAH), in the development of the gill vascular system, and this strong expression level was maintained throughout all the development stages. Our findings have important implications with respect to the biological role of Egr-1 and evolution of the first respiratory blood vessels in the gills of olive flounder. Further studies are required to elucidate the Egr-1-mediated stress response and to decipher the functional role of Egr-1 in developmental stages. PMID:25949193

  14. Melatonin-related genes expressed in the mouse uterus during early gestation promote embryo implantation.

    PubMed

    He, Changjiu; Wang, Jing; Li, Yu; Zhu, Kuanfeng; Xu, Zhiyuan; Song, Yile; Song, Yukun; Liu, Guoshi

    2015-04-01

    Melatonin, a superior antioxidant, is an important molecule which regulates female reproduction due to its receptor-mediated and receptor-independent antioxidant actions. In this study, we investigated the effect of melatonin on early gestation in a mouse model. During early gestation, the expression of the melatonin's rate-limiting enzyme, AANAT, gradually increased - in the uterus while the MT2 melatonin receptor was only expressed at day 2 of gestation and no MT1 was detected. Based on these findings, we conducted a melatonin injection experiment which demonstrated that 15 mg/kg melatonin significantly improved the number of implantation sites and the litter size. Also, the blastocyst and uterus were collected to identify the local action of melatonin. In the melatonin-treated mice, the endometrium was thicker than in the control mice; melatonin also caused an increase in density of uterine glands, and the uterine gland index (UGI) was significantly elevated over that of the control. Serum steroid hormone measurements revealed that at day 6 of gestation (postimplantation), melatonin significantly downregulated the E2 level, with no obvious effects on progesterone. Gene expression assay revealed that melatonin significantly upregulated expression of HB-EGF, a crucial gene involved in implantation as well as its receptor ErbB1 in the blastocyst. In addition, PRA, an important gene which influences the decidual response and luminal cell differentiation, p53, which regulates uterine through leukaemia inhibitory factor (LIF), were both increased after melatonin treatment. These data suggest that melatonin and its MT2 receptor influence early gestation. Exogenous melatonin treatment can improve mouse embryo implantation and litter size, which may have important applications in human reproductive health and animal husbandry.

  15. Evolutionary Techniques for Image Processing a Large Dataset of Early Drosophila Gene Expression

    NASA Astrophysics Data System (ADS)

    Spirov, Alexander; Holloway, David M.

    2003-12-01

    Understanding how genetic networks act in embryonic development requires a detailed and statistically significant dataset integrating diverse observational results. The fruit fly ( Drosophila melanogaster) is used as a model organism for studying developmental genetics. In recent years, several laboratories have systematically gathered confocal microscopy images of patterns of activity (expression) for genes governing early Drosophila development. Due to both the high variability between fruit fly embryos and diverse sources of observational errors, some new nontrivial procedures for processing and integrating the raw observations are required. Here we describe processing techniques based on genetic algorithms and discuss their efficacy in decreasing observational errors and illuminating the natural variability in gene expression patterns. The specific developmental problem studied is anteroposterior specification of the body plan.

  16. Modeling the Kinetics of a Memory-Associated Immediate Early Gene's Compartmental Expression After Sensory Experience

    NASA Astrophysics Data System (ADS)

    Willats, Adam; Ivanova, Tamara; Prinz, Astrid; Liu, Robert

    2015-03-01

    Immediate Early Genes (IEGs) are rapidly and transiently transcribed in neurons after a sensory experience. Some of these genes act as effector IEGs, which mediate specific effects on cellular function. Arc is one such effector IEG that is essential for synaptic plasticity and memory consolidation in hippocampus and cortex. The expression of Arc in neurons has previously been examined using an imaging method known as Compartmental Analysis of Temporal Fluorescent In-Situ Hybridization. Previous work found that the time course of Arc expression within the nuclear and perinuclear cytoplasmic compartments of a neuron is altered by prior sensory experience. We explore a simple model of the kinetics of IEG transcription and nuclear export, with the aim of eventually uncovering possible mechanisms for how experience alters expression kinetics. Thus far, we characterize our compartmental model using phase-plane analysis and validate it against several IEG expression data sets, including one where prior experience with vocalizing mice alters the time course of call-induced Arc expression in the auditory cortex of a listening mouse. Our model provides a framework to explore why Arc expression may change depending on a receiver's past sound experience and internal state. Adam Willats was supported by NIH Training Grant 5T90DA032466. This research was also supported by NIDCD R01 DC8343.

  17. Dynamics of gene expression patterns during early development of the European seabass (Dicentrarchus labrax).

    PubMed

    Kaitetzidou, E; Xiang, J; Antonopoulou, E; Tsigenopoulos, C S; Sarropoulou, E

    2015-05-01

    Larval and embryonic stages are the most critical period in the life cycle of marine fish. Key developmental events occur early in development and are influenced by external parameters like stress, temperature, salinity, and photoperiodism. Any failure may cause malformations, developmental delays, poor growth, and massive mortalities. Advanced understanding of molecular processes underlying marine larval development may lead to superior larval rearing conditions. Today, the new sequencing and bioinformatic methods allow transcriptome screens comprising messenger (mRNA) and microRNA (miRNA) with the scope of detecting differential expression for any species of interest. In the present study, we applied Illumina technology to investigate the transcriptome of early developmental stages of the European seabass (Dicentrarchus labrax). The European seabass, in its natural environment, is a euryhaline species and has shown high adaptation processes in early life phases. During its embryonic and larval phases the European seabass lives in a marine environment and as a juvenile it migrates to coastal zones, estuaries, and lagoons. Investigating the dynamics of gene expression in its early development may shed light on factors promoting phenotypic plasticity and may also contribute to the improvement and advancement of rearing methods of the European seabass, a species of high economic importance in European and Mediterranean aquaculture. We present the identification, characterization, and expression of mRNA and miRNA, comprising paralogous genes and differentially spliced transcripts from early developmental stages of the European seabass. We further investigated the detection of possible interactions of miRNA with mRNA.

  18. A developmental characterization of mesolimbocortical serotonergic gene expression changes following early immune challenge.

    PubMed

    Sidor, M M; Amath, A; MacQueen, G; Foster, J A

    2010-12-15

    An immunogenic challenge during early postnatal development leads to long-term changes in behavioural and physiological measures reflecting enhanced emotionality and anxiety. Altered CNS serotonin (5-HT) signalling during the third postnatal week is thought to modify the developing neurocircuitry governing anxiety-like behaviour. Changes in 5-HT signalling during this time window may underlie increased emotionality reported in early immune challenge rodents. Here we examine both the spatial and temporal profile of 5-HT related gene expression, including 5HT1A, 2A, 2C receptors, the 5-HT transporter (5HTT), and tryptophan hydroxylase 2 (TPH2) during early development (postnatal day [P]14, P17, P21, P28) in mice challenged with lipopolysaccharide (LPS) during the first postnatal week. Expression levels were measured using in situ hybridization in regions associated with mediating emotive behaviours: the dorsal raphe (DR), hippocampus, amygdala, and prefrontal cortex (PFC). Increased TPH2 and 5HTT expression in the ventrolateral region of the DR of LPS-mice accompanied decreased expression of ventral DR 5HT1A and dorsal DR 5HTT. In the forebrain, 5HT1A and 2A receptors were increased, whereas 5HT2C receptors were decreased in the hippocampus. Decreased mRNA expression of 5HT2C was detected in the amygdala and PFC of LPS-treated pups; 5HT1A was increased in the PFC. The majority of these changes were restricted to P14-21. These transient changes in 5-HT expression coincide with the critical time window in which 5-HT disturbance leads to permanent modification of anxiety-related behaviours. This suggests that alterations in CNS 5-HT during development may underlie the enhanced emotionality associated with an early immune challenge. PMID:20816924

  19. Regulation of chick early B-cell factor-1 gene expression in feather development.

    PubMed

    El-Magd, Mohammed Abu; Sayed-Ahmed, Ahmed; Awad, Ashraf; Shukry, Mustafa

    2014-05-01

    The chick Ebf1 (early B-cell factor-1) gene is a member of a novel family of helix loop helix transcription factors. The expression profile, regulation and significance of this gene have been extensively studied in lymphatic, nervous, adipose and muscular tissues. However, cEbf1 expression, regulation and function in the feather of chick embryo have not yet been investigated. cEbf1 expression was first detected throughout the mesenchymal core of some few feather placodes (D7-D7.5). After feathers became mature and grew distally (D9 and D10), the mesenchymal expression of cEbf1 became confined to the caudal margin of the proximal half of all formed feather buds. Because this dynamic pattern of expression resembles that of Sonic Hedgehog (Shh) protein and bone morphogenetic protein (Bmp4) plus the crucial role of these two major signals in feather development, we hypothesized that cEbf1 expression in the feather may be regulated by Shh and Bmp4. In a feather explant culture system, Shh signals are necessary to initiate and maintain cEbf1 expression in the posterior half of the feather bud, while Bmp4 is crucial for the initial cEbf1 expression in the anterior half of the feather bud. Inhibition of Shh, not only down-regulates cEbf1, but also changes the morphology of feather buds, which become irregular and fused. This is the first study to demonstrate that cEbf1 expression in the feather bud is under the control of Shh and Bmp4 signals and that expression may play a role in the normal development of feathers.

  20. Paternal benzo[a]pyrene exposure affects gene expression in the early developing mouse embryo.

    PubMed

    Brevik, Asgeir; Lindeman, Birgitte; Rusnakova, Vendula; Olsen, Ann-Karin; Brunborg, Gunnar; Duale, Nur

    2012-09-01

    The health of the offspring depends on the genetic constitution of the parental germ cells. The paternal genome appears to be important; e.g., de novo mutations in some genes seem to arise mostly from the father, whereas epigenetic modifications of DNA and histones are frequent in the paternal gonads. Environmental contaminants which may affect the integrity of the germ cells comprise the polycyclic aromatic hydrocarbon, benzo[a]pyrene (B[a]P). B[a]P has received much attention due to its ubiquitous distribution, its carcinogenic and mutagenic potential, and also effects on reproduction. We conducted an in vitro fertilization (IVF) experiment using sperm cells from B[a]P-exposed male mice to study effects of paternal B[a]P exposure on early gene expression in the developing mouse embryo. Male mice were exposed to a single acute dose of B[a]P (150 mg/kg, ip) 4 days prior to isolation of cauda sperm, followed by IVF of oocytes from unexposed superovulated mice. Gene expression in fertilized zygotes/embryos was determined using reverse transcription-qPCR at the 1-, 2-, 4-, 8-, and blastocyst cell stages of embryo development. We found that paternal B[a]P exposure altered the expression of numerous genes in the developing embryo especially at the blastocyst stage. Some genes were also affected at earlier developmental stages. Embryonic gene expression studies seem useful to identify perturbations of signaling pathways resulting from exposure to contaminants, and can be used to address mechanisms of paternal effects on embryo development.

  1. Comparative gene expression analysis of Dtg, a novel target gene of Dpp signaling pathway in the early Drosophila melanogaster embryo.

    PubMed

    Hodar, Christian; Zuñiga, Alejandro; Pulgar, Rodrigo; Travisany, Dante; Chacon, Carlos; Pino, Michael; Maass, Alejandro; Cambiazo, Verónica

    2014-02-10

    In the early Drosophila melanogaster embryo, Dpp, a secreted molecule that belongs to the TGF-β superfamily of growth factors, activates a set of downstream genes to subdivide the dorsal region into amnioserosa and dorsal epidermis. Here, we examined the expression pattern and transcriptional regulation of Dtg, a new target gene of Dpp signaling pathway that is required for proper amnioserosa differentiation. We showed that the expression of Dtg was controlled by Dpp and characterized a 524-bp enhancer that mediated expression in the dorsal midline, as well as, in the differentiated amnioserosa in transgenic reporter embryos. This enhancer contained a highly conserved region of 48-bp in which bioinformatic predictions and in vitro assays identified three Mad binding motifs. Mutational analysis revealed that these three motifs were necessary for proper expression of a reporter gene in transgenic embryos, suggesting that short and highly conserved genomic sequences may be indicative of functional regulatory regions in D. melanogaster genes. Dtg orthologs were not detected in basal lineages of Dipterans, which unlike D. melanogaster develop two extra-embryonic membranes, amnion and serosa, nevertheless Dtg orthologs were identified in the transcriptome of Musca domestica, in which dorsal ectoderm patterning leads to the formation of a single extra-embryonic membrane. These results suggest that Dtg was recruited as a new component of the network that controls dorsal ectoderm patterning in the lineage leading to higher Cyclorrhaphan flies, such as D. melanogaster and M. domestica.

  2. Comparative gene expression analysis of Dtg, a novel target gene of Dpp signaling pathway in the early Drosophila melanogaster embryo.

    PubMed

    Hodar, Christian; Zuñiga, Alejandro; Pulgar, Rodrigo; Travisany, Dante; Chacon, Carlos; Pino, Michael; Maass, Alejandro; Cambiazo, Verónica

    2014-02-10

    In the early Drosophila melanogaster embryo, Dpp, a secreted molecule that belongs to the TGF-β superfamily of growth factors, activates a set of downstream genes to subdivide the dorsal region into amnioserosa and dorsal epidermis. Here, we examined the expression pattern and transcriptional regulation of Dtg, a new target gene of Dpp signaling pathway that is required for proper amnioserosa differentiation. We showed that the expression of Dtg was controlled by Dpp and characterized a 524-bp enhancer that mediated expression in the dorsal midline, as well as, in the differentiated amnioserosa in transgenic reporter embryos. This enhancer contained a highly conserved region of 48-bp in which bioinformatic predictions and in vitro assays identified three Mad binding motifs. Mutational analysis revealed that these three motifs were necessary for proper expression of a reporter gene in transgenic embryos, suggesting that short and highly conserved genomic sequences may be indicative of functional regulatory regions in D. melanogaster genes. Dtg orthologs were not detected in basal lineages of Dipterans, which unlike D. melanogaster develop two extra-embryonic membranes, amnion and serosa, nevertheless Dtg orthologs were identified in the transcriptome of Musca domestica, in which dorsal ectoderm patterning leads to the formation of a single extra-embryonic membrane. These results suggest that Dtg was recruited as a new component of the network that controls dorsal ectoderm patterning in the lineage leading to higher Cyclorrhaphan flies, such as D. melanogaster and M. domestica. PMID:24321690

  3. Macrophage lineage switching of murine early pre-B lymphoid cells expressing transduced fms genes.

    PubMed Central

    Borzillo, G V; Ashmun, R A; Sherr, C J

    1990-01-01

    fms genes encoding either wild-type or constitutively activated colony-stimulating factor 1 receptors (CSF-1R) were introduced by retroviral infection into long-term mouse lymphoid cultures. Four early pre-B-cell lines transformed by the feline v-fms oncogene underwent spontaneous and irreversible differentiation to macrophages when transferred from RPMI 1640 to Iscove modified Dulbecco medium. Expression of wild-type human CSF-1R in early pre-B cells conferred no proliferative advantage unless human CSF-1 was added to the culture medium. A clonal, factor-dependent early pre-B-cell line (D1F9), selected for continuous growth on NIH 3T3 cell feeder layers producing human CSF-1, could be maintained in RPMI 1640 medium containing interleukin-7 (IL-7) but also differentiated to macrophages when grown in Iscove modified Dulbecco medium containing human CSF-1. The macrophages retained parental immunoglobulin gene rearrangements and proviral insertions, lost B-cell antigens, expressed butyrate esterase and MAC-1, were actively phagocytic, and no longer survived in IL-7. Unlike factor-independent v-fms transformants, the irreversible commitment of D1F9 cells to differentiate in the macrophage lineage could be suppressed by IL-7, depended on human (but not mouse) CSF-1, and was inhibited by an antibody to human CSF-1R. Signals mediated by transduced CSF-1R can therefore play a deterministic role in cell differentiation. Images PMID:2160584

  4. The early inflammatory response after flexor tendon healing: A gene expression and histological analysis

    PubMed Central

    Manning, CN; Havlioglu, N; Knutsen, E; Sakiyama-Elbert, SE; Silva, MJ; Thomopoulos, S; Gelberman, RH

    2014-01-01

    Despite advances in surgical techniques over the past three decades, tendon repairs remain prone to poor clinical outcomes. Previous attempts to improve tendon healing have focused on the later stages of healing (i.e., proliferation and matrix synthesis). The early inflammatory phase of tendon healing, however, is not fully understood and its modulation during healing has not yet been studied. Therefore, the purpose of this work was to characterize the early inflammatory phase of flexor tendon healing with the goal of identifying inflammation-related targets for future treatments. Canine flexor tendons were transected and repaired using techniques identical to those used clinically. The inflammatory response was monitored for 9 days. Temporal changes in immune cell populations and gene expression of inflammation-, matrix degradation-, and extracellular matrix-related factors were examined. Gene expression patterns paralleled changes in repair-site cell populations. Of the observed changes, the most dramatic effect was a greater than 4000-fold up-regulation in the expression of the pro-inflammatory factor IL-1β. While an inflammatory response is likely necessary for healing to occur, high levels of pro-inflammatory cytokines may result in collateral tissue damage and impaired tendon healing. These findings suggest that future tendon treatment approaches consider modulation of the inflammatory phase of healing. PMID:24464937

  5. Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution.

    PubMed

    Gómez-Sagasti, María T; Becerril, José M; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos

    2015-02-01

    The molecular response of Pseudomonas fluorescens cells exposed to a mixture of heavy metals remains largely unknown. Here, we studied the temporal changes in the early gene expression of P. fluorescens cells exposed to three doses of a polymetallic solution over two exposure times, through the application of a customized cDNA microarray. At the lowest metal dose (MD/4), we observed a repression of the Hsp70 chaperone system, MATE and MFS transporters, TonB membrane transporter and histidine kinases, together with an overexpression of metal transport (ChaC, CopC), chemotaxis and glutamine synthetase genes. At the intermediate metal dose (MD), several amino acid transporters, a response regulator (CheY), a TonB-dependent receptor and the mutT DNA repair gene were repressed; by contrast, an overexpression of genes associated with the antioxidative stress system and the transport of chelates and sulfur was observed. Finally, at the highest metal dose (4MD), a repression of genes encoding metal ion transporters, drug resistance and alginate biosynthesis was found, together with an overexpression of genes encoding antioxidative proteins, membrane transporters, ribosomal proteins, chaperones and proteases. It was concluded that P. fluorescens cells showed, over exposure time, a highly complex molecular response when exposed to a polymetallic solution, involving mechanisms related with chemotaxis, signal transmission, membrane transport, cellular redox state, and the regulation of transcription and ribosomal activity. PMID:25754557

  6. Activation of GATA4 gene expression at the early stage of cardiac specification

    NASA Astrophysics Data System (ADS)

    Yilbas, Ayse; Hamilton, Alison; Wang, Yingjian; Mach, Hymn; Lacroix, Natascha; Davis, Darryl; Chen, Jihong; LI, Qiao

    2014-03-01

    Currently, there are no effective treatments to directly repair damaged heart tissue after cardiac injury since existing therapies focus on rescuing or preserving reversibly damaged tissue. Cell-based therapies using cardiomyocytes generated from stem cells present a promising therapeutic approach to directly replace damaged myocardium with new healthy tissue. However, the molecular mechanisms underlying the commitment of stem cells into cardiomyocytes are not fully understood and will be critical to guide this new technology into the clinic. Since GATA4 is a critical regulator of cardiac differentiation, we examined the molecular basis underlying the early activation of GATA4 gene expression during cardiac differentiation of pluripotent stem cells. Our studies demonstrate the direct involvement of histone acetylation and transcriptional coactivator p300 in the regulation of GATA4 gene expression. More importantly, we show that histone acetyltransferase (HAT) activity is important for GATA4 gene expression with the use of curcumin, a HAT inhibitor. In addition, the widely used histone deacetylase inhibitor valproic acid enhances both histone acetylation and cardiac specification.

  7. Expression of Potential Regulatory Genes in Abdominal Adipose Tissue of Broiler Chickens during Early Development.

    PubMed

    Bohannon-Stewart, Ann; Kelley, Gary; Kimathi, Boniface; Subramanya, Sri Harsha K V; Donkor, Joseph; Darris, Carl; Tyus, James; Payne, Ashley; Byers, Shannon; Hui, Dafeng; Nahashon, Samuel; Chen, Fur-Chi; Ivy, Michael; Wang, Xiaofei

    2014-01-01

    The identities of genes that underlie population variation in adipose tissue development in farm animals are poorly understood. Previous studies in our laboratory have suggested that increased fat tissue involves the expression modulation of an array of genes in broiler chickens. Of special interest are eight genes, FGFR3, EPHB2, IGFBP2, GREM1, TNC, COL3A1, ACBD7, and SCD. To understand their expression regulation and response to dietary manipulation, we investigated their mRNA levels after dietary manipulation during early development. Chickens were fed either a recommended standard or a high caloric diet from hatch to eight weeks of age (WOA). The high caloric diet markedly affected bodyweight of the broiler birds. mRNA levels of the eight genes in the abdominal adipose tissue were assayed at 2, 4, 6, and 8 WOA using RT-qPCR. Results indicate that (1) FGFR3 mRNA level was affected significantly by diet, age, and diet:age interaction; (2) COL3A mRNA level was repressed by high caloric diet; (3) mRNA levels of EPHB2, ACBD7, and SCD were affected by age; (4) mRNA level of TNC was modulated by age:diet interaction; (5) changes in GREM1 and IGFBP2 mRNA levels were not statistically different. PMID:24551454

  8. Expression of Potential Regulatory Genes in Abdominal Adipose Tissue of Broiler Chickens during Early Development

    PubMed Central

    Bohannon-Stewart, Ann; Subramanya, Sri Harsha K. V.; Donkor, Joseph; Tyus, James; Hui, Dafeng; Ivy, Michael

    2014-01-01

    The identities of genes that underlie population variation in adipose tissue development in farm animals are poorly understood. Previous studies in our laboratory have suggested that increased fat tissue involves the expression modulation of an array of genes in broiler chickens. Of special interest are eight genes, FGFR3, EPHB2, IGFBP2, GREM1, TNC, COL3A1, ACBD7, and SCD. To understand their expression regulation and response to dietary manipulation, we investigated their mRNA levels after dietary manipulation during early development. Chickens were fed either a recommended standard or a high caloric diet from hatch to eight weeks of age (WOA). The high caloric diet markedly affected bodyweight of the broiler birds. mRNA levels of the eight genes in the abdominal adipose tissue were assayed at 2, 4, 6, and 8 WOA using RT-qPCR. Results indicate that (1) FGFR3 mRNA level was affected significantly by diet, age, and diet:age interaction; (2) COL3A mRNA level was repressed by high caloric diet; (3) mRNA levels of EPHB2, ACBD7, and SCD were affected by age; (4) mRNA level of TNC was modulated by age:diet interaction; (5) changes in GREM1 and IGFBP2 mRNA levels were not statistically different. PMID:24551454

  9. Effect of Hyperglycemia on Gene Expression during Early Organogenesis in Mice

    PubMed Central

    Zhao, Jing; Hakvoort, Theodorus B. M.; Willemsen, A. Marcel; Jongejan, Aldo; Sokolovic, Milka; Bradley, Edward J.; de Boer, Vincent C. J.; Baas, Frank; van Kampen, Antoine H. C.; Lamers, Wouter H.

    2016-01-01

    Background Cardiovascular and neural malformations are common sequels of diabetic pregnancies, but the underlying molecular mechanisms remain unknown. We hypothesized that maternal hyperglycemia would affect the embryos most shortly after the glucose-sensitive time window at embryonic day (ED) 7.5 in mice. Methods Mice were made diabetic with streptozotocin, treated with slow-release insulin implants and mated. Pregnancy aggravated hyperglycemia. Gene expression profiles were determined in ED8.5 and ED9.5 embryos from diabetic and control mice using Serial Analysis of Gene Expression and deep sequencing. Results Maternal hyperglycemia induced differential regulation of 1,024 and 2,148 unique functional genes on ED8.5 and ED9.5, respectively, mostly in downward direction. Pathway analysis showed that ED8.5 embryos suffered mainly from impaired cell proliferation, and ED9.5 embryos from impaired cytoskeletal remodeling and oxidative phosphorylation (all P ≤ E-5). A query of the Mouse Genome Database showed that 20–25% of the differentially expressed genes were caused by cardiovascular and/or neural malformations, if deficient. Despite high glucose levels in embryos with maternal hyperglycemia and a ~150-fold higher rate of ATP production from glycolysis than from oxidative phosphorylation on ED9.5, ATP production from both glycolysis and oxidative phosphorylation was reduced to ~70% of controls, implying a shortage of energy production in hyperglycemic embryos. Conclusion Maternal hyperglycemia suppressed cell proliferation during gastrulation and cytoskeletal remodeling during early organogenesis. 20–25% of the genes that were differentially regulated by hyperglycemia were associated with relevant congenital malformations. Unexpectedly, maternal hyperglycemia also endangered the energy supply of the embryo by suppressing its glycolytic capacity. PMID:27433804

  10. Gene expression signatures defining fundamental biological processes in pluripotent, early, and late differentiated embryonic stem cells.

    PubMed

    Gaspar, John Antonydas; Doss, Michael Xavier; Winkler, Johannes; Wagh, Vilas; Hescheler, Jürgen; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Sachinidis, Agapios

    2012-09-01

    Investigating the molecular mechanisms controlling the in vivo developmental program postembryogenesis is challenging and time consuming. However, the developmental program can be partly recapitulated in vitro by the use of cultured embryonic stem cells (ESCs). Similar to the totipotent cells of the inner cell mass, gene expression and morphological changes in cultured ESCs occur hierarchically during their differentiation, with epiblast cells developing first, followed by germ layers and finally somatic cells. Combination of high throughput -omics technologies with murine ESCs offers an alternative approach for studying developmental processes toward organ-specific cell phenotypes. We have made an attempt to understand differentiation networks controlling embryogenesis in vivo using a time kinetic, by identifying molecules defining fundamental biological processes in the pluripotent state as well as in early and the late differentiation stages of ESCs. Our microarray data of the differentiation of the ESCs clearly demonstrate that the most critical early differentiation processes occur at days 2 and 3 of differentiation. Besides monitoring well-annotated markers pertinent to both self-renewal and potency (capacity to differentiate to different cell lineage), we have identified candidate molecules for relevant signaling pathways. These molecules can be further investigated in gain and loss-of-function studies to elucidate their role for pluripotency and differentiation. As an example, siRNA knockdown of MageB16, a gene highly expressed in the pluripotent state, has proven its influence in inducing differentiation when its function is repressed.

  11. Central Renin Injections: Effects on Drinking and Expression of Immediate Early Genes

    NASA Technical Reports Server (NTRS)

    Xu, Zhice; Johnson, Alan Kim

    1998-01-01

    This study investigated the drinking response and the expression of Fos- and Egr-1-immunoreactivity (Fos-ir, Egr-1-ir) in the brain induced by endogenous angiotensin generated by intracerebroventricular (i.c.v.) injection of renin. Renin induced Fos-ir in the subformical organ (SFO), median preoptic (MnPO), supraoptic and paraventricular nuclei (SON and PVN), area postrema (AP), nuclei of the solitary tract (NTS) and lateral parabrachial nuclei (LPBN). Renin-induced Egr-1-ir exhibited a similar pattern of distribution as that observed for Fos-ir. The dose of i.c.v. renin that induced expression of immediate early gene (IEG) product immunoreactivity also produced vigorous drinking. When renin-injected rats were pretreated with captopril, an angiotensin converting enzyme inhibitor, drinking was blocked. With the same captopril pretreatment, both Fos- and Egr-1-ir in the SFO, MnPO, SON, PVN, AP and LPBN were also significantly reduced.

  12. Gene expression profiling of reproductive meristem types in early rice inflorescences by laser microdissection.

    PubMed

    Harrop, Thomas W R; Ud Din, Israr; Gregis, Veronica; Osnato, Michela; Jouannic, Stefan; Adam, Hélène; Kater, Martin M

    2016-04-01

    In rice, inflorescence architecture is established at early stages of reproductive development and contributes directly to grain yield potential. After induction of flowering, the complexity of branching, and therefore the number of seeds on the panicle, is determined by the activity of different meristem types and the timing of transitions between them. Although some of the genes involved in these transitions have been identified, an understanding of the network of transcriptional regulators controlling this process is lacking. To address this we used a precise laser microdissection and RNA-sequencing approach in Oryza sativa ssp. japonica cv. Nipponbare to produce quantitative data that describe the landscape of gene expression in four different meristem types: the rachis meristem, the primary branch meristem, the elongating primary branch meristem (including axillary meristems), and the spikelet meristem. A switch in expression profile between apical and axillary meristem types followed by more gradual changes during transitions in axillary meristem identity was observed, and several genes potentially involved in branching were identified. This resource will be vital for a mechanistic understanding of the link between inflorescence development and grain yield. PMID:26932536

  13. Gene expression profiling of reproductive meristem types in early rice inflorescences by laser microdissection.

    PubMed

    Harrop, Thomas W R; Ud Din, Israr; Gregis, Veronica; Osnato, Michela; Jouannic, Stefan; Adam, Hélène; Kater, Martin M

    2016-04-01

    In rice, inflorescence architecture is established at early stages of reproductive development and contributes directly to grain yield potential. After induction of flowering, the complexity of branching, and therefore the number of seeds on the panicle, is determined by the activity of different meristem types and the timing of transitions between them. Although some of the genes involved in these transitions have been identified, an understanding of the network of transcriptional regulators controlling this process is lacking. To address this we used a precise laser microdissection and RNA-sequencing approach in Oryza sativa ssp. japonica cv. Nipponbare to produce quantitative data that describe the landscape of gene expression in four different meristem types: the rachis meristem, the primary branch meristem, the elongating primary branch meristem (including axillary meristems), and the spikelet meristem. A switch in expression profile between apical and axillary meristem types followed by more gradual changes during transitions in axillary meristem identity was observed, and several genes potentially involved in branching were identified. This resource will be vital for a mechanistic understanding of the link between inflorescence development and grain yield.

  14. Functional characterization of calliphorid cell death genes and cellularization gene promoters for controlling gene expression and cell viability in early embryos.

    PubMed

    Edman, R M; Linger, R J; Belikoff, E J; Li, F; Sze, S-H; Tarone, A M; Scott, M J

    2015-02-01

    The New World screwworm fly, Cochliomyia hominivorax, and the Australian sheep blow fly, Lucilia cuprina, are major pests of livestock. The sterile insect technique was used to eradicate C. hominivorax from North and Central America. This involved area-wide releases of male and female flies that had been sterilized by radiation. Genetic systems have been developed for making 'male-only' strains that would improve the efficiency of genetic control of insect pests. One system involves induction of female lethality in embryos through activation of a pro-apoptotic gene by the tetracycline-dependent transactivator. Sex-specific expression is achieved using an intron from the transformer gene, which we previously isolated from several calliphorids. In the present study, we report the isolation of the promoters from the C. hominivorax slam and Lucilia sericata bnk cellularization genes and show that these promoters can drive expression of a GFP reporter gene in early embryos of transgenic L. cuprina. Additionally, we report the isolation of the L. sericata pro-apoptotic hid and rpr genes, identify conserved motifs in the encoded proteins and determine the relative expression of these genes at different stages of development. We show that widespread expression of the L. sericata pro-apoptotic genes was lethal in Drosophila melanogaster. The isolated gene promoters and pro-apoptotic genes could potentially be used to build transgenic embryonic sexing strains of calliphorid livestock pests.

  15. Analysis of gene expression during parabolic flights reveals distinct early gravity responses in Arabidopsis roots.

    PubMed

    Aubry-Hivet, D; Nziengui, H; Rapp, K; Oliveira, O; Paponov, I A; Li, Y; Hauslage, J; Vagt, N; Braun, M; Ditengou, F A; Dovzhenko, A; Palme, K

    2014-01-01

    Plant roots are among most intensively studied biological systems in gravity research. Altered gravity induces asymmetric cell growth leading to root bending. Differential distribution of the phytohormone auxin underlies root responses to gravity, being coordinated by auxin efflux transporters from the PIN family. The objective of this study was to compare early transcriptomic changes in roots of Arabidopsis thaliana wild type, and pin2 and pin3 mutants under parabolic flight conditions and to correlate these changes to auxin distribution. Parabolic flights allow comparison of transient 1-g, hypergravity and microgravity effects in living organisms in parallel. We found common and mutation-related genes differentially expressed in response to transient microgravity phases. Gene ontology analysis of common genes revealed lipid metabolism, response to stress factors and light categories as primarily involved in response to transient microgravity phases, suggesting that fundamental reorganisation of metabolic pathways functions upstream of a further signal mediating hormonal network. Gene expression changes in roots lacking the columella-located PIN3 were stronger than in those deprived of the epidermis and cortex cell-specific PIN2. Moreover, repetitive exposure to microgravity/hypergravity and gravity/hypergravity flight phases induced an up-regulation of auxin responsive genes in wild type and pin2 roots, but not in pin3 roots, suggesting a critical function of PIN3 in mediating auxin fluxes in response to transient microgravity phases. Our study provides important insights towards understanding signal transduction processes in transient microgravity conditions by combining for the first time the parabolic flight platform with the transcriptome analysis of different genetic mutants in the model plant, Arabidopsis.

  16. Altered gene expression in dry age-related macular degeneration suggests early loss of choroidal endothelial cells

    PubMed Central

    Whitmore, S. Scott; Braun, Terry A.; Skeie, Jessica M.; Haas, Christine M.; Sohn, Elliott H.; Stone, Edwin M.; Scheetz, Todd E.

    2013-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in developed countries. The molecular pathogenesis of early events in AMD is poorly understood. We investigated differential gene expression in samples of human retinal pigment epithelium (RPE) and choroid from early AMD and control maculas with exon-based arrays. Methods Gene expression levels in nine human donor eyes with early AMD and nine control human donor eyes were assessed using Affymetrix Human Exon ST 1.0 arrays. Two controls did not pass quality control and were removed. Differentially expressed genes were annotated using the Database for Annotation, Visualization and Integrated Discovery (DAVID), and gene set enrichment analysis (GSEA) was performed on RPE-specific and endothelium-associated gene sets. The complement factor H (CFH) genotype was also assessed, and differential expression was analyzed regarding high AMD risk (YH/HH) and low AMD risk (YY) genotypes. Results Seventy-five genes were identified as differentially expressed (raw p value <0.01; ≥50% fold change, mean log2 expression level in AMD or control ≥ median of all average gene expression values); however, no genes were significant (adj. p value <0.01) after correction for multiple hypothesis testing. Of 52 genes with decreased expression in AMD (fold change <0.5; raw p value <0.01), 18 genes were identified by DAVID analysis as associated with vision or neurologic processes. The GSEA of the RPE-associated and endothelium-associated genes revealed a significant decrease in genes typically expressed by endothelial cells in the early AMD group compared to controls, consistent with previous histologic and proteomic studies. Analysis of the CFH genotype indicated decreased expression of ADAMTS9 in eyes with high-risk genotypes (fold change = –2.61; raw p value=0.0008). Conclusions GSEA results suggest that RPE transcripts are preserved or elevated in early AMD, concomitant with loss of endothelial cell marker

  17. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  18. Time-Series Interactions of Gene Expression, Vascular Growth and Hemodynamics during Early Embryonic Arterial Development

    PubMed Central

    Goktas, Selda; Uslu, Fazil E.; Kowalski, William J.; Ermek, Erhan; Keller, Bradley B.

    2016-01-01

    The role of hemodynamic forces within the embryo as biomechanical regulators for cardiovascular morphogenesis, growth, and remodeling is well supported through the experimental studies. Furthermore, clinical experience suggests that perturbed flow disrupts the normal vascular growth process as one etiology for congenital heart diseases (CHD) and for fetal adaptation to CHD. However, the relationships between hemodynamics, gene expression and embryonic vascular growth are poorly defined due to the lack of concurrent, sequential in vivo data. In this study, a long-term, time-lapse optical coherence tomography (OCT) imaging campaign was conducted to acquire simultaneous blood velocity, pulsatile micro-pressure and morphometric data for 3 consecutive early embryonic stages in the chick embryo. In conjunction with the in vivo growth and hemodynamics data, in vitro reverse transcription polymerase chain reaction (RT-PCR) analysis was performed to track changes in transcript expression relevant to histogenesis and remodeling of the embryonic arterial wall. Our non-invasive extended OCT imaging technique for the microstructural data showed continuous vessel growth. OCT data coupled with the PIV technique revealed significant but intermitted increases in wall shear stress (WSS) between first and second assigned stages and a noticeable decrease afterwards. Growth rate, however, did not vary significantly throughout the embryonic period. Among all the genes studied, only the MMP-2 and CASP-3 expression levels remained unchanged during the time course. Concurrent relationships were obtained among the transcriptional modulation of the genes, vascular growth and hemodynamics-related changes. Further studies are indicated to determine cause and effect relationships and reversibility between mechanical and molecular regulation of vasculogenesis. PMID:27552150

  19. Time-Series Interactions of Gene Expression, Vascular Growth and Hemodynamics during Early Embryonic Arterial Development.

    PubMed

    Goktas, Selda; Uslu, Fazil E; Kowalski, William J; Ermek, Erhan; Keller, Bradley B; Pekkan, Kerem

    2016-01-01

    The role of hemodynamic forces within the embryo as biomechanical regulators for cardiovascular morphogenesis, growth, and remodeling is well supported through the experimental studies. Furthermore, clinical experience suggests that perturbed flow disrupts the normal vascular growth process as one etiology for congenital heart diseases (CHD) and for fetal adaptation to CHD. However, the relationships between hemodynamics, gene expression and embryonic vascular growth are poorly defined due to the lack of concurrent, sequential in vivo data. In this study, a long-term, time-lapse optical coherence tomography (OCT) imaging campaign was conducted to acquire simultaneous blood velocity, pulsatile micro-pressure and morphometric data for 3 consecutive early embryonic stages in the chick embryo. In conjunction with the in vivo growth and hemodynamics data, in vitro reverse transcription polymerase chain reaction (RT-PCR) analysis was performed to track changes in transcript expression relevant to histogenesis and remodeling of the embryonic arterial wall. Our non-invasive extended OCT imaging technique for the microstructural data showed continuous vessel growth. OCT data coupled with the PIV technique revealed significant but intermitted increases in wall shear stress (WSS) between first and second assigned stages and a noticeable decrease afterwards. Growth rate, however, did not vary significantly throughout the embryonic period. Among all the genes studied, only the MMP-2 and CASP-3 expression levels remained unchanged during the time course. Concurrent relationships were obtained among the transcriptional modulation of the genes, vascular growth and hemodynamics-related changes. Further studies are indicated to determine cause and effect relationships and reversibility between mechanical and molecular regulation of vasculogenesis. PMID:27552150

  20. Gene expression profiling and histomorphometric analyses of the early bone healing response around nanotextured implants

    PubMed Central

    Wazen, Rima M; Kuroda, Shingo; Nishio, Clarice; Sellin, Karine; Brunski, John B; Nanci, Antonio

    2013-01-01

    While in vitro studies have shown that nanoscale surface modifications influence cell fate and activity, there is little information on how they modulate healing at the bone–implant interface. Aim This study aims to investigate the effect of nanotopography at early time intervals when critical events for implant integration occur. Materials & methods Untreated and sulfuric acid/hydrogen peroxide-treated machined-surface titanium alloy implants were placed in rat tibiae. Samples were processed for DNA microarray analysis and histomorphometry. Results At both 3 and 5 days, the gene expression profile of the healing tissue around nanotextured implants differed from that around machined-surface implants or control empty holes, and were accompanied by an increase in bone–implant contact on day 5. While some standard pathways such as the immune response predominated, a number of unclassified genes were also implicated. Conclusion Nanotexture elicits an initial gene response that is more complex than suspected so far and favors healing at the bone–implant interface. PMID:23286527

  1. Hox and ParaHox gene expression in early body plan patterning of polyplacophoran mollusks

    PubMed Central

    Fritsch, Martin; Wollesen, Tim

    2016-01-01

    ABSTRACT Molecular developmental studies of various bilaterians have shown that the identity of the anteroposterior body axis is controlled by Hox and ParaHox genes. Detailed Hox and ParaHox gene expression data are available for conchiferan mollusks, such as gastropods (snails and slugs) and cephalopods (squids and octopuses), whereas information on the putative conchiferan sister group, Aculifera, is still scarce (but see Fritsch et al., 2015 on Hox gene expression in the polyplacophoran Acanthochitona crinita). In contrast to gastropods and cephalopods, the Hox genes in polyplacophorans are expressed in an anteroposterior sequence similar to the condition in annelids and other bilaterians. Here, we present the expression patterns of the Hox genes Lox5, Lox4, and Lox2, together with the ParaHox gene caudal (Cdx) in the polyplacophoran A. crinita. To localize Hox and ParaHox gene transcription products, we also investigated the expression patterns of the genes FMRF and Elav, and the development of the nervous system. Similar to the other Hox genes, all three Acr‐Lox genes are expressed in an anteroposterior sequence. Transcripts of Acr‐Cdx are seemingly present in the forming hindgut at the posterior end. The expression patterns of both the central class Acr‐Lox genes and the Acr‐Cdx gene are strikingly similar to those in annelids and nemerteans. In Polyplacophora, the expression patterns of the Hox and ParaHox genes seem to be evolutionarily highly conserved, while in conchiferan mollusks these genes are co‐opted into novel functions that might have led to evolutionary novelties, at least in gastropods and cephalopods. PMID:27098677

  2. Hox and ParaHox gene expression in early body plan patterning of polyplacophoran mollusks.

    PubMed

    Fritsch, Martin; Wollesen, Tim; Wanninger, Andreas

    2016-03-01

    Molecular developmental studies of various bilaterians have shown that the identity of the anteroposterior body axis is controlled by Hox and ParaHox genes. Detailed Hox and ParaHox gene expression data are available for conchiferan mollusks, such as gastropods (snails and slugs) and cephalopods (squids and octopuses), whereas information on the putative conchiferan sister group, Aculifera, is still scarce (but see Fritsch et al., 2015 on Hox gene expression in the polyplacophoran Acanthochitona crinita). In contrast to gastropods and cephalopods, the Hox genes in polyplacophorans are expressed in an anteroposterior sequence similar to the condition in annelids and other bilaterians. Here, we present the expression patterns of the Hox genes Lox5, Lox4, and Lox2, together with the ParaHox gene caudal (Cdx) in the polyplacophoran A. crinita. To localize Hox and ParaHox gene transcription products, we also investigated the expression patterns of the genes FMRF and Elav, and the development of the nervous system. Similar to the other Hox genes, all three Acr-Lox genes are expressed in an anteroposterior sequence. Transcripts of Acr-Cdx are seemingly present in the forming hindgut at the posterior end. The expression patterns of both the central class Acr-Lox genes and the Acr-Cdx gene are strikingly similar to those in annelids and nemerteans. In Polyplacophora, the expression patterns of the Hox and ParaHox genes seem to be evolutionarily highly conserved, while in conchiferan mollusks these genes are co-opted into novel functions that might have led to evolutionary novelties, at least in gastropods and cephalopods. PMID:27098677

  3. Catalase-independent early-gene expression in rat brain following acute ethanol exposure.

    PubMed

    Canales, Juan J

    2004-07-30

    Early-gene expression evoked by acute ethanol treatment was studied in rat brain by quantitative immunocytochemistry, with reference to ethanol metabolism by the enzyme catalase. Colocalization with mu-opioid receptor (MOR) sites was also examined. Ethanol challenges [1, 2.5, and 4 g/kg intraperitoneally (i.p.)] evoked dose-dependent increases in c-Fos expression in several brain regions, but overlap with MOR-rich sites was only partial. Strong inhibition of brain catalase activity (ca. 60%) with 3-amino-1,2,4-triazole (AT, 1 g/kg i.p.) did not alter ethanol-induced c-Fos nor Krox-24 expression in any of the brain regions analyzed. This evidence demonstrates that catalase-mediated metabolism is not a requisite for c-Fos nor Krox-24 induction in rat brain following acute ethanol treatment, and suggests that ethanol is by itself capable of eliciting strong neuronal and circuit-level adaptations in the nervous system.

  4. Loss of extra-striatal phosphodiesterase 10A expression in early premanifest Huntington's disease gene carriers.

    PubMed

    Wilson, Heather; Niccolini, Flavia; Haider, Salman; Marques, Tiago Reis; Pagano, Gennaro; Coello, Christopher; Natesan, Sridhar; Kapur, Shitij; Rabiner, Eugenii A; Gunn, Roger N; Tabrizi, Sarah J; Politis, Marios

    2016-09-15

    Huntington's disease (HD) is a monogenic neurodegenerative disorder with an underlying pathology involving the toxic effect of mutant huntingtin protein primarily in striatal and cortical neurons. Phosphodiesterase 10A (PDE10A) regulates intracellular signalling cascades, thus having a key role in promoting neuronal survival. Using positron emission tomography (PET) with [(11)C]IMA107, we investigated the in vivo extra-striatal expression of PDE10A in 12 early premanifest HD gene carriers. Image processing and kinetic modelling was performed using MIAKAT™. Parametric images of [(11)C]IMA107 non-displaceable binding potential (BPND) were generated from the dynamic [(11)C]IMA107 scans using the simplified reference tissue model with the cerebellum as the reference tissue for nonspecific binding. We set a threshold criterion for meaningful quantification of [(11)C]IMA107 BPND at 0.30 in healthy control data; regions meeting this criterion were designated as regions of interest (ROIs). MRI-based volumetric analysis showed no atrophy in ROIs. We found significant differences in mean ROIs [(11)C]IMA107 BPND between HD gene carriers and healthy controls. HD gene carriers had significant loss of PDE10A within the insular cortex and occipital fusiform gyrus compared to healthy controls. Insula and occipital fusiform gyrus are important brain areas for the regulation of cognitive and limbic function that is impaired in HD. Our findings suggest that dysregulation of PDE10A-mediated intracellular signalling could be an early phenomenon in the course of HD with relevance also for extra-striatal brain areas.

  5. Loss of extra-striatal phosphodiesterase 10A expression in early premanifest Huntington's disease gene carriers.

    PubMed

    Wilson, Heather; Niccolini, Flavia; Haider, Salman; Marques, Tiago Reis; Pagano, Gennaro; Coello, Christopher; Natesan, Sridhar; Kapur, Shitij; Rabiner, Eugenii A; Gunn, Roger N; Tabrizi, Sarah J; Politis, Marios

    2016-09-15

    Huntington's disease (HD) is a monogenic neurodegenerative disorder with an underlying pathology involving the toxic effect of mutant huntingtin protein primarily in striatal and cortical neurons. Phosphodiesterase 10A (PDE10A) regulates intracellular signalling cascades, thus having a key role in promoting neuronal survival. Using positron emission tomography (PET) with [(11)C]IMA107, we investigated the in vivo extra-striatal expression of PDE10A in 12 early premanifest HD gene carriers. Image processing and kinetic modelling was performed using MIAKAT™. Parametric images of [(11)C]IMA107 non-displaceable binding potential (BPND) were generated from the dynamic [(11)C]IMA107 scans using the simplified reference tissue model with the cerebellum as the reference tissue for nonspecific binding. We set a threshold criterion for meaningful quantification of [(11)C]IMA107 BPND at 0.30 in healthy control data; regions meeting this criterion were designated as regions of interest (ROIs). MRI-based volumetric analysis showed no atrophy in ROIs. We found significant differences in mean ROIs [(11)C]IMA107 BPND between HD gene carriers and healthy controls. HD gene carriers had significant loss of PDE10A within the insular cortex and occipital fusiform gyrus compared to healthy controls. Insula and occipital fusiform gyrus are important brain areas for the regulation of cognitive and limbic function that is impaired in HD. Our findings suggest that dysregulation of PDE10A-mediated intracellular signalling could be an early phenomenon in the course of HD with relevance also for extra-striatal brain areas. PMID:27538642

  6. Identification of ocular dominance domains in New World owl monkeys by immediate-early gene expression.

    PubMed

    Takahata, Toru; Miyashita, Masanobu; Tanaka, Shigeru; Kaas, Jon H

    2014-03-18

    Ocular dominance columns (ODCs) have been well studied in the striate cortex (V1) of macaques, as well defined arrays of columnar structure that receive inputs from one eye or the other, whereas ODC expression seems more obscure in some New World primate species. ODCs have been identified by means of eye injections of transneuronal transporters and examination of cytochrome oxidase (CO) activity patterns after monocular enucleation. More recently, live-imaging techniques have been used to reveal ODCs. Here, we used the expression of immediate-early genes (IEGs), protooncogene, c-Fos, and zinc finger protein, Zif268, after monocular inactivation (MI) to identify ODCs in V1 of New World owl monkeys. Because IEG expression is more sensitive to activity changes than CO expression, it is capable of revealing activity maps in all layers throughout V1 and demonstrating brief activity changes within a couple of hours. Using IEGs, we not only revealed apparent ODCs in owl monkeys but also discovered a number of unique features of their ODCs. Distinct from those in macaques, these ODCs sometimes bridged to other columns in layer 4 (Brodmann layer 4C). CO blobs straddled ODC borders in the central visual field, whereas they centered ODC patches in the peripheral visual field. In one case, the ODC pattern continued into V2. Finally, an elevation of IEG expression in layer 4 (4C) was observed along ODC borders after only brief MI. Our data provide insights into the structure and variability of ODCs in primates and revive debate over the functions and development of ODCs.

  7. Rhesus glycoprotein and urea transporter genes are expressed in early stages of development of rainbow trout (Oncorhynchus mykiss).

    PubMed

    Hung, Carrie C; Nawata, C Michele; Wood, Chris M; Wright, Patricia A

    2008-06-01

    The objective of this study was to determine if the genes for the putative ammonia transporters, Rhesus glycoproteins (Rh) and the facilitated urea transporter (UT) were expressed during early development of rainbow trout, Oncorhynchus mykiss Walbaum. We predicted that the Rh isoforms Rhbg, Rhcg1 and Rhcg2 would be expressed shortly after fertilization but UT expression would be delayed based on the ontogenic pattern of nitrogen excretion. Embryos were collected 3, 14 and 21 days postfertilization (dpf), whereas yolk sac larvae were sampled at 31 dpf and juveniles at 60 dpf (complete yolk absorption). mRNA levels were quantified using quantitative polymerase chain reaction and expressed relative to the control gene, elongation factor 1alpha. All four genes (Rhbg, Rhcg1, Rhcg2, UT) were detected before hatching (25-30 dpf). As predicted, the mRNA levels of the Rh genes, especially Rhcg2, were relatively high early in embryonic development (14 and 21 dpf), but UT mRNA levels remained low until after hatching (31 and 60 dpf). These findings are consistent with the pattern of nitrogen excretion in early stages of trout development. We propose that early expression of Rh genes is critical for the elimination of potentially toxic ammonia from the encapsulated embryo, whereas retention of the comparatively benign urea molecule until after hatch is less problematic for developing tissues and organ systems.

  8. Single-cell gene expression analyses of cellular reprogramming reveal a stochastic early and hierarchic late phase

    PubMed Central

    Buganim, Yosef; Faddah, Dina A.; Cheng, Albert W.; Itskovich, Elena; Markoulaki, Styliani; Ganz, Kibibi; Klemm, Sandy L.; van Oudenaarden, Alexander; Jaenisch, Rudolf

    2012-01-01

    During cellular reprogramming only a small fraction of cells become induced pluripotent stem cells (iPSCs). Previous analyses of gene expression during reprogramming were based on populations of cells, impeding single-cell level identification of reprogramming events. We utilized two gene expression technologies to profile 48 genes in single cells at various stages during the reprogramming process. Analysis of early stages revealed considerable variation in gene expression between cells in contrast to late stages. Expression of Esrrb, Utf1, Lin28, and Dppa2 is a better predictor for cells to progress into iPSCs than expression of Fbxo15, Fgf4, and Oct4 previously suggested to be reprogramming markers. Stochastic gene expression early in reprogramming is followed by a late hierarchical phase with Sox2 being the upstream factor in a gene expression hierarchy. Finally, downstream factors derived from the late phase, which do not include Oct4, Sox2, Klf4, c-Myc and Nanog, can activate the pluripotency circuitry. PMID:22980981

  9. Specifically Expressed Genes of the Nematode Bursaphelenchus Xylophilus Involved with Early Interactions with Pine Trees

    PubMed Central

    Qiu, Xiuwen; Wu, Xiaoqin; Huang, Lin; Tian, Minqi; Ye, Jianren

    2013-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. However, the pathogenesis-related genes of B. xylophilus are not well characterized. Thus, DNA microarrays were used to investigate differential gene expression in PWN where Pinus thunbergii was inoculated with nematodes, compared with those cultured on Botrytis cinerea. The microarrays comprised 31121 probes, 1310 (4.2%) of which were differentially regulated (changes of >2-fold, P < 0.01) in the two growth conditions. Of these 1310 genes, 633 genes were upregulated, whereas 677 genes were downregulated. Gene Ontology (GO) categories were assigned to the classes Cellular Component, Molecular Function, and Biological Process. The comparative gene expression analysis showed that a large number of the pathogenesis-related genes of B. xylophilus, such as pectate lyase genes, cytochrome P450s, UGTs, and ABC transporter genes, were highly expressed when B. xylophilus infected P. thunbergii. Annotation analysis indicated that these genes contributed to cell wall degradation, detoxification, and the reproduction process. The microarray results were validated using quantitative RT-PCR (qRT-PCR). The microarray data confirmed the specific expression of B. xylophilus genes during infection of P. thunbergii, which provides basic information that facilitates a better understanding of the molecular mechanism of PWD. PMID:24155981

  10. Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor.

    PubMed Central

    Mann, S K; Firtel, R A

    1987-01-01

    We examined two sets of genes expressed early in the developmental cycle of Dictyostelium discoideum that appear to be regulated by cyclic AMP (cAMP). The transcripts of both sets of genes were not detectable in vegetative cells. During normal development on filter pads, RNA complementary to these genes could be detected at about 2 h, peaked around 6 to 8 h, and decreased gradually thereafter. Expression of these genes upon starvation in shaking culture was stimulated by pulsing the cells with nanomolar levels of cAMP, a condition that mimics the in vivo pulsing during normal aggregation. Expression was inhibited by caffeine or by continuous levels of cAMP, a condition found later in development when in vivo expression of these genes decreased. The inhibition of caffeine could be overcome by pulsing cells with cAMP. These results suggest that the expression is mediated via the cell surface cAMP receptor, but does not require a rise in intracellular cAMP. mRNA from a gene of the second class was induced upon starvation, peaked by 2.5 h of development, and then declined. In contrast to the other genes, its expression was maintained by continuous levels of cAMP and repressed by cAMP pulses. These and other results on a number of classes of developmentally regulated genes indicates that changing levels of cAMP, acting via the cell surface cAMP receptor, are involved in controlling these groups of genes. We also examined the structure and partial sequence of the cAMP pulse-induced genes. The two tandemly duplicated M3 genes were almost continuously homologous over the sequenced portion of the protein-coding region except for a region near the N-terminal end. The two M3 genes had regions of homology in the 5' flanking sequence and showed slight homology to the same regions in gene D2, another cAMP pulse-induced gene. D2 showed extremely significant homology over its entire sequenced length to an acetylcholinesterase. The results presented here and by others suggest that

  11. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  12. Gene expression patterns during the early stages of chemically induced larval metamorphosis and settlement of the coral Acropora millepora.

    PubMed

    Siboni, Nachshon; Abrego, David; Motti, Cherie A; Tebben, Jan; Harder, Tilmann

    2014-01-01

    The morphogenetic transition of motile coral larvae into sessile primary polyps is triggered and genetically programmed upon exposure to environmental biomaterials, such as crustose coralline algae (CCA) and bacterial biofilms. Although the specific chemical cues that trigger coral larval morphogenesis are poorly understood there is much more information available on the genes that play a role in this early life phase. Putative chemical cues from natural biomaterials yielded defined chemical samples that triggered different morphogenetic outcomes: an extract derived from a CCA-associated Pseudoalteromonas bacterium that induced metamorphosis, characterized by non-attached metamorphosed juveniles; and two fractions of the CCA Hydrolithon onkodes (Heydrich) that induced settlement, characterized by attached metamorphosed juveniles. In an effort to distinguish the genes involved in these two morphogenetic transitions, competent larvae of the coral Acropora millepora were exposed to these predictable cues and the expression profiles of 47 coral genes of interest (GOI) were investigated after only 1 hour of exposure using multiplex RT-qPCR. Thirty-two GOI were differentially expressed, indicating a putative role during the early regulation of morphogenesis. The most striking differences were observed for immunity-related genes, hypothesized to be involved in cell recognition and adhesion, and for fluorescent protein genes. Principal component analysis of gene expression profiles resulted in separation between the different morphogenetic cues and exposure times, and not only identified those genes involved in the early response but also those which influenced downstream biological changes leading to larval metamorphosis or settlement.

  13. A Digital Framework to Build, Visualize and Analyze a Gene Expression Atlas with Cellular Resolution in Zebrafish Early Embryogenesis

    PubMed Central

    Castro-González, Carlos; Luengo-Oroz, Miguel A.; Duloquin, Louise; Savy, Thierry; Rizzi, Barbara; Desnoulez, Sophie; Doursat, René; Kergosien, Yannick L.; Ledesma-Carbayo, María J.; Bourgine, Paul

    2014-01-01

    A gene expression atlas is an essential resource to quantify and understand the multiscale processes of embryogenesis in time and space. The automated reconstruction of a prototypic 4D atlas for vertebrate early embryos, using multicolor fluorescence in situ hybridization with nuclear counterstain, requires dedicated computational strategies. To this goal, we designed an original methodological framework implemented in a software tool called Match-IT. With only minimal human supervision, our system is able to gather gene expression patterns observed in different analyzed embryos with phenotypic variability and map them onto a series of common 3D templates over time, creating a 4D atlas. This framework was used to construct an atlas composed of 6 gene expression templates from a cohort of zebrafish early embryos spanning 6 developmental stages from 4 to 6.3 hpf (hours post fertilization). They included 53 specimens, 181,415 detected cell nuclei and the segmentation of 98 gene expression patterns observed in 3D for 9 different genes. In addition, an interactive visualization software, Atlas-IT, was developed to inspect, supervise and analyze the atlas. Match-IT and Atlas-IT, including user manuals, representative datasets and video tutorials, are publicly and freely available online. We also propose computational methods and tools for the quantitative assessment of the gene expression templates at the cellular scale, with the identification, visualization and analysis of coexpression patterns, synexpression groups and their dynamics through developmental stages. PMID:24945246

  14. The GATA transcription factor GtaC regulates early developmental gene expression dynamics in Dictyostelium

    PubMed Central

    Santhanam, Balaji; Cai, Huaqing; Devreotes, Peter N.; Shaulsky, Gad; Katoh-Kurasawa, Mariko

    2015-01-01

    In many systems, including the social amoeba Dictyostelium discoideum, development is often marked by dynamic morphological and transcriptional changes orchestrated by key transcription factors. However, efforts to examine sequential genome-wide changes of gene regulation in developmental processes have been fairly limited. Here we report the developmental regulatory dynamics of GtaC, a GATA-type zinc-finger transcription factor, through the analyses of serial ChIP- and RNA-sequencing data. GtaC is essential for developmental progression, decoding extracellular cAMP pulses during early development and may play a role in mediating cell-type differentiation at later stages. We find that GtaC exhibits temporally distinctive DNA-binding patterns concordant with each developmental stage. We identify direct GtaC targets and observe cotemporaneous GtaC-binding and developmental expression regulation. Our results suggest that GtaC regulates multiple physiological processes as Dictyostelium transitions from a group of unicellular amoebae to an integrated multicellular organism. PMID:26144553

  15. Early IL-4 gene expression in abomasum is associated with resistance to Haemonchus contortus in hair and wool sheep breeds.

    PubMed

    Jacobs, J R; Sommers, K N; Zajac, A M; Notter, D R; Bowdridge, S A

    2016-06-01

    Early immune events associated with reduced larval burden remain unclear in parasite-resistant breeds of sheep. Therefore, our objective was to determine breed differences in immune-related gene expression following infection with H. contortus. Gene expression in abomasal tissue and mucosa and in abomasal lymph nodes (ALN) was measured in 24 St. Croix (hair) lambs and 24 Dorset x (Finn-Rambouillet) (wool) lambs at 0 (uninfected), 3, 5 and 7 days after infection with 10 000 L3 H. contortus larvae. Expression of IL-4 in abomasal mucosa was detected on day 3 and increased to day 7 in hair lambs, but was not detectable in wool lambs. Genes that recruit neutrophils (CXCL1) and macrophages (MCP1) were upregulated in abomasal mucosa of hair lambs. Genes associated with alternative macrophage activation (ARG-1) and eosinophil activation (Gal-14) were also upregulated in the abomasal mucosa of hair lambs. Tissue remodeling genes (MMP13, PDGF) and tumour necrosis factor alpha (TNF-α) and MCP1 were upregulated in abomasal tissue of wool lambs; these lambs also had greater expression of forkhead box P3 in ALN. These data indicate a role for early IL-4 expression locally and demonstrate potential downregulation of immunity in wool sheep that could facilitate establishment of H. contortus.

  16. Hedgehog pathway gene expression during early development of the molar tooth root in the mouse.

    PubMed

    Khan, Mohammed; Seppala, Maisa; Zoupa, Maria; Cobourne, Martyn T

    2007-01-01

    Sonic hedgehog is a secreted protein important for many aspects of embryonic development. In the developing tooth, Shh expression is restricted to the epithelial compartment and plays an important role during both initiation and subsequent coronal morphogenesis. We have investigated the expression of Shh and constituent members of the signalling pathway during early development of the molar tooth root in the mouse and find the presence of transcripts in Hertwig's epithelial root sheath. These epithelial cells of the root sheath and the surrounding apical mesenchyme of the dental papilla and follicle also expressed the Shh receptor Ptc1, agonist Smo and Gli downstream transcriptional effectors; however, this response occurred over short range. In contrast, the Shh antagonists Hip1 and Gas1 were both expressed at a distance from these responding cells, in more peripheral regions of the developing root. Transcripts of the Skn acyl transferase lacked specific expression in early root structures.

  17. Amygdala kindling potentiates seizure-stimulated immediate-early gene expression in rat cerebral cortex.

    PubMed

    Duman, R S; Craig, J S; Winston, S M; Deutch, A Y; Hernandez, T D

    1992-11-01

    Kindling induces long-term adaptations in neuronal function that lead to a decreased threshold for induction of seizures. In the present study, the influence of amygdala kindling on levels of mRNA for the immediate-early genes (IEGs) c-fos, c-jun, and NGF1-A were examined both before and after an acute electroconvulsive seizure (ECS). Although amygdala kindling did not significantly influence resting levels of c-fos mRNA in cerebral cortex, ECS-stimulated levels of c-fos mRNA (examined 45 min after ECS) were approximately twofold greater in the cerebral cortex of kindled rats relative to sham-treated controls. The influence of kindling on IEG expression was dependent on the time course of kindling, as ECS-stimulated levels of c-fos mRNA were not significantly increased in stage 2 kindled animals. ECS-stimulated levels of c-jun and NGF1-A mRNA were also significantly increased in cerebral cortex of kindled rats relative to sham-treated controls. The influence of kindling on IEG expression was long-lasting because an acute ECS stimulus significantly elevated levels of c-fos and c-jun mRNA in the cerebral cortex of animals that were kindled 5 months previously. In contrast to these effects in cerebral cortex, kindling did not influence ECS-stimulated levels of c-fos mRNA in hippocampus. Finally, immunohistochemical studies revealed lamina-specific changes in the cerebral cortex.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Early diffusion of gene expression profiling in breast cancer patients associated with areas of high income inequality.

    PubMed

    Ponce, Ninez A; Ko, Michelle; Liang, Su-Ying; Armstrong, Joanne; Toscano, Michele; Chanfreau-Coffinier, Catherine; Haas, Jennifer S

    2015-04-01

    With the Affordable Care Act reducing coverage disparities, social factors could prominently determine where and for whom innovations first diffuse in health care markets. Gene expression profiling is a potentially cost-effective innovation that guides chemotherapy decisions in early-stage breast cancer, but adoption has been uneven across the United States. Using a sample of commercially insured women, we evaluated whether income inequality in metropolitan areas was associated with receipt of gene expression profiling during its initial diffusion in 2006-07. In areas with high income inequality, gene expression profiling receipt was higher than elsewhere, but it was associated with a 10.6-percentage-point gap between high- and low-income women. In areas with low rates of income inequality, gene expression profiling receipt was lower, with no significant differences by income. Even among insured women, income inequality may indirectly shape diffusion of gene expression profiling, with benefits accruing to the highest-income patients in the most unequal places. Policies reducing gene expression profiling disparities should address low-inequality areas and, in unequal places, practice settings serving low-income patients.

  19. Levetiracetam attenuates hippocampal expression of synaptic plasticity-related immediate early and late response genes in amygdala-kindled rats

    PubMed Central

    2010-01-01

    Background The amygdala-kindled rat is a model for human temporal lobe epilepsy and activity-dependent synaptic plasticity. Hippocampal RNA isolated from amygdala-kindled rats at different kindling stages was analyzed to identify kindling-induced genes. Furthermore, effects of the anti-epileptic drug levetiracetam on kindling-induced gene expression were examined. Results Cyclooxygenase-2 (Cox-2), Protocadherin-8 (Pcdh8) and TGF-beta-inducible early response gene-1 (TIEG1) were identified and verified as differentially expressed transcripts in the hippocampus of kindled rats by in situ hybridization and quantitative RT-PCR. In addition, we identified a panel of 16 additional transcripts which included Arc, Egr3/Pilot, Homer1a, Ania-3, MMP9, Narp, c-fos, NGF, BDNF, NT-3, Synaptopodin, Pim1 kinase, TNF-α, RGS2, Egr2/krox-20 and β-A activin that were differentially expressed in the hippocampus of amygdala-kindled rats. The list consists of many synaptic plasticity-related immediate early genes (IEGs) as well as some late response genes encoding transcription factors, neurotrophic factors and proteins that are known to regulate synaptic remodelling. In the hippocampus, induction of IEG expression was dependent on the afterdischarge (AD) duration. Levetiracetam, 40 mg/kg, suppressed the development of kindling measured as severity of seizures and AD duration. In addition, single animal profiling also showed that levetiracetam attenuated the observed kindling-induced IEG expression; an effect that paralleled the anti-epileptic effect of the drug on AD duration. Conclusions The present study provides mRNA expression data that suggest that levetiracetam attenuates expression of genes known to regulate synaptic remodelling. In the kindled rat, levetiracetam does so by shortening the AD duration thereby reducing the seizure-induced changes in mRNA expression in the hippocampus. PMID:20105316

  20. Myocardial alternative RNA splicing and gene expression profiling in early stage hypoplastic left heart syndrome.

    PubMed

    Ricci, Marco; Xu, Yanji; Hammond, Harriet L; Willoughby, David A; Nathanson, Lubov; Rodriguez, Maria M; Vatta, Matteo; Lipshultz, Steven E; Lincoln, Joy

    2012-01-01

    Hypoplastic Left Heart Syndrome (HLHS) is a congenital defect characterized by underdevelopment of the left ventricle and pathological compensation of the right ventricle. If untreated, HLHS is invariably lethal due to the extensive increase in right ventricular workload and eventual failure. Despite the clinical significance, little is known about the molecular pathobiological state of HLHS. Splicing of mRNA transcripts is an important regulatory mechanism of gene expression. Tissue specific alterations of this process have been associated with several cardiac diseases, however, transcriptional signature profiles related to HLHS are unknown. In this study, we performed genome-wide exon array analysis to determine differentially expressed genes and alternatively spliced transcripts in the right ventricle (RV) of six neonates with HLHS, compared to the RV and left ventricle (LV) from non-diseased control subjects. In HLHS, over 180 genes were differentially expressed and 1800 were differentially spliced, leading to changes in a variety of biological processes involving cell metabolism, cytoskeleton, and cell adherence. Additional hierarchical clustering analysis revealed that differential gene expression and mRNA splicing patterns identified in HLHS are unique compared to non-diseased tissue. Our findings suggest that gene expression and mRNA splicing are broadly dysregulated in the RV myocardium of HLHS neonates. In addition, our analysis identified transcriptome profiles representative of molecular biomarkers of HLHS that could be used in the future for diagnostic and prognostic stratification to improve patient outcome.

  1. Expression of the immediate-early gene-encoded protein Egr-1 (zif268) during in vitro classical conditioning.

    PubMed

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink classical conditioning. The results showed that Egr-1 protein expression as determined by immunocytochemistry and Western blot analysis rapidly increased during the early stages of conditioning and remained elevated during the later stages. Further, expression of Egr-1 protein required NMDA receptor activation as it was blocked by bath application of AP-5. These findings suggest that the IEG-encoded proteins such as Egr-1 are activated during relatively simple forms of learning in vertebrates. In this case, Egr-1 may have a functional role in the acquisition phase of conditioning as well as in maintaining expression of conditioned responses.

  2. Progression of Gene Expression Changes following a Mechanical Injury to Articular Cartilage as a Model of Early Stage Osteoarthritis

    PubMed Central

    McCulloch, R. S.; Ashwell, M. S.; Maltecca, C.; O'Nan, A. T.; Mente, P. L.

    2014-01-01

    An impact injury model of early stage osteoarthritis (OA) progression was developed using a mechanical insult to an articular cartilage surface to evaluate differential gene expression changes over time and treatment. Porcine patellae with intact cartilage surfaces were randomized to one of three treatments: nonimpacted control, axial impaction (2000 N), or a shear impaction (500 N axial, with tangential displacement to induce shear forces). After impact, the patellae were returned to culture for 0, 3, 7, or 14 days. At the appropriate time point, RNA was extracted from full-thickness cartilage slices at the impact site. Quantitative real-time PCR was used to evaluate differential gene expression for 18 OA related genes from four categories: cartilage matrix, degradative enzymes and inhibitors, inflammatory response and signaling, and cell apoptosis. The shear impacted specimens were compared to the axial impacted specimens and showed that shear specimens more highly expressed type I collagen (Col1a1) at the early time points. In addition, there was generally elevated expression of degradative enzymes, inflammatory response genes, and apoptosis markers at the early time points. These changes suggest that the more physiologically relevant shear loading may initially be more damaging to the cartilage and induces more repair efforts after loading. PMID:25478225

  3. Microarray Expression Data Identify DCC as a Candidate Gene for Early Meningioma Progression

    PubMed Central

    Schulten, Hans-Juergen; Hussein, Deema; Al-Adwani, Fatima; Karim, Sajjad; Al-Maghrabi, Jaudah; Al-Sharif, Mona; Jamal, Awatif; Al-Ghamdi, Fahad; Baeesa, Saleh S.; Bangash, Mohammed; Chaudhary, Adeel; Al-Qahtani, Mohammed

    2016-01-01

    Meningiomas are the most common primary brain tumors bearing in a minority of cases an aggressive phenotype. Although meningiomas are stratified according to their histology and clinical behavior, the underlying molecular genetics predicting aggressiveness are not thoroughly understood. We performed whole transcript expression profiling in 10 grade I and four grade II meningiomas, three of which invaded the brain. Microarray expression analysis identified deleted in colorectal cancer (DCC) as a differentially expressed gene (DEG) enabling us to cluster meningiomas into DCC low expression (3 grade I and 3 grade II tumors), DCC medium expression (2 grade I and 1 grade II tumors), and DCC high expression (5 grade I tumors) groups. Comparison between the DCC low expression and DCC high expression groups resulted in 416 DEGs (p-value < 0.05; fold change > 2). The most significantly downregulated genes in the DCC low expression group comprised DCC, phosphodiesterase 1C (PDE1C), calmodulin-dependent 70kDa olfactomedin 2 (OLFM2), glutathione S-transferase mu 5 (GSTM5), phosphotyrosine interaction domain containing 1 (PID1), sema domain, transmembrane domain (TM) and cytoplasmic domain, (semaphorin) 6D (SEMA6D), and indolethylamine N-methyltransferase (INMT). The most significantly upregulated genes comprised chromosome 5 open reading frame 63 (C5orf63), homeodomain interacting protein kinase 2 (HIPK2), and basic helix-loop-helix family, member e40 (BHLHE40). Biofunctional analysis identified as predicted top upstream regulators beta-estradiol, TGFB1, Tgf beta complex, LY294002, and dexamethasone and as predicted top regulator effectors NFkB, PIK3R1, and CREBBP. The microarray expression data served also for a comparison between meningiomas from female and male patients and for a comparison between brain invasive and non-invasive meningiomas resulting in a number of significant DEGs and related biofunctions. In conclusion, based on its expression levels, DCC may constitute

  4. Expression of opsin genes early in ocular development of humans and mice.

    PubMed

    Tarttelin, Emma E; Bellingham, James; Bibb, Lindsay C; Foster, Russell G; Hankins, Mark W; Gregory-Evans, Kevin; Gregory-Evans, Cheryl Y; Wells, Dominic J; Lucas, Robert J

    2003-03-01

    We have compared the onsets of expression of the classical visual opsins with those of the non-rod, non-cone opsins in foetal and post-natal eye tissue from mice and humans. Mouse Rgr-opsin, peropsin, encephalopsin and melanopsin are all expressed in foetal development by E11.5, unlike the murine rod and cone opsins that exhibit post-natal expression, e.g. P1 for ultraviolet cone opsin and P5 for rod opsin. Human non-rod, non-cone opsins are also all expressed early, by 8.6 weeks post-conception. The implications of these observations are discussed with regard to the possible functions of these opsins at early stages of ocular development.

  5. Meta-analysis of differentiating mouse embryonic stem cell gene expression kinetics reveals early change of a small gene set.

    PubMed

    Glover, Clive H; Marin, Michael; Eaves, Connie J; Helgason, Cheryl D; Piret, James M; Bryan, Jennifer

    2006-11-24

    Stem cell differentiation involves critical changes in gene expression. Identification of these should provide endpoints useful for optimizing stem cell propagation as well as potential clues about mechanisms governing stem cell maintenance. Here we describe the results of a new meta-analysis methodology applied to multiple gene expression datasets from three mouse embryonic stem cell (ESC) lines obtained at specific time points during the course of their differentiation into various lineages. We developed methods to identify genes with expression changes that correlated with the altered frequency of functionally defined, undifferentiated ESC in culture. In each dataset, we computed a novel statistical confidence measure for every gene which captured the certainty that a particular gene exhibited an expression pattern of interest within that dataset. This permitted a joint analysis of the datasets, despite the different experimental designs. Using a ranking scheme that favored genes exhibiting patterns of interest, we focused on the top 88 genes whose expression was consistently changed when ESC were induced to differentiate. Seven of these (103728_at, 8430410A17Rik, Klf2, Nr0b1, Sox2, Tcl1, and Zfp42) showed a rapid decrease in expression concurrent with a decrease in frequency of undifferentiated cells and remained predictive when evaluated in additional maintenance and differentiating protocols. Through a novel meta-analysis, this study identifies a small set of genes whose expression is useful for identifying changes in stem cell frequencies in cultures of mouse ESC. The methods and findings have broader applicability to understanding the regulation of self-renewal of other stem cell types.

  6. Characterization and target genes of nine human PRD-like homeobox domain genes expressed exclusively in early embryos

    PubMed Central

    Madissoon, Elo; Jouhilahti, Eeva-Mari; Vesterlund, Liselotte; Töhönen, Virpi; Krjutškov, Kaarel; Petropoulous, Sophie; Einarsdottir, Elisabet; Linnarsson, Sten; Lanner, Fredrik; Månsson, Robert; Hovatta, Outi; Bürglin, Thomas R.; Katayama, Shintaro; Kere, Juha

    2016-01-01

    PAIRED (PRD)-like homeobox genes belong to a class of predicted transcription factor genes. Several of these PRD-like homeobox genes have been predicted in silico from genomic sequence but until recently had no evidence of transcript expression. We found recently that nine PRD-like homeobox genes, ARGFX, CPHX1, CPHX2, DPRX, DUXA, DUXB, NOBOX, TPRX1 and TPRX2, were expressed in human preimplantation embryos. In the current study we characterized these PRD-like homeobox genes in depth and studied their functions as transcription factors. We cloned multiple transcript variants from human embryos and showed that the expression of these genes is specific to embryos and pluripotent stem cells. Overexpression of the genes in human embryonic stem cells confirmed their roles as transcription factors as either activators (CPHX1, CPHX2, ARGFX) or repressors (DPRX, DUXA, TPRX2) with distinct targets that could be explained by the amino acid sequence in homeodomain. Some PRD-like homeodomain transcription factors had high concordance of target genes and showed enrichment for both developmentally important gene sets and a 36 bp DNA recognition motif implicated in Embryo Genome Activation (EGA). Our data implicate a role for these previously uncharacterized PRD-like homeodomain proteins in the regulation of human embryo genome activation and preimplantation embryo development. PMID:27412763

  7. Characterization and target genes of nine human PRD-like homeobox domain genes expressed exclusively in early embryos

    PubMed Central

    Madissoon, Elo; Jouhilahti, Eeva-Mari; Vesterlund, Liselotte; Töhönen, Virpi; Krjutškov, Kaarel; Petropoulous, Sophie; Einarsdottir, Elisabet; Linnarsson, Sten; Lanner, Fredrik; Månsson, Robert; Hovatta, Outi; Bürglin, Thomas R.; Katayama, Shintaro; Kere, Juha

    2016-01-01

    PAIRED (PRD)-like homeobox genes belong to a class of predicted transcription factor genes. Several of these PRD-like homeobox genes have been predicted in silico from genomic sequence but until recently had no evidence of transcript expression. We found recently that nine PRD-like homeobox genes, ARGFX, CPHX1, CPHX2, DPRX, DUXA, DUXB, NOBOX, TPRX1 and TPRX2, were expressed in human preimplantation embryos. In the current study we characterized these PRD-like homeobox genes in depth and studied their functions as transcription factors. We cloned multiple transcript variants from human embryos and showed that the expression of these genes is specific to embryos and pluripotent stem cells. Overexpression of the genes in human embryonic stem cells confirmed their roles as transcription factors as either activators (CPHX1, CPHX2, ARGFX) or repressors (DPRX, DUXA, TPRX2) with distinct targets that could be explained by the amino acid sequence in homeodomain. Some PRD-like homeodomain transcription factors had high concordance of target genes and showed enrichment for both developmentally important gene sets and a 36 bp DNA recognition motif implicated in Embryo Genome Activation (EGA). Our data implicate a role for these previously uncharacterized PRD-like homeodomain proteins in the regulation of human embryo genome activation and preimplantation embryo development. PMID:27412763

  8. Gene expression of four adhesive proteins in the early healing of bone defect and bone-implant interface.

    PubMed

    Zhang, Ting; Xia, Haibin; Wang, Yining; Peng, Cong; Li, Yuhong; Pan, Xinhua

    2006-01-01

    The objective of this study was to evaluate the gene expression of four bone-related adhesive proteins during the early healing of bone defect and bone-implant interface in animal experiments. T-shaped hollow pure titanium implants with dual acid-etched surfaces were placed into femurs of 17 Sprague-Dawley rats, and bone defects with the same size were made in the same site in 15 rats. Newly formed bone was harvested at 5 days, 8 days and 16 days respectively. The gene expression of fibronectin (FN), collagen I (COL I), bone sialoprotein II (BSP II) and osteopontin (OPN) in non-implant and bone-implant defects were examined using semi-quantity reverse transcription-polymerase chain reaction. The gene expression of OPN in the non-implant defect was slightly higher than that in the bone-implant interface. At 8 days postoperation, FN, COL I and BSP II expression were significantly up-regulated in the bone-implant group. All four proteins peaked at 8 days. The results indicate that the gene expression of the four adhesive proteins is different between bone defect and bone-implant interface. Intracellular synthesis of FN, COL I and BSP II was accelerated in the early healing stages of the bone-implant interface. PMID:17946089

  9. Satb1 Ablation Alters Temporal Expression of Immediate Early Genes and Reduces Dendritic Spine Density during Postnatal Brain Development

    PubMed Central

    Balamotis, Michael A.; Tamberg, Nele; Woo, Young Jae; Li, Jingchuan; Davy, Brian

    2012-01-01

    Complex behaviors, such as learning and memory, are associated with rapid changes in gene expression of neurons and subsequent formation of new synaptic connections. However, how external signals are processed to drive specific changes in gene expression is largely unknown. We found that the genome organizer protein Satb1 is highly expressed in mature neurons, primarily in the cerebral cortex, dentate hilus, and amygdala. In Satb1-null mice, cortical layer morphology was normal. However, in postnatal Satb1-null cortical pyramidal neurons, we found a substantial decrease in the density of dendritic spines, which play critical roles in synaptic transmission and plasticity. Further, we found that in the cerebral cortex, Satb1 binds to genomic loci of multiple immediate early genes (IEGs) (Fos, Fosb, Egr1, Egr2, Arc, and Bdnf) and other key neuronal genes, many of which have been implicated in synaptic plasticity. Loss of Satb1 resulted in greatly alters timing and expression levels of these IEGs during early postnatal cerebral cortical development and also upon stimulation in cortical organotypic cultures. These data indicate that Satb1 is required for proper temporal dynamics of IEG expression. Based on these findings, we propose that Satb1 plays a critical role in cortical neurons to facilitate neuronal plasticity. PMID:22064485

  10. Dietary tomato and lycopene impact androgen signaling- and carcinogenesis-related gene expression during early TRAMP prostate carcinogenesis.

    PubMed

    Wan, Lei; Tan, Hsueh-Li; Thomas-Ahner, Jennifer M; Pearl, Dennis K; Erdman, John W; Moran, Nancy E; Clinton, Steven K

    2014-12-01

    Consumption of tomato products containing the carotenoid lycopene is associated with a reduced risk of prostate cancer. To identify gene expression patterns associated with early testosterone-driven prostate carcinogenesis, which are impacted by dietary tomato and lycopene, wild-type (WT) and transgenic adenocarcinoma of the mouse prostate (TRAMP) mice were fed control or tomato- or lycopene-containing diets from 4 to 10 weeks of age. Eight-week-old mice underwent sham surgery, castration, or castration followed by testosterone repletion (2.5 mg/kg/d initiated 1 week after castration). Ten-week-old intact TRAMP mice exhibit early multifocal prostatic intraepithelial neoplasia. Of the 200 prostate cancer-related genes measured by quantitative NanoString, 189 are detectable, 164 significantly differ by genotype, 179 by testosterone status, and 30 by diet type (P < 0.05). In TRAMP, expression of Birc5, Mki67, Aurkb, Ccnb2, Foxm1, and Ccne2 is greater compared with WT and is decreased by castration. In parallel, castration reduces Ki67-positive staining (P < 0.0001) compared with intact and testosterone-repleted TRAMP mice. Expression of genes involved in androgen metabolism/signaling pathways is reduced by lycopene feeding (Srd5a1) and by tomato feeding (Srd5a2, Pxn, and Srebf1). In addition, tomato feeding significantly reduced expression of genes associated with stem cell features, Aldh1a and Ly6a, whereas lycopene feeding significantly reduced expression of neuroendocrine differentiation-related genes, Ngfr and Syp. Collectively, these studies demonstrate a profile of testosterone-regulated genes associated with early prostate carcinogenesis that are potential mechanistic targets of dietary tomato components. Future studies on androgen signaling/metabolism, stem cell features, and neuroendocrine differentiation pathways may elucidate the mechanisms by which dietary tomato and lycopene impact prostate cancer risk. PMID:25315431

  11. Use of heat stress responsive gene expression levels for early selection of heat tolerant cabbage (Brassica oleracea L.).

    PubMed

    Park, Hyun Ji; Jung, Won Yong; Lee, Sang Sook; Song, Jun Ho; Kwon, Suk-Yoon; Kim, Hyeran; Kim, Chulwook; Ahn, Jun Cheul; Cho, Hye Sun

    2013-06-04

    Cabbage is a relatively robust vegetable at low temperatures. However, at high temperatures, cabbage has disadvantages, such as reduced disease tolerance and lower yields. Thus, selection of heat-tolerant cabbage is an important goal in cabbage breeding. Easier or faster selection of superior varieties of cabbage, which are tolerant to heat and disease and have improved taste and quality, can be achieved with molecular and biological methods. We compared heat-responsive gene expression between a heat-tolerant cabbage line (HTCL), "HO", and a heat-sensitive cabbage line (HSCL), "JK", by Genechip assay. Expression levels of specific heat stress-related genes were increased in response to high-temperature stress, according to Genechip assays. We performed quantitative RT-PCR (qRT-PCR) to compare expression levels of these heat stress-related genes in four HTCLs and four HSCLs. Transcript levels for heat shock protein BoHsp70 and transcription factor BoGRAS (SCL13) were more strongly expressed only in all HTCLs compared to all HSCLs, showing much lower level expressions at the young plant stage under heat stress (HS). Thus, we suggest that expression levels of these genes may be early selection markers for HTCLs in cabbage breeding. In addition, several genes that are involved in the secondary metabolite pathway were differentially regulated in HTCL and HSCL exposed to heat stress.

  12. Gene expression analysis of Six3, Pax6, and Otx in the early development of the stalked crinoid Metacrinus rotundus.

    PubMed

    Omori, Akihito; Akasaka, Koji; Kurokawa, Daisuke; Amemiya, Shonan

    2011-01-01

    The stalked crinoid, Metacrinus rotundus, is one of the most basal extant echinoderms. Here, we show the expression patterns of Six3, Pax6, and Otx in the early development of M. rotundus. All three genes are highly expressed in stages from the gastrula to the auricularia larval stage. Ectodermal expression of MrOtx appears to be correlated with development of the ciliary band. These three genes are expressed sequentially along the embryonic body axis in the anterior and middle walls of the archenteron in the order of MrPax6, MrSix3, and MrOtx. The anterior, middle, and posterior parts of the archenteron in the late gastrula differentiate into the axo-hydrocoel, the enteric sac, and somatocoels at later stages, respectively. The three genes are expressed sequentially from the tip of the axo-hydrocoel to the bottom of enteric sac in the order of MrSix3, MrPax6, and MrOtx at the later stages. This suggests that these genes are involved in patterning of the larval endo-mesoderm in stalked crinoids. The present results suggest that radical alterations have occurred in the expression and function of homeobox genes in basal echinoderms. PMID:20837165

  13. Alterations in gene expression during fasting-induced atresia of early secondary ovarian follicles of coho salmon, Oncorhynchus kisutch.

    PubMed

    Yamamoto, Yoji; Luckenbach, J Adam; Young, Graham; Swanson, Penny

    2016-11-01

    Molecular processes that either regulate ovarian atresia or are consequences of atresia are poorly understood in teleost fishes. We hypothesized that feed restriction that perturbs normal ovarian growth and induces follicular atresia would alter ovarian gene expression patterns. Previtellogenic, two-year old coho salmon (Oncorhynchus kisutch) were subjected to prolonged fasting to induce atresia or maintained on a normal feeding schedule that would promote continued ovarian development. To identify genes that were specifically up- or down-regulated during oocyte growth in healthy, growing fish compared to fasted fish, reciprocal suppression subtractive hybridization (SSH) cDNA libraries were generated using ovaries from fed and fasted animals. Differential expression of genes identified by SSH was confirmed with quantitative PCR. The SSH library representing genes elevated in ovaries of fed fish relative to those of fasted fish contained steroidogenesis-related genes (e.g., hydroxy-delta-5-steroid dehydrogenase), Tgf-beta superfamily members (e.g., anti-Mullerian hormone) and cytoskeletal intermediate filament proteins (e.g., type I keratin s8). Overall, these genes were associated with steroid production, cell proliferation and differentiation, and ovarian epithelialization. The library representing genes elevated in ovaries of fasted fish relative to fed fish contained genes associated with apoptosis (e.g., programmed cell death protein 4), cortical alveoli (e.g., alveolin), the zona pellucida (e.g., zona pellucida protein c), and microtubules (e.g., microtubule associated protein tau). Elevated expression of this suite of genes was likely associated with the initiation of atresia and/or a reduced rate of follicle development in response to fasting. This study revealed ovarian genes involved in normal early secondary oocyte growth and potential early markers of atresia.

  14. Alterations in gene expression during fasting-induced atresia of early secondary ovarian follicles of coho salmon, Oncorhynchus kisutch.

    PubMed

    Yamamoto, Yoji; Luckenbach, J Adam; Young, Graham; Swanson, Penny

    2016-11-01

    Molecular processes that either regulate ovarian atresia or are consequences of atresia are poorly understood in teleost fishes. We hypothesized that feed restriction that perturbs normal ovarian growth and induces follicular atresia would alter ovarian gene expression patterns. Previtellogenic, two-year old coho salmon (Oncorhynchus kisutch) were subjected to prolonged fasting to induce atresia or maintained on a normal feeding schedule that would promote continued ovarian development. To identify genes that were specifically up- or down-regulated during oocyte growth in healthy, growing fish compared to fasted fish, reciprocal suppression subtractive hybridization (SSH) cDNA libraries were generated using ovaries from fed and fasted animals. Differential expression of genes identified by SSH was confirmed with quantitative PCR. The SSH library representing genes elevated in ovaries of fed fish relative to those of fasted fish contained steroidogenesis-related genes (e.g., hydroxy-delta-5-steroid dehydrogenase), Tgf-beta superfamily members (e.g., anti-Mullerian hormone) and cytoskeletal intermediate filament proteins (e.g., type I keratin s8). Overall, these genes were associated with steroid production, cell proliferation and differentiation, and ovarian epithelialization. The library representing genes elevated in ovaries of fasted fish relative to fed fish contained genes associated with apoptosis (e.g., programmed cell death protein 4), cortical alveoli (e.g., alveolin), the zona pellucida (e.g., zona pellucida protein c), and microtubules (e.g., microtubule associated protein tau). Elevated expression of this suite of genes was likely associated with the initiation of atresia and/or a reduced rate of follicle development in response to fasting. This study revealed ovarian genes involved in normal early secondary oocyte growth and potential early markers of atresia. PMID:27320185

  15. PU. 1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation.

    PubMed

    Olson, M C; Scott, E W; Hack, A A; Su, G H; Tenen, D G; Singh, H; Simon, M C

    1995-12-01

    We have previously shown using gene targeting that PU.1 is essential for the development of lymphoid and myeloid lineages during fetal liver hematopoiesis. We now show that PU.1 is required for the maturation of yolk sac-derived myeloid progenitors and for the differentiation of ES cells into macrophages. The role of PU.1 in regulating target genes, thought to be critical in the development of monocytes and granulocytes, has been analyzed. Early genes such as GM-CSFR, G-CSFR, and myeloperoxidase are expressed in PU.1-/- embryos and differentiated PU.1-/- ES cells. However, the expression of genes associated with terminal myeloid differentiation (CD11b, CD64, and M-CSFR) is eliminated in differentiated PU.1-/- ES cells. Development of macrophages is restored with the introduction of a PU.1 cDNA regulated by its own promoter. The PU.1-/- ES cells represent an important model for analyzing myeloid cell development.

  16. Expression of a mouse metallothionein-Escherichia coli. beta. -galactosidase fusion gene (MT-. beta. gal) in early mouse embryos

    SciTech Connect

    Stevens, M.E.; Meneses, J.J.; Pedersen, R.A. )

    1989-08-01

    The authors have microinjected DNA containing the inducible mouse metallothionein-I (MT-I) promoter, coupled to the structural gene for Escherichia coli {beta}-galactosidase (lacZ), into the pronuclei of one-cell mouse embryos. A qualitative histochemical assay, with 5-bromo-4-chloro-3-indolyl {beta}-D-galactopyranoside (X-Gal) as a substrate, was used to detect expression of lacZ at several preimplantation stages. They observed staining indicative of exogenous {beta}-galactosidase activity in 5-17% of DNA-injected embryos assayed at preimplantation stages after 16-24 h treatment with ZnSO{sub 4}. Thus, lacZ can be used as an indicator gene for promoter function during early mouse embryogenesis, and the incorporation of the MT-I promoter into fusion genes can be a useful means of controlling the expression of exogenous genes in preimplantation mouse embryos.

  17. Economic Impact of Gene Expression Profiling in Patients with Early-Stage Breast Cancer in France

    PubMed Central

    Katz, Gregory; Romano, Olivier; Foa, Cyril; Vataire, Anne-Lise; Chantelard, Jean-Victor; Hervé, Robert; Barletta, Hugues; Durieux, Axel; Martin, Jean-Pierre; Salmon, Rémy

    2015-01-01

    Background and Aims The heterogeneous nature of breast cancer can make decisions on adjuvant chemotherapy following surgical resection challenging. Oncotype DX is a validated gene expression profiling test that predicts the likelihood of adjuvant chemotherapy benefit in early-stage breast cancer. The aim of this study is to determine the costs of chemotherapy in private hospitals in France, and evaluate the cost-effectiveness of Oncotype DX from national insurance and societal perspectives. Methods A multicenter study was conducted in seven French private hospitals, capturing retrospective data from 106 patient files. Cost estimates were used in conjunction with a published Markov model to assess the cost-effectiveness of using Oncotype DX to inform chemotherapy decision making versus standard care. Sensitivity analyses were performed. Results The cost of adjuvant chemotherapy in private hospitals was estimated at EUR 8,218 per patient from a national insurance perspective and EUR 10,305 from a societal perspective. Cost-effectiveness analysis indicated that introducing Oncotype DX improved life expectancy (+0.18 years) and quality-adjusted life expectancy (+0.17 QALYs) versus standard care. Oncotype DX was found cost-effective from a national insurance perspective (EUR 2,134 per QALY gained) and cost saving from a societal perspective versus standard care. Inclusion of lost productivity costs in the modeling analysis meant that costs for eligible patients undergoing Oncotype DX testing were on average EUR 602 lower than costs for those receiving standard care. Conclusions As Oncotype DX was found both cost and life-saving from a societal perspective, the test was considered to be dominant to standard care. However, the delay in coverage has the potential to erode the quality of the French healthcare system, thus depriving patients of technologies that could improve clinical outcomes and allow healthcare professionals to better allocate hospital resources to

  18. Protein Kinase Cδ Blocks Immediate-Early Gene Expression in Senescent Cells by Inactivating Serum Response Factor

    PubMed Central

    Wheaton, Keith; Riabowol, Karl

    2004-01-01

    Fibroblasts lose the ability to replicate in response to growth factors and become unable to express growth-associated immediate-early genes, including c-fos and egr-1, as they become senescent. The serum response factor (SRF), a major transcriptional activator of immediate-early gene promoters, loses the ability to bind to the serum response element (SRE) and becomes hyperphosphorylated in senescent cells. We identify protein kinase C delta (PKCδ) as the kinase responsible for inactivation of SRF both in vitro and endogenously in senescent cells. This is due to a higher level of PKCδ activity as cells age, production of the PKCδ catalytic fragment, and its nuclear localization in senescent but not in low-passage-number cells. The phosphorylation of T160 of SRF by PKCδ in vitro and in vivo led to loss of SRF DNA binding activity. Both the PKCδ inhibitor rottlerin and ectopic expression of a dominant negative form of PKCδ independently restored SRE-dependent transcription and immediate-early gene expression in senescent cells. Modulation of PKCδ activity in vivo with rottlerin or bistratene A altered senescent- and young-cell morphology, respectively. These observations support the idea that the coordinate transcriptional inhibition of several growth-associated genes by PKCδ contributes to the senescent phenotype. PMID:15282327

  19. Shaped singular spectrum analysis for quantifying gene expression, with application to the early Drosophila embryo.

    PubMed

    Shlemov, Alex; Golyandina, Nina; Holloway, David; Spirov, Alexander

    2015-01-01

    In recent years, with the development of automated microscopy technologies, the volume and complexity of image data on gene expression have increased tremendously. The only way to analyze quantitatively and comprehensively such biological data is by developing and applying new sophisticated mathematical approaches. Here, we present extensions of 2D singular spectrum analysis (2D-SSA) for application to 2D and 3D datasets of embryo images. These extensions, circular and shaped 2D-SSA, are applied to gene expression in the nuclear layer just under the surface of the Drosophila (fruit fly) embryo. We consider the commonly used cylindrical projection of the ellipsoidal Drosophila embryo. We demonstrate how circular and shaped versions of 2D-SSA help to decompose expression data into identifiable components (such as trend and noise), as well as separating signals from different genes. Detection and improvement of under- and overcorrection in multichannel imaging is addressed, as well as the extraction and analysis of 3D features in 3D gene expression patterns.

  20. Shaped Singular Spectrum Analysis for Quantifying Gene Expression, with Application to the Early Drosophila Embryo

    PubMed Central

    Holloway, David

    2015-01-01

    In recent years, with the development of automated microscopy technologies, the volume and complexity of image data on gene expression have increased tremendously. The only way to analyze quantitatively and comprehensively such biological data is by developing and applying new sophisticated mathematical approaches. Here, we present extensions of 2D singular spectrum analysis (2D-SSA) for application to 2D and 3D datasets of embryo images. These extensions, circular and shaped 2D-SSA, are applied to gene expression in the nuclear layer just under the surface of the Drosophila (fruit fly) embryo. We consider the commonly used cylindrical projection of the ellipsoidal Drosophila embryo. We demonstrate how circular and shaped versions of 2D-SSA help to decompose expression data into identifiable components (such as trend and noise), as well as separating signals from different genes. Detection and improvement of under- and overcorrection in multichannel imaging is addressed, as well as the extraction and analysis of 3D features in 3D gene expression patterns. PMID:25945341

  1. Whole transcriptome profiling of maize during early somatic embryogenesis reveals altered expression of stress factors and embryogenesis-related genes.

    PubMed

    Salvo, Stella A G D; Hirsch, Candice N; Buell, C Robin; Kaeppler, Shawn M; Kaeppler, Heidi F

    2014-01-01

    Embryogenic tissue culture systems are utilized in propagation and genetic engineering of crop plants, but applications are limited by genotype-dependent culture response. To date, few genes necessary for embryogenic callus formation have been identified or characterized. The goal of this research was to enhance our understanding of gene expression during maize embryogenic tissue culture initiation. In this study, we highlight the expression of candidate genes that have been previously regarded in the literature as having important roles in somatic embryogenesis. We utilized RNA based sequencing (RNA-seq) to characterize the transcriptome of immature embryo explants of the highly embryogenic and regenerable maize genotype A188 at 0, 24, 36, 48, and 72 hours after placement of explants on tissue culture initiation medium. Genes annotated as functioning in stress response, such as glutathione-S-transferases and germin-like proteins, and genes involved with hormone transport, such as PINFORMED, increased in expression over 8-fold in the study. Maize genes with high sequence similarity to genes previously described in the initiation of embryogenic cultures, such as transcription factors BABY BOOM, LEAFY COTYLEDON, and AGAMOUS, and important receptor-like kinases such as SOMATIC EMBRYOGENESIS RECEPTOR LIKE KINASES and CLAVATA, were also expressed in this time course study. By combining results from whole genome transcriptome analysis with an in depth review of key genes that play a role in the onset of embryogenesis, we propose a model of coordinated expression of somatic embryogenesis-related genes, providing an improved understanding of genomic factors involved in the early steps of embryogenic culture initiation in maize and other plant species.

  2. Early Differential Gene Expression in Haemocytes from Resistant and Susceptible Biomphalaria glabrata Strains in Response to Schistosoma mansoni

    PubMed Central

    Lockyer, Anne E.; Emery, Aidan M.; Kane, Richard A.; Walker, Anthony J.; Mayer, Claus D.; Mitta, Guillaume; Coustau, Christine; Adema, Coen M.; Hanelt, Ben; Rollinson, David; Noble, Leslie R.; Jones, Catherine S.

    2012-01-01

    The outcome of infection in the host snail Biomphalaria glabrata with the digenean parasite Schistosoma mansoni is determined by the initial molecular interplay occurring between them. The mechanisms by which schistosomes evade snail immune recognition to ensure survival are not fully understood, but one possibility is that the snail internal defence system is manipulated by the schistosome enabling the parasite to establish infection. This study provides novel insights into the nature of schistosome resistance and susceptibility in B. glabrata at the transcriptomic level by simultaneously comparing gene expression in haemocytes from parasite-exposed and control groups of both schistosome-resistant and schistosome-susceptible strains, 2 h post exposure to S. mansoni miracidia, using an novel 5K cDNA microarray. Differences in gene expression, including those for immune/stress response, signal transduction and matrix/adhesion genes were identified between the two snail strains and tests for asymmetric distributions of gene function also identified immune-related gene expression in resistant snails, but not in susceptible. Gene set enrichment analysis revealed that genes involved in mitochondrial electron transport, ubiquinone biosynthesis and electron carrier activity were consistently up-regulated in resistant snails but down-regulated in susceptible. This supports the hypothesis that schistosome-resistant snails recognize schistosomes and mount an appropriate defence response, while in schistosome-susceptible snails the parasite suppresses this defence response, early in infection. PMID:23300533

  3. Spatio-Temporal Gene Expression Profiling during In Vivo Early Ovarian Folliculogenesis: Integrated Transcriptomic Study and Molecular Signature of Early Follicular Growth

    PubMed Central

    Bonnet, Agnes; Servin, Bertrand; Mulsant, Philippe; Mandon-Pepin, Beatrice

    2015-01-01

    Background The successful achievement of early ovarian folliculogenesis is important for fertility and reproductive life span. This complex biological process requires the appropriate expression of numerous genes at each developmental stage, in each follicular compartment. Relatively little is known at present about the molecular mechanisms that drive this process, and most gene expression studies have been performed in rodents and without considering the different follicular compartments. Results We used RNA-seq technology to explore the sheep transcriptome during early ovarian follicular development in the two main compartments: oocytes and granulosa cells. We documented the differential expression of 3,015 genes during this phase and described the gene expression dynamic specific to these compartments. We showed that important steps occurred during primary/secondary transition in sheep. We also described the in vivo molecular course of a number of pathways. In oocytes, these pathways documented the chronology of the acquisition of meiotic competence, migration and cellular organization, while in granulosa cells they concerned adhesion, the formation of cytoplasmic projections and steroid synthesis. This study proposes the involvement in this process of several members of the integrin and BMP families. The expression of genes such as Kruppel-like factor 9 (KLF9) and BMP binding endothelial regulator (BMPER) was highlighted for the first time during early follicular development, and their proteins were also predicted to be involved in gene regulation. Finally, we selected a data set of 24 biomarkers that enabled the discrimination of early follicular stages and thus offer a molecular signature of early follicular growth. This set of biomarkers includes known genes such as SPO11 meiotic protein covalently bound to DSB (SPO11), bone morphogenetic protein 15 (BMP15) and WEE1 homolog 2 (S. pombe)(WEE2) which play critical roles in follicular development but other

  4. Gene expression profiling reveals underlying molecular mechanisms of the early stages of tamoxifen-induced rat hepatocarcinogenesis

    SciTech Connect

    Pogribny, Igor P. Bagnyukova, Tetyana V.; Tryndyak, Volodymyr P.; Muskhelishvili, Levan; Rodriguez-Juarez, Rocio; Kovalchuk, Olga; Han Tao; Fuscoe, James C.; Ross, Sharon A.; Beland, Frederick A.

    2007-11-15

    Tamoxifen is a widely used anti-estrogenic drug for chemotherapy and, more recently, for the chemoprevention of breast cancer. Despite the indisputable benefits of tamoxifen in preventing the occurrence and re-occurrence of breast cancer, the use of tamoxifen has been shown to induce non-alcoholic steatohepatitis, which is a life-threatening fatty liver disease with a risk of progression to cirrhosis and hepatocellular carcinoma. In recent years, the high-throughput microarray technology for large-scale analysis of gene expression has become a powerful tool for increasing the understanding of the molecular mechanisms of carcinogenesis and for identifying new biomarkers with diagnostic and predictive values. In the present study, we used the high-throughput microarray technology to determine the gene expression profiles in the liver during early stages of tamoxifen-induced rat hepatocarcinogenesis. Female Fisher 344 rats were fed a 420 ppm tamoxifen containing diet for 12 or 24 weeks, and gene expression profiles were determined in liver of control and tamoxifen-exposed rats. The results indicate that early stages of tamoxifen-induced liver carcinogenesis are characterized by alterations in several major cellular pathways, specifically those involved in the tamoxifen metabolism, lipid metabolism, cell cycle signaling, and apoptosis/cell proliferation control. One of the most prominent changes during early stages of tamoxifen-induced hepatocarcinogenesis is dysregulation of signaling pathways in cell cycle progression from the G{sub 1} to S phase, evidenced by the progressive and sustained increase in expression of the Pdgfc, Calb3, Ets1, and Ccnd1 genes accompanied by the elevated level of the PI3K, p-PI3K, Akt1/2, Akt3, and cyclin B, D1, and D3 proteins. The early appearance of these alterations suggests their importance in the mechanism of neoplastic cell transformation induced by tamoxifen.

  5. Early regulation of hypothalamic arcuate nucleus CART gene expression by short photoperiod in the Siberian hamster.

    PubMed

    Mercer, Julian G; Ellis, Claire; Moar, Kim M; Logie, Tracy J; Morgan, Peter J; Adam, Clare L

    2003-03-28

    Cocaine- and amphetamine-regulated transcript (CART) mRNA is expressed in a number of hypothalamic nuclei including the arcuate nucleus (ARC). An increase in CART gene expression in the ARC of juvenile female Siberian hamsters (Phodopus sungorus) 14 days after transfer to short photoperiod at weaning and prior to major divergence of body weight trajectory in this seasonal mammal implicates CART in the induction of programmed weight change. In the current series of experiments, elevated CART mRNA in short photoperiod juvenile female animals relative to long photoperiod controls was apparent throughout the caudal-rostral extent of the ARC after 14 days, but was not observed when short photoperiod exposure was limited to 4-7 days. Elevated CART gene expression was also observed in juvenile males 14 days after transfer to short photoperiod at weaning, in adult female hamsters 14 days after transfer to short photoperiod and in adult male hamsters 21 days after transfer to short photoperiod. There were no consistent trends in expression levels of other energy balance-related genes with these relatively short duration photoperiod manipulations, suggesting that CART may be involved in short photoperiod-programmed body weight regulation.

  6. Measuring gene expression noise in early Drosophila embryos: nucleus-to-nucleus variability

    PubMed Central

    Golyandina, Nina E.; Holloway, David M.; Lopes, Francisco J.P.; Spirov, Alexander V.; Spirova, Ekaterina N.; Usevich, Konstantin D.

    2012-01-01

    In recent years the analysis of noise in gene expression has widely attracted the attention of experimentalists and theoreticians. Experimentally, the approaches based on in vivo fluorescent reporters in single cells appear to be straightforward and effective tools for bacteria and yeast. However, transferring these approaches to multicellular organisms presents many methodological problems. Here we describe our approach to measure between-nucleus variability (noise) in the primary morphogenetic gradient of Bicoid (Bcd) in the precellular blastoderm stage of fruit fly (Drosophila) embryos. The approach is based on the comparison of results for fixed immunostained embryos with observations of live embryos carrying fluorescent Bcd (Bcd-GFP). We measure the noise using two-dimensional Singular Spectrum Analysis (2D SSA). We have found that the nucleus-to-nucleus noise in Bcd intensity, both for live (Bcd-GFP) and for fixed immunstained embryos, tends to be signal-independent. In addition, the character of the noise is sensitive to the nuclear masking technique used to extract quantitative intensities. Further, the method of decomposing the raw quantitative expression data into a signal (expression surface) and residual noise affects the character of the residual noise. We find that careful masking of confocal images and use of appropriate computational tools to decompose raw expression data into trend and noise makes it possible to extract and study the biological noise of gene expression. PMID:22723811

  7. Measuring gene expression noise in early Drosophila embryos: nucleus-to-nucleus variability.

    PubMed

    Golyandina, Nina E; Holloway, David M; Lopes, Francisco J P; Spirov, Alexander V; Spirova, Ekaterina N; Usevich, Konstantin D

    2012-01-01

    In recent years the analysis of noise in gene expression has widely attracted the attention of experimentalists and theoreticians. Experimentally, the approaches based on in vivo fluorescent reporters in single cells appear to be straightforward and effective tools for bacteria and yeast. However, transferring these approaches to multicellular organisms presents many methodological problems. Here we describe our approach to measure between-nucleus variability (noise) in the primary morphogenetic gradient of Bicoid (Bcd) in the precellular blastoderm stage of fruit fly (Drosophila) embryos. The approach is based on the comparison of results for fixed immunostained embryos with observations of live embryos carrying fluorescent Bcd (Bcd-GFP). We measure the noise using two-dimensional Singular Spectrum Analysis (2D SSA). We have found that the nucleus-to-nucleus noise in Bcd intensity, both for live (Bcd-GFP) and for fixed immunstained embryos, tends to be signal-independent. In addition, the character of the noise is sensitive to the nuclear masking technique used to extract quantitative intensities. Further, the method of decomposing the raw quantitative expression data into a signal (expression surface) and residual noise affects the character of the residual noise. We find that careful masking of confocal images and use of appropriate computational tools to decompose raw expression data into trend and noise makes it possible to extract and study the biological noise of gene expression.

  8. Dramatic early event in chronic allograft nephropathy: increased but not decreased expression of MMP-9 gene

    PubMed Central

    2013-01-01

    Objective The infiltration of mononuclear cells and replication and migration of smooth muscle cells (SMCs) from media into the intima in the vascular wall are the cardinal pathological changes in the early stage of chronic allograft nephropathy (CAN). But the mechanism is unclear. Therefore we investigated the role of matrix metalloproteinase 9 (MMP-9) and its interaction with TGF-beta1, tubulointerstitial mononuclear cells infiltration and migration of SMCs in the early stage of CAN. Methods Kidneys of Fisher (F334) rats were orthotopically transplanted into bilaterally nephrectomized Lewis (LEW) recipients. To suppress an initial episode of acute rejection, rats were briefly treated with cyclosporine A (1.5 mg/kg/day) for the first 10 days. Animals were harvested at 12 weeks after transplantation for histological, immunohistochemistry and molecular biological analysis. Results The expression of MMP-9 was up-regulated in interstitium and vascular wall in the early stage of CAN, where there were interstitial mononuclear cells infiltration and SMCs migration and proliferation. Moreover the expression of MMP-9 were positively correlated with the degree of interstitial mononuclear cells infiltration, the quantity of SMCs in arteriolar wall, and also the increased TFG-beta1 expression in the tubulointerstitium and arteriolar wall. Conclusions MMP-9 may play an important role in the mechanism of pathological changes during the earlier period of CAN. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1582313332832700. PMID:23351884

  9. RNA sequencing analysis of gene expression regulated by the transcription factor SlZFP2 during early fruit development.

    PubMed

    Weng, Lin; Zhao, Fangfang; Li, Rong; Xiao, Han

    2016-06-01

    The transcription factor SlZFP2 (Solanum lycopersicum Zinc Finger Protein 2) regulates ABA biosynthesis during fruit development. To reveal the regulatory network of this transcription factor, we conducted a high-throughput RNA-seq to identify differentially expressed genes in 2 dpa (days post anthesis) fruits from a representative RNAi line in Solanum pimpinellifolium LA1589 background and the wild type. The transcriptome analysis revealed that expression of 2722 genes was regulated by SlZFP2 during early fruit development and further helped to narrow down its direct targets to 193 genes. Here, we provide a detailed description of the experimental procedure associated with our transcriptome sequencing data deposited in the National Center for Biotechnology Information (accession no. GSE63838). PMID:27114906

  10. Sulphur limitation and early sulphur deficiency responses in poplar: significance of gene expression, metabolites, and plant hormones

    PubMed Central

    Honsel, Anne; Kojima, Mikiko; Haas, Richard; Frank, Wolfgang; Sakakibara, Hitoshi; Herschbach, Cornelia; Rennenberg, Heinz

    2012-01-01

    The influence of sulphur (S) depletion on the expression of genes related to S metabolism, and on metabolite and plant hormone contents was analysed in young and mature leaves, fine roots, xylem sap, and phloem exudates of poplar (Populus tremula×Populus alba) with special focus on early consequences. S depletion was applied by a gradual decrease of sulphate availability. The observed changes were correlated with sulphate contents. Based on the decrease in sulphate contents, two phases of S depletion could be distinguished that were denominated as ‘S limitation’ and ‘early S deficiency’. S limitation was characterized by improved sulphate uptake (enhanced root-specific sulphate transporter PtaSULTR1;2 expression) and reduction capacities (enhanced adenosine 5′-phosphosulphate (APS) reductase expression) and by enhanced remobilization of sulphate from the vacuole (enhanced putative vacuolar sulphate transporter PtaSULTR4;2 expression). During early S deficiency, whole plant distribution of S was impacted, as indicated by increasing expression of the phloem-localized sulphate transporter PtaSULTR1;1 and by decreasing glutathione contents in fine roots, young leaves, mature leaves, and phloem exudates. Furthermore, at ‘early S deficiency’, expression of microRNA395 (miR395), which targets transcripts of PtaATPS3/4 (ATP sulphurylase) for cleavage, increased. Changes in plant hormone contents were observed at ‘early S deficiency’ only. Thus, S depletion affects S and plant hormone metabolism of poplar during ‘S limitation’ and ‘early S deficiency’ in a time series of events. Despite these consequences, the impact of S depletion on growth of poplar plants appears to be less severe than in Brassicaceae such as Arabidopsis thaliana or Brassica sp. PMID:22162873

  11. Dynamic shifts in corticostriatal expression patterns of the immediate early genes Homer 1a and Zif268 during early and late phases of instrumental training.

    PubMed

    Hernandez, Pepe J; Schiltz, Craig A; Kelley, Ann E

    2006-01-01

    Adaptive motor actions require prior knowledge of instrumental contingencies. With practice, these actions can become highly automatic in nature. However, the molecular and anatomical substrates mediating these related forms of learning are not understood. In the present study, we used in situ hybridization to measure the mRNA levels of two immediate early genes (IEGs) in an instrumental paradigm where rats learned to lever-press for food. We report that after three training sessions, Homer 1a and Zif268 (an effector and regulatory IEG, respectively) were significantly induced within an extensive corticostriatal network relative to untrained controls. With extended training (23 sessions), however, a shift in the expression patterns of the two genes was evident. Expression of Homer 1a (official symbol Homer1) decreased significantly in frontal and cingulate cortices, whereas striatal expression was generally maintained. Interestingly, Homer 1a expression markedly increased with extensive training in the ventrolateral region of the striatum (VLS) relative to early learners, suggesting that plasticity in the VLS is required for the efficient production of the learned behavior or in habit formation. Zif268 (official symbol Egr1) expression generally decreased with extensive training; however, these changes were not significant. These results demonstrate for the first time, on a molecular level, a dynamic shift in the contribution of corticostriatal systems mediating the early acquisition and consolidation of goal-directed responses to those engaged after extensive training. PMID:17015857

  12. Expression dynamics of bovine MX genes in the endometrium and placenta during early to mid pregnancy

    PubMed Central

    SHIROZU, Takahiro; SASAKI, Keisuke; KAWAHARA, Manabu; YANAGAWA, Yojiro; NAGANO, Masashi; YAMAUCHI, Nobuhiko; TAKAHASHI, Masashi

    2015-01-01

    MX belongs to a family of type I interferon (IFN)-stimulated genes, and the MX protein has antiviral activity. MX has at least two isoforms, known as MX1 and MX2, in mammals. Moreover, bovine MX1 has been found to have alternative splice variants—namely, MX1-a and MX1B. In ruminants, IFN-τ—a type I IFN—is temporarily produced from the conceptus before implantation and induces MX expression in the endometrium. However, the expression dynamics of MX after implantation are not clear. In the present study, we investigated the expression of MX1-a, MX1B and MX2 in the endometrium and placenta before and after implantation along with the expression of IFN-α, type I receptors (IFNAR1 and IFNAR2) and interferon regulatory factors (IRF3 and IRF9). Pregnant uterine samples were divided into five groups according to pregnancy days 14–18, 25–40, 50–70, 80–100, and 130–150. Tissue samples were collected from the intercaruncular endometrium (IC), caruncular endometrium (C) and fetal placenta (P). Although all the MX expressions were significantly higher in the IC and C at days 14–18, presumably caused by embryo-secreted IFN-τ stimulation, their expressions were also detectable in the IC, C and P after implantation. Furthermore, IFN-α expression was significantly higher in the IC. RT-PCR indicated IFNAR1, IFNAR2, IRF3 and IRF9 mRNA in all the tissues during pregnancy. These results suggest that all the MX genes are affected by the type I IFN pathway during pregnancy and are involved in an immune response to protect the mother and fetus. PMID:26498202

  13. Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells

    SciTech Connect

    Gao, Xiugong Sprando, Robert L.; Yourick, Jeffrey J.

    2015-08-15

    Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72 h after exposure to 0.25 mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. - Highlights: • Studied genomic changes in mouse embryonic stem cells upon thalidomide exposure • Identified gene expression changes that may represent thalidomide embryotoxicity • The toxicogenomic changes coincide well with known thalidomide clinical outcomes. • The mouse embryonic stem cell model is suitable for developmental toxicity testing. • The model has the potential for high-throughput screening of a multitude of compounds.

  14. Thalidomide induced early gene expression perturbations indicative of human embryopathy in mouse embryonic stem cells.

    PubMed

    Gao, Xiugong; Sprando, Robert L; Yourick, Jeffrey J

    2015-08-15

    Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72h after exposure to 0.25mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment.

  15. Expression of a cellular gene cloned in herpes simplex virus: rabbit beta-globin is regulated as an early viral gene in infected fibroblasts.

    PubMed Central

    Smiley, J R; Smibert, C; Everett, R D

    1987-01-01

    We constructed nondefective herpes simplex virus type 1 recombinants bearing the intact rabbit beta-globin gene inserted into the viral gene for thymidine kinase to study the expression of a cellular gene when it is present in the viral genome during lytic viral infections. The globin promoter was activated to high levels during productive infection of Vero cells, giving rise to properly spliced and processed cytoplasmic globin transcripts. Expression of globin RNA occurred with early kinetics, was not affected by blocking viral DNA replication, and was strongly inhibited by preventing viral immediate-early protein synthesis with cycloheximide. These results support the hypothesis that temporal control of herpes simplex virus early gene expression is accomplished by mechanisms that are not restricted to viral promoters. In addition, these data show that a cellular transcript can be correctly processed and can accumulate to high levels during viral infection; this indicates that the mechanisms of virally induced shutoff of host RNA accumulation and degradation of host mRNAs do not depend on sequence-specific differentiation between host and viral RNAs. These findings also suggest that herpesviruses have considerable potential as high-capacity gene transfer vectors for a variety of applications. Images PMID:3037101

  16. Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups.

    PubMed

    Bel-Vialar, Sophie; Itasaki, Nobue; Krumlauf, Robb

    2002-11-01

    Initiation of Hox genes requires interactions between numerous factors and signaling pathways in order to establish their precise domain boundaries in the developing nervous system. There are distinct differences in the expression and regulation of members of Hox genes within a complex suggesting that multiple competing mechanisms are used to initiate their expression domains in early embryogenesis. In this study, by analyzing the response of HoxB genes to both RA and FGF signaling in neural tissue during early chick embryogenesis (HH stages 7-15), we have defined two distinct groups of Hox genes based on their reciprocal sensitivity to RA or FGF during this developmental period. We found that the expression domain of 5' members from the HoxB complex (Hoxb6-Hoxb9) can be expanded anteriorly in the chick neural tube up to the level of the otic vesicle following FGF treatment and that these same genes are refractory to RA treatment at these stages. Furthermore, we showed that the chick caudal-related genes, cdxA and cdxB, are also responsive to FGF signaling in neural tissue and that their anterior expansion is also limited to the level of the otic vesicle. Using a dominant negative form of a Xenopus Cdx gene (XcadEnR) we found that the effect of FGF treatment on 5' HoxB genes is mediated in part through the activation and function of CDX activity. Conversely, the 3' HoxB genes (Hoxb1 and Hoxb3-Hoxb5) are sensitive to RA but not FGF treatments at these stages. We demonstrated by in ovo electroporation of a dominant negative retinoid receptor construct (dnRAR) that retinoid signaling is required to initiate expression. Elevating CDX activity by ectopic expression of an activated form of a Xenopus Cdx gene (XcadVP16) in the hindbrain ectopically activates and anteriorly expands Hoxb4 expression. In a similar manner, when ectopic expression of XcadVP16 is combined with FGF treatment, we found that Hoxb9 expression expands anteriorly into the hindbrain region. Our

  17. An amphioxus nodal gene (AmphiNodal) with early symmetrical expression in the organizer and mesoderm and later asymmetrical expression associated with left-right axis formation

    NASA Technical Reports Server (NTRS)

    Yu, Jr-Kai; Holland, Linda Z.; Holland, Nicholas D.

    2002-01-01

    The full-length sequence and zygotic expression of an amphioxus nodal gene are described. Expression is first detected in the early gastrula just within the dorsal lip of the blastopore in a region of hypoblast that is probably comparable with the vertebrate Spemann's organizer. In the late gastrula and early neurula, expression remains bilaterally symmetrical, limited to paraxial mesoderm and immediately overlying regions of the neural plate. Later in the neurula stage, all neural expression disappears, and mesodermal expression disappears from the right side. All along the left side of the neurula, mesodermal expression spreads into the left side of the gut endoderm. Soon thereafter, all expression is down-regulated except near the anterior and posterior ends of the animal, where transcripts are still found in the mesoderm and endoderm on the left side. At this time, expression also begins in the ectoderm on the left side of the head, in the region where the mouth later forms. These results suggest that amphioxus and vertebrate nodal genes play evolutionarily conserved roles in establishing Spemann's organizer, patterning the mesoderm rostrocaudally and setting up the asymmetrical left-right axis of the body.

  18. Pheromone-induced expression of immediate early genes in the mouse vomeronasal sensory system.

    PubMed

    Haga-Yamanaka, Sachiko; Touhara, Kazushige

    2013-01-01

    Immediate early genes (IEGs) are powerful tools for visualizing activated neurons and extended circuits that are stimulated by sensory input. Several kinds of IEGs (e.g., c-fos, egr-1) have been utilized for detecting activated receptor neurons in the pheromone sensory organ called the vomeronasal organ (VNO), as well as for mapping the neurons within the central nervous system (CNS) excited by pheromones.In this chapter, we describe the procedure for the detection of pheromone-induced neural activation in the VNO and CNS using the c-Fos immunostaining technique.

  19. SuperFly: a comparative database for quantified spatio-temporal gene expression patterns in early dipteran embryos.

    PubMed

    Cicin-Sain, Damjan; Pulido, Antonio Hermoso; Crombach, Anton; Wotton, Karl R; Jiménez-Guri, Eva; Taly, Jean-François; Roma, Guglielmo; Jaeger, Johannes

    2015-01-01

    We present SuperFly (http://superfly.crg.eu), a relational database for quantified spatio-temporal expression data of segmentation genes during early development in different species of dipteran insects (flies, midges and mosquitoes). SuperFly has a special focus on emerging non-drosophilid model systems. The database currently includes data of high spatio-temporal resolution for three species: the vinegar fly Drosophila melanogaster, the scuttle fly Megaselia abdita and the moth midge Clogmia albipunctata. At this point, SuperFly covers up to 9 genes and 16 time points per species, with a total of 1823 individual embryos. It provides an intuitive web interface, enabling the user to query and access original embryo images, quantified expression profiles, extracted positions of expression boundaries and integrated datasets, plus metadata and intermediate processing steps. SuperFly is a valuable new resource for the quantitative comparative study of gene expression patterns across dipteran species. Moreover, it provides an interesting test set for systems biologists interested in fitting mathematical gene network models to data. Both of these aspects are essential ingredients for progress toward a more quantitative and mechanistic understanding of developmental evolution.

  20. SuperFly: a comparative database for quantified spatio-temporal gene expression patterns in early dipteran embryos.

    PubMed

    Cicin-Sain, Damjan; Pulido, Antonio Hermoso; Crombach, Anton; Wotton, Karl R; Jiménez-Guri, Eva; Taly, Jean-François; Roma, Guglielmo; Jaeger, Johannes

    2015-01-01

    We present SuperFly (http://superfly.crg.eu), a relational database for quantified spatio-temporal expression data of segmentation genes during early development in different species of dipteran insects (flies, midges and mosquitoes). SuperFly has a special focus on emerging non-drosophilid model systems. The database currently includes data of high spatio-temporal resolution for three species: the vinegar fly Drosophila melanogaster, the scuttle fly Megaselia abdita and the moth midge Clogmia albipunctata. At this point, SuperFly covers up to 9 genes and 16 time points per species, with a total of 1823 individual embryos. It provides an intuitive web interface, enabling the user to query and access original embryo images, quantified expression profiles, extracted positions of expression boundaries and integrated datasets, plus metadata and intermediate processing steps. SuperFly is a valuable new resource for the quantitative comparative study of gene expression patterns across dipteran species. Moreover, it provides an interesting test set for systems biologists interested in fitting mathematical gene network models to data. Both of these aspects are essential ingredients for progress toward a more quantitative and mechanistic understanding of developmental evolution. PMID:25404137

  1. The effect of enterotoxigenic Escherichia coli F4ab,ac on early-weaned piglets: a gene expression study.

    PubMed

    Schroyen, M; Goddeeris, B M; Stinckens, A; Verhelst, R; Janssens, S; Cox, E; Georges, M; Niewold, T; Buys, N

    2013-03-15

    Diarrhoea in neonatal and early-weaned piglets due to enterotoxigenic Escherichia coli-F4 (ETEC-F4) is an important problem in the pig farming industry. There is substantial evidence for a genetic basis for susceptibility to ETEC-F4 since not all pigs suffer from diarrhoea after an ETEC-F4 infection. A region on SSC13 has been found to be in close linkage to the susceptibility of piglets for ETEC-F4ab,ac. Potential candidate genes on SSC13 have been examined and although some polymorphisms were found to be in linkage disequilibrium with the phenotype, the causative mutation has not yet been found. In this study we are looking at the expression of porcine genes in relation to ETEC-F4ab,ac. With the aid of the Affymetrix GeneChip Porcine Genome Array we were able to find differentially expressed genes between ETEC-F4ab,ac receptor positive (Fab,acR(+)) piglets without diarrhoea and F4ab,acR(+) piglets with diarrhoea or F4ab,acR(-) animals. Since the susceptibility to ETEC-F4ab,ac was described as a Mendelian trait, it is not so surprisingly that only two differentially expressed genes, transferrin receptor (TFRC) and trefoil factor 1 (TFF1), came out of the analysis. Although both genes could pass for functional candidate genes only TFRC also mapped to the region on SSC13 associated with susceptibility for ETEC-F4, which makes TFRC a positional functional candidate gene. Validation by qRT-PCR confirmed the differential expression of TFRC and TFF1. In piglets without diarrhoea, the expression of both genes was higher in F4ab,acR(+) than in F4ab,acR(-) piglets. Similarly, TFRC and TFF1 expression in F4ab,acR(+) piglets without diarrhoea was also higher than in F4ab,acR(+) piglets with diarrhoea. Consequently, although both genes might not play a role as receptor for F4 fimbriae, they could be of great importance during an ETEC-F4 outbreak. An upregulation of TFRC can be a consequence of the piglets ability to raise an effective immune response. An elevation of TFF1, a

  2. Expression of leptin and its receptor genes in the ovarian follicles of cycling and early pregnant pigs.

    PubMed

    Smolinska, N; Kaminski, T; Siawrys, G; Przala, J

    2013-01-01

    Leptin is a polypeptide hormone produced primarily by adipocytes. It has been implicated in the regulation of satiety and energy homeostasis. Leptin has been suggested to play a role in reproduction based on its involvement in the regulation of the hypothalamic-pituitary-gonadal axis via endocrine, paracrine and/or autocrine pathways. The aim of the present study was to localize the cellular distribution of leptin and the long isoform of leptin receptor (OB-Rb) genes in porcine ovarian antral follicles and to compare the expression levels of leptin and OB-Rb mRNAs in porcine granulosa cells (GC), theca interna (TIC) and theca externa (TEC) cells during the luteal phase of the estrous cycle and in early pregnancy. The expression of leptin and OB-Rb genes was detected in GC, TIC and TEC. Significantly higher levels of leptin gene expression in GC were observed during the mid- and late-luteal phases of the cycle than on days 30 to 32 of pregnancy. On days 14 to 16 of pregnancy, leptin mRNA expression was higher than that on days 14 to 16 of the cycle. The expression of the OB-Rb gene in GC and TEC increased during pregnancy in comparison with the analyzed luteal phases of the cycle. Our results validate the hypothesis that locally produced leptin plays a role in the regulation of porcine reproduction at the ovarian level and exerts a direct effect on porcine follicles. The differences in OB-Rb gene expression in porcine GC and theca cells also suggest that their sensitivity to leptin varies in the ovaries of pregnant and cyclic pigs.

  3. Gene expression profiling of metaplastic lineages identifies CDH17 as a prognostic marker in early-stage gastric cancer

    PubMed Central

    Lee, Hyuk-Joon; Nam, Ki Taek; Park, Heae Surng; Kim, Min A; LaFleur, Bonnie J.; Aburatani, Hiroyuki; Yang, Han-Kwang; Kim, Woo Ho; Goldenring, James R.

    2010-01-01

    Background & Aims Intestinal metaplasia (IM) and spasmolytic polypeptide-expressing metaplasia (SPEM) are precursors to gastric carcinogenesis. We sought to identify molecular biomarkers of gastric metaplasias and gastric cancer by gene expression profiling of metaplastic lesions from patients. Methods cDNA microarray analysis was performed on IM and SPEM cells isolated from patient samples using laser capture microdissection. Up-regulated transcripts in metaplstic lesions were confirmed by immunostaining analysis in IM, SPEM, and gastric cancer tissues. Proteins that were highly expressed specifically in gastric cancer tissues were analyzed for their association with survival in a test set (n=450) and a validation set (n=502) of samples from gastric cancer patients. Results Compared to normal chief cells, 858 genes were differentially expressed in IM or SPEM samples. Immunostaining was detected for 12 proteins, including 3 new markers of IM (ACE2, LGALS4, AKR1B10) and 3 of SPEM (OLFM4, LYZ, DPCR1). Of 13 proteins expressed in IM or SPEM, 8 were expressed by 17%–50% of human gastric cancer tissues (MUC13, OLFM4, CDH17, KRT20, MUC5AC, LGALS4, AKR1B10, REG4). Expression of CDH17 or MUC13 correlated with patient survival in the test and a validation sets. Multivariate analysis showed that CDH17 was an independent prognostic factor in patients with stage I or node-negative disease. Conclusion We identified several novel biomarkers for IM, SPEM, and gastric cancer using gene expression profiling of human metaplastic lesions. Expression of CDH17 and MUC13 was upregulated in gastric cancer tissues. CDH17 is a promising prognostic marker for early-stage gastric cancer. PMID:20398667

  4. Increased nitrogen-use efficiency in transgenic rice plants over-expressing a nitrogen-responsive early nodulin gene identified from rice expression profiling.

    PubMed

    Bi, Yong-Mei; Kant, Surya; Clarke, Joseph; Clark, Joseph; Gidda, Satinder; Ming, Feng; Xu, Jianyao; Rochon, Amanda; Shelp, Barry J; Hao, Lixin; Zhao, Rong; Mullen, Robert T; Zhu, Tong; Rothstein, Steven J

    2009-12-01

    Development of genetic varieties with improved nitrogen-use efficiency (NUE) is essential for sustainable agriculture. In this study, we developed a growth system for rice wherein N was the growth-limiting factor, and identified N-responsive genes by a whole genome transcriptional profiling approach. Some genes were selected to test their functionality in NUE by a transgenic approach. One such example with positive effects on NUE is an early nodulin gene OsENOD93-1. This OsENOD93-1 gene responded significantly to both N induction and N reduction. Transgenic rice plants over-expressing the OsENOD93-1 gene had increased shoot dry biomass and seed yield. This OsENOD93-1 gene was expressed at high levels in roots of wild-type (WT) plants, and its protein product was localized in mitochondria. Transgenic plants accumulated higher concentrations of total amino acids and total N in roots. A higher concentration of amino acids in xylem sap was detected in transgenic plants, especially under N stress. In situ hybridization revealed that OsENOD93-1 is expressed in vascular bundles, as well as in epidermis and endodermis. This work demonstrates that transcriptional profiling, coupled with a transgenic validation approach, is an effective strategy for gene discovery. The knowledge gained from this study could be applied to other important crops.

  5. Caffeine Induces High Expression of cyp-35A Family Genes and Inhibits the Early Larval Development in Caenorhabditis elegans

    PubMed Central

    Min, Hyemin; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

    2015-01-01

    Intake of caffeine during pregnancy can cause retardation of fetal development. Although the significant influence of caffeine on animal development is widely recognized, much remains unknown about its mode of action because of its pleiotropic effects on living organisms. In the present study, by using Caenorhabditis elegans as a model organism, the effects of caffeine on development were examined. Brood size, embryonic lethality, and percent larval development were investigated, and caffeine was found to inhibit the development of C. elegans at most of the stages in a dosage-dependent fashion. Upon treatment with 30 mM caffeine, the majority (86.1 ± 3.4%) of the L1 larvae were irreversibly arrested without further development. In contrast, many of the late-stage larvae survived and grew to adults when exposed to the same 30 mM caffeine. These results suggest that early-stage larvae are more susceptible to caffeine than later-stage larvae. To understand the metabolic responses to caffeine treatment, the levels of expression of cytochrome P450 (cyp) genes were examined with or without caffeine treatment using comparative micro-array, and it was found that the expression of 24 cyp genes was increased by more than 2-fold (p < 0.05). Among them, induction of the cyp-35A gene family was the most prominent. Interestingly, depletion of the cyp-35A family genes one-by-one or in combination through RNA interference resulted in partial rescue from early larval developmental arrest caused by caffeine treatment, suggesting that the high-level induction of cyp-35A family genes can be fatal to the development of early-stage larvae. PMID:25591395

  6. Caffeine induces high expression of cyp-35A family genes and inhibits the early larval development in Caenorhabditis elegans.

    PubMed

    Min, Hyemin; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

    2015-03-01

    Intake of caffeine during pregnancy can cause retardation of fetal development. Although the significant influence of caffeine on animal development is widely recognized, much remains unknown about its mode of action because of its pleiotropic effects on living organisms. In the present study, by using Caenorhabditis elegans as a model organism, the effects of caffeine on development were examined. Brood size, embryonic lethality, and percent larval development were investigated, and caffeine was found to inhibit the development of C. elegans at most of the stages in a dosage-dependent fashion. Upon treatment with 30 mM caffeine, the majority (86.1 ± 3.4%) of the L1 larvae were irreversibly arrested without further development. In contrast, many of the late-stage larvae survived and grew to adults when exposed to the same 30 mM caffeine. These results suggest that early-stage larvae are more susceptible to caffeine than later-stage larvae. To understand the metabolic responses to caffeine treatment, the levels of expression of cytochrome P450 (cyp) genes were examined with or without caffeine treatment using comparative micro-array, and it was found that the expression of 24 cyp genes was increased by more than 2-fold (p < 0.05). Among them, induction of the cyp-35A gene family was the most prominent. Interestingly, depletion of the cyp-35A family genes one-by-one or in combination through RNA interference resulted in partial rescue from early larval developmental arrest caused by caffeine treatment, suggesting that the high-level induction of cyp-35A family genes can be fatal to the development of early-stage larvae.

  7. Consequences of early life stress on the expression of endocannabinoid-related genes in the rat brain.

    PubMed

    Marco, Eva M; Echeverry-Alzate, Victor; López-Moreno, Jose Antonio; Giné, Elena; Peñasco, Sara; Viveros, Maria Paz

    2014-09-01

    The endocannabinoid system is involved in several physiological and pathological states including anxiety, depression, addiction and other neuropsychiatric disorders. Evidence from human and rodent studies suggests that exposure to early life stress may increase the risk of psychopathology later in life. Indeed, maternal deprivation (MD) (24 h at postnatal day 9) in rats induces behavioural alterations associated with depressive-like and psychotic-like symptoms, as well as important changes in the endocannabinoid system. As most neuropsychiatric disorders first appear at adolescence, and show remarkable sexual dimorphisms in their prevalence and severity, in the present study, we analysed the gene expression of the main components of the brain cannabinoid system in adolescent (postnatal day 46) Wistar male and female rats reared under standard conditions or exposed to MD. For this, we analysed, by real-time quantitative PCR, the expression of genes encoding for CB1 and CB2 receptors, TRPV1 and GPR55 (Cnr1, Cnr2a, Cnr2b, Trpv1, and Gpr55), for the major enzymes of synthesis, N-acyl phosphatidyl-ethanolamine phospholipase D (NAPE-PLD) and diacylglycerol lipase (DAGL) (Nape-pld, Dagla and Daglb), and degradation, fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) (Faah, Magl and Cox-2), in specific brain regions, that is, the frontal cortex, ventral and dorsal striatum, dorsal hippocampus and amygdala. In males, MD increased the genetic expression of all the genes studied within the frontal cortex, whereas in females such an increase was observed only in the hippocampus. In conclusion, the endocannabinoid system is sensitive to early life stress at the gene expression level in a sex-dependent and region-dependent manner, and these changes are already evident in the adolescent brain.

  8. Spaceflight and simulated microgravity cause a significant reduction of key gene expression in early T-cell activation.

    PubMed

    Martinez, Emily M; Yoshida, Miya C; Candelario, Tara Lynne T; Hughes-Fulford, Millie

    2015-03-15

    Healthy immune function depends on precise regulation of lymphocyte activation. During the National Aeronautics and Space Administration (NASA) Apollo and Shuttle eras, multiple spaceflight studies showed depressed lymphocyte activity under microgravity (μg) conditions. Scientists on the ground use two models of simulated μg (sμg): 1) the rotating wall vessel (RWV) and 2) the random positioning machine (RPM), to study the effects of altered gravity on cell function before advancing research to the true μg when spaceflight opportunities become available on the International Space Station (ISS). The objective of this study is to compare the effects of true μg and sμg on the expression of key early T-cell activation genes in mouse splenocytes from spaceflight and ground animals. For the first time, we compared all three conditions of microgravity spaceflight, RPM, and RWV during immune gene activation of Il2, Il2rα, Ifnγ, and Tagap; moreover, we confirm two new early T-cell activation genes, Iigp1 and Slamf1. Gene expression for all samples was analyzed using quantitative real-time PCR (qRT-PCR). Our results demonstrate significantly increased gene expression in activated ground samples with suppression of mouse immune function in spaceflight, RPM, and RWV samples. These findings indicate that sμg models provide an excellent test bed for scientists to develop baseline studies and augment true μg in spaceflight experiments. Ultimately, sμg and spaceflight studies in lymphocytes may provide insight into novel regulatory pathways, benefiting both future astronauts and those here on earth suffering from immune disorders. PMID:25568077

  9. Spaceflight and simulated microgravity cause a significant reduction of key gene expression in early T-cell activation

    PubMed Central

    Martinez, Emily M.; Yoshida, Miya C.; Candelario, Tara Lynne T.

    2015-01-01

    Healthy immune function depends on precise regulation of lymphocyte activation. During the National Aeronautics and Space Administration (NASA) Apollo and Shuttle eras, multiple spaceflight studies showed depressed lymphocyte activity under microgravity (μg) conditions. Scientists on the ground use two models of simulated μg (sμg): 1) the rotating wall vessel (RWV) and 2) the random positioning machine (RPM), to study the effects of altered gravity on cell function before advancing research to the true μg when spaceflight opportunities become available on the International Space Station (ISS). The objective of this study is to compare the effects of true μg and sμg on the expression of key early T-cell activation genes in mouse splenocytes from spaceflight and ground animals. For the first time, we compared all three conditions of microgravity spaceflight, RPM, and RWV during immune gene activation of Il2, Il2rα, Ifnγ, and Tagap; moreover, we confirm two new early T-cell activation genes, Iigp1 and Slamf1. Gene expression for all samples was analyzed using quantitative real-time PCR (qRT-PCR). Our results demonstrate significantly increased gene expression in activated ground samples with suppression of mouse immune function in spaceflight, RPM, and RWV samples. These findings indicate that sμg models provide an excellent test bed for scientists to develop baseline studies and augment true μg in spaceflight experiments. Ultimately, sμg and spaceflight studies in lymphocytes may provide insight into novel regulatory pathways, benefiting both future astronauts and those here on earth suffering from immune disorders. PMID:25568077

  10. Comparative study of MSX-2, DLX-5, and DLX-7 gene expression during early human tooth development.

    PubMed

    Davideau, J L; Demri, P; Hotton, D; Gu, T T; MacDougall, M; Sharpe, P; Forest, N; Berdal, A

    1999-12-01

    Msx and Dlx family transcription factors are key elements of craniofacial development and act in specific combinations with growth factors to control the position and shape of various skeletal structures in mice. In humans, the mutations of MSX and DLX genes are associated with specific syndromes, such as tooth agenesis, craniosynostosis, and tricho-dento-osseous syndrome. To establish some relationships between those reported human syndromes, previous experimental data in mice, and the expression patterns of MSX and DLX homeogenes in the human dentition, we investigated MSX-2, DLX-5, and DLX-7 expression patterns and compared them in orofacial tissues of 7.5- to 9-wk-old human embryos by using in situ hybridization. Our data showed that MSX-2 was strongly expressed in the progenitor cells of human orofacial skeletal structures, including mandible and maxilla bones, Meckel's cartilage, and tooth germs, as shown for DLX-5. DLX-7 expression was restricted to the vestibular lamina and, later on, to the vestibular part of dental epithelium. The comparison of MSX-2, DLX-5, and DLX-7 expression patterns during the early stages of development of different human tooth types showed the existence of spatially ordered sequences of homeogene expression along the vestibular/lingual axis of dental epithelium. The expression of MSX-2 in enamel knot, as well as the coincident expression of MSX-2, DLX-5, and DLX-7 in a restricted vestibular area of dental epithelium, suggests the existence of various organizing centers involved in the control of human tooth morphogenesis.

  11. Analysis of the early adaptive response of endothelial cells to hypoxia via a long serial analysis of gene expression

    SciTech Connect

    Liang, Guang-Ping; Su, Yong-Yue; Chen, Jian; Yang, Zong-Cheng; Liu, You-Sheng; Luo, Xiang-Dong

    2009-07-10

    Activation of endothelial cells in humans is an early event in the response to hypoxia that may contribute to the endothelium's endogenous capacity to reduce tissue injury. To better understand the mechanism underlying this process, we utilized Long Serial Analysis of Gene Expression to study the transcriptome of human vein umbilical endothelial cells (EA.hy926) shortly after the induction of hypoxia. Of over 13,000 genes detected in each pool, 112 showed obvious differences in expression. Metabolic processes such as protein biosynthesis and proteolysis, aminoglycan metabolism, ribonucleotide biosynthesis, adenosine salvage, and lipid metabolism were reinforced. Pro-proliferation and pro-apoptotic states suggest the co-existence of pro- and anti-injury forces in endothelium shortly after the induction of hypoxia. Other adaptive responses include reinforced angiogenesis and vasodilation. Additionally, gene transcription in the endothelium shortly after the induction of hypoxia was regulated independently of HIF-1{alpha}. Our efforts to elucidate the adaptive response at an early post-hypoxia stage should contribute to further investigation of the protective processes that occur in the endothelium and has potential clinical implications.

  12. Co-ordinate regulation of herpes simplex virus gene expression is mediated by the functional interaction of two immediate early gene products.

    PubMed

    Gelman, I H; Silverstein, S

    1986-10-01

    At early times after infection with herpes simplex virus, transcription from beta-promoters is initiated only in the presence of a functional 174,000 Mr phosphoprotein (ICP4), encoded by an immediate early (alpha) gene (IE4). A transient expression assay was used to analyze the requirement for two (ICP4 and ICP0) of the five alpha-gene products in the transcriptional regulation of model alpha and beta-gene promoters. These studies reveal that cells cotransfected with plasmids containing the alpha-gene sequences for infected cell proteins (ICPs) 4 and 0 and a thymidine kinase (TK, a beta-gene) gene or the thymidine kinase promoter fused to a chloramphenicol acetyltransferase (CAT) cassette accumulate 10 to 20-fold more RNA or exhibit 10 to 20-fold more CAT activity than cells cotransfected with a plasmid encoding either alpha-gene protein and a thymidine kinase indicator gene. Functional ICP4 is required for enhanced transcriptional activation in the transient expression assay system. It is also required for the uniform dispersal of ICP0 throughout the nucleus as shown by immunofluorescence staining analysis of transfected cells. Two alpha-promoter-CAT fusions were used as targets to study what effects ICP4, ICP0 and Vmw65 (the virion-associated alpha-gene transactivator) have on expression from alpha-promoters that contain all of the sequences that confer alpha-gene regulation, or only the core sequence governing basal level expression. We conclude that ICP4 can activate alpha-gene expression from the core sequence and, depending on its abundance, activate or repress expression from a promoter containing the sequences required for alpha-gene regulation. Independent of these alpha-regulatory sequences cotransfection with low levels of sequences encoding both ICP0 and ICP4 activate expression. At higher ratios of effector (both ICP4 and ICP0) the target accumulation of CAT activity decreases. Although a ts allele of IE4 (cloned from the mutant virus tsK) does not

  13. Early Changes in Gene Expression Induced by Tobacco Smoke: Evidence for the Importance of Estrogen within Lung Tissue

    PubMed Central

    Meireles, Sibele I.; Esteves, Gustavo H.; Hirata, Roberto; Peri, Suraj; Devarajan, Karthik; Slifker, Michael; Mosier, Stacy L.; Peng, Jing; Vadhanam, Manicka V.; Hurst, Harrell E.; Neves, E. Jordao; Reis, Luiz F.; Gairola, C. Gary; Gupta, Ramesh C.; Clapper, Margie L.

    2010-01-01

    Lung cancer is the leading cause of cancer deaths in the U.S., surpassing breast cancer as the primary cause of cancer-related mortality in women. The goal of the present study was to identify early molecular changes in the lung induced by exposure to tobacco smoke and thus identify potential targets for chemoprevention. Female A/J mice were exposed to either tobacco smoke or HEPA-filtered air via a whole-body exposure chamber (6 h/day; 5 days/wk for 3, 8 and 20 wk). Gene expression profiles of lung tissue from control and smoke-exposed animals were established using a 15 K cDNA microarray. Cytochrome P450 1b1 (Cyp1b1), a Phase I enzyme involved in both the metabolism of xenobiotics and the 4-hydroxylation of 17β-estradiol, was modulated to the greatest extent following smoke exposure. A panel of 10 genes was found to be differentially expressed in control and smoke-exposed lung tissue at 3, 8 and 20 wk (P < 0.001). The interaction network of these differentially expressed genes revealed new pathways modulated by short-term smoke exposure including estrogen metabolism. In addition, 17β-estradiol was detected within murine lung tissue by gas chromatography coupled mass spectrometry and immunohistochemistry. Identification of the early molecular events that contribute to lung tumor formation is anticipated to lead to the development of promising targeted chemopreventive therapies. In conclusion, the presence of 17β-estradiol within lung tissue when combined with the modulation of Cyp1b1 and other estrogen metabolism genes by tobacco smoke provides novel insight into a possible role for estrogens in lung cancer. PMID:20515954

  14. Ebola Virion Attachment and Entry into Human Macrophages Profoundly Effects Early Cellular Gene Expression

    PubMed Central

    Feldmann, Friedericke; Buehler, Lukas K.; Kindrachuk, Jason; DeFilippis, Victor; da Silva Correia, Jean; Früh, Klaus; Kuhn, Jens H.; Burton, Dennis R.; Feldmann, Heinz

    2011-01-01

    Zaire ebolavirus (ZEBOV) infections are associated with high lethality in primates. ZEBOV primarily targets mononuclear phagocytes, which are activated upon infection and secrete mediators believed to trigger initial stages of pathogenesis. The characterization of the responses of target cells to ZEBOV infection may therefore not only further understanding of pathogenesis but also suggest possible points of therapeutic intervention. Gene expression profiles of primary human macrophages exposed to ZEBOV were determined using DNA microarrays and quantitative PCR to gain insight into the cellular response immediately after cell entry. Significant changes in mRNA concentrations encoding for 88 cellular proteins were observed. Most of these proteins have not yet been implicated in ZEBOV infection. Some, however, are inflammatory mediators known to be elevated during the acute phase of disease in the blood of ZEBOV-infected humans. Interestingly, the cellular response occurred within the first hour of Ebola virion exposure, i.e. prior to virus gene expression. This observation supports the hypothesis that virion binding or entry mediated by the spike glycoprotein (GP1,2) is the primary stimulus for an initial response. Indeed, ZEBOV virions, LPS, and virus-like particles consisting of only the ZEBOV matrix protein VP40 and GP1,2 (VLPVP40-GP) triggered comparable responses in macrophages, including pro-inflammatory and pro-apoptotic signals. In contrast, VLPVP40 (particles lacking GP1,2) caused an aberrant response. This suggests that GP1,2 binding to macrophages plays an important role in the immediate cellular response. PMID:22028943

  15. Integrating early life experience, gene expression, brain development, and emergent phenotypes: unraveling the thread of nature via nurture.

    PubMed

    Weaver, Ian C G

    2014-01-01

    Adaptation to environmental changes is based on the perpetual generation of new phenotypes. Modern biology has focused on the role of epigenetic mechanisms in facilitating the adaptation of organisms to changing environments through alterations in gene expression. Inherited and/or acquired epigenetic factors are relatively stable and have regulatory roles in numerous genomic activities that translate into phenotypic outcomes. Evidence that dietary and pharmacological interventions have the potential to reverse environment-induced modification of epigenetic states (e.g., early life experience, nutrition, medication, infection) has provided an additional stimulus for understanding the biological basis of individual differences in cognitive abilities and disorders of the brain. It has been suggested that accurate quantification of the relative contribution of heritable genetic and epigenetic variation is essential for understanding phenotypic divergence and adaptation in changing environments, a process requiring stable modulation of gene expression. The main challenge for epigenetics in psychology and psychiatry is to determine how experiences and environmental cues, including the nature of our nurture, influence the expression of neuronal genes to produce long-term individual differences in behavior, cognition, personality, and mental health. To this end, focusing on DNA and histone modifications and their initiators, mediators and readers may provide new inroads for understanding the molecular basis of phenotypic plasticity and disorders of the brain. In this chapter, we review recent discoveries highlighting epigenetic aspects of normal brain development and mental illness, as well as discuss some future directions in the field of behavioral epigenetics.

  16. Regulation of gene expression during early neuronal differentiation: evidence for patterns conserved across neuron populations and vertebrate classes.

    PubMed

    Ernsberger, Uwe

    2012-04-01

    Analysis of transcription factor function during neurogenesis has provided a huge amount of data on the generation and specification of diverse neuron populations in the central and peripheral nervous systems of vertebrates. However, an understanding of the induction of key neuron functions including electrical information processing and synaptic transmission lags seriously behind. Whereas pan-neuronal markers such as neurofilaments, neuron-specific tubulin and RNA-binding proteins have often been included in developmental analysis, the molecular players underlying electrical activity and transmitter release have been neglected in studies addressing gene expression during neuronal induction. Here, I summarize the evidence for a distinct accumulation pattern of mRNAs for synaptic proteins, a pattern that is delayed compared with pan-neuronal gene expression during neurogenesis. The conservation of this pattern across diverse avian and mammalian neuron populations suggests a common mechanism for the regulation of various sets of neuronal genes during initial neuronal differentiation. The co-regulation of genes coding for synaptic proteins from embryonic to postnatal development indicates that the expression of the players required for synaptic transmission shares common regulatory features. For the ion channels involved in neuronal electrical activity, such as voltage-gated sodium channels, the situation is less clear because of the lack of comparative studies early during neurogenesis. Transcription factors have been characterized that regulate the expression of synaptic proteins in vitro and in vivo. They currently do not explain the co-regulation of these genes across different neuron populations. The neuron-restrictive silencing factor NRSF/REST targets a large gene set, but not all of the genes coding for pan-neuronal, synaptic and ion channel proteins. The discrepancy between NRSF/REST loss-of-function and silencer-to-activator-switch studies leaves the full

  17. The Early-Onset Myocardial Infarction Associated PHACTR1 Gene Regulates Skeletal and Cardiac Alpha-Actin Gene Expression

    PubMed Central

    Kelloniemi, Annina; Szabo, Zoltan; Serpi, Raisa; Näpänkangas, Juha; Ohukainen, Pauli; Tenhunen, Olli; Kaikkonen, Leena; Koivisto, Elina; Bagyura, Zsolt; Kerkelä, Risto; Leosdottir, Margret; Hedner, Thomas; Melander, Olle

    2015-01-01

    The phosphatase and actin regulator 1 (PHACTR1) locus is a very commonly identified hit in genome-wide association studies investigating coronary artery disease and myocardial infarction (MI). However, the function of PHACTR1 in the heart is still unknown. We characterized the mechanisms regulating Phactr1 expression in the heart, used adenoviral gene delivery to investigate the effects of Phactr1 on cardiac function, and analyzed the relationship between MI associated PHACTR1 allele and cardiac function in human subjects. Phactr1 mRNA and protein levels were markedly reduced (60%, P<0.01 and 90%, P<0.001, respectively) at 1 day after MI in rats. When the direct myocardial effects of Phactr1 were studied, the skeletal α-actin to cardiac α-actin isoform ratio was significantly higher (1.5-fold, P<0.05) at 3 days but 40% lower (P<0.05) at 2 weeks after adenovirus-mediated Phactr1 gene delivery into the anterior wall of the left ventricle. Similarly, the skeletal α-actin to cardiac α-actin ratio was lower at 2 weeks in infarcted hearts overexpressing Phactr1. In cultured neonatal cardiac myocytes, adenovirus-mediated Phactr1 overexpression for 48 hours markedly increased the skeletal α-actin to cardiac α-actin ratio, this being associated with an enhanced DNA binding activity of serum response factor. Phactr1 overexpression exerted no major effects on the expression of other cardiac genes or LV structure and function in normal and infarcted hearts during 2 weeks’ follow-up period. In human subjects, MI associated PHACTR1 allele was not associated significantly with cardiac function (n = 1550). Phactr1 seems to regulate the skeletal to cardiac α-actin isoform ratio. PMID:26098115

  18. Early expression of stem cell-associated genes within the CD8 compartment after treatment with a tumor vaccine.

    PubMed

    Kohler, M Eric; Hallett, William H D; Chen, Qing-Rong; Khan, Javed; Johnson, Bryon D; Orentas, Rimas J

    2010-01-01

    Using a mouse neuroblastoma cell line, we have demonstrated that vaccination of tumor-free mice with a cell-based vaccine leads to productive immunity and resistance to tumor challenge, while vaccination of tumor-bearing mice does not. The T cell immunity induced by this vaccine, as measured by in vitro assays, is amplified by the depletion of Treg. Our goal is to understand this barrier to the development of protective cellular immunity. mRNA microarray analyses of CD8(+) T cells from naïve or tumor-bearing mice undergoing vaccination were carried out with or without administering anti-CD25 antibody. Gene-expression pathway analysis revealed the presence of CD8(+) T cells expressing stem cell-associated genes early after induction of productive anti-tumor immunity in tumor-free mice, prior to any phenotypic changes, but not in tumor-bearing mice. These data demonstrate that early after the induction of productive immune response, cells within the CD8(+) T cell compartment adopt a stem cell-related genetic phenotype that correlates with increased anti-tumor function.

  19. Expression of genes involved in the embryo-maternal interaction in the early-pregnant canine uterus.

    PubMed

    Kautz, E; Gram, A; Aslan, S; Ay, S S; Selçuk, M; Kanca, H; Koldaş, E; Akal, E; Karakaş, K; Findik, M; Boos, A; Kowalewski, M P

    2014-05-01

    Although there is no acute luteolytic mechanism in the absence of pregnancy in the bitch, a precise and well-timed embryo-maternal interaction seems to be required for the initiation and maintenance of gestation. As only limited information is available about these processes in dogs, in this study, the uterine expression of possible decidualization markers was investigated during the pre-implantation stage (days 10-12) of pregnancy and in the corresponding nonpregnant controls. In addition, the expression of selected genes associated with blastocyst development and/or implantation was investigated in embryos flushed from the uteri of bitches used for this study (unhatched and hatched blastocysts). There was an upregulated expression of prolactin receptor (PRLR) and IGF2 observed pre-implantation. The expression of PRL and of IGF1 was unaffected, and neither was the expression of progesterone- or estrogen receptor β (ESR2). In contrast, (ESR1) levels were elevated during early pregnancy. Prostaglandin (PG)-system revealed upregulated expression of PGE2-synthase and its receptors, PTGER2 and PTGER4, and of the PG-transporter. Elevated levels of AKR1C3 mRNA, but not the protein itself, were noted. Expression of prostaglandin-endoperoxide synthase 2 (PTGS2) remained unaffected. Most of the transcripts were predominantly localized to the uterine epithelial cells, myometrium and, to a lesser extent, to the uterine stroma. PGES (PTGES) mRNA was abundantly expressed in both groups of embryos and appeared higher in the hatched ones. The expression level of IGF2 mRNA appeared higher than that of IGF1 mRNA in hatched embryos. In unhatched embryos IGF1, IGF2, and PTGS2 mRNA levels were below the detection limit.

  20. TGFβ2 regulates hypothalamic Trh expression through the TGFβ inducible early gene-1 (TIEG1) during fetal development.

    PubMed

    Martínez-Armenta, Miriam; Díaz de León-Guerrero, Sol; Catalán, Ana; Alvarez-Arellano, Lourdes; Uribe, Rosa Maria; Subramaniam, Malayannan; Charli, Jean-Louis; Pérez-Martínez, Leonor

    2015-01-15

    The hypothalamus regulates the homeostasis of the organism by controlling hormone secretion from the pituitary. The molecular mechanisms that regulate the differentiation of the hypothalamic thyrotropin-releasing hormone (TRH) phenotype are poorly understood. We have previously shown that Klf10 or TGFβ inducible early gene-1 (TIEG1) is enriched in fetal hypothalamic TRH neurons. Here, we show that expression of TGFβ isoforms (1-3) and both TGFβ receptors (TβRI and II) occurs in the hypothalamus concomitantly with the establishment of TRH neurons during late embryonic development. TGFβ2 induces Trh expression via a TIEG1 dependent mechanism. TIEG1 regulates Trh expression through an evolutionary conserved GC rich sequence on the Trh promoter. Finally, in mice deficient in TIEG1, Trh expression is lower than in wild type animals at embryonic day 17. These results indicate that TGFβ signaling, through the upregulation of TIEG1, plays an important role in the establishment of Trh expression in the embryonic hypothalamus.

  1. Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs

    PubMed Central

    Stoker, Aaron M; Cook, James L; Kuroki, Keiichi; Fox, Derek B

    2006-01-01

    Background Osteoarthritis (OA) is a progressive and debilitating disease that often develops from a focal lesion and may take years to clinically manifest to a complete loss of joint structure and function. Currently, there is not a cure for OA, but early diagnosis and initiation of treatment may dramatically improve the prognosis and quality of life for affected individuals. This study was designed to determine the feasibility of analyzing changes in gene expression of articular cartilage using the Pond-Nuki model two weeks after ACL-transection in dogs, and to characterize the changes observed at this time point. Methods The ACL of four dogs was completely transected arthroscopically, and the contralateral limb was used as the non-operated control. After two weeks the dogs were euthanatized and tissues harvested from the tibial plateau and femoral condyles of both limbs. Two dogs were used for histologic analysis and Mankin scoring. From the other two dogs the surface of the femoral condyle and tibial plateau were divided into four regions each, and tissues were harvested from each region for biochemical (GAG and HP) and gene expression analysis. Significant changes in gene expression were determined using REST-XL, and Mann-Whitney rank sum test was used to analyze biochemical data. Significance was set at (p < 0.05). Results Significant differences were not observed between ACL-X and control limbs for Mankin scores or GAG and HP tissue content. Further, damage to the tissue was not observed grossly by India ink staining. However, significant changes in gene expression were observed between ACL-X and control tissues from each region analyzed, and indicate that a unique regional gene expression profile for impending ACL-X induced joint pathology may be identified in future studies. Conclusion The data obtained from this study lend credence to the research approach and model for the characterization of OA, and the identification and validation of future diagnostic

  2. The 19S proteasome activator promotes human cytomegalovirus immediate early gene expression through proteolytic and nonproteolytic mechanisms.

    PubMed

    Winkler, Laura L; Kalejta, Robert F

    2014-10-01

    Proteasomes are large, multisubunit complexes that support normal cellular activities by executing the bulk of protein turnover. During infection, many viruses have been shown to promote viral replication by using proteasomes to degrade cellular factors that restrict viral replication. For example, the human cytomegalovirus (HCMV) pp71 protein induces the proteasomal degradation of Daxx, a cellular transcriptional repressor that can silence viral immediate early (IE) gene expression. We previously showed that this degradation requires both the proteasome catalytic 20S core particle (CP) and the 19S regulatory particle (RP). The 19S RP associates with the 20S CP to facilitate protein degradation but also plays a 20S CP-independent role promoting transcription. Here, we present a nonproteolytic role of the 19S RP in HCMV IE gene expression. We demonstrate that 19S RP subunits are recruited to the major immediate early promoter (MIEP) that directs IE transcription. Depletion of 19S RP subunits generated a defect in RNA polymerase II elongation through the MIE locus during HCMV infection. Our results reveal that HCMV commandeers proteasome components for both proteolytic and nonproteolytic roles to promote HCMV lytic infection. Importance: Proteasome inhibitors decrease or eliminate 20S CP activity and are garnering increasing interest as chemotherapeutics. However, an increasing body of evidence implicates 19S RP subunits in important proteolytic-independent roles during transcription. Thus, pharmacological inhibition of the 20S CP as a means to modulate proteasome function toward therapeutic effect is an incomplete capitalization on the potential of this approach. Here, we provide an additional example of nonproteolytic 19S RP function in promoting HCMV transcription. These data provide a novel system with which to study the roles of different proteasome components during transcription, a rationale for previously described shifts in 19S RP subunit localization during

  3. Segment polarity gene expression in a myriapod reveals conserved and diverged aspects of early head patterning in arthropods.

    PubMed

    Janssen, Ralf

    2012-09-01

    Arthropods show two kinds of developmental mode. In the so-called long germ developmental mode (as exemplified by the fly Drosophila), all segments are formed almost simultaneously from a preexisting field of cells. In contrast, in the so-called short germ developmental mode (as exemplified by the vast majority of arthropods), only the anterior segments are patterned similarly as in Drosophila, and posterior segments are added in a single or double segmental periodicity from a posterior segment addition zone (SAZ). The addition of segments from the SAZ is controlled by dynamic waves of gene activity. Recent studies on a spider have revealed that a similar dynamic process, involving expression of the segment polarity gene (SPG) hedgehog (hh), is involved in the formation of the anterior head segments. The present study shows that in the myriapod Glomeris marginata the early expression of hh is also in a broad anterior domain, but this domain corresponds only to the ocular and antennal segment. It does not, like in spiders, represent expression in the posterior adjacent segment. In contrast, the anterior hh pattern is conserved in Glomeris and insects. All investigated myriapod SPGs and associated factors are expressed with delay in the premandibular (tritocerebral) segment. This delay is exclusively found in insects and myriapods, but not in chelicerates, crustaceans and onychophorans. Therefore, it may represent a synapomorphy uniting insects and myriapods (Atelocerata hypothesis), contradicting the leading opinion that suggests a sister relationship of crustaceans and insects (Pancrustacea hypothesis). In Glomeris embryos, the SPG engrailed is first expressed in the mandibular segment. This feature is conserved in representatives of all arthropod classes suggesting that the mandibular segment may have a special function in anterior patterning.

  4. Immediate early gene expression reveals interactions between social and nicotine rewards on brain activity in adolescent male rats.

    PubMed

    Bastle, Ryan M; Peartree, Natalie A; Goenaga, Julianna; Hatch, Kayla N; Henricks, Angela; Scott, Samantha; Hood, Lauren E; Neisewander, Janet L

    2016-10-15

    Smoking initiation predominantly occurs during adolescence, often in the presence of peers. Therefore, understanding the neural mechanisms underlying the rewarding effects of nicotine and social stimuli is vital. Using the conditioned place preference (CPP) procedure, we measured immediate early gene (IEG) expression in animals following exposure either to a reward-conditioned environment or to the unconditioned stimuli (US). Adolescent, male rats were assigned to the following CPP US conditions: (1) Saline+Isolated, (2) Nicotine+Isolated, (3) Saline+Social, or (4) Nicotine+Social. For Experiment 1, brain tissue was collected 90min following the CPP expression test and processed for Fos immunohistochemistry. We found that rats conditioned with nicotine with or without a social partner exhibited CPP; however, we found no group differences in Fos expression in any brain region analyzed, with the exception of the nucleus accumbens core that exhibited a social-induced attenuation in Fos expression. For Experiment 2, brain tissue was collected 90min following US exposure during the last conditioning session. We found social reward-induced increases in IEG expression in striatal and amydalar subregions. In contrast, nicotine reduced IEG expression in prefrontal and striatal subregions. Reward interactions were also found in the dorsolateral striatum, basolateral amygdala, and ventral tegmental area where nicotine alone attenuated IEG expression and social reward reversed this effect. These results suggest that in general social rewards enhance, whereas nicotine attenuates, activation of mesocorticolimbic regions; however, the rewards given together interact to enhance activation in some regions. The findings contribute to knowledge of how a social environment influences nicotine effects.

  5. Construction and characterization of a herpes simplex virus type 1 mutant unable to transinduce immediate-early gene expression.

    PubMed

    Ace, C I; McKee, T A; Ryan, J M; Cameron, J M; Preston, C M

    1989-05-01

    A herpes simplex virus mutant, in1814, possessing a 12-base-pair insertion in the gene encoding the transinducing factor Vmw65 has been constructed. The insertion abolished the ability of Vmw65 to transinduce immediate-early (IE) gene expression and to form a protein-DNA complex with cell proteins and the IE-specific regulatory element TAATGAGAT. Accumulation of IE RNA 1 and 2 was reduced four- to fivefold in in1814-infected cells, but the level of IE RNA 4 was reduced only by twofold, and IE RNA 3 was unaffected. Mutant in1814 had a high particle/PFU ratio, but many of the particles, although unable to form plaques, were capable of normal participation in the early stages of infection at high multiplicity of infection. The defect of in1814 was overcome partially by transfection of a plasmid encoding the IE protein Vmw110 into cells prior to titration and by prior infection with ultraviolet light-inactivated herpes simplex virus. Mutant in1814 was essentially avirulent when injected into mice. The results demonstrate that transinduction of IE transcription by Vmw65 is important at low multiplicity of infection and in vivo but that at high multiplicity of infection the function is redundant.

  6. Coordinated gene expression in adipose tissue and liver differs between cows with high or low NEFA concentrations in early lactation.

    PubMed

    van Dorland, H A; Sadri, H; Morel, I; Bruckmaier, R M

    2012-02-01

    Dairy cows with high and low plasma non-esterified fatty acid (NEFA) concentrations in early lactation were compared for plasma parameters and mRNA expression of genes in liver and subcutaneous adipose tissue. The study involved 16 multiparous dairy cows with a plasma NEFA concentration of >500 μmol/l [n = 8, high NEFA (HNEFA)] and <140 μmol/l [n = 8, low NEFA (LNEFA)] in the first week post-partum (pp). Blood samples, adipose and liver tissues were collected on day 1 (+1d) and at week 3 pp (+3wk). Blood plasma was assayed for concentrations of metabolites and hormones. Subcutaneous adipose and liver tissues were analysed for mRNA abundance by real-time qRT-PCR encoding parameters related to lipid metabolism. Results showed that mean daily milk yield and milk fat quantity were higher in HNEFA than in LNEFA cows (p < 0.01), and the NEB was more negative in HNEFA than in LNEFA in +3wk too (p < 0.05). HNEFA cows had slightly lower (p < 0.1) insulin concentrations than LNEFA cows across the study period, and the body condition score decreased more from +1d to +3wk in HNEFA than in LNEFA (p = 0.09). The mRNA abundance of genes in the liver related to fatty acid oxidation (carnitine palmitoyltransferase 2 and very long chain acyl-coenzyme A dehydrogenase) and ketogenesis (3-hydroxy-3-methylglutaryl-coenzyme A synthase 2) were lower in HNEFA than in LNEFA cows. No differences between the two groups were observed for mRNA expression of genes in adipose tissue. The number of calculated significant correlation coefficients (moderately strong) between parameters in the liver and in adipose tissue was nearly similar on +1d, and higher for HNEFA compared with LNEFA cows in +3wk. In conclusion, dairy cows with high compared with low plasma NEFA concentrations in early lactation show differentially synchronized mRNA expression of genes in adipose tissue and liver in +3wk that suggests a different orchestrated homeorhetic regulation of lipid metabolism.

  7. Early embryonic death-associated changes in genome-wide gene expression profiles in the fetal placenta of the cow carrying somatic nuclear-derived cloned embryo.

    PubMed

    Oishi, Masahito; Gohma, Hiroshi; Hashizume, Kazuyoshi; Taniguchi, Yukio; Yasue, Hiroshi; Takahashi, Seiya; Yamada, Takahisa; Sasaki, Yoshiyuki

    2006-04-01

    Successful somatic nuclear transfer-derived cloning has been reported in cattle; however, the cloned embryo is highly susceptible to death around day 60 of gestation leading to early embryonic loss. The early embryonic death is postulated to possibly arise in part from an atypical placentation. We have performed cDNA macroarray analysis using 3,353 of the previously cataloged 4,165 genes, in order to characterize the early embryonic death-associated changes in genome-wide gene expression profiles in the fetal placenta of the cow carrying somatic nuclear transfer-derived cloned embryo. A more marked difference in the expression profiles was observed between the fetal placentas of the cows with the cloned immotile embryo (CD) and with the cloned motile embryo (CL) or artificial insemination-derived motile embryo (AI), as compared to between the CL and AI placentas, suggesting an aberration of the expression profile in the CD placenta among the three placentas. Further, 291 and 77 genes showed more than twofold elevation and less than 50% reduction, respectively, in either or both of two CD (CD1 and CD2) placentas in comparison with the CL placenta, but no differential expression between the CL and AI placentas. The expression patterns of six genes in the AI, CL, and CD placentas were confirmed in an experiment with an additional sample for each of the three placentas. Among the placental genes showing the early embryonic death-associated changes of expression in the cow with the cloned embryo, IGF2 (elevated gene), and HBA1, HBA2, SPTB, and SPTBN1 genes (reduced gene) are intriguing in that the changes of expression in these genes were observed in an additional sample of CD placenta as well as the CD1 and CD2 placentas, and in that overexpression (for IGF2) and dysfunction or deficiency (for HBA1, HBA2, SPTB, and SPTBN1) result in embryonic lethality.

  8. Time Course of Immediate Early Gene Protein Expression in the Spinal Cord following Conditioning Stimulation of the Sciatic Nerve in Rats

    PubMed Central

    Bojovic, Ognjen; Panja, Debabrata; Bittins, Margarethe; Bramham, Clive R.; Tjølsen, Arne

    2015-01-01

    Long-term potentiation induced by conditioning electrical stimulation of afferent fibers is a widely studied form of synaptic plasticity in the brain and the spinal cord. In the spinal cord dorsal horn, long-term potentiation is induced by a series of high-frequency trains applied to primary afferent fibers. Conditioning stimulation (CS) of sciatic nerve primary afferent fibers also induces expression of immediate early gene proteins in the lumbar spinal cord. However, the time course of immediate early gene expression and the rostral-caudal distribution of expression in the spinal cord have not been systematically studied. Here, we examined the effects of sciatic nerve conditioning stimulation (10 stimulus trains, 0.5 ms stimuli, 7.2 mA, 100 Hz, train duration 2 s, 8 s intervals between trains) on cellular expression of immediate early genes, Arc, c-Fos and Zif268, in anesthetized rats. Immunohistochemical analysis was performed on sagittal sections obtained from Th13- L5 segments of the spinal cord at 1, 2, 3, 6 and 12 h post-CS. Strikingly, all immediate early genes exhibited a monophasic increase in expression with peak increases detected in dorsal horn neurons at 2 hours post-CS. Regional analysis showed peak increases at the location between the L3 and L4 spinal segments. Both Arc, c-Fos and Zif268 remained significantly elevated at 2 hours, followed by a sharp decrease in immediate early gene expression between 2 and 3 hours post-CS. Colocalization analysis performed at 2 hours post-CS showed that all c-Fos and Zif268 neurons were positive for Arc, while 30% and 43% of Arc positive neurons were positive for c-Fos and Zif268, respectively. The present study identifies the spinal cord level and time course of immediate early gene (IEGP) expression of relevance for analysis of IEGPs function in neuronal plasticity and nociception. PMID:25860146

  9. Genes of the adaptive immune system are expressed early in zebrafish larval development following lipopolysaccharide stimulation

    NASA Astrophysics Data System (ADS)

    Li, Fengling; Zhang, Shicui; Wang, Zhiping; Li, Hongyan

    2011-03-01

    Information regarding immunocompetence of the adaptive immune system (AIS) in zebrafish Danio rerio remains limited. Here, we stimulated an immune response in fish embryos, larvae and adults using lipopolysaccharide (LPS) and measured the upregulation of a number of AIS-related genes ( Rag2, AID, TCRAC, IgLC-1, mIg, sIg, IgZ and DAB) 3 and 18 h later. We found that all of the genes evaluated were strongly induced following LPS stimulation, with most of them responding at 8 d post fertilization. This confirms that a functional adaptive immune response is present in D. rerio larvae, and provides a window for further functional analyses.

  10. Heterosis manifestation during early Arabidopsis seedling development is characterized by intermediate gene expression and enhanced metabolic activity in the hybrids.

    PubMed

    Meyer, Rhonda C; Witucka-Wall, Hanna; Becher, Martina; Blacha, Anna; Boudichevskaia, Anastassia; Dörmann, Peter; Fiehn, Oliver; Friedel, Svetlana; von Korff, Maria; Lisec, Jan; Melzer, Michael; Repsilber, Dirk; Schmidt, Renate; Scholz, Matthias; Selbig, Joachim; Willmitzer, Lothar; Altmann, Thomas

    2012-08-01

    Heterosis-associated cellular and molecular processes were analyzed in seeds and seedlings of Arabidopsis thaliana accessions Col-0 and C24 and their heterotic hybrids. Microscopic examination revealed no advantages in terms of hybrid mature embryo organ sizes or cell numbers. Increased cotyledon sizes were detectable 4 days after sowing. Growth heterosis results from elevated cell sizes and numbers, and is well established at 10 days after sowing. The relative growth rates of hybrid seedlings were most enhanced between 3 and 4 days after sowing. Global metabolite profiling and targeted fatty acid analysis revealed maternal inheritance patterns for a large proportion of metabolites in the very early stages. During developmental progression, the distribution shifts to dominant, intermediate and heterotic patterns, with most changes occurring between 4 and 6 days after sowing. The highest incidence of heterotic patterns coincides with establishment of size differences at 4 days after sowing. In contrast, overall transcript patterns at 4, 6 and 10 days after sowing are characterized by intermediate to dominant patterns, with parental transcript levels showing the largest differences. Overall, the results suggest that, during early developmental stages, intermediate gene expression and higher metabolic activity in the hybrids compared to the parents lead to better resource efficiency, and therefore enhanced performance in the hybrids.

  11. Early Cytokine and Chemokine Gene Expression during Pseudomonas aeruginosa Corneal Infection in Mice

    PubMed Central

    Kernacki, Karen A.; Goebel, Dennis J.; Poosch, Michael S.; Hazlett, Linda D.

    1998-01-01

    Using a multiprobe RNase protection assay, we examined cytokine and chemokine mRNAs that were expressed after corneal infection with Pseudomonas aeruginosa in mice. Cytokines that were upregulated included interleukin-1α (IL-1α) and -1β, IL-1 receptor antagonist, IL-6, IL-11, granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, stem cell factor, lymphotoxin β, transforming growth factor β1, and tumor necrosis factor alpha. Chemokine transcripts that were upregulated included Eotaxin; gamma-interferon-inducible protein 10; monocyte chemoattractant protein 1; macrophage inflammatory proteins 1α, 1β, and 2; and RANTES. Peak expression of these cytokines and chemokines was observed between 1 and 3 days after infection. These responses returned to or approached baseline preinfection levels by 7 days after ocular challenge. Identification of the various cytokines and chemokines upregulated during corneal infection provides important information relevant to unraveling the pathogenesis induced by this bacterium and provides hope that specific molecules can be targeted for therapy. PMID:9423885

  12. Quantitative perturbation-based analysis of gene expression predicts enhancer activity in early Drosophila embryo.

    PubMed

    Sayal, Rupinder; Dresch, Jacqueline M; Pushel, Irina; Taylor, Benjamin R; Arnosti, David N

    2016-01-01

    Enhancers constitute one of the major components of regulatory machinery of metazoans. Although several genome-wide studies have focused on finding and locating enhancers in the genomes, the fundamental principles governing their internal architecture and cis-regulatory grammar remain elusive. Here, we describe an extensive, quantitative perturbation analysis targeting the dorsal-ventral patterning gene regulatory network (GRN) controlled by Drosophila NF-κB homolog Dorsal. To understand transcription factor interactions on enhancers, we employed an ensemble of mathematical models, testing effects of cooperativity, repression, and factor potency. Models trained on the dataset correctly predict activity of evolutionarily divergent regulatory regions, providing insights into spatial relationships between repressor and activator binding sites. Importantly, the collective predictions of sets of models were effective at novel enhancer identification and characterization. Our study demonstrates how experimental dataset and modeling can be effectively combined to provide quantitative insights into cis-regulatory information on a genome-wide scale. PMID:27152947

  13. Shaped 3D singular spectrum analysis for quantifying gene expression, with application to the early zebrafish embryo.

    PubMed

    Shlemov, Alex; Golyandina, Nina; Holloway, David; Spirov, Alexander

    2015-01-01

    Recent progress in microscopy technologies, biological markers, and automated processing methods is making possible the development of gene expression atlases at cellular-level resolution over whole embryos. Raw data on gene expression is usually very noisy. This noise comes from both experimental (technical/methodological) and true biological sources (from stochastic biochemical processes). In addition, the cells or nuclei being imaged are irregularly arranged in 3D space. This makes the processing, extraction, and study of expression signals and intrinsic biological noise a serious challenge for 3D data, requiring new computational approaches. Here, we present a new approach for studying gene expression in nuclei located in a thick layer around a spherical surface. The method includes depth equalization on the sphere, flattening, interpolation to a regular grid, pattern extraction by Shaped 3D singular spectrum analysis (SSA), and interpolation back to original nuclear positions. The approach is demonstrated on several examples of gene expression in the zebrafish egg (a model system in vertebrate development). The method is tested on several different data geometries (e.g., nuclear positions) and different forms of gene expression patterns. Fully 3D datasets for developmental gene expression are becoming increasingly available; we discuss the prospects of applying 3D-SSA to data processing and analysis in this growing field.

  14. The Expression Pattern of Melatonin Receptor 1a Gene during Early Life Stages in the Nile tilapia (Oreochromis niloticus)

    PubMed Central

    Jin, Ye Hwa; Park, Jin Woo; Kim, Jung-Hyun; Kwon, Joon Yeong

    2013-01-01

    The action of melatonin within the body of animals is known to be mediated by melatonin receptors. Three different types of melatonin receptors have been identified so far in fish. However, which of these are specifically involved in puberty onset is not known in fish. We cloned and analyzed the sequence of melatonin receptor 1a (mel 1a) gene in Nile tilapia Oreochromis niloticus. In addition, we examined the tissue distribution of gene expressions for three types of receptors, mel 1a, 1b and lc and investigated which of them is involved in the onset of puberty by comparing their expression with that of gonadotropin-releasing hormone receptor I (GnRHr I) gene using quantitative real-time PCR from 1 week post hatch (wph) to 24 wph. The mel 1a gene of Nile tilapia consisted of two exons and one bulky intron between them. Mel 1a gene was found to be highly conserved gene showing high homology with the corresponding genes from different teleost. All three types of melatonin receptor genes were expressed in the brain, eyes and ovary in common. Expression of mel 1a gene was the most abundant and ubiquitous among 3 receptors in the brain, liver, gill, ovary, muscle, eye, heart, intestine, spleen and kidney. Mel 1b and mel 1c genes were, however, expressed in fewer tissues at low level. During the development post hatch, expressions of both mel 1a and GnRHr I genes significantly increased at 13 wph which was close to the putative timing of puberty onset in this species. These results suggest that among three types of receptors mel 1a is most likely associated with the action of melatonin in the onset of puberty in Nile tilapia. PMID:25949120

  15. Profiles of mRNA expression of related genes in the duck hypothalamus-pituitary growth axis during embryonic and early post-hatch development.

    PubMed

    Hu, Yan; Liu, Hongxiang; Song, Chi; Xu, Wenjuan; Ji, Gaige; Zhu, Chunhong; Shu, Jingting; Li, Huifang

    2015-03-15

    In this study, the ontogeny of body and liver weight and the pattern of related gene mRNA expression in the hypothalamus-pituitary growth axis (HPGA) of two different duck breeds (Anas platyrhynchos domestica) were compared during embryonic and post-hatch development. Duck hypothalamic growth hormone release hormone (GHRH), somatostatin (SS), pituitary growth hormone (GH), liver growth hormone receptor (GHR) and insulin-like growth factor-I (IGF-1) mRNA were first detected on the 13th embryonic day. During early duck development, SS maintained a lower expression status, whereas the other four genes exhibited highly significant variations in an age-specific manner. Highly significant breed specificity was observed with respect to hepatic IGF-1 mRNA expression, which showed a significant breed-age interaction effect. Compared with previous studies on chickens, significant species differences were observed regarding the mRNA expression of bird embryonic HPGA-related genes. During early development, highly significant breed and age specificity were observed with respect to developmental changes in body and liver weight, and varying degrees of significant linear correlation were found between these performances and the mRNA expression of HPGA-related genes in the duck HPGA. These results suggest that different genetic backgrounds may lead to differences in duck growth and HPGA-related gene mRNA expression, and the differential mRNA expression of related genes in the duck HPGA may be particularly important in the early growth of ducks. Furthermore, hepatic IGF-1 mRNA expression presented highly significant breed specificity, and evidence suggests the involvement of hepatic IGF-1 in mediating genetic effects on embryo and offspring growth in ducks.

  16. Quantitative perturbation-based analysis of gene expression predicts enhancer activity in early Drosophila embryo

    PubMed Central

    Sayal, Rupinder; Dresch, Jacqueline M; Pushel, Irina; Taylor, Benjamin R; Arnosti, David N

    2016-01-01

    Enhancers constitute one of the major components of regulatory machinery of metazoans. Although several genome-wide studies have focused on finding and locating enhancers in the genomes, the fundamental principles governing their internal architecture and cis-regulatory grammar remain elusive. Here, we describe an extensive, quantitative perturbation analysis targeting the dorsal-ventral patterning gene regulatory network (GRN) controlled by Drosophila NF-κB homolog Dorsal. To understand transcription factor interactions on enhancers, we employed an ensemble of mathematical models, testing effects of cooperativity, repression, and factor potency. Models trained on the dataset correctly predict activity of evolutionarily divergent regulatory regions, providing insights into spatial relationships between repressor and activator binding sites. Importantly, the collective predictions of sets of models were effective at novel enhancer identification and characterization. Our study demonstrates how experimental dataset and modeling can be effectively combined to provide quantitative insights into cis-regulatory information on a genome-wide scale. DOI: http://dx.doi.org/10.7554/eLife.08445.001 PMID:27152947

  17. Selective translational regulation of ribosomal protein gene expression during early development of Drosophila melanogaster.

    PubMed Central

    Kay, M A; Jacobs-Lorena, M

    1985-01-01

    We have previously characterized a cloned cDNA coding for a developmentally regulated mRNA in Drosophila melanogaster whose expression is selectively regulated at the translational level during oogenesis and embryogenesis. In this report we show that this translationally regulated mRNA (rpA1) codes for an acidic ribosomal protein. Furthermore, our results indicate that most ribosomal protein mRNAs are regulated similarly to rpA1 mRNA. This conclusion is based on cell-free translation of mRNAs derived from polysomes and postpolysomal supernatants as well as in vivo labeling experiments. Thus, the translation of many ribosomal protein mRNAs appears to be temporally related to the synthesis of rRNA during D. melanogaster development. The relationship between rRNA transcription and ribosomal protein mRNA translation was further investigated by genetically reducing rRNA synthesis with the use of bobbed mutants. Unexpectedly, neither ribosomal protein mRNA abundance nor translation was altered in these mutants. Images PMID:3939320

  18. Paternal poly (ADP-ribose) metabolism modulates retention of inheritable sperm histones and early embryonic gene expression.

    PubMed

    Ihara, Motomasa; Meyer-Ficca, Mirella L; Leu, N Adrian; Rao, Shilpa; Li, Fan; Gregory, Brian D; Zalenskaya, Irina A; Schultz, Richard M; Meyer, Ralph G

    2014-05-01

    To achieve the extreme nuclear condensation necessary for sperm function, most histones are replaced with protamines during spermiogenesis in mammals. Mature sperm retain only a small fraction of nucleosomes, which are, in part, enriched on gene regulatory sequences, and recent findings suggest that these retained histones provide epigenetic information that regulates expression of a subset of genes involved in embryo development after fertilization. We addressed this tantalizing hypothesis by analyzing two mouse models exhibiting abnormal histone positioning in mature sperm due to impaired poly(ADP-ribose) (PAR) metabolism during spermiogenesis and identified altered sperm histone retention in specific gene loci genome-wide using MNase digestion-based enrichment of mononucleosomal DNA. We then set out to determine the extent to which expression of these genes was altered in embryos generated with these sperm. For control sperm, most genes showed some degree of histone association, unexpectedly suggesting that histone retention in sperm genes is not an all-or-none phenomenon and that a small number of histones may remain associated with genes throughout the genome. The amount of retained histones, however, was altered in many loci when PAR metabolism was impaired. To ascertain whether sperm histone association and embryonic gene expression are linked, the transcriptome of individual 2-cell embryos derived from such sperm was determined using microarrays and RNA sequencing. Strikingly, a moderate but statistically significant portion of the genes that were differentially expressed in these embryos also showed different histone retention in the corresponding gene loci in sperm of their fathers. These findings provide new evidence for the existence of a linkage between sperm histone retention and gene expression in the embryo.

  19. Αlpha 2a-Adrenoceptor Gene Expression and Early Life Stress-Mediated Propensity to Alcohol Drinking in Outbred Rats

    PubMed Central

    Comasco, Erika; Todkar, Aniruddha; Granholm, Linnea; Nilsson, Kent W.; Nylander, Ingrid

    2015-01-01

    Stressful events early in life, later high alcohol consumption and vulnerability to alcohol use disorder (AUD) are tightly linked. Norepinephrine is highly involved in the stress response and the α2A-adrenoceptor, which is an important regulator of norepinephrine signalling, is a putative target in pharmacotherapy of AUD. The aim of the present study was to investigate the effects of early-life stress and adult voluntary alcohol drinking on the α2A-adrenoceptor. The relative expression and promoter DNA methylation of the Adra2a gene were measured in the hypothalamus, a key brain region in stress regulation. A well-characterized animal model of early-life stress was used in combination with an episodic voluntary drinking in adulthood. Alcohol drinking rats with a history of early-life stress had lower Adra2a expression than drinking rats not exposed to stress. Alcohol intake and Adra2a gene expression were negatively correlated in high-drinking animals, which were predominantly rats subjected to early-life stress. The results provide support for a link between early-life stress, susceptibility for high alcohol consumption, and low Adra2a expression in the hypothalamus. These findings can increase our understanding of the neurobiological basis for vulnerability to initiate risk alcohol consumption and individual differences in the response to α2A-adrenoceptor agonists. PMID:26121187

  20. A gene expression atlas of a bicoid-depleted Drosophila embryo reveals early canalization of cell fate

    PubMed Central

    Staller, Max V.; Fowlkes, Charless C.; Bragdon, Meghan D. J.; Wunderlich, Zeba; Estrada, Javier; DePace, Angela H.

    2015-01-01

    In developing embryos, gene regulatory networks drive cells towards discrete terminal fates, a process called canalization. We studied the behavior of the anterior-posterior segmentation network in Drosophila melanogaster embryos by depleting a key maternal input, bicoid (bcd), and measuring gene expression patterns of the network at cellular resolution. This method results in a gene expression atlas containing the levels of mRNA or protein expression of 13 core patterning genes over six time points for every cell of the blastoderm embryo. This is the first cellular resolution dataset of a genetically perturbed Drosophila embryo that captures all cells in 3D. We describe the technical developments required to build this atlas and how the method can be employed and extended by others. We also analyze this novel dataset to characterize the degree and timing of cell fate canalization in the segmentation network. We find that in two layers of this gene regulatory network, following depletion of bcd, individual cells rapidly canalize towards normal cell fates. This result supports the hypothesis that the segmentation network directly canalizes cell fate, rather than an alternative hypothesis whereby cells are initially mis-specified and later eliminated by apoptosis. Our gene expression atlas provides a high resolution picture of a classic perturbation and will enable further computational modeling of canalization and gene regulation in this transcriptional network. PMID:25605785

  1. Sex and strategy use matters for pattern separation, adult neurogenesis, and immediate early gene expression in the hippocampus.

    PubMed

    Yagi, Shunya; Chow, Carmen; Lieblich, Stephanie E; Galea, Liisa A M

    2016-01-01

    Adult neurogenesis in the dentate gyrus (DG) plays a crucial role for pattern separation, and there are sex differences in the regulation of neurogenesis. Although sex differences, favoring males, in spatial navigation have been reported, it is not known whether there are sex differences in pattern separation. The current study was designed to determine whether there are sex differences in the ability for separating similar or distinct patterns, learning strategy choice, adult neurogenesis, and immediate early gene (IEG) expression in the DG in response to pattern separation training. Male and female Sprague-Dawley rats received a single injection of the DNA synthesis marker, bromodeoxyuridine (BrdU), and were tested for the ability of separating spatial patterns in a spatial pattern separation version of delayed nonmatching to place task using the eight-arm radial arm maze. Twenty-seven days following BrdU injection, rats received a probe trial to determine whether they were idiothetic or spatial strategy users. We found that male spatial strategy users outperformed female spatial strategy users only when separating similar, but not distinct, patterns. Furthermore, male spatial strategy users had greater neurogenesis in response to pattern separation training than all other groups. Interestingly, neurogenesis was positively correlated with performance on similar pattern trials during pattern separation in female spatial strategy users but negatively correlated with performance in male idiothetic strategy users. These results suggest that the survival of new neurons may play an important positive role for pattern separation of similar patterns in females. Furthermore, we found sex and strategy differences in IEG expression in the CA1 and CA3 regions in response to pattern separation. These findings emphasize the importance of studying biological sex on hippocampal function and neural plasticity.

  2. 17α-Ethinylestradiol (EE2) treatment of wild roach (Rutilus rutilus) during early life development disrupts expression of genes directly involved in the feedback cycle of estrogen.

    PubMed

    Nikoleris, Lina; Hultin, Cecilia L; Hallgren, Per; Hansson, Maria C

    2016-02-01

    Fish are more sensitive to introduced disturbances from synthetic endocrine disrupting compounds during early life phases compared with mature stages. 17α-Ethinylestradiol (EE2), which is the active compound in human oral contraceptives and hormone replacement therapies, is today ever present in the effluents from sewage treatment plants. EE2 targets and interacts with the endogenous biological systems of exposed vertebrates resulting in to large extents unknown short- and long-term effects. We investigated how EE2 exposure affects expression profiles of a large number of target genes during early life of roach (Rutilus rutilus). We exposed fertilized roach eggs collected from a lake in Southern Sweden to EE2 for 12weeks together with 1+-year-old roach in aquaria. We measured the gene expression of the estrogen receptor (esr)1/2a/2b, androgen receptor (ar), vitellogenin, cytochrome P450 (cyp)19a1a/1b in fertilized eggs; newly hatched larvae; 12-week-old fry; and juvenile wild roach (1+-year-old). Results shows that an EE2 concentration as low as 0.5ng/L significantly affects gene expression during early development. Gene expression responses vary both among life stages and molecular receptors. We also show that the gene profile of the estrogen feedback cycle to a large extent depends on the relationship between the three esr genes and the two cyp19a1 genes, which are all up-regulated with age. Results indicate that a disruption of the natural activity of the dominant esr gene could lead to detrimental biological effects if EE2 exposure occurs during development, even if this exposure occurred for only a short period. PMID:26689641

  3. Reduction in WT1 gene expression during early treatment predicts the outcome in patients with acute myeloid leukemia.

    PubMed

    Andersson, Charlotta; Li, Xingru; Lorenz, Fryderyk; Golovleva, Irina; Wahlin, Anders; Li, Aihong

    2012-12-01

    Wilms tumor gene 1 (WT1) expression has been suggested as an applicable minimal residual disease marker in acute myeloid leukemia (AML). We evaluated the use of this marker in 43 adult AML patients. Quantitative assessment of WT1 gene transcripts was performed using real-time quantitative-polymerase chain reaction assay. Samples from both the peripheral blood and the bone marrow were analyzed at diagnosis and during follow-up. A strong correlation was observed between WT1 normalized with 2 different control genes (β-actin and ABL1, P<0.001). WT1 mRNA level at diagnosis was of no prognostic relevance (P>0.05). A≥1-log reduction in WT1 expression in bone marrow samples taken <1 month after diagnosis significantly correlated with an improved overall survival (P=0.004) and freedom from relapse (P=0.010) when β-actin was used as control gene. Furthermore, a reduction in WT1 expression by ≥2 logs in peripheral blood samples taken at a later time point significantly correlated with a better outcome for overall survival (P=0.004) and freedom from relapse (P=0.012). This result was achieved when normalizing against both β-actin and ABL1. These results therefore suggest that WT1 gene expression can provide useful information for minimal residual disease detection in adult AML patients and that combined use of control genes can give more informative results.

  4. Type I Interferon Released by Myeloid Dendritic Cells Reversibly Impairs Cytomegalovirus Replication by Inhibiting Immediate Early Gene Expression

    PubMed Central

    Holzki, Julia Katharina; Dağ, Franziska; Dekhtiarenko, Iryna; Rand, Ulfert; Casalegno-Garduño, Rosaely; Trittel, Stephanie; May, Tobias; Riese, Peggy

    2015-01-01

    ABSTRACT Cytomegalovirus (CMV) is a ubiquitous beta-herpesvirus whose reactivation from latency is a major cause of morbidity and mortality in immunocompromised hosts. Mouse CMV (MCMV) is a well-established model virus to study virus-host interactions. We showed in this study that the CD8-independent antiviral function of myeloid dendritic cells (mDC) is biologically relevant for the inhibition of MCMV replication in vivo and in vitro. In vivo ablation of CD11c+ DC resulted in higher viral titers and increased susceptibility to MCMV infection in the first 3 days postinfection. We developed in vitro coculture systems in which we cocultivated MCMV-infected endothelial cells or fibroblasts with T cell subsets and/or dendritic cells. While CD8 T cells failed to control MCMV replication, bone marrow-derived mDC reduced viral titers by a factor of up to 10,000. Contact of mDC with the infected endothelial cells was crucial for their antiviral activity. Soluble factors secreted by the mDC blocked MCMV replication at the level of immediate early (IE) gene expression, yet the viral lytic cycle reinitiated once the mDC were removed from the cells. On the other hand, the mDC did not impair MCMV replication in cells deficient for the interferon (IFN) alpha/beta receptor (IFNAR), arguing that type I interferons were critical for viral control by mDC. In light of our recent observation that type I IFN is sufficient for the induction of latency immediately upon infection, our results imply that IFN secreted by mDC may play an important role in the establishment of CMV latency. IMPORTANCE Numerous studies have focused on the infection of DC with cytomegaloviruses and on the establishment of latency within them. However, almost all of these studies have relied on the infection of DC monocultures in vitro, whereas DC are just one among many cell types present in an infection site in vivo. To mimic this aspect of the in vivo situation, we cocultured DC with infected endothelial cells

  5. Early and sustained altered expression of aging-related genes in young 3xTg-AD mice

    PubMed Central

    Gatta, V; D'Aurora, M; Granzotto, A; Stuppia, L; Sensi, S L

    2014-01-01

    Alzheimer's disease (AD) is a multifactorial neurological condition associated with a genetic profile that is still not completely understood. In this study, using a whole gene microarray approach, we investigated age-dependent gene expression profile changes occurring in the hippocampus of young and old transgenic AD (3xTg-AD) and wild-type (WT) mice. The aim of the study was to assess similarities between aging- and AD-related modifications of gene expression and investigate possible interactions between the two processes. Global gene expression profiles of hippocampal tissue obtained from 3xTg-AD and WT mice at 3 and 12 months of age (m.o.a.) were analyzed by hierarchical clustering. Interaction among transcripts was then studied with the Ingenuity Pathway Analysis (IPA) software, a tool that discloses functional networks and/or pathways associated with sets of specific genes of interest. Cluster analysis revealed the selective presence of hundreds of upregulated and downregulated transcripts. Functional analysis showed transcript involvement mainly in neuronal death and autophagy, mitochondrial functioning, intracellular calcium homeostasis, inflammatory response, dendritic spine formation, modulation of synaptic functioning, and cognitive decline. Thus, overexpression of AD-related genes (such as mutant APP, PS1, and hyperphosphorylated tau, the three genes that characterize our model) appears to favor modifications of additional genes that are involved in AD development and progression. The study also showed overlapping changes in 3xTg-AD at 3 m.o.a. and WT mice at 12 m.o.a., thereby suggesting altered expression of aging-related genes that occurs earlier in 3xTg-AD mice. PMID:24525730

  6. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  7. Early over expression of messenger RNA for multiple genes, including insulin, in the Pancreatic Lymph Nodes of NOD mice is associated with Islet Autoimmunity

    PubMed Central

    Regnault, Béatrice; Osorio y Fortea, José; Miao, Dongmei; Eisenbarth, George; Melanitou, Evie

    2009-01-01

    Background Autoimmune diabetes (T1D) onset is preceded by a long inflammatory process directed against the insulin-secreting β cells of the pancreas. Deciphering the early autoimmune mechanisms represents a challenge due to the absence of clinical signs at early disease stages. The aim of this study was to identify genes implicated in the early steps of the autoimmune process, prior to inflammation, in T1D. We have previously established that insulin autoantibodies (E-IAA) predict early diabetes onset delineating an early phenotypic check point (window 1) in disease pathogenesis. We used this sub-phenotype and applied differential gene expression analysis in the pancreatic lymph nodes (PLN) of 5 weeks old Non Obese Diabetic (NOD) mice differing solely upon the presence or absence of E-IAA. Analysis of gene expression profiles has the potential to provide a global understanding of the disease and to generate novel hypothesis concerning the initiation of the autoimmune process. Methods Animals have been screened weekly for the presence of E-IAA between 3 and 5 weeks of age. E-IAA positive or negative NOD mice at least twice were selected and RNAs isolated from the PLN were used for microarray analysis. Comparison of transcriptional profiles between positive and negative animals and functional annotations of the resulting differentially expressed genes, using software together with manual literature data mining, have been performed. Results The expression of 165 genes was modulated between E-IAA positive and negative PLN. In particular, genes coding for insulin and for proteins known to be implicated in tissue remodelling and Th1 immunity have been found to be highly differentially expressed. Forty one genes showed over 5 fold differences between the two sets of samples and 30 code for extracellular proteins. This class of proteins represents potential diagnostic markers and drug targets for T1D. Conclusion Our data strongly suggest that the immune related mechanisms

  8. Identification of genes differentially expressed during early interactions between the stem rot fungus (Sclerotium rolfsii) and peanut (Arachis hypogaea) cultivars with increasing disease resistance levels.

    PubMed

    Jogi, Ansuya; Kerry, John W; Brenneman, Timothy B; Leebens-Mack, James H; Gold, Scott E

    2016-03-01

    Sclerotium rolfsii, a destructive soil-borne fungal pathogen causes stem rot of the cultivated peanut, Arachis hypogaea. This study aimed to identify differentially expressed genes associated with peanut resistance and fungal virulence. Four peanut cultivars (A100-32, Georgia Green, GA-07W and York) with increasing resistance levels were inoculated with a virulent S. rolfsii strain to study the early plant-pathogen interaction. 454 sequencing was performed on RNAs from infected tissue collected at 4 days post inoculation, generating 225,793 high-quality reads. Normalized read counts and fold changes were calculated and statistical analysis used to identify differentially expressed genes. Several genes identified as differential in the RNA-seq experiment were selected based on functions of interest and real-time PCR employed to corroborate their differential expression. Expanding the analysis to include all four cultivars revealed a small but interesting set of genes showing colinearity between cultivar resistance and expression levels. This study identified a set of genes possibly related to pathogen response that may be useful marker assisted selection or transgenic disease control strategies. Additionally, a set of differentially expressed genes that have not been functionally characterized in peanut or other plants and warrant additional investigation were identified.

  9. Expression of p53 Target Genes in the Early Phase of Long-Term Potentiation in the Rat Hippocampal CA1 Area

    PubMed Central

    Pustylnyak, Vladimir O.; Lisachev, Pavel D.; Shtark, Mark B.

    2015-01-01

    Gene expression plays an important role in the mechanisms of long-term potentiation (LTP), which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC) tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity. PMID:25767724

  10. Expression profiles of differentially regulated genes during the early stages of apple flower infection with Erwinia amylovora.

    PubMed

    Sarowar, Sujon; Zhao, Youfu; Soria-Guerra, Ruth Elena; Ali, Shahjahan; Zheng, Danman; Wang, Dongping; Korban, Schuyler S

    2011-10-01

    To identify genes involved in the response to the fire blight pathogen Erwinia amylovora in apple (Malus×domestica), expression profiles were investigated using an apple oligo (70-mer) array representing 40, 000 genes. Blossoms of a fire blight-susceptible apple cultivar Gala were collected from trees growing in the orchard, placed on a tray in the laboratory, and spray-inoculated with a suspension of E. amylovora at a concentration of 10(8) cfu ml(-1). Uninoculated detached flowers served as controls at each time point. Expression profiles were captured at three different time points post-inoculation at 2, 8, and 24 h, together with those at 0 h (uninoculated). A total of about 3500 genes were found to be significantly modulated in response to at least one of the three time points. Among those, a total of 770, 855, and 1002 genes were up-regulated, by 2-fold, at 2, 8, and 24 h following inoculation, respectively; while, 748, 1024, and 1455 genes were down-regulated, by 2-fold, at 2, 8, and 24 h following inoculation, respectively. Over the three time points post-inoculation, 365 genes were commonly up-regulated and 374 genes were commonly down-regulated. Both sets of genes were classified based on their functional categories. The majority of up-regulated genes were involved in metabolism, signal transduction, signalling, transport, and stress response. A number of transcripts encoding proteins/enzymes known to be up-regulated under particular biotic and abiotic stress were also up-regulated following E. amylovora treatment. Those up- or down-regulated genes encode transcription factors, signaling components, defense-related, transporter, and metabolism, all of which have been associated with disease responses in Arabidopsis and rice, suggesting similar response pathways are involved in apple blossoms.

  11. The varicella-zoster virus-mediated delayed host shutoff: open reading frame 17 has no major function, whereas immediate-early 63 protein represses heterologous gene expression.

    PubMed

    Desloges, Nathalie; Rahaus, Markus; Wolff, Manfred H

    2005-12-01

    We reported that varicella-zoster virus (VZV) causes a delayed host shutoff during its replicative cycle. VZV open reading frame 17 (ORF17) is the homologue of the herpes simplex virus (HSV) UL41 gene encoding the virion host shutoff (vhs) protein which is responsible for the shutoff effect observed in HSV-infected cells. In the present study, we demonstrated that ORF17 is expressed as a late protein during the VZV replicative cycle in different infected permissive cell lines which showed a delayed shutoff of cellular RNA. A cell line with stable expression of VZV ORF17 was infected with VZV. In these cells, VZV replication and delayed host shutoff remained unchanged when compared to normal infected cells. ORF17 was not capable of repressing the expression of the beta-gal reporter gene under the control of the human cytomegalovirus immediate-early gene promoter or to inhibit the expression of a CAT reporter gene under the control of the human GAPDH promoter, indicating that ORF17 has no major function in the VZV-mediated delayed host shutoff. To determine whether other viral factors are involved in the host shutoff, a series of cotransfection assays was performed. We found that the immediate-early 63 protein (IE63) was able to downregulate the expression of reporter genes under the control of the two heterologous promoters, indicating that this viral factor can be involved in the VZV-mediated delayed host shutoff. Other factors can be also implicated to modulate the repressing action of IE63 to achieve a precise balance between the viral and cellular gene expression.

  12. First Generation Gene Expression Signature for Early Prediction of Late Occurring Hematological Acute Radiation Syndrome in Baboons.

    PubMed

    Port, M; Herodin, F; Valente, M; Drouet, M; Lamkowski, A; Majewski, M; Abend, M

    2016-07-01

    We implemented a two-stage study to predict late occurring hematologic acute radiation syndrome (HARS) in a baboon model based on gene expression changes measured in peripheral blood within the first two days after irradiation. Eighteen baboons were irradiated to simulate different patterns of partial-body and total-body exposure, which corresponded to an equivalent dose of 2.5 or 5 Gy. According to changes in blood cell counts the surviving baboons (n = 17) exhibited mild (H1-2, n = 4) or more severe (H2-3, n = 13) HARS. Blood samples taken before irradiation served as unexposed control (H0, n = 17). For stage I of this study, a whole genome screen (mRNA microarrays) was performed using a portion of the samples (H0, n = 5; H1-2, n = 4; H2-3, n = 5). For stage II, using the remaining samples and the more sensitive methodology, qRT-PCR, validation was performed on candidate genes that were differentially up- or down-regulated during the first two days after irradiation. Differential gene expression was defined as significant (P < 0.05) and greater than or equal to a twofold difference above a H0 classification. From approximately 20,000 genes, on average 46% appeared to be expressed. On day 1 postirradiation for H2-3, approximately 2-3 times more genes appeared up-regulated (1,418 vs. 550) or down-regulated (1,603 vs. 735) compared to H1-2. This pattern became more pronounced at day 2 while the number of differentially expressed genes decreased. The specific genes showed an enrichment of biological processes coding for immune system processes, natural killer cell activation and immune response (P = 1 × E-06 up to 9 × E-14). Based on the P values, magnitude and sustained differential gene expression over time, we selected 89 candidate genes for validation using qRT-PCR. Ultimately, 22 genes were confirmed for identification of H1-3 classifications and seven genes for identification of H2-3 classifications using qRT-PCR. For H1-3 classifications, most genes were

  13. Meta-analysis of Gene Expression in the Mouse Liver Reveals Biomarkers Associated with Inflammation Increased Early During Aging

    EPA Science Inventory

    Aging is associated with a predictable loss of cellular homeostasis, a decline in physiological function and an increase in various diseases. We hypothesized that similar age-related gene expression profiles would be observed in mice across independent studies. Employing a metaan...

  14. Early-phase GVHD gene expression profile in target versus non-target tissues: kidney, a possible target?

    PubMed

    Sadeghi, B; Al-Chaqmaqchi, H; Al-Hashmi, S; Brodin, D; Hassan, Z; Abedi-Valugerdi, M; Moshfegh, A; Hassan, M

    2013-02-01

    GVHD is a major complication after allo-SCT. In GVHD, some tissues like liver, intestine and skin are infiltrated by donor T cells while others like muscle are not. The mechanism underlying targeted tropism of donor T cells is not fully understood. In the present study, we aim to explore differences in gene expression profile among target versus non-target tissues in a mouse model of GVHD based on chemotherapy conditioning. Expression levels of JAK-signal transducers and activators of transcription (STAT), CXCL1, ICAM1 and STAT3 were increased in the liver and remained unchanged (or decreased) in the muscle and kidney after conditioning. At the start of GVHD the expression levels of CXCL9, ITGb2, SAA3, MARCO, TLR and VCAM1 were significantly higher in the liver or kidney compared with the muscle of GVHD animals. Moreover, biological processes of inflammatory reactions, leukocyte migration, response to bacterium and chemotaxis followed the same pattern. Our data show that both chemotherapy and allogenicity exclusively induce expression of inflammatory genes in target tissues. Moreover, gene expression profile and histopathological findings in the kidney are similar to those observed in the liver of GVHD mice.

  15. Expression of proteolipid protein gene in spinal cord stem cells and early oligodendrocyte progenitor cells is dispensable for normal cell migration and myelination.

    PubMed

    Harlow, Danielle E; Saul, Katherine E; Culp, Cecilia M; Vesely, Elisa M; Macklin, Wendy B

    2014-01-22

    Plp1 gene expression occurs very early in development, well before the onset of myelination, creating a conundrum with regard to the function of myelin proteolipid protein (PLP), one of the major proteins in compact myelin. Using PLP-EGFP mice to investigate Plp1 promoter activity, we found that, at very early time points, PLP-EGFP was expressed in Sox2+ undifferentiated precursors in the spinal cord ventricular zone (VZ), as well as in the progenitors of both neuronal and glial lineages. As development progressed, most PLP-EGFP-expressing cells gave rise to oligodendrocyte progenitor cells (OPCs). The expression of PLP-EGFP in the spinal cord was quite dynamic during development. PLP-EGFP was highly expressed as cells delaminated from the VZ. Expression was downregulated as cells moved laterally through the cord, and then robustly upregulated as OPCs differentiated into mature myelinating oligodendrocytes. The presence of PLP-EGFP expression in OPCs raises the question of its role in this migratory population. We crossed PLP-EGFP reporter mice into a Plp1-null background to investigate the role of PLP in early OPC development. In the absence of PLP, normal numbers of OPCs were generated and their distribution throughout the spinal cord was unaffected. However, the orientation and length of OPC processes during migration was abnormal in Plp1-null mice, suggesting that PLP plays a role either in the structural integrity of OPC processes or in their response to extracellular cues that orient process outgrowth.

  16. Expression profile of IGF-I-calcineurin-NFATc3-dependent pathway genes in skeletal muscle during early development between duck breeds differing in growth rates.

    PubMed

    Shu, Jingting; Li, Huifang; Shan, Yanju; Xu, Wenjuan; Chen, Wenfeng; Song, Chi; Song, Weitao

    2015-06-01

    The insulin-like growth factor I (IGF-I)-calcineurin (CaN)-NFATc signaling pathways have been implicated in the regulation of myocyte hypertrophy and fiber-type specificity. In the present study, the expression of the CnAα, NFATc3, and IGF-I genes was quantified by RT-PCR for the first time in the breast muscle (BM) and leg muscle (LM) on days 13, 17, 21, 25, and 27 of embryonic development, as well as at 7 days posthatching (PH), in Gaoyou and Jinding ducks, which differ in their muscle growth rates. Consistent expression patterns of CnAα, NFATc3, and IGF-I were found in the same anatomical location at different development stages in both duck breeds, showing significant differences in an age-specific fashion. However, the three genes were differentially expressed in the two different anatomical locations (BM and LM). CnAα, NFATc3, and IGF-I messenger RNA (mRNA) could be detected as early as embryonic day 13 (ED13), and the highest level appeared at this stage in both BM and LM. Significant positive relationships were observed in the expression of the studied genes in the BM and LM of both duck breeds. Also, the expression of these three genes showed a positive relationship with the percentage of type IIb fibers and a negative relationship with the percentage of type I fibers and type IIa fibers. Our data indicate differential expression and coordinated developmental regulation of the selected genes involved in the IGF-I-calcineurin-NFATc3 pathway in duck skeletal muscle during embryonic and early PH growth and development; these data also indicate that this signaling pathway might play a role in the regulation of myofiber type transition.

  17. Promiscuous trans activation of gene expression by an Epstein-Barr virus-encoded early nuclear protein.

    PubMed Central

    Lieberman, P M; O'Hare, P; Hayward, G S; Hayward, S D

    1986-01-01

    We identified an Epstein-Barr virus (EBV) gene product which functions in transient-expression assays as a nonspecific trans activator. In Vero cells, cotransfection of the BglII J DNA fragment of EBV together with recombinant constructs containing the bacterial chloramphenicol acetyltransferase (CAT) gene gave up to a 100-fold increased expression of CAT activity over that in cells transfected with the recombinant CAT constructs alone. The BglII J fragment acted promiscuously, in that increased CAT synthesis was observed regardless of whether the promoter sequences driving the CAT gene were of EBV, simian virus 40, adenovirus, or herpes simplex virus origin. Cleavage of cloned BglII-J plasmid DNA before transfection revealed that activation was dependent upon the presence of an intact BMLF1 open reading frame. This was confirmed with subclones of BglII-J and with hybrid promoter-open reading frame constructs. This region of the genome is also present in the rearranged P3HR-1-defective DNA species, and defective DNA clones containing these sequences produced a similar activation of CAT expression in cotransfection experiments. The heterogeneous 45-60-kilodalton polypeptide product of BMLF1 may play an important regulatory role in expression of lytic-cycle proteins in EBV-infected lymphocytes. Images PMID:3018281

  18. Epigenetics and gene expression.

    PubMed

    Gibney, E R; Nolan, C M

    2010-07-01

    Transcription, translation and subsequent protein modification represent the transfer of genetic information from the archival copy of DNA to the short-lived messenger RNA, usually with subsequent production of protein. Although all cells in an organism contain essentially the same DNA, cell types and functions differ because of qualitative and quantitative differences in their gene expression. Thus, control of gene expression is at the heart of differentiation and development. Epigenetic processes, including DNA methylation, histone modification and various RNA-mediated processes, are thought to influence gene expression chiefly at the level of transcription; however, other steps in the process (for example, translation) may also be regulated epigenetically. The following paper will outline the role epigenetics is believed to have in influencing gene expression.

  19. Gene expression alterations associated with outcome in aromatase inhibitor-treated ER+ early-stage breast cancer patients.

    PubMed

    Thomsen, Karina G; Lyng, Maria B; Elias, Daniel; Vever, Henriette; Knoop, Ann S; Lykkesfeldt, Anne E; Lænkholm, Anne-Vibeke; Ditzel, Henrik J

    2015-12-01

    Aromatase inhibitors (AI), either alone or together with chemotherapy, have become the standard adjuvant treatment for postmenopausal, estrogen receptor-positive (ER+) breast cancer. Although AIs improve overall survival, resistance is still a major clinical problem, thus additional biomarkers predictive of outcome of ER+ breast cancer patients treated with AIs are needed. Global gene expression analysis was performed on ER+ primary breast cancers from patients treated with adjuvant AI monotherapy; half experienced recurrence (median follow-up 6.7 years). Gene expression alterations were validated by qRT-PCR, and functional studies evaluating the effect of siRNA-mediated gene knockdown on cell growth were performed. Twenty-six genes, including TFF3, DACH1, RGS5, and GHR, were shown to exhibit altered expression in tumors from patients with recurrence versus non-recurrent (fold change ≥1.5, p < 0.05), and the gene expression alterations were confirmed using qRT-PCR. Ten of these 26 genes could be linked in a network associated with cellular proliferation, growth, and development. TFF3, which encodes for trefoil factor 3 and is an estrogen-responsive oncogene shown to play a functional role in tamoxifen resistance and metastasis of ER+ breast cancer, was also shown to be upregulated in an AI-resistant cell line model, and reduction of TFF3 levels using TFF3-specific siRNAs decreased the growth of both the AI-resistant and -sensitive parental cell lines. Moreover, overexpression of TFF3 in parental AI-sensitive MCF-7/S0.5 cells resulted in reduced sensitivity to the AI exemestane, whereas TFF3 overexpression had no effect on growth in the absence of exemestane, indicating that TFF3 mediates growth and survival signals that abrogate the growth inhibitory effect of exemestane. We identified a panel of 26 genes exhibiting altered expression associated with disease recurrence in patients treated with adjuvant AI monotherapy, including TFF3, which was shown to

  20. Gene expression alterations associated with outcome in aromatase inhibitor-treated ER+ early-stage breast cancer patients.

    PubMed

    Thomsen, Karina G; Lyng, Maria B; Elias, Daniel; Vever, Henriette; Knoop, Ann S; Lykkesfeldt, Anne E; Lænkholm, Anne-Vibeke; Ditzel, Henrik J

    2015-12-01

    Aromatase inhibitors (AI), either alone or together with chemotherapy, have become the standard adjuvant treatment for postmenopausal, estrogen receptor-positive (ER+) breast cancer. Although AIs improve overall survival, resistance is still a major clinical problem, thus additional biomarkers predictive of outcome of ER+ breast cancer patients treated with AIs are needed. Global gene expression analysis was performed on ER+ primary breast cancers from patients treated with adjuvant AI monotherapy; half experienced recurrence (median follow-up 6.7 years). Gene expression alterations were validated by qRT-PCR, and functional studies evaluating the effect of siRNA-mediated gene knockdown on cell growth were performed. Twenty-six genes, including TFF3, DACH1, RGS5, and GHR, were shown to exhibit altered expression in tumors from patients with recurrence versus non-recurrent (fold change ≥1.5, p < 0.05), and the gene expression alterations were confirmed using qRT-PCR. Ten of these 26 genes could be linked in a network associated with cellular proliferation, growth, and development. TFF3, which encodes for trefoil factor 3 and is an estrogen-responsive oncogene shown to play a functional role in tamoxifen resistance and metastasis of ER+ breast cancer, was also shown to be upregulated in an AI-resistant cell line model, and reduction of TFF3 levels using TFF3-specific siRNAs decreased the growth of both the AI-resistant and -sensitive parental cell lines. Moreover, overexpression of TFF3 in parental AI-sensitive MCF-7/S0.5 cells resulted in reduced sensitivity to the AI exemestane, whereas TFF3 overexpression had no effect on growth in the absence of exemestane, indicating that TFF3 mediates growth and survival signals that abrogate the growth inhibitory effect of exemestane. We identified a panel of 26 genes exhibiting altered expression associated with disease recurrence in patients treated with adjuvant AI monotherapy, including TFF3, which was shown to

  1. JC virus promoter/enhancers contain TATA box-associated Spi-B-binding sites that support early viral gene expression in primary astrocytes.

    PubMed

    Marshall, Leslie J; Moore, Lisa D; Mirsky, Matthew M; Major, Eugene O

    2012-03-01

    JC virus (JCV) is the aetiological agent of the demyelinating disease progressive multifocal leukoencephalopathy, an AIDS defining illness and serious complication of mAb therapies. Initial infection probably occurs in childhood. In the working model of dissemination, virus persists in the kidney and lymphoid tissues until immune suppression/modulation causes reactivation and trafficking to the brain where JCV replicates in oligodendrocytes. JCV infection is regulated through binding of host factors such as Spi-B to, and sequence variation in the non-coding control region (NCCR). Although NCCR sequences differ between sites of persistence and pathogenesis, evidence suggests that the virus that initiates infection in the brain disseminates via B-cells derived from latently infected haematopoietic precursors in the bone marrow. Spi-B binds adjacent to TATA boxes in the promoter/enhancer of the PML-associated JCV Mad-1 and Mad-4 viruses but not the non-pathogenic, kidney-associated archetype. The Spi-B-binding site of Mad-1/Mad-4 differs from that of archetype by a single nucleotide, AAAAGGGAAGGGA to AAAAGGGAAGGTA. Point mutation of the Mad-1 Spi-B site reduced early viral protein large T-antigen expression by up to fourfold. Strikingly, the reverse mutation in the archetype NCCR increased large T-antigen expression by 10-fold. Interestingly, Spi-B protein binds the NCCR sequence flanking the viral promoter/enhancer, but these sites are not essential for early viral gene expression. The effect of mutating Spi-B-binding sites within the JCV promoter/enhancer on early viral gene expression strongly suggests a role for Spi-B binding to the viral promoter/enhancer in the activation of early viral gene expression.

  2. Early changes in gene expression induced by blue light irradiation of A2E-laden retinal pigment epithelial cells

    PubMed Central

    van der Burght, Barbro W.; Hansen, Morten; Olsen, Jørgen; Zhou, Jilin; Wu, Yalin; Nissen, Mogens H.; Sparrow, Janet R.

    2016-01-01

    Purpose Accumulation of bisretinoids as lipofuscin in retinal pigment epithelial (RPE) cells is implicated in the pathogenesis of some blinding diseases including age-related macular degeneration (AMD). To identify genes whose expression may change under conditions of bisretinoid accumulation, we investigated the differential gene expression in RPE cells that had accumulated the lipofuscin fluorophore A2E and were exposed to blue light (430 nm). Methods A2E-laden RPE cells were exposed to blue light (A2E/430 nm) at various time intervals. Cell death was quantified using Dead Red staining, and RNA levels for the entire genome was determined using DNA microarrays (Affymetrix GeneChip Human Genome 2.0 Plus). Array results for selected genes were confirmed by real-time reverse-transcriptase polymerase chain reaction. Results Principal component analysis revealed that the A2E-laden RPE cells irradiated with blue light were clearly distinguishable from the control samples. We found differential regulation of genes belonging to the following functional groups: transcription factors, stress response, apoptosis and immune response. Among the last mentioned were downregulation of four genes that coded for proteins that have an inhibitory effect on the complement cascade: (complement factor H, complement factor H-related 1, complement factor I and vitronectin) and of two belonging to the classical pathway (complement component 1, s subcomponent and complement component 1, r subcomponent). Conclusion This study demonstrates that blue light irradiation of A2E-laden RPE cells can alter the transcription of genes belonging to different functional pathways including stress response, apoptosis and the immune response. We suggest that these molecules may be associated to the pathogenesis of AMD and can potentially serve as future therapeutic targets. PMID:23742627

  3. Changes of thyroid hormone levels and related gene expression in zebrafish on early life stage exposure to triadimefon.

    PubMed

    Liu, Shaoying; Chang, Juhua; Zhao, Ying; Zhu, Guonian

    2011-11-01

    In this study, zebrafish was exposed to triadimefon. Thyroid hormones levels and the expression of related genes in the hypothalamic-pituitary-thyroid (HPT) axis, including thyroid-stimulating hormone (TSH-beta), deiodinases (dio1 and dio2) and the thyroid hormone receptor (thraa and thrb) were evaluated. After triadimefon exposure, increased T4 can be explained by increased thyroid-stimulating hormone (TSH-beta). The conversion of T4 to T3 (deiodinase type I-dio1) was decreased, which reduced the T3 level. Thyroid hormone receptor beta (thrb) mRNA levels were significantly down-regulated, possibly as a response to the decreased T3 levels. The overall results indicated that triadimefon exposure could alter gene expression in the HPT axis and that mechanisms of disruption of thyroid status by triadimefon could occur at several steps in the synthesis, regulation, and action of thyroid hormones.

  4. Assessing early therapeutic response to bevacizumab in primary breast cancer using magnetic resonance imaging and gene expression profiles.

    PubMed

    Mehta, Shaveta; Hughes, Nicholas P; Buffa, Francesca M; Li, Sonia P; Adams, Rosemary F; Adwani, Asha; Taylor, N Jane; Levitt, Nicola C; Padhani, Anwar R; Makris, Andreas; Harris, Adrian L

    2011-01-01

    Antiangiogenic therapy is a promising approach for the treatment of breast cancer. In practice, however, only a subset of patients who receive antiangiogenic drugs demonstrate a significant response. A key challenge, therefore, is to discover biomarkers that are predictive of response to antiangiogenic therapy. To address this issue, we have designed a window-of-opportunity study in which bevacizumab is administered as a short-term first-line treatment to primary breast cancer patients. Central to our approach is the use of a detailed pharmacodynamic assessment, consisting of pre- and post-bevacizumab multi-parametric magnetic resonance imaging scans and core biopsies for exon array gene expression analysis. Here, we illustrate three intrinsic patterns of response to bevacizumab and discuss the molecular mechanisms that may underpin each. Our results illustrate how the combination of dynamic imaging data and gene expression profiles can guide the development of biomarkers for predicting response to antiangiogenic therapy.

  5. Changes of thyroid hormone levels and related gene expression in zebrafish on early life stage exposure to triadimefon.

    PubMed

    Liu, Shaoying; Chang, Juhua; Zhao, Ying; Zhu, Guonian

    2011-11-01

    In this study, zebrafish was exposed to triadimefon. Thyroid hormones levels and the expression of related genes in the hypothalamic-pituitary-thyroid (HPT) axis, including thyroid-stimulating hormone (TSH-beta), deiodinases (dio1 and dio2) and the thyroid hormone receptor (thraa and thrb) were evaluated. After triadimefon exposure, increased T4 can be explained by increased thyroid-stimulating hormone (TSH-beta). The conversion of T4 to T3 (deiodinase type I-dio1) was decreased, which reduced the T3 level. Thyroid hormone receptor beta (thrb) mRNA levels were significantly down-regulated, possibly as a response to the decreased T3 levels. The overall results indicated that triadimefon exposure could alter gene expression in the HPT axis and that mechanisms of disruption of thyroid status by triadimefon could occur at several steps in the synthesis, regulation, and action of thyroid hormones. PMID:22004968

  6. The thyroid hormone receptor gene (c-erbA alpha) is expressed in advance of thyroid gland maturation during the early embryonic development of Xenopus laevis.

    PubMed Central

    Banker, D E; Bigler, J; Eisenman, R N

    1991-01-01

    The c-erbA proto-oncogene encodes the thyroid hormone receptor, a ligand-dependent transcription factor which plays an important role in vertebrate growth and development. To define the role of the thyroid hormone receptor in developmental processes, we have begun studying c-erbA gene expression during the ontogeny of Xenopus laevis, an organism in which thyroid hormone has well-documented effects on morphogenesis. Using polymerase chain reactions (PCR) as a sensitive assay of specific gene expression, we found that polyadenylated erbA alpha RNA is present in Xenopus cells at early developmental stages, including the fertilized egg, blastula, gastrula, and neurula. By performing erbA alpha-specific PCR on reverse-transcribed RNAs from high-density sucrose gradient fractions prepared from early-stage embryos, we have demonstrated that these erbA transcripts are recruited to polysomes. Therefore, erbA is expressed in Xenopus development prior to the appearance of the thyroid gland anlage in tailbud-stage embryos. This implies that erbA alpha/thyroid hormone receptors may play ligand-independent roles during the early development of X. laevis. Quantitative PCR revealed a greater than 25-fold range in the steady-state levels of polyadenylated erbA alpha RNA across early stages of development, as expressed relative to equimolar amounts of total embryonic RNA. Substantial increases in the levels of erbA alpha RNA were noted at stages well after the onset of zygotic transcription at the mid-blastula transition, with accumulation of erbA alpha transcripts reaching a relative maximum in advance of metamorphosis. We also show that erbA alpha RNAs are expressed unequally across Xenopus neural tube embryos. This differential expression continues through later stages of development, including metamorphosis. This finding suggests that erbA alpha/thyroid hormone receptors may play roles in tissue-specific processes across all of Xenopus development. Images PMID:1656222

  7. Unraveling low-level gamma radiation--responsive changes in expression of early and late genes in leaves of rice seedlings at Iitate Village, Fukushima.

    PubMed

    Hayashi, Gohei; Shibato, Junko; Imanaka, Tetsuji; Cho, Kyoungwon; Kubo, Akihiro; Kikuchi, Shoshi; Satoh, Kouji; Kimura, Shinzo; Ozawa, Shoji; Fukutani, Satoshi; Endo, Satoru; Ichikawa, Katsuki; Agrawal, Ganesh Kumar; Shioda, Seiji; Fukumoto, Manabu; Rakwal, Randeep

    2014-01-01

    In the summer of 2012, 1 year after the nuclear accident in March 2011 at the Fukushima Daiichi nuclear power plant, we examined the effects of gamma radiation on rice at a highly contaminated field of Iitate village in Fukushima, Japan. We investigated the morphological and molecular changes on healthy rice seedlings exposed to continuous low-dose gamma radiation up to 4 µSv h(-1), about 80 times higher than natural background level. After exposure to gamma rays, expression profiles of selected genes involved in DNA replication/repair, oxidative stress, photosynthesis, and defense/stress functions were examined by RT-PCR, which revealed their differential expression in leaves in a time-dependent manner over 3 days (6, 12, 24, 48, and 72 h). For example, OsPCNA mRNA rapidly increased at 6, 12, and 24 h, suggesting that rice cells responded to radiation stress by activating a gene involved in DNA repair mechanisms. At 72 h, genes related to the phenylpropanoid pathway (OsPAL2) and cell death (OsPR1oa) were strongly induced, indicating activation of defense/stress responses. We next profiled the transcriptome using a customized rice whole-genome 4×44K DNA microarray at early (6h) and late (72 h) time periods. Low-level gamma radiation differentially regulated rice leaf gene expression (induced 4481 and suppressed 3740 at 6 h and induced 2291 and suppressed 1474 genes at 72 h) by at least 2-fold. Using the highly upregulated and downregulated gene list, MapMan bioinformatics tool generated diagrams of early and late pathways operating in cells responding to gamma ray exposure. An inventory of a large number of gamma radiation-responsive genes provides new information on novel regulatory processes in rice.

  8. Unraveling low-level gamma radiation--responsive changes in expression of early and late genes in leaves of rice seedlings at Iitate Village, Fukushima.

    PubMed

    Hayashi, Gohei; Shibato, Junko; Imanaka, Tetsuji; Cho, Kyoungwon; Kubo, Akihiro; Kikuchi, Shoshi; Satoh, Kouji; Kimura, Shinzo; Ozawa, Shoji; Fukutani, Satoshi; Endo, Satoru; Ichikawa, Katsuki; Agrawal, Ganesh Kumar; Shioda, Seiji; Fukumoto, Manabu; Rakwal, Randeep

    2014-01-01

    In the summer of 2012, 1 year after the nuclear accident in March 2011 at the Fukushima Daiichi nuclear power plant, we examined the effects of gamma radiation on rice at a highly contaminated field of Iitate village in Fukushima, Japan. We investigated the morphological and molecular changes on healthy rice seedlings exposed to continuous low-dose gamma radiation up to 4 µSv h(-1), about 80 times higher than natural background level. After exposure to gamma rays, expression profiles of selected genes involved in DNA replication/repair, oxidative stress, photosynthesis, and defense/stress functions were examined by RT-PCR, which revealed their differential expression in leaves in a time-dependent manner over 3 days (6, 12, 24, 48, and 72 h). For example, OsPCNA mRNA rapidly increased at 6, 12, and 24 h, suggesting that rice cells responded to radiation stress by activating a gene involved in DNA repair mechanisms. At 72 h, genes related to the phenylpropanoid pathway (OsPAL2) and cell death (OsPR1oa) were strongly induced, indicating activation of defense/stress responses. We next profiled the transcriptome using a customized rice whole-genome 4×44K DNA microarray at early (6h) and late (72 h) time periods. Low-level gamma radiation differentially regulated rice leaf gene expression (induced 4481 and suppressed 3740 at 6 h and induced 2291 and suppressed 1474 genes at 72 h) by at least 2-fold. Using the highly upregulated and downregulated gene list, MapMan bioinformatics tool generated diagrams of early and late pathways operating in cells responding to gamma ray exposure. An inventory of a large number of gamma radiation-responsive genes provides new information on novel regulatory processes in rice. PMID:25124817

  9. Expressed sequence-tag analysis of ovaries of Brachiaria brizantha reveals genes associated with the early steps of embryo sac differentiation of apomictic plants.

    PubMed

    Silveira, Erica Duarte; Guimarães, Larissa Arrais; de Alencar Dusi, Diva Maria; da Silva, Felipe Rodrigues; Martins, Natália Florencio; do Carmo Costa, Marcos Mota; Alves-Ferreira, Márcio; de Campos Carneiro, Vera Tavares

    2012-02-01

    In apomixis, asexual mode of plant reproduction through seeds, an unreduced megagametophyte is formed due to circumvented or altered meiosis. The embryo develops autonomously from the unreduced egg cell, independently of fertilization. Brachiaria is a genus of tropical forage grasses that reproduces sexually or by apomixis. A limited number of studies have reported the sequencing of apomixis-related genes and a few Brachiaria sequences have been deposited at genebank databases. This work shows sequencing and expression analyses of expressed sequence-tags (ESTs) of Brachiaria genus and points to transcripts from ovaries with preferential expression at megasporogenesis in apomictic plants. From the 11 differentially expressed sequences from immature ovaries of sexual and apomictic Brachiaria brizantha obtained from macroarray analysis, 9 were preferentially detected in ovaries of apomicts, as confirmed by RT-qPCR. A putative involvement in early steps of Panicum-type embryo sac differentiation of four sequences from B. brizantha ovaries: BbrizHelic, BbrizRan, BbrizSec13 and BbrizSti1 is suggested. Two of these, BbrizSti1 and BbrizHelic, with similarity to a gene coding to stress induced protein and a helicase, respectively, are preferentially expressed in the early stages of apomictic ovaries development, especially in the nucellus, in a stage previous to the differentiation of aposporous initials, as verified by in situ hybridization.

  10. A gene expression screen.

    PubMed Central

    Wang, Z; Brown, D D

    1991-01-01

    A gene expression screen identifies mRNAs that differ in abundance between two mRNA mixtures by a subtractive hybridization method. The two mRNA populations are converted to double-stranded cDNAs, fragmented, and ligated to linkers for polymerase chain reaction (PCR) amplification. The multiple cDNA fragments isolated from any given gene can be treated as alleles in a genetic screen. Probability analysis of the frequency with which multiple alleles are found provides an estimation of the total number of up- and down-regulated genes. We have applied this method to genes that are differentially expressed in amphibian tadpole tail tissue in the first 24 hr after thyroid hormone treatment, which ultimately induces tail resorption. We estimate that there are about 30 up-regulated genes; 16 have been isolated. Images PMID:1722336

  11. Gene expression technology

    SciTech Connect

    Goeddel, D.V. )

    1990-01-01

    The articles in this volume were assemble to enable the reader to design effective strategies for the expression of cloned genes and cDNAs. More than a compilation of papers describing the multitude of techniques now available for expressing cloned genes, this volume provides a manual that should prove useful for solving the majority of expression problems one likely to encounter. The four major expression systems commonly available to most investigators are stressed: Escherichia coli, Bacillus subtilis, yeast, and mammalian cells. Each of these system has its advantages and disadvantages, details of which are found in Chapter 1 and the strategic overviews for the four major sections of the volume. The papers in each of these sections provide many suggestions on how to proceed if initial expression levels are not sufficient.

  12. A new reporter mouse cytomegalovirus reveals maintained immediate-early gene expression but poor virus replication in cycling liver sinusoidal endothelial cells

    PubMed Central

    2013-01-01

    Background The MCMV major immediate early promoter/enhancer (MIEP) is a bidirectional promoter that drives the expression of the three immediate early viral genes, namely ie1, ie2 and ie3. The regulation of their expression is intensively studied, but still incompletely understood. Methods We constructed a reporter MCMV, (MCMV-MIEPr) expressing YFP and tdTomato under the control of the MIEP as proxies of ie1 and ie2, respectively. Moreover, we generated a liver sinusoidal endothelial cell line (LSEC-uniLT) where cycling is dependent on doxycycline. We used these novel tools to study the kinetics of MIEP-driven gene expression in the context of infection and at the single cell level by flow cytometry and by live imaging of proliferating and G0-arrested cells. Results MCMV replicated to higher titers in G0-arrested LSEC, and cycling cells showed less cytopathic effect or YFP and tdTomato expression at 5 days post infection. In the first 24 h post infection, however, there was no difference in MIEP activity in cycling or G0-arrested cells, although we could observe different profiles of MIEP gene expression in different cell types, like LSECs, fibroblasts or macrophages. We monitored infected LSEC-uniLT in G0 by time lapse microscopy over five days and noticed that most cells survived infection for at least 96 h, arguing that quick lysis of infected cells could not account for the spread of the virus. Interestingly, we noticed a strong correlation between the ratio of median YFP and tdTomato expression and length of survival of infected cells. Conclusion By means of our newly developed genetic tools, we showed that the expression pattern of MCMV IE1 and IE2 genes differs between macrophages, endothelial cells and fibroblasts. Substantial and cell-cycle independent differences in the ie1 and ie2 transcription could also be observed within individual cells of the same population, and marked ie2 gene expression was associated with longer survival of the infected cells

  13. Expression of insulin-like growth factor system genes in liver tissue during embryonic and early post-hatch development in duck (Anas platyrhynchos Domestica).

    PubMed

    Jianmin, Zou; Jingting, Shu; Yanju, Shan; Yan, Hu; Chi, Song; Wenqi, Zhu

    2014-04-01

    The IGF system is one of the most important endocrine and paracrine growth factor systems that regulate fetal and placental growth, whereas the liver is the principal source of circulation IGF-I. In the present study, expression of IGF-I, IGF type-I receptor (IGF-IR), and IGF binding protein (IGFBP)-3 genes was quantified by RT-PCR in the liver tissue on days 13, 17, 21, 25, and 27 of embryonic development, as well as at 7 days post-hatching (PH) in meat-type Gaoyou ducks and egg-type Jinding ducks. The results showed that IGF-I mRNA could be detected as early as on E 13d, but the expression level was low throughout embryonic development before increasing dramatically by E 27d and 7 days PH in both duck breeds. However, Gaoyou ducks exhibited higher IGF-I mRNA level than Jinding ducks, and the differences were significant on E 13d, E 21d, and at 7 days PH. Expression of IGF-IR in liver increased gradually in the former stages of the embryonic development, reaching its highest point on E 21d, and then declined up until 7 days PH. The expression pattern of IGFBP-3 gene was similar to that of IGF-IR gene, increasing significantly from E 17d. The expression peak appeared on E 25d, then declined significantly just prior to hatching (day 27) and was followed by an increase at 7 days PH. In general, the expression level of IGF-IR and IGFBP-3 genes in Jinding ducks was higher than that in Gaoyou ducks. Inverse relationships were observed for the expression of IGF-I and IGF-IR, and IGF-I and IGFBP-3, whereas a positive relationship was observed for the expression of IGF-IR and IGFBP-3. Our data indicate a differential expression of selected genes that comprise the IGF system in the duck liver tissue during embryonic and early PH growth and development.

  14. A Porcine Animal Model for Early Meniscal Degeneration – Analysis of Histology, Gene Expression and Magnetic Resonance Imaging Six Months after Resection of the Anterior Cruciate Ligament

    PubMed Central

    Kreinest, Michael; Reisig, Gregor; Ströbel, Philipp; Dinter, Dietmar; Attenberger, Ulrike; Lipp, Peter; Schwarz, Markus

    2016-01-01

    Background/Objective The menisci of the mammalian knee joint balance the incongruence between femoral condyle and tibial plateau and thus menisci absorb and distribute high loads. Degeneration processes of the menisci lead to pain syndromes in the knee joint. The origin of such degenerative processes on meniscal tissue is rarely understood and may be described best as an imbalance of anabolic and catabolic metabolism. A standardized animal model of meniscal degeneration is needed for further studies. The aim of the current study was to develop a porcine animal model with early meniscal degeneration. Material and Methods Resection of the anterior cruciate ligament (ACLR) was performed on the left knee joints of eight Göttingen minipigs. A sham operation was carried out on the right knee joint. The grade of degeneration was determined 26 weeks after the operation using histology and magnetic resonance imaging (MRI). Furthermore, the expression of 14 genes which code for extracellular matrix proteins, catabolic matrix metalloproteinases and inflammation mediators were analyzed. Results Degenerative changes were detected by a histological analysis of the medial meniscus after ACLR. These changes were not detected by MRI. In terms of their gene expression profile, these degenerated medial menisci showed a significantly increased expression of COL1A1. Conclusion This paper describes a new animal model for early secondary meniscal degeneration in the Göttingen minipig. Histopathological evidence of the degenerative changes could be described. This early degenerative changes could not be seen by NMR imaging. PMID:27434644

  15. A joint modeling approach for uncovering associations between gene expression, bioactivity and chemical structure in early drug discovery to guide lead selection and genomic biomarker development.

    PubMed

    Perualila-Tan, Nolen; Kasim, Adetayo; Talloen, Willem; Verbist, Bie; Göhlmann, Hinrich W H; Shkedy, Ziv

    2016-08-01

    The modern drug discovery process involves multiple sources of high-dimensional data. This imposes the challenge of data integration. A typical example is the integration of chemical structure (fingerprint features), phenotypic bioactivity (bioassay read-outs) data for targets of interest, and transcriptomic (gene expression) data in early drug discovery to better understand the chemical and biological mechanisms of candidate drugs, and to facilitate early detection of safety issues prior to later and expensive phases of drug development cycles. In this paper, we discuss a joint model for the transcriptomic and the phenotypic variables conditioned on the chemical structure. This modeling approach can be used to uncover, for a given set of compounds, the association between gene expression and biological activity taking into account the influence of the chemical structure of the compound on both variables. The model allows to detect genes that are associated with the bioactivity data facilitating the identification of potential genomic biomarkers for compounds efficacy. In addition, the effect of every structural feature on both genes and pIC50 and their associations can be simultaneously investigated. Two oncology projects are used to illustrate the applicability and usefulness of the joint model to integrate multi-source high-dimensional information to aid drug discovery. PMID:27269248

  16. Reduced cortical expression of a newly identified splicing variant of the DLG1 gene in patients with early-onset schizophrenia.

    PubMed

    Uezato, A; Yamamoto, N; Iwayama, Y; Hiraoka, S; Hiraaki, E; Umino, A; Haramo, E; Umino, M; Yoshikawa, T; Nishikawa, T

    2015-10-06

    The human discs, large homolog 1 gene (DLG1) is mapped to the schizophrenia-susceptibility locus 3q29, and it encodes a scaffold protein that interacts with the N-methyl-D-aspartate receptor presumably dysregulated in schizophrenia. In the current study, we have newly identified a splicing variant of DLG1, which is transcribed from an unreported 95-base-pair exon (exon 3b) and is labeled 3b(+). We investigated the mRNA expression of 3b(+) in the post-mortem dorsolateral prefrontal cortices of patients with psychiatric disorders, obtained from The Stanley Medical Research Institute, and examined the potential association of the expression with the genotype of the single-nucleotide polymorphism (SNP) rs3915512 located within exon 3b. A real-time quantitative reverse transcriptase-polymerase chain reaction revealed that the mRNA levels of 3b(+) were significantly reduced in patients with early-onset schizophrenia (onset at <18 years old, P=0.0003) but not in those with non-early-onset schizophrenia, early-onset or non-early-onset bipolar disorder or in the controls. Furthermore, the genotype at the rs3915512 SNP was closely associated with the levels of 3b(+) mRNA expression. It is inferred that the T allele fails to meet the exonic splicing enhancer consensus, thus resulting in skipping of exon 3b, leading to the expression of 3b(-) (the previously known DLG1 variant) but not 3b(+). Because all the subjects with early-onset schizophrenia in the current study possess the T/T genotype, the reduced level of the DLG1 3b(+) transcript may be involved in the susceptibility and/or pathophysiology of early-onset schizophrenia.

  17. Gene structure and expression

    SciTech Connect

    Hawkins, J. )

    1990-01-01

    This book describes the structure of genes in molecular terms and summarizes present knowledge about how their activity is regulated. It covers a range of topics, including a review of the structure and replication of DNA, transcription and translation, prokaryotic and eukaryotic gene organization and expression, retroviruses and oncogenes. The book also includes a chapter on the methodology of DNA manipulation including sections on site-directed mutagenesis, the polymerase chain reaction, reporter genes and restriction fragment length polymorphisms. The hemoglobin gene system and the genetics of the proteins of the immune system are presented in the latter half of the book to show the structure and expression of the most well-studied systems in higher eukaryotes. The final chapter reviews the differences between prokaryotic and the eukaryotic genomes.

  18. Gene expression of Lactobacillus plantarum and the commensal microbiota in the ileum of healthy and early SIV-infected rhesus macaques

    PubMed Central

    Golomb, Benjamin L.; Hirao, Lauren A.; Dandekar, Satya; Marco, Maria L.

    2016-01-01

    Chronic HIV infection results in impairment of gut-associated lymphoid tissue leading to systemic immune activation. We previously showed that in early SIV-infected rhesus macaques intestinal dysfunction is initiated with the induction of the IL-1β pathway in the small intestine and reversed by treatment with an exogenous Lactobacillus plantarum strain. Here, we provide evidence that the transcriptomes of L. plantarum and ileal microbiota are not altered shortly after SIV infection. L. plantarum adapts to the small intestine by expressing genes required for tolerating oxidative stress, modifying cell surface composition, and consumption of host glycans. The ileal microbiota of L. plantarum-containing healthy and SIV+ rhesus macaques also transcribed genes for host glycan metabolism as well as for cobalamin biosynthesis. Expression of these pathways by bacteria were proposed but not previously demonstrated in the mammalian small intestine. PMID:27102350

  19. Utilization of a novel deuterostome model for the study of regeneration genetics: molecular cloning of genes that are differentially expressed during early stages of larval sea star regeneration.

    PubMed

    Vickery, M C; Vickery, M S; McClintock, J B; Amsler, C D

    2001-01-10

    Sea stars share many characteristics with vertebrates, including deuterostome type development. We previously reported that sea star larvae are capable of complete regeneration (with organogenesis) of missing body parts. Here we report the first application of whole-body cDNA subtractive hybridization for the identification of regeneration-specific gene expression in a deuterostome. We identified nine novel cDNAs from genes differentially expressed during early larval sea star regeneration, including a serine protease which may have a function similar to that of trypsin/plasmin-like proteases during vertebrate wound repair and regeneration. This study demonstrates that sea star larvae can provide a valuable new deuterostome model for the study of regeneration genetics, with potential applications in vertebrate regeneration. PMID:11179669

  20. Expression of Rice Chitinase Gene in Genetically Engineered Tomato Confers Enhanced Resistance to Fusarium Wilt and Early Blight.

    PubMed

    Jabeen, Nyla; Chaudhary, Zubeda; Gulfraz, Muhammad; Rashid, Hamid; Mirza, Bushra

    2015-09-01

    This is the first study reporting the evaluation of transgenic lines of tomato harboring rice chitinase (RCG3) gene for resistance to two important fungal pathogens Fusarium oxysporum f. sp. lycopersici (Fol) causing fusarium wilt and Alternaria solani causing early blight (EB). In this study, three transgenic lines TL1, TL2 and TL3 of tomato Solanum lycopersicum Mill. cv. Riogrande genetically engineered with rice chitinase (RCG 3) gene and their R1 progeny was tested for resistance to Fol by root dip method and A. solani by detached leaf assay. All the R0 transgenic lines were highly resistant to these fungal pathogens compared to non-transgenic control plants. The pattern of segregation of three independent transformant for Fol and A. solani was also studied. Mendelian segregation was observed in transgenic lines 2 and 3 while it was not observed in transgenic line 1. It was concluded that introduction of chitinase gene in susceptible cultivar of tomato not only enhanced the resistance but was stably inherited in transgenic lines 2 and 3. PMID:26361473

  1. Expression of Rice Chitinase Gene in Genetically Engineered Tomato Confers Enhanced Resistance to Fusarium Wilt and Early Blight

    PubMed Central

    Jabeen, Nyla; Chaudhary, Zubeda; Gulfraz, Muhammad; Rashid, Hamid; Mirza, Bushra

    2015-01-01

    This is the first study reporting the evaluation of transgenic lines of tomato harboring rice chitinase (RCG3) gene for resistance to two important fungal pathogens Fusarium oxysporum f. sp. lycopersici (Fol) causing fusarium wilt and Alternaria solani causing early blight (EB). In this study, three transgenic lines TL1, TL2 and TL3 of tomato Solanum lycopersicum Mill. cv. Riogrande genetically engineered with rice chitinase (RCG 3) gene and their R1 progeny was tested for resistance to Fol by root dip method and A. solani by detached leaf assay. All the R0 transgenic lines were highly resistant to these fungal pathogens compared to non-transgenic control plants. The pattern of segregation of three independent transformant for Fol and A. solani was also studied. Mendelian segregation was observed in transgenic lines 2 and 3 while it was not observed in transgenic line 1. It was concluded that introduction of chitinase gene in susceptible cultivar of tomato not only enhanced the resistance but was stably inherited in transgenic lines 2 and 3. PMID:26361473

  2. HPA Axis Gene Expression and DNA Methylation Profiles in Rats Exposed to Early Life Stress, Adult Voluntary Ethanol Drinking and Single Housing

    PubMed Central

    Todkar, Aniruddha; Granholm, Linnea; Aljumah, Mujtaba; Nilsson, Kent W.; Comasco, Erika; Nylander, Ingrid

    2016-01-01

    The neurobiological basis of early life stress (ELS) impact on vulnerability to alcohol use disorder is not fully understood. The effect of ELS, adult ethanol consumption and single housing, on expression of stress and DNA methylation regulatory genes as well as blood corticosterone levels was investigated in the hypothalamus and pituitary of adult out-bred Wistar rats subjected to different rearing conditions. A prolonged maternal separation (MS) of 360 min (MS360) was used to study the effect of ELS, and a short MS of 15 min (MS15) was used as a control. Voluntary ethanol drinking was assessed using a two-bottle free choice paradigm to simulate human episodic drinking. The effects of single housing and ethanol were assessed in conventional animal facility rearing (AFR) conditions. Single housing in adulthood was associated with lower Crhr1 and higher Pomc expression in the pituitary, whereas ethanol drinking was associated with higher expression of Crh in the hypothalamus and Crhr1 in the pituitary, accompanied by lower corticosterone levels. As compared to controls with similar early life handling, rats exposed to ELS displayed lower expression of Pomc in the hypothalamus, and higher Dnmt1 expression in the pituitary. Voluntary ethanol drinking resulted in lower Fkbp5 expression in the pituitary and higher Crh expression in the hypothalamus, independently of rearing conditions. In rats exposed to ELS, water and ethanol drinking was associated with higher and lower corticosterone levels, respectively. The use of conventionally reared rats as control group yielded more significant results than the use of rats exposed to short MS. Positive correlations, restricted to the hypothalamus and ELS group, were observed between the expression of the hypothalamus-pituitary-adrenal receptor and the methylation-related genes. Promoter DNA methylation and expression of respective genes did not correlate suggesting that other loci are involved in transcriptional regulation

  3. Gene expression analysis in biomarker research and early drug development using function tested reverse transcription quantitative real-time PCR assays.

    PubMed

    Lohmann, Sabine; Herold, Andrea; Bergauer, Tobias; Belousov, Anton; Betzl, Gisela; Demario, Mark; Dietrich, Manuel; Luistro, Leopoldo; Poignée-Heger, Manuela; Schostack, Kathy; Simcox, Mary; Walch, Heiko; Yin, Xuefeng; Zhong, Hua; Weisser, Martin

    2013-01-01

    The identification of new biomarkers is essential in the implementation of personalized health care strategies that offer new therapeutic approaches with optimized and individualized treatment. In support of hypothesis generation and testing in the course of our biomarker research an online portal and respective function-tested reverse transcription quantitative real-time PCR assays (RT-qPCR) facilitated the selection of relevant biomarker genes. We have established workflows applicable for convenient high throughput gene expression analysis in biomarker research with cell lines (in vitro studies) and xenograft mouse models (in vivo studies) as well as formalin-fixed paraffin-embedded tissue (FFPET) sections from various human research and clinical tumor samples. Out of 92 putative biomarker candidate genes selected in silico, 35 were shown to exhibit differential expression in various tumor cell lines. These were further analysed by in vivo xenograft mouse models, which identified 13 candidate genes including potential response prediction biomarkers and a potential pharmacodynamic biomarker. Six of these candidate genes were selected for further evaluation in FFPET samples, where optimized RNA isolation, reverse transcription and qPCR assays provided reliable determination of relative expression levels as precondition for differential gene expression analysis of FFPET samples derived from projected clinical studies. Thus, we successfully applied function tested RT-qPCR assays in our biomarker research for hypothesis generation with in vitro and in vivo models as well as for hypothesis testing with human FFPET samples. Hence, appropriate function-tested RT-qPCR assays are available in biomarker research accompanying the different stages of drug development, starting from target identification up to early clinical development. The workflow presented here supports the identification and validation of new biomarkers and may lead to advances in efforts to achieve the

  4. Regulation of early T-lineage gene expression and developmental progression by the progenitor cell transcription factor PU.1.

    PubMed

    Champhekar, Ameya; Damle, Sagar S; Freedman, George; Carotta, Sebastian; Nutt, Stephen L; Rothenberg, Ellen V

    2015-04-15

    The ETS family transcription factor PU.1 is essential for the development of several blood lineages, including T cells, but its function in intrathymic T-cell precursors has been poorly defined. In the thymus, high PU.1 expression persists through multiple cell divisions in early stages but then falls sharply during T-cell lineage commitment. PU.1 silencing is critical for T-cell commitment, but it has remained unknown how PU.1 activities could contribute positively to T-cell development. Here we employed conditional knockout and modified antagonist PU.1 constructs to perturb PU.1 function stage-specifically in early T cells. We show that PU.1 is needed for full proliferation, restricting access to some non-T fates, and controlling the timing of T-cell developmental progression such that removal or antagonism of endogenous PU.1 allows precocious access to T-cell differentiation. Dominant-negative effects reveal that this repression by PU.1 is mediated indirectly. Genome-wide transcriptome analysis identifies novel targets of PU.1 positive and negative regulation affecting progenitor cell signaling and cell biology and indicating distinct regulatory effects on different subsets of progenitor cell transcription factors. Thus, in addition to supporting early T-cell proliferation, PU.1 regulates the timing of activation of the core T-lineage developmental program.

  5. Regulation of early T-lineage gene expression and developmental progression by the progenitor cell transcription factor PU.1

    PubMed Central

    Champhekar, Ameya; Damle, Sagar S.; Freedman, George; Carotta, Sebastian; Nutt, Stephen L.

    2015-01-01

    The ETS family transcription factor PU.1 is essential for the development of several blood lineages, including T cells, but its function in intrathymic T-cell precursors has been poorly defined. In the thymus, high PU.1 expression persists through multiple cell divisions in early stages but then falls sharply during T-cell lineage commitment. PU.1 silencing is critical for T-cell commitment, but it has remained unknown how PU.1 activities could contribute positively to T-cell development. Here we employed conditional knockout and modified antagonist PU.1 constructs to perturb PU.1 function stage-specifically in early T cells. We show that PU.1 is needed for full proliferation, restricting access to some non-T fates, and controlling the timing of T-cell developmental progression such that removal or antagonism of endogenous PU.1 allows precocious access to T-cell differentiation. Dominant-negative effects reveal that this repression by PU.1 is mediated indirectly. Genome-wide transcriptome analysis identifies novel targets of PU.1 positive and negative regulation affecting progenitor cell signaling and cell biology and indicating distinct regulatory effects on different subsets of progenitor cell transcription factors. Thus, in addition to supporting early T-cell proliferation, PU.1 regulates the timing of activation of the core T-lineage developmental program. PMID:25846797

  6. De Novo Analysis of Wolfiporia cocos Transcriptome to Reveal the Differentially Expressed Carbohydrate-Active Enzymes (CAZymes) Genes During the Early Stage of Sclerotial Growth.

    PubMed

    Zhang, Shaopeng; Hu, Bingxiong; Wei, Wei; Xiong, Ying; Zhu, Wenjun; Peng, Fang; Yu, Yang; Zheng, Yonglian; Chen, Ping

    2016-01-01

    The sclerotium of Wolfiporia cocos has been used as an edible mushroom and/or a traditional herbal medicine for centuries. W. cocos sclerotial formation is dependent on parasitism of the wood of Pinus species. Currently, the sclerotial development mechanisms of W. cocos remain largely unknown and the lack of pine resources limit the commercial production. The CAZymes (carbohydrate-active enzymes) play important roles in degradation of the plant cell wall to provide carbohydrates for fungal growth, development, and reproduction. In this study, the transcript profiles from W. cocos mycelium and 2-months-old sclerotium, the early stage of sclerotial growth, were specially analyzed using de novo sequencing technology. A total of 142,428,180 high-quality reads of mycelium and 70,594,319 high-quality reads of 2-months-old sclerotium were obtained. Additionally, differentially expressed genes from the W. cocos mycelium and 2-months-old sclerotium stages were analyzed, resulting in identification of 69 CAZymes genes which were significantly up-regulated during the early stage of sclerotial growth compared to that of in mycelium stage, and more than half of them belonged to glycosyl hydrolases (GHs) family, indicating the importance of W. cocos GHs family for degrading the pine woods. And qRT-PCR was further used to confirm the expression pattern of these up-regulated CAZymes genes. Our results will provide comprehensive CAZymes genes expression information during W. cocos sclerotial growth at the transcriptional level and will lay a foundation for functional genes studies in this fungus. In addition, our study will also facilitate the efficient use of limited pine resources, which is significant for promoting steady development of Chinese W. cocos industry.

  7. De Novo Analysis of Wolfiporia cocos Transcriptome to Reveal the Differentially Expressed Carbohydrate-Active Enzymes (CAZymes) Genes During the Early Stage of Sclerotial Growth

    PubMed Central

    Zhang, Shaopeng; Hu, Bingxiong; Wei, Wei; Xiong, Ying; Zhu, Wenjun; Peng, Fang; Yu, Yang; Zheng, Yonglian; Chen, Ping

    2016-01-01

    The sclerotium of Wolfiporia cocos has been used as an edible mushroom and/or a traditional herbal medicine for centuries. W. cocos sclerotial formation is dependent on parasitism of the wood of Pinus species. Currently, the sclerotial development mechanisms of W. cocos remain largely unknown and the lack of pine resources limit the commercial production. The CAZymes (carbohydrate-active enzymes) play important roles in degradation of the plant cell wall to provide carbohydrates for fungal growth, development, and reproduction. In this study, the transcript profiles from W. cocos mycelium and 2-months-old sclerotium, the early stage of sclerotial growth, were specially analyzed using de novo sequencing technology. A total of 142,428,180 high-quality reads of mycelium and 70,594,319 high-quality reads of 2-months-old sclerotium were obtained. Additionally, differentially expressed genes from the W. cocos mycelium and 2-months-old sclerotium stages were analyzed, resulting in identification of 69 CAZymes genes which were significantly up-regulated during the early stage of sclerotial growth compared to that of in mycelium stage, and more than half of them belonged to glycosyl hydrolases (GHs) family, indicating the importance of W. cocos GHs family for degrading the pine woods. And qRT-PCR was further used to confirm the expression pattern of these up-regulated CAZymes genes. Our results will provide comprehensive CAZymes genes expression information during W. cocos sclerotial growth at the transcriptional level and will lay a foundation for functional genes studies in this fungus. In addition, our study will also facilitate the efficient use of limited pine resources, which is significant for promoting steady development of Chinese W. cocos industry. PMID:26870032

  8. CAMKII-conditional deletion of histone deacetylase 2 potentiates acute methamphetamine-induced expression of immediate early genes in the mouse nucleus accumbens.

    PubMed

    Torres, Oscar V; McCoy, Michael T; Ladenheim, Bruce; Jayanthi, Subramaniam; Brannock, Christie; Tulloch, Ingrid; Krasnova, Irina N; Cadet, Jean Lud

    2015-08-24

    Methamphetamine (METH) produces increases in the expression of immediate early genes (IEGs) and of histone deacetylase 2 (HDAC2) in the rat nucleus accumbens (NAc). Here, we tested whether HDAC2 deletion influenced the effects of METH on IEG expression in the NAc. Microarray analyses showed no baseline differences in IEG expression between wild-type (WT) and HDAC2 knockout (KO) mice. Quantitative-PCR analysis shows that an acute METH injection produced time-dependent increases in mRNA levels of several IEGs in both genotypes. Interestingly, HDAC2KO mice displayed greater METH-induced increases in Egr1 and Egr2 mRNA levels measured at one hour post-injection. The levels of Fosb, Fra2, Egr1, and Egr3 mRNAs stayed elevated in the HDAC2KO mice 2 hours after the METH injection whereas these mRNAs had normalized in the WT mice. In WT mice, METH caused increased HDAC2 recruitment to the promoters some IEGs at 2 hours post injection. METH-induced prolonged increases in Fosb, Fra2, Egr1, and Egr3 mRNA levels in HDAC2KO mice were associated with increased enrichment of phosphorylated CREB (pCREB) on the promoters of these genes. Based on our observations, we hypothesize that HDAC2 may regulate the expression of these genes, in part, by prolonging the actions of pCREB in the mouse NAc.

  9. CAMKII-conditional deletion of histone deacetylase 2 potentiates acute methamphetamine-induced expression of immediate early genes in the mouse nucleus accumbens

    PubMed Central

    Torres, Oscar V.; McCoy, Michael T.; Ladenheim, Bruce; Jayanthi, Subramaniam; Brannock, Christie; Tulloch, Ingrid; Krasnova, Irina N.; Cadet, Jean Lud

    2015-01-01

    Methamphetamine (METH) produces increases in the expression of immediate early genes (IEGs) and of histone deacetylase 2 (HDAC2) in the rat nucleus accumbens (NAc). Here, we tested whether HDAC2 deletion influenced the effects of METH on IEG expression in the NAc. Microarray analyses showed no baseline differences in IEG expression between wild-type (WT) and HDAC2 knockout (KO) mice. Quantitative-PCR analysis shows that an acute METH injection produced time-dependent increases in mRNA levels of several IEGs in both genotypes. Interestingly, HDAC2KO mice displayed greater METH-induced increases in Egr1 and Egr2 mRNA levels measured at one hour post-injection. The levels of Fosb, Fra2, Egr1, and Egr3 mRNAs stayed elevated in the HDAC2KO mice 2 hours after the METH injection whereas these mRNAs had normalized in the WT mice. In WT mice, METH caused increased HDAC2 recruitment to the promoters some IEGs at 2 hours post injection. METH-induced prolonged increases in Fosb, Fra2, Egr1, and Egr3 mRNA levels in HDAC2KO mice were associated with increased enrichment of phosphorylated CREB (pCREB) on the promoters of these genes. Based on our observations, we hypothesize that HDAC2 may regulate the expression of these genes, in part, by prolonging the actions of pCREB in the mouse NAc. PMID:26300473

  10. Expression of Early Growth Response Gene-2 and Regulated Cytokines Correlates with Recovery from Guillain-Barré Syndrome.

    PubMed

    Doncel-Pérez, Ernesto; Mateos-Hernández, Lourdes; Pareja, Eduardo; García-Forcada, Ángel; Villar, Margarita; Tobes, Raquel; Romero Ganuza, Francisco; Vila Del Sol, Virginia; Ramos, Ricardo; Fernández de Mera, Isabel G; de la Fuente, José

    2016-02-01

    Guillain-Barré syndrome (GBS) is an immune-mediated peripheral neuropathy. The goal of this research was the identification of biomarkers associated with recovery from GBS. In this study, we compared the transcriptome of PBMCs from a GBS patient and her healthy twin to discover possible correlates of disease progression and recovery. The study was then extended using GBS and spinal cord injury unrelated patients with similar medications and healthy individuals. The early growth response gene-2 (EGR2) was upregulated in GBS patients during disease recovery. The results provided evidence for the implication of EGR2 in GBS and suggested a role for EGR2 in the regulation of IL-17, IL-22, IL-28A, and TNF-β cytokines in GBS patients. These results identified biomarkers associated with GBS recovery and suggested that EGR2 overexpression has a pivotal role in the downregulation of cytokines implicated in the pathophysiology of this acute neuropathy. PMID:26718337

  11. Colostrum whey down-regulates the expression of early and late inflammatory response genes induced by Escherichia coli and Salmonella enterica Typhimurium components in intestinal epithelial cells.

    PubMed

    Blais, M; Fortier, M; Pouliot, Y; Gauthier, S F; Boutin, Y; Asselin, C; Lessard, M

    2015-01-28

    Pathogenic invasion by Escherichia coli and Salmonellae remains a constant threat to the integrity of the intestinal epithelium and can rapidly induce inflammatory responses. At birth, colostrum consumption exerts numerous beneficial effects on the properties of intestinal epithelial cells and protects the gastrointestinal tract of newborns from pathogenic invasion. The present study aimed to investigate the effect of colostrum on the early and late inflammatory responses induced by pathogens. The short-term (2 h) and long-term (24 h) effects of exposure to heat-killed (HK) E. coli and Salmonella enterica Typhimurium on gene expression in the porcine intestinal epithelial cell (IPEC-J2) model were first evaluated by microarray and quantitative PCR analyses. Luciferase assays were performed using a NF-κB-luc reporter construct to investigate the effect of colostrum whey treatment on the activation of NF-κB induced by HK bacteria. Luciferase assays were also performed using NF-κB-luc, IL-8-luc and IL-6-luc reporter constructs in human colon adenocarcinoma Caco-2/15 cells exposed to dose-response stimulations with HK bacteria and colostrum whey. Bovine colostrum whey treatment decreased the expression of early and late inflammatory genes induced by HK bacteria in IPEC-J2, as well as the transcriptional activation of NF-κB-luc induced by HK bacteria. Unlike that with colostrum whey, treatment with other milk fractions failed to decrease the activation of NF-κB-luc induced by HK bacteria. Lastly, the reduction of the HK bacteria-induced activation of NF-κB-luc, IL-8-luc and IL-6-luc by colostrum whey was dose dependent. The results of the present study indicate that bovine colostrum may protect and preserve the integrity of the intestinal mucosal barrier in the host by controlling the expression levels of early and late inflammatory genes following invasion by enteric pathogens. PMID:25471114

  12. A Pectate Lyase-Coding Gene Abundantly Expressed during Early Stages of Infection Is Required for Full Virulence in Alternaria brassicicola.

    PubMed

    Cho, Yangrae; Jang, Mina; Srivastava, Akhil; Jang, Jae-Hyuk; Soung, Nak-Kyun; Ko, Sung-Kyun; Kang, Dae-Ook; Ahn, Jong Seog; Kim, Bo Yeon

    2015-01-01

    Alternaria brassicicola causes black spot disease of Brassica species. The functional importance of pectin digestion enzymes and unidentified phytotoxins in fungal pathogenesis has been suspected but not verified in A. brassicicola. The fungal transcription factor AbPf2 is essential for pathogenicity and induces 106 genes during early pathogenesis, including the pectate lyase-coding gene, PL1332. The aim of this study was to test the importance and roles of PL1332 in pathogenesis. We generated deletion strains of the PL1332 gene, produced heterologous PL1332 proteins, and evaluated their association with virulence. Deletion strains of the PL1332 gene were approximately 30% less virulent than wild-type A. brassicicola, without showing differences in colony expansion on solid media and mycelial growth in nutrient-rich liquid media or minimal media with pectins as a major carbon source. Heterologous PL1332 expressed as fusion proteins digested polygalacturons in vitro. When the fusion proteins were injected into the apoplast between leaf veins of host plants the tissues turned dark brown and soft, resembling necrotic leaf tissue. The PL1332 gene was the first example identified as a general toxin-coding gene and virulence factor among the 106 genes regulated by the transcription factor, AbPf2. It was also the first gene to have its functions investigated among the 19 pectate lyase genes and several hundred putative cell-wall degrading enzymes in A. brassicicola. These results further support the importance of the AbPf2 gene as a key pathogenesis regulator and possible target for agrochemical development.

  13. Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate.

    PubMed

    Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M

    2016-08-01

    Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. PMID:27040527

  14. Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate.

    PubMed

    Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M

    2016-08-01

    Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus.

  15. Effect of mitotic inducers and retinoic acid blocker on expression of pluripotent genes in ES cells derived from early stage in vitro-produced embryos in buffalo.

    PubMed

    Kumar, Ashok; Kumar, Kuldeep; Singh, Renu; Puri, Gopal; Ranjan, R; Yasotha, T; Singh, R K; Sarkar, M; Bag, Sadhan

    2012-12-01

    So far, it has been difficult to generate embryonic stem (ES) cell from early stage preimplantation embryos of buffalo. These ES cells will be more helpful for efficient embryo cloning and generation of body cells as they are more primitive than inner cell mass (ICM)-derived ES cells. The present study was conducted to find the effect of lipopolysaccharide (LPS), melatonin (N-acetyl-5-methoxytryptamine, a pineal gland product), and citral (3,7-dimethyl-2,6-octadienal and a retinoic acid synthesis blocker) on establishment of primary ES cell colonies, the comparative size of the ES cell colonies, and expression of pluripotent genes during extended period of culture in buffalo. Zona-free eight-cell stage in vitro fertilization (IVF) embryos were cultured in ES cell medium supplemented with none (media I as control), LPS (media II), citral melatonin (media III), or melatonin (media IV). The multiplication of blastomere leading to ES cell colony formation and expression of pluripotent genes were assessed up to day 20 of culture. The primary colony formation, the comparative size of the ES cell colonies, and expression of pluripotent genes in these colonies were better in the medium supplemented with melatonin in all days of culture. Within melatonin supplementation, the colony size was comparatively larger on day 8 and day 12 of culture. Further, with this supplementation, the Oct-4 and Nanog expression was comparatively higher on all days of culture. The results indicated that supplementation of melatonin helped in the formation of better primary ES cell colony as well as in the maintenance of pluripotency. The results also indicated that primary colonies developed on day 8 to day 12 of culture may be better for passaging them for establishment of ES cell line from early stage preimplantation IVF embryos of in buffalo.

  16. Effect of mitotic inducers and retinoic acid blocker on expression of pluripotent genes in ES cells derived from early stage in vitro-produced embryos in buffalo.

    PubMed

    Kumar, Ashok; Kumar, Kuldeep; Singh, Renu; Puri, Gopal; Ranjan, R; Yasotha, T; Singh, R K; Sarkar, M; Bag, Sadhan

    2012-12-01

    So far, it has been difficult to generate embryonic stem (ES) cell from early stage preimplantation embryos of buffalo. These ES cells will be more helpful for efficient embryo cloning and generation of body cells as they are more primitive than inner cell mass (ICM)-derived ES cells. The present study was conducted to find the effect of lipopolysaccharide (LPS), melatonin (N-acetyl-5-methoxytryptamine, a pineal gland product), and citral (3,7-dimethyl-2,6-octadienal and a retinoic acid synthesis blocker) on establishment of primary ES cell colonies, the comparative size of the ES cell colonies, and expression of pluripotent genes during extended period of culture in buffalo. Zona-free eight-cell stage in vitro fertilization (IVF) embryos were cultured in ES cell medium supplemented with none (media I as control), LPS (media II), citral melatonin (media III), or melatonin (media IV). The multiplication of blastomere leading to ES cell colony formation and expression of pluripotent genes were assessed up to day 20 of culture. The primary colony formation, the comparative size of the ES cell colonies, and expression of pluripotent genes in these colonies were better in the medium supplemented with melatonin in all days of culture. Within melatonin supplementation, the colony size was comparatively larger on day 8 and day 12 of culture. Further, with this supplementation, the Oct-4 and Nanog expression was comparatively higher on all days of culture. The results indicated that supplementation of melatonin helped in the formation of better primary ES cell colony as well as in the maintenance of pluripotency. The results also indicated that primary colonies developed on day 8 to day 12 of culture may be better for passaging them for establishment of ES cell line from early stage preimplantation IVF embryos of in buffalo. PMID:23093464

  17. Gene Expression Study of Monocytes/Macrophages during Early Foreign Body Reaction and Identification of Potential Precursors of Myofibroblasts

    PubMed Central

    Vranken, Ilse; Lebacq, An; Flameng, Willem

    2010-01-01

    Foreign body reaction (FBR), initiated by adherence of macrophages to biomaterials, is associated with several complications. Searching for mechanisms potentially useful to overcome these complications, we have established the signaling role of monocytes/macrophages in the development of FBR and the presence of CD34+ cells that potentially differentiate into myofibroblasts. Therefore, CD68+ cells were in vitro activated with fibrinogen and also purified from the FBR after 3 days of implantation in rats. Gene expression profiles showed a switch from monocytes and macrophages attracted by fibrinogen to activated macrophages and eventually wound-healing macrophages. The immature FBR also contained a subpopulation of CD34+ cells, which could be differentiated into myofibroblasts. This study showed that macrophages are the clear driving force of FBR, dependent on milieu, and myofibroblast deposition and differentiation. PMID:20886081

  18. Effects of butachlor on estrogen receptor, vitellogenin and P450 aromatase gene expression in the early life stage of zebrafish.

    PubMed

    Chang, Juhua; Gui, Wenjun; Wang, Minghua; Zhu, Guonian

    2012-01-01

    Butachlor has adverse effects on fecundity and disrupts sex hormone homeostasis in adult zebrafish, but the underlying molecular mechanisms are still unclear. In the present study, zebrafish (Danio rerio) embryos were exposed to various concentrations of butachlor from 2 h post-fertilization (hpf) to 30 days post-fertilization (dpf). The transcription of genes involved estrogen receptors (ERα, ERβ1 and ERβ2), vitellogenins (VTG I and II), and cytochrome P450 aromatase (CYP19a) was analyzed by real-time quantitative PCR. The results showed that there was no significant alteration in the expression of VTGI, ERα, ERβ1, ERβ2 and CYP19a after 30 days of butachlor exposure, whereas the transcription of VTG II gene was significantly up-regulated in zebrafish exposed to 100 μg/L butachlor. It is suggested that butachlor may be a weak estrogen, and more endpoints need to be investigated to assess the effects of butachlor on the hypothalamus-pituitary-gonadal axis of zebrafish.

  19. Palmitoyl-protein thioesterase gene expression in the developing mouse brain and retina: implications for early loss of vision in infantile neuronal ceroid lipofuscinosis.

    PubMed

    Zhang, Z; Mandal, A K; Wang, N; Keck, C L; Zimonjic, D B; Popescu, N C; Mukherjee, A B

    1999-04-29

    Mutations in the palmitoyl-protein thioesterase (PPT) gene cause infantile neuronal ceroid lipofuscinosis (INCL), the clinical manifestations of which include the early loss of vision followed by deterioration of brain functions. To gain insight into the temporal onset of these clinical manifestations, we isolated and characterized a murine PPT (mPPT)-cDNA, mapped the gene on distal chromosome 4, and studied its expression in the eye and in the brain during development. Our results show that both cDNA and protein sequences of the murine and human PPTs are virtually identical and that the mPPT expression in the retina and in the brain is temporally regulated during development. Furthermore, the retinal expression of mPPT occurs much earlier and at a higher level than in the brain at all developmental stages investigated. Since many retinal and brain proteins are highly palmitoylated and depalmitoylation by PPT is essential for their effective recycling in the lysosomes, our results raise the possibility that inactivating mutations of the PPT gene, as occur in INCL, are likely to cause cellular accumulation of lipid-modified proteins in the retina earlier than in the brain. Consequently, the loss of vision occurs before the deterioration of brain functions in this disease. PMID:10231585

  20. Interaction of Host Nucleolin with Influenza A Virus Nucleoprotein in the Early Phase of Infection Limits the Late Viral Gene Expression

    PubMed Central

    Kumar, Deepshikha; Broor, Shobha; Rajala, Maitreyi S.

    2016-01-01

    Influenza A virus nucleoprotein, is a multifunctional RNA-binding protein, encoded by segment-5 of the negative sense RNA genome. It serves as a key connector between the virus and the host during virus replication. It continuously shuttles between the cytoplasm and the nucleus interacting with various host cellular factors. In the current study, host proteins interacting with nucleoprotein of Influenza A virus of H1N1 2009 pandemic strain were identified by co-immunoprecipitation studies followed by MALDI-TOF/MS analysis. Here we report the host nucleolin, a major RNA-binding protein of the nucleolus as a novel interacting partner to influenza A virus nucleoprotein. We thus, explored the implications of this interaction in virus life cycle and our studies have shown that these two proteins interact early during infection in the cytoplasm of infected cells. Depletion of nucleolin in A549 cells by siRNA targeting endogenous nucleolin followed by influenza A virus infection, disrupted its interaction with viral nucleoprotein, resulting in increased expression of gene transcripts encoding late viral proteins; matrix (M1) and hemagglutinin (HA) in infected cells. On the contrary, over expression of nucleolin in cells transiently transfected with pEGFP-NCL construct followed by virus infection significantly reduced the late viral gene transcripts, and consequently the viral titer. Altered expression of late viral genes and titers following manipulation of host cellular nucleolin, proposes the functional importance of its interaction with nucleoprotein during influenza A virus infection. PMID:27711134

  1. UVB-dependent changes in the expression of fast-responding early genes is modulated by huCOP1 in keratinocytes.

    PubMed

    Fazekas, B; Polyánka, H; Bebes, A; Tax, G; Szabó, K; Farkas, K; Kinyó, A; Nagy, F; Kemény, L; Széll, M; Ádám, É

    2014-11-01

    Ultraviolet (UV) B is the most prominent physical carcinogen in the environment leading to the development of various skin cancers. We have previously demonstrated that the human ortholog of the Arabidopsis thaliana constitutive photomorphogenesis 1 (COP1) protein, huCOP1, is expressed in keratinocytes in a UVB-regulated manner and is a negative regulator of p53 as a posttranslational modifier. However, it was not known whether huCOP1 plays a role in mediating the UVB-induced early transcriptional responses of human keratinocytes. In this study, we report that stable siRNA-mediated silencing of huCOP1 affects the UVB response of several genes within 2 h of irradiation, indicating that altered huCOP1 expression sensitizes the cells toward UVB. Pathway analysis identified a molecular network in which 13 of the 30 examined UVB-regulated genes were organized around three central proteins. Since the expression of the investigated genes was upregulated by UVB in the siCOP1 cell line, we hypothesize that huCOP1 is a repressor of the identified pathway. Several members of the network have been implicated previously in the pathogenesis of non-melanoma skin cancers; therefore, clarifying the role of huCOP1 in these skin diseases may have clinical relevance in the future.

  2. Phylogenetic analysis and seasonal cold acclimation-associated expression of early light-induced protein genes of Rhododendron catawbiense.

    PubMed

    Peng, Yanhui; Lin, Wuling; Wei, Hui; Krebs, Stephen L; Arora, Rajeev

    2008-01-01

    The early light-induced proteins (ELIPs) are nuclear-encoded, light stress-induced proteins located in thylakoid membranes and related to light-harvesting Chl a/b-binding proteins. Recent evidence from physiological and genetic (mutant) studies supports a photoprotective function for ELIPs, particularly when green tissues are exposed to high light intensities at suboptimal temperatures. Broad-leaved evergreens belonging to genus Rhododendron are often exposed to a combination of low temperatures and high light in their natural habitat as the understory plants in deciduous forests and, therefore, are expected to employ photoprotective strategies during overwintering phase. Here we report analysis and characterization of previously identified ELIP expressed sequence tags (ESTs) from winter-collected Rhododendron catawbiense leaves. 5' or 3' rapid amplification of complementary DNA ends (RACEs) coupled with bioinformatic analyses were used to identify seven unique ELIPs from the 40 ESTs and were designated as RcELIP1-RcELIP7. Phylogenetic analysis revealed separate clustering of ELIP homologs from lower plants, monocots and eudicots (including RcELIPs) and further indicated an evolutionary divergence of ELIPs among angiosperms and gymnosperms. To gain insights into the cold acclimation (CA) physiology of rhododendrons, relative and absolute quantitative expression of RcELIPs was examined during seasonal CA of R. catawbiense leaves using real time reverse transcriptase-polymerase chain reaction. All seven RcELIPs were distinctly upregulated during the CA. It is postulated that RcELIPs expression constitutes an adaptive response to cold and high light in winter-adapted rhododendron leaves and perhaps plays a key role in the protection of photosynthetic apparatus from these stresses.

  3. Precocious anaphase and expression of Securin and p53 genes as candidate biomarkers for the early detection in areca nut-induced carcinogenesis.

    PubMed

    Kurkalang, Sillarine; Banerjee, Atanu; Dkhar, Hughbert; Nongrum, Henry B; Ganguly, Buddha; Islam, Mohammad; Rangad, Gordon M; Chatterjee, Anupam

    2015-05-01

    Research over the years has generated enough evidence to implicate areca nut, as a carcinogen in humans. Besides oral, significant rise in the incidence of cancers of the oesophagus, liver and stomach was seen among areca nut chewers. Early diagnosis seems key to understand the initial processes of carcinogenesis which is highly curable. In North-East India, betel quid contains raw areca nut (RAN), lime and small portion of betel leaf without any other constituents. This study was not intended to isolate any active ingredients from the RAN and to look its action. The present objective is to validate the screening of precocious anaphase and analysis of expression of Securin and p53 in non-target cells like human peripheral blood lymphocytes (PBLs) and mouse bone marrow cells (BMCs) as early indicative parameters of RAN + lime-induced cancers. A total of 35 mice were examined at different time points for following ad libitum administration of RAN extract in drinking water with lime. Peripheral blood was collected from 32 human donors of which, 24 were RAN + lime heavy chewers. Expression of genes was assessed by immunoblotting and/or by immunohistochemistry. Histological preparation of stomach tissue of mice revealed that RAN + lime induced stomach cancer. A gradual increase in the frequency of precocious anaphases and aneuploid cells was observed in both RAN + lime-treated mouse BMC and human PBL of RAN heavy chewers. Levels of p53 and Securin were increased in these cells during early days of RAN + lime exposure. The level of Securin was significantly higher in human tumour samples than their adjacent normal counterpart. The expression of Securin was increased significantly in RAN + lime-administered mice as well as in stomach tumour. Present study revealed that precocious anaphase and expression of p53 and Securin in non-target cells are significantly associated with an increased risk of RAN-induced cancer and thus these parameters can be of early diagnostic value.

  4. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity.

    PubMed

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks.

  5. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity

    PubMed Central

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks. PMID:26137459

  6. Early adaptive response of the retina to a pro-diabetogenic diet: Impairment of cone response and gene expression changes in high-fructose fed rats.

    PubMed

    Thierry, Magalie; Pasquis, Bruno; Buteau, Bénédicte; Fourgeux, Cynthia; Dembele, Doulaye; Leclere, Laurent; Gambert-Nicot, Ségolène; Acar, Niyazi; Bron, Alain M; Creuzot-Garcher, Catherine P; Bretillon, Lionel

    2015-06-01

    towards an increased expression of αA- and αB-crystallin proteins was observed at day 8. Our results are consistent with early alterations of the functioning and gene expression in the retina in a pro diabetogenic environment.

  7. Platelet-Derived Growth Factor-Stimulated Expression of the MCP-1 Immediate-Early Gene Involves an Inhibitory Multiprotein Complex

    PubMed Central

    Sridhar, Padma; Liu, Yu; Chin, Lisa D.; Borja, Charlene E.; Mann, Mana; Skopicki, Hal A.; Freter, Rolf R.

    1999-01-01

    We have demonstrated previously that the seven-nucleotide (nt) motif TTTTGTA (the heptamer) that is present within the proximal 3′ untranslated sequences of numerous immediate-early genes is essential for platelet-derived growth factor (PDGF)-stimulated induction of the MCP-1 immediate-early gene. On this basis, the heptamer was suggested to be a conserved regulatory element involved in immediate-early gene expression, although its mechanism of action was unknown. Herein, we demonstrate that the heptamer functions to remove an inhibition of PDGF induction of MCP-1 maintained by two independently acting inhibitory elements present in the MCP-1 5′ flanking sequences (designated I* elements). PDGF treatment relieves the I*-mediated inhibition of MCP-1 expression only if the heptamer is also present. One inhibitory element is contained within a 59-nt portion of MCP-1 5′ flanking sequences and functions in an orientation-independent and heptamer-regulated manner. Significantly, proteins binding to two DNA sequences contribute to the formation of a single multiprotein complex on the 59-nt I* element. The I*-binding complex contains Sp3, an Sp1-like protein, and a novel DNA-binding protein. Moreover, the complex does not form on two 59-nt sequences containing mutations that reverse the inhibition of PDGF induction maintained by the wild-type I* element. We propose to call the multiprotein I*-binding complex a repressosome and suggest that it acts to repress PDGF-stimulated transcription of MCP-1 in the absence of the heptamer TTTTGTA. PMID:10330162

  8. Expression kinetics of key genes in the early innate immune response to Great Lakes viral hemorrhagic septicemia virus IVb infection in yellow perch (Perca flavescens)

    USGS Publications Warehouse

    Olson, Wendy; Emmenegger, Eveline; Glenn, Jolene; Simchick, Crystal; Winton, Jim; Goetz, Frederick

    2013-01-01

    The recently discovered strain of viral hemorrhagic septicemia virus, VHSV-IVb, represents an example of the introduction of an extremely pathogenic rhabdovirus capable of infecting a wide variety of new fish species in a new host-environment. The goal of the present study was to delineate the expression kinetics of key genes in the innate immune response relative to the very early stages of VHSV-IVb infection using the yellow perch (Perca flavescens) as a model. Administration of VHSV-IVb by IP-injection into juvenile yellow perch resulted in 84% cumulative mortality, indicating their high susceptibility to this disease. In fish sampled in the very early stages of infection, a significant up-regulation of Mx gene expression in the liver, as well as IL-1β and SAA activation in the head kidney, spleen, and liver was directly correlated to viral load. The potential down-regulation of Mx in the hematopoietic tissues, head kidney and spleen, may represent a strategy utilized by the virus to increase replication.

  9. Isolation of early genes expressed in reproductive organs of the dioecious white campion (Silene latifolia) by subtraction cloning using an asexual mutant.

    PubMed

    Barbacar, N; Hinnisdaels, S; Farbos, I; Monéger, F; Lardon, A; Delichère, C; Mouras, A; Negrutiu, I

    1997-10-01

    The dioecious white campion (Silene latifolia) has been chosen as a working model for sexual development. In this species, sexual dimorphism is achieved through two distinct developmental blocks: inhibition of carpel development in male flowers, and early arrest of anther differentiation in female flowers. The combined advantages of the dioecious system and the availability of a sexual mutant lacking both male and female reproductive organs have been exploited in a molecular subtraction approach using male and asexual flower buds. This resulted in the cloning of 22 cDNA clones expressed in stamens at distinct stages of development. Fourteen of these clones corresponded to genes whose expression was detected in pre-meiotic stamens, a stage of development for which very little information is presently available. Furthermore, the absence of similarities with database sequences for ten clones suggests that they represent novel genes. Functional analysis of each clone will enable their positioning within the reproductive organ developmental pathway(s). In parallel, these clones are being exploited as developmental markers of early differentiation within the flower. PMID:9375394

  10. Intragraft Expression of the IL-10 Gene Is Up-Regulated in Renal Protocol Biopsies with Early Interstitial Fibrosis, Tubular Atrophy, and Subclinical Rejection

    PubMed Central

    Hueso, Miguel; Navarro, Estanis; Moreso, Francesc; O'Valle, Francisco; Pérez-Riba, Mercè; del Moral, Raimundo García; Grinyó, Josep M.; Serón, Daniel

    2010-01-01

    Grafts with subclinical rejection associated with interstitial fibrosis and tubular atrophy (SCR+IF/TA) show poorer survival than grafts with subclinical rejection without IF/TA (SCR). Aiming to detect differences among SCR+IF/TA and SCR, we immunophenotyped the inflammatory infiltrate (CD45, CD3, CD20, CD68) and used a low-density array to determine levels of TH1 (interleukin IL-2, IL-3, γ-interferon, tumor necrosis factor-α, lymphotoxin-α, lymphotoxin-β, granulocyte-macrophage colony-stimulating factor) and TH2 (IL-4, IL-5, IL-6, IL-10, and IL-13) transcripts as well as of IL-2R (as marker for T-cell activation) in 31 protocol biopsies of renal allografts. Here we show that grafts with early IF/TA and SCR can be distinguished from grafts with SCR on the basis of the activation of IL-10 gene expression and of an increased infiltration by B-lymphocytes in a cellular context in which the degree of T-cell activation is similar in both groups of biopsies, as demonstrated by equivalent levels of IL-2R mRNA. These results suggest that the up-regulation of the IL-10 gene expression, as well as an increased proportion of B-lymphocytes in the inflammatory infiltrates, might be useful as markers of early chronic lesions in grafts with SCR. PMID:20150436

  11. Systems Analysis of Early Host Gene Expression Provides Clues for Transient Mycobacterium avium ssp avium vs. Persistent Mycobacterium avium ssp paratuberculosis Intestinal Infections

    PubMed Central

    Khare, Sangeeta; Drake, Kenneth L.; Lawhon, Sara D.; Nunes, Jairo E. S.; Figueiredo, Josely F.; Rossetti, Carlos A.; Gull, Tamara; Everts, Robin E.; Lewin, Harris. A.; Adams, Leslie Garry

    2016-01-01

    It has long been a quest in ruminants to understand how two very similar mycobacterial species, Mycobacterium avium ssp. paratuberculosis (MAP) and Mycobacterium avium ssp. avium (MAA) lead to either a chronic persistent infection or a rapid-transient infection, respectively. Here, we hypothesized that when the host immune response is activated by MAP or MAA, the outcome of the infection depends on the early activation of signaling molecules and host temporal gene expression. To test our hypothesis, ligated jejuno-ileal loops including Peyer’s patches in neonatal calves were inoculated with PBS, MAP, or MAA. A temporal analysis of the host transcriptome profile was conducted at several times post-infection (0.5, 1, 2, 4, 8 and 12 hours). When comparing the transcriptional responses of calves infected with the MAA versus MAP, discordant patterns of mucosal expression were clearly evident, and the numbers of unique transcripts altered were moderately less for MAA-infected tissue than were mucosal tissues infected with the MAP. To interpret these complex data, changes in the gene expression were further analyzed by dynamic Bayesian analysis. Bayesian network modeling identified mechanistic genes, gene-to-gene relationships, pathways and Gene Ontologies (GO) biological processes that are involved in specific cell activation during infection. MAP and MAA had significant different pathway perturbation at 0.5 and 12 hours post inoculation. Inverse processes were observed between MAP and MAA response for epithelial cell proliferation, negative regulation of chemotaxis, cell-cell adhesion mediated by integrin and regulation of cytokine-mediated signaling. MAP inoculated tissue had significantly lower expression of phagocytosis receptors such as mannose receptor and complement receptors. This study reveals that perturbation of genes and cellular pathways during MAP infection resulted in host evasion by mucosal membrane barrier weakening to access entry in the ileum

  12. Quantitative mRNA expression analysis of selected genes in patients with early-stage hypothyroidism induced by treatment with iodine-131.

    PubMed

    Guo, Kun; Gao, Rui; Yu, Yan; Zhang, Weixiao; Yang, Yuxuan; Yang, Aimin

    2015-11-01

    The present study aimed to investigate the molecular markers indicative of early-stage hypothyroidism induced by treatment with iodine-131, in order to assist in further investigations of radio iodine‑induced hypothyroidism. A total of 59 patients diagnosed with hyperthyroidism (male/female, 16/43; median age, 46.4 years) and 27 healthy subjects (male/female, 7/21; median age, 44.6 years) were included in the present study. All patients were treated with appropriate doses of iodine‑131 and, three months following treatment, the patients were subdivided into two groups: A group with early‑stage hypothyroidism symptoms, and a group with non‑early‑stage hypothyroidism, including euthyroid patients and patients remaining with hyperthyroidism. Tissue samples from the patients and healthy subjects were collected by fine needle biopsies, and the mRNA expression levels of B-cell lymphoma 2 (Bcl‑2), nuclear factor (NF)‑κB, Ku70, epidermal growth factor receptor (EGFR), early growth response 1 (Egr‑1), TP53 and ataxia telangiectasia mutated were analyzed using reverse transcription‑quantitative polymerase chain reaction prior to iodine‑131 treatment. The association of the variation of target genes with susceptibility to early‑stage hypothyroidism was analyzed. Compared with normal subjects, the mRNA expression levels of Ku70 (0.768, vs. 3.304, respectively; P<0.001) and EGFR (0.859, vs. 1.752, respectively; P<0.05) were significantly higher, whereas those of NF‑κB (0.884, vs. 0.578, respectively; P<0.05) and Bcl‑2 (1.235, vs. 0.834, respectively; P<0.05) were lower in the hyperthyroid patients. Following treatment with iodine‑131, 30 of the 59 (50.8%) patients with hyperthyroidism were diagnosed with early‑stage hypothyroidism, and in the early‑stage hypothyroidism group, the mRNA expression levels of Bcl‑2 were significantly decreased (P<0.05), whereas those of Egr‑1 (P<0.05) were significantly increased, compared with the non

  13. Quantitative mRNA expression analysis of selected genes in patients with early-stage hypothyroidism induced by treatment with iodine-131.

    PubMed

    Guo, Kun; Gao, Rui; Yu, Yan; Zhang, Weixiao; Yang, Yuxuan; Yang, Aimin

    2015-11-01

    The present study aimed to investigate the molecular markers indicative of early-stage hypothyroidism induced by treatment with iodine-131, in order to assist in further investigations of radio iodine‑induced hypothyroidism. A total of 59 patients diagnosed with hyperthyroidism (male/female, 16/43; median age, 46.4 years) and 27 healthy subjects (male/female, 7/21; median age, 44.6 years) were included in the present study. All patients were treated with appropriate doses of iodine‑131 and, three months following treatment, the patients were subdivided into two groups: A group with early‑stage hypothyroidism symptoms, and a group with non‑early‑stage hypothyroidism, including euthyroid patients and patients remaining with hyperthyroidism. Tissue samples from the patients and healthy subjects were collected by fine needle biopsies, and the mRNA expression levels of B-cell lymphoma 2 (Bcl‑2), nuclear factor (NF)‑κB, Ku70, epidermal growth factor receptor (EGFR), early growth response 1 (Egr‑1), TP53 and ataxia telangiectasia mutated were analyzed using reverse transcription‑quantitative polymerase chain reaction prior to iodine‑131 treatment. The association of the variation of target genes with susceptibility to early‑stage hypothyroidism was analyzed. Compared with normal subjects, the mRNA expression levels of Ku70 (0.768, vs. 3.304, respectively; P<0.001) and EGFR (0.859, vs. 1.752, respectively; P<0.05) were significantly higher, whereas those of NF‑κB (0.884, vs. 0.578, respectively; P<0.05) and Bcl‑2 (1.235, vs. 0.834, respectively; P<0.05) were lower in the hyperthyroid patients. Following treatment with iodine‑131, 30 of the 59 (50.8%) patients with hyperthyroidism were diagnosed with early‑stage hypothyroidism, and in the early‑stage hypothyroidism group, the mRNA expression levels of Bcl‑2 were significantly decreased (P<0.05), whereas those of Egr‑1 (P<0.05) were significantly increased, compared with the non

  14. Presentation of noise during acute restraint stress attenuates expression of immediate early genes and arginine vasopressin in the hypothalamic paraventricular nucleus but not corticosterone secretion in rats.

    PubMed

    Sugimoto, Koji; Ohmomo, Hideki; Shutoh, Fumihiro; Nogami, Haruo; Hisano, Setsuji

    2015-07-01

    The present study investigated the effect of acoustic stimulation on the activation of the hypothalamic-pituitary-adrenal (HPA) axis in rats submitted to acute restraint stress, through semi-quantitative histochemical analysis of expression of immediate early gene products (c-Fos, JunB and phosphorylated c-Jun) and arginine vasopressin (AVP) hnRNA in the paraventricular nucleus (PVN). Simultaneous presentation of white or pink noise with restraint resulted in a significant attenuation of stress-induced c-Fos and JunB expression in the dorsal body of dorsal medial parvicellular subdivision (mpdd) of the PVN, as compared with restraint without noise. However, this presentation did not change phosphorylation of c-Jun and the plasma corticosterone level. Moreover, white noise presentation during restraint led to a reduction in the number of c-Fos- or JunB-expressing corticotropin-releasing hormone (CRH) neurons and the number of neurons expressing AVP hnRNA in the mpdd. Dual-histochemical labeling revealed co-expression of c-Fos and JunB, as well as JunB and AVP hnRNA in mpdd neurons. These data suggest that acoustic stimuli have an attenuation effect on the restraint-induced activation of neuroendocrine CRH neurons, resulting in the reduction in AVP production as an adaptation of HPA axis to repeated stress.

  15. Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)

    NASA Astrophysics Data System (ADS)

    Sayaka, Shimomura-Umemura; Ijiri, Kenichi

    2006-01-01

    Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

  16. Early Stress Causes Sex-Specific, Life-Long Changes in Behaviour, Levels of Gonadal Hormones, and Gene Expression in Chickens

    PubMed Central

    Elfwing, Magnus; Nätt, Daniel; Goerlich-Jansson, Vivian C.; Persson, Mia; Hjelm, Jonas; Jensen, Per

    2015-01-01

    Early stress can have long-lasting phenotypic effects. Previous research shows that male and female chickens differ in many behavioural aspects, and respond differently to chronic stress. The present experiment aimed to broadly characterize long-term sex differences in responses to brief events of stress experienced during the first weeks of life. Chicks from a commercial egg-laying hybrid were exposed to stress by inducing periods of social isolation during their first three weeks of life, followed by a broad behavioural, physiological and genomic characterization throughout life. Early stressed males, but not females, where more anxious in an open field-test, stayed shorter in tonic immobility and tended to have delayed sexual maturity, as shown by a tendency for lower levels of testosterone compared to controls. While early stressed females did not differ from non-stressed in fear and sexual maturation, they were more socially dominant than controls. The differential gene expression profile in hypothalamus was significantly correlated from 28 to 213 days of age in males, but not in females. In conclusion, early stress had a more pronounced long-term effect on male than on female chickens, as evidenced by behavioral, endocrine and genomic responses. This may either be attributed to inherent sex differences due to evolutionary causes, or possibly to different stress related selection pressures on the two sexes during commercial chicken breeding. PMID:25978318

  17. Early stress causes sex-specific, life-long changes in behaviour, levels of gonadal hormones, and gene expression in chickens.

    PubMed

    Elfwing, Magnus; Nätt, Daniel; Goerlich-Jansson, Vivian C; Persson, Mia; Hjelm, Jonas; Jensen, Per

    2015-01-01

    Early stress can have long-lasting phenotypic effects. Previous research shows that male and female chickens differ in many behavioural aspects, and respond differently to chronic stress. The present experiment aimed to broadly characterize long-term sex differences in responses to brief events of stress experienced during the first weeks of life. Chicks from a commercial egg-laying hybrid were exposed to stress by inducing periods of social isolation during their first three weeks of life, followed by a broad behavioural, physiological and genomic characterization throughout life. Early stressed males, but not females, where more anxious in an open field-test, stayed shorter in tonic immobility and tended to have delayed sexual maturity, as shown by a tendency for lower levels of testosterone compared to controls. While early stressed females did not differ from non-stressed in fear and sexual maturation, they were more socially dominant than controls. The differential gene expression profile in hypothalamus was significantly correlated from 28 to 213 days of age in males, but not in females. In conclusion, early stress had a more pronounced long-term effect on male than on female chickens, as evidenced by behavioral, endocrine and genomic responses. This may either be attributed to inherent sex differences due to evolutionary causes, or possibly to different stress related selection pressures on the two sexes during commercial chicken breeding.

  18. Effects of dry period length and dietary energy source on metabolic status and hepatic gene expression of dairy cows in early lactation.

    PubMed

    Chen, J; Gross, J J; van Dorland, H A; Remmelink, G J; Bruckmaier, R M; Kemp, B; van Knegsel, A T M

    2015-02-01

    In a prior study, we observed that cows with a 0-d dry period had greater energy balance and lower milk production compared with cows with a 30- or 60-d dry period in early lactation. The objective of the current study was to evaluate the influence of dry period length on metabolic status and hepatic gene expression in cows fed a lipogenic or glucogenic diet in early lactation. Holstein-Friesian dairy cows (n=167) were assigned randomly to 3×2 factorial design with 3 dry period lengths (n=56, 55, and 56 for 0-, 30-, and 60-d dry, respectively) and 2 early lactation diets (n=84 and 83 for glucogenic and lipogenic diet, respectively). Cows were fed a glucogenic or lipogenic diet from 10d before the expected calving date and onward. The main ingredient for a glucogenic concentrate was corn, and the main ingredients for a lipogenic concentrate were sugar beet pulp, palm kernel, and rumen-protected palm oil. Blood was sampled weekly from 95 cows from wk 3 precalving to wk 8 postcalving. Liver samples were collected from 76 cows in wk -2, 2, and 4 relative to calving. Liver samples were analyzed for triacylglycerol concentrations and mRNA expression of 12 candidate genes. Precalving, cows with a 0-d dry period had greater plasma β-hydroxybutyrate, urea, and insulin concentrations compared with cows with a 30- or 60-d dry period. Postcalving, cows with a 0-d dry period had lower liver triacylglycerol and plasma nonesterified fatty acids concentrations (0.20, 0.32, and 0.36mmol/L for 0-, 30-, and 60-d dry period, respectively), greater plasma glucose, insulin-like growth factor-I, and insulin (24.38, 14.02, and 11.08µIU/mL for 0-, 30-, and 60-d dry period, respectively) concentrations, and lower hepatic mRNA expression of pyruvate carboxylase, compared with cows with a 30- or 60-d dry period. Plasma urea and β-hydroxybutyrate concentrations were greater in cows fed a lipogenic diet compared with cows fed a glucogenic diet. In conclusion, cows with a 0-d dry period had

  19. CaaX-prenyltransferases are essential for expression of genes involvedin the early stages of monoterpenoid biosynthetic pathway in Catharanthus roseus cells.

    PubMed

    Courdavault, Vincent; Thiersault, Martine; Courtois, Martine; Gantet, Pascal; Oudin, Audrey; Doireau, Pierre; St-Pierre, Benoit; Giglioli-Guivarc'h, Nathalie

    2005-04-01

    CaaX-prenyltransferases (CaaX-PTases) catalyse the covalent attachment of isoprenyl groups to conserved cysteine residues located at the C-terminal CaaX motif of a protein substrate. This post-translational modification is required for the function and/or subcellular localization of some transcription factors and components of signal transduction and membrane trafficking machinery. CaaX-PTases, including protein farnesyltransferase (PFT) and type-I protein geranylgeranyltransferase (PGGT-I), are heterodimeric enzymes composed of a common alpha subunit and a specific beta subunit. We have established RNA interference cell lines targeting the beta subunits of PFT and PGGT-I, respectively, in the Catharanthus roseus C20D cell line, which synthesizes monoterpenoid indole alkaloids in response to auxin depletion from the culture medium. In both types of RNAi cell lines, expression of a subset of genes involved in the early stage of monoterpenoid biosynthetic pathway (ESMB genes), including the MEP pathway, is strongly decreased. The role of CaaX-PTases in ESMB gene regulation was confirmed by using the general prenyltransferase inhibitor s-perillyl alcohol (SP) and the specific PFT inhibitor Manumycin A on the wild type line. Furthermore, supplementation of SP inhibited cells with monoterpenoid intermediates downstream of the steps encoded by the ESMB genes restores monoterpenoid indole alkaloids biosynthesis. We conclude that protein targets for both PFT and PGGT-I are required for the expression of ESMB genes and monoterpenoid biosynthesis in C. roseus, this represents a non previously described role for protein prenyltransferase in plants.

  20. Glial fibrillary acidic protein promoters direct adenovirus early 1A gene and human telomerase reverse transcriptase promoters direct sodium iodide symporter expression for malignant glioma radioiodine therapy.

    PubMed

    Li, Wei; Tan, Jian; Wang, Peng; Li, Ning; Li, Chengxia

    2015-01-01

    Malignant glioma can be treated with radioiodine following transfection with human sodium iodide symporter (hNIS) gene. Ad-Tp-E1A-Gp-NIS is engineered with human telomerase reverse transcriptase (hTERT) and glial fibrillary acidic protein (GFAP) promoters to express early region 1A (E1A) and hNIS genes, which may be useful in targeted gene therapy. The Ad-Tp-E1A-Gp-NIS was constructed and purified using the E1A and hNIS genes regulated by the hTERT and GFAP promoters, respectively. Glioma cells were infected by Ad-Tp-E1A-Gp-NIS. Selective replication ability of Ad-Tp-E1A-Gp-NIS was then evaluated by plaque forming assay, transgene expression by Western blot, (125)I-iodide uptake and efflux, clonogenicity following (131)I-iodide treatment in the tumor cells, and radioiodine therapy using nude mouse model. The Ad-Tp-E1A-Gp-NIS could selectively replicate; the hNIS gene was successfully expressed under the GFAP promoter. Western blot analyses using E1A- and hNIS-specific antibodies revealed two bands of approximately 40 and 70 kDa. In addition, the cells showed about 93.4 and 107.1 times higher (125)I uptake in U251 and U87 cells than in the control cells, respectively. Clonogenic assay indicated that >90% of cells transfected with Ad-Tp-E1A-Gp-NIS were killed. The Ad-Tp-E1A-Gp-NIS-transfected and 2 mCi (131)I-injected U87 xenograft nude mice survived the longest among the three groups. Ad-Tp-E1A-Gp-NIS has a good ability of selective replication and strong antitumor selectivity. An effective therapy of (131)I was achieved activity in malignant glioma cells after induction of tumor-specific iodide uptake activity by GFAP promoter-directed hNIS gene expression in vitro and in vivo.

  1. Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

    PubMed

    Mukilan, Murugan; Ragu Varman, Durairaj; Sudhakar, Sivasubramaniam; Rajan, Koilmani Emmanuvel

    2015-04-01

    The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C. sphinx. However, the infusion of AS-ODN post-training did not cause a deficit in memory formation. Furthermore, the inhibition of miR-132 reduced the olfactory training-induced expression of IEGs and post synaptic density protein-95 (PSD-95) in the OB. Additionally, we show that miR-132 regulates the activation of calcium/calmodulin-dependent protein kinase-II (CaMKII) and cAMP response element binding protein (CREB), possibly through miR-148a. These data suggest that olfactory training induces the expression of miR-132 and IEGs, which in turn activates post-synaptic proteins that regulate olfactory memory formation. PMID:25725166

  2. Direct combinatorial interaction between a herpes simplex virus regulatory protein and a cellular octamer-binding factor mediates specific induction of virus immediate-early gene expression.

    PubMed Central

    O'Hare, P; Goding, C R; Haigh, A

    1988-01-01

    We provide evidence for a novel mechanism of transcriptional regulation in which the immediate-early (IE) transactivating protein of herpes simplex virus, Vmw65, is assembled into a specific DNA-binding complex together with a cellular octamer-binding factor (TRF). The assembly of Vmw65/TRF complex requires not only the core TRF recognition site, but also flanking sequences which are dispensable for TRF binding alone. We show from functional analyses that TRF binding by a motif is required but not sufficient to confer induction on a heterologous promoter, and it is the ability of the motif to allow TRF/Vmw65 complex assembly which correlates with functional activity. Thus, for the induction of HSV IE expression, Vmw65 forms a complex with TRF by recognition of the specific subset of appropriately flanked TRF binding sites present in each of the IE genes. This mechanism may provide a paradigm for the selective utilization of the same transcription factor in differential gene expression. Images PMID:2854058

  3. Lasting Effects on Body Weight and Mammary Gland Gene Expression in Female Mice upon Early Life Exposure to n-3 but Not n-6 High-Fat Diets

    PubMed Central

    Bastian, Caleb A.; Westerman, Anja; Pisano, M. Michele; Pennings, Jeroen L. A.; Verhoef, Aart; Green, Maia L.; Piersma, Aldert H.; de Vries, Annemieke; Knudsen, Thomas B.

    2013-01-01

    Exposure to an imbalance of nutrients prior to conception and during critical developmental periods can have lasting consequences on physiological processes resulting in chronic diseases later in life. Developmental programming has been shown to involve structural and functional changes in important tissues. The aim of the present study was to investigate whether early life diet has a programming effect on the mammary gland. Wild-type mice were exposed from 2 weeks prior to conception to 6 weeks of age to a regular low-fat diet, or to high-fat diets based on either corn oil or flaxseed oil. At 6 weeks of age, all mice were shifted to the regular low-fat diet until termination at 10 weeks of age. Early life exposure to a high-fat diet, either high in n-6 (corn oil) or in n-3 (flaxseed oil) polyunsaturated fatty acids, did not affect birth weight, but resulted in an increased body weight at 10 weeks of age. Transcriptome analyses of the fourth abdominal mammary gland revealed differentially expressed genes between the different treatment groups. Exposure to high-fat diet based on flaxseed oil, but not on corn oil, resulted in regulation of pathways involved in energy metabolism, immune response and inflammation. Our findings suggest that diet during early life indeed has a lasting effect on the mammary gland and significantly influences postnatal body weight gain, metabolic status, and signaling networks in the mammary gland of female offspring. PMID:23409006

  4. The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

    SciTech Connect

    Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O'Callaghan, Dennis J. . E-mail: docall@lsuhsc.edu

    2007-06-20

    The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed.

  5. Gene Express Inc.

    PubMed

    Saccomanno, Colette F

    2006-07-01

    Gene Express, Inc. is a technology-licensing company and provider of Standardized Reverse Transcription Polymerase Chain Reaction (StaRT-PCR) services. Designed by and for clinical researchers involved in pharmaceutical, biomarker and molecular diagnostic product development, StaRT-PCR is a unique quantitative and standardized multigene expression measurement platform. StaRT-PCR meets all of the performance characteristics defined by the US FDA as required to support regulatory submissions [101,102] , and by the Clinical Laboratory Improvement Act of 1988 (CLIA) as necessary to support diagnostic testing [1] . A standardized mixture of internal standards (SMIS), manufactured in bulk, provides integrated quality control wherein each native template target gene is measured relative to a competitive template internal standard. Bulk production enables the compilation of a comprehensive standardized database from across multiple experiments, across collaborating laboratories and across the entire clinical development lifecycle of a given compound or diagnostic product. For the first time, all these data are able to be directly compared. Access to such a database can dramatically shorten the time from investigational new drug (IND) to new drug application (NDA), or save time and money by hastening a substantiated 'no-go' decision. High-throughput StaRT-PCR is conducted at the company's automated Standardized Expression Measurement (SEM) Center. Currently optimized for detection on a microcapillary electrophoretic platform, StaRT-PCR products also may be analyzed on microarray, high-performance liquid chromatography (HPLC), or matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) platforms. SEM Center services deliver standardized genomic data--data that will accelerate the application of pharmacogenomic technology to new drug and diagnostic test development and facilitate personalized medicine.

  6. Inducible gene expression in transgenic Xenopus embryos.

    PubMed

    Wheeler, G N; Hamilton, F S; Hoppler, S

    2000-07-13

    The amphibian Xenopus laevis has been successfully used for many years as a model system for studying vertebrate development. Because of technical limitations, however, molecular investigations have mainly concentrated on early stages. We have developed a straightforward method for stage-specific induction of gene expression in transgenic Xenopus embryos [1] [2]. This method is based on the Xenopus heat shock protein 70 (Xhsp70 [3]) promoter driving the expression of desired gene products. We found that ubiquitous expression of the transgene is induced upon relatively mild heat treatment. Green fluorescent protein (GFP) was used as a marker to monitor successful induction of gene expression in transgenic embryos. We used this method to study the stage specificity of Wnt signalling function. Transient ectopic Wnt-8 expression during early neurulation was sufficient to repress anterior head development and this capacity was restricted to early stages of neurulation. By transient over-expression at different stages of development, we show that frizzled-7 disrupted morphogenesis sequentially from anterior to posterior along the dorsal axis as development proceeds. These results demonstrate that this method for inducible gene expression in transgenic Xenopus embryos will be a very powerful tool for temporal analysis of gene function and for studying molecular mechanisms of vertebrate organogenesis.

  7. Over-expression of Brassica napus phosphatidylinositol-phospholipase C2 in canola induces significant changes in gene expression and phytohormone distribution patterns, enhances drought tolerance and promotes early flowering and maturation.

    PubMed

    Georges, Fawzy; DAS, Shankar; Ray, Heather; Bock, Cheryl; Nokhrina, Kateryna; Kolla, Venkat Apparao; Keller, Wilf

    2009-12-01

    Phosphatidylinositol-specific phospholipase C (PtdIns-PLC2) plays a central role in the phosphatidylinositol-specific signal transduction pathway. It catalyses the hydrolysis of membrane-bound phosphatidylinositol 4,5-bisphosphate to produce two second messengers, sn-1,2-diacylglycerol and inositol 1,4,5-trisphosphate. The former is a membrane activator of protein kinase C in mammalian systems, and the latter is a Ca(2+) modulator which induces distinctive oscillating bursts of cytosolic Ca(2+), resulting in regulation of gene expression and activation of proteins. Sustained over-expression of BnPtdIns-PLC2 in transgenic Brassica napus lines brought about an early shift from vegetative to reproductive phases, and shorter maturation periods, accompanied by notable alterations in hormonal distribution patterns in various tissues. The photosynthetic rate increased, while stomata were partly closed. Numerous gene expression changes that included induction of stress-related genes such as glutathione S-transferase, hormone-regulated and regulatory genes, in addition to a number of kinases, calcium-regulated factors and transcription factors, were observed. Other changes included increased phytic acid levels and phytohormone organization patterns. These results suggest the importance of PtdIns-PLC2 as an elicitor of a battery of events that systematically control hormone regulation, and plant growth and development in what may be a preprogrammed mode.

  8. Exposure time to caffeine affects heartbeat and cell damage-related gene expression of zebrafish Danio rerio embryos at early developmental stages.

    PubMed

    Abdelkader, Tamer Said; Chang, Seo-Na; Kim, Tae-Hyun; Song, Juha; Kim, Dong Su; Park, Jae-Hak

    2013-11-01

    Caffeine is white crystalline xanthine alkaloid that is naturally found in some plants and can be produced synthetically. It has various biological effects, especially during pregnancy and lactation. We studied the effect of caffeine on heartbeat, survival and the expression of cell damage related genes, including oxidative stress (HSP70), mitochondrial metabolism (Cyclin G1) and apoptosis (Bax and Bcl2), at early developmental stages of zebrafish embryos. We used 100 µm concentration based on the absence of locomotor effects. Neither significant mortality nor morphological changes were detected. We monitored hatching at 48 h post-fertilization (hpf) to 96 hpf. At 60 and 72 hpf, hatching decreased significantly (P < 0.05); however, the overall hatching rate at 96 hpf was 94% in control and 93% in caffeine treatment with no significant difference (P > 0.05). Heartbeats per minute were 110, 110 and 112 in control at 48, 72 and 96 hpf, respectively. Caffeine significantly increased heartbeat - 122 and 136 at 72 and 96 hpf, respectively. Quantitative RT-PCR showed significant up-regulation after caffeine exposure in HSP70 at 72 hpf; in Cyclin G1 at 24, 48 and 72 hpf; and in Bax at 48 and 72 hpf. Significant down-regulation was found in Bcl2 at 48 and 72 hpf. The Bax/Bcl2 ratio increased significantly at 48 and 72 hpf. We conclude that increasing exposure time to caffeine stimulates oxidative stress and may trigger apoptosis via a mitochondrial-dependent pathway. Also caffeine increases heartbeat from early phases of development without affecting the morphology and survival but delays hatching. Use of caffeine during pregnancy and lactation may harm the fetus by affecting the expression of cell-damage related genes.

  9. Vibriosis induced by experimental cohabitation in Crassostrea gigas: evidence of early infection and down-expression of immune-related genes.

    PubMed

    De Decker, Sophie; Saulnier, Denis

    2011-02-01

    The understanding of reciprocal interactions between Crassostrea gigas and Vibrio sp., whether these be virulent or avirulent, is vital for the development of methods to improve the health status of cultured oysters. We describe an original non-invasive experimental infection technique using cohabitation, designed to explore these interactions. Using real-time PCR techniques we examined the dynamics of virulent and avirulent Vibrio sp. in oyster hemolymph and tank seawater, and made a parallel study of the expression of four genes involved in oyster immune defense: Cg-BPI, Cg-EcSOD, Cg-IκB, Cg-TIMP. No mortality occurred in control animals, but oysters put in cohabitation for 2-48 h with animals previously infected by two Vibrio pathogens suffered mortalities from 2 to 16 days post-cohabitation. Our results show that virulent Vibrio infect healthy individuals after only 2 h of cohabitation, with values ranging from 4.5 x 10² to 2 x 10⁴ cells ml⁻¹ hemolymph. Simultaneously, an approximate ten-fold increase of the total Vibrio population was observed in control animals, with a 6.6-78.5-fold up-expression of targeted genes. In contrast, oysters exposed to harmful bacteria had mean expression levels strongly down-regulated by a factor of 9.2-29 (depending on the gene) compared with control animals. Although oysters were still found to be infected by virulent Vibrio after 6-48 h of cohabitation, no significant differences were noted when comparing levels of each transcript in control and infected oysters at the same sampling times during this period: the important differences were noted before 6 h cohabitation. Taken together, our data support (1) the hypothesis that virulent Vibrio disturbs the immune response of this invertebrate host both rapidly and significantly, although this occurs specifically during an early and transient period during the first 6 h of cohabitation challenge, and that (2) expression of targeted genes is not correlated with vibriosis

  10. Early-life stress changes expression of GnRH and kisspeptin genes and DNA methylation of GnRH3 promoter in the adult zebrafish brain.

    PubMed

    Khor, Yee Min; Soga, Tomoko; Parhar, Ishwar S

    2016-02-01

    Early-life stress can cause long-term effects in the adulthood such as alterations in behaviour, brain functions and reproduction. DNA methylation is a mechanism of epigenetic change caused by early-life stress. Dexamethasone (DEX) was administered to zebrafish larvae to study its effect on reproductive dysfunction. The level of GnRH2, GnRH3, Kiss1 and Kiss2 mRNAs were measured between different doses of DEX treatment groups in adult zebrafish. Kiss1 and GnRH2 expression were increased in the 200mg/L DEX treated while Kiss2 and GnRH3 mRNA levels were up-regulated in the 2mg/L DEX-treated zebrafish. The up-regulation may be related to programming effect of DEX in the zebrafish larvae, causing overcompensation mechanism to increase the mRNA levels. Furthermore, DEX treatment caused negative impact on the development and maturation of the testes, in particular spermatogenesis. Therefore, immature gonadal development may cause positive feedback by increasing GnRH and Kiss. This indicates that DEX can alter the regulation of GnRH2, GnRH3, Kiss1 and Kiss2 in adult zebrafish, which affects maturation of gonads. Computer analysis of 1.5 kb region upstream of the 5' UTR of Kiss1, Kiss2, GnRH2 and GnRH3 promoter showed that there are putative binding sites of glucocorticoid response element and transcription factors involved in stress response. GnRH3 promoter analysed from pre-optic area, ventral telencephalon and ventral olfactory bulb showed higher methylation at CpG residues located on -1410, -1377 and -1355 between control and 2mg/L DEX-treated groups. Hence, early-life DEX treatment can alter methylation of GnRH3 gene promoter, which subsequently affects gene regulation and reproductive functions.

  11. Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.

    PubMed Central

    Takemura, Yoshihiro; Kuroki, Katsuou; Katou, Masahiro; Kishimoto, Masayuki; Tsuji, Wataru; Nishihara, Eiji; Tamura, Fumio

    2015-01-01

    To better understand the molecular mechanisms related to growth promotion in the early developmental stages of Eustoma grandiflorum (Raf.) Shinn. under end-of-day far-red light (EOD-FR) treatment, we analyzed the leaf transcriptome of treated (EOD) and untreated plants (Cont) by using RNA-seq technology. EOD-FR treatment for only about 2 weeks in regions with limited sunshine during winter resulted in significantly higher internode length between the 3rd and 4th nodes on the main stem in EOD than in Cont. Among the differentially expressed genes (DEGs) related to synthesis or transport of auxin, higher levels of YUCCA (CL6581) and PIN4 (CL6181) were noted after treatment in EOD than in Cont in the leaf. In addition, high expression levels of GA20ox (Unigene11862) related to gibberellin (GA) synthesis and transcription factor bHLH 135 (CL7761) were observed in the stem of EOD, 3 h after treatment. A vertical section of the stem showed that the pith length of cells at the 4th node was longer in EOD than in Cont. Collectively, these results suggested that EOD-FR treatment increased the expression of DEGs related to GA and auxin biosynthesis, bHLH transcription factor, and internodal cell elongation along the longitudinal axis of Eustoma plants. PMID:26642764

  12. Gene expression changes triggered by end-of-day far-red light treatment on early developmental stages of Eustoma grandiflorum (Raf.) Shinn.

    PubMed

    Takemura, Yoshihiro; Kuroki, Katsuou; Katou, Masahiro; Kishimoto, Masayuki; Tsuji, Wataru; Nishihara, Eiji; Tamura, Fumio

    2015-01-01

    To better understand the molecular mechanisms related to growth promotion in the early developmental stages of Eustoma grandiflorum (Raf.) Shinn. under end-of-day far-red light (EOD-FR) treatment, we analyzed the leaf transcriptome of treated (EOD) and untreated plants (Cont) by using RNA-seq technology. EOD-FR treatment for only about 2 weeks in regions with limited sunshine during winter resulted in significantly higher internode length between the 3rd and 4th nodes on the main stem in EOD than in Cont. Among the differentially expressed genes (DEGs) related to synthesis or transport of auxin, higher levels of YUCCA (CL6581) and PIN4 (CL6181) were noted after treatment in EOD than in Cont in the leaf. In addition, high expression levels of GA20ox (Unigene11862) related to gibberellin (GA) synthesis and transcription factor bHLH 135 (CL7761) were observed in the stem of EOD, 3 h after treatment. A vertical section of the stem showed that the pith length of cells at the 4th node was longer in EOD than in Cont. Collectively, these results suggested that EOD-FR treatment increased the expression of DEGs related to GA and auxin biosynthesis, bHLH transcription factor, and internodal cell elongation along the longitudinal axis of Eustoma plants. PMID:26642764

  13. The Zebrafish Homologue of the Human DYT1 Dystonia Gene Is Widely Expressed in CNS Neurons but Non-Essential for Early Motor System Development

    PubMed Central

    Sager, Jonathan J.; Torres, Gonzalo E.; Burton, Edward A.

    2012-01-01

    DYT1 dystonia is caused by mutation of the TOR1A gene, resulting in the loss of a single glutamic acid residue near the carboxyl terminal of TorsinA. The neuronal functions perturbed by TorsinA[ΔE] are a major unresolved issue in understanding the pathophysiology of dystonia, presenting a critical roadblock to developing effective treatments. We identified and characterized the zebrafish homologue of TOR1A, as a first step towards elucidating the functions of TorsinA in neurons, in vivo, using the genetically-manipulable zebrafish model. The zebrafish genome was found to contain a single alternatively-spliced tor1 gene, derived from a common ancestral locus shared with the dual TOR1A and TOR1B paralogues found in tertrapods. tor1 was expressed ubiquitously during early embryonic development and in multiple adult tissues, including the CNS. The 2.1 kb tor1 mRNA encodes Torsin1, which is 59% identical and 78% homologous to human TorsinA. Torsin1 was expressed as major 45 kDa and minor 47 kDa glycoproteins, within the cytoplasm of neurons and neuropil throughout the CNS. Similar to previous findings relating to human TorsinA, mutations of the ATP hydrolysis domain of Torsin1 resulted in relocalization of the protein in cultured cells from the endoplasmic reticulum to the nuclear envelope. Zebrafish embryos lacking tor1 during early development did not show impaired viability, overt morphological abnormalities, alterations in motor behavior, or developmental defects in the dopaminergic system. Torsin1 is thus non-essential for early development of the motor system, suggesting that important CNS functions may occur later in development, consistent with the critical time window in late childhood when dystonia symptoms usually emerge in DYT1 patients. The similarities between Torsin1 and human TorsinA in domain organization, expression pattern, and cellular localization suggest that the zebrafish will provide a useful model to understand the neuronal functions of Torsins

  14. Nonadditive gene expression in polyploids.

    PubMed

    Yoo, Mi-Jeong; Liu, Xiaoxian; Pires, J Chris; Soltis, Pamela S; Soltis, Douglas E

    2014-01-01

    Allopolyploidy involves hybridization and duplication of divergent parental genomes and provides new avenues for gene expression. The expression levels of duplicated genes in polyploids can show deviation from parental additivity (the arithmetic average of the parental expression levels). Nonadditive expression has been widely observed in diverse polyploids and comprises at least three possible scenarios: (a) The total gene expression level in a polyploid is similar to that of one of its parents (expression-level dominance); (b) total gene expression is lower or higher than in both parents (transgressive expression); and (c) the relative contribution of the parental copies (homeologs) to the total gene expression is unequal (homeolog expression bias). Several factors may result in expression nonadditivity in polyploids, including maternal-paternal influence, gene dosage balance, cis- and/or trans-regulatory networks, and epigenetic regulation. As our understanding of nonadditive gene expression in polyploids remains limited, a new generation of investigators should explore additional phenomena (i.e., alternative splicing) and use other high-throughput "omics" technologies to measure the impact of nonadditive expression on phenotype, proteome, and metabolome. PMID:25421600

  15. Early free access to hypertonic NaCl solution induces a long-term effect on drinking, brain cell activity and gene expression of adult rat offspring.

    PubMed

    Macchione, A F; Beas, C; Dadam, F M; Caeiro, X E; Godino, A; Ponce, L F; Amigone, J L; Vivas, L

    2015-07-01

    Exposure to an altered osmotic environment during a pre/postnatal period can differentially program the fluid intake and excretion pattern profile in a way that persists until adulthood. However, knowledge about the programming effects on the underlying brain neurochemical circuits of thirst and hydroelectrolyte balance, and its relation with behavioral outputs, is limited. We evaluated whether early voluntary intake of hypertonic NaCl solution may program adult offspring fluid balance, plasma vasopressin, neural activity, and brain vasopressin and angiotensinergic receptor type 1a (AT1a)-receptor gene expression. The manipulation (M) period covered dams from 1 week before conception until offspring turned 1-month-old. The experimental groups were (i) Free access to hypertonic NaCl solution (0.45 M NaCl), food (0.18% NaCl) and water [M-Na]; and (ii) Free access to food and water only [M-Ctrol]. Male offspring (2-month-old) were subjected to iv infusion (0.15 ml/min) of hypertonic (1.5M NaCl), isotonic (0.15M NaCl) or sham infusion during 20 min. Cumulative water intake (140 min) and drinking latency to the first lick were recorded from the start of the infusion. Our results indicate that, after systemic sodium overload, the M-Na group had increased water intake, and diminished neuronal activity (Fos-immunoreactivity) in the subfornical organ (SFO) and nucleus of the solitary tract. They also showed reduced relative vasopressin (AVP)-mRNA and AT1a-mRNA expression at the supraoptic nucleus and SFO, respectively. The data indicate that the availability of a rich source of sodium during the pre/postnatal period induces a long-term effect on drinking, neural activity, and brain gene expression implicated in the control of hydroelectrolyte balance.

  16. Evolution of Gene Expression after Gene Amplification

    PubMed Central

    Garcia, Nelson; Zhang, Wei; Wu, Yongrui; Messing, Joachim

    2015-01-01

    We took a rather unique approach to investigate the conservation of gene expression of prolamin storage protein genes across two different subfamilies of the Poaceae. We took advantage of oat plants carrying single maize chromosomes in different cultivars, called oat–maize addition (OMA) lines, which permitted us to determine whether regulation of gene expression was conserved between the two species. We found that γ-zeins are expressed in OMA7.06, which carries maize chromosome 7 even in the absence of the trans-acting maize prolamin-box-binding factor (PBF), which regulates their expression. This is likely because oat PBF can substitute for the function of maize PBF as shown in our transient expression data, using a γ-zein promoter fused to green fluorescent protein (GFP). Despite this conservation, the younger, recently amplified prolamin genes in maize, absent in oat, are not expressed in the corresponding OMAs. However, maize can express the oldest prolamin gene, the wheat high-molecular weight glutenin Dx5 gene, even when maize Pbf is knocked down (through PbfRNAi), and/or another maize transcription factor, Opaque-2 (O2) is knocked out (in maize o2 mutant). Therefore, older genes are conserved in their regulation, whereas younger ones diverged during evolution and eventually acquired a new repertoire of suitable transcriptional activators. PMID:25912045

  17. Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication.

    PubMed

    Meier, Jeffery L; Keller, Michael J; McCoy, James J

    2002-01-01

    We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication.

  18. Involvement of EARLY BUD-BREAK, an AP2/ERF Transcription Factor Gene, in Bud Break in Japanese Pear (Pyrus pyrifolia Nakai) Lateral Flower Buds: Expression, Histone Modifications and Possible Target Genes.

    PubMed

    Anh Tuan, Pham; Bai, Songling; Saito, Takanori; Imai, Tsuyoshi; Ito, Akiko; Moriguchi, Takaya

    2016-05-01

    In the Japanese pear (Pyrus pyrifolia Nakai) 'Kosui', three developmental stages of lateral flower buds have been proposed to occur during ecodormancy to the flowering phase, i.e. rapid enlargement, sprouting and flowering. Here, we report an APETALA2/ethylene-responsive factor (AP2/ERF) transcription factor gene, named pear EARLY BUD-BREAK (PpEBB), which was highly expressed during the rapid enlargement stage occurring prior to the onset of bud break in flower buds. Gene expression analysis revealed that PpEBB expression was dramatically increased during the rapid enlargement stage in three successive growing seasons. PpEBB transcript levels peaked 1 week prior to onset of bud break in 'Kosui' potted plants treated with hydrogen cyanamide or water under forcing conditions. Chromatin immunoprecipitation-quantitative PCR showed that higher levels of active histone modifications (trimethylation of the histone H3 tail at Lys4) in the 5'-upstream and start codon regions of the PpEBB gene were associated with the induced expression level of PpEBB during the rapid enlargement stage. In addition, we provide evidence that PpEBB may interact with and regulate pear four D-type cyclin (PpCYCD3) genes during bud break in 'Kosui' lateral flower buds. PpEBB significantly increased the promoter activities of four PpCYCD3 genes in a dual-luciferase assay using tobacco leaves. Taken together, our findings uncovered aspects of the bud break regulatory mechanism in the Japanese pear and provided further evidence that the EBB family plays an important role in bud break in perennial plants. PMID:26940832

  19. Involvement of EARLY BUD-BREAK, an AP2/ERF Transcription Factor Gene, in Bud Break in Japanese Pear (Pyrus pyrifolia Nakai) Lateral Flower Buds: Expression, Histone Modifications and Possible Target Genes.

    PubMed

    Anh Tuan, Pham; Bai, Songling; Saito, Takanori; Imai, Tsuyoshi; Ito, Akiko; Moriguchi, Takaya

    2016-05-01

    In the Japanese pear (Pyrus pyrifolia Nakai) 'Kosui', three developmental stages of lateral flower buds have been proposed to occur during ecodormancy to the flowering phase, i.e. rapid enlargement, sprouting and flowering. Here, we report an APETALA2/ethylene-responsive factor (AP2/ERF) transcription factor gene, named pear EARLY BUD-BREAK (PpEBB), which was highly expressed during the rapid enlargement stage occurring prior to the onset of bud break in flower buds. Gene expression analysis revealed that PpEBB expression was dramatically increased during the rapid enlargement stage in three successive growing seasons. PpEBB transcript levels peaked 1 week prior to onset of bud break in 'Kosui' potted plants treated with hydrogen cyanamide or water under forcing conditions. Chromatin immunoprecipitation-quantitative PCR showed that higher levels of active histone modifications (trimethylation of the histone H3 tail at Lys4) in the 5'-upstream and start codon regions of the PpEBB gene were associated with the induced expression level of PpEBB during the rapid enlargement stage. In addition, we provide evidence that PpEBB may interact with and regulate pear four D-type cyclin (PpCYCD3) genes during bud break in 'Kosui' lateral flower buds. PpEBB significantly increased the promoter activities of four PpCYCD3 genes in a dual-luciferase assay using tobacco leaves. Taken together, our findings uncovered aspects of the bud break regulatory mechanism in the Japanese pear and provided further evidence that the EBB family plays an important role in bud break in perennial plants.

  20. Serial analysis of gene expression.

    PubMed

    Velculescu, V E; Zhang, L; Vogelstein, B; Kinzler, K W

    1995-10-20

    The characteristics of an organism are determined by the genes expressed within it. A method was developed, called serial analysis of gene expression (SAGE), that allows the quantitative and simultaneous analysis of a large number of transcripts. To demonstrate this strategy, short diagnostic sequence tags were isolated from pancreas, concatenated, and cloned. Manual sequencing of 1000 tags revealed a gene expression pattern characteristic of pancreatic function. New pancreatic transcripts corresponding to novel tags were identified. SAGE should provide a broadly applicable means for the quantitative cataloging and comparison of expressed genes in a variety of normal, developmental, and disease states. PMID:7570003

  1. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis.

    PubMed

    Kubík, Stěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena - Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  2. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis

    PubMed Central

    Kubík, Štěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena – Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  3. Early changes in pulmonary gene expression following tobacco exposure shed light on the role of estrogen metabolism in lung carcinogenesis.

    PubMed

    Siegfried, Jill M

    2010-06-01

    This perspective on Meireles et al. (beginning on p. 707 in this issue of the journal) discusses the increasing evidence for the role of female steroid hormones in lung cancer development and progression. The novel work of Meireles et al. is the first evidence for the rapid upregulation by tobacco smoke of a key cytochrome P450 gene that can metabolize estrogens such as beta-estradiol to potentially carcinogenic catechol and quinine forms, as well as the first evidence for the colocalization of beta-estradiol and estrogen receptors in murine airway epithelium. Actions of estrogens that contribute to lung carcinogenesis, especially in the presence of tobacco smoke, may involve both reactive intermediates that damage DNA and steroid hormone receptor signaling that promotes growth.

  4. Differential expression of transcriptional regulatory units in the prefrontal cortex of patients with bipolar disorder: potential role of early growth response gene 3

    PubMed Central

    Pfaffenseller, B; da Silva Magalhães, P V; De Bastiani, M A; Castro, M A A; Gallitano, A L; Kapczinski, F; Klamt, F

    2016-01-01

    Bipolar disorder (BD) is a severe mental illness with a strong genetic component. Despite its high degree of heritability, current genetic studies have failed to reveal individual loci of large effect size. In lieu of focusing on individual genes, we investigated regulatory units (regulons) in BD to identify candidate transcription factors (TFs) that regulate large groups of differentially expressed genes. Network-based approaches should elucidate the molecular pathways governing the pathophysiology of BD and reveal targets for potential therapeutic intervention. The data from a large-scale microarray study was used to reconstruct the transcriptional associations in the human prefrontal cortex, and results from two independent microarray data sets to obtain BD gene signatures. The regulatory network was derived by mapping the significant interactions between known TFs and all potential targets. Five regulons were identified in both transcriptional network models: early growth response 3 (EGR3), TSC22 domain family, member 4 (TSC22D4), interleukin enhancer-binding factor 2 (ILF2), Y-box binding protein 1 (YBX1) and MAP-kinase-activating death domain (MADD). With a high stringency threshold, the consensus across tests was achieved only for the EGR3 regulon. We identified EGR3 in the prefrontal cortex as a potential key target, robustly repressed in both BD signatures. Considering that EGR3 translates environmental stimuli into long-term changes in the brain, disruption in biological pathways involving EGR3 may induce an impaired response to stress and influence on risk for psychiatric disorders, particularly BD. PMID:27163206

  5. Early energy and protein reduction: effects on growth, blood profiles and expression of genes related to protein and fat metabolism in broilers.

    PubMed

    Yang, Y X; Guo, J; Yoon, S Y; Jin, Z; Choi, J Y; Piao, X S; Kim, B W; Ohh, S J; Wang, M H; Chae, B J

    2009-03-01

    1. A total of 320-d-old Ross broilers were used in a 6-week study to investigate the effects of feeding lower energy and protein diets from d 8 to 14 on growth performance, blood profiles, and gene expression of leptin and myostatin. 2. Broilers were randomly allotted to 4 treatments, each treatment applied to 4 pens with 20 birds in each. During first week, all the birds were fed on a common starter diet (13.4 MJ ME/kg, 230 g/kg CP and 11.0 g/kg lysine). The birds were then subjected to their respective treatment diets from d 8 to 14. Treatment diets comprised two ME levels, 13.4 and 12.0 MJ/kg, each with two levels of CP, 230 and 184 g/kg. This was followed by feeding common starter and finisher diets for the last 4 weeks. 3. Dietary protein reduction resulted in poor performance and feed efficiency while energy reduction resulted in poor feed efficiency between d 8 and 14. From d 14 to 42 birds previously fed diets lower in energy and protein showed similar body weight gain and feed intake to well-fed birds. Moreover from d 8 to 14, birds fed on energy and protein-reduced diets had lower nutrient metabolisability coefficients. 4. The blood urea nitrogen (BUN) and relative weights of heart and breast muscle were lower in birds fed protein-reduced diets while energy reduction resulted in lower plasma glucose, abdominal fat and intestinal weight at d 14. At d 42, birds fed on the protein-reduced diets had lower BUN, breast muscle weight and small intestine length, while feeding on the energy-reduced diets resulted in lower abdominal fat. 5. Upregulated myostatin mRNA expression in breast muscle and downregulation of leptin mRNA expression in abdominal fat were observed in birds fed on protein and energy-reduced diets, respectively. 6. In conclusion, early nutrient reduction affected growth performance and produced lesser abdominal fat in broilers. Moreover, early energy and/or protein reduction could change muscle and fat metabolism by regulating the expressions of

  6. Method of controlling gene expression

    DOEpatents

    Peters, Norman K.; Frost, John W.; Long, Sharon R.

    1991-12-03

    A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

  7. The dopamine uptake inhibitor 3 alpha-[bis(4'-fluorophenyl)metoxy]-tropane reduces cocaine-induced early-gene expression, locomotor activity, and conditioned reward.

    PubMed

    Velázquez-Sánchez, Clara; Ferragud, Antonio; Hernández-Rabaza, Vicente; Nácher, Amparo; Merino, Virginia; Cardá, Miguel; Murga, Juan; Canales, Juan J

    2009-11-01

    Benztropine (BZT) analogs, a family of high-affinity dopamine transporter ligands, are molecules that exhibit pharmacological and behavioral characteristics predictive of significant therapeutic potential in cocaine addiction. Here, we examined in mice the effects of 3 alpha-[bis(4'-fluorophenyl)metoxy]-tropane (AHN-1055) on motor activity, conditioned place preference (CPP) and c-Fos expression in the striatum. AHN-1055 produced mild attenuation of spontaneous locomotor activity at a low dose (1 mg/kg) and weak stimulation at a higher dose (10 mg/kg). In parallel, the BZT analog significantly increased c-Fos expression in the dorsolateral caudoputamen at the high dose, whereas producing marginal decreases at low and moderate doses (1, 3 mg/kg) in both dorsal and ventral striatum. Interaction assays showed that cocaine's ability to stimulate locomotor activity was decreased by AHN-1055 treatment, but not by treatment with D-amphetamine. Such reduced ability did not result from an increase in stereotyped behavior. Another dopamine uptake inhibitor, nomifensine, decreased cocaine-induced locomotor activity but evoked by itself intense motor stereotypies. Remarkably, the BZT analog dose-dependently blocked cocaine-induced CPP without producing CPP when given alone, and blocked in conditioned mice cocaine-stimulated early-gene activation in the nucleus accumbens and dorsomedial striatum. These observations provide evidence that AHN-1055 does not behave as a classical psychomotor stimulant and that some of its properties, including attenuation of cocaine-induced striatal c-Fos expression, locomotor stimulation, and CPP, support its candidacy, and that of structurally related molecules, as possible pharmacotherapies in cocaine addiction.

  8. Prenatal exposure to moderate levels of ethanol alters social behavior in adult rats: Relationship to structural plasticity and immediate early gene expression in frontal cortex

    PubMed Central

    Hamilton, Derek A.; Akers, Katherine G.; Rice, James P.; Johnson, Travis E.; Candelaria-Cook, Felicha T.; Maes, Levi I.; Rosenberg, Martina; Valenzuela, C. Fernando; Savage, Daniel D.

    2009-01-01

    The goals of the present study were to characterize the effects of prenatal exposure to moderate levels of ethanol on adult social behavior, and to evaluate fetal-ethanol-related effects on dendritic morphology, structural plasticity and activity-related immediate early gene (IEG) expression in the agranular insular (AID) and prelimbic (Cg3) regions of frontal cortex. Baseline fetal-ethanol-related alterations in social behavior were limited to reductions in social investigation in males. Repeated experience with novel cage-mates resulted in comparable increases in wrestling and social investigation among saccharin- and ethanol-exposed females, whereas social behavioral effects among males were more evident in ethanol-exposed animals. Male ethanol-exposed rats also displayed profound increases in wrestling when social interaction was motivated by 24 hours of isolation. Baseline decreases in dendritic length and spine density in AID were observed in ethanol-exposed rats that were always housed with the same cage-mate. Modest experience-related decreases in dendritic length and spine density in AID were observed in saccharin-exposed rats housed with various cage-mates. In contrast, fetal-ethanol-exposed rats displayed experience-related increases in dendritic length in AID, and no experience-related changes in spine density. The only effect observed in Cg3 was a baseline increase in basilar dendritic length among male ethanol-exposed rats. Robust increases in activity-related IEG expression in AID (c-fos and Arc) and Cg3 (c-fos) were observed following social interaction in saccharin-exposed rats, however, activity-related increases in IEG expression were not observed in fetal-ethanol-exposed rats in either region. The results indicate that deficits in social behavior are among the long-lasting behavioral consequences of moderate ethanol exposure during brain development, and implicate AID, and to a lesser degree Cg3, in fetal-ethanol-related social behavior

  9. The dopamine uptake inhibitor 3 alpha-[bis(4'-fluorophenyl)metoxy]-tropane reduces cocaine-induced early-gene expression, locomotor activity, and conditioned reward.

    PubMed

    Velázquez-Sánchez, Clara; Ferragud, Antonio; Hernández-Rabaza, Vicente; Nácher, Amparo; Merino, Virginia; Cardá, Miguel; Murga, Juan; Canales, Juan J

    2009-11-01

    Benztropine (BZT) analogs, a family of high-affinity dopamine transporter ligands, are molecules that exhibit pharmacological and behavioral characteristics predictive of significant therapeutic potential in cocaine addiction. Here, we examined in mice the effects of 3 alpha-[bis(4'-fluorophenyl)metoxy]-tropane (AHN-1055) on motor activity, conditioned place preference (CPP) and c-Fos expression in the striatum. AHN-1055 produced mild attenuation of spontaneous locomotor activity at a low dose (1 mg/kg) and weak stimulation at a higher dose (10 mg/kg). In parallel, the BZT analog significantly increased c-Fos expression in the dorsolateral caudoputamen at the high dose, whereas producing marginal decreases at low and moderate doses (1, 3 mg/kg) in both dorsal and ventral striatum. Interaction assays showed that cocaine's ability to stimulate locomotor activity was decreased by AHN-1055 treatment, but not by treatment with D-amphetamine. Such reduced ability did not result from an increase in stereotyped behavior. Another dopamine uptake inhibitor, nomifensine, decreased cocaine-induced locomotor activity but evoked by itself intense motor stereotypies. Remarkably, the BZT analog dose-dependently blocked cocaine-induced CPP without producing CPP when given alone, and blocked in conditioned mice cocaine-stimulated early-gene activation in the nucleus accumbens and dorsomedial striatum. These observations provide evidence that AHN-1055 does not behave as a classical psychomotor stimulant and that some of its properties, including attenuation of cocaine-induced striatal c-Fos expression, locomotor stimulation, and CPP, support its candidacy, and that of structurally related molecules, as possible pharmacotherapies in cocaine addiction. PMID:19606084

  10. Gene expression and fractionation resistance

    PubMed Central

    2014-01-01

    Background Previous work on whole genome doubling in plants established the importance of gene functional category in provoking or suppressing duplicate gene loss, or fractionation. Other studies, particularly in Paramecium have correlated levels of gene expression with vulnerability or resistance to duplicate loss. Results Here we analyze the simultaneous effect of function category and expression in two plant data sets, rosids and asterids. Conclusion We demonstrate function category and expression level have independent effects, though expression does not play the dominant role it does in Paramecium. PMID:25573431

  11. Sleep research in space: expression of immediate early genes in forebrain structures of rats during the nasa neurolab mission (STS-90).

    PubMed

    Centini, C; Pompeiano, O

    2007-05-01

    1. Electrophysiological and behavioural observations have shown that changes in the sleep-waking activity occur in astronauts during the space flight. Experiments performed in ground-based experiments have previously shown that the immediate early gene (IEG) c-fos, a marker of neuronal activation, can be used as a molecular correlate of sleep and waking. However, while Fos expression peaks within 2-4 hours after the stimulus and returns to baseline within 6-8 hours, other IEGs as the FRA proteins which are also synthetized soon after their induction, persist in the cell nuclei for longer periods of time, ranging from 1-2 days to weeks. 2. Both Fos and FRA expression were evaluated in several adult albino rats sacrificed at different time points of the space flight, i.e. either at FD2 and FD14, i.e. at launch and about two weeks after launch, respectively, or at R + 1 and R + 13, i.e. at the reentry and about two weeks after landing. The changes in Fos and FRA expression were then compared with those obtained in ground controls. These experiments demonstrate activation of several brain areas which varies during the different phases of the space flight. Due to their different time of persistence, Fos and FRA immunohistochemistry can provide only correlative observations. In particular, FRA expression has been quite helpful to identify the occurrence of short-lasting events such as those related either to stress or to REM-sleep, whose episodes last in the rat only a few min and could hardly be detected by using only Fos expression. 3. Evidence was presented indicating that at FD2 and FD14 Fos-labeled cells were observed in several brain areas in which Fos had been previously identified as being induced by spontaneous or forced waking in ground-based experiments. In contrast to these findings FLT rats sacrificed at R + 1 showed low levels of Fos immunostaining in the cerebral cortex (neocortex) and several forebrain structures such as the hypothalamus and thalamus

  12. How do women trade-off benefits and risks in chemotherapy treatment decisions based on gene expression profiling for early-stage breast cancer? A discrete choice experiment

    PubMed Central

    Marshall, Deborah A; Deal, Ken; Bombard, Yvonne; Leighl, Natasha; MacDonald, Karen V; Trudeau, Maureen

    2016-01-01

    Objectives Gene expression profiling (GEP) of tumours informs baseline risk prediction, potentially affecting adjuvant chemotherapy decisions for women with early-stage breast cancer. Since only 15% will experience a recurrence, concerns have been raised about potential harms from overtreatment and high GEP costs in publicly funded healthcare systems. We aimed to estimate preferences and personal utility of GEP testing information and benefit–risk trade-offs in chemotherapy treatment decisions. Design, setting and intervention Based on literature review and findings from our qualitative research (focus groups, interviews with patients with breast cancer and medical oncologists), we developed a discrete choice experiment (DCE) survey and administered it via an internet panel. The DCE included 12 choice tasks with 5 attributes and 3 alternatives considering orthogonality, D-efficiency and level balance. Participants The DCE survey was administered to 1004 Canadian women from the general population. Main outcome measures Preferences were analysed using conditional logit and hierarchical Bayes and evaluated for goodness of fit. We conducted simulation analyses for alternative scenarios. Results GEP test score indicating likely benefit from chemotherapy was the most important attribute. Doctor's clinical estimate of the risk of cancer returning, trust in your cancer doctor and side effects of chemotherapy (temporary and permanent) were relatively less important but showed significant differences among levels. In the scenario analyses, 78% were likely to choose chemotherapy in a high-risk scenario, 55% in a moderate-risk scenario and 33% in a low-risk scenario, with the other attributes held constant. A high GEP score was more important in influencing the choice of chemotherapy for those at intermediate clinical risk. Conclusions GEP testing information influences chemotherapy treatment decisions in early-stage breast cancer and varies depending on clinical risk

  13. Perspectives: Gene Expression in Fisheries Management

    USGS Publications Warehouse

    Nielsen, Jennifer L.; Pavey, Scott A.

    2010-01-01

    Functional genes and gene expression have been connected to physiological traits linked to effective production and broodstock selection in aquaculture, selective implications of commercial fish harvest, and adaptive changes reflected in non-commercial fish populations subject to human disturbance and climate change. Gene mapping using single nucleotide polymorphisms (SNPs) to identify functional genes, gene expression (analogue microarrays and real-time PCR), and digital sequencing technologies looking at RNA transcripts present new concepts and opportunities in support of effective and sustainable fisheries. Genomic tools have been rapidly growing in aquaculture research addressing aspects of fish health, toxicology, and early development. Genomic technologies linking effects in functional genes involved in growth, maturation and life history development have been tied to selection resulting from harvest practices. Incorporating new and ever-increasing knowledge of fish genomes is opening a different perspective on local adaptation that will prove invaluable in wild fish conservation and management. Conservation of fish stocks is rapidly incorporating research on critical adaptive responses directed at the effects of human disturbance and climate change through gene expression studies. Genomic studies of fish populations can be generally grouped into three broad categories: 1) evolutionary genomics and biodiversity; 2) adaptive physiological responses to a changing environment; and 3) adaptive behavioral genomics and life history diversity. We review current genomic research in fisheries focusing on those that use microarrays to explore differences in gene expression among phenotypes and within or across populations, information that is critically important to the conservation of fish and their relationship to humans.

  14. Absence of an essential regulatory influence of the adenovirus E1B 19-kilodalton protein on viral growth and early gene expression in human diploid WI38, HeLa, and A549 cells.

    PubMed Central

    Telling, G C; Perera, S; Szatkowski-Ozers, M; Williams, J

    1994-01-01

    Mutations in the gene encoding the adenovirus (Ad) early region 1B 19-kDa protein (the 19K gene) result in multiple phenotypic effects upon infection of permissive human cells. It has been reported, for example, that Ad type 2 (Ad2) and Ad5 with mutations in the 19K gene (19K-defective mutants) have a marked growth advantage compared with wild-type virus in human diploid WI38 cells (E. White, B. Faha, and B. Stillman, Mol. Cell. Biol. 6:3763-3773, 1986), and it was proposed that this host range phenotype stems from the large increase in viral early gene expression reported to occur in the mutant-infected cells. These observations gave rise to the hypothesis that the 19-kDa protein (the 19K protein) normally functions as a negative regulator of Ad early gene expression and growth. We have tested this hypothesis and find that Ad5 and Ad12 wild-type viruses grow as efficiently as their respective 19K-defective mutants, in1 and dl337 and pm700 and in700, in WI38 and other human cell types. Neither the accumulation of E1A cytoplasmic mRNAs nor the synthesis of E1A and other viral early proteins in these cells is altered as a result of these mutations in the 19K gene, and we conclude that the 19K protein does not play an essential role in regulating viral early gene expression or viral growth in human cells. Images PMID:8254769

  15. Expression of interferon (IFN)-stimulated genes in extrauterine tissues during early pregnancy in sheep is the consequence of endocrine IFN-tau release from the uterine vein.

    PubMed

    Oliveira, João F; Henkes, Luiz E; Ashley, Ryan L; Purcell, Scott H; Smirnova, Natalia P; Veeramachaneni, D N Rao; Anthony, Russell V; Hansen, Thomas R

    2008-03-01

    The ruminant conceptus synthesizes and secretes interferon (IFN)-tau, which presumably acts via an intrauterine paracrine mechanism to signal maternal recognition of pregnancy. The aims of this study were to determine whether IFN-stimulated genes (ISG) such as ISG15 and OAS-1 are differentially expressed in blood cells circulating in the uterus of ewes; whether extrauterine components of the reproductive tract such as the corpus luteum (CL) also express mRNA for these ISG, and whether antiviral activity is greater in uterine vein than in uterine artery during early pregnancy. The concentrations of mRNA for both ISG were significantly greater (P < 0.0001) in endometrium and jugular blood of 15-d pregnant ewes than in nonpregnant ewes. ISG15 and OAS-1 mRNA concentrations were also greater (P < 0.05) in CL from 15-d pregnant ewes than in nonpregnant ewes. Immunohistochemistry revealed intense staining for ISG15 in large luteal cells on d 15 of pregnancy. Blood cells from uterine artery and vein of 15-d pregnant ewes had similar ISG15 and OAS-1 mRNA concentrations, suggesting that these cells were not conditioned by IFN-tau within the uterus. By using an antiviral assay, uterine venous blood was found to contain 500- to 1000-fold higher concentrations of bioactive IFN-tau than in uterine arterial blood on d 15 of pregnancy. It is concluded that uterine vein releases IFN-tau, which induces ISG in extrauterine tissues such as the CL during the time of maternal recognition of pregnancy.

  16. Effects of Valproic Acid and Dexamethasone Administration on Early Bio-Markers and Gene Expression Profile in Acute Kidney Ischemia-Reperfusion Injury in the Rat

    PubMed Central

    Speir, Ryan W.; Stallings, Jonathan D.; Andrews, Jared M.; Gelnett, Mary S.; Brand, Timothy C.; Salgar, Shashikumar K.

    2015-01-01

    Renal ischemia-reperfusion (IR) causes acute kidney injury (AKI) with high mortality and morbidity. The objective of this investigation was to ameliorate kidney IR injury and identify novel biomarkers for kidney injury and repair. Under general anesthesia, left renal ischemia was induced in Wister rats by occluding renal artery for 45 minutes, followed by reperfusion and right nephrectomy. Thirty minutes prior to ischemia, rats (n = 8/group) received Valproic Acid (150 mg/kg; VPA), Dexamethasone (3 mg/kg; Dex) or Vehicle (saline) intraperitoneally. Animals were sacrificed at 3, 24 or 120 h post-IR. Plasma creatinine (mg/dL) at 24 h was reduced (P<0.05) in VPA (2.7±1.8) and Dex (2.3±1.2) compared to Vehicle (3.8±0.5) group. At 3 h, urine albumin (mg/mL) was higher in Vehicle (1.47±0.10), VPA (0.84±0.62) and Dex (1.04±0.73) compared to naïve (uninjured/untreated control) (0.14±0.26) group. At 24 h post-IR urine lipocalin-2 (μg/mL) was higher (P<0.05) in VPA, Dex and Vehicle groups (9.61–11.36) compared to naïve group (0.67±0.29); also, kidney injury molecule-1 (KIM-1; ng/mL) was higher (P<0.05) in VPA, Dex and Vehicle groups (13.7–18.7) compared to naïve group (1.7±1.9). Histopathology demonstrated reduced (P<0.05) ischemic injury in the renal cortex in VPA (Grade 1.6±1.5) compared to Vehicle (Grade 2.9±1.1). Inflammatory cytokines IL1β and IL6 were downregulated and anti-apoptotic molecule BCL2 was upregulated in VPA group. Furthermore, kidney DNA microarray demonstrated reduced injury, stress, and apoptosis related gene expression in the VPA administered rats. VPA appears to ameliorate kidney IR injury via reduced inflammatory cytokine, apoptosis/stress related gene expression, and improved regeneration. KIM-1, lipocalin-2 and albumin appear to be promising early urine biomarkers for the diagnosis of AKI. PMID:25970334

  17. Regulation of Neuronal Gene Expression

    NASA Astrophysics Data System (ADS)

    Thiel, Gerald; Lietz, Michael; Leichter, Michael

    Humans as multicellular organisms contain a variety of different cell types where each cell population must fulfill a distinct function in the interest of the whole organism. The molecular basis for the variations in morphology, biochemistry, molecular biology, and function of the various cell types is the cell-type specific expression of genes. These genes encode proteins necessary for executing the specialized functions of each cell type within an organism. We describe here a regulatory mechanism for the expression of neuronal genes. The zinc finger protein REST binds to the regulatory region of many neuronal genes and represses neuronal gene expression in nonneuronal tissues. A negative regulatory mechanism, involving a transcriptional repressor, seems to play an important role in establishing the neuronal phenotype.

  18. Prognostic Significance of ESR1 Gene Amplification, mRNA/Protein Expression and Functional Profiles in High-Risk Early Breast Cancer: A Translational Study of the Hellenic Cooperative Oncology Group (HeCOG)

    PubMed Central

    Pentheroudakis, George; Kotoula, Vassiliki; Eleftheraki, Anastasia G.; Tsolaki, Eleftheria; Wirtz, Ralph M.; Kalogeras, Konstantine T.; Batistatou, Anna; Bobos, Mattheos; Dimopoulos, Meletios A.; Timotheadou, Eleni; Gogas, Helen; Christodoulou, Christos; Papadopoulou, Kyriaki; Efstratiou, Ioannis; Scopa, Chrisoula D.; Papaspyrou, Irene; Vlachodimitropoulos, Dimitrios; Linardou, Helena; Samantas, Epaminontas; Pectasides, Dimitrios; Pavlidis, Nicholas; Fountzilas, George

    2013-01-01

    Background Discrepant data have been published on the incidence and prognostic significance of ESR1 gene amplification in early breast cancer. Patients and Methods Formalin-fixed paraffin-embedded tumor blocks were collected from women with early breast cancer participating in two HeCOG adjuvant trials. Messenger RNA was studied by quantitative PCR, ER protein expression was centrally assessed using immunohistochemistry (IHC) and ESR1 gene copy number by dual fluorescent in situ hybridization probes. Results In a total of 1010 women with resected node-positive early breast adenocarcinoma, the tumoral ESR1/CEP6 gene ratio was suggestive of deletion in 159 (15.7%), gene gain in 551 (54.6%) and amplification in 42 cases (4.2%), with only 30 tumors (3%) harboring five or more ESR1 copies. Gene copy number ratio showed a significant, though weak correlation to mRNA and protein expression (Spearman's Rho <0.23, p = 0.01). ESR1 clusters were observed in 9.5% (57 gain, 38 amplification) of cases. In contrast to mRNA and protein expression, which were favorable prognosticators, gene copy number changes did not obtain prognostic significance. When ESR1/CEP6 gene ratio was combined with function (as defined by ER protein and mRNA expression) in a molecular classifier, the Gene Functional profile, it was functional status that impacted on prognosis. In univariate analysis, patients with functional tumors (positive ER protein expression and gene ratio normal or gain/amplification) fared better than those with non-functional tumors with ESR1 gain (HR for relapse or death 0.49–0.64, p = 0.003). Significant interactions were observed between gene gain/amplification and paclitaxel therapy (trend for DFS benefit from paclitaxel only in patients with ESR1 gain/amplification, p = 0.066) and Gene Functional profile with HER2 amplification (Gene Functional profile prognostic only in HER2-normal cases, p = 0.029). Conclusions ESR1 gene deletion and amplification do not

  19. Morphological and Gene Expression Changes in Cattle Embryos from Hatched Blastocyst to Early Gastrulation Stages after Transfer of In Vitro Produced Embryos

    PubMed Central

    van Leeuwen, Jessica; Berg, Debra K.; Pfeffer, Peter L.

    2015-01-01

    A detailed morphological staging system for cattle embryos at stages following blastocyst hatching and preceding gastrulation is presented here together with spatiotemporal mapping of gene expression for BMP4, BRACHYURY, CERBERUS1 (CER1), CRIPTO, EOMESODERMIN, FURIN and NODAL. Five stages are defined based on distinct developmental events. The first of these is the differentiation of the visceral hypoblast underlying the epiblast, from the parietal hypoblast underlying the mural trophoblast. The second concerns the formation of an asymmetrically positioned, morphologically recognisable region within the visceral hypoblast that is marked by the presence of CER1 and absence of BMP4 expression. We have termed this the anterior visceral hypoblast or AVH. Intra-epiblast cavity formation and the disappearance of the polar trophoblast overlying the epiblast (Rauber’s layer) have been mapped in relation to AVH formation. The third chronological event involves the transition of the epiblast into the embryonic ectoderm with concomitant onset of posterior NODAL, EOMES and BRACHYURY expression. Lastly, gastrulation commences as the posterior medial embryonic ectoderm layer thickens to form the primitive streak and cells ingress between the embryonic ectoderm and hypoblast. At this stage a novel domain of CER1 expression is seen whereas the AVH disappears. Comparison with the mouse reveals that while gene expression patterns at the onset of gastrulation are well conserved, asymmetry establishment, which relies on extraembryonic tissues such as the hypoblast and trophoblast, has diverged in terms of both gene expression and morphology. PMID:26076128

  20. Early expansion and expression of the lipopolysaccharide (LPS)-induced TNF-α factor (LITAF) gene family in the LPS-exposed monogonont rotifer Brachionus koreanus.

    PubMed

    Jeong, Chang-Bum; Lee, Jeong-Hyeon; Lee, Jae-Seong; Rhee, Jae-Sung

    2015-10-01

    To date, a single lipopolysaccharide-induced TNF-α factor (LITAF) homologue, mediating the expression of inflammatory cytokines including TNF-α in terms of host defense was identified in vertebrates and most invertebrates such as insects, mollusks, and crustaceans. However, LITAF gene family members have recently been characterized in only two mollusks, Crassostrea gigas and Mytilus galloprovincialis. Although a large gene family expansion of LITAF homologues was observed in the nematode Caenorhabditis elegans, the amino acid sequences encoded by the C. elegans LITAF homologue have low similarities to other LITAF gene family members. In this study, three LITAF genes were identified in the monogonont rotifer Brachionus koreanus. In silico analyses of B. koreanus LITAF genes of conserved domains and phylogenetic relationships supported gene annotations that indicated that LITAF is involved in innate immunity in primitive rotifers. To examine transcriptional sensitivity of B. koreanus LITAF genes, the rotifers were exposed to different concentrations of lipopolysaccharide (LPS). Transcriptional levels of LITAF1 and LITAF2 gene were significantly upregulated dose- and time-dependently in response to LPS exposure for 24 h. LPS exposure induced glutathione (GSH) depletion and antioxidant enzyme activity levels for 24 h in B. koreanus. These results suggested that the B. koreanus LITAF gene family has potential sensitivities directly and/or indirectly to immune stimulator-triggered oxidative stress.

  1. Cytotoxicity of probiotics from Philippine commercial dairy products on cancer cells and the effect on expression of cfos and cjun early apoptotic-promoting genes and Interleukin-1 β and Tumor Necrosis Factor-α proinflammatory cytokine genes.

    PubMed

    Shyu, Peter T; Oyong, Glenn G; Cabrera, Esperanza C

    2014-01-01

    This study determined cytotoxicity of probiotic Lactobacillus spp. from Philippine dairy products on cancer cells and normal fibroblasts and their effects on expression of early apoptotic-promoting cfos, cjun and proinflammatory cytokine IL-1β, TNF-α genes. Cultures were from Yakult, Bear Brand Probiotic Drink, Nido3+ Powdered Milk. Filter-sterilized supernatants from cultures of Lactobacillus spp. were evaluated for cytotoxicity to colon cancer cells (HT-29 and HCT116), leukemia cells (THP-1), and normal human dermal fibroblasts (HDFn) using PrestoBlue. Bleomycin was the positive control. Absolute quantification of transcript levels was conducted using qRT-PCR. Cytotoxicity index profiles on HDFn, THP-1 of all probiotic supernatants and negative controls suggest nontoxicity to the cells when compared to bleomycin, whereas all probiotic supernatants were found to be cytotoxic to HT-29 and HCT-116 colon cancer cell lines. Expression of cfos, cjun transcripts was significantly upregulated in HT-29 and HCT116 cells treated with probiotic supernatants compared to untreated baseline levels (P < 0.05). Expression of IL-1β and TNF-α by lipopolysaccharide-treated macrophages was significantly downregulated in cells with probiotic supernatants compared to those exposed to MRS medium (P < 0.05). Results provide strong support for the role of Lactobacillus spp. studied in anticancer therapy and in prevention of inflammation that may act as precursor to carcinogenesis.

  2. Cytotoxicity of probiotics from Philippine commercial dairy products on cancer cells and the effect on expression of cfos and cjun early apoptotic-promoting genes and Interleukin-1 β and Tumor Necrosis Factor-α proinflammatory cytokine genes.

    PubMed

    Shyu, Peter T; Oyong, Glenn G; Cabrera, Esperanza C

    2014-01-01

    This study determined cytotoxicity of probiotic Lactobacillus spp. from Philippine dairy products on cancer cells and normal fibroblasts and their effects on expression of early apoptotic-promoting cfos, cjun and proinflammatory cytokine IL-1β, TNF-α genes. Cultures were from Yakult, Bear Brand Probiotic Drink, Nido3+ Powdered Milk. Filter-sterilized supernatants from cultures of Lactobacillus spp. were evaluated for cytotoxicity to colon cancer cells (HT-29 and HCT116), leukemia cells (THP-1), and normal human dermal fibroblasts (HDFn) using PrestoBlue. Bleomycin was the positive control. Absolute quantification of transcript levels was conducted using qRT-PCR. Cytotoxicity index profiles on HDFn, THP-1 of all probiotic supernatants and negative controls suggest nontoxicity to the cells when compared to bleomycin, whereas all probiotic supernatants were found to be cytotoxic to HT-29 and HCT-116 colon cancer cell lines. Expression of cfos, cjun transcripts was significantly upregulated in HT-29 and HCT116 cells treated with probiotic supernatants compared to untreated baseline levels (P < 0.05). Expression of IL-1β and TNF-α by lipopolysaccharide-treated macrophages was significantly downregulated in cells with probiotic supernatants compared to those exposed to MRS medium (P < 0.05). Results provide strong support for the role of Lactobacillus spp. studied in anticancer therapy and in prevention of inflammation that may act as precursor to carcinogenesis. PMID:25276792

  3. Effects of nutrient restriction of bovine dams during early gestation on postnatal growth, carcass and organ characteristics, and gene expression in adipose tissue and muscle.

    PubMed

    Long, N M; Prado-Cooper, M J; Krehbiel, C R; DeSilva, U; Wettemann, R P

    2010-10-01

    Angus x Hereford heifers (15 mo and artificially inseminated to a single sire) were used to evaluate the effect of prenatal nutritional restriction on postnatal growth and development. At d 32 of gestation, dams were stratified by BW and BCS and allotted to a low-nutrition [55% of NRC (1996) requirements, n = 10] or moderate-nutrition [100% of NRC (1996) requirements, n = 10] diet. After 83 d of feeding, dams were commingled and received a diet in excess of requirements. Dams were allowed to calve naturally, and birth weights and growth of calves were recorded. Bulls were castrated at birth. Steers (16 mo of age, 5 per treatment) received a high-concentrate diet ad libitum to a constant age (88 ± 1 wk). Steers were slaughtered and weights of the empty body and organs were recorded. Samples of organs, muscle (complexus), and perirenal and subcutaneous adipose tissue were stored at -80 degrees C, and then DNA and protein concentrations were quantified and expression of genes associated with fatty acid metabolism and glucose uptake were measured in adipose and muscle tissue. Dams had similar (P > 0.33) BW and BCS at the beginning of the experiment. At the end of restriction, dams on the low-nutrition diet weighed less (P ≤ 0.01) and had less BCS (P < 0.001) than those on the moderate-nutrition diet. Length of gestation was 274 ± 2 d for dams in the low-nutrition treatment and 278 ± 2 d (P = 0.05) for dams in the moderate-nutrition treatment. Nutrient restriction during gestation did not influence birth weight or postnatal growth of calves. Lungs and trachea of steers whose dams were fed the low-nutrition diet weighed less (P = 0.05) at slaughter than those of steers whose dams were fed the moderate-nutrition diet; weights of other organs were not influenced by treatment. Complexus muscle from steers whose dams were fed the low-nutrition diet had a greater (P = 0.04) concentration of DNA and larger muscle fiber area compared with steers whose dams were fed the

  4. Identification and expression analysis of genes associated with the early berry development in the seedless grapevine (Vitis vinifera L.) cultivar Sultanine.

    PubMed

    Costenaro-da-Silva, Danielle; Passaia, Gisele; Henriques, João A P; Margis, Rogério; Pasquali, Giancarlo; Revers, Luís F

    2010-11-01

    Sultanine grapevine (Vitis vinifera L.) is one of the most important commercial seedless table-grape varieties and the main source of seedlessness for breeding programs around the world. Despite its commercial relevance, little is known about the genetic control of seedlessness in grapes, remaining unknown the molecular identity of genes responsible for such phenotype. Actually, studies concerning berry development in seedless grapes are scarce at the molecular level. We therefore developed a representational difference analysis (RDA) modified method named Bulk Representational Analysis of Transcripts (BRAT) in the attempt to identify genes specifically associated with each of the main developmental stages of Sultanine grapevine berries. A total of 2400 transcript-derived fragments (TDFs) were identified and cloned by RDA according to three specific developmental berry stages. After sequencing and in silico analysis, 1554 (64.75%) TDFs were validated according to our sequence quality cut-off. The assembly of these expressed sequence tags (ESTs) yielded 504 singletons and 77 clusters, with an overall EST redundancy of approximately 67%. Amongst all stage-specific cDNAs, nine candidate genes were selected and, along with two reference genes, submitted to a deeper analysis of their temporal expression profiles by reverse transcription-quantitative PCR. Seven out of nine genes proved to be in agreement with the stage-specific expression that allowed their isolation by RDA. PMID:21802609

  5. Gene networks controlling early cerebral cortex arealization.

    PubMed

    Mallamaci, Antonello; Stoykova, Anastassia

    2006-02-01

    Early thalamus-independent steps in the process of cortical arealization take place on the basis of information intrinsic to the cortical primordium, as proposed by Rakic in his classical protomap hypothesis [Rakic, P. (1988)Science, 241, 170-176]. These steps depend on a dense network of molecular interactions, involving genes encoding for diffusible ligands which are released around the borders of the cortical field, and transcription factor genes which are expressed in graded ways throughout this field. In recent years, several labs worldwide have put considerable effort into identifying members of this network and disentangling its topology. In this respect, a considerable amount of knowledge has accumulated and a first, provisional description of the network can be delineated. The aim of this review is to provide an organic synthesis of our current knowledge of molecular genetics of early cortical arealization, i.e. to summarise the mechanisms by which secreted ligands and graded transcription factor genes elaborate positional information and trigger the activation of distinctive area-specific morphogenetic programs.

  6. Carcinogen-induced trans activation of gene expression

    SciTech Connect

    Kleinberger, T.; Flint, Y.B.; Blank, M.; Etkin, S.; Lavi, S.

    1988-03-01

    The authors report a new mechanism of carcinogen action by which the expression of several genes was concomitantly enhanced. This mechanism involved the altered activity of cellular factors which modulate the expression of genes under their control. The increased expression was regulated at least in part on the transcriptional level and did not require amplification of the overexpressed genes. This phenomenon was transient; it was apparent as early as 24 h after carcinogen treatment and declined a few days later.

  7. Carcinogen-induced trans activation of gene expression.

    PubMed Central

    Kleinberger, T; Flint, Y B; Blank, M; Etkin, S; Lavi, S

    1988-01-01

    We report a new mechanism of carcinogen action by which the expression of several genes was concomitantly enhanced. This mechanism involved the altered activity of cellular factors which modulate the expression of genes under their control. The increased expression was regulated at least in part on the transcriptional level and did not require amplification of the overexpressed genes. This phenomenon was transient; it was apparent as early as 24 h after carcinogen treatment and declined a few days later. Images PMID:2835673

  8. Evaluation of Selected Borrelia burgdorferi lp54 Plasmid-Encoded Gene Products Expressed during Mammalian Infection as Antigens To Improve Serodiagnostic Testing for Early Lyme Disease.

    PubMed

    Weiner, Zachary P; Crew, Rebecca M; Brandt, Kevin S; Ullmann, Amy J; Schriefer, Martin E; Molins, Claudia R; Gilmore, Robert D

    2015-11-01

    Laboratory testing for the diagnosis of Lyme disease is performed primarily by serologic assays and is accurate for detection beyond the acute stage of the infection. Serodiagnostic assays to detect the early stages of infection, however, are limited in their sensitivity, and improvement is warranted. We analyzed a series of Borrelia burgdorferi proteins known to be induced within feeding ticks and/or during mammalian infection for their utility as serodiagnostic markers against a comprehensive panel of Lyme disease patient serum samples. The antigens were assayed for IgM and IgG reactivity in line immunoblots and separately by enzyme-linked immunosorbent assay (ELISA), with a focus on reactivity against early Lyme disease with erythema migrans (EM), early disseminated Lyme neuroborreliosis, and early Lyme carditis patient serum samples. By IgM immunoblotting, we found that recombinant proteins BBA65, BBA70, and BBA73 reacted with early Lyme EM samples at levels comparable to those of the OspC antigen used in the current IgM blotting criteria. Additionally, these proteins reacted with serum samples from patients with early neuroborreliosis and early carditis, suggesting value in detecting early stages of this disease progression. We also found serological reactivity against recombinant proteins BBA69 and BBA73 with early-Lyme-disease samples using IgG immunoblotting and ELISA. Significantly, some samples that had been scored negative by the Centers for Disease Control and Prevention-recommended 2-tiered testing algorithm demonstrated positive reactivity to one or more of the antigens by IgM/IgG immunoblot and ELISA. These results suggest that incorporating additional in vivo-expressed antigens into the current IgM/IgG immunoblotting tier in a recombinant protein platform assay may improve the performance of early-Lyme-disease serologic testing.

  9. Nutritional regulation of gene expression.

    PubMed

    Cousins, R J

    1999-01-25

    Genes are regulated by complex arrays of response elements that influence the rate of transcription. Nutrients and hormones either act directly to influence these rates or act indirectly through specialized signaling pathways. Metabolites of vitamins A and D, fatty acids, some sterols, and zinc are among the nutrients that influence transcription directly. Components of dietary fiber may influence gene expression indirectly through changes in hormonal signaling, mechanical stimuli, and metabolites produced by the intestinal microflora. In addition, consumption of water-soluble fibers may lead to changes in gene expression mediated through indirect mechanisms that influence transcription rates. In the large intestine, short-chain fatty acids, including butyric acid, are produced by microflora. Butyric acid can indirectly influence gene expression. Some sources of fiber limit nutrient absorption, particularly of trace elements. This could have direct or indirect effects on gene expression. Identification of genes in colonic epithelial cells that are differentially regulated by dietary fiber will be an important step toward understanding the role of dietary factors in colorectal cancer progression.

  10. Keratin gene expression profiles after digit amputation in C57BL/6 vs. regenerative MRL mice imply an early regenerative keratinocyte activated-like state

    PubMed Central

    Cheng, Chia-Ho; Leferovich, John; Zhang, Xiang-Ming; Bedelbaeva, Khamilia; Gourevitch, Dmitri; Hatcher, Cathy J.; Basson, Craig T.; Heber-Katz, Ellen

    2013-01-01

    Mouse strains C57BL/6 (B6) and MRL were studied by whole mouse genome chip microarray analyses of RNA isolated from amputation sites at different times pre- and postamputation at the midsecond phalange of the middle digit. Many keratin genes were highly differentially expressed. All keratin genes were placed into three temporal response classes determined by injury/preinjury ratios. One class, containing only Krt6 and Krt16, were uniquely expressed relative to the other two classes and exhibited different temporal responses in MRL vs. B6. Immunohistochemical staining for Krt6 and Krt16 in tissue sections, including normal digit, flank skin, and small intestine, and from normal and injured ear pinna tissue exhibited staining differences in B6 (low) and MRL (high) that were consistent with the microarray results. Krt10 staining showed no injury-induced differences, consistent with microarray expression. We analyzed Krt6 and Krt16 gene association networks and observed in uninjured tissue several genes with higher expression levels in MRL, but not B6, that were associated with the keratinocyte activated state: Krt6, Krt16, S100a8, S100a9, and Il1b; these data suggest that keratinocytes in the MRL strain, but not in B6, are in an activated state prior to wounding. These expression levels decreased in MRL at all times postwounding but rose in the B6, peaking at day 3. Other keratins significantly expressed in the normal basal keratinocyte state showed no significant strain differences. These data suggest that normal MRL skin is in a keratinocyte activated state, which may provide it with superior responses to wounding. PMID:23512742

  11. Keratin gene expression profiles after digit amputation in C57BL/6 vs. regenerative MRL mice imply an early regenerative keratinocyte activated-like state.

    PubMed

    Cheng, Chia-Ho; Leferovich, John; Zhang, Xiang-Ming; Bedelbaeva, Khamilia; Gourevitch, Dmitri; Hatcher, Cathy J; Basson, Craig T; Heber-Katz, Ellen; Marx, Kenneth A

    2013-06-01

    Mouse strains C57BL/6 (B6) and MRL were studied by whole mouse genome chip microarray analyses of RNA isolated from amputation sites at different times pre- and postamputation at the midsecond phalange of the middle digit. Many keratin genes were highly differentially expressed. All keratin genes were placed into three temporal response classes determined by injury/preinjury ratios. One class, containing only Krt6 and Krt16, were uniquely expressed relative to the other two classes and exhibited different temporal responses in MRL vs. B6. Immunohistochemical staining for Krt6 and Krt16 in tissue sections, including normal digit, flank skin, and small intestine, and from normal and injured ear pinna tissue exhibited staining differences in B6 (low) and MRL (high) that were consistent with the microarray results. Krt10 staining showed no injury-induced differences, consistent with microarray expression. We analyzed Krt6 and Krt16 gene association networks and observed in uninjured tissue several genes with higher expression levels in MRL, but not B6, that were associated with the keratinocyte activated state: Krt6, Krt16, S100a8, S100a9, and Il1b; these data suggest that keratinocytes in the MRL strain, but not in B6, are in an activated state prior to wounding. These expression levels decreased in MRL at all times postwounding but rose in the B6, peaking at day 3. Other keratins significantly expressed in the normal basal keratinocyte state showed no significant strain differences. These data suggest that normal MRL skin is in a keratinocyte activated state, which may provide it with superior responses to wounding.

  12. Hahb-10, a sunflower homeobox-leucine zipper gene, is regulated by light quality and quantity, and promotes early flowering when expressed in Arabidopsis.

    PubMed

    Rueda, Eva C; Dezar, Carlos A; Gonzalez, Daniel H; Chan, Raquel L

    2005-12-01

    Homeodomain-leucine zipper proteins constitute a family of transcription factors found only in plants. Expression patterns of the sunflower homeobox-leucine zipper gene Hahb-10 (Helianthus annuus homeobox-10), that belongs to the HD-Zip II subfamily, were analysed. Northern blots showed that Hahb-10 is expressed primarily in mature leaves, although expression is clearly detectable in younger leaves and also in stems. Considerably higher expression levels were detected in etiolated seedlings compared with light-grown seedlings. Induction of Hahb-10 expression was observed when seedlings were subjected to treatment with gibberellins. Transgenic Arabidopsis thaliana plants that express Hahb-10 under the 35S cauliflower mosaic virus promoter show special phenotypic characteristics such as darker cotyledons and planar leaves. A reduction in the life cycle of about 25% allowing earlier seed collection was also observed, and this phenomenon is clearly related to a shortened flowering time. When the number of plants per pot increased, the difference in developmental rate between transgenic and non-transformed individuals became larger. After gibberellin treatment, the relative difference in life cycle duration was considerably reduced. Several light-regulated genes have been tested as possible target genes of Hahb-10. One of them, PsbS, shows a different response to illumination conditions in transgenic plants compared with the response in wild-type plants while the other genes behave similarly in both genotypes. We propose that Hahb-10 functions in a signalling cascade(s) that control(s) plant responses to light quality and quantity, and may also be involved in gibberellin transduction pathways. PMID:16215272

  13. Barley plants over-expressing the NAC transcription factor gene HvNAC005 show stunting and delay in development combined with early senescence

    PubMed Central

    Christiansen, Michael W.; Matthewman, Colette; Podzimska-Sroka, Dagmara; O’Shea, Charlotte; Lindemose, Søren; Møllegaard, Niels Erik; Holme, Inger B.; Hebelstrup, Kim; Skriver, Karen; Gregersen, Per L.

    2016-01-01

    The plant-specific NAC transcription factors have attracted particular attention because of their involvement in stress responses, senescence, and nutrient remobilization. The HvNAC005 gene of barley encodes a protein belonging to subgroup NAC-a6 of the NAC family. This study shows that HvNAC005 is associated with developmental senescence. It was significantly up-regulated following ABA treatment, supported by ABA-responsive elements in its promoter, but it was not up-regulated during dark-induced senescence. The C-termini of proteins closely related to HvNAC005 showed overall high divergence but also contained conserved short motifs. A serine- and leucine-containing central motif was essential for transcriptional activity of the HvNAC005 C-terminus in yeast. Over-expression of HvNAC005 in barley resulted in a strong phenotype with delayed development combined with precocious senescence. The over-expressing plants showed up-regulation of genes involved with secondary metabolism, hormone metabolism, stress, signalling, development, and transport. Up-regulation of senescence markers and hormone metabolism and signalling genes supports a role of HvNAC005 in the cross field of different hormone and signalling pathways. Binding of HvNAC005 to promoter sequences of putative target genes containing the T[G/A]CGT core motif was shown by direct protein–DNA interactions of HvNAC005 with promoters for two of the up-regulated genes. In conclusion, HvNAC005 was shown to be a strong positive regulator of senescence and so is an obvious target for the fine-tuning of gene expression in future attempts to improve nutrient remobilization related to the senescence process in barley. PMID:27436280

  14. Barley plants over-expressing the NAC transcription factor gene HvNAC005 show stunting and delay in development combined with early senescence.

    PubMed

    Christiansen, Michael W; Matthewman, Colette; Podzimska-Sroka, Dagmara; O'Shea, Charlotte; Lindemose, Søren; Møllegaard, Niels Erik; Holme, Inger B; Hebelstrup, Kim; Skriver, Karen; Gregersen, Per L

    2016-09-01

    The plant-specific NAC transcription factors have attracted particular attention because of their involvement in stress responses, senescence, and nutrient remobilization. The HvNAC005 gene of barley encodes a protein belonging to subgroup NAC-a6 of the NAC family. This study shows that HvNAC005 is associated with developmental senescence. It was significantly up-regulated following ABA treatment, supported by ABA-responsive elements in its promoter, but it was not up-regulated during dark-induced senescence. The C-termini of proteins closely related to HvNAC005 showed overall high divergence but also contained conserved short motifs. A serine- and leucine-containing central motif was essential for transcriptional activity of the HvNAC005 C-terminus in yeast. Over-expression of HvNAC005 in barley resulted in a strong phenotype with delayed development combined with precocious senescence. The over-expressing plants showed up-regulation of genes involved with secondary metabolism, hormone metabolism, stress, signalling, development, and transport. Up-regulation of senescence markers and hormone metabolism and signalling genes supports a role of HvNAC005 in the cross field of different hormone and signalling pathways. Binding of HvNAC005 to promoter sequences of putative target genes containing the T[G/A]CGT core motif was shown by direct protein-DNA interactions of HvNAC005 with promoters for two of the up-regulated genes. In conclusion, HvNAC005 was shown to be a strong positive regulator of senescence and so is an obvious target for the fine-tuning of gene expression in future attempts to improve nutrient remobilization related to the senescence process in barley. PMID:27436280

  15. Transgenic Arabidopsis Gene Expression System

    NASA Technical Reports Server (NTRS)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  16. Zipf's Law in Gene Expression

    NASA Astrophysics Data System (ADS)

    Furusawa, Chikara; Kaneko, Kunihiko

    2003-02-01

    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  17. Neighboring Genes Show Correlated Evolution in Gene Expression.

    PubMed

    Ghanbarian, Avazeh T; Hurst, Laurence D

    2015-07-01

    When considering the evolution of a gene's expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking.

  18. Early gestational gene transfer with targeted ATP7B expression in the liver improves phenotype in a murine model of Wilson's disease.

    PubMed

    Roybal, J L; Endo, M; Radu, A; Gray, L; Todorow, C A; Zoltick, P W; Lutsenko, S; Flake, A W

    2012-11-01

    The ideal gene therapy for metabolical liver disorders would target hepatocytes before the onset of disease and be durable, non-toxic and non-immunogenic. Early gestational gene transfer can achieve such goals. Here, we demonstrate that prenatal gene transfer of human Atp7b reduces liver pathology and improves biochemical markers in Atp7b(-/-) mice, a murine model of Wilson's disease (WD). Following prenatal injection of lentivirus vector containing the human Atp7b gene under the transcriptional control of a liver-specific promoter, the full-length ATP7B was detectable in mouse livers for the entire duration of experiments (20 weeks after birth). In contrast to a marked pathology in non-injected animals, livers from age-matched treated mice consistently demonstrated normal gross and histological morphology. Hepatic copper content was decreased in the majority of treated mice, although remaining copper levels varied. Improvement of hepatic copper metabolism was further apparent from the presence of copper-bound ceruloplasmin in the sera and normalization of the mRNA levels for HMG CoA-reductase. With this approach, the complete loss of copper transport function can be ameliorated, as evident from phenotypical improvement in treated Atp7b(-/-) mice. This study provides proof of principle for in utero gene therapy in WD and other liver-based enzyme deficiencies.

  19. Neighboring Genes Show Correlated Evolution in Gene Expression

    PubMed Central

    Ghanbarian, Avazeh T.; Hurst, Laurence D.

    2015-01-01

    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  20. Vascular gene expression: a hypothesis

    PubMed Central

    Martínez-Navarro, Angélica C.; Galván-Gordillo, Santiago V.; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto

    2013-01-01

    The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a “primitive” vascular tissue (a lycophyte), as well as from others that lack a true vascular tissue (a bryophyte), and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non-vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT, and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants. PMID:23882276

  1. Differential modulation of expression of nuclear receptor mediated genes by tris(2-butoxyethyl) phosphate (TBOEP) on early life stages of zebrafish (Danio rerio).

    PubMed

    Ma, Zhiyuan; Yu, Yijun; Tang, Song; Liu, Hongling; Su, Guanyong; Xie, Yuwei; Giesy, John P; Hecker, Markus; Yu, Hongxia

    2015-12-01

    As one substitute for phased-out brominated flame retardants (BFRs), tris(2-butoxyethyl) phosphate (TBOEP) is frequently detected in aquatic organisms. However, knowledge about endocrine disrupting mechanisms associated with nuclear receptors caused by TBOEP remained restricted to results from in vitro studies with mammalian cells. In the study, results of which are presented here, embryos/larvae of zebrafish (Danio rerio) were exposed to 0.02, 0.1 or 0.5μM TBOEP to investigate expression of genes under control of several nuclear hormone receptors (estrogen receptors (ERs), androgen receptor (AR), thyroid hormone receptor alpha (TRα), mineralocorticoid receptor (MR), glucocorticoid receptor (GR), aryl hydrocarbon (AhR), peroxisome proliferator-activated receptor alpha (PPARα), and pregnane×receptor (P×R)) pathways at 120hpf. Exposure to 0.5μM TBOEP significantly (p<0.05, one-way analysis of variance) up-regulated expression of estrogen receptors (ERs, er1, er2a, and er2b) genes and ER-associated genes (vtg4, vtg5, pgr, ncor, and ncoa3), indicating TBOEP modulates the ER pathway. In contrast, expression of most genes (mr, 11βhsd, ube2i,and adrb2b) associated with the mineralocorticoid receptor (MR) pathway were significantly down-regulated. Furthermore, in vitro mammalian cell-based (MDA-kb2 and H4IIE-luc) receptor transactivation assays, were also conducted to investigate possible agonistic or antagonistic effects on AR- and AhR-mediated pathways. In mammalian cells, none of these pathways were affected by TBOEP at the concentrations studied. Receptor-mediated responses (in vivo) and mammalian cell lines receptor binding assay (in vitro) combined with published information suggest that TBOEP can modulate receptor-mediated, endocrine process (in vivo/in vitro), particularly ER and MR. PMID:26562049

  2. After-ripening alters the gene expression pattern of oxidases involved in the ethylene and gibberellin pathways during early imbibition of Sisymbrium officinale L. seeds.

    PubMed

    Iglesias-Fernández, Raquel; Matilla, Angel

    2009-01-01

    After-ripening (AR) in Sisymbrium officinale seeds altered SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 gene expression. Except for SoGA20ox2 expression, which sharply diminished, the expression of the other genes rose during development, particularly that of SoACS7. In contrast, only the SoACO2 and SoGA2ox6 transcripts increased with seed desiccation; the others decreased. AR increased the SoGA3ox2 transcript in dry seed, but dramatically decreased the SoACS7 transcript. At the onset of imbibition, AR inhibited SoACS7 and SoACO2 expression and stimulated that of SoGA20ox2, SoGA3ox2, and SoGA2ox6, demonstrating that the participation of ethylene (ET) and gibberellins (GAs) differs in after-ripened and non-after-ripened seeds. The inhibition of SoACO2 expression in the presence of GA(4+7), paclobutrazol (PB), inhibitors of ET synthesis and signalling (IESS), and notably ET+GA(4+7) indicated ET-GA cross-talk in non-after-ripened seeds. A positive effect of AR in reversing this inhibition was found. The idea of ET-GA cross-talk is also supported by the effect of ET on SoGA3ox2 expression, notably induced by the AR process. In contrast, SoGA20ox2 expression did not appear to be susceptible to AR. SoGA2ox6 expression, poorly known in seeds, suggests that AR prompted an up-regulation under all treatments studied, whereas in non-after-ripened seeds expression was down-regulated. On the other hand, the beta-mannanase (MAN) activity dramatically increased in dry after-ripened seed, being significantly boosted by ET. The absence of MAN inhibition by IESS suggests that although ET seems to be one of the factors controlling MAN, its presence did not appear to be essential. GA(4+7) only increased MAN in seeds which were after-ripened. Here, it is proposed that ET and GAs participate actively in establishing the AR process.

  3. Gene expression profile of pulpitis

    PubMed Central

    Galicia, Johnah C.; Henson, Brett R.; Parker, Joel S.; Khan, Asma A.

    2016-01-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the Significance Analysis of Microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (≥30mm on VAS) compared to those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology. PMID:27052691

  4. Gene expression profile of pulpitis.

    PubMed

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A

    2016-06-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology. PMID:27052691

  5. Dietary daidzein influences laying performance of ducks (Anas platyrhynchos) and early post-hatch growth of their hatchlings by modulating gene expression.

    PubMed

    Zhao, Ruqian; Wang, Yaju; Zhou, Yuchuan; Ni, Yingdong; Lu, Lizhi; Grossmann, Roland; Chen, Jie

    2004-08-01

    Our previous studies demonstrated that dietary supplementation of daidzein improves egg production in duck breeders during late periods of the laying cycle. The present study was aimed to clarify whether the growth of ducklings hatched from eggs laid by daidzein-treated hens would be affected, and to elucidate the mechanisms underlying potential trans-generational effects, by determining changes of hormone levels and mRNA expression of relevant genes. Daidzein was added to the basal diet of 415-day-old duck breeders at the level of 5 mg/kg. During 9 weeks of daidzein treatment, laying rate increased by 7.70%, average egg mass tended to increase, whereas yolk/albumen ratio decreased significantly. These changes were accompanied by significantly elevated plasma T4 and E2 levels, enhanced gonadotropin releasing hormone (GnRH) mRNA, but diminished estrogen receptor (ER)-beta mRNA expression in hypothalamus of daidzein-treated hens. Ducklings hatched from daidzein-treated eggs were significantly smaller at hatching, but they caught up with their control counterparts by 4 weeks of age. Serum levels of T4, pituitary GH, hepatic GH receptor (GHR) and type-1 IGF receptor (IGF-1R) mRNA expression were all suppressed markedly in the daidzein-treated group at hatching, but this suppression proved to be temporary, as at 4 weeks of age, expression levels of all investigated genes were restored. However, it is noteworthy that at 4 weeks of age an obvious down-regulation of hypothalamic GnRH mRNA expression was detected in ducklings maternally exposed to daidzein. Our results provide evidence that maternal exposure to daidzein affects post-hatch growth in the duck with accompanying changes in the secretion of metabolic hormones and expression of growth-related genes. Although the negative effect of maternal daidzein on embryonic growth could be eliminated 4 weeks after hatching, the long-term effect of maternal daidzein on reproductive function is not to be ignored and awaits

  6. Duplicate genes increase gene expression diversity within and between species.

    PubMed

    Gu, Zhenglong; Rifkin, Scott A; White, Kevin P; Li, Wen-Hsiung

    2004-06-01

    Using microarray gene expression data from several Drosophila species and strains, we show that duplicated genes, compared with single-copy genes, significantly increase gene expression diversity during development. We show further that duplicate genes tend to cause expression divergences between Drosophila species (or strains) to evolve faster than do single-copy genes. This conclusion is also supported by data from different yeast strains.

  7. Disease Severity Is Associated with Differential Gene Expression at the Early and Late Phases of Infection in Nonhuman Primates Infected with Different H5N1 Highly Pathogenic Avian Influenza Viruses

    PubMed Central

    Muramoto, Yukiko; Shoemaker, Jason E.; Le, Mai Quynh; Itoh, Yasushi; Tamura, Daisuke; Sakai-Tagawa, Yuko; Imai, Hirotaka; Uraki, Ryuta; Takano, Ryo; Kawakami, Eiryo; Ito, Mutsumi; Okamoto, Kiyoko; Ishigaki, Hirohito; Mimuro, Hitomi; Sasakawa, Chihiro; Matsuoka, Yukiko; Noda, Takeshi; Fukuyama, Satoshi; Ogasawara, Kazumasa; Kitano, Hiroaki

    2014-01-01

    ABSTRACT Occasional transmission of highly pathogenic avian H5N1 influenza viruses to humans causes severe pneumonia with high mortality. To better understand the mechanisms via which H5N1 viruses induce severe disease in humans, we infected cynomolgus macaques with six different H5N1 strains isolated from human patients and compared their pathogenicity and the global host responses to the virus infection. Although all H5N1 viruses replicated in the respiratory tract, there was substantial heterogeneity in their replicative ability and in the disease severity induced, which ranged from asymptomatic to fatal. A comparison of global gene expression between severe and mild disease cases indicated that interferon-induced upregulation of genes related to innate immunity, apoptosis, and antigen processing/presentation in the early phase of infection was limited in severe disease cases, although interferon expression was upregulated in both severe and mild cases. Furthermore, coexpression analysis of microarray data, which reveals the dynamics of host responses during the infection, demonstrated that the limited expression of these genes early in infection led to a failure to suppress virus replication and to the hyperinduction of genes related to immunity, inflammation, coagulation, and homeostasis in the late phase of infection, resulting in a more severe disease. Our data suggest that the attenuated interferon-induced activation of innate immunity, apoptosis, and antigen presentation in the early phase of H5N1 virus infection leads to subsequent severe disease outcome. IMPORTANCE Highly pathogenic avian H5N1 influenza viruses sometimes transmit to humans and cause severe pneumonia with ca. 60% lethality. The continued circulation of these viruses poses a pandemic threat; however, their pathogenesis in mammals is not fully understood. We, therefore, investigated the pathogenicity of six H5N1 viruses and compared the host responses of cynomolgus macaques to the virus

  8. Systems Biophysics of Gene Expression

    PubMed Central

    Vilar, Jose M.G.; Saiz, Leonor

    2013-01-01

    Gene expression is a process central to any form of life. It involves multiple temporal and functional scales that extend from specific protein-DNA interactions to the coordinated regulation of multiple genes in response to intracellular and extracellular changes. This diversity in scales poses fundamental challenges to the use of traditional approaches to fully understand even the simplest gene expression systems. Recent advances in computational systems biophysics have provided promising avenues to reliably integrate the molecular detail of biophysical process into the system behavior. Here, we review recent advances in the description of gene regulation as a system of biophysical processes that extend from specific protein-DNA interactions to the combinatorial assembly of nucleoprotein complexes. There is now basic mechanistic understanding on how promoters controlled by multiple, local and distal, DNA binding sites for transcription factors can actively control transcriptional noise, cell-to-cell variability, and other properties of gene regulation, including precision and flexibility of the transcriptional responses. PMID:23790365

  9. Complete Mitochondrial Genome of Helicoverpa zea (Lepidoptera: Noctuidae) and Expression Profiles of Mitochondrial-Encoded Genes in Early and Late Embryos

    PubMed Central

    Perera, Omaththage P.; Walsh, Thomas K.; Luttrell, Randall G.

    2016-01-01

    The mitochondrial genome (mitogenome) of the bollworm, Helicoverpa zea (Boddie), was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogenome (gene order and orientation) was identical to other known lepidopteran mitogenome sequences. Compared with Helicoverpa armigera (Hübner) mitogenome, there were a few differences in the lengths of gaps between genes, but the lengths of nucleotide overlaps were essentially conserved between the two species. Nucleotide composition of the H. zea mitochondrial genome was very similar to those of the related species H. armigera and Helicoverpa punctigera Wallengren. Mapping of RNA-Seq reads obtained from 2-h eggs and 48-h embryos to protein coding genes (PCG) revealed that all H. zea PCGs were processed as single mature gene transcripts except for the bicistronic atp8 + atp6 transcript. A tRNA-like sequence predicted to form a hammer-head-like secondary structure that may play a role in transcription start and mitogenome replication was identified within the control region of the H. zea mitogenome. Similar structures were also found within the control regions of several other lepidopteran species. Expression analysis revealed significant differences in levels of expression of PCGs within each developmental stage, but the pattern of variation was similar in both developmental stages analyzed in this study. Mapping of RNA-Seq reads to PCG transcripts also identified transcription termination and polyadenylation sites that differed from the sites described in other lepidopteran species. PMID:27126963

  10. T-cell activation and early gene response in dogs.

    PubMed

    Mortlock, Sally-Anne; Wei, Jerry; Williamson, Peter

    2015-01-01

    T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR), and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA) (5μg/ml), including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2), early growth response 1 (EGR1), growth arrest and DNA damage-inducible gene (GADD45B), phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1), V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS), early growth response 2 (EGR2), hemogen (HEMGN), polo-like kinase 2 (PLK2) and polo-like kinase 3 (PLK3). Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in cell cycle

  11. The Gene Expression Omnibus database

    PubMed Central

    Clough, Emily; Barrett, Tanya

    2016-01-01

    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome–protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at http://www.ncbi.nlm.nih.gov/geo/. PMID:27008011

  12. The Gene Expression Omnibus Database.

    PubMed

    Clough, Emily; Barrett, Tanya

    2016-01-01

    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome-protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at http://www.ncbi.nlm.nih.gov/geo/. PMID:27008011

  13. Gene Expression Studies in Mosquitoes

    PubMed Central

    Chen, Xlao-Guang; Mathur, Geetika; James, Anthony A.

    2009-01-01

    Research on gene expression in mosquitoes is motivated by both basic and applied interests. Studies of genes involved in hematophagy, reproduction, olfaction, and immune responses reveal an exquisite confluence of biological adaptations that result in these highly-successful life forms. The requirement of female mosquitoes for a bloodmeal for propagation has been exploited by a wide diversity of viral, protozoan and metazoan pathogens as part of their life cycles. Identifying genes involved in host-seeking, blood feeding and digestion, reproduction, insecticide resistance and susceptibility/refractoriness to pathogen development is expected to provide the bases for the development of novel methods to control mosquito-borne diseases. Advances in mosquito transgenesis technologies, the availability of whole genome sequence information, mass sequencing and analyses of transcriptomes and RNAi techniques will assist development of these tools as well as deepen the understanding of the underlying genetic components for biological phenomena characteristic of these insect species. PMID:19161831

  14. Early transcriptomic adaptation to Na₂CO₃ stress altered the expression of a quarter of the total genes in the maize genome and exhibited shared and distinctive profiles with NaCl and high pH stresses.

    PubMed

    Zhang, Li-Min; Liu, Xiang-Guo; Qu, Xin-Ning; Yu, Ying; Han, Si-Ping; Dou, Yao; Xu, Yao-Yao; Jing, Hai-Chun; Hao, Dong-Yun

    2013-11-01

    Sodium carbonate (Na₂CO₃) presents a huge challenge to plants by the combined damaging effects of Na⁺, high pH, and CO₃²⁻. Little is known about the cellular responses to Na₂CO₃ stress. In this study, the transcriptome of maize (Zea mays L. cv. B73) roots exposed to Na₂CO₃ stress for 5 h was compared with those of NaCl and NaOH stresses. The expression of 8,319 genes, representing over a quarter of the total number of genes in the maize genome, was altered by Na₂CO₃ stress, and the downregulated genes (5,232) outnumbered the upregulated genes (3,087). The effects of Na₂CO₃ differed from those of NaCl and NaOH, primarily by downregulating different categories of genes. Pathways commonly altered by Na₂CO₃, NaCl, and NaOH were enriched in phenylpropanoid biosynthesis, oxidation of unsaturated fatty acids, ATP-binding cassette (ABC) transporters, as well as the metabolism of secondary metabolites. Genes for brassinosteroid biosynthesis were specifically upregulated by Na₂CO₃, while genes involved in ascorbate and aldarate metabolism, protein processing in the endoplasmic reticulum and by N-glycosylation, fatty acid biosynthesis, and the circadian rhythm were downregulated. This work provides the first holistic picture of early transcriptomic adaptation to Na₂CO₃ stress, and highlights potential molecular pathways that could be manipulated to improve tolerance in maize.

  15. Global analysis of patterns of gene expression during Drosophila embryogenesis

    PubMed Central

    Tomancak, Pavel; Berman, Benjamin P; Beaton, Amy; Weiszmann, Richard; Kwan, Elaine; Hartenstein, Volker; Celniker, Susan E; Rubin, Gerald M

    2007-01-01

    Background Cell and tissue specific gene expression is a defining feature of embryonic development in multi-cellular organisms. However, the range of gene expression patterns, the extent of the correlation of expression with function, and the classes of genes whose spatial expression are tightly regulated have been unclear due to the lack of an unbiased, genome-wide survey of gene expression patterns. Results We determined and documented embryonic expression patterns for 6,003 (44%) of the 13,659 protein-coding genes identified in the Drosophila melanogaster genome with over 70,000 images and controlled vocabulary annotations. Individual expression patterns are extraordinarily diverse, but by supplementing qualitative in situ hybridization data with quantitative microarray time-course data using a hybrid clustering strategy, we identify groups of genes with similar expression. Of 4,496 genes with detectable expression in the embryo, 2,549 (57%) fall into 10 clusters representing broad expression patterns. The remaining 1,947 (43%) genes fall into 29 clusters representing restricted expression, 20% patterned as early as blastoderm, with the majority restricted to differentiated cell types, such as epithelia, nervous system, or muscle. We investigate the relationship between expression clusters and known molecular and cellular-physiological functions. Conclusion Nearly 60% of the genes with detectable expression exhibit broad patterns reflecting quantitative rather than qualitative differences between tissues. The other 40% show tissue-restricted expression; the expression patterns of over 1,500 of these genes are documented here for the first time. Within each of these categories, we identified clusters of genes associated with particular cellular and developmental functions. PMID:17645804

  16. Use of dual section mRNA in situ hybridisation/immunohistochemistry to clarify gene expression patterns during the early stages of nephron development in the embryo and in the mature nephron of the adult mouse kidney.

    PubMed

    Georgas, Kylie; Rumballe, Bree; Wilkinson, Lorine; Chiu, Han Sheng; Lesieur, Emmanuelle; Gilbert, Thierry; Little, Melissa H

    2008-11-01

    The kidney is the most complex organ within the urogenital system. The adult mouse kidney contains in excess of 8,000 mature nephrons, each of which can be subdivided into a renal corpuscle and 14 distinct tubular segments. The histological complexity of this organ can make the clarification of the site of gene expression by in situ hybridisation difficult. We have defined a panel of seven antibodies capable of identifying the six stages of early nephron development, the tubular nephron segments and the components of the renal corpuscle within the embryonic and adult mouse kidney. We have analysed in detail the protein expression of Wt1, Calb1 Aqp1, Aqp2 and Umod using these antibodies. We have then coupled immunohistochemistry with RNA in situ hybridisation in order to precisely identify the expression pattern of different genes, including Wnt4, Umod and Spp1. This technique will be invaluable for examining at high resolution, the structure of both the developing and mature nephron where standard in situ hybridisation and histological techniques are insufficient. The use of this technique will enhance the expression analyses of genes which may be involved in nephron formation and the function of the mature nephron in the mouse.

  17. Using Immediate-Early Genes to Map Hippocampal Subregional Functions

    ERIC Educational Resources Information Center

    Kubik, Stepan; Miyashita, Teiko; Guzowski, John F.

    2007-01-01

    Different functions have been suggested for the hippocampus and its subdivisions along both transversal and longitudinal axes. Expression of immediate-early genes (IEGs) has been used to map specific functions onto neuronal activity in different areas of the brain including the hippocampus (IEG imaging). Here we review IEG studies on hippocampal…

  18. Strong early seed-specific gene regulatory region

    SciTech Connect

    Broun, Pierre; Somerville, Chris

    2002-01-01

    Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

  19. Strong early seed-specific gene regulatory region

    DOEpatents

    Broun, Pierre; Somerville, Chris

    1999-01-01

    Nucleic acid sequences and methods for their use are described which provide for early seed-specific transcription, in order to modulate or modify expression of foreign or endogenous genes in seeds, particularly embryo cells. The method finds particular use in conjunction with modifying fatty acid production in seed tissue.

  20. Expression Pattern of Inflammatory Response Genes and Their Regulatory MicroRNAs in Bovine Oviductal Cells in Response to Lipopolysaccharide: Implication for Early Embryonic Development

    PubMed Central

    Ibrahim, Sally; Salilew-Wondim, Dessie; Rings, Franca; Hoelker, Michael; Neuhoff, Christiane; Tholen, Ernst; Looft, Christian; Schellander, Karl; Tesfaye, Dawit

    2015-01-01

    In the present study, we used an in vitro model to investigate the response of the oviduct with respect to inflammatory mediators and their regulatory microRNAs in case of bacterial infection and subsequent association with embryo survival. For this, we conducted two experiments. In the first experiment, cultured primary bovine oviductal cells (BOEC) were challenged with lipopolysaccharide (LPS) for 24h and the temporal expression pattern of inflammatory mediators and their regulatory microRNAs were measured at 0, 3, 6, 12, 24 and 48h after LPS treatment. Intriguingly, the temporal patterns of all miRNAs except miR-21 were significantly up-regulated at 6h after LPS treatment. Whereas, we observed significant overexpression of pro-inflammatory mediators as tumor necrosis factor alpha (TNFα) and interleukin-1 beta (IL1β) after LPS challenge for 24h. On the other hand, the expression level of essential elements like oviductal glycoprotein 1 (OVGP1) and insulin-like growth factor 2 (IGF2) was significantly decreased in challenged groups compared with control. Moreover, miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215 have shown a clear suppression in challenged group after LPS treatment. In the 2nd experiment there were four groups of blastocysts produced, namely embryo+LPS free media, embryo+LPS, BOEC+embryo and BOEC+embryo+LPS. The suboptimal oviduct environment due to LPS challenge is found to have a significant influence on the expression of inflammatory response genes (TNFα and CSF1), stress response genes (SOD and CAT), mitochondrial activity, reactive oxygen species (ROS) accumulation and apoptotic level either in cultured or co-cultured blastocysts. Collectively, LPS challenge led to aberrant changes in oviductal transcriptome profile, which could lead to a suboptimal environment for embryo development. PMID:25764515

  1. Expression pattern of inflammatory response genes and their regulatory micrornas in bovine oviductal cells in response to lipopolysaccharide: implication for early embryonic development.

    PubMed

    Ibrahim, Sally; Salilew-Wondim, Dessie; Rings, Franca; Hoelker, Michael; Neuhoff, Christiane; Tholen, Ernst; Looft, Christian; Schellander, Karl; Tesfaye, Dawit

    2015-01-01

    In the present study, we used an in vitro model to investigate the response of the oviduct with respect to inflammatory mediators and their regulatory microRNAs in case of bacterial infection and subsequent association with embryo survival. For this, we conducted two experiments. In the first experiment, cultured primary bovine oviductal cells (BOEC) were challenged with lipopolysaccharide (LPS) for 24h and the temporal expression pattern of inflammatory mediators and their regulatory microRNAs were measured at 0, 3, 6, 12, 24 and 48h after LPS treatment. Intriguingly, the temporal patterns of all miRNAs except miR-21 were significantly up-regulated at 6h after LPS treatment. Whereas, we observed significant overexpression of pro-inflammatory mediators as tumor necrosis factor alpha (TNFα) and interleukin-1 beta (IL1β) after LPS challenge for 24h. On the other hand, the expression level of essential elements like oviductal glycoprotein 1 (OVGP1) and insulin-like growth factor 2 (IGF2) was significantly decreased in challenged groups compared with control. Moreover, miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215 have shown a clear suppression in challenged group after LPS treatment. In the 2nd experiment there were four groups of blastocysts produced, namely embryo+LPS free media, embryo+LPS, BOEC+embryo and BOEC+embryo+LPS. The suboptimal oviduct environment due to LPS challenge is found to have a significant influence on the expression of inflammatory response genes (TNFα and CSF1), stress response genes (SOD and CAT), mitochondrial activity, reactive oxygen species (ROS) accumulation and apoptotic level either in cultured or co-cultured blastocysts. Collectively, LPS challenge led to aberrant changes in oviductal transcriptome profile, which could lead to a suboptimal environment for embryo development. PMID:25764515

  2. Effects of A-CREB, a dominant negative inhibitor of CREB, on the expression of c-fos and other immediate early genes in the rat SON during hyperosmotic stimulation in vivo

    PubMed Central

    Lubelski, Daniel; Ponzio, Todd A.; Gainer, Harold

    2016-01-01

    Intraperitoneal administration of hypertonic saline to the rat supraoptic nucleus (SON) increases the expression of several immediate early genes (IEG) and the vasopressin gene. These increases have usually been attributed to action of the cyclic-AMP Response Element Binding Protein (CREB). In this paper, we study the role of CREB in these events in vivo by delivering a potent dominant-negative form of CREB, known as A-CREB, to the rat SON through the use of an adeno-associated viral (AAV) vector. Preliminary experiments on HEK 293 cells in vitro showed that the A-CREB vector that we used completely eliminated CREB-induced c-fos expression. We stereotaxically injected this AAV-A-CREB into one SON and a control AAV into the contralateral SON of the same rat. Two weeks following these injections we injected hypertonic saline intraperitoneally into the rat. Using this paradigm, we could measure the relative effects of inhibiting CREB on the induced expression of c-fos, ngfi-a, ngfi-b, and vasopressin genes in the A-CREB AAV injected SON versus the control AAV injected SON in the same rat. We found only a small (20%) decrease of c-fos expression and a 30% decrease of ngfi-b expression in the presence of the A-CREB. There were no significant changes in expression found in the other IEGs nor in vasopressin that were produced by the A-CREB. This suggests that CREB may play only a minor role in the expression of IEGs and vasopressin in the osmotically activated SON in vivo. PMID:22079318

  3. Genetic alteration and gene expression modulation during cancer progression

    PubMed Central

    Garnis, Cathie; Buys, Timon PH; Lam, Wan L

    2004-01-01

    Cancer progresses through a series of histopathological stages. Progression is thought to be driven by the accumulation of genetic alterations and consequently gene expression pattern changes. The identification of genes and pathways involved will not only enhance our understanding of the biology of this process, it will also provide new targets for early diagnosis and facilitate treatment design. Genomic approaches have proven to be effective in detecting chromosomal alterations and identifying genes disrupted in cancer. Gene expression profiling has led to the subclassification of tumors. In this article, we will describe the current technologies used in cancer gene discovery, the model systems used to validate the significance of the genes and pathways, and some of the genes and pathways implicated in the progression of preneoplastic and early stage cancer. PMID:15035667

  4. Modification of Gene Expression of Connexins in the Rat Corpus Epididymis by Estradiol Benzoate or Flutamide Exposure at the Early Neonatal Age.

    PubMed

    Lee, Ki-Ho

    2015-06-01

    Cell-cell direct communication through channel-forming molecules, connexin (Cx), is essential for a tissue to exchange signaling molecules between neighboring cells and establish unique functional characteristics during postnatal development. The corpus epididymis is a well-known androgen-responsive tissue and involves in proper sperm maturation. In the present research, it was attempted to determine if expression of Cx isoforms in the corpus epididymis in the adult is modulated by exposure to estrogenic or anti-androgenic compound during the early postnatal period. The neonatal male rats at 7 days of age were subcutaneously injected by estradiol benzoate (EB) at low-dose (0.015 mg/kg body weight) or high-dose (1.5 mg/kg body weight) or flutamide (Flu) at low-dose (500 mg/kg body weight) or high-dose (50 mg/kg body weight). The corpus epididymis collected at 4 months of age was subjected to evaluate expressional changes of Cx isoforms by quantitative real-time PCR. Treatment of low-dose EB resulted in increases of Cx32, Cx37, and Cx45 transcript levels, while exposure to high-dose EB decreased expression of Cx26, Cx30.3, Cx31, Cx31.1, Cx32, Cx40, Cx43, and Cx45. Treatments of Flu caused significant decreases of expression of all examined Cx isoforms, except Cx37 and Cx43 shown no expressional change with high-dose Flu treatment. These findings imply that expression of most Cx isoforms present in the corpus epididymis would be transcriptionally regulated by actions of androgen and/or estrogen during postnatal period. PMID:27004263

  5. Identification of four soybean reference genes for gene expression normalization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene expression analysis requires the use of reference genes stably expressed independently of specific tissues or environmental conditions. Housekeeping genes (e.g., actin, tubulin, ribosomal, polyubiquitin and elongation factor 1-alpha) are commonly used as reference genes with the assumption tha...

  6. Mitochondrial RNA granules: Compartmentalizing mitochondrial gene expression

    PubMed Central

    Jourdain, Alexis A.; Boehm, Erik; Maundrell, Kinsey

    2016-01-01

    In mitochondria, DNA replication, gene expression, and RNA degradation machineries coexist within a common nondelimited space, raising the question of how functional compartmentalization of gene expression is achieved. Here, we discuss the recently characterized “mitochondrial RNA granules,” mitochondrial subdomains with an emerging role in the regulation of gene expression. PMID:26953349

  7. Early-age feed restriction affects viability and gene expression of satellite cells isolated from the gastrocnemius muscle of broiler chicks

    PubMed Central

    2012-01-01

    Background Muscle growth depends on the fusion of proliferate satellite cells to existing myofibers. We reported previously that 0–14 day intermittent feeding led to persistent retardation in myofiber hypertrophy. However, how satellite cells respond to such nutritional insult has not been adequately elucidated. Results One-day-old broiler chicks were allocated to control (Con, ad libitum feeding), intermittent feeding (IF, feed provided on alternate days) and re-feeding (RF, 2 days ad libitum feeding after 12 days of intermittent feeding) groups. Chickens were killed on Day 15 and satellite cells were isolated. When cultured, satellite cells from the IF group demonstrated significant retardation in proliferation and differentiation potential, while RF partly restored the proliferation rate and differentiation potential of the satellite cells. Significant up-regulation of insulin like growth factor I receptor (IGF-IR) (P<0.05) and thyroid hormone receptor α (TRα) (P<0.05), and down-regulation of growth hormone receptor (GHR) (P<0.01) and IGF-I (P<0.01) mRNA expression was observed in freshly isolated IF satellite cells when compared with Con cells. In RF cells, the mRNA expression of IGF-I was higher (P<0.05) and of TRα was lower (P<0.01) than in IF cells, suggesting that RF restored the mRNA expression of TRα and IGF-I, but not of GHR and IGF-IR. The Bax/Bcl-2 ratio tended to increase in the IF group, which was reversed in the RF group (P<0.05), indicating that RF reduced the pro-apoptotic influence of IF. Moreover, no significant effect of T3 was detected on cell survival in IF cells compared with Con (P<0.001) or RF (P<0.05) cells. Conclusions These data suggest that early-age feed restriction inhibits the proliferation and differentiation of satellite cells, induces changes in mRNA expression of the GH/IGF-I and thyroid hormone receptors in satellite cells, as well as blunted sensitivity of satellite cells to T3, and that RF partially reverses these

  8. Differential gene expression in the bovine corpus luteum during transition from early phase to midphase and its potential role in acquisition of luteolytic sensitivity to prostaglandin F2 alpha.

    PubMed

    Goravanahally, Madhusudan P; Salem, Mohamed; Yao, Jianbo; Inskeep, E Keith; Flores, Jorge A

    2009-05-01

    Prostaglandin F2 alpha (PGF(2alpha)) brings about regression of the bovine corpus luteum (CL). This luteolytic property of PGF(2alpha) is used in beef and dairy cattle to synchronize estrus. A limitation of this protocol is insensitivity of the early CL to luteolytic actions of PGF(2alpha). The mechanisms underlying this differential luteal sensitivity are poorly understood. The developing CL has a maximum number of PGF(2alpha) receptors; therefore, differences in signaling events may be responsible for luteal insensitivity. Hence, differential gene expression at two developmental stages of CL, Day 4 (D-4) and D-10 after estrus, might account for differences in signal transduction pathways associated with luteal sensitivity. This possibility was examined in these studies. Microarray analysis (n = 3 cows per stage) identified 167 genes that were differentially expressed (P < 0.05). These were categorized into genes involved in protein biosynthesis and modification (18.5%), transcription regulation and DNA biosynthesis (18.5%), miscellaneous (17.0%), cell signaling (12.0%), steroidogenesis and metabolism (10.2%), extracellular matrix and cytoskeletal proteins (9.5%), unknown functions (6.0%), protein degradation (5.3%), and antioxidant property (3.0%). Real-time PCR confirmed the differential expression of nine selected genes, including tyrosine 3-monooxygenase/tryptophan 5-monooxygense activation protein zeta polypeptide (YWHAZ) and regulator of G protein signaling 2 24-kDa (RGS2), observed in microarray. Furthermore, the in vivo effect of exogenous PGF(2alpha) (n = 3 cows per stage) on selected genes that were found to be differentially expressed during this developmental transition was examined. PGF(2alpha) increased the expression of a guanine nucleotide-binding protein (G protein) beta polypeptide 1 (GNB1) in D-4 CL and calcium/calmodulin-dependent kinase kinase 2 beta (CAMKK2) in D-10 CL. Therefore, GNB1, CAMKK2, YWHAZ, and RGS2 are candidate genes that may

  9. Early gene expression events in the laminar abscission zone of abscission-promoted citrus leaves after a cycle of water stress/rehydration: involvement of CitbHLH1.

    PubMed

    Agustí, Javier; Gimeno, Jacinta; Merelo, Paz; Serrano, Ramón; Cercós, Manuel; Conesa, Ana; Talón, Manuel; Tadeo, Francisco R

    2012-10-01

    Leaf abscission is a common response of plants to drought stress. Some species, such as citrus, have evolved a specific behaviour in this respect, keeping their leaves attached to the plant body during water stress until this is released by irrigation or rain. This study successfully reproduced this phenomenon under controlled conditions (24h of water stress followed by 24h of rehydration) and used it to construct a suppression subtractive hybridization cDNA library enriched in genes involved in the early stages of rehydration-promoted leaf abscission after water stress. Sequencing of the library yielded 314 unigenes, which were spotted onto nylon membranes. Membrane hybridization with petiole (Pet)- and laminar abscission zone (LAZ)-enriched RNA samples corresponding to early steps in leaf abscission revealed an almost exclusive preferential gene expression programme in the LAZ. The data identified major processes such as protein metabolism, cell-wall modification, signalling, control of transcription and vesicle production, and transport as the main biological processes activated in LAZs during the early steps of rehydration-promoted leaf abscission after water stress. Based on these findings, a model for the early steps of citrus leaf abscission is proposed. In addition, it is suggested that CitbHLH1, the putative citrus orthologue of Arabidopsis BIGPETAL, may play major roles in the control of abscission-related events in citrus abscission zones.

  10. Early gene expression events in the laminar abscission zone of abscission-promoted citrus leaves after a cycle of water stress/rehydration: involvement of CitbHLH1.

    PubMed

    Agustí, Javier; Gimeno, Jacinta; Merelo, Paz; Serrano, Ramón; Cercós, Manuel; Conesa, Ana; Talón, Manuel; Tadeo, Francisco R

    2012-10-01

    Leaf abscission is a common response of plants to drought stress. Some species, such as citrus, have evolved a specific behaviour in this respect, keeping their leaves attached to the plant body during water stress until this is released by irrigation or rain. This study successfully reproduced this phenomenon under controlled conditions (24h of water stress followed by 24h of rehydration) and used it to construct a suppression subtractive hybridization cDNA library enriched in genes involved in the early stages of rehydration-promoted leaf abscission after water stress. Sequencing of the library yielded 314 unigenes, which were spotted onto nylon membranes. Membrane hybridization with petiole (Pet)- and laminar abscission zone (LAZ)-enriched RNA samples corresponding to early steps in leaf abscission revealed an almost exclusive preferential gene expression programme in the LAZ. The data identified major processes such as protein metabolism, cell-wall modification, signalling, control of transcription and vesicle production, and transport as the main biological processes activated in LAZs during the early steps of rehydration-promoted leaf abscission after water stress. Based on these findings, a model for the early steps of citrus leaf abscission is proposed. In addition, it is suggested that CitbHLH1, the putative citrus orthologue of Arabidopsis BIGPETAL, may play major roles in the control of abscission-related events in citrus abscission zones. PMID:23028022

  11. Protection of beagle dogs from mucosal challenge with canine oral papillomavirus by immunization with recombinant adenoviruses expressing codon-optimized early genes.

    PubMed

    Johnston, Kimberly B; Monteiro, Juanita M; Schultz, Loren D; Chen, Ling; Wang, Fubao; Ausensi, Virginia A; Dell, Elayne C; Santos, Elmer B; Moore, Richard A; Palker, Thomas J; Stanley, Margaret A; Jansen, Kathrin U

    2005-06-01

    Replication-deficient adenoviral (rAd5) vaccines containing codon-optimized E1, E2, E4, and E7 genes of canine oral papillomavirus (COPV) were tested singly or in combination to determine which vaccines could protect against mucosal challenge with COPV. In three studies, groups of 4-6 beagle dogs were immunized subcutaneously (s.c.) with 10(11) rAd5 at 8-10 weeks and 4-6 weeks prior to challenge with infectious COPV particles at multiple oral mucosal sites. Control dogs were immunized with equivalent doses of rAd5 expressing human papillomavirus (HPV) type 16 L1 (rAd5-HPV-16 L1). In the first study, complete protection from COPV-induced papillomas was achieved by immunization with rAd5 vaccine combinations expressing either E1 + E2 or E1 + E2 + E4 + E7; whereas two of six dogs immunized with rAd5-E4 + rAd5-E7 and six of six rAd5-HPV16-L1-immunized control dogs developed oral papillomas. In two subsequent studies, rAd5-E1 and rAd5-E2 vaccines were tested singly or in combination to assess levels of protective immunity to COPV challenge. Subcutaneous immunization with either one or two doses of rAd5 expressing the COPV E1 and E2 genes could protect > 90% of challenged dogs from wart formation. In contrast, all eight dogs immunized with rAd5-HPV-16 L1 developed papillomas at multiple sites. Protection was accompanied by significant IFN-gamma responses to COPV E1 and E2 peptides. Partial protection was conferred by two immunizations with either rAd5-E1 (6 of 9 protected) or rAd5-E2 (8 of 9 protected). These data indicate that rAd5 expressing papillomavirus E1 and E2 proteins can induce strong protective responses even in outbred populations under practical immunization conditions. PMID:15892962

  12. Expression analysis of five zebrafish RXFP3 homologues reveals evolutionary conservation of gene expression pattern.

    PubMed

    Donizetti, Aldo; Fiengo, Marcella; Iazzetti, Giovanni; del Gaudio, Rosanna; Di Giaimo, Rossella; Pariante, Paolo; Minucci, Sergio; Aniello, Francesco

    2015-01-01

    Relaxin peptides exert different functions in reproduction and neuroendocrine processes via interaction with two evolutionarily unrelated groups of receptors: RXFP1 and RXFP2 on one hand, RXFP3 and RXFP4 on the other hand. Evolution of receptor genes after splitting of tetrapods and teleost lineage led to a different retention rate between mammals and fish, with the latter having more gene copies compared to the former. In order to improve our knowledge on the evolution of the relaxin ligands/receptors system and have insights on their function in early stages of life, in the present paper we analyzed the expression pattern of five zebrafish RXFP3 homologue genes during embryonic development. In our analysis, we show that only two of the five genes are expressed during embryogenesis and that their transcripts are present in all the developmental stages. Spatial localization analysis of these transcripts revealed that the gene expression is restricted in specific territories starting from early pharyngula stage. Both genes are expressed in the brain but in different cell clusters and in extra-neural territories, one gene in the interrenal gland and the other in the pancreas. These two genes share expression territories with the homologue mammalian counterpart, highlighting a general conservation of gene expression regulatory processes and their putative function during evolution that are established early in vertebrate embryogenesis.

  13. Effect of adiponectin on the steroidogenic acute regulatory protein, P450 side chain cleavage enzyme and 3β-hydroxysteroid dehydrogenase gene expression, progesterone and androstenedione production by the porcine uterus during early pregnancy.

    PubMed

    Smolinska, N; Dobrzyn, K; Kiezun, M; Szeszko, K; Maleszka, A; Kaminski, T

    2016-06-01

    Adiponectin and its receptors are expressed in the human and porcine uterus and this endocrine system has important role in the regulation of reproductive processes. The expression of steroidogenic acute regulatory protein (StAR) and 3β-hydroxysteroid dehydrogenase (HSD3B1) were observed in the human and porcine uterus during the oestrous cycle and pregnancy. The de novo synthesis of steroids in the uterus might be a crucial factor for effective implantation and maintenance of pregnancy. We hypothesized that adiponectin modulates the expression of key enzymes in the synthesis of the steroids: StAR, P450 side chain cleavage enzyme (CYP11A1) and HSD3B1, as well as progesterone (P4) and androstenedione (A4) secretion by the porcine uterus. Endometrial and myometrial explants harvested from gilts (n = 5) on days 10 to 11, 12 to 13, 15 to 16 and 27 to 28 of pregnancy and on days 10 to 11 of the oestrous cycle were cultured in vitro in the presence of adiponectin (1, 10 μg/ml), adiponectin with insulin (10 ng/ml) and insulin alone (10 ng/ml). Gene expression was examined by real-time PCR, and the secretion of the steroids was determined by radioimmunoassay. The content of StAR, CYP11A1 and HSD3B1 mRNAs and the secretion of P4 and A4 was modulated by adiponectin in endometrial and myometrial tissue explants during early pregnancy and the oestrous cycle. In this action adiponectin interacted with insulin. Insulin itself also regulated the steroidogenic activity of the porcine uterus. ere we reported, for the first time, the expression of CYP11A1 genes in the porcine endometrium and myometrium. Our novel findings indicate that adiponectin affects basal and insulin-stimulated expression of key steroidogenic genes and production of steroid hormones by the porcine uterus during maternal recognition of pregnancy and implantation. PMID:27512005

  14. Comparison of Bacterial Burden and Cytokine Gene Expression in Golden Hamsters in Early Phase of Infection with Two Different Strains of Leptospira interrogans.

    PubMed

    Fujita, Rie; Koizumi, Nobuo; Sugiyama, Hiromu; Tomizawa, Rina; Sato, Ryoichi; Ohnishi, Makoto

    2015-01-01

    Leptospirosis, a zoonotic infection with worldwide prevalence, is caused by pathogenic spirochaetes of Leptospira spp., and exhibits an extremely broad clinical spectrum in human patients. Although previous studies indicated that specific serovars or genotypes of Leptospira spp. were associated with severe leptospirosis or its outbreak, the mechanism underlying the difference in virulence of the various Leptospira serotypes or genotypes remains unclear. The present study addresses this question by measuring and comparing bacterial burden and cytokine gene expression in hamsters infected with strains of two L. interrogans serovars Manilae (highly virulent) and Hebdomadis (less virulent). The histopathology of kidney, liver, and lung tissues was also investigated in infected hamsters. A significantly higher bacterial burden was observed in liver tissues of hamsters infected with serovar Manilae than those infected with serovar Hebdomadis (p < 0.01). The average copy number of the leptospiral genome was 1,302 and 20,559 in blood and liver, respectively, of hamsters infected with serovar Manilae and 1,340 and 4,896, respectively, in hamsters infected with serovar Hebdomadis. The expression levels of mip1alpha in blood; tgfbeta, il1beta, mip1alpha, il10, tnfalpha and cox2 in liver; and tgfbeta, il6, tnfalpha and cox2 in lung tissue were significantly higher in hamsters infected with serovar Manilae than those infected with serovar Hebdomadis (p < 0.05). In addition, infection with serovar Manilae resulted in a significantly larger number of hamsters with tnfalpha upregulation (p = 0.04). Severe distortion of tubular cell arrangement and disruption of renal tubules in kidney tissues and hemorrhage in lung tissues were observed in Manilae-infected hamsters. These results demonstrate that serovar Manilae multiplied more efficiently in liver tissues and induced significantly higher expression of genes encoding pro- and anti-inflammatory cytokines than serovar Hebdomadis

  15. Hyperbaric oxygen treatment induces antioxidant gene expression.

    PubMed

    Godman, Cassandra A; Joshi, Rashmi; Giardina, Charles; Perdrizet, George; Hightower, Lawrence E

    2010-06-01

    Although the underlying molecular causes of aging are not entirely clear, hormetic agents like exercise, heat, and calorie restriction may generate a mild pro-oxidant stress that induces cell protective responses to promote healthy aging. As an individual ages, many cellular and physiological processes decline, including wound healing and reparative angiogenesis. This is particularly critical in patients with chronic non-healing wounds who tend to be older. We are interested in the potential beneficial effects of hyperbaric oxygen as a mild hormetic stress on human microvascular endothelial cells. We analyzed global gene expression changes in human endothelial cells following a hyperbaric exposure comparable to a clinical treatment. Our analysis revealed an upregulation of antioxidant, cytoprotective, and immediate early genes. This increase coincided with an increased resistance to a lethal oxidative stress. Our data indicate that hyperbaric oxygen can induce protection against oxidative insults in endothelial cells and may provide an easily administered hormetic treatment to help promote healthy aging.

  16. Contrasting role of phospholipase C-{gamma}1 in the expression of immediate early genes induced by epidermal or platelet-derived growth factors

    SciTech Connect

    Liao Hongjun; Santos, Josue de los; Carpenter, Graham . E-mail: graham.carpenter@vanderbilt.edu

    2006-04-01

    While significant progress has been achieved in identifying the signal transduction elements that operate downstream of activated receptor tyrosine kinases, it remains unclear how different receptors utilize these signaling elements to achieve a common response. This study compares the capacity of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) to elicit the induction of immediate early gene (IEG) mRNAs in the presence or absence of phospholipase C-{gamma}1 (PLC-{gamma}1). The results show that while PDGF induction of nearly all IEG mRNAs is abrogated in plcg1 null cells, EGF induction of the same genes is variable in the null cells and exhibits three distinct responses. Five IEG mRNAs (Nup475, Cyr61, TF, Gly, TS7) are completely inducible by EGF in the presence or absence of PLC-{gamma}1, while three others (JE, KC, FIC) exhibit a stringent requirement for the presence of PLC-{gamma}1. The third type of response is exhibited by c-fos and COX-2. While these mRNAs are completely induced by EGF in the absence of PLC-{gamma}1, the time course of their accumulation is significantly delayed. No IEG was identified as completely inducible by EGF and PDGF in the absence of PLC-{gamma}1. Electrophoretic mobility shift assays (EMSA) demonstrate that PLC-{gamma}1 is necessary for nuclear extracts from PDGF-treated cells, but not EGF-treated cells, to interact with probes for AP-1 or NF-{kappa}B.

  17. Krüppel-like factor 4 is widely expressed in the mouse male and female reproductive tract and responds as an immediate early gene to activation of the protein kinase A in TM4 Sertoli cells.

    PubMed

    Godmann, M; Kosan, C; Behr, R

    2010-04-01

    Krüppel-like factor 4 (KLF4) is a zinc finger transcription factor critically involved in cell proliferation, differentiation, and carcinogenesis. Recently, KLF4 has also been used for the generation of induced pluripotent stem cells. In this study, we analyzed Klf4 expression in different mouse tissues using northern blot analysis and immunohistochemistry. Focusing on the male and female reproductive tract, we showed for the first time that KLF4 is expressed in the epithelia of the murine uterus and the vagina. In the male reproductive tract, we detected KLF4 in the epithelia of the epididymis, ductus deferens, coagulating gland, and the penis. As KLF4 is strongly inducible by FSH signaling in Sertoli cells and as this transcription factor is also involved in Sertoli cell development, we employed the mouse Sertoli cell line TM4 as a model system to investigate i) the induction kinetics of Klf4 upon activation of the cAMP/protein kinase A pathway by forskolin and ii) the effects of Klf4 induction on TM4 cell cycle progression. Interestingly, Klf4 mRNA and protein were rapidly but transiently induced, reaching peak levels after 90-120 min and declining to basal levels within 4 h. Compared with the inducible cAMP early repressor, an immediate early response gene, the induction kinetics of Klf4 is much faster. In conclusion, Klf4 is an immediate early gene in TM4 cells and its expression in several epithelia of the male and female reproductive tract suggests an important role of Klf4 in mouse reproductive functions.

  18. Expression of immediate early genes in the hippocampal formation of the black-capped chickadee (Poecile atricapillus) during a food-hoarding task.

    PubMed

    Smulders, T V; DeVoogd, T J

    2000-09-01

    Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal HF of both storing and retrieving chickadees compared to controls. In retrieving birds, the number of Fos-like immunoreactive neurons relates to the number of items remembered, while the number of ZENK-like immunoreactive neurons in the HF may be related to the accuracy of cache retrieval. These results imply that the brain might process complex information by recruiting more neurons into the network of active neurons. Thus, our results could help explain why food-hoarding birds have more HF neurons than non-hoarders, and why this number increases in autumn when large numbers of food items are cached.

  19. Acute nicotine enhances spontaneous recovery of contextual fear and changes c-fos early gene expression in infralimbic cortex, hippocampus, and amygdala.

    PubMed

    Kutlu, Munir G; Tumolo, Jessica M; Holliday, Erica; Garrett, Brendan; Gould, Thomas J

    2016-08-01

    Exposure therapy, which focuses on extinguishing fear-triggering cues and contexts, is widely used to treat post-traumatic stress disorder (PTSD). Yet, PTSD patients who received successful exposure therapy are vulnerable to relapse of fear response after a period of time, a phenomenon known as spontaneous recovery (SR). Increasing evidence suggests ventral hippocampus, basolateral amygdala, and infralimbic cortex may be involved in SR. PTSD patients also show high rates of comorbidity with nicotine dependence. While the comorbidity between smoking and PTSD might suggest nicotine may alter SR, the effects of nicotine on SR of contextual fear are unknown. In the present study, we tested the effects of acute nicotine administration on SR of extinguished contextual fear memories and c-fos immediate early gene immunohistochemistry in mice. Our results demonstrated that acute nicotine enhanced SR of extinguished fear whereas acute nicotine did not affect retrieval of unextinguished contextual memories. This suggests that the effect of acute nicotine on SR is specific for memories that have undergone extinction treatment. C-fos immunoreactive (IR) cells in the ventral hippocampus and basolateral amygdala were increased in the nicotine-treated mice following testing for SR, whereas the number of IR cells in the infralimbic cortex was decreased in the same group. Overall, this study suggests that nicotine may adversely affect context-specific relapse of fear memories and this effect is potentially mediated by the suppression of cortical regions and increased activity in the ventral hippocampus and amygdala. PMID:27421892

  20. Gammaherpesvirus Lytic Gene Expression as Characterized by DNA Array

    PubMed Central

    Ahn, Joo Wook; Powell, Kenneth L.; Kellam, Paul; Alber, Dagmar G.

    2002-01-01

    Gammaherpesviruses are associated with a number of diseases including lymphomas and other malignancies. Murine gammaherpesvirus 68 (MHV-68) constitutes the most amenable animal model for this family of pathogens. However experimental characterization of gammaherpesvirus gene expression, at either the protein or RNA level, lags behind that of other, better-studied alpha- and beta-herpesviruses. We have developed a cDNA array to globally characterize MHV-68 gene expression profiles, thus providing an experimental supplement to a genome that is chiefly annotated by homology. Viral genes started to be transcribed as early as 3 h postinfection (p.i.), and this was followed by a rapid escalation of gene expression that could be seen at 5 h p.i. Individual genes showed their own transcription profiles, and most genes were still being expressed at 18 h p.i. Open reading frames (ORFs) M3 (chemokine-binding protein), 52, and M9 (capsid protein) were particularly noticeable due to their very high levels of expression. Hierarchical cluster analysis of transcription profiles revealed four main groups of genes and allowed functional predictions to be made by comparing expression profiles of uncharacterized genes to those of genes of known function. Each gene was also categorized according to kinetic class by blocking de novo protein synthesis and viral DNA replication in vitro. One gene, ORF 73, was found to be expressed with α-kinetics, 30 genes were found to be expressed with β-kinetics, and 42 genes were found to be expressed with γ-kinetics. This fundamental characterization furthers the development of this model and provides an experimental basis for continued investigation of gammaherpesvirus pathology. PMID:12021358

  1. Gene Expression in First Trimester Preeclampsia Placenta

    PubMed Central

    Founds, Sandra A.; Terhorst, Lauren A.; Conrad, Kirk P.; Hogge, W. Allen; Jeyabalan, Arun; Conley, Yvette P.

    2013-01-01

    Background The goal of this study was to further validate eight candidate genes identified in a microarray analysis of first trimester placentas in preeclampsia. Material and method Surplus chorionic villus sampling (CVS) specimens of 4 women subsequently diagnosed with preeclampsia (PE) and 8 control women (C) without preeclampsia analyzed previously by microarray and 24 independent additional control samples (AS) were submitted for confirmatory studies by quantitative real-time polymerase chain reaction (qRT-PCR). Results Downregulation was significant in FSTL3 in PE as compared to C and AS (p = .04). PAEP was downregulated, but the difference was only significant between C and AS (p = .002) rather than between PE and either of the control groups. Expression levels for CFH, EPAS1, IGFBP1, MMP12, and SEMA3C were not statistically different among groups, but trends were consistent with microarray results; there was no anti-correlation. S100A8 was not measurable in all samples, probably because different probes and primers were needed. Conclusions This study corroborates reduced FSTL3 expression in the first trimester of preeclampsia. Nonsignificant trends in the other genes may require follow-up in studies powered for medium or medium/large effect sizes. qRT-PCR verification of the prior microarray of CVS may support the placental origins of preeclampsia hypothesis. Replication is needed for the candidate genes as potential biomarkers of susceptibility, early detection, and/or individualized care of maternal–infant preeclampsia. PMID:21044967

  2. T(lys), a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes.

    PubMed

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta; Contursi, Patrizia

    2013-05-01

    While studying the gene expression of the Sulfolobus spindle-shaped virus 1 (SSV1) in Sulfolobus solfataricus lysogenic cells, a novel viral transcript (T(lys)) was identified. Transcriptional analysis revealed that T(lys) is expressed only in the absence of UV irradiation and is downregulated during the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and T(ind)) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA-binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and T(ind) transcripts, as well as of its own promoter. Binding sites of F55 are included within a tandem-repeated sequence overlapping the transcription start sites and/or the B recognition element of the pertinent genes. The strongest binding was observed with the promoters of T5 and T6, and an apparent cooperativity in binding was observed with the T(ind) promoter. Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1. PMID:23514883

  3. Tlys, a Newly Identified Sulfolobus Spindle-Shaped Virus 1 Transcript Expressed in the Lysogenic State, Encodes a DNA-Binding Protein Interacting at the Promoters of the Early Genes

    PubMed Central

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta

    2013-01-01

    While studying the gene expression of the Sulfolobus spindle-shaped virus 1 (SSV1) in Sulfolobus solfataricus lysogenic cells, a novel viral transcript (Tlys) was identified. Transcriptional analysis revealed that Tlys is expressed only in the absence of UV irradiation and is downregulated during the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA-binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding sites of F55 are included within a tandem-repeated sequence overlapping the transcription start sites and/or the B recognition element of the pertinent genes. The strongest binding was observed with the promoters of T5 and T6, and an apparent cooperativity in binding was observed with the Tind promoter. Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1. PMID:23514883

  4. Gravity-Induced Gene Expression in Plants.

    NASA Astrophysics Data System (ADS)

    Sederoff, Heike; Heber, Steffen; Howard, Brian; Myburg-Nichols, Henrietta; Hammond, Rebecca; Salinas-Mondragon, Raul; Brown, Christopher S.

    Plants sense changes in their orientation towards the vector of gravity and respond with directional growth. Several metabolites in the signal transduction cascade have been identified. However, very little is known about the interaction between these sensing and signal transduction events and even less is known about their role in the differential growth response. Gravity induced changes in transcript abundance have been identified in Arabidopsis whole seedlings and root apices (Moseyko et al. 2002; Kimbrough et al. 2004). Gravity induced transcript abundance changes can be observed within less than 1 min after stimulation (Salinas-Mondragon et al. 2005). Gene expression however requires not only transcription but also translation of the mRNA. Translation can only occur when mRNA is associated with ribosomes, even though not all mRNA associated with ribosomes is actively translated. To approximate translational capacity we quantified whole genome transcript abundances in corn stem pulvini during the first hour after gravity stimulation in total and poly-ribosomal fractions. As in Arabidopsis root apices, transcript abundances of several clusters of genes responded to gravity stimulation. The vast majority of these transcripts were also found to associate with polyribosomes in the same temporal and quantitative pattern. These genes are transcriptionally regulated by gravity stimulation, but do not exhibit translational regulation. However, a small group of genes showed increased transcriptional regulation after gravity stimulation, but no association with polysomes. These transcripts likely are translationally repressed. The mechanism of translational repression for these transcripts is unknown. Based on the hypothesis that the genes essential for gravitropic responses should be expressed in most or all species, we compared the temporal gravity induced expression pattern of all orthologs identified between maize and Arabidopsis. A small group of genes showed high

  5. The effects of progesterone on transcriptional expression profiles of genes associated with hypothalamic-pituitary-gonadal and hypothalamic-pituitary-adrenal axes during the early development of zebrafish (Danio rerio).

    PubMed

    Liang, Yan-Qiu; Huang, Guo-Yong; Ying, Guang-Guo; Liu, Shuang-Shuang; Jiang, Yu-Xia; Liu, Shan; Peng, Feng-Jiao

    2015-06-01

    Progesterone (P4) has been reported in surface water, and it may have adverse effects on aquatic organisms. This study provided the transcriptional effects of P4 during the early development of zebrafish. Zebrafish embryos were exposed for 144 h post fertilization (hpf) to 0, 6, 45 and 90 ng L(-1) P4, and transcriptional expression profiles of the hypothalamic-pituitary-gonadal (HPG) and hypothalamic-pituitary-adrenal (HPA) axes were assessed every day. For the receptor signaling pathways, P4 significantly induced the transcript of Pgr gene above 45 ng L(-1) at 72 and 144 hpf, but inhibited its transcript above 6 ng L(-1) at 96 and 120 hpf. A significant up-regulation of Vtg1 mRNA was observed at 6 ng L(-1) P4 or higher at 24, 96 and 144 hpf. For the steroidogenic pathways, the transcriptional expression of Cyp11a1 and Hsd17b3 mRNAs was mediated by 6 ng L(-1) P4 or higher according to different exposure time points. In addition, P4 resulted in a significant induction of Cyp19a1a and Cyp11b mRNA expression while it caused a significant inhibition of Hsd11b2 mRNA expression above 6 ng L(-1). For the other target genes related to hypothalamic and pituitary hormones, P4 mainly modulated the transcripts of Gnrh2, Fshb and Lhb genes at 6 ng L(-1) or higher. The overall results from the present study indicate that P4 at environmentally relevant concentrations could cause the potential effects on zebrafish reproductive and adrenal endocrine systems by interfering with the HPG and HPA axes.

  6. Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

    PubMed

    Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

    2014-11-01

    Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

  7. Nfix Expression Critically Modulates Early B Lymphopoiesis and Myelopoiesis

    PubMed Central

    O’Connor, Caitríona; Campos, Joana; Osinski, Jason M.; Gronostajski, Richard M.; Michie, Alison M.; Keeshan, Karen

    2015-01-01

    The commitment of stem and progenitor cells toward specific hematopoietic lineages is tightly controlled by a number of transcription factors that regulate differentiation programs via the expression of lineage restricting genes. Nuclear factor one (NFI) transcription factors are important in regulating hematopoiesis and here we report an important physiological role of NFIX in B- and myeloid lineage commitment and differentiation. We demonstrate that NFIX acts as a regulator of lineage specification in the haematopoietic system and the expression of Nfix was transcriptionally downregulated as B cells commit and differentiate, whilst maintained in myeloid progenitor cells. Ectopic Nfix expression in vivo blocked early B cell development stage, coincident with the stage of its downregulation. Furthermore, loss of Nfix resulted in the perturbation of myeloid and lymphoid cell differentiation, and a skewing of gene expression involved in lineage fate determination. Nfix was able to promote myeloid differentiation of total bone marrow cells under B cell specific culture conditions but not when expressed in the hematopoietic stem cell (HSPC), consistent with its role in HSPC survival. The lineage choice determined by Nfix correlated with transcriptional changes in a number of genes, such as E2A, C/EBP, and Id genes. These data highlight a novel and critical role for NFIX transcription factor in hematopoiesis and in lineage specification. PMID:25780920

  8. The Epstein-Barr Virus BDLF4 Gene Is Required for Efficient Expression of Viral Late Lytic Genes.

    PubMed

    Watanabe, Takahiro; Narita, Yohei; Yoshida, Masahiro; Sato, Yoshitaka; Goshima, Fumi; Kimura, Hiroshi; Murata, Takayuki

    2015-10-01

    Epstein-Barr virus (EBV) is a gammaherpesvirus, associated with infectious mononucleosis and various types of malignancy. We focused here on the BDLF4 gene of EBV and identified it as a lytic gene, expressed with early kinetics. Viral late gene expression of the BDLF4 knockout strain was severely restricted; this could be restored by an exogenous supply of BDLF4. These results indicate that BDLF4 is important for the EBV lytic replication cycle, especially in late gene expression.

  9. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2012-05-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  10. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2008-06-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  11. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2013-10-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  12. Early expression of the gene for interphotoreceptor retinol-binding protein during photoreceptor differentiation suggests a critical role for the interphotoreceptor matrix in retinal development.

    PubMed

    Gonzalez-Fernandez, F; Healy, J I

    1990-12-01

    Interphotoreceptor retinol-binding protein (IRBP), the major protein component of the subretinal space, is in a strategic position to mediate cellular interactions between the retinal pigmented epithelium (RPE) and the neural retina. While IRBP appears to be involved in vitamin A transport during the visual cycle in the adult, the role of this protein during eye development has not been determined. As a first step to understanding the role of IRBP during retinal development, we have studied the expression of the mRNA for this glycolipoprotein during photoreceptor differentiation in the rat. A rat neural retina cDNA library was prepared from which an IRBP clone was isolated. The clone contains an open reading frame followed by a 3' noncoding sequence ending in 10 adenosine residues. The coding region has an identity of 83.9 and 82.5% with the nucleotide sequence of human and bovine IRBP, respectively. Rats (Sprague-Dawley, Wistar, and Royal College of Surgeon pink-eyed controls) have a 6.4 and a 5.2-kb mRNA for IRBP which are present in a 1:4 ratio and thus are the only vertebrate known to definitely have more than one major form of the IRBP message. Genomic Southern blots are consistent with the hypothesis that there is only one allele of the IRBP gene, suggesting that the two forms are produced by alternative processing of the mRNA. To generate an antisense RNA probe for use in molecular titration assays and Northern blots, an Eco RI-Bam HI fragment from the coding region was subcloned in between flanking Sp6 and T7 promoters. Total RNA was prepared from undissected rat globes from postnatal days p0-p22. The expression of the mRNA for IRBP was studied by Northern blots and the level of the transcripts determined by solution hybridization assays. Approximately 10(5) IRBP mRNA transcripts/micrograms total eye RNA are present at birth. This increases to a final level of 3.1 X 10(6) transcripts/micrograms total RNA by p9. The one-half maximal level of the mRNA occurs

  13. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  14. Expression of a human placental alkaline phosphatase gene in transfected cells: Use as a reporter for studies of gene expression

    SciTech Connect

    Henthorn, P.; Zervos, P.; Raducha, M.; Harris, H.; Kadesch, T.

    1988-09-01

    The human placental alkaline phosphatase gene has been cloned and reintroduced into mammalian cells. When a plasmid carrying the gene under control of the simian virus 40 early promoter (pSV2Apap) is transfected into a variety of different cell types, placental alkaline phosphatase activity can readily be detected by using whole cell suspensions or cell lysates. Alkaline phosphatase activity can also be visualized directly in individual transfected cells by histochemical staining. The gene is appropriate for use as a reporter in studies of gene regulation since its expression is dependent on the presence of exogenous transcription control elements. The overall assay to detect the expression of the gene is quantitative, very rapid, and inexpensive. Cotransfections of cells with pSV2Apap and a related plasmid carrying the bacterial chloramphenicol acetyltransferase gene (pSV2Acat) indicate that transcription of these two genes is detected with roughly the same sensitivity.

  15. Visually Relating Gene Expression and in vivo DNA Binding Data

    SciTech Connect

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  16. Profiling Gene Expression in Germinating Brassica Roots.

    PubMed

    Park, Myoung Ryoul; Wang, Yi-Hong; Hasenstein, Karl H

    2014-01-01

    Based on previously developed solid-phase gene extraction (SPGE) we examined the mRNA profile in primary roots of Brassica rapa seedlings for highly expressed genes like ACT7 (actin7), TUB (tubulin1), UBQ (ubiquitin), and low expressed GLK (glucokinase) during the first day post-germination. The assessment was based on the mRNA load of the SPGE probe of about 2.1 ng. The number of copies of the investigated genes changed spatially along the length of primary roots. The expression level of all genes differed significantly at each sample position. Among the examined genes ACT7 expression was most even along the root. UBQ was highest at the tip and root-shoot junction (RS). TUB and GLK showed a basipetal gradient. The temporal expression of UBQ was highest in the MZ 9 h after primary root emergence and higher than at any other sample position. Expressions of GLK in EZ and RS increased gradually over time. SPGE extraction is the result of oligo-dT and oligo-dA hybridization and the results illustrate that SPGE can be used for gene expression profiling at high spatial and temporal resolution. SPGE needles can be used within two weeks when stored at 4 °C. Our data indicate that gene expression studies that are based on the entire root miss important differences in gene expression that SPGE is able to resolve for example growth adjustments during gravitropism.

  17. The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes.

    PubMed

    Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques

    2011-02-01

    The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

  18. [Gene expression profile of spinal ventral horn in ALS].

    PubMed

    Yamamoto, Masahiko; Tanaka, Fumiaki; Sobue, Gen

    2007-10-01

    The causative pathomechanism of sporadic amyotrophic lateral sclerosis (ALS) is not clearly understood. Using microarray technology combined with laser-captured microdissection, gene expression profiles of degenerating spinal motor neurons as well as spinal ventral horn from autopsied patients with sporadic ALS were examined. Spinal motor neurons showed a distinct gene expression profile from the whole spinal ventral horn. Three percent of genes examined were significantly downregulated, and 1% were upregulated in motor neurons. In contrast with motor neurons, the total spinal ventral horn homogenates demonstrated 0.7% and 0.2% significant upregulation and downregulation of gene expression, respectively. Downregulated genes in motor neurons included those associated with cytoskeleton/axonal transport, transcription and cell surface antigens/receptors, such as dynactin 1 (DCTN1) and early growth response 3 (EGR3). In particular, DCTN1 was markedly downregulated in most residual motor neurons prior to the accumulation of pNF-H and ubiquitylated protein. Promoters for cell death pathway, death receptor 5 (DR5), cyclins C (CCNC) and A1 (CCNA), and caspases were upregulated, whereas cell death inhibitors, acetyl-CoA transporter (ACATN) and NF-kappaB (NFKB) were also upregulated. In terms of spinal ventral horn, the expression of genes related to cell surface antigens/receptors, transcription and cell adhesion/ECM were increased. The gene expression resulting in neurodegenerative and neuroprotective changes were both present in spinal motor neurons and ventral horn. Moreover, Inflammation-related genes, such as belonging to the cytokine family were not, however, significantly upregulated in either motor neurons or ventral horn. The sequence of motor neuron-specific gene expression changes from early DCTN1 downregulation to late CCNC upregulation in sporadic ALS can provide direct information on the genes leading to neurodegeneration and neuronal death, and are helpful

  19. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    PubMed Central

    2009-01-01

    second in basidiomata, confirming their distinctiveness. The number of transcripts of the gene for plerototolysin B increased in reddish-pink mycelium and indicated an activation of the initial basidiomata production even at this culturing stage. Expression of the glucose transporter gene increased in mycelium after the stress, coinciding with a decrease of adenylate cyclase gene transcription. This indicated that nutrient uptake can be an important signal to trigger fruiting in this fungus. Conclusion The identification of genes with increased expression in this phase of the life cycle of M. perniciosa opens up new possibilities of controlling fungus spread as well as of genetic studies of biological processes that lead to basidiomycete fruiting. This is the first comparative morphologic study of the early development both in vivo and in vitro of M. perniciosa basidiomata and the first description of genes expressed at this stage of the fungal life cycle. PMID:19653910

  20. Sex-specific gene expression in early life stage fathead minnows (Pimephales promelas) throughout development and after exposure to synthetic hormones

    EPA Science Inventory

    There is evidence that exposure to endocrine disrupting chemicals (EDCs) during early life stages can alter sex differentiation in fishes. Fathead minnows (Pimephales promelas) are commonly used as a model fish species in endocrine disruption studies. However, limited knowledge...

  1. Serial analysis of gene expression (SAGE) in rat liver regeneration

    SciTech Connect

    Cimica, Velasco . E-mail: vcimica@aecom.yu.edu; Batusic, Danko; Haralanova-Ilieva, Borislava; Chen, Yonglong; Hollemann, Thomas; Pieler, Tomas; Ramadori, Giuliano

    2007-08-31

    We have applied serial analysis of gene expression for studying the molecular mechanism of the rat liver regeneration in the model of 70% partial hepatectomy. We generated three SAGE libraries from a normal control liver (NL library: 52,343 tags), from a sham control operated liver (Sham library: 51,028 tags), and from a regenerating liver (PH library: 53,061 tags). By SAGE bioinformatics analysis we identified 40 induced genes and 20 repressed genes during the liver regeneration. We verified temporal expression of such genes by real time PCR during the regeneration process and we characterized 13 induced genes and 3 repressed genes. We found connective tissue growth factor transcript and protein induced very early at 4 h after PH operation before hepatocytes proliferation is triggered. Our study suggests CTGF as a growth factor signaling mediator that could be involved directly in the mechanism of liver regeneration induction.

  2. Gene Expression Patterns in Ovarian Carcinomas

    PubMed Central

    Schaner, Marci E.; Ross, Douglas T.; Ciaravino, Giuseppe; Sørlie, Therese; Troyanskaya, Olga; Diehn, Maximilian; Wang, Yan C.; Duran, George E.; Sikic, Thomas L.; Caldeira, Sandra; Skomedal, Hanne; Tu, I-Ping; Hernandez-Boussard, Tina; Johnson, Steven W.; O'Dwyer, Peter J.; Fero, Michael J.; Kristensen, Gunnar B.; Børresen-Dale, Anne-Lise; Hastie, Trevor; Tibshirani, Robert; van de Rijn, Matt; Teng, Nelson N.; Longacre, Teri A.; Botstein, David; Brown, Patrick O.; Sikic, Branimir I.

    2003-01-01

    We used DNA microarrays to characterize the global gene expression patterns in surface epithelial cancers of the ovary. We identified groups of genes that distinguished the clear cell subtype from other ovarian carcinomas, grade I and II from grade III serous papillary carcinomas, and ovarian from breast carcinomas. Six clear cell carcinomas were distinguished from 36 other ovarian carcinomas (predominantly serous papillary) based on their gene expression patterns. The differences may yield insights into the worse prognosis and therapeutic resistance associated with clear cell carcinomas. A comparison of the gene expression patterns in the ovarian cancers to published data of gene expression in breast cancers revealed a large number of differentially expressed genes. We identified a group of 62 genes that correctly classified all 125 breast and ovarian cancer specimens. Among the best discriminators more highly expressed in the ovarian carcinomas were PAX8 (paired box gene 8), mesothelin, and ephrin-B1 (EFNB1). Although estrogen receptor was expressed in both the ovarian and breast cancers, genes that are coregulated with the estrogen receptor in breast cancers, including GATA-3, LIV-1, and X-box binding protein 1, did not show a similar pattern of coexpression in the ovarian cancers. PMID:12960427

  3. Human cytomegalovirus miR-UL112-1 promotes the down-regulation of viral immediate early-gene expression during latency to prevent T-cell recognition of latently infected cells.

    PubMed

    Lau, Betty; Poole, Emma; Van Damme, Ellen; Bunkens, Lieve; Sowash, Madeleine; King, Harry; Murphy, Eain; Wills, Mark; Van Loock, Marnix; Sinclair, John

    2016-09-01

    Human cytomegalovirus, a member of the herpesvirus family, can cause significant morbidity and mortality in immune compromised patients resulting from either primary lytic infection or reactivation from latency. Latent infection is associated with a restricted viral transcription programme compared to lytic infection which consists of defined protein coding RNAs but also includes a number of virally encoded microRNAs (miRNAs). One of these, miR-UL112-1, is known to target the major lytic IE72 transcript but, to date, a functional role for miR-UL112-1 during latent infection has not been shown. To address this, we have analysed latent infection in myeloid cells using a virus in which the target site for miR-UL112-1 in the 3' UTR of IE72 was removed such that any IE72 RNA present during latent infection would no longer be subject to regulation by miR-UL112-1 through the RNAi pathway. Our data show that removal of the miR-UL112-1 target site in IE72 results in increased levels of IE72 RNA in experimentally latent primary monocytes. Furthermore, this resulted in induction of immediate early (IE) gene expression that is detectable by IE-specific cytotoxic T-cells (CTLs); no such CTL recognition of monocytes latently infected with wild-type virus was observed. We also recapitulated these findings in the more tractable THP-1 cell line model of latency. These observations argue that an important role for miR-UL112-1 during latency is to ensure tight control of lytic viral immediate early (IE) gene expression thereby preventing recognition of latently infected cells by the host's potent pre-existing anti-viral CTL response.

  4. Differentiation, early response gene expression, and apoptosis induction in human breast tumor cells by Okadaic Acid and related inhibitors of protein phosphatases 1 and 2A. Okadaic acid effects on human breast tumor cells

    SciTech Connect

    Kiguchi, K.; Giometti, C.; Chubb, C.H.; Huberman, E.; Fujiki, H.

    1992-08-20

    Okadaic acid (OA), a tumor promoter and an inhibitor of protein phosphatases (PPH) 1 and 2A, was tested for its ability to induce events associated with differentiation and apoptosis induction in the human MCF-7, AU-565, and MB-231 breast tumor cells. Differentiation in these cells was characterized by inhibition of cell multiplication, reactivity with monoclonal antibodies to {alpha}-lactalbumin and {beta}-casein, and the appearance of large lipid droplets; apoptosis was characterized by the appearance of cells with segmented and fragmented nuclei. In the MCF-7 cell line, OA at nanomolar concentrations elicited within 5 min an increase in the phosphorylation of a set of cellular proteins, within hours expression of the early response genes, junB, c-jun, and c-fos and within days manifestation of differentiation and apoptosis markers. Differentiation and apoptosis were also induced by dinophysistoxin-1 and calyculin A, two other tumor promoters and inhibitors of PPH 1 and 2A, but not by OA tetramethyl ether, an inactive OA derivative, or microcystin LR, a PPH 1 and 2A inhibitor that penetrates epithelial cells poorly. OA induced both differentiation and apoptosis in MB-231 cells and MCF-7, but only differentiation in AU-565 cells. Phorbol 12-myristate 13-acetate (PMA), a tumor promoter that is not an inhibitor of PPH 1 and 2A but rather an activator of protein kinase C, also induced within minutes the phosphorylation of proteins, within hours the expression of early response genes, and within days differentiation, but not apoptosis; yet PMA was able to attenuate apoptosis induced by the okadaic acid class of tumor promoters. These results indicate that OA and related agents can induce processes that result in tumor breast cell differentiation and apoptosis, and this induction is associated with their ability to inhibit PPH 1 and 2A. Yet apoptosis is not necessarily required for differentiation induction by these agents.

  5. Arabidopsis gene expression patterns during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

  6. Gearbox gene expression and growth rate.

    PubMed

    Aldea, M; Garrido, T; Tormo, A

    1993-07-01

    Regulation of gene expression in prokaryotic cells usually takes place at the level of transcription initiation. Different forms of RNA polymerase recognizing specific promoters are engaged in the control of many prokaryotic regulons. This also seems to be the case for some Escherichia coli genes that are induced at low growth rates and by nutrient starvation. Their gene products are synthesized at levels inversely proportional to growth rate, and this mode of regulation has been termed gearbox gene expression. This kind of growth-rate modulation is exerted by specific transcriptional initiation signals, the gearbox promoters, and some of them depend on a putative new σ factor (RpoS). Gearbox promoters drive expression of morphogenetic and cell division genes at constant levels per cell and cycle to meet the demands of cell division and septum formation. A mechanism is proposed that could sense the growth rate of the cell to alter gene expression by the action of specific σ factors.

  7. The gene expression signatures of melanoma progression

    PubMed Central

    Haqq, Christopher; Nosrati, Mehdi; Sudilovsky, Daniel; Crothers, Julia; Khodabakhsh, Daniel; Pulliam, Brian L.; Federman, Scot; Miller, James R.; Allen, Robert E.; Singer, Mark I.; Leong, Stanley P. L.; Ljung, Britt-Marie; Sagebiel, Richard W.; Kashani-Sabet, Mohammed

    2005-01-01

    Because of the paucity of available tissue, little information has previously been available regarding the gene expression profiles of primary melanomas. To understand the molecular basis of melanoma progression, we compared the gene expression profiles of a series of nevi, primary melanomas, and melanoma metastases. We found that metastatic melanomas exhibit two dichotomous patterns of gene expression, which unexpectedly reflect gene expression differences already apparent in comparing laser-capture microdissected radial and vertical phases of a large primary melanoma. Unsupervised hierarchical clustering accurately separated nevi and primary melanomas. Multiclass significance analysis of microarrays comparing normal skin, nevi, primary melanomas, and the two types of metastatic melanoma identified 2,602 transcripts that significantly correlated with sample class. These results suggest that melanoma pathogenesis can be understood as a series of distinct molecular events. The gene expression signatures identified here provide the basis for developing new diagnostics and targeting therapies for patients with malignant melanoma. PMID:15833814

  8. Global Gene Expression Analysis of Murine Limb Development

    PubMed Central

    Taher, Leila; Collette, Nicole M.; Murugesh, Deepa; Maxwell, Evan; Ovcharenko, Ivan; Loots, Gabriela G.

    2011-01-01

    Detailed information about stage-specific changes in gene expression is crucial for understanding the gene regulatory networks underlying development and the various signal transduction pathways contributing to morphogenesis. Here we describe the global gene expression dynamics during early murine limb development, when cartilage, tendons, muscle, joints, vasculature and nerves are specified and the musculoskeletal system of limbs is established. We used whole-genome microarrays to identify genes with differential expression at 5 stages of limb development (E9.5 to 13.5), during fore- and hind-limb patterning. We found that the onset of limb formation is characterized by an up-regulation of transcription factors, which is followed by a massive activation of genes during E10.5 and E11.5 which levels off at later time points. Among the 3520 genes identified as significantly up-regulated in the limb, we find ∼30% to be novel, dramatically expanding the repertoire of candidate genes likely to function in the limb. Hierarchical and stage-specific clustering identified expression profiles that are likely to correlate with functional programs during limb development and further characterization of these transcripts will provide new insights into specific tissue patterning processes. Here, we provide for the first time a comprehensive analysis of developmentally regulated genes during murine limb development, and provide some novel insights into the expression dynamics governing limb morphogenesis. PMID:22174793

  9. Global gene expression analysis of murine limb development.

    PubMed

    Taher, Leila; Collette, Nicole M; Murugesh, Deepa; Maxwell, Evan; Ovcharenko, Ivan; Loots, Gabriela G

    2011-01-01

    Detailed information about stage-specific changes in gene expression is crucial for understanding the gene regulatory networks underlying development and the various signal transduction pathways contributing to morphogenesis. Here we describe the global gene expression dynamics during early murine limb development, when cartilage, tendons, muscle, joints, vasculature and nerves are specified and the musculoskeletal system of limbs is established. We used whole-genome microarrays to identify genes with differential expression at 5 stages of limb development (E9.5 to 13.5), during fore- and hind-limb patterning. We found that the onset of limb formation is characterized by an up-regulation of transcription factors, which is followed by a massive activation of genes during E10.5 and E11.5 which levels off at later time points. Among the 3520 genes identified as significantly up-regulated in the limb, we find ~30% to be novel, dramatically expanding the repertoire of candidate genes likely to function in the limb. Hierarchical and stage-specific clustering identified expression profiles that are likely to correlate with functional programs during limb development and further characterization of these transcripts will provide new insights into specific tissue patterning processes. Here, we provide for the first time a comprehensive analysis of developmentally regulated genes during murine limb development, and provide some novel insights into the expression dynamics governing limb morphogenesis.

  10. Early evolution of the LIM homeobox gene family

    SciTech Connect

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  11. The Mouse Gene Expression Database (GXD)

    PubMed Central

    Ringwald, Martin; Eppig, Janan T.; Begley, Dale A.; Corradi, John P.; McCright, Ingeborg J.; Hayamizu, Terry F.; Hill, David P.; Kadin, James A.; Richardson, Joel E.

    2001-01-01

    The Gene Expression Database (GXD) is a community resource of gene expression information for the laboratory mouse. By combining the different types of expression data, GXD aims to provide increasingly complete information about the expression profiles of genes in different mouse strains and mutants, thus enabling valuable insights into the molecular networks that underlie normal development and disease. GXD is integrated with the Mouse Genome Database (MGD). Extensive interconnections with sequence databases and with databases from other species, and the development and use of shared controlled vocabularies extend GXD’s utility for the analysis of gene expression information. GXD is accessible through the Mouse Genome Informatics web site at http://www.informatic s.jax.org/ or directly at http://www.informatics.jax.org/me nus/expression_menu.shtml. PMID:11125060

  12. Photosynthetic gene expression in higher plants.

    PubMed

    Berry, James O; Yerramsetty, Pradeep; Zielinski, Amy M; Mure, Christopher M

    2013-11-01

    Within the chloroplasts of higher plants and algae, photosynthesis converts light into biological energy, fueling the assimilation of atmospheric carbon dioxide into biologically useful molecules. Two major steps, photosynthetic electron transport and the Calvin-Benson cycle, require many gene products encoded from chloroplast as well as nuclear genomes. The expression of genes in both cellular compartments is highly dynamic and influenced by a diverse range of factors. Light is the primary environmental determinant of photosynthetic gene expression. Working through photoreceptors such as phytochrome, light regulates photosynthetic genes at transcriptional and posttranscriptional levels. Other processes that affect photosynthetic gene expression include photosynthetic activity, development, and biotic and abiotic stress. Anterograde (from nucleus to chloroplast) and retrograde (from chloroplast to nucleus) signaling insures the highly coordinated expression of the many photosynthetic genes between these different compartments. Anterograde signaling incorporates nuclear-encoded transcriptional and posttranscriptional regulators, such as sigma factors and RNA-binding proteins, respectively. Retrograde signaling utilizes photosynthetic processes such as photosynthetic electron transport and redox signaling to influence the expression of photosynthetic genes in the nucleus. The basic C3 photosynthetic pathway serves as the default form used by most of the plant species on earth. High temperature and water stress associated with arid environments have led to the development of specialized C4 and CAM photosynthesis, which evolved as modifications of the basic default expression program. The goal of this article is to explain and summarize the many gene expression and regulatory processes that work together to support photosynthetic function in plants.

  13. Effect of nTiO2 and nCeO2 nanoparticles on gene expression, germination, and early development in plants

    EPA Science Inventory

    Ten agronomic plant species and Arabidopsis thaliana were exposed to different concentrations of the metal oxide nanoparticles (NPs) TiO2 or CeO2 (0 - 1000 mg L-1) and monitored to examine effects on germination rate and early seedling development. Endpoints measured included ge...

  14. Gene Expression Noise, Fitness Landscapes, and Evolution

    NASA Astrophysics Data System (ADS)

    Charlebois, Daniel

    The stochastic (or noisy) process of gene expression can have fitness consequences for living organisms. For example, gene expression noise facilitates the development of drug resistance by increasing the time scale at which beneficial phenotypic states can be maintained. The present work investigates the relationship between gene expression noise and the fitness landscape. By incorporating the costs and benefits of gene expression, we track how the fluctuation magnitude and timescale of expression noise evolve in simulations of cell populations under stress. We find that properties of expression noise evolve to maximize fitness on the fitness landscape, and that low levels of expression noise emerge when the fitness benefits of gene expression exceed the fitness costs (and that high levels of noise emerge when the costs of expression exceed the benefits). The findings from our theoretical/computational work offer new hypotheses on the development of drug resistance, some of which are now being investigated in evolution experiments in our laboratory using well-characterized synthetic gene regulatory networks in budding yeast. Nserc Postdoctoral Fellowship (Grant No. PDF-453977-2014).

  15. Expression of the Arabidopsis Gene Akr Coincides with Chloroplast Development.

    PubMed

    Zhang, H.; Wang, J.; Goodman, H. M.

    1994-12-01

    Reduced expression of a nuclear gene of Arabidopsis thaliana, Akr, results in the formation of chlorotic plants due to a block in the proplastid-to-chloroplast development pathway (H. Zhang, D.C. Scheirer, W. Fowle, H.M. Goodman [1992] Plant Cell 4: 1575-1588). In an effort to discern the function of the Akr gene product in chloroplast development, transgenic plants containing an Akr::[beta]-glucuronidase gene fusion were constructed to monitor the spatial and temporal patterns of Akr expression. Akr is expressed only in chloroplast-containing tissues and maximal expression occurs during the seedling stage, coincident with chloroplast development. This result is consistent with the hypothesis that Akr is required at an early stage of chloroplast development. The effects of an AKR deficiency on the expression of nuclear and plastid genes required for photosynthetic activity were also examined. Within chloroplast-deficient leaves of plants in which Akr expression is limited by the presence of Akr antisense transgenes or truncated Akr sense transgenes, mRNAs for the nuclear genes Cab2, Cab4, RbcS, and GapA are present at wild-type levels; similarly, levels of mRNAs for the plastid genes rbcL and psbA are not affected by the AKR deficiency. Thus, although expression of these photosynthetic genes is tightly coordinated with the development and maintenance of chloroplasts in wild-type plants, their expression is unaffected in AKR-deficient chlorotic leaves. Therefore, we propose that Akr functions in a pathway different from the one controlling the expression and regulation of the photosynthetic genes during chloroplast development, and at a specific developmental stage after the putative plastid factor is made.

  16. Striatal patch compartment lesions alter methamphetamine-induced behavior and immediate early gene expression in the striatum, substantia nigra and frontal cortex.

    PubMed

    Murray, Ryan C; Gilbert, Yamiece E; Logan, Anna S; Hebbard, John C; Horner, Kristen A

    2014-07-01

    Methamphetamine (METH) induces stereotypy, which is characterized as inflexible, repetitive behavior. Enhanced activation of the patch compartment of the striatum has been correlated with stereotypy, suggesting that stereotypy may be related to preferential activation of this region. However, the specific contribution of the patch compartment to METH-induced stereotypy is not clear. To elucidate the involvement of the patch compartment to the development of METH-induced stereotypy, we determined if destruction of this sub-region altered METH-induced behaviors. Animals were bilaterally infused in the striatum with the neurotoxin dermorphin-saporin (DERM-SAP; 17 ng/μl) to specifically ablate the neurons of the patch compartment. Eight days later, animals were treated with METH (7.5 mg/kg), placed in activity chambers, observed for 2 h and killed. DERM-SAP pretreatment significantly reduced the number and total area of mu-labeled patches in the striatum. DERM-SAP pretreatment significantly reduced the intensity of METH-induced stereotypy and the spatial immobility typically observed with METH-induced stereotypy. In support of this observation, DERM-SAP pretreatment also significantly increased locomotor activity in METH-treated animals. In the striatum, DERM-SAP pretreatment attenuated METH-induced c-Fos expression in the patch compartment, while enhancing METH-induced c-Fos expression in the matrix compartment. DERM-SAP pretreatment followed by METH administration augmented c-Fos expression in the SNpc and reduced METH-induced c-Fos expression in the SNpr. In the medial prefrontal, but not sensorimotor cortex, c-Fos and zif/268 expression was increased following METH treatment in animals pre-treated with DERM-SAP. These data indicate that the patch compartment is necessary for the expression of repetitive behaviors and suggests that alterations in activity in the basal ganglia may contribute to this phenomenon.

  17. Prostaglandin F2α Stimulates the Expression and Secretion of Transforming Growth Factor B1 Via Induction of the Early Growth Response 1 Gene (EGR1) in the Bovine Corpus Luteum

    PubMed Central

    Hou, Xiaoying; Arvisais, Edward W.; Jiang, Chao; Chen, Dong-bao; Roy, Shyamal K.; Pate, Joy L.; Hansen, Thomas R.; Rueda, Bo R.; Davis, John S.

    2008-01-01

    In most mammals, prostaglandin F2α (PGF2α) is believed to be a trigger that induces the regression of the corpus luteum (CL), whereby progesterone synthesis is inhibited, the luteal structure involutes, and the reproductive cycle resumes. Studies have shown that the early growth response 1 (EGR1) protein can induce the expression of proapoptotic proteins, suggesting that EGR1 may play a role in luteal regression. Our hypothesis is that EGR1 mediates the actions of PGF2α by inducing the expression of TGF β1 (TGFB1), a key tissue remodeling protein. The levels of EGR1 mRNA and protein were up-regulated in the bovine CL during PGF2α-induced luteolysis in vivo and in PGF2α-treated luteal cells in vitro. Using chemical and genetic approaches, the RAF/MAPK kinase (MEK) 1/ERK pathway was identified as a proximal signaling event required for the induction of EGR1 in PGF2α-treated cells. Treatment with PGF2α increased the expression of TGFB1 mRNA and protein as well as the binding of EGR1 protein to TGFB1 promoter in bovine luteal cells. The effect of PGF2α on TGFB1 expression was mimicked by a protein kinase C (PKC)/RAF/MEK1/ERK activator or adenoviral-mediated expression of EGR1. The stimulatory effect of PGF2α on TGFB1 mRNA and TGFB1 protein secretion was inhibited by blockade of MEK1/ERK signaling and by adenoviral-mediated expression of NAB2, an EGR1 binding protein that inhibits EGR1 transcriptional activity. Treatment of luteal cells with TGFB1 reduced progesterone secretion, implicating TGFB1 in luteal regression. These studies demonstrate that PGF2α stimulates the expression of EGR1 and TGFB1 in the CL. We suggest that EGR1 plays a role in the expression of genes whose cognate proteins coordinate luteal regression. PMID:17916653

  18. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-07-07

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development.

  19. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

    PubMed

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  20. Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling

    PubMed Central

    Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

    2016-01-01

    During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. PMID:27194808

  1. Analysis of lamprey clustered Fox genes: insight into Fox gene evolution and expression in vertebrates.

    PubMed

    Wotton, Karl R; Shimeld, Sebastian M

    2011-12-01

    In the human genome, members of the FoxC, FoxF, FoxL1, and FoxQ1 gene families are found in two paralagous clusters. One cluster contains the genes FOXQ1, FOXF2, FOXC1 and the second consists of FOXF1, FOXC2, and FOXL1. In jawed vertebrates these genes are known to be expressed in different pharyngeal tissues and all, except FoxQ1, are involved in patterning the early embryonic mesoderm. We have previously traced the evolution of this cluster in the bony vertebrates, and the gene content is identical in the dogfish, a member of the most basally branching lineage of the jawed vertebrates. Here we extend these analyses to jawless vertebrates. Using genomic searches and molecular approaches we have identified homologues of these genes from lampreys. We identify two FoxC genes, two FoxF genes, two FoxQ1 genes and single FoxL1 gene. We examine the embryonic expression of one predominantly mesodermally expressed gene family, FoxC, and the endodermally expressed member of the cluster, FoxQ1. We identified FoxQ1 transcripts in the pharyngeal endoderm, while the two FoxC genes are differentially expressed in the pharyngeal mesenchyme and ectoderm. Furthermore we identify conserved expression of lamprey FoxC genes in the paraxial and intermediate mesoderms. We interpret our results through a chordate-wide comparison of expression patterns and discuss gene content in the context of theories on the evolution of the vertebrate genome.

  2. Copper induces the expression of cholesterogenic genes in human macrophages.

    PubMed

    Svensson, Per Arne; Englund, Mikael C O; Markström, Emilia; Ohlsson, Bertil G; Jernås, Margareta; Billig, Håkan; Torgerson, Jarl S; Wiklund, Olov; Carlsson, Lena M S; Carlsson, Björn

    2003-07-01

    Accumulation of lipids and cholesterol by macrophages and subsequent transformation into foam cells are key features in development of atherosclerosis. Serum copper concentrations have been shown to be associated with cardiovascular disease. However, the mechanism behind the proatherogenic effect of copper is not clear. We used DNA microarrays to define the changes in gene expression profile in response to copper exposure of human macrophages. Expression monitoring by DNA microarray revealed 91 genes that were regulated. Copper increased the expression of seven cholesterogenic genes (3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) synthase, IPP isomerase, squalene synthase, squalene epoxidase, methyl sterol oxidase, H105e3 mRNA and sterol-C5-desaturase) and low-density lipoprotein receptor (LDL-R), and decreased the expression of CD36 and lipid binding proteins. The expression of LDL-R and HMG CoA reductase was also investigated using real time PCR. The expression of both of these genes was increased after copper treatment of macrophages (P<0.01 and P<0.01, respectively). We conclude that copper activates cholesterogenic genes in macrophages, which may provide a mechanism for the association between copper and atherosclerosis. The effect of copper on cholesterogenic genes may also have implications for liver steatosis in early stages of Wilson's disease.

  3. Gene expression analysis of aberrant signaling pathways in meningiomas

    PubMed Central

    TORRES-MARTÍN, MIGUEL; MARTINEZ-GLEZ, VICTOR; PEÑA-GRANERO, CAROLINA; ISLA, ALBERTO; LASSALETTA, LUIS; DE CAMPOS, JOSE M.; PINTO, GIOVANNY R.; BURBANO, ROMMEL R.; MELÉNDEZ, BÁRBARA; CASTRESANA, JAVIER S.; REY, JUAN A.

    2013-01-01

    Examining aberrant pathway alterations is one method for understanding the abnormal signals that are involved in tumorigenesis and tumor progression. In the present study, expression arrays were performed on tumor-related genes in meningiomas. The GE Array Q Series HS-006 was used to determine the expression levels of 96 genes that corresponded to six primary biological regulatory pathways in a series of 42 meningiomas, including 32 grade I, four recurrent grade I and six grade II tumors, in addition to three normal tissue controls. Results showed that 25 genes that were primarily associated with apoptosis and angiogenesis functions were downregulated and 13 genes frequently involving DNA damage repair functions were upregulated. In addition to the inactivation of the neurofibromin gene, NF2, which is considered to be an early step in tumorigenesis, variations of other biological regulatory pathways may play a significant role in the development of meningioma. PMID:23946817

  4. Gene expression analysis of aberrant signaling pathways in meningiomas.

    PubMed

    Torres-Martín, Miguel; Martinez-Glez, Victor; Peña-Granero, Carolina; Isla, Alberto; Lassaletta, Luis; DE Campos, Jose M; Pinto, Giovanny R; Burbano, Rommel R; Meléndez, Bárbara; Castresana, Javier S; Rey, Juan A

    2013-07-01

    Examining aberrant pathway alterations is one method for understanding the abnormal signals that are involved in tumorigenesis and tumor progression. In the present study, expression arrays were performed on tumor-related genes in meningiomas. The GE Array Q Series HS-006 was used to determine the expression levels of 96 genes that corresponded to six primary biological regulatory pathways in a series of 42 meningiomas, including 32 grade I, four recurrent grade I and six grade II tumors, in addition to three normal tissue controls. Results showed that 25 genes that were primarily associated with apoptosis and angiogenesis functions were downregulated and 13 genes frequently involving DNA damage repair functions were upregulated. In addition to the inactivation of the neurofibromin gene, NF2, which is considered to be an early step in tumorigenesis, variations of other biological regulatory pathways may play a significant role in the development of meningioma. PMID:23946817

  5. Gene expression correlates of unexplained fatigue.

    PubMed

    Whistler, Toni; Taylor, Renee; Craddock, R Cameron; Broderick, Gordon; Klimas, Nancy; Unger, Elizabeth R

    2006-04-01

    Quantitative trait analysis (QTA) can be used to test whether the expression of a particular gene significantly correlates with some ordinal variable. To limit the number of false discoveries in the gene list, a multivariate permutation test can also be performed. The purpose of this study is to identify peripheral blood gene expression correlates of fatigue using quantitative trait analysis on gene expression data from 20,000 genes and fatigue traits measured using the multidimensional fatigue inventory (MFI). A total of 839 genes were statistically associated with fatigue measures. These mapped to biological pathways such as oxidative phosphorylation, gluconeogenesis, lipid metabolism, and several signal transduction pathways. However, more than 50% are not functionally annotated or associated with identified pathways. There is some overlap with genes implicated in other studies using differential gene expression. However, QTA allows detection of alterations that may not reach statistical significance in class comparison analyses, but which could contribute to disease pathophysiology. This study supports the use of phenotypic measures of chronic fatigue syndrome (CFS) and QTA as important for additional studies of this complex illness. Gene expression correlates of other phenotypic measures in the CFS Computational Challenge (C3) data set could be useful. Future studies of CFS should include as many precise measures of disease phenotype as is practical.

  6. Noise Minimisation in Gene Expression Switches

    PubMed Central

    Monteoliva, Diana; McCarthy, Christina B.; Diambra, Luis

    2013-01-01

    Gene expression is subject to stochastic variation which leads to fluctuations in the rate of protein production. Recently, a study in yeast at a genomic scale showed that, in some cases, gene expression variability alters phenotypes while, in other cases, these remain unchanged despite fluctuations in the expression of other genes. These studies suggested that noise in gene expression is a physiologically relevant trait and, to prevent harmful stochastic variation in the expression levels of some genes, it can be subject to minimisation. However, the mechanisms for noise minimisation are still unclear. In the present work, we analysed how noise expression depends on the architecture of the cis-regulatory system, in particular on the number of regulatory binding sites. Using analytical calculations and stochastic simulations, we found that the fluctuation level in noise expression decreased with the number of regulatory sites when regulatory transcription factors interacted with only one other bound transcription factor. In contrast, we observed that there was an optimal number of binding sites when transcription factors interacted with many bound transcription factors. This finding suggested a new mechanism for preventing large fluctuations in the expression of genes which are sensitive to the concentration of regulators. PMID:24376783

  7. Noise minimisation in gene expression switches.

    PubMed

    Monteoliva, Diana; McCarthy, Christina B; Diambra, Luis

    2013-01-01

    Gene expression is subject to stochastic variation which leads to fluctuations in the rate of protein production. Recently, a study in yeast at a genomic scale showed that, in some cases, gene expression variability alters phenotypes while, in other cases, these remain unchanged despite fluctuations in the expression of other genes. These studies suggested that noise in gene expression is a physiologically relevant trait and, to prevent harmful stochastic variation in the expression levels of some genes, it can be subject to minimisation. However, the mechanisms for noise minimisation are still unclear. In the present work, we analysed how noise expression depends on the architecture of the cis-regulatory system, in particular on the number of regulatory binding sites. Using analytical calculations and stochastic simulations, we found that the fluctuation level in noise expression decreased with the number of regulatory sites when regulatory transcription factors interacted with only one other bound transcription factor. In contrast, we observed that there was an optimal number of binding sites when transcription factors interacted with many bound transcription factors. This finding suggested a new mechanism for preventing large fluctuations in the expression of genes which are sensitive to the concentration of regulators.

  8. Gene Expression Signature in Endemic Osteoarthritis by Microarray Analysis

    PubMed Central

    Wang, Xi; Ning, Yujie; Zhang, Feng; Yu, Fangfang; Tan, Wuhong; Lei, Yanxia; Wu, Cuiyan; Zheng, Jingjing; Wang, Sen; Yu, Hanjie; Li, Zheng; Lammi, Mikko J.; Guo, Xiong

    2015-01-01

    Kashin-Beck Disease (KBD) is an endemic osteochondropathy with an unknown pathogenesis. Diagnosis of KBD is effective only in advanced cases, which eliminates the possibility of early treatment and leads to an inevitable exacerbation of symptoms. Therefore, we aim to identify an accurate blood-based gene signature for the detection of KBD. Previously published gene expression profile data on cartilage and peripheral blood mononuclear cells (PBMCs) from adults with KBD were compared to select potential target genes. Microarray analysis was conducted to evaluate the expression of the target genes in a cohort of 100 KBD patients and 100 healthy controls. A gene expression signature was identified using a training set, which was subsequently validated using an independent test set with a minimum redundancy maximum relevance (mRMR) algorithm and support vector machine (SVM) algorithm. Fifty unique genes were differentially expressed between KBD patients and healthy controls. A 20-gene signature was identified that distinguished between KBD patients and controls with 90% accuracy, 85% sensitivity, and 95% specificity. This study identified a 20-gene signature that accurately distinguishes between patients with KBD and controls using peripheral blood samples. These results promote the further development of blood-based genetic biomarkers for detection of KBD. PMID:25997002

  9. Nucleosome repositioning underlies dynamic gene expression

    PubMed Central

    Nocetti, Nicolas; Whitehouse, Iestyn

    2016-01-01

    Nucleosome repositioning at gene promoters is a fundamental aspect of the regulation of gene expression. However, the extent to which nucleosome repositioning is used within eukaryotic genomes is poorly understood. Here we report a comprehensive analysis of nucleosome positions as budding yeast transit through an ultradian cycle in which expression of >50% of all genes is highly synchronized. We present evidence of extensive nucleosome repositioning at thousands of gene promoters as genes are activated and repressed. During activation, nucleosomes are relocated to allow sites of general transcription factor binding and transcription initiation to become accessible. The extent of nucleosome shifting is closely related to the dynamic range of gene transcription and generally related to DNA sequence properties and use of the coactivators TFIID or SAGA. However, dynamic gene expression is not limited to SAGA-regulated promoters and is an inherent feature of most genes. While nucleosome repositioning occurs pervasively, we found that a class of genes required for growth experience acute nucleosome shifting as cells enter the cell cycle. Significantly, our data identify that the ATP-dependent chromatin-remodeling enzyme Snf2 plays a fundamental role in nucleosome repositioning and the expression of growth genes. We also reveal that nucleosome organization changes extensively in concert with phases of the cell cycle, with large, regularly spaced nucleosome arrays being established in mitosis. Collectively, our data and analysis provide a framework for understanding nucleosome dynamics in relation to fundamental DNA-dependent transactions. PMID:26966245

  10. Nucleosome repositioning underlies dynamic gene expression.

    PubMed

    Nocetti, Nicolas; Whitehouse, Iestyn

    2016-03-15

    Nucleosome repositioning at gene promoters is a fundamental aspect of the regulation of gene expression. However, the extent to which nucleosome repositioning is used within eukaryotic genomes is poorly understood. Here we report a comprehensive analysis of nucleosome positions as budding yeast transit through an ultradian cycle in which expression of >50% of all genes is highly synchronized. We present evidence of extensive nucleosome repositioning at thousands of gene promoters as genes are activated and repressed. During activation, nucleosomes are relocated to allow sites of general transcription factor binding and transcription initiation to become accessible. The extent of nucleosome shifting is closely related to the dynamic range of gene transcription and generally related to DNA sequence properties and use of the coactivators TFIID or SAGA. However, dynamic gene expression is not limited to SAGA-regulated promoters and is an inherent feature of most genes. While nucleosome repositioning occurs pervasively, we found that a class of genes required for growth experience acute nucleosome shifting as cells enter the cell cycle. Significantly, our data identify that the ATP-dependent chromatin-remodeling enzyme Snf2 plays a fundamental role in nucleosome repositioning and the expression of growth genes. We also reveal that nucleosome organization changes extensively in concert with phases of the cell cycle, with large, regularly spaced nucleosome arrays being established in mitosis. Collectively, our data and analysis provide a framework for understanding nucleosome dynamics in relation to fundamental DNA-dependent transactions.

  11. microRNA-dependent Temporal Gene Expression in the Ureteric Bud Epithelium during Mammalian Kidney Development

    PubMed Central

    Nagalakshmi, Vidya K.; Lindner, Volkhard; Wessels, Andy; Yu, Jing

    2014-01-01

    Background Our previous study on mouse mutants with the ureteric bud (UB) epithelium-specific Dicer deletion (Dicer UB mutants) demonstrated the significance of UB epithelium-derived miRNAs in UB development. Results Our whole-genome transcriptional profiling showed that the Dicer mutant UB epithelium abnormally retained transcriptional features of the early UB epithelium and failed to express many genes associated with collecting duct differentiation. Further, we identified a temporal expression pattern of early UB genes during UB epithelium development in which gene expression was detected at early developmental stages and became undetectable by E14.5. In contrast, expression of early UB genes persisted at later stages in the Dicer mutant UB epithelium and increased at early stages. Our bioinformatics analysis of the abnormally persistently expressed early genes in the Dicer mutant UB epithelium showed significant enrichment of the let-7 family miRNA targets. We further identified a temporal expression pattern of let-7 miRNAs in the UB epithelium that is anti-parallel to that of some early UB genes during kidney development. Conclusions We propose a model in which the let-7 family miRNAs silence the expression of a subset of early genes in the UB epithelium at later developmental stages in order to promote collecting duct differentiation. PMID:25369991

  12. Metabolic gene profile in early human fetal heart development.

    PubMed

    Iruretagoyena, J I; Davis, W; Bird, C; Olsen, J; Radue, R; Teo Broman, A; Kendziorski, C; Splinter BonDurant, S; Golos, T; Bird, I; Shah, D

    2014-07-01

    The primitive cardiac tube starts beating 6-8 weeks post fertilization in the developing embryo. In order to describe normal cardiac development during late first and early second trimester in human fetuses this study used microarray and pathways analysis and created a corresponding 'normal' database. Fourteen fetal hearts from human fetuses between 10 and 18 weeks of gestational age (GA) were prospectively collected at the time of elective termination of pregnancy. RNA from recovered tissues was used for transcriptome analysis with Affymetrix 1.0 ST microarray chip. From the amassed data we investigated differences in cardiac development within the 10-18 GA period dividing the sample by GA in three groups: 10-12 (H1), 13-15 (H2) and 16-18 (H3) weeks. A fold change of 2 or above adjusted for a false discovery rate of 5% was used as initial cutoff to determine differential gene expression for individual genes. Test for enrichment to identify functional groups was carried out using the Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG). Array analysis correctly identified the cardiac specific genes, and transcripts reported to be differentially expressed were confirmed by qRT-PCR. Single transcript and Ontology analysis showed first trimester heart expression of myosin-related genes to be up-regulated >5-fold compared with second trimester heart. In contrast the second trimester hearts showed further gestation-related increases in many genes involved in energy production and cardiac remodeling. In conclusion, fetal heart development during the first trimester was dominated by heart-specific genes coding for myocardial development and differentiation. During the second trimester, transcripts related to energy generation and cardiomyocyte communication for contractile coordination/proliferation were more dominant. Transcripts related to fatty acid metabolism can be seen as early as 10 weeks and clearly increase as the heart matures. Retinol

  13. Regulation of Flagellar Gene Expression in Bacteria.

    PubMed

    Osterman, I A; Dikhtyar, Yu Yu; Bogdanov, A A; Dontsova, O A; Sergiev, P V

    2015-11-01

    The flagellum of a bacterium is a supramolecular structure of extreme complexity comprising simultaneously both a unique system of protein transport and a molecular machine that enables the bacterial cell movement. The cascade of expression of genes encoding flagellar components is closely coordinated with the steps of molecular machine assembly, constituting an amazing regulatory system. Data on structure, assembly, and regulation of flagellar gene expression are summarized in this review. The regulatory mechanisms and correlation of the process of regulation of gene expression and flagellum assembly known from the literature are described. PMID:26615435

  14. Expression of nebulette during early cardiac development.

    PubMed

    Esham, Michael; Bryan, Kourtney; Milnes, Jennifer; Holmes, William B; Moncman, Carole L

    2007-04-01

    Nebulette, a cardiac homologue of nebulin, colocalizes with alpha-actinin in the pre-myofibrils of spreading cardiomyocytes and has been hypothesized to play a critical role in the formation of the thin-filament-Z-line complex early during myofibrillogenesis. Data from mesodermal explants or whole tissue mounts of developing hearts suggest that the pattern of myofibrillogenesis in situ may differ from observations of spreading cardiomyocytes. To evaluate the role of nebulette in myofibrillogenesis, we have analyzed the expression of nebulette in chicken heart rudiments by immunoblots and immunofluorescence. We detect the 110 kDa nebulette in heart rudiments derived from stage 9-10 using the anti-nebulin mAb, N114, or polyclonal anti-nebulette Abs by immunoblotting. Immunofluorescence analysis of explants stained with anti-nebulette and anti-alpha-actinin Abs demonstrates that both proteins localize along actin filaments in punctate to continuous manner at early stages of cardiac development and later give rise to striations. In both cases, the punctate staining had a periodicity of approximately 1.0 microm indicating a pre-myofibrils distribution at the earliest time points examined. We demonstrate that nebulette is indeed associated with premyofibrils in very early stages of myofibrillogenesis and suggest that nebulette may play an important role in the formation of these structures.

  15. Novel cell lines promote the discovery of genes involved in early heart development.

    PubMed

    Brunskill, E W; Witte, D P; Yutzey, K E; Potter, S S

    2001-07-15

    Clonal cell lines representing early cardiomyocytes would provide valuable reagents for the dissection of the genetic program of early cardiogenesis. Here we describe the establishment and characterization of cell lines from the hearts of transgenic mice and embryos with SV40 large T antigen expressed in the heart-forming region. Ultrastructure analysis by transmission electron microscopy showed the primitive, precontractile nature of the resulting cells, with the absence of myofilaments, Z lines, and intercalated disks. Immunohistochemistry, RT-PCR, Northern blots, and oligonucleotide microarrays were used to determine the expression levels of thousands of genes in the 1H and ECL-2 cell lines. The resulting gene-expression profiles showed the transcription of early cardiomyocyte genes such as Nkx2.5, GATA4, Tbx5, dHAND, cardiac troponin C, and SM22-alpha. Furthermore, many genes not previously implicated in early cardiac development were expressed. Two of these genes, Hic-5, a possible negative regulator of muscle differentiation, and the transcription enhancing factor TEF-5 were selected and shown by in situ hybridizations to be expressed in the early developing heart. The results show that the 1H and ECL-2 cell lines can be used to discover novel genes expressed in the early cardiomyocyte. PMID:11437454

  16. Early BrdU-responsive genes constitute a novel class of senescence-associated genes in human cells

    SciTech Connect

    Minagawa, Sachi; Nakabayashi, Kazuhiko; Fujii, Michihiko; Scherer, Stephen W.; Ayusawa, Dai . E-mail: dayusawa@yokohama-cu.ac.jp

    2005-04-01

    We identified genes that immediately respond to 5-bromodeoxyuridine (BrdU) in SUSM-1, an immortal fibroblastic line, with DNA microarray and Northern blot analysis. At least 29 genes were found to alter gene expression greater than twice more or less