Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E
2016-10-01
Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights
Early-life inflammation, immune response and ageing.
Khan, Imroze; Agashe, Deepa; Rolff, Jens
2017-03-15
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).
Early-life inflammation, immune response and ageing
2017-01-01
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145
Arsenic and Immune Response to Infection During Pregnancy and Early Life.
Attreed, Sarah E; Navas-Acien, Ana; Heaney, Christopher D
2017-06-01
Arsenic, a known carcinogen and developmental toxicant, is a major threat to global health. While the contribution of arsenic exposure to chronic diseases and adverse pregnancy and birth outcomes is recognized, its ability to impair critical functions of humoral and cell-mediated immunity-including the specific mechanisms in humans-is not well understood. Arsenic has been shown to increase risk of infectious diseases that have significant health implications during pregnancy and early life. Here, we review the latest research on the mechanisms of arsenic-related immune response alterations that could underlie arsenic-associated increased risk of infection during the vulnerable periods of pregnancy and early life. The latest evidence points to alteration of antibody production and transplacental transfer as well as failure of T helper cells to produce IL-2 and proliferate. Critical areas for future research include the effects of arsenic exposure during pregnancy and early life on immune responses to natural infection and the immunogenicity and efficacy of vaccines.
The bradykinin B2 receptor in the early immune response against Listeria infection.
Kaman, Wendy E; Wolterink, Arthur F W M; Bader, Michael; Boele, Linda C L; van der Kleij, Desiree
2009-02-01
The endogenous danger signal bradykinin was recently found implicated in the development of immunity against parasites via dendritic cells. We here report an essential role of the B(2) (B(2)R) bradykinin receptor in the early immune response against Listeria infection. Mice deficient in B(2)R (B(2)R(-/-) mice) were shown to suffer from increased hepatic bacterial burden and concomitant dramatic weight loss during infection with Listeria monocytogenes. Levels of cytokines known to play a pivotal role in the early phase immune response against L. monocytogenes, IL-12p70 and IFN-gamma, were reduced in B(2)R(-/-) mice. To extend these findings to the human system, we show that bradykinin potentiates the production of IL-12p70 in human monocyte-derived dendritic cells. Thus, we show that bradykinin and the B(2)R play a role in early innate immune functions during bacterial infection.
Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J
2011-03-01
The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.
2013-01-01
Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to
Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.
Puill-Stephan, Eneour; Seneca, François O; Miller, David J; van Oppen, Madeleine J H; Willis, Bette L
2012-01-01
Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are needed to further
Mourglia-Ettlin, Gustavo; Marqués, Juan Martín; Chabalgoity, José Alejandro; Dematteis, Sylvia
2011-01-01
Background Cystic echinococcosis is a worldwide distributed helminth zoonosis caused by the larval stage of Echinococcus granulosus. Human secondary cystic echinococcosis is caused by dissemination of protoscoleces after accidental rupture of fertile cysts and is due to protoscoleces ability to develop into new metacestodes. In the experimental model of secondary cystic echinococcosis mice react against protoscoleces producing inefficient immune responses, allowing parasites to develop into cysts. Although the chronic phase of infection has been analyzed in depth, early immune responses at the site of infection establishment, e.g., peritoneal cavity, have not been well studied. Because during early stages of infection parasites are thought to be more susceptible to immune attack, this work focused on the study of cellular and molecular events triggered early in the peritoneal cavity of infected mice. Principal Findings Data obtained showed disparate behaviors among subpopulations within the peritoneal lymphoid compartment. Regarding B cells, there is an active molecular process of plasma cell differentiation accompanied by significant local production of specific IgM and IgG2b antibodies. In addition, peritoneal NK cells showed a rapid increase with a significant percentage of activated cells. Peritoneal T cells showed a substantial increase, with predominance in CD4+ T lymphocytes. There was also a local increase in Treg cells. Finally, cytokine response showed local biphasic kinetics: an early predominant induction of Th1-type cytokines (IFN-γ, IL-2 and IL-15), followed by a shift toward a Th2-type profile (IL-4, IL-5, IL-6, IL-10 and IL-13). Conclusions Results reported here open new ways to investigate the involvement of immune effectors players in E. granulosus establishment, and also in the sequential promotion of Th1- toward Th2-type responses in experimental secondary cystic echinococcosis. These data would be relevant for designing rational therapies
Arsenic and Immune Response to Infection During Pregnancy and Early Life
Attreed, Sarah E.; Navas-Acien, Ana
2017-01-01
Purpose of Review Arsenic, a known carcinogen and developmental toxicant, is a major threat to global health. While the contribution of arsenic exposure to chronic diseases and adverse pregnancy and birth outcomes is recognized, its ability to impair critical functions of humoral and cell-mediated immunity—including the specific mechanisms in humans—is not well understood. Arsenic has been shown to increase risk of infectious diseases that have significant health implications during pregnancy and early life. Here, we review the latest research on the mechanisms of arsenic-related immune response alterations that could underlie arsenic-associated increased risk of infection during the vulnerable periods of pregnancy and early life. Recent Findings The latest evidence points to alteration of antibody production and transplacental transfer as well as failure of T helper cells to produce IL-2 and proliferate. Summary Critical areas for future research include the effects of arsenic exposure during pregnancy and early life on immune responses to natural infection and the immunogenicity and efficacy of vaccines. PMID:28488132
2009-02-01
Burn wound model Mice were anaesthetised using isoflurane inha- lation. After shaving the dorsum, the exposed skin was washed gently with room...Extracorporeal shock wave therapy suppresses the early proinflammatory immune response to a severe cutaneous burn injury* Thomas A Davis, Alexander...S, Peoples GE, Tadaki D, Elster EA. Extracorporeal shock wave therapy suppresses the early proinflammatory immune response to a severe cutaneous burn
Harder, Jeffrey M; Braine, Catherine E; Williams, Pete A; Zhu, Xianjun; MacNicoll, Katharine H; Sousa, Gregory L; Buchanan, Rebecca A; Smith, Richard S; Libby, Richard T; Howell, Gareth R; John, Simon W M
2017-05-09
Various immune response pathways are altered during early, predegenerative stages of glaucoma; however, whether the early immune responses occur secondarily to or independently of neuronal dysfunction is unclear. To investigate this relationship, we used the Wld s allele, which protects from axon dysfunction. We demonstrate that DBA/2J .Wld s mice develop high intraocular pressure (IOP) but are protected from retinal ganglion cell (RGC) dysfunction and neuroglial changes that otherwise occur early in DBA/2J glaucoma. Despite this, immune pathways are still altered in DBA/2J .Wld s mice. This suggests that immune changes are not secondary to RGC dysfunction or altered neuroglial interactions, but may be directly induced by the increased strain imposed by high IOP. One early immune response following IOP elevation is up-regulation of complement C3 in astrocytes of DBA/2J and DBA/2J. Wld s mice. Unexpectedly, because the disruption of other complement components, such as C1Q, is protective in glaucoma, C3 deficiency significantly increased the number of DBA/2J eyes with nerve damage and RGC loss at an early time point after IOP elevation. Transcriptional profiling of C3-deficient cultured astrocytes implicated EGFR signaling as a hub in C3-dependent responses. Treatment with AG1478, an EGFR inhibitor, also significantly increased the number of DBA/2J eyes with glaucoma at the same early time point. These findings suggest that C3 protects from early glaucomatous damage, a process that may involve EGFR signaling and other immune responses in the optic nerve head. Therefore, therapies that target specific components of the complement cascade, rather than global inhibition, may be more applicable for treating human glaucoma.
Harder, Jeffrey M.; Braine, Catherine E.; Williams, Pete A.; Zhu, Xianjun; MacNicoll, Katharine H.; Sousa, Gregory L.; Buchanan, Rebecca A.; Smith, Richard S.; Howell, Gareth R.; John, Simon W. M.
2017-01-01
Various immune response pathways are altered during early, predegenerative stages of glaucoma; however, whether the early immune responses occur secondarily to or independently of neuronal dysfunction is unclear. To investigate this relationship, we used the Wlds allele, which protects from axon dysfunction. We demonstrate that DBA/2J.Wlds mice develop high intraocular pressure (IOP) but are protected from retinal ganglion cell (RGC) dysfunction and neuroglial changes that otherwise occur early in DBA/2J glaucoma. Despite this, immune pathways are still altered in DBA/2J.Wlds mice. This suggests that immune changes are not secondary to RGC dysfunction or altered neuroglial interactions, but may be directly induced by the increased strain imposed by high IOP. One early immune response following IOP elevation is up-regulation of complement C3 in astrocytes of DBA/2J and DBA/2J.Wlds mice. Unexpectedly, because the disruption of other complement components, such as C1Q, is protective in glaucoma, C3 deficiency significantly increased the number of DBA/2J eyes with nerve damage and RGC loss at an early time point after IOP elevation. Transcriptional profiling of C3-deficient cultured astrocytes implicated EGFR signaling as a hub in C3-dependent responses. Treatment with AG1478, an EGFR inhibitor, also significantly increased the number of DBA/2J eyes with glaucoma at the same early time point. These findings suggest that C3 protects from early glaucomatous damage, a process that may involve EGFR signaling and other immune responses in the optic nerve head. Therefore, therapies that target specific components of the complement cascade, rather than global inhibition, may be more applicable for treating human glaucoma. PMID:28446616
Expression of Putative Immune Response Genes during Early Ontogeny in the Coral Acropora millepora
Puill-Stephan, Eneour; Seneca, François O.; Miller, David J.; van Oppen, Madeleine J. H.; Willis, Bette L.
2012-01-01
Background Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Methodology/Principal Findings Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A.millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Conclusions/Significance Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of
Boyd, Ashleigh S; Wood, Kathryn J
2010-06-04
The fully differentiated progeny of ES cells (ESC) may eventually be used for cell replacement therapy (CRT). However, elements of the innate immune system may contribute to damage or destruction of these tissues when transplanted. Herein, we assessed the hitherto ill-defined contribution of the early innate immune response in CRT after transplantation of either ESC derived insulin producing cell clusters (IPCCs) or adult pancreatic islets. Ingress of neutrophil or macrophage cells was noted immediately at the site of IPCC transplantation, but this infiltration was attenuated by day three. Gene profiling identified specific inflammatory cytokines and chemokines that were either absent or sharply reduced by three days after IPCC transplantation. Thus, IPCC transplantation provoked less of an early immune response than pancreatic islet transplantation. Our study offers insights into the characteristics of the immune response of an ESC derived tissue in the incipient stages following transplantation and suggests potential strategies to inhibit cell damage to ensure their long-term perpetuation and functionality in CRT.
ALD1 Regulates Basal Immune Components and Early Inducible Defense Responses in Arabidopsis.
Cecchini, Nicolás M; Jung, Ho Won; Engle, Nancy L; Tschaplinski, Timothy J; Greenberg, Jean T
2015-04-01
Robust immunity requires basal defense machinery to mediate timely responses and feedback cycles to amplify defenses against potentially spreading infections. AGD2-LIKE DEFENSE RESPONSE PROTEIN 1 (ALD1) is needed for the accumulation of the plant defense signal salicylic acid (SA) during the first hours after infection with the pathogen Pseudomonas syringae and is also upregulated by infection and SA. ALD1 is an aminotransferase with multiple substrates and products in vitro. Pipecolic acid (Pip) is an ALD1-dependent bioactive product induced by P. syringae. Here, we addressed roles of ALD1 in mediating defense amplification as well as the levels and responses of basal defense machinery. ALD1 needs immune components PAD4 and ICS1 (an SA synthesis enzyme) to confer disease resistance, possibly through a transcriptional amplification loop between them. Furthermore, ALD1 affects basal defense by controlling microbial-associated molecular pattern (MAMP) receptor levels and responsiveness. Vascular exudates from uninfected ALD1-overexpressing plants confer local immunity to the wild type and ald1 mutants yet are not enriched for Pip. We infer that, in addition to affecting Pip accumulation, ALD1 produces non-Pip metabolites that play roles in immunity. Thus, distinct metabolite signals controlled by the same enzyme affect basal and early defenses versus later defense responses, respectively.
The innate and adaptive immune response to avian influenza virus
USDA-ARS?s Scientific Manuscript database
Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...
Boyd, Ashleigh S.; Wood, Kathryn J.
2010-01-01
Background The fully differentiated progeny of ES cells (ESC) may eventually be used for cell replacement therapy (CRT). However, elements of the innate immune system may contribute to damage or destruction of these tissues when transplanted. Methodology/Principal Findings Herein, we assessed the hitherto ill-defined contribution of the early innate immune response in CRT after transplantation of either ESC derived insulin producing cell clusters (IPCCs) or adult pancreatic islets. Ingress of neutrophil or macrophage cells was noted immediately at the site of IPCC transplantation, but this infiltration was attenuated by day three. Gene profiling identified specific inflammatory cytokines and chemokines that were either absent or sharply reduced by three days after IPCC transplantation. Thus, IPCC transplantation provoked less of an early immune response than pancreatic islet transplantation. Conclusions/Significance Our study offers insights into the characteristics of the immune response of an ESC derived tissue in the incipient stages following transplantation and suggests potential strategies to inhibit cell damage to ensure their long-term perpetuation and functionality in CRT. PMID:20532031
Innate Immunity to Respiratory Infection in Early Life
Lambert, Laura; Culley, Fiona J.
2017-01-01
Early life is a period of particular susceptibility to respiratory infections and symptoms are frequently more severe in infants than in adults. The neonatal immune system is generally held to be deficient in most compartments; responses to innate stimuli are weak, antigen-presenting cells have poor immunostimulatory activity and adaptive lymphocyte responses are limited, leading to poor immune memory and ineffective vaccine responses. For mucosal surfaces such as the lung, which is continuously exposed to airborne antigen and to potential pathogenic invasion, the ability to discriminate between harmless and potentially dangerous antigens is essential, to prevent inflammation that could lead to loss of gaseous exchange and damage to the developing lung tissue. We have only recently begun to define the differences in respiratory immunity in early life and its environmental and developmental influences. The innate immune system may be of relatively greater importance than the adaptive immune system in the neonatal and infant period than later in life, as it does not require specific antigenic experience. A better understanding of what constitutes protective innate immunity in the respiratory tract in this age group and the factors that influence its development should allow us to predict why certain infants are vulnerable to severe respiratory infections, design treatments to accelerate the development of protective immunity, and design age specific adjuvants to better boost immunity to infection in the lung. PMID:29184555
Voelz, Kerstin; Gratacap, Remi L; Wheeler, Robert T
2015-11-01
Mucormycosis is an emerging fungal infection that is clinically difficult to manage, with increasing incidence and extremely high mortality rates. Individuals with diabetes, suppressed immunity or traumatic injury are at increased risk of developing disease. These individuals often present with defects in phagocytic effector cell function. Research using mammalian models and phagocytic effector cell lines has attempted to decipher the importance of the innate immune system in host defence against mucormycosis. However, these model systems have not been satisfactory for direct analysis of the interaction between innate immune effector cells and infectious sporangiospores in vivo. Here, we report the first real-time in vivo analysis of the early innate immune response to mucormycete infection using a whole-animal zebrafish larval model system. We identified differential host susceptibility, dependent on the site of infection (hindbrain ventricle and swim bladder), as well as differential functions of the two major phagocyte effector cell types in response to viable and non-viable spores. Larval susceptibility to mucormycete spore infection was increased upon immunosuppressant treatment. We showed for the first time that macrophages and neutrophils were readily recruited in vivo to the site of infection in an intact host and that spore phagocytosis can be observed in real-time in vivo. While exploring innate immune effector recruitment dynamics, we discovered the formation of phagocyte clusters in response to fungal spores that potentially play a role in fungal spore dissemination. Spores failed to activate pro-inflammatory gene expression by 6 h post-infection in both infection models. After 24 h, induction of a pro-inflammatory response was observed only in hindbrain ventricle infections. Only a weak pro-inflammatory response was initiated after spore injection into the swim bladder during the same time frame. In the future, the zebrafish larva as a live whole
Injury-induced immune responses in Hydra.
Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte
2014-08-01
The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights
Mahiti, Macdonald; Brumme, Zabrina L; Jessen, Heiko; Brockman, Mark A; Ueno, Takamasa
2015-07-31
HLA class II-restricted CD4(+) T lymphocytes play an important role in controlling HIV-1 replication, especially in the acute/early infection stage. But, HIV-1 Nef counteracts this immune response by down-regulating HLA-DR and up-regulating the invariant chain associated with immature HLA-II (Ii). Although functional heterogeneity of various Nef activities, including down-regulation of HLA class I (HLA-I), is well documented, our understanding of Nef-mediated evasion of HLA-II-restricted immune responses during acute/early infection remains limited. Here, we examined the ability of Nef clones from 47 subjects with acute/early progressive infection and 46 subjects with chronic progressive infection to up-regulate Ii and down-regulate HLA-DR and HLA-I from the surface of HIV-infected cells. HLA-I down-regulation function was preserved among acute/early Nef clones, whereas both HLA-DR down-regulation and Ii up-regulation functions displayed relatively broad dynamic ranges. Nef's ability to down-regulate HLA-DR and up-regulate Ii correlated positively at this stage, suggesting they are functionally linked in vivo. Acute/early Nef clones also exhibited higher HLA-DR down-regulation and lower Ii up-regulation functions compared to chronic Nef clones. Taken together, our results support enhanced Nef-mediated HLA class II immune evasion activities in acute/early compared to chronic infection, highlighting the potential importance of these functions following transmission. Copyright © 2015 Elsevier Inc. All rights reserved.
Rizzuto, Gabrielle; Tagliani, Elisa; Manandhar, Priyanka; Erlebacher, Adrian; Bakardjiev, Anna I
2017-08-01
The bacterial pathogen Listeria monocytogenes causes foodborne systemic disease in pregnant women, which can lead to preterm labor, stillbirth, or severe neonatal disease. Colonization of the maternal decidua appears to be an initial step in the maternal component of the disease as well as bacterial transmission to the placenta and fetus. Host-pathogen interactions in the decidua during this early stage of infection remain poorly understood. Here, we assessed the dynamics of L. monocytogenes infection in primary human decidual organ cultures and in the murine decidua in vivo A high inoculum was necessary to infect both human and mouse deciduas, and the data support the existence of a barrier to initial colonization of the murine decidua. If successful, however, colonization in both species was followed by significant bacterial expansion associated with an inability of the decidua to mount appropriate innate cellular immune responses. The innate immune deficits included the failure of bacterial foci to attract macrophages and NK cells, cell types known to be important for early defenses against L. monocytogenes in the spleen, as well as a decrease in the tissue density of inflammatory Ly6C hi monocytes in vivo These results suggest that the infectivity of the decidua is not the result of an enhanced recruitment of L. monocytogenes to the gestational uterus but rather is due to compromised local innate cellular immune responses. Copyright © 2017 American Society for Microbiology.
Fish oil supplementation in early infancy modulates developing infant immune responses.
D'Vaz, N; Meldrum, S J; Dunstan, J A; Lee-Pullen, T F; Metcalfe, J; Holt, B J; Serralha, M; Tulic, M K; Mori, T A; Prescott, S L
2012-08-01
Maternal fish oil supplementation during pregnancy has been associated with altered infant immune responses and a reduced risk of infant sensitization and eczema. To examine the effect of early postnatal fish oil supplementation on infant cellular immune function at 6 months of age in the context of allergic disease. In a double-blind randomized controlled trial (ACTRN12606000281594), 420 infants of high atopic risk received fish oil [containing 280 mg docosahexaenoic acid (DHA) and 110 mg eicosapentanoic acid (EPA)] or control oil daily from birth to 6 months. One hundred and twenty infants had blood collected at 6 months of age. Fatty acid levels, induced cytokine responses, T cell subsets and monocyte HLA-DR expression were assessed at 6 months of age. Infant allergies were assessed at 6 and 12 months of age. DHA and EPA levels were significantly higher in the fish oil group and erythrocyte arachidonic acid (AA) levels were lower (all P < 0.05). Infants in the fish oil group had significantly lower IL-13 responses (P = 0.036) to house dust mite (HDM) and higher IFNγ (P = 0.035) and TNF (P = 0.017) responses to phytohaemaglutinin (PHA). Infants with relatively high DHA levels had lower Th2 responses to allergens including lower IL-13 to β-lactoglobulin (BLG) (P = 0.020), and lower IL-5 to BLG (P = 0.045). Postnatal fish oil supplementation increased infant n-3 polyunsaturated fatty acid (PUFA) levels and associated with lowered allergen-specific Th2 responses and elevated polyclonal Th1 responses. Our results add to existing evidence of n-3 PUFA having immunomodulatory properties that are potentially allergy-protective. © 2012 Blackwell Publishing Ltd.
Oral treatment with enrofloxacin early in life promotes Th2-mediated immune response in mice.
Strzępa, Anna; Majewska-Szczepanik, Monika; Kowalczyk, Paulina; Woźniak, Dorota; Motyl, Sylwia; Szczepanik, Marian
2016-02-01
Th2 lymphocytes play a crucial role in the development of allergy. These pathologies are caused by coordinated production of the cytokines IL-4, IL-5 and IL-13 that regulate the activity of eosinophils, basophils and B cells. According to the 'hygiene hypothesis', the reduced exposure to microorganisms favors allergy occurrence. The advances in medicine in the field of infection therapy promoted an increasing application of antibiotics which, apart from eliminating pathogens, also partially eliminate the microbiota. Epicutaneous (EC) immunization with ovalbumin (OVA) followed by OVA challenge was used to study the influence of partial gut flora depletion by oral treatment with enrofloxacin on type-2 immune response. Current work describes the influence of enrofloxacin application on anti-OVA antibody production and cytokine synthesis in young and adult mice. Immune response in adult mice is less sensitive to modification of natural gut flora. We observed that enrofloxacin treatment of adult mice leads to significant decrease of anti-OVA IgG2a production while synthesis of anti-OVA IgE was not changed. The production of type-1 (IFN-γ), type-2 (IL-4, IL-5, IL-10, IL-13) and Th17-associated (IL-17A) cytokines was inhibited. On the other hand, treatment of young mice with enrofloxacin significantly upregulates the production of anti-OVA IgE and inhibits the secretion of anti-OVA IgG2a antibodies. Additionally, treatment with enrofloxacin early in life prior to OVA immunization results in increased production of type-2 (IL-4, IL-10 and IL-13) cytokines. Our results clearly indicate that the immune system is more vulnerable to decreased bacterial exposure early in life that may promote development of allergy. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob
2012-01-01
Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the
Castro, Rosario; Abós, Beatriz; Pignatelli, Jaime; von Gersdorff Jørgensen, Louise; González Granja, Aitor; Buchmann, Kurt; Tafalla, Carolina
2014-01-01
Among the essential metabolic functions of the liver, in mammals, a role as mediator of systemic and local innate immunity has also been reported. Although the presence of an important leukocyte population in mammalian liver is well documented, the characterization of leukocyte populations in the teleost liver has been only scarcely addressed. In the current work, we have confirmed the presence of IgM+, IgD+, IgT+, CD8α+, CD3+ cells, and cells expressing major histocompatibility complex (MHC-II) in rainbow trout (Oncorhynchus mykiss) liver by flow cytometry and/or immunohistochemistry analysis. Additionally, the effect of viral hemorrhagic septicemia virus (VHSV) on the liver immune response was assessed. First, we studied the effect of viral intraperitoneal injection on the transcription of a wide selection of immune genes at days 1, 2 and 5 post-infection. These included a group of leukocyte markers genes, pattern recognition receptors (PRRs), chemokines, chemokine receptor genes, and other genes involved in the early immune response and in acute phase reaction. Our results indicate that T lymphocytes play a key role in the initial response to VHSV in the liver, since CD3, CD8, CD4, perforin, Mx and interferon (IFN) transcription levels were up-regulated in response to VHSV. Consequently, flow cytometry analysis of CD8α+ cells in liver and spleen at day 5 post-infection revealed a decrease in the number of CD8α+ cells in the spleen and an increased population in the liver. No differences were found however in the percentages of B lymphocyte (IgM+ or IgD+) populations. In addition, a strong up-regulation in the transcription levels of several PRRs and chemokines was observed from the second day of infection, indicating an important role of these factors in the response of the liver to viral infections. PMID:25338079
Transcriptional Profiling of the Immune Response to Marburg Virus Infection.
Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J
2015-10-01
Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells
Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...
Lee, Kyung-Yil; Rhim, Jung-Woo; Kang, Jin-Han
2011-01-01
It has been believed that acute lung injury in influenza virus infections is caused by a virus-induced cytopathy; viruses that have multiplied in the upper respiratory tract spread to lung tissues along the lower respiratory tract. However, some experimental and clinical studies have suggested that the pathogenesis of acute lung injury in influenza virus infections is associated with excessive host response including a cell-mediated immune reaction. During the pandemic H1N1 2009 influenza A virus infections in Korea, we experienced a dramatic effect of immune-modulators (corticosteroids) on the patients with severe pneumonia who had significant respiratory distress at presentation and those who showed rapidly progressive pneumonia during oseltamivir treatment. We also found that the pneumonia patients treated with corticosteroids showed the lowest lymphocyte differential and that the severity of pneumonia was associated with the lymphocyte count at presentation. From our findings and previous experimental and clinical studies, we postulated that hyperactive immune cells (T cells) may be involved in the acute lung injury of influenza virus infections, using a hypothesis of 'protein homeostasis system'; the inducers of the cell-mediated immune response are initially produced at the primary immune sites by the innate immune system. These substances reach the lung cells, the main target organ, via the systemic circulation, and possibly the cells of other organs, including myocytes or central nerve system cells, leading to extrapulmonary symptoms (e.g., myalgia and rhabdomyolysis, and encephalopathy). To control these substances that may be possibly toxic to host cells, the adaptive immune reaction may be operated by immune cells, mainly lymphocytes. Hyperimmune reaction of immune cells produces higher levels of cytokines which may be associated with acute lung injury, and may be controlled by early use of immune-modulators. Early initiation and proper dosage of immune
Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W
2014-11-28
NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors
Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.
Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M
2017-09-04
Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.
Current views on the mechanisms of immune responses to trauma and infection
Michalak, Grzegorz; Słotwiński, Robert
2015-01-01
According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036
Hepatitis C Virus Reveals a Novel Early Control in Acute Immune Response
Arnaud, Noëlla; Dabo, Stéphanie; Akazawa, Daisuke; Fukasawa, Masayoshi; Shinkai-Ouchi, Fumiko; Hugon, Jacques; Wakita, Takaji; Meurs, Eliane F.
2011-01-01
Recognition of viral RNA structures by the intracytosolic RNA helicase RIG-I triggers induction of innate immunity. Efficient induction requires RIG-I ubiquitination by the E3 ligase TRIM25, its interaction with the mitochondria-bound MAVS protein, recruitment of TRAF3, IRF3- and NF-κB-kinases and transcription of Interferon (IFN). In addition, IRF3 alone induces some of the Interferon-Stimulated Genes (ISGs), referred to as early ISGs. Infection of hepatocytes with Hepatitis C virus (HCV) results in poor production of IFN despite recognition of the viral RNA by RIG-I but can lead to induction of early ISGs. HCV was shown to inhibit IFN production by cleaving MAVS through its NS3/4A protease and by controlling cellular translation through activation of PKR, an eIF2α-kinase containing dsRNA-binding domains (DRBD). Here, we have identified a third mode of control of IFN induction by HCV. Using HCVcc and the Huh7.25.CD81 cells, we found that HCV controls RIG-I ubiquitination through the di-ubiquitine-like protein ISG15, one of the early ISGs. A transcriptome analysis performed on Huh7.25.CD81 cells silenced or not for PKR and infected with JFH1 revealed that HCV infection leads to induction of 49 PKR-dependent genes, including ISG15 and several early ISGs. Silencing experiments revealed that this novel PKR-dependent pathway involves MAVS, TRAF3 and IRF3 but not RIG-I, and that it does not induce IFN. Use of PKR inhibitors showed that this pathway requires the DRBD but not the kinase activity of PKR. We then demonstrated that PKR interacts with HCV RNA and MAVS prior to RIG-I. In conclusion, HCV recruits PKR early in infection as a sensor to trigger induction of several IRF3-dependent genes. Among those, ISG15 acts to negatively control the RIG-I/MAVS pathway, at the level of RIG-I ubiquitination.These data give novel insights in the machinery involved in the early events of innate immune response. PMID:22022264
Falduto, Guido H; Vila, Cecilia C; Saracino, María P; Gentilini, María V; Venturiello, Stella M
2016-11-15
Parasitic infection caused by Trichinella spiralis provokes an early stimulation of the mucosal immune system which causes an allergic inflammatory response in the lungs. The present work was intended to characterize the kinetics of emergence of regulatory parameters in Wistar rat lungs during this early inflammatory response, between days 0 and 13p.i. The presence of regulatory cells such as regulatory T cells (Tregs) and alternatively activated macrophages (AAM) was analyzed in lung cell suspensions. Moreover, a regulatory cytokine (TGF-β) was studied in lung tissue extracts. Considering that newborn larvae (NBL) travel along the pulmonary microvasculature, the ability of this parasite stage to modulate the activation of lung macrophages was evaluated. For this purpose, lung macrophages from non-infected or infected rats (day 6p.i.) were cultured with live or dead NBL. Arginase activity (characteristic of AAM) and nitric oxide (NO produced by iNOS, characteristic of classical activated macrophages) were measured after 48h. Our results revealed a significant increase in the percentage of Tregs on days 6 and 13p.i., arginase activity on day 13p.i. and TGF-β levels on days 6 and 13p.i. Lung macrophages from non-infected rats cultured with live NBL showed a significant increase in arginase activity and NO levels. Live and dead NBL induced a significant increase in arginase activity in lung macrophages from infected rats. Only live NBL significantly increased NO levels in these macrophages. The present work demonstrates for the first time, the emergence of regulatory parameters in the early lung immune response during T. spiralis infection. The immumodulatory properties exerted by NBL during its passage through this organ could be the cause of such regulation. Moreover, we have shown the ability of NBL to activate macrophages from the lung parenchyma by the classical and alternative pathways. Copyright © 2016 Elsevier B.V. All rights reserved.
Characterization of host immune responses in Ebola virus infections.
Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo
2014-06-01
Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.
Immunization of pregnant women: Future of early infant protection
Faucette, Azure N; Pawlitz, Michael D; Pei, Bo; Yao, Fayi; Chen, Kang
2015-01-01
Children in early infancy do not mount effective antibody responses to many vaccines against commons infectious pathogens, which results in a window of increased susceptibility or severity infections. In addition, vaccine-preventable infections are among the leading causes of morbidity in pregnant women. Immunization during pregnancy can generate maternal immune protection as well as elicit the production and transfer of antibodies cross the placenta and via breastfeeding to provide early infant protection. Several successful vaccines are now recommended to all pregnant women worldwide. However, significant gaps exist in our understanding of the efficacy and safety of other vaccines and in women with conditions associated with increased susceptible to high-risk pregnancies. Public acceptance of maternal immunization remained to be improved. Broader success of maternal immunization will rely on the integration of advances in basic science in vaccine design and evaluation and carefully planned clinical trials that are inclusive to pregnant women. PMID:26366844
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete
2009-07-30
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.
Early growth response 2 and Egr3 are unique regulators in immune system.
Taefehshokr, Sina; Key, Yashar Azari; Khakpour, Mansour; Dadebighlu, Pourya; Oveisi, Amin
2017-01-01
The immune system is evolved to defend the body against pathogens and is composed of thousands of complicated and intertwined pathways, which are highly controlled by processes such as transcription and repression of cellular genes. Sometimes the immune system malfunctions and a break down in self-tolerance occurs. This lead to the inability to distinguish between self and non-self and cause attacks on host tissues, a condition also known as autoimmunity, which can result in chronic debilitating diseases. Early growth response genes are family of transcription factors comprising of four members, Egr1, Egr2, Egr3 and Egr4. All of which contain three cyc2-His2 zinc fingers. Initially, Egr2 function was identified in the regulation of peripheral nerve myelination, hindbrain segmentation. Egr3, on the other hand, is highly expressed in muscle spindle development. Egr2 and Egr3 are induced due to the antigen stimulation and this signaling is implemented through the B and T cell receptors in the adaptive immunity. T cell receptor signaling plays a key role in Egr 2 and 3 expressions via their interaction with NFAT molecules. Egr 2 and 3 play a crucial role in regulation of the immune system and their involvement in B and T cell activation, anergy induction and preventing the autoimmune disease has been investigated. The deficiency of these transcription factors has been associated to deficient Cbl-b expression, a resistant to anergy phenotype, and expression of effector and activated T cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
Liu, Dong; Uzonna, Jude E
2012-01-01
The complicated interactions between Leishmania and the host antigen-presenting cells (APCs) have fundamental effects on the final outcome of the disease. Two major APCs, macrophages and dendritic cells (DCs), play critical roles in mediating resistance and susceptibility during Leishmania infection. Macrophages are the primary resident cell for Leishmania: they phagocytose and permit parasite proliferation. However, these cells are also the major effector cells to eliminate infection. The effective clearance of parasites by macrophages depends on activation of appropriate immune response, which is usually initiated by DCs. Here, we review the early interaction of APCs with Leishmania parasites and how these interactions profoundly impact on the ensuing adaptive immune response. We also discuss how the current knowledge will allow further refinement of our understanding of the interplay between Leishmania and its hosts that leads to resistance or susceptibility.
Liu, Dong; Uzonna, Jude E.
2012-01-01
The complicated interactions between Leishmania and the host antigen-presenting cells (APCs) have fundamental effects on the final outcome of the disease. Two major APCs, macrophages and dendritic cells (DCs), play critical roles in mediating resistance and susceptibility during Leishmania infection. Macrophages are the primary resident cell for Leishmania: they phagocytose and permit parasite proliferation. However, these cells are also the major effector cells to eliminate infection. The effective clearance of parasites by macrophages depends on activation of appropriate immune response, which is usually initiated by DCs. Here, we review the early interaction of APCs with Leishmania parasites and how these interactions profoundly impact on the ensuing adaptive immune response. We also discuss how the current knowledge will allow further refinement of our understanding of the interplay between Leishmania and its hosts that leads to resistance or susceptibility. PMID:22919674
Francis, J. P.; Richmond, P. C.; Strickland, D.; Prescott, S. L.; Pomat, W. S.; Michael, A.; Nadal‐Sims, M. A.; Edwards‐Devitt, C. J.; Holt, P. G.; Lehmann, D.
2016-01-01
Summary In areas where Streptococcus pneumoniae is highly endemic, infants experience very early pneumococcal colonization of the upper respiratory tract, with carriage often persisting into adulthood. We aimed to explore whether newborns in high‐risk areas have pre‐existing pneumococcal‐specific cellular immune responses that may affect early pneumococcal acquisition. Cord blood mononuclear cells (CBMC) of 84 Papua New Guinean (PNG; high endemic) and 33 Australian (AUS; low endemic) newborns were stimulated in vitro with detoxified pneumolysin (dPly) or pneumococcal surface protein A (PspA; families 1 and 2) and compared for cytokine responses. Within the PNG cohort, associations between CBMC dPly and PspA‐induced responses and pneumococcal colonization within the first month of life were studied. Significantly higher PspA‐specific interferon (IFN)‐γ, tumour necrosis factor (TNF)‐α, interleukin (IL)‐5, IL‐6, IL‐10 and IL‐13 responses, and lower dPly‐IL‐6 responses were produced in CBMC cultures of PNG compared to AUS newborns. Higher CBMC PspA‐IL‐5 and PspA‐IL‐13 responses correlated with a higher proportion of cord CD4 T cells, and higher dPly‐IL‐6 responses with a higher frequency of cord antigen‐presenting cells. In the PNG cohort, higher PspA‐specific IL‐5 and IL‐6 CBMC responses were associated independently and significantly with increased risk of earlier pneumococcal colonization, while a significant protective effect was found for higher PspA‐IL‐10 CBMC responses. Pneumococcus‐specific cellular immune responses differ between children born in pneumococcal high versus low endemic settings, which may contribute to the higher risk of infants in high endemic settings for early pneumococcal colonization, and hence disease. PMID:27859014
Q fever in pregnant goats: humoral and cellular immune responses
2013-01-01
Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213
Hambuchen, Michael D.; Carroll, F. Ivy; Rüedi-Bettschen, Daniela; Hendrickson, Howard P.; Hennings, Leah J.; Blough, Bruce E.; Brieaddy, Lawrence E.; Pidaparthi, Ramakrishna R.; Owens, S. Michael
2015-01-01
We hypothesized that an anti-METH mAb could be used in combination with a METH-conjugate vaccine (MCV) to safely improve the overall quality and magnitude of the anti-METH immune response. The benefits would include immediate onset of action (from the mAb), timely increases in the immune responses (from the combined therapy) and duration of antibody response that could last for months (from the MCV). A novel METH-like hapten (METH-SSOO9) was synthesized and then conjugated to immunocyanin monomers of Keyhole limpet hemocyanin (ICKLH) to create the MCV, ICKLH-SOO9. The vaccine, in combination with previously discovered anti-METH mAb7F9, was then tested in rats for safety and potential efficacy. The combination antibody therapy allowed safe achievement of an early high anti-METH antibody response, which persisted throughout the study. Indeed, even after four months the METH vaccine antibodies still had the capacity to significantly reduce METH brain concentrations resulting from a 0.56 mg/kg METH dose. PMID:25973614
Adaptive Immune Responses following Senecavirus A Infection in Pigs.
Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G
2018-02-01
Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease
Raineki, Charlis; Bodnar, Tamara S; Holman, Parker J; Baglot, Samantha L; Lan, Ni; Weinberg, Joanne
2017-11-01
The contribution of the early postnatal environment to the pervasive effects of prenatal alcohol exposure (PAE) is poorly understood. Moreover, PAE often carries increased risk of exposure to adversity/stress during early life. Dysregulation of immune function may play a role in how pre- and/or postnatal adversity/stress alters brain development. Here, we combine two animal models to examine whether PAE differentially increases vulnerability to immune dysregulation in response to early-life adversity. PAE and control litters were exposed to either limited bedding (postnatal day [PN] 8-12) to model early-life adversity or normal bedding, and maternal behavior and pup vocalizations were recorded. Peripheral (serum) and central (amygdala) immune (cytokines and C-reactive protein - CRP) responses of PAE animals to early-life adversity were evaluated at PN12. Insufficient bedding increased negative maternal behavior in both groups. Early-life adversity increased vocalization in all animals; however, PAE pups vocalized less than controls. Early-life adversity reduced serum TNF-α, KC/GRO, and IL-10 levels in control but not PAE animals. PAE increased serum CRP, and levels were even higher in pups exposed to adversity. Finally, PAE reduced KC/GRO and increased IL-10 levels in the amygdala. Our results indicate that PAE alters immune system development and both behavioral and immune responses to early-life adversity, which could have subsequent consequences for brain development and later life health. Copyright © 2017 Elsevier Inc. All rights reserved.
Leptospirosis in human: Biomarkers in host immune responses.
Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha
2018-03-01
Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.
Early exposure to ultraviolet-B radiation decreases immune function later in life
Ceccato, Emma; Cramp, Rebecca L.; Seebacher, Frank; Franklin, Craig E.
2016-01-01
Amphibians have declined dramatically worldwide. Many of these declines are occurring in areas where no obvious anthropogenic stressors are present. It is proposed that in these areas, environmental factors such as elevated solar ultraviolet-B (UV-B) radiation could be responsible. Ultraviolet-B levels have increased in many parts of the world as a consequence of the anthropogenic destruction of the ozone layer. Amphibian tadpoles are particularly sensitive to the damaging effects of UV-B radiation, with exposure disrupting growth and fitness in many species. Given that UV-B can disrupt immune function in other animals, we tested the hypothesis that early UV-B exposure suppresses the immune responses of amphibian tadpoles and subsequent juvenile frogs. We exposed Limnodynastes peronii tadpoles to sublethal levels of UV-B radiation for 6 weeks after hatching, then examined indices of immune function in both the tadpoles and the subsequent metamorphs. There was no significant effect of UV-B on tadpole leucocyte counts or on their response to an acute antigen (phytohaemagglutinin) challenge. However, early UV-B exposure resulted in a significant reduction in both metamorph leucocyte abundance and their response to an acute phytohaemagglutinin challenge. These data demonstrate that early UV-B exposure can have carry-over effects on later life-history traits even if the applied stressor has no immediately discernible effect. These findings have important implications for our understanding of the effects of UV-B exposure on amphibian health and susceptibility to diseases such as chytridiomycosis. PMID:27668081
Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4
Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna
2017-01-01
Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are
Verma, Puja; Tapadia, Madhu G
2015-08-01
In insects, humoral response to injury is accomplished by the production of antimicrobial peptides (AMPs) which are secreted in the hemolymph to eliminate the pathogen. Drosophila Malpighian tubules (MTs), however, are unique immune organs that show constitutive expression of AMPs even in unchallenged conditions and the onset of immune response is developmental stage dependent. Earlier reports have shown ecdysone positively regulates immune response after pathogenic challenge however, a robust response requires prior potentiation by the hormone. Here we provide evidence to show that MTs do not require prior potentiation with ecdysone hormone for expression of AMPs and they respond to ecdysone very fast even without immune challenge, although the different AMPs Diptericin, Cecropin, Attacin, Drosocin show differential expression in response to ecdysone. We show that early gene Broad complex (BR-C) could be regulating the IMD pathway by activating Relish and physically interacting with it to activate AMPs expression. BR-C depletion from Malpighian tubules renders the flies susceptible to infection. We also show that in MTs ecdysone signaling is transduced by EcR-B1 and B2. In the absence of ecdysone signaling the IMD pathway associated genes are down regulated and activation and translocation of transcription factor Relish is also affected. Copyright © 2015 Elsevier Ltd. All rights reserved.
Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E
2000-04-01
Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.
Simon, K; de Vries Reilingh, G; Bolhuis, J E; Kemp, B; Lammers, A
2015-09-01
Early life conditions such as feed and water availability immediately post hatch (PH) and housing conditions may influence immune development and therefore immune reactivity later in life. The current study addressed the consequences of a combination of these 2 early life conditions for immune reactivity, i.e., the specific antibody response towards a non-infectious lung challenge. Broiler chicks received feed and water either immediately p.h. or with a 72 h delay and were either reared in a floor or a cage system. At 4 weeks of age, chicks received either an intra-tracheally administered Escherichia coli lipopolysaccharide (LPS)/Human Serum Albumin (HUSA) challenge or a placebo, and antibody titers were measured up to day 14 after administration of the challenge. Chicks housed on the floor and which had a delayed access to feed p.h. showed the highest antibody titers against HuSA. These chicks also showed the strongest sickness response and poorest performance in response to the challenge, indicating that chicks with delayed access to feed might be more sensitive to an environment with higher antigenic pressure. In conclusion, results from the present study show that early life feeding strategy and housing conditions influence a chick's response to an immune challenge later in life. These 2 early life factors should therefore be taken into account when striving for a balance between disease resistance and performance in poultry. © 2015 Poultry Science Association Inc.
Hidderley, Margaret; Holt, Martin
2004-03-01
Autogenic training (AT) is a type of meditation usually used for reducing stress. This pilot study describes how AT was used on a group of early stage cancer patients and the observed effect on stress-related behaviours and immune system responses. This was a randomized trial with 31 early stage breast cancer women, having received a lumpectomy and adjuvant radiotherapy. The women were randomized into two groups. Group 1 received a home visit only. Group 2 received a home visit and 2 months' weekly Autogenic training. At the beginning and end of the 2 monthly periods, the Hospital Anxiety and Depression Scale (HADS) and T and B cell markers were measured to give an indication of changes in immune system responses and measurement of anxiety and depression. At the end of the study, HADS scores and T and B cell markers remained similar in the women who did not receive AT. The women receiving AT showed a strong statistical difference for an improvement in their HADS scores and those women observed in a meditative state as opposed to a relaxed state were found to have an increase in their immune responses. This study suggests AT as a powerful self-help therapy.
γδ T Cells Are a Component of Early Immunity against Preerythrocytic Malaria Parasites
McKenna, Kyle C.; Tsuji, Moriya; Sarzotti, Marcella; Sacci, John B.; Witney, Adam A.; Azad, Abdu F.
2000-01-01
We tested the hypothesis that γδ T cells are a component of an early immune response directed against preerythrocytic malaria parasites that are required for the induction of an effector αβ T-cell immune response generated by irradiated-sporozoite (irr-spz) immunization. γδ T-cell-deficient (TCRδ−/−) mice on a C57BL/6 background were challenged with Plasmodium yoelii (17XNL strain) sporozoites, and then liver parasite burden was measured at 42 h postchallenge. Liver parasite burden was measured by quantification of parasite-specific 18S rRNA in total liver RNA by quantitative-competitive reverse transcription-PCR and by an automated 5′ exonuclease PCR. Sporozoite-challenged TCRδ−/− mice showed a significant (P < 0.01) increase in liver parasite burden compared to similarly challenged immunocompetent mice. In support of this result, TCRδ−/− mice were also found to be more susceptible than immunocompetent mice to a sporozoite challenge when blood-stage parasitemia was used as a readout. A greater percentage of TCRδ−/− mice than of immunocompetent mice progressed to a blood-stage infection when challenged with five or fewer sporozoites (odds ratio = 2.35, P = 0.06). TCRδ−/− mice receiving a single irr-spz immunization showed percent inhibition of liver parasites comparable to that of immunized immunocompetent mice following a sporozoite challenge. These data support the hypothesis that γδ T cells are a component of early immunity directed against malaria preerythrocytic parasites and suggest that γδ T cells are not required for the induction of an effector αβ T-cell immune response generated by irr-spz immunization. PMID:10722623
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
Obanewa, Olayinka; Newell, Marie-Louise
2017-09-01
To systematically review the association between maternal nutritional status in pregnancy and infant immune response to childhood vaccines. We reviewed literature on maternal nutrition during pregnancy, fetal immune system and vaccines and possible relationships. Thereafter, we undertook a systematic review of the literature of maternal nutritional status and infant vaccine response, extracted relevant information, assessed quality of the nine papers identified and present findings in a narrative format. From limited evidence of average quality, intrauterine nutrition deficiency could lead to functional deficit in the infant's immune function; child vaccine response may thus be negatively affected by maternal malnutrition. Response to childhood vaccination may be associated with fetal and early life environment; evaluation of programs should take this into account.
2010-01-01
Background Deficiencies in vitamins and mineral elements are important causes of morbidity in developing countries, possibly because they lead to defective immune responses to infection. The aim of the study was to assess the effects of mineral element deficiencies on early innate cytokine responses to Plasmodium falciparum malaria. Methods Peripheral blood mononuclear cells from 304 Tanzanian children aged 6-72 months were stimulated with P. falciparum-parasitized erythrocytes obtained from in vitro cultures. Results The results showed a significant increase by 74% in geometric mean of TNF production in malaria-infected individuals with zinc deficiency (11% to 240%; 95% CI). Iron deficiency anaemia was associated with increased TNF production in infected individuals and overall with increased IL-10 production, while magnesium deficiency induced increased production of IL-10 by 46% (13% to 144%) in uninfected donors. All donors showed a response towards IL-1β production, drawing special attention for its possible protective role in early innate immune responses to malaria. Conclusions In view of these results, the findings show plasticity in cytokine profiles of mononuclear cells reacting to malaria infection under conditions of different micronutrient deficiencies. These findings lay the foundations for future inclusion of a combination of precisely selected set of micronutrients rather than single nutrients as part of malaria vaccine intervention programmes in endemic countries. PMID:20470442
Demeure, Christian E; Blanchet, Charlène; Fitting, Catherine; Fayolle, Corinne; Khun, Huot; Szatanik, Marek; Milon, Geneviève; Panthier, Jean-Jacques; Jaubert, Jean; Montagutelli, Xavier; Huerre, Michel; Cavaillon, Jean-Marc; Carniel, Elisabeth
2012-01-01
Although laboratory mice are usually highly susceptible to Yersinia pestis, we recently identified a mouse strain (SEG) that exhibited an exceptional capacity to resist bubonic plague and used it to identify immune mechanisms associated with resistance. The kinetics of infection, circulating blood cells, granulopoiesis, lesions, and cellular populations in the spleen, and cytokine production in various tissues were compared in SEG and susceptible C57BL/6J mice after subcutaneous infection with the virulent Y. pestis CO92. Bacterial invasion occurred early (day 2) but was transient in SEG/Pas mice, whereas in C57BL/6J mice it was delayed but continuous until death. The bacterial load in all organs significantly correlated with the production of 5 cytokines (granulocyte colony-stimulating factor, keratinocyte-derived chemokine (KC), macrophage cationic peptide-1 (MCP-1), interleukin 1α, and interleukin 6) involved in monocyte and neutrophil recruitment. Indeed, higher proportions of these 2 cell types in blood and massive recruitment of F4/80(+)CD11b(-) macrophages in the spleen were observed in SEG/Pas mice at an early time point (day 2). Later times after infection (day 4) were characterized in C57BL/6J mice by destructive lesions of the spleen and impaired granulopoiesis. A fast and efficient Y. pestis dissemination in SEG mice may be critical for the triggering of an early and effective innate immune response necessary for surviving plague.
Porto, Wagnner José Nascimento; Horcajo, Pilar; Kim, Pomy de Cássia Peixoto; Regidor-Cerrillo, Javier; Romão, Elton Amorim; Álvarez-García, Gema; Mesquita, Emanuela Polimeni de; Mota, Rinaldo Aparecido; Ortega-Mora, Luis Miguel
2017-08-15
Neospora caninum can cause reproductive failure in goats. However, the pathogenesis of neosporosis in this domestic species remains largely unknown. We recently demonstrated that the outcome of experimental infection by N. caninum in pregnant goats is highly dependent on the time of gestation, during which infection occurs. In the present study, we examined the peripheral and placental immune responses in these groups of goats infected with 10 6 tachyzoites of the Nc-Spain7 isolate at early (G1, at day 40 of gestation, dg), mid (G2, 90 dg) and late (G3, 120 dg) gestation, together with a group of non-infected goats as a control group (G4). Seroconversion was observed as early as day 10 post-infection (pi) in all goats from G1 that aborted earlier (10-11 pi). The remaining infected goats had seroconverted by day 14 pi. Similar IFN-γ kinetic profiles were found in sera from goats in G1 and G2 with a significant increase in the IFN-γ levels on days 7 and 10 pi. This increase was not observed in G3. A similar pattern of placental cytokine expression was found in all infected groups. IFN-γ and IL-4 showed the highest increase, followed by a weaker up-regulation in TNF-α and IL-10. The lowest up-regulation was observed for IL-12 expression. In summary, this study provides information regarding the dynamics of immune responses and their relationship with the outcome of N. caninum infection in goats during gestation. Copyright © 2017 Elsevier B.V. All rights reserved.
Khalil, Syed Muaz; Tonkin, Daniel R.; Mattocks, Melissa D.; Snead, Andrew T.; Johnston, Robert E.; White, Laura J.
2014-01-01
Dengue viruses (DENV1-4) cause 390 million clinical infections every year, several hundred thousand of which progress to severe hemorrhagic and shock syndromes. Preexisting immunity resulting from a previous DENV infection is the major risk factor for severe dengue during secondary heterologous infections. During primary infections in infants, maternal antibodies pose an analogous risk. At the same time, maternal antibodies are likely to prevent induction of endogenous anti-DENV antibodies in response to current live, attenuated virus (LAV) vaccine candidates. Any effective early life dengue vaccine has to overcome maternal antibody interference (leading to ineffective vaccination) and poor induction of antibody responses (increasing the risk of severe dengue disease upon primary infection). In a previous study, we demonstrated that a non-propagating Venezuelan equine encephalitis virus replicon expression vector (VRP), expressing the ectodomain of DENV E protein (E85), overcomes maternal interference in a BALB/c mouse model. We report here that a single immunization with a tetravalent VRP vaccine induced NAb and T-cell responses to each serotype at a level equivalent to the monovalent vaccine components, suggesting that this vaccine modality can overcome serotype interference. Furthermore, neonatal immunization was durable and could be boosted later in life to further increase NAb and T-cell responses. Although the neonatal immune response was lower in magnitude than responses in adult BALB/c mice, we demonstrate that VRP vaccines generated protective immunity from a lethal challenge after a single neonatal immunization. In summary, VRP vaccines expressing DENV antigens were immunogenic and protective in neonates, and hence are promising candidates for safe and effective vaccination in early life. PMID:24882043
Immune oncology, immune responsiveness and the theory of everything.
Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue
2018-06-05
Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.
Lin, Yong-Chin; Chen, Jiann-Chu; Morni, Wan Zabidii W.; Putra, Dedi Fazriansyah; Huang, Chien-Lun; Li, Chang-Che; Hsieh, Jen-Fang
2013-01-01
Background Recent work suggested that the presence of specific memory or some form of adaptive immunity occurs in insects and shrimp. Hypervariable pattern recognition molecules, known as Down syndrome cell adhesion molecules, are able to mount specific recognition, and immune priming in invertebrates. In the present study, we attempted to understand the immune response pattern of white shrimp Litopenaeus vannamei which received primary (PE) and secondary exposure (SE) to Vibrio alginolyticus. Methodology Immune parameters and proliferation of haematopoietic tissues (HPTs) of shrimp which had received PE and SE to V. alginolyticus were measured. In the PE trial, the immune parameters and proliferation of HPTs of shrimp that received heat-killed V. alginolyticus (HVa) and formalin-inactivated V. alginolyticus (FVa) were measured. Mortality, immune parameters and proliferation of HPTs of 7-day-HVa-PE shrimp (shrimp that received primary exposure to HVa after 7 days) and 7-day-FVa-PE shrimp (shrimp that received primary exposure to FVa after 7 days) following SE to live V. alginolyticus (LVa) were measured. Phagocytic activity and clearance efficiency were examined for the 7∼35-day-HVa-PE and FVa-PE shrimp. Results HVa-receiving shrimp showed an earlier increase in the immune response on day 1, whereas FVa-receiving shrimp showed a late increase in the immune response on day 5. The 7-day-FVa-PE shrimp showed enhancement of immunity when encountering SE to LVa, whereas 7-day-HVa-PE shrimp showed a minor enhancement in immunity. 7-day-FVa-PE shrimp showed higher proliferation and an HPT mitotic index. Both phagocytic activity and clearance maintained higher for both HVa-PE and FVa-PE shrimp after 28 days. Conclusions HVa- and FVa-receiving shrimp showed the bacteria agglutinated prior to being phagocytised. FVa functions as a vaccine, whereas HVa functions as an inducer and can be used as an immune adjuvant. A combined mixture of FVa and HVa can serve as a
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shimizu, Yuya; Miyazaki, Yasuyuki; Ibuki, Kentaro
2005-12-20
TNF-{alpha} has been implicated in the pathogenesis of, and the immune response against, HIV-1 infection. To clarify the roles of TNF-{alpha} against HIV-1-related virus infection in an SHIV-macaque model, we genetically engineered an SHIV to express the TNF-{alpha} gene (SHIV-TNF) and characterized the virus's properties in vivo. After the acute viremic stage, the plasma viral loads declined earlier in the SHIV-TNF-inoculated monkeys than in the parental SHIV (SHIV-NI)-inoculated monkeys. SHIV-TNF induced cell death in the lymph nodes without depletion of circulating CD4{sup +} T cells. SHIV-TNF provided some immunity in monkeys by increasing the production of the chemokine RANTES andmore » by inducing an antigen-specific proliferation of lymphocytes. The monkeys immunized with SHIV-TNF were partly protected against a pathogenic SHIV (SHIV-C2/1) challenge. These findings suggest that TNF-{alpha} contributes to the induction of an effective immune response against HIV-1 rather than to the progression of disease at the early stage of infection.« less
Characterization of the early local immune response to Ixodes ricinus tick bites in human skin.
Glatz, Martin; Means, Terry; Haas, Josef; Steere, Allen C; Müllegger, Robert R
2017-03-01
Little is known about the immunomodulation by tick saliva during a natural tick bite in human skin, the site of the tick-host interaction. We examined the expression of chemokines, cytokines and leucocyte markers on the mRNA levels and histopathologic changes in human skin biopsies of tick bites (n=37) compared to unaffected skin (n=9). Early tick-bite skin lesions (<24 hours of tick attachment) were characterized by a predominance of macrophages and dendritic cells, elevated mRNA levels of macrophage chemoattractants (CCL2, CCL3, CCL4) and neutrophil chemoattractants (CXCL1, CXCL8), of the pro-inflammatory cytokine, IL-1β, and the anti-inflammatory cytokine, IL-5. In contrast, the numbers of lymphocytes and mRNA levels of lymphocyte cell markers (CD4, CD8, CD19), lymphocyte chemoattractants (CXCL9, CXCL10, CXCL11, CXCL13, CCL1, CCL22), dendritic cell chemoattractants (CCL20), and other pro- (IL-6, IL-12p40, IFN-γ, TNF-α) and anti-inflammatory cytokines (IL-4, IL-10, TGF-β) did not differ from normal skin. With longer tick attachment (>24 hours), the numbers of innate immune cells and mediators (not significantly) declined, whereas the numbers of lymphocytes (not significantly) increased. Natural tick bites by Ixodes ricinus ticks initially elicit a strong local innate immune response in human skin. Beyond 24 hours of tick attachment, this response usually becomes less, perhaps because of immunomodulation by tick saliva. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Larsen, Jeppe Madura; Brix, Susanne; Thysen, Anna Hammerich; Birch, Sune; Rasmussen, Morten Arendt; Bisgaard, Hans
2014-04-01
Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonization of neonatal airways with the pathogenic bacterial strains Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. The Copenhagen Prospective Studies on Asthma in Childhood birth cohort was followed prospectively, and asthma was diagnosed at age 7 years. The immune response to H influenzae, M catarrhalis, and S pneumoniae was analyzed in 292 infants using PBMCs isolated and stored since the age of 6 months. The immune response was assessed based on the pattern of cytokines produced and T-cell activation. The immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17 (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. Children with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic bacteria colonizing the airways in early life might lead to chronic airway inflammation and childhood asthma. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Toll immune signal activates cellular immune response via eicosanoids.
Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun
2018-07-01
Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.
A modified live canine parvovirus vaccine. II. Immune response.
Carmichael, L E; Joubert, J C; Pollock, R V
1983-01-01
The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.
Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M
2004-03-01
Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.
Immune responses in space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1998-01-01
Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological
Leukocyte susceptibility and immune response against Vibrio parahaemolyticus in Totoaba macdonaldi.
Reyes-Becerril, Martha; Alamillo, Erika; Sánchez-Torres, Luvia; Ascencio-Valle, Felipe; Perez-Urbiola, Juan C; Angulo, Carlos
2016-12-01
Vibrio parahaemolyticus is a serious pathogen that affects aquaculture. Nonetheless, to the best of our knowledge, no studies have focused on its immunological implications in Totoaba macdonaldi. Thus, the early immune response to V. parahaemolyticus in juveniles of totoaba was studied at 24 h post-infection with an in vivo study. In addition, changes in cellular innate immune parameters - phagocytosis, respiratory burst activity and viability (annexin V/propidium iodide) - were evaluated in vitro in head-kidney, spleen and thymus leukocytes at 6 and 24 h after bacterial stimulation by flow cytometry. Simultaneously, the expression levels of two immune-relevant genes (IL-1β and IL-8) were measured by using real time PCR. During in vivo study, mRNA transcripts of IL-1β were highly expressed in spleen, thymus and intestine and down-regulated in liver after 24 h post-infection. IL-8 gene expression was upregulated in spleen, intestine and liver compared to that of non-infected fish and down-regulated in thymus after 24 h post-infection. Generally, the results showed a significant decrease in cellular immune responses during the infection, principally in phagocytic ability and respiratory burst. The survival or viability of stimulated leukocytes was significantly reduced causing necrosis and apoptosis, indicating a robust killing response by V. parahaemolyticus. Finally the in vitro analysis showed that transcript levels of IL-1β and IL-8 were up-regulated during stimulation with V. parahaemolyticus in head-kidney, spleen and intestine and down-regulated in thymus at any time of the experiment. Although V. parahaemolyticus has been reported to be an important pathogen for many aquatic organisms, to our knowledge this might be the first report of early-immune response in juvenile totoaba and these immune parameters may be reliable indicators and can be useful in the health control of this species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Using an agent-based model to analyze the dynamic communication network of the immune response
2011-01-01
Background The immune system behaves like a complex, dynamic network with interacting elements including leukocytes, cytokines, and chemokines. While the immune system is broadly distributed, leukocytes must communicate effectively to respond to a pathological challenge. The Basic Immune Simulator 2010 contains agents representing leukocytes and tissue cells, signals representing cytokines, chemokines, and pathogens, and virtual spaces representing organ tissue, lymphoid tissue, and blood. Agents interact dynamically in the compartments in response to infection of the virtual tissue. Agent behavior is imposed by logical rules derived from the scientific literature. The model captured the agent-to-agent contact history, and from this the network topology and the interactions resulting in successful versus failed viral clearance were identified. This model served to integrate existing knowledge and allowed us to examine the immune response from a novel perspective directed at exploiting complex dynamics, ultimately for the design of therapeutic interventions. Results Analyzing the evolution of agent-agent interactions at incremental time points from identical initial conditions revealed novel features of immune communication associated with successful and failed outcomes. There were fewer contacts between agents for simulations ending in viral elimination (win) versus persistent infection (loss), due to the removal of infected agents. However, early cellular interactions preceded successful clearance of infection. Specifically, more Dendritic Agent interactions with TCell and BCell Agents, and more BCell Agent interactions with TCell Agents early in the simulation were associated with the immune win outcome. The Dendritic Agents greatly influenced the outcome, confirming them as hub agents of the immune network. In addition, unexpectedly high frequencies of Dendritic Agent-self interactions occurred in the lymphoid compartment late in the loss outcomes. Conclusions
Wieten, R W; Goorhuis, A; Jonker, E F F; de Bree, G J; de Visser, A W; van Genderen, P J J; Remmerswaal, E B M; Ten Berge, I J M; Visser, L G; Grobusch, M P; van Leeuwen, E M M
2016-06-01
The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen patients using different immunosuppressive drugs and 30 healthy individuals vaccinated 0-22 years ago were included. The serological response was measured using the plaque reduction neutralization test (PRNT). CD8(+) and CD4(+) T-cell responses were measured following proliferation and re-stimulation with YFV peptide pools. Phenotypic characteristics and cytokine responses of CD8(+) T-cells were determined using class I tetramers. The geometric mean titre of neutralizing antibodies was not different between the groups (p = 0.77). The presence of YFV-specific CD4(+) and CD8(+) T-cell did not differ between patients and healthy individuals (15/15, 100.0% vs. 29/30, 96.7%, p = 0.475). Time since vaccination correlated negatively with the number of YFV-specific CD8(+) T-cells (r = -0.66, p = 0.0045). Percentages of early-differentiated memory cells increased (r = 0.67, p = 0.017) over time. These results imply that YF vaccination is effective despite certain immunosuppressive drug regimens. An early-differentiated memory-like phenotype persisted, which is associated with effective expansion upon re-encounter with antigen, suggesting a potent memory T-cell pool remains. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Innate immune response to Burkholderia mallei.
Saikh, Kamal U; Mott, Tiffany M
2017-06-01
Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.
Innate immune response to Burkholderia mallei
Saikh, Kamal U.; Mott, Tiffany M.
2017-01-01
Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960
Synthetic Rhamnolipid Bolaforms trigger an innate immune response in Arabidopsis thaliana.
Luzuriaga-Loaiza, W Patricio; Schellenberger, Romain; De Gaetano, Yannick; Obounou Akong, Firmin; Villaume, Sandra; Crouzet, Jérôme; Haudrechy, Arnaud; Baillieul, Fabienne; Clément, Christophe; Lins, Laurence; Allais, Florent; Ongena, Marc; Bouquillon, Sandrine; Deleu, Magali; Dorey, Stephan
2018-06-04
Stimulation of plant innate immunity by natural and synthetic elicitors is a promising alternative to conventional pesticides for a more sustainable agriculture. Sugar-based bolaamphiphiles are known for their biocompatibility, biodegradability and low toxicity. In this work, we show that Synthetic Rhamnolipid Bolaforms (SRBs) that have been synthesized by green chemistry trigger Arabidopsis innate immunity. Using structure-function analysis, we demonstrate that SRBs, depending on the acyl chain length, differentially activate early and late immunity-related plant defense responses and provide local increase in resistance to plant pathogenic bacteria. Our biophysical data suggest that SRBs can interact with plant biomimetic plasma membrane and open the possibility of a lipid driven process for plant-triggered immunity by SRBs.
Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M
2016-08-01
Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. Copyright © 2016 Elsevier Inc. All rights reserved.
Assessment of the innate immune response in the periparturient cow.
Trevisi, Erminio; Minuti, Andrea
2018-02-01
The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tilapia show immunization response against Ich
USDA-ARS?s Scientific Manuscript database
This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...
The immune response to human CMV
La Rosa, Corinna; Diamond, Don J
2012-01-01
This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079
Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying
2007-01-01
BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844
Cellular immune responses to HIV
NASA Astrophysics Data System (ADS)
McMichael, Andrew J.; Rowland-Jones, Sarah L.
2001-04-01
The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.
Super-resolution microscopy reveals protein spatial reorganization in early innate immune responses.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carson, Bryan D.; Aaron, Jesse S.; Timlin, Jerilyn Ann
2010-10-01
Over the past decade optical approaches were introduced that effectively break the diffraction barrier. Of particular note were introductions of Stimulated Emission/Depletion (STED) microscopy, Photo-Activated Localization Microscopy (PALM), and the closely related Stochastic Optical Reconstruction Microscopy (STORM). STORM represents an attractive method for researchers, as it does not require highly specialized optical setups, can be implemented using commercially available dyes, and is more easily amenable to multicolor imaging. We implemented a simultaneous dual-color, direct-STORM imaging system through the use of an objective-based TIRF microscope and filter-based image splitter. This system allows for excitation and detection of two fluorophors simultaneously, viamore » projection of each fluorophor's signal onto separate regions of a detector. We imaged the sub-resolution organization of the TLR4 receptor, a key mediator of innate immune response, after challenge with lipopolysaccharide (LPS), a bacteria-specific antigen. While distinct forms of LPS have evolved among various bacteria, only some LPS variations (such as that derived from E. coli) typically result in significant cellular immune response. Others (such as from the plague bacteria Y. pestis) do not, despite affinity to TLR4. We will show that challenge with LPS antigens produces a statistically significant increase in TLR4 receptor clusters on the cell membrane, presumably due to recruitment of receptors to lipid rafts. These changes, however, are only detectable below the diffraction limit and are not evident using conventional imaging methods. Furthermore, we will compare the spatiotemporal behavior of TLR4 receptors in response to different LPS chemotypes in order to elucidate possible routes by which pathogens such as Y. pestis are able to circumvent the innate immune system. Finally, we will exploit the dual-color STORM capabilities to simultaneously image LPS and TLR4 receptors in the
Early childhood poverty, immune-mediated disease processes, and adult productivity.
Ziol-Guest, Kathleen M; Duncan, Greg J; Kalil, Ariel; Boyce, W Thomas
2012-10-16
This study seeks to understand whether poverty very early in life is associated with early-onset adult conditions related to immune-mediated chronic diseases. It also tests the role that these immune-mediated chronic diseases may play in accounting for the associations between early poverty and adult productivity. Data (n = 1,070) come from the US Panel Study of Income Dynamics and include economic conditions in utero and throughout childhood and adolescence coupled with adult (age 30-41 y) self-reports of health and economic productivity. Results show that low income, particularly in very early childhood (between the prenatal and second year of life), is associated with increases in early-adult hypertension, arthritis, and limitations on activities of daily living. Moreover, these relationships and particularly arthritis partially account for the associations between early childhood poverty and adult productivity as measured by adult work hours and earnings. The results suggest that the associations between early childhood poverty and these adult disease states may be immune-mediated.
Host Immune Responses That Promote Initial HIV Spread
2011-07-01
exposure to virus and peak viremia. The vaginal mucosa is the most common site of infection and vaccine strategies focus mainly on promoting...spread to the lymph node specifically in the acute phase, i.e., upon vaginal inoculation. The resulting mathematical model is based on mechanistic...for early immune response to SIV and HIV infection are generally assumed to be similar and are described as follows. Virus enters the vaginal lumen and
Characterization and role of the immune response during ligament healing
NASA Astrophysics Data System (ADS)
Chamberlain, Connie S.
inflammation and stimulating remodeling. IL-4 dose- and time-dependently stimulated early ligament regeneration but was unable to maintain the response during later healing. In summary, this work demonstrated the association between the immune cells and ligament healing, indicating a potential for obtaining a more regenerative response by modulating the immune response in a time, dose, and spatial manner.
Evidence of premature immune aging in patients thymectomized during early childhood
Sauce, Delphine; Larsen, Martin; Fastenackels, Solène; Duperrier, Anne; Keller, Michael; Grubeck-Loebenstein, Beatrix; Ferrand, Christophe; Debré, Patrice; Sidi, Daniel; Appay, Victor
2009-01-01
While the thymus is known to be essential for the initial production of T cells during early life, its contribution to immune development remains a matter of debate. In fact, during cardiac surgery in newborns, the thymus is completely resected to enable better access to the heart to correct congenital heart defects, suggesting that it may be dispensable during childhood and adulthood. Here, we show that young adults thymectomized during early childhood exhibit an altered T cell compartment. Specifically, absolute CD4+ and CD8+ T cell counts were decreased, and these T cell populations showed substantial loss of naive cells and accumulation of oligoclonal memory cells. A subgroup of these young patients (22 years old) exhibited a particularly altered T cell profile that is usually seen in elderly individuals (more than 75 years old). This condition was directly related to CMV infection and the induction of strong CMV-specific T cell responses, which may exhaust the naive T cell pool in the absence of adequate T cell renewal from the thymus. Together, these marked immunological alterations are reminiscent of the immune risk phenotype, which is defined by a cluster of immune markers predictive of increased mortality in the elderly. Overall, our data highlight the importance of the thymus in maintaining the integrity of T cell immunity during adult life. PMID:19770514
Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes
Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen
2014-01-01
Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463
Immune responses to invasive aspergillosis: new understanding and therapeutic opportunities
Hohl, Tobias M.
2017-01-01
Purpose of review Invasive aspergillosis is a worldwide disease that primarily affects immune-compromised patients, agricultural workers with corneal abrasions, individuals with structural lung disease, and patients with primary immune deficiency. The critical function of the immune system is to prevent the germination of airborne conidia into tissue-invasive hyphae. This review covers recent advances that shape our understanding of anti-Aspergillus immunity at the molecular and cellular level. Recent findings Host defense against conidia and hyphae occurs via distinct molecular mechanisms that involve intracellular and extracellular killing pathways, as well as cooperation between different myeloid cell subsets. The strength and efficacy of the host response is shaped by the tissue microenvironment. In preclinical models of disease, host immune augmentation strategies have yielded benefits, yet translating these insights into therapeutic strategies in humans remains challenging. Summary Although advances in early diagnostic strategies and in antifungal drugs have ameliorated clinical outcomes of invasive aspergillosis, further improvements depend on gaining deeper insight into and translating advances in anti-Aspergillus immunity. PMID:28509673
[Inflammasome and its role in immunological and inflammatory response at early stage of burns].
Zhang, Fang; Li, Jiahui; Xia, Zhaofan
2014-06-01
Inflammasomes are large multi-protein complexes that serve as a platform for caspase-1 activation, and this process induces subsequent maturation and secretion of the proinflammatory cytokines IL-1β and IL-18, as well as pyroptosis. As an important component of the innate immune system, early activation of inflammasomes in a variety of immune cell subsets can mediate inflammatory response and immunological conditions after burn injury. Here, we review the current knowledge of inflammasomes and its role in immunological and inflammatory response at the early stage of burn injury.
Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.
VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H
1996-04-01
Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.
Inhibition of Innate Immune Responses Is Key to Pathogenesis by Arenaviruses.
Meyer, Bjoern; Ly, Hinh
2016-04-01
Mammalian arenaviruses are zoonotic viruses that cause asymptomatic, persistent infections in their rodent hosts but can lead to severe and lethal hemorrhagic fever with bleeding and multiorgan failure in human patients. Lassa virus (LASV), for example, is endemic in several West African countries, where it is responsible for an estimated 500,000 infections and 5,000 deaths annually. There are currently no FDA-licensed therapeutics or vaccines available to combat arenavirus infection. A hallmark of arenavirus infection (e.g., LASV) is general immunosuppression that contributes to high viremia. Here, we discuss the early host immune responses to arenavirus infection and the recently discovered molecular mechanisms that enable pathogenic viruses to suppress host immune recognition and to contribute to the high degree of virulence. We also directly compare the innate immune evasion mechanisms between arenaviruses and other hemorrhagic fever-causing viruses, such as Ebola, Marburg, Dengue, and hantaviruses. A better understanding of the immunosuppression and immune evasion strategies of these deadly viruses may guide the development of novel preventative and therapeutic options. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Kim, Ju Hyeon; Min, Jee Sun; Kang, Jae Soon; Kwon, Deok Ho; Yoon, Kyong Sup; Strycharz, Joseph; Koh, Young Ho; Pittendrigh, Barry Robert; Clark, J Marshall; Lee, Si Hyeock
2011-05-01
The differences in the immune response between body lice, Pediculus humanus humanus, and head lice, Pediculus humanus capitis, were investigated initially by measuring the proliferation rates of two model bacteria, a Gram-positive Staphylococcus aureus and a Gram-negative Escherichia coli, following challenge by injection. Body lice showed a significantly reduced immune response compared to head lice particularly to E. coli at the early stage of the immune challenge. Annotation of the body louse genome identified substantially fewer immune-related genes compared with other insects. Nevertheless, all required genetic components of the major immune pathways, except for the immune deficiency (Imd) pathway, are still retained in the body louse genome. Transcriptional profiling of representative genes involved in the humoral immune response, following bacterial challenge, revealed that both body and head lice, regardless of their developmental stages, exhibited an increased immune response to S. aureus but little to E. coli. Head lice, however, exhibited a significantly higher phagocytotic activity against E. coli than body lice, whereas the phagocytosis against S. aureus differed only slightly between body and head lice. These findings suggest that the greater immune response in head lice against E. coli is largely due to enhanced phagocytosis and not due to differences in the humoral immune response. The reduced phagocytotic activity in body lice could be responsible, in part, for their increased vector competence. Copyright © 2011 Elsevier Ltd. All rights reserved.
Perrett, K P; John, T M; Jin, C; Kibwana, E; Yu, L-M; Curtis, N; Pollard, A J
2014-04-01
Protection against Haemophilus influenzae type b (Hib), a rapidly invading encapsulated bacteria, is dependent on maintenance of an adequate level of serum antibody through early childhood. In many countries, Hib vaccine booster doses have been implemented after infant immunization to sustain immunity. We investigated the long-term persistence of antibody and immunological memory in primary-school children following infant (with or without booster) Hib vaccination. Anti-polyribosylribitol phosphate (PRP) immunoglobulin G (IgG) concentration and the frequency of circulating Hib-specific memory B cells were measured before a booster of a Hib-serogroup C meningococcal (MenC) conjugate vaccine and again 1 week, 1 month, and 1 year after the booster in 250 healthy children aged 6-12 years in an open-label phase 4 clinical study. Six to 12 years following infant priming with 3 doses of Hib conjugate vaccine, anti-PRP IgG geometric mean concentrations were 3.11 µg/mL and 0.71 µg/mL and proportions with anti-PRP IgG ≥1.0 µg/mL were 79% and 43% in children who had or had not, respectively, received a fourth Hib conjugate vaccine dose (mean age, 3.9 years). Higher baseline and post-Hib-MenC booster responses (anti-PRP IgG and memory B cells) were found in younger children and in those who had received a fourth Hib dose. Sustained Hib conjugate vaccine-induced immunity in children is dependent on time since infant priming and receipt of a booster. Understanding the relationship between humoral and cellular immunity following immunization with conjugate vaccines may direct vaccine design and boosting strategies to sustain individual and population immunity against encapsulated bacteria in early childhood. Clinical Trials Registration ISRCTN728588998.
Hallmarks of response to immune checkpoint blockade
Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A
2017-01-01
Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159
An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response
Buckley, Katherine M.; Rast, Jonathan P.
2017-01-01
The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism. PMID:29109720
Spaceflight and immune responses of Rhesus monkeys
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1994-01-01
Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.
Feuerecker, Matthias; Crucian, Brian; Salam, Alex P; Rybka, Ales; Kaufmann, Ines; Moreels, Marjan; Quintens, Roel; Schelling, Gustav; Thiel, Manfred; Baatout, Sarah; Sams, Clarence; Choukèr, Alexander
2014-09-01
Abstract Feuerecker, Matthias, Brian Crucian, Alex P. Salam, Ales Rybka, Ines Kaufmann, Marjan Moreels, Roel Quintens, Gustav Schelling, Manfred Thiel, Sarah Baatout, Clarence Sams, and Alexander Choukèr. Early adaption in the Antarctic environment at Dome C: Consequences on stress-sensitive innate immune functions. High Alt Med Biol 15:341-348, 2014.-Purpose/Aims: Medical reports of Antarctic expeditions indicate that health is affected under these extreme conditions. The present study at CONCORDIA-Station (Dome C, 3233 m) seeks to investigate the early consequences of confinement and hypobaric hypoxia on the human organism. Nine healthy male participants were included in this study. Data collection occurred before traveling to Antarctica (baseline), and at 1 week and 1 month upon arrival. Investigated parameters included basic physiological variables, psychological stress tests, cell blood count, stress hormones, and markers of innate immune functions in resting and stimulated immune cells. By testing for the hydrogen peroxide (H2O2) production of stimulated polymorphonuclear leukocytes (PMNs), the effects of the hypoxia-adenosine-sensitive immune modulatory pathways were examined. As compared to baseline data, reduced oxygen saturation, hemoconcentration, and an increase of secreted catecholamines was observed, whereas no psychological stress was seen. Upon stimulation, the activity of PMNs and L-selectin shedding was mitigated after 1 week. Endogenous adenosine concentration was elevated during the early phase. In summary, living conditions at high altitude influence the innate immune system's response. After 1 month, some of the early effects on the human organism were restored. As this early adaptation is not related to psychological stress, the changes observed are likely to be induced by environmental stressors, especially hypoxia. As hypoxia is triggering ATP-catabolism, leading to elevated endogenous adenosine concentrations, this and the increased
Robison, Steve G
2013-01-01
The successful completion of early childhood immunizations is a proxy for overall quality of early care. Immunization statuses are usually assessed by up-to-date (UTD) rates covering combined series of different immunizations. However, series UTD rates often only bear on which single immunization is missing, rather than the success of all immunizations. In the US, most series UTD rates are limited by missing fourth DTaP-containing immunizations (diphtheria/tetanus/pertussis) due at 15 to 18 months of age. Missing 4th DTaP immunizations are associated either with a lack of visits at 15 to 18 months of age, or to visits without immunizations. Typical immunization data however cannot distinguish between these two reasons. This study compared immunization records from the Oregon ALERT IIS with medical encounter records for two-year olds in the Oregon Health Plan. Among those with 3 valid DTaPs by 9 months of age, 31.6% failed to receive a timely 4th DTaP; of those without a 4th DTaP, 42.1% did not have any provider visits from 15 through 18 months of age, while 57.9% had at least one provider visit. Those with a 4th DTaP averaged 2.45 encounters, while those with encounters but without 4th DTaPs averaged 2.23 encounters.
Virus-like nanostructures for tuning immune response
NASA Astrophysics Data System (ADS)
Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.
2015-11-01
Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.
Early Subretinal Allograft Rejection Is Characterized by Innate Immune Activity.
Kennelly, Kevin P; Holmes, Toby M; Wallace, Deborah M; O'Farrelly, Cliona; Keegan, David J
2017-06-09
Successful subretinal transplantation is limited by considerable early graft loss despite pharmacological suppression of adaptive immunity. We postulated that early innate immune activity is a dominant factor in determining graft survival and chose a nonimmunosuppressed mouse model of retinal pigment epithelial (RPE) cell transplantation to explore this. Expression of almost all measured cytokines by DH01 RPE cells increased significantly following graft preparation, and the neutrophil chemoattractant KC/GRO/CINC was most significantly increased. Subretinal allografts of DH01 cells (C57BL/10 origin) into healthy, nonimmunosuppressed C57BL/6 murine eyes were harvested and fixed at 1, 3, 7, and 28 days postoperatively and subsequently cryosectioned and stained. Graft cells were detected using SV40 large T antigen (SV40T) immunolabeling and apoptosis/necrosis by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL). Sections were also immunolabeled for macrophage (CD11b and F4/80), neutrophil (Gr1 Ly-6G), and T-lymphocyte (CD3-ɛ) infiltration. Images captured with an Olympus FV1000 confocal microscope were analyzed using the Imaris software. The proportion of the subretinal bolus comprising graft cells (SV40T+) was significantly (p < 0.001) reduced between postoperative day (POD) 3 (90 ± 4%) and POD 7 (20 ± 7%). CD11b+, F4/80+, and Gr1 Ly-6G+ cells increased significantly (p < 0.05) from POD 1 and predominated over SV40T+ cells by POD 7. Colabeling confocal microscopic analysis demonstrated graft engulfment by neutrophils and macrophages at POD 7, and reconstruction of z-stacked confocal images confirmed SV40T inside Gr1 Ly-6G+ cells. Expression of CD3-ɛ was low and did not differ significantly between time points. By POD 28, no graft cells were detectable and few inflammatory cells remained. These studies reveal, for the first time, a critical role for innate immune mechanisms early in subretinal graft rejection. The future success
Unique aspects of the perinatal immune system.
Zhang, Xiaoming; Zhivaki, Dania; Lo-Man, Richard
2017-08-01
The early stages of life are associated with increased susceptibility to infection, which is in part due to an ineffective immune system. In the context of infection, the immune system must be stimulated to provide efficient protection while avoiding insufficient or excessive activation. Yet, in early life, age-dependent immune regulation at molecular and cellular levels contributes to a reduced immunological fitness in terms of pathogen clearance and response to vaccines. To enable microbial colonization to be tolerated at birth, epigenetic immune cell programming and early life-specific immune regulatory and effector mechanisms ensure that vital functions and organ development are supported and that tissue damage is avoided. Advancement in our understanding of age-related remodelling of immune networks and the consequent tuning of immune responsiveness will open up new possibilities for immune intervention and vaccine strategies that are designed specifically for early life.
Cardinaud, Marion; Dheilly, Nolwenn M; Huchette, Sylvain; Moraga, Dario; Paillard, Christine
2015-08-01
Vibrio harveyi is a marine bacterial pathogen responsible for episodic abalone mortalities in France, Japan and Australia. In the European abalone, V. harveyi invades the circulatory system in a few hours after exposure and is lethal after 2 days of infection. In this study, we investigated the responses of European abalone immune cells over the first 24 h of infection. Results revealed an initial induction of immune gene expression including Rel/NF-kB, Mpeg and Clathrin. It is rapidly followed by a significant immuno-suppression characterized by reduced cellular hemocyte parameters, immune response gene expressions and enzymatic activities. Interestingly, Ferritin was overexpressed after 24 h of infection suggesting that abalone attempt to counter V. harveyi infection using soluble effectors. Immune function alteration was positively correlated with V. harveyi concentration. This study provides the evidence that V. harveyi has a hemolytic activity and an immuno-suppressive effect in the European abalone. Copyright © 2015 Elsevier Ltd. All rights reserved.
Socioeconomic disadvantage, gestational immune activity, and neurodevelopment in early childhood
Hornig, Mady; Ghassabian, Akhgar; Hahn, Jill; Cherkerzian, Sara; Albert, Paul S.; Buka, Stephen L.; Goldstein, Jill M.
2017-01-01
Children raised in economically disadvantaged households face increased risks of poor health in adulthood, suggesting that inequalities in health have early origins. From the child’s perspective, exposure to economic hardship may begin as early as conception, potentially via maternal neuroendocrine–immune responses to prenatal stressors, which adversely impact neurodevelopment. Here we investigate whether socioeconomic disadvantage is associated with gestational immune activity and whether such activity is associated with abnormalities among offspring during infancy. We analyzed concentrations of five immune markers (IL-1β, IL-6, IL-8, IL-10, and TNF-α) in maternal serum from 1,494 participants in the New England Family Study in relation to the level of maternal socioeconomic disadvantage and their involvement in offspring neurologic abnormalities at 4 mo and 1 y of age. Median concentrations of IL-8 were lower in the most disadvantaged pregnancies [−1.53 log(pg/mL); 95% CI: −1.81, −1.25]. Offspring of these pregnancies had significantly higher risk of neurologic abnormalities at 4 mo [odds ratio (OR) = 4.61; CI = 2.84, 7.48] and 1 y (OR = 2.05; CI = 1.08, 3.90). This higher risk was accounted for in part by fetal exposure to lower maternal IL-8, which also predicted higher risks of neurologic abnormalities at 4 mo (OR = 7.67; CI = 4.05, 14.49) and 1 y (OR = 2.92; CI = 1.46, 5.87). Findings support the role of maternal immune activity in fetal neurodevelopment, exacerbated in part by socioeconomic disadvantage. This finding reveals a potential pathophysiologic pathway involved in the intergenerational transmission of socioeconomic inequalities in health. PMID:28607066
Shoda, Lisl Km; Battista, Christina; Siler, Scott Q; Pisetsky, David S; Watkins, Paul B; Howell, Brett A
2017-01-01
Drug-induced liver injury (DILI) remains an adverse event of significant concern for drug development and marketed drugs, and the field would benefit from better tools to identify liver liabilities early in development and/or to mitigate potential DILI risk in otherwise promising drugs. DILIsym software takes a quantitative systems toxicology approach to represent DILI in pre-clinical species and in humans for the mechanistic investigation of liver toxicity. In addition to multiple intrinsic mechanisms of hepatocyte toxicity (ie, oxidative stress, bile acid accumulation, mitochondrial dysfunction), DILIsym includes the interaction between hepatocytes and cells of the innate immune response in the amplification of liver injury and in liver regeneration. The representation of innate immune responses, detailed here, consolidates much of the available data on the innate immune response in DILI within a single framework and affords the opportunity to systematically investigate the contribution of the innate response to DILI.
Outcome Prediction in Mathematical Models of Immune Response to Infection.
Mai, Manuel; Wang, Kun; Huber, Greg; Kirby, Michael; Shattuck, Mark D; O'Hern, Corey S
2015-01-01
Clinicians need to predict patient outcomes with high accuracy as early as possible after disease inception. In this manuscript, we show that patient-to-patient variability sets a fundamental limit on outcome prediction accuracy for a general class of mathematical models for the immune response to infection. However, accuracy can be increased at the expense of delayed prognosis. We investigate several systems of ordinary differential equations (ODEs) that model the host immune response to a pathogen load. Advantages of systems of ODEs for investigating the immune response to infection include the ability to collect data on large numbers of 'virtual patients', each with a given set of model parameters, and obtain many time points during the course of the infection. We implement patient-to-patient variability v in the ODE models by randomly selecting the model parameters from distributions with coefficients of variation v that are centered on physiological values. We use logistic regression with one-versus-all classification to predict the discrete steady-state outcomes of the system. We find that the prediction algorithm achieves near 100% accuracy for v = 0, and the accuracy decreases with increasing v for all ODE models studied. The fact that multiple steady-state outcomes can be obtained for a given initial condition, i.e. the basins of attraction overlap in the space of initial conditions, limits the prediction accuracy for v > 0. Increasing the elapsed time of the variables used to train and test the classifier, increases the prediction accuracy, while adding explicit external noise to the ODE models decreases the prediction accuracy. Our results quantify the competition between early prognosis and high prediction accuracy that is frequently encountered by clinicians.
Trans-Golgi network/early endosome: a central sorting station for cargo proteins in plant immunity.
LaMontagne, Erica D; Heese, Antje
2017-12-01
In plants, the trans-Golgi network (TGN) functionally overlaps with the early endosome (EE), serving as a central sorting hub to direct newly synthesized and endocytosed cargo to the cell surface or vacuole. Here, we focus on the emerging role of the TGN/EE in sorting of immune cargo proteins for effective plant immunity against pathogenic bacteria and fungi. Specific vesicle coat and regulatory components at the TGN/EE ensure that immune cargoes are correctly sorted and transported to the location of their cellular functions. Our understanding of the identity of immune cargoes and the underlying cellular mechanisms regulating their sorting are still rudimentary, but this knowledge is essential to understanding the physiological contribution of the TGN/EE to effective immune responses. Copyright © 2017. Published by Elsevier Ltd.
Plasticity in early immune evasion strategies of a bacterial pathogen.
Bernard, Quentin; Smith, Alexis A; Yang, Xiuli; Koci, Juraj; Foor, Shelby D; Cramer, Sarah D; Zhuang, Xuran; Dwyer, Jennifer E; Lin, Yi-Pin; Mongodin, Emmanuel F; Marques, Adriana; Leong, John M; Anguita, Juan; Pal, Utpal
2018-04-17
Borrelia burgdorferi is one of the few extracellular pathogens capable of establishing persistent infection in mammals. The mechanisms that sustain long-term survival of this bacterium are largely unknown. Here we report a unique innate immune evasion strategy of B. burgdorferi , orchestrated by a surface protein annotated as BBA57, through its modulation of multiple spirochete virulent determinants. BBA57 function is critical for early infection but largely redundant for later stages of spirochetal persistence, either in mammals or in ticks. The protein influences host IFN responses as well as suppresses multiple host microbicidal activities involving serum complement, neutrophils, and antimicrobial peptides. We also discovered a remarkable plasticity in BBA57-mediated spirochete immune evasion strategy because its loss, although resulting in near clearance of pathogens at the inoculum site, triggers nonheritable adaptive changes that exclude detectable nucleotide alterations in the genome but incorporate transcriptional reprograming events. Understanding the malleability in spirochetal immune evasion mechanisms that ensures their host persistence is critical for the development of novel therapeutic and preventive approaches to combat long-term infections like Lyme borreliosis.
Early Immune Function and Duration of Organ Dysfunction in Critically Ill Septic Children.
Muszynski, Jennifer A; Nofziger, Ryan; Moore-Clingenpeel, Melissa; Greathouse, Kristin; Anglim, Larissa; Steele, Lisa; Hensley, Josey; Hanson-Huber, Lisa; Nateri, Jyotsna; Ramilo, Octavio; Hall, Mark W
2018-02-22
Late immune suppression is associated with nosocomial infection and mortality in septic adults and children. Relationships between early immune suppression and outcomes in septic children remain unclear. Prospective observational study to test the hypothesis that early innate and adaptive immune suppression are associated with longer duration of organ dysfunction in children with severe sepsis/septic shock. Methods, Measurements and Main Results: Children aged < 18 years meeting consensus criteria for severe sepsis or septic shock were sampled within 48 hours of sepsis onset. Healthy controls were sampled once. Innate immune function was quantified by whole blood ex vivo lipopolysaccharide-induced TNFα production capacity. Adaptive immune function was quantified by ex vivo phytohemagglutinin-induced IFNγ production capacity. 102 septic children and 35 healthy children were enrolled. Compared to healthy children, septic children demonstrated lower LPS-induced TNFα production (p < 0.0001) and lower PHA-induced IFNγ production (p<0.0001). Among septic children, early innate and adaptive immune suppression were associated with greater number of days with multiple organ dysfunction (MODS) and greater number of days with any organ dysfunction. On multivariable analyses, early innate immune suppression remained independently associated with increased MODS days [aRR 1.2 (1.03, 1.5)] and organ dysfunction days [aRR 1.2 (1.1, 1.3)]. Critically ill children with severe sepsis or septic shock demonstrate early innate and adaptive immune suppression. Early suppression of both innate and adaptive immunity are associated with longer duration of organ dysfunction and may be useful markers to guide investigations of immunomodulatory therapies in septic children.
Immune Response in Thyroid Cancer: Widening the Boundaries
Ward, Laura Sterian
2014-01-01
The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756
Systems analysis of protective immune responses to RTS,S malaria vaccination in humans
Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali
2017-01-01
RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898
Measles virus-induced suppression of immune responses.
Griffin, Diane E
2010-07-01
Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.
Kowalczyk, Aleksandra; Doener, Fatma; Zanzinger, Kai; Noth, Janine; Baumhof, Patrick; Fotin-Mleczek, Mariola; Heidenreich, Regina
2016-07-19
mRNA represents a new platform for the development of therapeutic and prophylactic vaccines with high flexibility with respect to production and application. We have previously shown that our two component self-adjuvanted mRNA-based vaccines (termed RNActive® vaccines) induce balanced immune responses comprising both humoral and cellular effector as well as memory responses. Here, we evaluated the early events upon intradermal application to gain more detailed insights into the underlying mode of action of our mRNA-based vaccine. We showed that the vaccine is taken up in the skin by both non-leukocytic and leukocytic cells, the latter being mostly represented by antigen presenting cells (APCs). mRNA was then transported to the draining lymph nodes (dLNs) by migratory dendritic cells. Moreover, the encoded protein was expressed and efficiently presented by APCs within the dLNs as shown by T cell proliferation and immune cell activation, followed by the induction of the adaptive immunity. Importantly, the immunostimulation was limited to the injection site and lymphoid organs as no proinflammatory cytokines were detected in the sera of the immunized mice indicating a favorable safety profile of the mRNA-based vaccines. Notably, a substantial boostability of the immune responses was observed, indicating that mRNA can be used effectively in repetitive immunization schedules. The evaluation of the immunostimulation following prime and boost vaccination revealed no signs of exhaustion as demonstrated by comparable levels of cytokine production at the injection site and immune cell activation within dLNs. In summary, our data provide mechanistic insight into the mode of action and a rational for the use of mRNA-based vaccines as a promising immunization platform. Copyright © 2016 Elsevier Ltd. All rights reserved.
Immune Responses to HCV and Other Hepatitis Viruses
Park, Su-Hyung; Rehermann, Barbara
2014-01-01
Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Active Suppression of Early Immune Response in Tobacco by the Human Pathogen Salmonella Typhimurium
Shirron, Natali; Yaron, Sima
2011-01-01
The persistence of enteric pathogens on plants has been studied extensively, mainly due to the potential hazard of human pathogens such as Salmonella enterica being able to invade and survive in/on plants. Factors involved in the interactions between enteric bacteria and plants have been identified and consequently it was hypothesized that plants may be vectors or alternative hosts for enteric pathogens. To survive, endophytic bacteria have to escape the plant immune systems, which function at different levels through the plant-bacteria interactions. To understand how S. enterica survives endophyticaly we conducted a detailed analysis on its ability to elicit or evade the plant immune response. The models of this study were Nicotiana tabacum plants and cells suspension exposed to S. enterica serovar Typhimurium. The plant immune response was analyzed by looking at tissue damage and by testing oxidative burst and pH changes. It was found that S. Typhimurium did not promote disease symptoms in the contaminated plants. Live S. Typhimurium did not trigger the production of an oxidative burst and pH changes by the plant cells, while heat killed or chloramphenicol treated S. Typhimurium and purified LPS of Salmonella were significant elicitors, indicating that S. Typhimurium actively suppress the plant response. By looking at the plant response to mutants defective in virulence factors we showed that the suppression depends on secreted factors. Deletion of invA reduced the ability of S. Typhimurium to suppress oxidative burst and pH changes, indicating that a functional SPI1 TTSS is required for the suppression. This study demonstrates that plant colonization by S. Typhimurium is indeed an active process. S. Typhimurium utilizes adaptive strategies of altering innate plant perception systems to improve its fitness in the plant habitat. All together these results suggest a complex mechanism for perception of S. Typhimurium by plants. PMID:21541320
Belknap, J K; Giguère, S; Pettigrew, A; Cochran, A M; Van Eps, A W; Pollitt, C C
2007-01-01
Recent research has indicated that inflammation plays a role in the early stages of laminitis and that, similar to organ failure in human sepsis, early inflammatory mechanisms may lead to downstream events resulting in lamellar failure. Characterisation of the type of immune response (i.e. innate vs. adaptive) is essential in order to develop therapeutic strategies to counteract these deleterious events. To quantitate gene expression of pro-inflammatory cytokines known to be important in the innate and adaptive immune response during the early stages of laminitis, using both the black walnut extract (BWE) and oligofructose (OF) models of laminitis. Real-time qPCR was used to assess lamellar mRNA expression of interleukins-1beta, 2, 4, 6, 8, 10, 12 and 18, and tumour necrosis factor alpha and interferon gamma at the developmental stage and at the onset of lameness. Significantly increased lamellar mRNA expression of cytokines important in the innate immune response were present at the developmental stage of the BWE model, and at the onset of acute lameness in both the BWE model and OF model. Of the cytokines characteristic of the Th1 and Th2 arms of the adaptive immune response, a mixed response was noted at the onset of acute lameness in the BWE model, whereas the response was skewed towards a Th1 response at the onset of lameness in the OF model. Lamellar inflammation is characterised by strong innate immune response in the developmental stages of laminitis; and a mixture of innate and adaptive immune responses at the onset of lameness. These results indicate that anti-inflammatory treatment of early stage laminitis (and the horse at risk of laminitis) should include not only therapeutic drugs that address prostanoid activity, but should also address the marked increases in lamellar cytokine expression.
Lopera, Damaris; Urán-Jiménez, Martha Eugenia
2016-01-01
Neutrophils predominate during the acute phase of the Paracoccidioides brasiliensis infection. Herein, we determined the role of the neutrophil during the early stages of experimental pulmonary paracoccidioidomycosis using a monoclonal antibody (mAb) specific for neutrophils. Male BALB/c mice were inoculated intranasally with 1.5 × 106 or 2 × 106 P. brasiliensis yeast cells. The mAb was administered 24 h before infection, followed by doses every 48 h until mice were sacrificed. Survival time was evaluated and mice were sacrificed at 48 h and 96 h after inoculation to assess cellularity, fungal load, cytokine/chemokine levels, and histopathological analysis. Neutrophils from mAb-treated mice were efficiently depleted (99.04%). Eighty percent of the mice treated with the mAb and infected with 1.5 × 106 yeast cells died during the first two weeks after infection. When mice were treated and infected with 2 × 106 yeast cells, 100% of them succumbed by the first week after infection. During the acute inflammatory response significant increases in numbers of eosinophils, fungal load and levels of proinflammatory cytokines/chemokines were observed in the mAb-treated mice. We also confirmed that neutrophils are an important source of IFN-γ and IL-17. These results indicate that neutrophils are essential for protection as well as being important for regulating the early inflammatory immune response in experimental pulmonary paracoccidioidomycosis. PMID:27642235
Prescott, Joseph B; Hall, Pamela R; Bondu-Hawkins, Virginie S; Ye, Chunyan; Hjelle, Brian
2007-08-01
Sin Nombre virus (SNV) is a highly pathogenic New World virus and etiologic agent of hantavirus cardiopulmonary syndrome. We have previously shown that replication-defective virus particles are able to induce a strong IFN-stimulated gene (ISG) response in human primary cells. RNA viruses often stimulate the innate immune response by interactions between viral nucleic acids, acting as a pathogen-associated molecular pattern, and cellular pattern-recognition receptors (PRRs). Ligand binding to PRRs activates transcription factors which regulate the expression of antiviral genes, and in all systems examined thus far, IFN regulatory factor 3 (IRF3) has been described as an essential intermediate for induction of ISG expression. However, we now describe a model in which IRF3 is dispensable for the induction of ISG transcription in response to viral particles. IRF3-independent ISG transcription in human hepatoma cell lines is initiated early after exposure to SNV virus particles in an entry- and replication-independent fashion. Furthermore, using gene knockdown, we discovered that this activation is independent of the best-characterized RNA- and protein-sensing PRRs including the cytoplasmic caspase recruitment domain-containing RNA helicases and the TLRs. SNV particles engage a heretofore unrecognized PRR, likely located at the cell surface, and engage a novel IRF3-independent pathway that activates the innate immune response.
Fox, Helen C; Milivojevic, Verica; Angarita, Gustavo A; Stowe, Raymond; Sinha, Rajita
2017-01-01
Background Peripheral immune system cytokines may play an integral role in underlying sensitized stress response and alcohol craving during early withdrawal. To date, the nature of these immune changes during early abstinence have not been examined. Methods Thirty-nine early abstinent, treatment-seeking alcohol dependent individuals and 46 socially drinking controls were exposed to three guided imageries: stress, alcohol cue and neutral. These were presented randomly across consecutive days. Plasma measures of tumor necrosis factor alpha (TNFα), tumor necrosis factor receptor 1 (TNFR1), interleukin-6 (IL-6), and interleukin-10 (IL-10), were collected at baseline, immediately after imagery and at various recovery time-points. Ratings of alcohol craving, negative mood and anxiety were also obtained at the same time-points. Results The alcohol group demonstrated decreased basal IL-10 compared with controls particularly following exposure to alcohol cue. They also showed a dampened TNFα and TNFR1 response to stress and cue, respectively, and a generalized suppression of IL-6. In the alcohol group, these immune system adaptations occurred alongside significant elevations in anxiety, negative mood and alcohol craving. Conclusions Findings demonstrate that broad immuno-suppression is still observed in alcohol dependent individuals after three weeks of abstinence and may be linked to motivation for alcohol. PMID:28675117
Wolferstätter, Michael; Schweneker, Marc; Späth, Michaela; Lukassen, Susanne; Klingenberg, Marieken; Brinkmann, Kay; Wielert, Ursula; Lauterbach, Henning; Hochrein, Hubertus; Chaplin, Paul; Suter, Mark; Hausmann, Jürgen
2014-12-01
Double-stranded RNA (dsRNA) is an important molecular pattern associated with viral infection and is detected by various extra- and intracellular recognition molecules. Poxviruses have evolved to avoid producing dsRNA early in infection but generate significant amounts of dsRNA late in infection due to convergent transcription of late genes. Protein kinase R (PKR) is activated by dsRNA and triggers major cellular defenses against viral infection, including protein synthesis shutdown, apoptosis, and type I interferon (IFN-I) production. The poxviral E3 protein binds and sequesters viral dsRNA and is a major antagonist of the PKR pathway. We found that the highly replication-restricted modified vaccinia virus Ankara (MVA) engineered to produce excess amounts of dsRNA early in infection showed enhanced induction of IFN-β in murine and human cells in the presence of an intact E3L gene. IFN-β induction required a minimum overlap length of 300 bp between early complementary transcripts and was strongly PKR dependent. Excess early dsRNA produced by MVA activated PKR early but transiently in murine cells and induced enhanced systemic levels of IFN-α, IFN-γ, and other cytokines and chemokines in mice in a largely PKR-dependent manner. Replication-competent chorioallantois vaccinia virus Ankara (CVA) generating excess early dsRNA also enhanced IFN-I production and was apathogenic in mice even at very high doses but showed no in vitro host range defect. Thus, genetically adjuvanting MVA and CVA to generate excess early dsRNA is an effective method to enhance innate immune stimulation by orthopoxvirus vectors and to attenuate replicating vaccinia virus in vivo. Efficient cellular sensing of pathogen-specific components, including double-stranded RNA (dsRNA), is an important prerequisite of an effective antiviral immune response. The prototype poxvirus vaccinia virus (VACV) and its derivative modified vaccinia virus Ankara (MVA) produce dsRNA as a by-product of viral
Thwe, Phyu M; Pelgrom, Leonard; Cooper, Rachel; Beauchamp, Saritha; Reisz, Julie A; D'Alessandro, Angelo; Everts, Bart; Amiel, Eyal
2017-09-05
Dendritic cell (DC) activation by Toll-like receptor (TLR) agonists causes rapid glycolytic reprogramming that is required to meet the metabolic demands of their immune activation. Recent efforts in the field have identified an important role for extracellular glucose sourcing to support DC activation. However, the contributions of intracellular glucose stores to these processes have not been well characterized. We demonstrate that DCs possess intracellular glycogen stores and that cell-intrinsic glycogen metabolism supports the early effector functions of TLR-activated DCs. Inhibition of glycogenolysis significantly attenuates TLR-mediated DC maturation and impairs their ability to initiate lymphocyte activation. We further report that DCs exhibit functional compartmentalization of glucose- and glycogen-derived carbons, where these substrates preferentially contribute to distinct metabolic pathways. This work provides novel insights into nutrient homeostasis in DCs, demonstrating that differential utilization of glycogen and glucose metabolism regulates their optimal immune function. Copyright © 2017 Elsevier Inc. All rights reserved.
Matos, L; Muñoz, M C; Molina, J M; Rodríguez, F; Perez, D; Lopez, A; Ferrer, O; Hermosilla, C; Taubert, A; Ruiz, A
2017-08-15
During the first schizogony, the goat coccidia Eimeria ninakohlyakimovae develops macroschizonts in lacteal duct endothelial cells, whose rupture leads to severe ileal damage and clinical signs during the prepatent period. The immune response elicited against early stages of the parasite development still requires to be investigated. In the present study we have evaluated immune reactions in goat kids primary- and challenged-infected with Eimeria ninakohlyakimovae, and sacrificed during prepatency (7days after challenge). The oocyst output during the primary infection, body weight and clinical condition of all the animals were examined and, at the end of the experiment, all the goat kids were euthanized and subjected to necropsy. Samples were taken from different sections of the ileum, colon and mesenteric lymph nodes (MLN) of primary- and challenged E. ninakohlyakimovae-infected animals. Intestinal leukocyte subpopulations were characterized in E. ninakohlyakimovae-infected mucosa and counts of lymphocytes, eosinophils, polymorphonuclear neutrophils (PMN), globular leukocytes and mast cells were recorded. Additionally, gene expression of caprine IL-2, IL-4, IL-10 and INFγ of ileal, colonic and MLN tissues were performed, as well as the immunohistochemical characterization of immune cells. The E. ninakohlyakimovae primary infection resulted in moderate to severe enteritis with different degrees of diarrhoea and was accompanied by high OPG counts and an increase of most immune cells analyzed when compared to uninfected control animals. Furthermore, eosinophil-, lymphocyte-, globular leukocyte- and mast cell-counts were significantly higher in the challenge group compared to the primary infected animals, whilst the opposite was true for PMN counts. The challenge infection was also associated with moderate increased levels of local mucosal IgA. Interestingly, the number of immature schizonts found at the ileal mucosa was statistically higher in the challenge infected
Hopewell, Emily L.; Bronk, Crystina C.; Massengill, Michael; Engelman, Robert W.; Beg, Amer A.
2012-01-01
Microbial adjuvants in vaccines activate key transcription factors, including NF-κB and interferon response factors (IRFs). However, the individual role of these transcription factor pathways in promoting adaptive immunity by adjuvants is not clear. It is widely believed that induction of a strong inflammatory response potentiates an adaptive immune response. In this study, we sought to determine whether activation of the pro-inflammatory inhibitor of κB kinase β (IKKβ) canonical NF-κB pathway promoted vaccine-induced immune responses. An adenovirus expressing constitutively-activated IKKβ (AdIKK) induced robust DC maturation and high expression of key cytokines compared to a control virus. In vivo, AdIKK triggered rapid inflammation after pulmonary infection, increased leukocyte entry into draining LNs, and enhanced early antibody and T-cell responses. Notably, AdIKK did not influence the overall magnitude of the adaptive immune response. These results indicate that induction of inflammation by IKKβ/NF-κB in this setting impacts the kinetics but not the magnitude of adaptive immune responses. These findings therefore help define the individual role of a key pathway induced by vaccine adjuvants in promoting adaptive immunity. PMID:22161279
Epithelium-Innate Immune Cell Axis in Mucosal Responses to SIV
Shang, L.; Duan, L.; Perkey, K. E.; Wietgrefe, S.; Zupancic, M.; Smith, A. J.; Southern, P. J.; Johnson, R. P.; Haase, A. T.
2016-01-01
In the SIV-rhesus macaque model of HIV-1 transmission to women, one hallmark of the mucosal response to exposure to high doses of SIV is CD4 T cell recruitment that fuels local virus expansion in early infection. In this study, we systematically analyzed the cellular events and chemoattractant profiles in cervical tissues that precede CD4 T cell recruitment. We show that vaginal exposure to the SIV inoculum rapidly induces chemokine expression in cervical epithelium including CCL3, CCL20, and CXCL8. The chemokine expression is associated with early recruitment of macrophages and plasmacytoid dendritic cells that are co-clustered underneath the cervical epithelium. Production of chemokines CCL3 and CXCL8 by these cells in turn generates a chemokine gradient that is spatially correlated with the recruitment of CD4 T cells. We further show that the protection of SIVmac239Δnef vaccination against vaginal challenge is correlated with the absence of this epithelium-innate immune cell-CD4 T cell axis response in the cervical mucosa. Our results reveal a critical role for cervical epithelium in initiating early mucosal responses to vaginal infection, highlight an important role for macrophages in target cell recruitment and provide further evidence of a paradoxical dampening effect of a protective vaccine on these early mucosal responses. PMID:27435105
Epithelium-innate immune cell axis in mucosal responses to SIV.
Shang, L; Duan, L; Perkey, K E; Wietgrefe, S; Zupancic, M; Smith, A J; Southern, P J; Johnson, R P; Haase, A T
2017-03-01
In the SIV (simian immunodeficiency virus)-rhesus macaque model of HIV-1 (human immunodeficiency virus type I) transmission to women, one hallmark of the mucosal response to exposure to high doses of SIV is CD4 T-cell recruitment that fuels local virus expansion in early infection. In this study, we systematically analyzed the cellular events and chemoattractant profiles in cervical tissues that precede CD4 T-cell recruitment. We show that vaginal exposure to the SIV inoculum rapidly induces chemokine expression in cervical epithelium including CCL3, CCL20, and CXCL8. The chemokine expression is associated with early recruitment of macrophages and plasmacytoid dendritic cells that are co-clustered underneath the cervical epithelium. Production of chemokines CCL3 and CXCL8 by these cells in turn generates a chemokine gradient that is spatially correlated with the recruitment of CD4 T cells. We further show that the protection of SIVmac239Δnef vaccination against vaginal challenge is correlated with the absence of this epithelium-innate immune cell-CD4 T-cell axis response in the cervical mucosa. Our results reveal a critical role for cervical epithelium in initiating early mucosal responses to vaginal infection, highlight an important role for macrophages in target cell recruitment, and provide further evidence of a paradoxical dampening effect of a protective vaccine on these early mucosal responses.
Evasion of Early Antiviral Responses by Herpes Simplex Viruses
Suazo, Paula A.; Ibañez, Francisco J.; Retamal-Díaz, Angello R.; Paz-Fiblas, Marysol V.; Bueno, Susan M.; Kalergis, Alexis M.; González, Pablo A.
2015-01-01
Besides overcoming physical constraints, such as extreme temperatures, reduced humidity, elevated pressure, and natural predators, human pathogens further need to overcome an arsenal of antimicrobial components evolved by the host to limit infection, replication and optimally, reinfection. Herpes simplex virus-1 (HSV-1) and herpes simplex virus-2 (HSV-2) infect humans at a high frequency and persist within the host for life by establishing latency in neurons. To gain access to these cells, herpes simplex viruses (HSVs) must replicate and block immediate host antiviral responses elicited by epithelial cells and innate immune components early after infection. During these processes, infected and noninfected neighboring cells, as well as tissue-resident and patrolling immune cells, will sense viral components and cell-associated danger signals and secrete soluble mediators. While type-I interferons aim at limiting virus spread, cytokines and chemokines will modulate resident and incoming immune cells. In this paper, we discuss recent findings relative to the early steps taking place during HSV infection and replication. Further, we discuss how HSVs evade detection by host cells and the molecular mechanisms evolved by these viruses to circumvent early antiviral mechanisms, ultimately leading to neuron infection and the establishment of latency. PMID:25918478
Chen, Yan; Zhang, Jin; Lu, Yong; Wang, Libo
2015-01-01
Bronchial asthma is a chronic airway inflammatory condition with high morbidity, and effective treatments for asthma are limited. Allergen-specific immunotherapy can only induce peripheral immune tolerance and is not sustainable. Exploring new therapeutic strategies is of great clinical importance. Recombinant adenovirus (rAdV) was used as a vector to make cells expressing cytotoxic T lymphocyte-associated antigen-4-immunoglobulin (CTLA4Ig) a soluble CTLA4 immunoglobulin fusion protein. Dendritic cells (DCs) were modified using the rAdVs together with allergens. Then these modified DCs were transplanted to mice before allergen sensitization. The persistence and specificity of immune tolerance were evaluated in mice challenged with asthma allergens at 3 and 7 months. DCs modified by CTLA4Ig showed increased IL-10 secretion, decreased IL-12 secretion, and T cell stimulation in vitro. Mice treated with these DCs in the early neonatal period developed tolerance against the allergens that were used to induce asthma in the adult stage. Asthma symptoms, lung damage, airway reactivity, and inflammatory response all improved. Humoral immunity indices showed that this therapeutic strategy strongly suppressed mice immune responses and was maintained for as long as 7 months. Furthermore, allergen cross-sensitization and challenge experiments demonstrated that this immune tolerance was allergen-specific. Treatment with CTLA4Ig modified DCs in the early neonatal period, inducing persistent and allergen-specific immune tolerance to asthma in adult mice. Our results suggest that it may be possible to develop a vaccine for asthma. PMID:25860995
Summerfield, Artur; Guzylack-Piriou, Laurence; Harwood, Lisa; McCullough, Kenneth C
2009-03-15
Foot-and-mouth disease (FMD) represents one of the most economically important diseases of farm animals. The basis for the threat caused by this virus is the high speed of replication, short incubation time, high contagiousness, and high mutation rate resulting in constant antigenic changes. Thus, although protective immune responses against FMD virus (FMDV) can be efficacious, the rapidity of virus replication and spread can outpace immune defence development and overrun the immune system. FMDV can also evade innate immune responses through its ability to shut down cellular protein synthesis, including IFN type I, in susceptible epithelial cells. This is important for virus evolution, as FMDV is quite sensitive to the action of IFN. Despite this, innate immune responses are probably induced in vivo, although detailed studies on this subject are lacking. Accordingly, this interaction of FMDV with cells of the innate immune system is of particular interest. Dendritic cells (DC) can be infected by FMDV and support viral RNA replication, and viral protein synthesis but the latter is inefficient or abortive, leading most often to incomplete replication and progeny virus release. As a result DC can be activated, and particularly in the case of plasmacytoid DC (pDC), this is manifest in terms of IFN-alpha release. Our current state of knowledge on innate immune responses induced by FMDV is still only at a relatively early stage of understanding. As we progress, the investigations in this area will help to improve the design of current vaccines and the development of novel control strategies against FMD.
Piret, Jocelyne; Boivin, Guy
2015-09-01
Herpes simplex viruses are large double-stranded DNA viruses. These viruses have the ability to establish a lifelong latency in sensory ganglia and to invade and replicate in the CNS. Apart from relatively benign mucosal infections, HSV is responsible for severe illnesses including HSV encephalitis (HSE). HSE is the most common cause of sporadic, potentially fatal viral encephalitis in Western countries. If left untreated, the mortality rate associated with HSE is approximately 70%. Despite antiviral therapy, the mortality is still higher than 30%, and almost 60% of surviving individuals develop neurological sequelae. It is suggested that direct virus-related and indirect immune-mediated mechanisms contribute to the damages occurring in the CNS during HSE. In this manuscript, we describe the innate immune response to HSV, the development of HSE in mice knock-out for proteins of the innate immune system as well as inherited deficiencies in key components of the signaling pathways involved in the production of type I interferon that could predispose individuals to develop HSE. Finally, we review several immunomodulatory strategies aimed at modulating the innate immune response at a critical time after infection that were evaluated in mouse models and could be combined with antiviral therapy to improve the prognosis of HSE. In conclusion, the cerebral innate immune response that develops during HSE is a "double-edged sword" as it is critical to control viral replication in the brain early after infection, but, if left uncontrolled, may also result in an exaggerated inflammatory response that could be detrimental to the host. Copyright © 2015 John Wiley & Sons, Ltd.
Effects of Air Pollutants on Development of Allergic Immune Responses in the Respiratory Tract
Gershwin, Laurel J.
2003-01-01
The increased incidence of allergic asthma in the human population worldwide has stimulated many explanatory theories. A concomitant decrease in air quality leads to epidemiological and laboratory-based studies to demonstrate a link between air pollutants and asthma. Specifically, ozone, environmental tobacco smoke, and diesel exhaust are associated with enhancement of respiratory allergy to inhaled allergens. This review summarizes the state of the knowledge, both human epidemiology and laboratory animal experiments, linking air pollution to allergy. Critical issues involve development of the lung and the fetal immune response, and the potential for substances like ozone and ETS in the air to modulate early immune responses with lifelong consequences. PMID:14768942
Altered Innate and Lymphocytic Immune Responses in Mouse Splenocytes Post-Flight
NASA Technical Reports Server (NTRS)
Hwang, ShenAn; Crucian, Brian E.; Sams, Clarence F.; Actor, Jeffrey K.
2011-01-01
Space flight is known to affect immune responses of astronauts and animals, decreasing lymphocytic responses to mitogenic stimuli, delayed typed hypersensitivity reactions, and T-cell activation. Despite changes in immune suppression, there are no reports of consistent adverse clinical events post flight. To further investigate the spectrum of affected immune responses, murine splenocytes were stimulated immediately post-shuttle flight (14 days on STS-135) with T-cell stimulators or toll-like receptor agonists. Comparisons were made to ground control splenocytes from age-matched mice. Cell phenotypes were assessed, as well as activation markers and associated cytokine production. The CD4+ population decreased with no concurrent decrease in CD8+ cells from shuttle mice post flight compared to ground controls. Regarding antigen presenting cell populations, the number of CD11c+ cells were slightly elevated post flight, compared to ground controls, with increased MHC Class I expression (I-A(sup b)) and no change in Class II expression (H-2K(sup b)). CD86+ populations were also significantly diminished. However, the decreased markers did not correlate with activity. Stimulation of splenocytes post flight showed significant increase in bead uptake, increased Class I expression, increased TNF-alpha and IL-6 production in response to TLR-2 (zymosan) and TLR-4 (LPS) agonists. While most activated (ConA or anti-CD3/anti-CD28) CD4+ cells showed markedly diminished responses (reduced IL-2 production), non-specific T cell responses to superantigen (SEA/SEB) increased post flight as determined by expression of early activation markers. Production of additional cytokines was also dysregulated postflight. Overall, persistent immune changes during space flight could represent unique clinical risks for exploration class missions. The consequences of pathogenic encounter remain an important concern that should be addressed.
In vivo Ebola virus infection leads to a strong innate response in circulating immune cells.
Caballero, Ignacio S; Honko, Anna N; Gire, Stephen K; Winnicki, Sarah M; Melé, Marta; Gerhardinger, Chiara; Lin, Aaron E; Rinn, John L; Sabeti, Pardis C; Hensley, Lisa E; Connor, John H
2016-09-05
Ebola virus is the causative agent of a severe syndrome in humans with a fatality rate that can approach 90 %. During infection, the host immune response is thought to become dysregulated, but the mechanisms through which this happens are not entirely understood. In this study, we analyze RNA sequencing data to determine the host response to Ebola virus infection in circulating immune cells. Approximately half of the 100 genes with the strongest early increases in expression were interferon-stimulated genes, such as ISG15, OAS1, IFIT2, HERC5, MX1 and DHX58. Other highly upregulated genes included cytokines CXCL11, CCL7, IL2RA, IL2R1, IL15RA, and CSF2RB, which have not been previously reported to change during Ebola virus infection. Comparing this response in two different models of exposure (intramuscular and aerosol) revealed a similar signature of infection. The strong innate response in the aerosol model was seen not only in circulating cells, but also in primary and secondary target tissues. Conversely, the innate immune response of vaccinated macaques was almost non-existent. This suggests that the innate response is a major aspect of the cellular response to Ebola virus infection in multiple tissues. Ebola virus causes a severe infection in humans that is associated with high mortality. The host immune response to virus infection is thought to be an important aspect leading to severe pathology, but the components of this overactive response are not well characterized. Here, we analyzed how circulating immune cells respond to the virus and found that there is a strong innate response dependent on active virus replication. This finding is in stark contrast to in vitro evidence showing a suppression of innate immune signaling, and it suggests that the strong innate response we observe in infected animals may be an important contributor to pathogenesis.
Neuropeptide Substance P and the Immune Response
Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza
2016-01-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883
Neuropeptide substance P and the immune response.
Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza
2016-11-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.
Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation
Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.
1978-01-01
A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541
Host Immune Response to Influenza A Virus Infection.
Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long
2018-01-01
Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.
Childhood Immunization: A Key Component of Early Childhood Development
ERIC Educational Resources Information Center
Messonnier, Nancy
2017-01-01
Physical health is a key component of early childhood development and school readiness. By keeping children healthy and decreasing the chances of disease outbreaks, immunizations help early childhood programs create a safe environment for children. While overall vaccination rates are high nationally for most vaccines routinely recommended for…
Immunomodulator-based enhancement of anti smallpox immune responses.
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.
Modulation of Antibody-Mediated Immune Response by Probiotics in Chickens
Haghighi, Hamid R.; Gong, Jianhua; Gyles, Carlton L.; Hayes, M. Anthony; Sanei, Babak; Parvizi, Payvand; Gisavi, Haris; Chambers, James R.; Sharif, Shayan
2005-01-01
Probiotic bacteria, including Lactobacillus acidophilus and Bifidobacterium bifidum, have been shown to enhance antibody responses in mammals. The objective of this study was to examine the effects of a probiotic product containing the above bacteria in addition to Streptococcus faecalis on the induction of the chicken antibody response to various antigens, both systemically and in the gut. The birds received probiotics via oral gavage and subsequently were immunized with sheep red blood cells (SRBC) and bovine serum albumin (BSA) to evaluate antibody responses in serum or with tetanus toxoid (TT) to measure the mucosal antibody response in gut contents. Control groups received phosphate-buffered saline. Overall, BSA and SRBC induced a detectable antibody response as early as week 1 postimmunization (p.i.), which lasted until week 3 p.i. Probiotic-treated birds had significantly (P ≤ 0.001) more serum antibody (predominantly immunoglobulin M [IgM]) to SRBC than the birds that were not treated with probiotics. However, treatment with probiotics did not enhance the serum IgM and IgG antibody responses to BSA. Immunization with TT resulted in the presence of specific IgA and IgG antibody responses in the gut. Again, treatment with probiotics did not change the level or duration of the antibody response in the gut. In conclusion, probiotics enhance the systemic antibody response to some antigens in chickens, but it remains to be seen whether probiotics have an effect on the generation of the mucosal antibody response. PMID:16339061
Early-Life Host–Microbiome Interphase: The Key Frontier for Immune Development
Amenyogbe, Nelly; Kollmann, Tobias R.; Ben-Othman, Rym
2017-01-01
Human existence can be viewed as an “animal in a microbial world.” A healthy interaction of the human host with the microbes in and around us heavily relies on a well-functioning immune system. As development of both the microbiota and the host immune system undergo rapid changes in early life, it is not surprising that even minor alterations during this co-development can have profound consequences. Scrutiny of existing data regarding pre-, peri-, as well as early postnatal modulators of newborn microbiota indeed suggest strong associations with several immune-mediated diseases with onset far beyond the newborn period. We here summarize these data and extract overarching themes. This same effort in turn sets the stage to guide effective countermeasures, such as probiotic administration. The objective of our review is to highlight the interaction of host immune ontogeny with the developing microbiome in early life as a critical window of susceptibility for lifelong disease, as well as to identify the enormous potential to protect and promote lifelong health by specifically targeting this window of opportunity. PMID:28596951
Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel
2015-01-01
Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to
Stress proteins and the immune response.
Moseley, P
2000-07-25
The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61
Human Immune Responses to Dengue Viruses.
1984-08-01
ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON
Immune Responses to HIV and SIV in Mucosal Tissues: “Location, Location, Location”
Shacklett, Barbara L.
2010-01-01
Purpose of review This review summarizes research literature regarding mucosal immunity to HIV and SIV, with an emphasis on work published within the past 18 months. Recent findings Notable recent studies have focused on the pivotal events occurring within mucosal tissues during acute HIV/SIV infection that serve to establish a balance between detrimental immune activation and beneficial adaptive responses. In cervicovaginal mucosa, an early inflammatory response leads to recruitment of susceptible target cells. At this acute stage, the in vivo ratio between CD8+ effector cells and infected CD4+ T-cells may be critical for limiting viral dissemination. Acute infection is also accompanied by loss of germinal center architecture and T/B cell apoptosis in Peyer’s patches of the gastrointestinal tract. During chronic infection, mucosal CD8+ T-cells may play a role in immune control, as suggested by studies of elite controllers. Summary Mucosal tissues serve as the major portal of entry for HIV, and house a majority of the body’s lymphocytes, including CD4+ T-cells that are targets for infection. Recent studies have focused renewed attention on events occurring immediately after transmission, and underscore the concept that the balance between inflammation and protective immunity is established by host responses in mucosal tissues. PMID:20543589
Jeon, Yung Jin; Kim, Hyun Jik
2018-05-01
Respiratory mucosa especially nasal epithelium is well known as the first-line barrier of air-borne pathogens. High levels of reactive oxygen species (ROS) are detected in in vitro cultured human epithelial cells and in vivo lung. With identification of NADPH oxidase (Nox) system of respiratory epithelium, the antimicrobial role of ROS has been studied. Duox2 is the most abundant Nox isoform and produces the regulated amount of ROS in respiratory epithelium. Duox2-derived ROS are involved in antiviral innate immune responses but more studies are needed to verify the mechanism. In respiratory epithelium, Duox2-derived ROS is critical for recognition of virus through families retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) at the early stage of antiviral innate immune responses. Various secreted interferons (IFNs) play essential roles for antiviral host defense by downstream cell signaling, and transcription of IFN-stimulated genes is started to suppress viral replication. Type I and type III IFNs are verified more responsible for influenza A virus (IAV) infection in respiratory epithelium and Duox2 is required to regulate IFN-related immune responses. Transient overexpression of Duox2 using cationic polymer polyethylenimine (PEI) induces secretion of type I and type III IFNs and significantly attenuated IAV replication in respiratory epithelium. Here, we discuss Duox2-mediated antiviral innate immune responses and the role of Duox2 as a mucosal vaccine to resist respiratory viral infection.
Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran
2016-01-01
Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population
The unfolded protein response in immunity and inflammation
Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.
2017-01-01
The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803
B cell function in the immune response to helminths
Harris, Nicola
2010-01-01
Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556
Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833
Mucosal immune response to poliovirus vaccines in childhood.
Ogra, P L
1984-01-01
Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.
Effect of antipyretic analgesics on immune responses to vaccination.
Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B
2016-09-01
While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.
HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin
Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago
2014-01-01
AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN
Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke
2013-01-01
Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066
Chung, Joon-Yong; Bae, Young-An; Yun, Doo-Hee; Yang, Hyun-Jong; Kong, Yoon
2012-12-01
In fascioliasis, T-helper 2 (Th2) responses predominate, while little is known regarding early immune phenomenon. We herein analyzed early immunophenotype changes of BALB/c, C57BL/6, and C3H/He mice experimentally infected with 5 Fasciola hepatica metacercariae. A remarkable expansion of CD19(+) B cells was observed as early as week 1 post-infection while CD4(+)/CD8(+) T cells were down-regulated. Accumulation of Mac1(+) cells with time after infection correlated well with splenomegaly of all mice strains tested. The expression of tumor necrosis factor (TNF)-α mRNA in splenocytes significantly decreased while that of IL-4 up-regulated. IL-1β expression was down-modulated in BALB/c and C57BL/6 mice, but not in C3H/He. Serum levels of transforming growth factor (TGF)-β were considerably elevated in all mice during 3 weeks of infection period. These collective results suggest that experimental murine fascioliasis might derive immune suppression with elevated levels of TGF-β and IL-4 during the early stages of infection.
Sombetzki, Martina; Koslowski, Nicole; Rabes, Anne; Seneberg, Sonja; Winkelmann, Franziska; Fritzsche, Carlos; Loebermann, Micha; Reisinger, Emil C
2018-01-01
Infection with the intravascular diecious trematode Schistosoma spp . remains a serious tropical disease and public health problem in the developing world, affecting over 258 million people worldwide. During chronic Schistosoma mansoni infection, complex immune responses to tissue-entrapped parasite eggs provoke granulomatous inflammation which leads to serious damage of the liver and intestine. The suppression of protective host immune mechanisms by helminths promotes parasite survival and benefits the host by reducing tissue damage. However, immune-suppressive cytokines may reduce vaccine-induced immune responses. By combining a single-sex infection system with a murine air pouch model, we were able to demonstrate that male and female schistosomes play opposing roles in modulating the host's immune response. Female schistosomes suppress early innate immune responses to invading cercariae in the skin and upregulate anergy-associated genes. In contrast, male schistosomes trigger strong innate immune reactions which lead to a reduction in worm and egg burden in the liver. Our data suggest that the female worm is a neglected player in the dampening of the host's immune defense system and is therefore a promising target for new immune modulatory therapies.
Viral Vaccine Immunogenicity in Relation to Host Cell-Mediated and Humoral Immune Responses.
1976-05-01
adjuvants, particularly complete Freund’s adjuvant or Bordetella pertussis , were donors capable of consistently transferring adoptive immunity...vac- cine combined with adjuvants, particularly complete Freund’s adjuvant or Bordetella pertussis , were donors capable of consistently transferring...Freund’s adjuvant and Bordetella pertussis , are consistently capable of producing early and brisk serum neutralizing antibody responses in adoptively
NASA Astrophysics Data System (ADS)
Liu, Xiangdong; Li, Qingze; Pan, Jianxin
2018-06-01
Modern medical studies show that chemotherapy can help most cancer patients, especially for those diagnosed early, to stabilize their disease conditions from months to years, which means the population of tumor cells remained nearly unchanged in quite a long time after fighting against immune system and drugs. In order to better understand the dynamics of tumor-immune responses under chemotherapy, deterministic and stochastic differential equation models are constructed to characterize the dynamical change of tumor cells and immune cells in this paper. The basic dynamical properties, such as boundedness, existence and stability of equilibrium points, are investigated in the deterministic model. Extended stochastic models include stochastic differential equations (SDEs) model and continuous-time Markov chain (CTMC) model, which accounts for the variability in cellular reproduction, growth and death, interspecific competitions, and immune response to chemotherapy. The CTMC model is harnessed to estimate the extinction probability of tumor cells. Numerical simulations are performed, which confirms the obtained theoretical results.
Impact of early treatment programs on HIV epidemics: An immunity-based mathematical model.
Rahman, S M Ashrafur; Vaidya, Naveen K; Zou, Xingfu
2016-10-01
While studies on pre-exposure prophylaxis (PrEP) and post-exposure prophylaxis (PEP) have demonstrated substantial advantages in controlling HIV transmission, the overall benefits of the programs with early initiation of antiretroviral therapy (ART) have not been fully understood and are still on debate. Here, we develop an immunity-based (CD4+ T cell count based) mathematical model to study the impacts of early treatment programs on HIV epidemics and the overall community-level immunity. The model is parametrized using the HIV prevalence data from South Africa and fully analyzed for stability of equilibria and infection persistence criteria. Using our model, we evaluate the effects of early treatment on the new infection transmission, disease death, basic reproduction number, HIV prevalence, and the community-level immunity. Our model predicts that the programs with early treatments significantly reduce the new infection transmission and increase the community-level immunity, but the treatments alone may not be enough to eliminate HIV epidemics. These findings, including the community-level immunity, might provide helpful information for proper implementation of HIV treatment programs. Copyright © 2016 Elsevier Inc. All rights reserved.
Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K
2014-01-01
We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.
Antitumor immune responses mediated by dendritic cells
Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne
2013-01-01
Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744
Effect of antipyretic analgesics on immune responses to vaccination
Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.
2016-01-01
ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296
2013-01-01
Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half
Damage signals in the insect immune response
Krautz, Robert; Arefin, Badrul; Theopold, Ulrich
2014-01-01
Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815
The early cellular signatures of protective immunity induced by live viral vaccination.
Kohler, Siegfried; Bethke, Nicole; Böthe, Matthias; Sommerick, Sophie; Frentsch, Marco; Romagnani, Chiara; Niedrig, Matthias; Thiel, Andreas
2012-09-01
Here, we have used primary vaccination of healthy donors with attenuated live yellow fever virus 17D (YFV-17D) as a model to study the generation of protective immunity. In short intervals after vaccination, we analyzed the induction of YFV-17D specific T- and B-cell immunity, bystander activation, dendritic cell subsets, changes in serum cytokine levels, and YFV-17D-specific antibodies. We show activation of innate immunity and a concomitant decline of numbers of peripheral blood T and B cells. An early peak of antigen-specific T cells at day 2, followed by mobilization of innate immune cells, preceded the development of maximal adaptive immunity against YFV-17D at day 14 after vaccination. Interestingly, potent adaptive immunity as measured by high titers of neutralizing YFV-17D-specific antibodies, correlated with early activation and recruitment of YFV-17D-specific CD4(+) T cells and higher levels of sIL-6R. Thus our data might provide new insights into the interplay of innate and adaptive immunity for the induction of protective immunity. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lee, Sung Won; Park, Hyun Jung; Kim, Nayoung; Hong, Seokmann
2013-01-01
Natural killer dendritic cells (NKDCs) possess potent anti-tumor activity, but the cellular effect of NKDC interactions with other innate immune cells is unclear. In this study, we demonstrate that the interaction of NKDCs and natural killer T (NKT) cells is required for the anti-tumor immune responses that are elicited by α -galactosylceramide ( α -GC) in mice. The rapid and strong expression of interferon- γ by NKDCs after α -GC stimulation was dependent on NKT cells. Various NK and DC molecular markers and cytotoxic molecules were up-regulated following α -GC administration. This up-regulation could improve NKDC presentation of tumor antigens and increase cytotoxicity against tumor cells. NKDCs were required for the stimulation of DCs, NK cells, and NKT cells. The strong anti-tumor immune responses elicited by α -GC may be due to the down-regulation of regulatory T cells. Furthermore, the depletion of NKDCs dampened the tumor clearance mediated by α -GC-stimulated NKT cells in vivo. Taken together, these results indicate that complex interactions of innate immune cells might be required to achieve optimal anti-tumor immune responses during the early stages of tumorigenesis.
Innate immunity and HIV-1 infection.
Lehner, T; Wang, Y; Whittall, T; Seidl, T
2011-04-01
HIV-1 is predominantly transmitted through mucosal tissues, targeting CD4(+)CCR5(+) T cells, 50% of which are destroyed within 2 weeks of infection. Conventional vaccination strategies have so far failed to prevent HIV-1 infection. Neither antibodies nor cytotoxic lymphocytes are capable of mounting a sufficiently rapid immune response to prevent early destruction of these cells. However, innate immunity is an early-response system, largely independent of prior encounter with a pathogen. Innate immunity can be classified into cellular, extracellular, and intracellular components, each of which is exemplified in this review by γδ T cells, CC chemokines, and APOBEC3G, respectively. First, γδ T cells are found predominantly in mucosal tissues and produce cytokines, CC chemokines, and antiviral factors. Second, the CC chemokines CCL-3, CCL-4, and CCL-5 can be upregulated by immunization of macaques with SIVgp120 and gag p27, and these can bind and downmodulate CCR5, thereby inhibiting HIV-1 entry into the host cells. Third, APOBEC3G is generated and maintained following rectal mucosal immunization in rhesus macaques for over 17 weeks, and the innate anti-SIV factor is generated by CD4(+)CD95(+)CCR7(-) effector memory T cells. Thus, innate anti-HIV-1 or SIV immunity can be linked with immune memory, mediated by CD4(+) T cells generating APOBEC3G. The multiple innate functions may mount an early anti-HIV-1 response and either prevent viral transmission or contain the virus until an effective adaptive immune response develops.
Interplay between behavioural thermoregulation and immune response in mealworms.
Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco
2012-11-01
Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Amend, Donald F.; Smith, Lynnwood
1974-01-01
Juvenile rainbow trout (Salmo gairdneri) were injected with infectious hematopoietic necrosis (IHN) virus and various hematological and blood chemical changes were monitored over 9 days. The packed cell volume, hemoglobin, red blood cell count, and plasma bicarbonate were significantly depressed by day 4. Plasma chloride, calcium, phosphorus, total protein, and blood cell types did not change during the 9 days. Furthermore, plasma LDH isozyme was significantly increased by the fourth day, and fish infected with infectious pancreatic necrosis virus, Vibrio anguillarum, Aeromonas salmonicida, and redmouth bacterium did not show specific LDH isozyme alterations. Acid-base alterations occurred at 10 C but not at 18 C. The acid-base imbalance and elevation of the LDH isozyme were consistently associated with the early development of the disease.The immune response after injection of IHN virus was determined and protection from disease was tested by passive immunization. Actively immunized fish developed IHN-neutralizing antibodies within 54 days after injection of virus, and the antibodies were protective when juvenile fish were passively immunized and experimentally challenged with IHN virus.
Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.
2014-01-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276
Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C
2015-03-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Immune Response to Giardia duodenalis
Faubert, Gaétan
2000-01-01
The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490
Saunders-Blades, J L; Korver, D R
2015-06-01
The metabolite 25-hydroxy vitamin D3 (25-OHD) can complement or replace vitamin D3 in poultry rations, and may influence broiler production and immune function traits. The effect of broiler breeder dietary 25-OHD on egg production, hatchability, and chick early innate immune function was studied. We hypothesized that maternal dietary 25-OHD would support normal broiler breeder production and a more mature innate immune system of young chicks. Twenty-three-week-old Ross 308 hens (n=98) were placed in 4 floor pens and fed either 2,760 IU vitamin D3 (D) or 69 μg 25-OHD/kg feed. Hen weights were managed according to the primary breeder management guide. At 29 to 31 wk (Early), 46 to 48 wk (Mid), and 61 to 63 wk (Late), hens were artificially inseminated and fertile eggs incubated and hatched. Chicks were placed in cages based on maternal treatment and grown to 7 d age. Innate immune function and plasma 25-OHD were assessed at 1 and 4 d post-hatch on 15 chicks/treatment. Egg production, hen BW, and chick hatch weight were not affected by diet (P>0.05). Total in vitro Escherichia coli (E. coli) killing by 25-OHD chicks was greater than the D chicks at 4 d for the Early and Mid hatches, and 1 and 4 d for the Late hatch. This can be partly explained by the 25-OHD chicks from the Late hatch also having a greater E. coli phagocytic capability. No consistent pattern of oxidative burst response was observed. Chicks from the Mid hatch had greater percent phagocytosis, phagocytic capability, and E. coli killing than chicks from Early and Late hatches. Overall, maternal 25-OHD increased hatchability and in vitro chick innate immunity towards E. coli. Regardless of treatment, chicks from Late and Early hens had weaker early innate immune responses than chicks from Mid hens. The hen age effect tended to be the greatest factor influencing early chick innate immunity, but maternal 25-OHD also increased several measures relative to D. © 2015 Poultry Science Association Inc.
Human Immune Responses to Dengue Viruses.
1986-07-01
0-1 NO- 3K1- INO. "o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in
SUMO-Enriched Proteome for Drosophila Innate Immune Response
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.
2015-01-01
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570
SUMO-Enriched Proteome for Drosophila Innate Immune Response.
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S
2015-08-18
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.
Sena, Angela A. S.; Glavan, Tiffany; Jiang, Guochun; Sankaran-Walters, Sumathi; Grishina, Irina; Dandekar, Satya; Goulart, Luiz R.
2016-01-01
HIV-1 disease progression is paradoxically characterized by systemic chronic immune activation and gut mucosal immune dysfunction, which is not fully defined. Annexin A1 (ANXA1), an inflammation modulator, is a potential link between systemic inflammation and gut immune dysfunction during the simian immunodeficiency virus (SIV) infection. Gene expression of ANXA1 and cytokines were assessed in therapy-naïve rhesus macaques during early and chronic stages of SIV infection and compared with SIV-negative controls. ANXA1 expression was suppressed in the gut but systemically increased during early infection. Conversely, ANXA1 expression increased in both compartments during chronic infection. ANXA1 expression in peripheral blood was positively correlated with HLA-DR+CD4+ and CD8+ T-cell frequencies, and negatively associated with the expression of pro-inflammatory cytokines and CCR5. In contrast, the gut mucosa presented an anergic cytokine profile in relation to ANXA1 expression. In vitro stimulations with ANXA1 peptide resulted in decreased inflammatory response in PBMC but increased activation of gut lymphocytes. Our findings suggest that ANXA1 signaling is dysfunctional in SIV infection, and may contribute to chronic inflammation in periphery and with immune dysfunction in the gut mucosa. Thus, ANXA1 signaling may be a novel therapeutic target for the resolution of immune dysfunction in HIV infection. PMID:27484833
Zipperer, Ginger R.; Arumugam, Sridhar; Chirgwin, Sharon R.; Coleman, Sharon U.; Shakya, Krishna P.; Klei, Thomas R.
2013-01-01
Previous studies have shown that intradermally (ID) injected B. pahangi L3s migrate through various tissues and into the lymphatics of gerbils in a distinct pattern. Excretory/secretory products (ES) produced at the time of invasion of B. pahangi are likely to be important in this early migration phase of the parasite life cycle in their rodent host. Hence, early L3 ES was collected from 24 hr in vitro cultures of B. pahangi L3 larvae and used in immunization experiments to investigate the effect of immunity to early L3 ES on worm migration, survival and development of B. pahangi. Immunization of gerbils with ES in RIBI adjuvant produced antibodies to numerous ES proteins eliciting a strong humoral response to ES and indirect fluorescent antibody (IFA) assay using anti-ES serum recognized the ES proteins on the surface of B. pahangi L3 larvae. Following ES immunization, gerbils were challenged either ID or intraperitoneally (IP) with 100 L3s of B. pahangi and euthanized at 3 or 106 days post inoculation (DPI). Immunization with early ES slowed the migration of ID inoculated L3 at 3DPI and significantly altered the locations of adult worms at 106 DPI. Immunization did not induce protection in any treatment group. However, immunized animals had significantly fewer microfilariae per female worm suggesting the antigens in ES are important in microfilariae development or survival in the host. The number of lymphatic granulomas was also significantly reduced in ES immunized animals. It is important to note that microfilariae serve as a nidus in these granulomas. Our results shows immunization with early B. malayi L3 ES alters the worm migration, affects circulating microfilarial numbers and reduces lymphatic granulomas associated with B. pahangi infection in gerbils. PMID:23981910
Muñoz-Carrillo, J L; Contreras-Cordero, J F; Muñoz-López, J L; Maldonado-Tapia, C H; Muñoz-Escobedo, J J; Moreno-García, M A
2017-09-01
In the early stage of the intestinal phase of Trichinella spiralis infection, the host triggers a Th1-type immune response with the aim of eliminating the parasite. However, this response damages the host which favours the survival of the parasite. In the search for novel pharmacological strategies that inhibit the Th1 immune response and assist the host against T. spiralis infection, a recent study showed that resiniferatoxin had anti-inflammatory activity contributed to the host in T. spiralis infection. In this study, we evaluated whether RTX modulates the host immune response through the inhibition of Th1 cytokines in the intestinal phase. In addition, it was determined whether the treatment with RTX affects the infectivity of T. spiralis-L1 and the development of the T. spiralis life cycle. Our results show that RTX decreased serum levels of IL-12, INF-γ, IL-1β, TNF-α and parasite burden on muscle tissue. It was observed that T. spiralis-L1 treated with RTX decreased their infectivity affecting the development of the T. spiralis life cycle in mouse. These results demonstrate that RTX is able to inhibit the production of Th1 cytokines, contributing to the defence against T. spiralis, which places it as a potential drug modulator of the immune response. © 2017 John Wiley & Sons Ltd.
Immune function trade-offs in response to parasite threats.
Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W
2017-04-01
Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Innate immune sensing and response to influenza.
Pulendran, Bali; Maddur, Mohan S
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.
Control of epithelial immune-response genes and implications for airway immunity and inflammation.
Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J
1998-01-01
A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.
Wang, Raymond M; Johnson, Todd D; He, Jingjin; Rong, Zhili; Wong, Michelle; Nigam, Vishal; Behfar, Atta; Xu, Yang; Christman, Karen L
2017-06-01
Current assessment of biomaterial biocompatibility is typically implemented in wild type rodent models. Unfortunately, different characteristics of the immune systems in rodents versus humans limit the capability of these models to mimic the human immune response to naturally derived biomaterials. Here we investigated the utility of humanized mice as an improved model for testing naturally derived biomaterials. Two injectable hydrogels derived from decellularized porcine or human cadaveric myocardium were compared. Three days and one week after subcutaneous injection, the hydrogels were analyzed for early and mid-phase immune responses, respectively. Immune cells in the humanized mouse model, particularly T-helper cells, responded distinctly between the xenogeneic and allogeneic biomaterials. The allogeneic extracellular matrix derived hydrogels elicited significantly reduced total, human specific, and CD4 + T-helper cell infiltration in humanized mice compared to xenogeneic extracellular matrix hydrogels, which was not recapitulated in wild type mice. T-helper cells, in response to the allogeneic hydrogel material, were also less polarized towards a pro-remodeling Th2 phenotype compared to xenogeneic extracellular matrix hydrogels in humanized mice. In both models, both biomaterials induced the infiltration of macrophages polarized towards a M2 phenotype and T-helper cells polarized towards a Th2 phenotype. In conclusion, these studies showed the importance of testing naturally derived biomaterials in immune competent animals and the potential of utilizing this humanized mouse model for further studying human immune cell responses to biomaterials in an in vivo environment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Renoz, François; Noël, Christine; Errachid, Abdelmounaim; Foray, Vincent; Hance, Thierry
2015-01-01
In addition to its obligatory symbiont Buchnera aphidicola, the pea aphid Acyrthosiphon pisum can harbor several facultative bacterial symbionts which can be mutualistic in the context of various ecological interactions. Belonging to a genus where many members have been described as pathogen in invertebrates, Serratia symbiotica is one of the most common facultative partners found in aphids. The recent discovery of strains able to grow outside their host allowed us to simulate environmental acquisition of symbiotic bacteria by aphids. Here, we performed an experiment to characterize the A. pisum response to the ingestion of the free-living S. symbiotica CWBI-2.3T in comparison to the ingestion of the pathogenic Serratia marcescens Db11 at the early steps in the infection process. We found that, while S. marcescens Db11 killed the aphids within a few days, S. symbiotica CWBI-2.3T did not affect host survival and colonized the whole digestive tract within a few days. Gene expression analysis of immune genes suggests that S. symbiotica CWBI-2.3T did not trigger an immune reaction, while S. marcescens Db11 did, and supports the hypothesis of a fine-tuning of the host immune response set-up for fighting pathogens while maintaining mutualistic partners. Our results also suggest that the lysosomal system and the JNK pathway are possibly involved in the regulation of invasive bacteria in aphids and that the activation of the JNK pathway is IMD-independent in the pea aphid.
Renoz, François; Noël, Christine; Errachid, Abdelmounaim; Foray, Vincent; Hance, Thierry
2015-01-01
In addition to its obligatory symbiont Buchnera aphidicola, the pea aphid Acyrthosiphon pisum can harbor several facultative bacterial symbionts which can be mutualistic in the context of various ecological interactions. Belonging to a genus where many members have been described as pathogen in invertebrates, Serratia symbiotica is one of the most common facultative partners found in aphids. The recent discovery of strains able to grow outside their host allowed us to simulate environmental acquisition of symbiotic bacteria by aphids. Here, we performed an experiment to characterize the A. pisum response to the ingestion of the free-living S. symbiotica CWBI-2.3T in comparison to the ingestion of the pathogenic Serratia marcescens Db11 at the early steps in the infection process. We found that, while S. marcescens Db11 killed the aphids within a few days, S. symbiotica CWBI-2.3T did not affect host survival and colonized the whole digestive tract within a few days. Gene expression analysis of immune genes suggests that S. symbiotica CWBI-2.3T did not trigger an immune reaction, while S. marcescens Db11 did, and supports the hypothesis of a fine-tuning of the host immune response set-up for fighting pathogens while maintaining mutualistic partners. Our results also suggest that the lysosomal system and the JNK pathway are possibly involved in the regulation of invasive bacteria in aphids and that the activation of the JNK pathway is IMD-independent in the pea aphid. PMID:25811863
Innate immune response development in nestling tree swallows
Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.
2011-01-01
We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.
Modeling Systems-Level Regulation of Host Immune Responses
Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka
2007-01-01
Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300
A mouse model with age-dependent immune response and immune-tolerance for HBV infection.
Yi, Xuerui; Yuan, Youcheng; Li, Na; Yi, Lu; Wang, Cuiling; Qi, Ying; Gong, Liang; Liu, Guangze; Kong, Xiangping
2018-02-01
Viral clearance of human HBV infection largely depends on the age of exposure. Thus, a mouse model with age-dependent immune response and immune-tolerance for HBV infection was established. HBVRag1 mice were generated by crossing Rag1 -/- mice with HBV-Tg mice. Following adoptive transfer of splenocytes adult (8-9 weeks old) and young (3 weeks old) HBVRag1 mice were named as HBVRag-ReA and HBVRag-ReY mice respectively. The biochemical parameters that were associated with viral load and immune function, as well as the histological evaluation of the liver tissues between the two mouse models were detected. The immune tolerance of HBVRag-ReY mice that were reconstituted at the early stages of life was evaluated by quantitative hepatitis B core antibody assay, adoptive transfer, and modulation of gut microbiota with the addition of antibiotics. HBVRag-ReA mice indicated apparent hepatocytes damage, clearance of HBsAg and production of HBsAb and HBcAb. HBVRag-ReY mice did not develop ALT elevation, and produced HBcAb and HBsAg. A higher number of hepatic CD8 + T and B cells promoted clearance of HBsAg in HBVRag-ReA mice following 30 days of lymphocyte transfer. In contrast to HBVRag-ReA mice, HBVRag-ReY mice exhibited higher levels of Th1/Th2 cytokines. HBVRag-ReY mice exhibited significantly higher (P < .01, approximately 10-fold) serum quantitative anti-HBc levels than HBV-Tg mice, which might be similar to the phase of immune clearance and immune tolerance in human HBV infection. Furthermore, the age-related tolerance in HBVRag-ReY mice that were sensitive to antibiotic treatment was different from that noted in HBV-Tg mice. GS-9620 could inhibit the production of HBsAg, whereas HBV vaccination could induce sustained seroconversion in HBVRag-ReY mice with low levels of HBsAg. The present study described a mouse model with age-dependent immunity and immune-tolerance for HBV infection in vivo, which may mimic chronic HBV infection in humans. Copyright © 2017
Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.
Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C
2016-05-01
Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.
Brown, Traci A.; Holian, Andrij; Pinkerton, Kent E.; Lee, Joong Won; Cho, Yoon Hee
2016-01-01
Asbestos in combination with tobacco smoke exposure reportedly leads to more severe physiological consequences than asbestos alone; limited data also show an increased disease risk due to environmental tobacco smoke (ETS) exposure. Environmental influences during gestation and early lung development can result in physiological changes that alter risk for disease development throughout an individual’s lifetime. Therefore, maternal lifestyle may impact the ability of offspring to subsequently respond to environmental insults and alter overall disease susceptibility. In this study, we examined the effects of exposure to ETS in utero and during early postnatal development on asbestos-related inflammation and disease in adulthood. ETS exposure in utero appeared to shift inflammation towards a Th2 phenotype, via suppression of Th1 inflammatory cytokine production. This effect was further pronounced in mice exposed to ETS in utero and during early postnatal development. In utero ETS exposure led to increased collagen deposition, a marker of fibrotic disease, when the offspring was later exposed to asbestos, which was further increased with additional ETS exposure during early postnatal development. These data suggest that ETS exposure in utero alters the immune responses and leads to greater disease development after asbestos exposure, which is further exacerbated when exposure to ETS continues during early postnatal development. PMID:27138493
Brown, Traci Ann; Holian, Andrij; Pinkerton, Kent E; Lee, Joong Won; Cho, Yoon Hee
2016-07-01
Asbestos in combination with tobacco smoke exposure reportedly leads to more severe physiological consequences than asbestos alone; limited data also show an increased disease risk due to environmental tobacco smoke (ETS) exposure. Environmental influences during gestation and early lung development can result in physiological changes that alter risk for disease development throughout an individual's lifetime. Therefore, maternal lifestyle may impact the ability of offspring to subsequently respond to environmental insults and alter overall disease susceptibility. In this study, we examined the effects of exposure to ETS in utero and during early postnatal development on asbestos-related inflammation and disease in adulthood. ETS exposure in utero appeared to shift inflammation towards a Th2 phenotype, via suppression of Th1 inflammatory cytokine production. This effect was further pronounced in mice exposed to ETS in utero and during early postnatal development. In utero ETS exposure led to increased collagen deposition, a marker of fibrotic disease, when the offspring was later exposed to asbestos, which was further increased with additional ETS exposure during early postnatal development. These data suggest that ETS exposure in utero alters the immune responses and leads to greater disease development after asbestos exposure, which is further exacerbated when exposure to ETS continues during early postnatal development.
Agouron and immune response to commercialize remune immune-based treatment.
James, J S
1998-06-19
Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.
Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877
Modeling the interactions between pathogenic bacteria, bacteriophage and immune response
NASA Astrophysics Data System (ADS)
Leung, Chung Yin (Joey); Weitz, Joshua S.
The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.
Reproductive Toxicity of T Cells in Early Life: Abnormal Immune Development and Postnatal Diseases.
Liu, Han-Xiao; Jiang, Aifang; Chen, Ting; Qu, Wen; Yan, Hui-Yi; Ping, Jie
2017-01-01
Immunity is a balanced status with adequate biological defenses to recognize and fight "non-self", as well as adequate tolerance to recognize "self". To maintain this immune homeostasis, a well-organized T cell immune network is required, which in part depends on the well-controlled development of alternative effector T cells, with different cytokine repertoires. Recent researches have pointed that developing fetal T cells network is a remarkably sensitive toxicological target for adverse factors in early life. Epidemiological and experimental studies showed an inseparable relationship between T cell developmental toxicity and immune diseases in adults. Considering that the inflammatory and immune disorders have become a growing health problem worldwide, increasing attention is now being paid to the T cell developmental toxicity. We propose that adverse factors may have programming effects on the crucial functions of immune system during early life which is critical for fetal T cell development and the establishment of the distinct T cell repertoires balance. The permanently disturbed intrathymic or peripheral T cell development may in turn lead to the immune disorders in later life. In this manuscript, we reviewed how adverse factors affected T cell development in early-life with the consequence of the immune dysfunction and immune diseases, and further elucidate the mechanisms. These mechanisms will be helpful in prevention and treatment of the increased prevalence of immune diseases by interfering those pathways. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor
2008-04-01
Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.
Peroxiredoxin 5 modulates immune response in Drosophila
Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.
2010-01-01
Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624
The innate immune response during urinary tract infection and pyelonephritis
Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.
2013-01-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397
The innate immune response during urinary tract infection and pyelonephritis.
Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S
2014-07-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.
Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas
Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.
2000-01-01
Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a
Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.
Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M
2013-04-16
Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.
Immune and stress responses in oysters with insights on adaptation.
Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude
2015-09-01
Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.
Innate Immune Sensing and Response to Influenza
Pulendran, Bali; Maddur, Mohan S.
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919
Pène, Frédéric; Zuber, Benjamin; Courtine, Emilie; Rousseau, Christophe; Ouaaz, Fatah; Toubiana, Julie; Tazi, Asmaa; Mira, Jean-Paul; Chiche, Jean-Daniel
2008-12-15
Host infection by pathogens triggers an innate immune response leading to a systemic inflammatory response, often followed by an immune dysfunction which can favor the emergence of secondary infections. Dendritic cells (DCs) link innate and adaptive immunity and may be centrally involved in the regulation of sepsis-induced immune dysfunction. We assessed the contribution of DCs to lung defense in a murine model of sublethal polymicrobial sepsis (cecal ligature and puncture, CLP). In this model, bone marrow-derived DCs (BMDCs) retained an immature phenotype, associated with decreased capacity of IL-12p70 release and impaired priming of T cell lymphocytes. Eight days after CLP surgery, we induced a secondary pulmonary infection through intratracheal instillation of 5 x 10(6) CFUs of Pseudomonas aeruginosa. Whereas all sham-operated mice survived, 80% of post-CLP mice died after secondary pneumonia. Post-CLP mice exhibited marked lung damage with early recruitment of neutrophils, cytokine imbalance with decreased IL-12p70 production, and increased IL-10 release, but no defective bacterial lung clearance, while systemic bacterial dissemination was almost constant. Concomitant intrapulmonary administration of exogenous BMDCs into post-CLP mice challenged with P. aeruginosa dramatically improved survival. BMDCs did not improve bacterial lung clearance, but delayed neutrophil recruitment, strongly attenuated the early peak of TNF-alpha and restored an adequate Il-12p70/IL-10 balance in post-CLP mice. Thus, adoptive transfer of BMDCs reversed sepsis-induced immune dysfunction in a relevant model of secondary P. aeruginosa pneumonia. Unexpectedly, the mechanism of action of BMDCs did not involve enhanced antibacterial activity, but occurred by dampening the pulmonary inflammatory response.
Probiotics, antibiotics and the immune responses to vaccines
Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep
2015-01-01
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456
Probiotics, antibiotics and the immune responses to vaccines.
Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep
2015-06-19
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Hoek, Kristen L; Samir, Parimal; Howard, Leigh M; Niu, Xinnan; Prasad, Nripesh; Galassie, Allison; Liu, Qi; Allos, Tara M; Floyd, Kyle A; Guo, Yan; Shyr, Yu; Levy, Shawn E; Joyce, Sebastian; Edwards, Kathryn M; Link, Andrew J
2015-01-01
Systems biology is an approach to comprehensively study complex interactions within a biological system. Most published systems vaccinology studies have utilized whole blood or peripheral blood mononuclear cells (PBMC) to monitor the immune response after vaccination. Because human blood is comprised of multiple hematopoietic cell types, the potential for masking responses of under-represented cell populations is increased when analyzing whole blood or PBMC. To investigate the contribution of individual cell types to the immune response after vaccination, we established a rapid and efficient method to purify human T and B cells, natural killer (NK) cells, myeloid dendritic cells (mDC), monocytes, and neutrophils from fresh venous blood. Purified cells were fractionated and processed in a single day. RNA-Seq and quantitative shotgun proteomics were performed to determine expression profiles for each cell type prior to and after inactivated seasonal influenza vaccination. Our results show that transcriptomic and proteomic profiles generated from purified immune cells differ significantly from PBMC. Differential expression analysis for each immune cell type also shows unique transcriptomic and proteomic expression profiles as well as changing biological networks at early time points after vaccination. This cell type-specific information provides a more comprehensive approach to monitor vaccine responses.
[Immune system aging rate in patients with early forms of chronic cerebrovascular diseases].
Kochetkova, N G; Al'tman, D Sh; Teplova, S N
2009-01-01
Using the Bioage and Snake software the immune and cardiovascular system aging rate was diagnosed in patients having early forms of chronic cerebrovascular diseases (CCVD). The indicators of biological, cardiopulmonary and immunological age were studied in patients showing early symptoms of cerebrovascular insufficiency and dyscirculatory encephalopathy of the 1st stage. The rate of age-dependent physiological changes was diagnosed compared to general body aging rate. Some specific patterns of immune system aging were found in patients with early forms of CCVDs, the cardinal aging symptoms (heterotropia, heterochronia) were verified.
Levy, Ofer; Netea, Mihai G.
2014-01-01
Unique features of immunity early in life include a distinct immune system particularly reliant on innate immunity, with weak T helper (Th)1-polarizing immune responses, and impaired responses to certain vaccines leading to a heightened susceptibility to infection. To these important aspects, we now add an increasingly appreciated concept that the innate immune system displays epigenetic memory of an earlier infection or vaccination, a phenomenon that has been named “trained immunity”. Exposure of neonatal leukocytes in vitro or neonatal animals or humans in vivo to specific innate immune stimuli results in an altered innate immune set point. Given the particular importance of innate immunity early in life, trained immunity to early life infection and/or immunization may play an important role in modulating both acute and chronic diseases. PMID:24352476
Arginine and Citrulline and the Immune Response in Sepsis
Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn
2015-01-01
Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985
The immune response to Nipah virus infection.
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J
2012-09-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.
Chemokine-mediated immune responses in the female genital tract mucosa.
Deruaz, Maud; Luster, Andrew D
2015-04-01
The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.
Influence of ionizing radiation on the immune response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brocadeszaalberg, O.
1974-01-01
The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)
Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K
2011-08-01
The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.
Budesonide and Formoterol Reduce Early Innate Anti-Viral Immune Responses In Vitro
Davies, Janet M.; Carroll, Melanie L.; Li, Hongzhuo; Poh, Alisa M.; Kirkegard, Darren; Towers, Michelle; Upham, John W.
2011-01-01
Asthma is a chronic inflammatory airways disease in which respiratory viral infections frequently trigger exacerbations. Current treatment of asthma with combinations of inhaled corticosteroids and long acting beta2 agonists improves asthma control and reduces exacerbations but what impact this might have on innate anti-viral immunity is unclear. We investigated the in vitro effects of asthma drugs on innate anti-viral immunity. Peripheral blood mononuclear cells (PBMC) from healthy and asthmatic donors were cultured for 24 hours with the Toll-like receptor 7 agonist, imiquimod, or rhinovirus 16 (RV16) in the presence of budesonide and/or formoterol. Production of proinflammatory cytokines and expression of anti-viral intracellular signalling molecules were measured by ELISA and RT-PCR respectively. In PBMC from healthy donors, budesonide alone inhibited IP-10 and IL-6 production induced by imiquimod in a concentration-dependent manner and the degree of inhibition was amplified when budesonide and formoterol were used in combination. Formoterol alone had little effect on these parameters, except at high concentrations (10−6 M) when IL-6 production increased. In RV16 stimulated PBMC, the combination of budesonide and formoterol inhibited IFNα and IP-10 production in asthmatic as well as healthy donors. Combination of budesonide and formoterol also inhibited RV16-stimulated expression of the type I IFN induced genes myxovirus protein A and 2′, 5′ oligoadenylate synthetise. Notably, RV16 stimulated lower levels of type Myxovirus A and oligoadenylate synthase in PBMC of asthmatics than control donors. These in vitro studies demonstrate that combinations of drugs commonly used in asthma therapy inhibit both early pro-inflammatory cytokines and key aspects of the type I IFN pathway. These findings suggest that budesonide and formoterol curtail excessive inflammation induced by rhinovirus infections in patients with asthma, but whether this inhibits viral clearance
Onchocerciasis modulates the immune response to mycobacterial antigens
Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E
1999-01-01
Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056
Valdés-Tovar, Marcela; Escobar, Carolina; Solís-Chagoyán, Héctor; Asai, Miguel; Benítez-King, Gloria
2015-03-01
The light-dark cycle is an environmental factor that influences immune physiology, and so, variations of the photoperiod length result in altered immune responsivity. Macrophage physiology comprises a spectrum of functions that goes from host defense to immune down-regulation, in addition to their homeostatic activities. Macrophages also play a key role in the transition from innate to adaptive immune responses. Met-enkephalin (MEnk) has been recognized as a modulator of macrophage physiology acting in an autocrine or paracrine fashion to influence macrophage activation, phenotype polarization and production of cytokines that would enhance lymphocyte activation at early stages of an immune response. Previously it was shown that splenic MEnk tissue content is reduced in rats exposed to constant light. In this work, we explored whether production of Met-enkephalin-containing peptides (MECPs) in cultured splenic macrophages is affected by exposure of rats to a constant light regime. In addition, we explored whether primary immune response was impaired under this condition. We found that in rats, 15 days in constant light was sufficient to disrupt their general activity rhythm. Splenic MEnk content oscillations and levels were also blunted throughout a 24-h period in animals subjected to constant light. In agreement, de novo synthesis of MECPs evaluated through incorporation of (35)S-methionine was reduced in splenic macrophages from rats exposed to constant light. Moreover, MECPs immunocytochemistry showed a decrease in the intracellular content and lack of granule-like deposits in this condition. Furthermore, we found that primary T-dependent antibody response was compromised in rats exposed to constant light. In those animals, pharmacologic treatment with MEnk increased IFN-γ-secreting cells. Also, IL-2 secretion from antigen-stimulated splenocytes was reduced after incubation with naloxone, suggesting that immune-derived opioid peptides and stimulation of opioid
Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID
Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.
Xu, Huanbin; Wang, Xiaolei; Morici, Lisa A; Pahar, Bapi; Veazey, Ronald S
2011-03-25
We previously showed intravaginal inoculation with SHIVsf162p3 results in transient viremia followed by undetectable viremia in most macaques, and some displayed subsequent immunity to superinfection with pathogenic SIVmac251. Here we compare early T cell activation, proliferation, and plasma cytokine/chemokine responses in macaques intravaginally infected with either SHIVsf162p3 or SIVmac251 to determine whether distinct differences in host responses may be associated with early viral containment. The data show SIVmac251 infection results in significantly higher levels of T cell activation, proliferation, and a mixed cytokine/chemokine "storm" in plasma in primary infection, whereas infection with SHIVsf162p3 resulted in significantly lower levels of T cell activation, proliferation, and better preservation of memory CD4+ T cells in early infection which immediately preceded control of viremia. These results support the hypothesis that early systemic immune activation, T cell proliferation, and a more prominent and broader array of cytokine/chemokine responses facilitate SIV replication, and may play a key role in persistence of infection, and the progression to AIDS. In contrast, immune unresponsiveness may be associated with eventual clearance of virus, a concept that may have key significance for therapy and vaccine design.
Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis
2017-02-01
Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.
Nash, Michael J.; Frank, Daniel N.; Friedman, Jacob E.
2017-01-01
The developing infant gut microbiome affects metabolism, maturation of the gastrointestinal tract, immune system function, and brain development. Initial seeding of the neonatal microbiota occurs through maternal and environmental contact. Maternal diet, antibiotic use, and cesarean section alter the offspring microbiota composition, at least temporarily. Nutrients are thought to regulate initial perinatal microbial colonization, a paradigm known as the “Restaurant” hypothesis. This hypothesis proposes that early nutritional stresses alter both the initial colonizing bacteria and the development of signaling pathways controlled by microbial mediators. These stresses fine-tune the immune system and metabolic homeostasis in early life, potentially setting the stage for long-term metabolic and immune health. Dysbiosis, an imbalance or a maladaptation in the microbiota, can be caused by several factors including dietary alterations and antibiotics. Dysbiosis can alter biological processes in the gut and in tissues and organs throughout the body. Misregulated development and activity of both the innate and adaptive immune systems, driven by early dysbiosis, could have long-lasting pathologic consequences such as increased autoimmunity, increased adiposity, and non-alcoholic fatty liver disease (NAFLD). This review will focus on factors during pregnancy and the neonatal period that impact a neonate’s gut microbiome, as well as the mechanisms and possible links from early infancy that can drive increased risk for diseases including obesity and NAFLD. The complex pathways that connect diet, the microbiota, immune system development, and metabolism, particularly in early life, present exciting new frontiers for biomedical research. PMID:29326657
Enhancing the Immune Response to Recombinant Plague Antigens
2006-05-01
Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant
Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens
Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.
2007-01-01
In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440
Costs of mounting an immune response during pregnancy in a lizard.
Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald
2013-01-01
Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.
Multiscale modeling of mucosal immune responses
2015-01-01
Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut
Multiscale modeling of mucosal immune responses.
Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep
2015-01-01
Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T
Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai
2010-12-01
The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).
The cellular immunity and oxidative stress markers in early pregnancy loss.
Daglar, Korkut; Biberoglu, Ebru; Kirbas, Ayse; Dirican, Aylin Onder; Genc, Metin; Avci, Aslihan; Biberoglu, Kutay
2016-01-01
We investigated whether changes in cellular immunity and oxidative stress in pregnancy have any association with spontaneous miscarriage. Circulating adenosine deaminase (ADA) activity as a marker of cellular immunity and malondialdehyde (MDA) and catalase (CAT), glutathione peroxidase (GPx) as markers of T lymphocyte activation and parameters of oxidative stress and antioxidant defense were compared between 40 women with early pregnancy loss and another 40 women with ungoing healthy pregnancy. Women with miscarriage had higher serum ADA and GPx levels when compared with women with normal pregnancy (p = 0.034 and p < 0.001, respectively). Although serum MDA level was slightly higher in women with miscarriage, the difference was not significant (p = 0.083). CAT levels were alike in both groups. We have demonstrated an increased cellular immunity and perhaps a compensated oxidative stress related to increased antioxidant activation in women with early spontaneous pregnancy loss.
The immune response to Nipah virus infection
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.
2012-01-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317
Cytomegalovirus infection enhances the immune response to influenza.
Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M
2015-04-01
Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.
Cellular immune response experiment MA-031
NASA Technical Reports Server (NTRS)
Criswell, B. S.
1976-01-01
Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.
Activating the innate immune response to counter chronic hepatitis B virus infection.
Lamb, Camilla; Arbuthnot, Patrick
2016-12-01
Chronic infection with hepatitis B virus (HBV) is endemic to several populous parts of the world, where resulting complicating cirrhosis and hepatocellular carcinoma occur commonly. Licensed drugs to treat the infection have limited curative efficacy, and development of therapies that eliminate all replication intermediates of HBV is a priority. Areas covered: The recent demonstration that the activation of the innate immune response may eradicate HBV from infected hepatocytes has a promising therapeutic application. Small molecule stimulators of Toll-like receptors (TLRs) inhibit replication of woodchuck hepatitis virus in woodchucks and HBV in chimpanzees and mice. Early stage clinical trials using GS-9620, a TLR7 agonist, indicate that this candidate antiviral is well tolerated in humans. Using an alternative approach, triggering the innate immune response with agonists of lymphotoxin-β receptor caused efficient APOBEC-mediated deamination and degradation of viral covalently closed circular DNA. Expert opinion: Eliminating HBV cccDNA from infected individuals would constitute a cure, and has become the focus of intensive research that employs various therapeutic approaches, including gene therapy. Immunomodulation through innate immune activation shows promise for the treatment of chronic infection of HBV (CHB) and, used in combination with other therapeutics, may contribute to the global control of infections and ultimately to the eradication of HBV.
Suppressive influences in the immune response to cancer.
Bronte, Vincenzo; Mocellin, Simone
2009-01-01
Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.
Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar
2017-12-24
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis
Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar
2017-01-01
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550
Costs of immune responses are related to host body size and lifespan
Brace, Amber J.; Lajeunesse, Marc J.; Ardia, Daniel R.; ...
2017-06-01
A central assumption in ecological immunology is that immune responses are costly, with costs manifesting directly (e.g., increases in metabolic rate and increased amino acid usage) or as tradeoffs with other life processes (e.g., reduced growth and reproductive success). Across taxa, host longevity, timing of maturity, and reproductive effort affect the organization of immune systems. It is reasonable, therefore, to expect that these and related factors should also affect immune activation costs. Specifically, species that spread their breeding efforts over a long lifetime should experience lower immune costs than those that mature and breed quickly and die comparatively early. Likewise,more » body mass should affect immune costs, as body size affects the extent to which hosts are exposed to parasites as well as how hosts can combat infections (via its effects on metabolic rates and other factors). Here in this paper, we used phylogenetic meta-regression to reveal that, in general, animals incur costs of immune activation, but small species that are relatively long-lived incur the largest costs. These patterns probably arise because of the relative need for defense when infection risk is comparatively high and fitness can only be realized over a comparatively long period. However, given the diversity of species considered here and the overall modest effects of body mass and life history on immune costs, much more research is necessary before generalizations are appropriate.« less
Costs of immune responses are related to host body size and lifespan
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brace, Amber J.; Lajeunesse, Marc J.; Ardia, Daniel R.
A central assumption in ecological immunology is that immune responses are costly, with costs manifesting directly (e.g., increases in metabolic rate and increased amino acid usage) or as tradeoffs with other life processes (e.g., reduced growth and reproductive success). Across taxa, host longevity, timing of maturity, and reproductive effort affect the organization of immune systems. It is reasonable, therefore, to expect that these and related factors should also affect immune activation costs. Specifically, species that spread their breeding efforts over a long lifetime should experience lower immune costs than those that mature and breed quickly and die comparatively early. Likewise,more » body mass should affect immune costs, as body size affects the extent to which hosts are exposed to parasites as well as how hosts can combat infections (via its effects on metabolic rates and other factors). Here in this paper, we used phylogenetic meta-regression to reveal that, in general, animals incur costs of immune activation, but small species that are relatively long-lived incur the largest costs. These patterns probably arise because of the relative need for defense when infection risk is comparatively high and fitness can only be realized over a comparatively long period. However, given the diversity of species considered here and the overall modest effects of body mass and life history on immune costs, much more research is necessary before generalizations are appropriate.« less
Fetal immune response to chorioamnionitis
Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.
2014-01-01
Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922
Human Immune Response to Dengue Infections
1989-07-31
antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8
The effects of early life adversity on the immune system.
Elwenspoek, Martha M C; Kuehn, Annette; Muller, Claude P; Turner, Jonathan D
2017-08-01
Early life adversity (ELA) is associated with a higher risk for diseases in adulthood. Although the pathophysiological effects of ELA are varied, there may be a unifying role for the immune system in all of the long-term pathologies such as chronic inflammatory disorders (autoimmune diseases, allergy, and asthma). Recently, significant efforts have been made to elucidate the long-term effects ELA has on immune function, as well as the mechanisms underlying these immune changes. In this review, we focus on data from human studies investigating immune parameters in relation to post-natal adverse experiences. We describe the current understanding of the 'ELA immune phenotype', characterized by inflammation, impairment of the cellular immune system, and immunosenescence. However, at present, data addressing specific immune functions are limited and there is a need for high-quality, well powered, longitudinal studies to unravel cause from effect. Besides the immune system, also the stress system and health behaviors are altered in ELA. We discuss probable underlying mechanisms based on epigenetic programming that could explain the ELA immune phenotype and whether this is a direct effect of immune programming or an indirect consequence of changes in behavior or stress reactivity. Understanding the underlying mechanisms will help define effective strategies to prevent or counteract negative ELA-associated outcomes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Caplan, Jeffrey L.; Zhu, Xiaohong; Mamillapalli, Padmavathi; Marathe, Rajendra; Anandalakshmi, Radhamani; Dinesh-Kumar, S. P.
2009-01-01
Summary The plant innate immune response requires a rapid, global reprogramming of cellular processes. Here we employed two complementary proteomic methods, two-dimensional differential in-gel electrophoresis (2D-DIGE) and iTRAQ, to identify differentially regulated proteins early during a defense response. Besides defense-related proteins, the constituents of the largest category of up-regulated proteins were cytoplasmic- and endoplasmic reticulum (ER)-residing molecular chaperones. Silencing of ER-resident protein disulfide isomerases, NbERp57 and NbP5, and the calreticulins, NbCRT2 and NbCRT3, lead to a partial loss of N immune receptor-mediated defense against Tobacco mosaic virus (TMV). Furthermore, NbCRT2 and NbCRT3 are required for the expression of a novel induced receptor-like kinase (IRK). IRK is a plasma membrane-localized protein required for the N-mediated hypersensitive response programmed cell death (HR-PCD) and resistance to TMV. These data support a model in which ER-resident chaperones are required for the accumulation of membrane bound or secreted proteins that are necessary for innate immunity. PMID:19917500
Pontier-Bres, Rodolphe; Munro, Patrick; Boyer, Laurent; Anty, Rodolphe; Imbert, Véronique; Terciolo, Chloé; André, Fréderic; Rampal, Patrick; Lemichez, Emmanuel; Peyron, Jean-François; Czerucka, Dorota
2014-01-01
Salmonella enterica serovar Typhimurium (ST) is an enteropathogenic Gram-negative bacterium that causes infection following oral ingestion. ST spreads rapidly along the gastrointestinal tract (GIT) and invades the intestinal epithelium to ultimately reach internal body organs. The probiotic yeast Saccharomyces boulardii BIOCODEX (S.b-B) is prescribed for prophylaxis of diarrheal infectious diseases. We previously showed that S.b-B prevents weight loss in ST-infected mice and significantly decreases bacterial translocation to the spleen and liver. This study was designed to investigate the effect of S.b-B on ST migration along the GIT and the impact of the yeast on the host's early innate immune responses. Bioluminescent imaging (BLI) was used to evaluate the effect of S.b-B on the progression of luminescent Salmonella Typhimurium (ST-lux) in the GIT of mice pretreated with streptomycin. Photonic emission (PE) was measured in GIT extracts (stomach, small intestine, cecum and colon) at various time periods post-infection (PI). PE analysis revealed that, 45 min PI, ST-lux had migrated slightly faster in the mice treated with S.b-B than in the untreated infected animals. At 90 min PI, ST-lux had reached the cecum in both groups of mice. Adhesion of ST to S.b-B was visualized in the intestines of the mice and probably accounts for (1) the faster elimination of ST-lux in the feces, and (2) reduced translocation of ST to the spleen and liver. In the early phase of infection, S.b-B also modifies the host's immune responses by (1) increasing IFN-γ gene expression and decreasing IL-10 gene expression in the small intestine, and (2) elevating both IFN-γ, and IL-10 mRNA levels in the cecum. BLI revealed that S.b-B modifies ST migration and the host immune response along the GIT. Study findings shed new light on the protective mechanisms of S.b-B during the early phase of Salmonella pathogenesis.
Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu
2017-01-01
While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733
Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam
2017-01-01
Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086
Strain difference in the immune response to hydralazine in inbred guinea-pigs
Ellman, L.; Inman, J.; Green, Ira
1971-01-01
Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639
Abdallah, Fatma; Hassanin, Ola
2015-12-01
Avian Influenza (AI) vaccines are widely used for mammals and birds in a trial to eliminate the Avian Influenza virus (AIV) infection from the world. However and up till now the virus is still existed via modulation of its antigenic structure to evade the pressure of host immune responses. For a complete understanding of the immune responses following AI vaccination in chickens, the modulations of the chickens humoral immune responses and interferon-alpha signaling pathway, as a fundamental part of the innate immune responses, were investigated. In our study, we measured the humoral immune response using hemagglutination-inhibition (HI) and enzyme-linked immunosorbent assay (ELISA) tests. In addition, chicken interferon-alpha pathway components was measured at RNA levels using Quantitative Real-time PCR (qRT-PCR) following one dose of inactivated H5N1 influenza vaccine at 14 days of age. In this study, the protective levels of humoral antibody responses were observed at 14, 21 and 28 days following immunization with inactivated (Re-1/H5N1) AI vaccine. In the chicken spleen cells, up regulation in the chicken interferon-alpha pathway components (MX1 & IRF7) was existed as early as 48 h post vaccination and remained until 28 days post vaccination at the endogenous state. However, after the recall with ex-vivo stimulation, the up regulation was more pronounced in the transcriptional factor (IRF7) compared to the antiviral gene (MX1) at 28 days post vaccination. So far, from our results it appears that the inactivated H5N1 vaccine can trigger the chicken interferon-alpha signaling pathway as well as it can elicit protective humoral antibody responses.
Factors that deregulate the protective immune response in tuberculosis.
Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana
2009-01-01
Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.
Immune response to 60-day head-down bed rest
NASA Astrophysics Data System (ADS)
Song, Jinping; Guo, Aihua; Zhong, Ping; Zhang, Hongyu; Wu, Feng; Wan, Yumin; Bai, Yanqiang; Chen, Shanguang; Li, Yinghui
Introduction: Exposure of humans to spaceflight has resulted in disregulation of the immune system. Head-down bed rest (HDBR) has been extensively used as an earth-bound analog to study physiologic effects mimicking those occurring in weightlessness during spaceflight. It is uncertain how a prolonged period of bed rest affect human immune responses. The objective of this study was to investigate the effects of 60-day HDBR on immune function and EB virus reactivation in seven male volunteers. Methods: There were seven healthy male volunteers who were subjected to HDBR for 60d. Immunological parameters including leukocyte subset distribution, lymphocyte proliferation to mitogens, secreted cytokine profiles and EB virus reactivation were monitored. Results: Total WBC conunts increased significantly 10d post-HDBR as compared with pre-HDBR. At the same time, the relative percentage of neutrophils was also higher than pre-HDBR but not significant. MFI of CD11b in neutrophils was reduced obviously at thd end of HDBR. T Lymphocyte proliferations to PHA reduced at HDBR 30, HDBR 60 and 10d post-HDBR while IL-2 production decreased significantly at the same time. IFN-and IL-4 production trended to decrease at HDBR 30 and HDBR 60. The relative percentage of T lymphocyte subset, B lymphocyte and NK cells were not altered. EBV EA (early antigen) were negative and EBV VCA titers had no changes through HDBR. Conclusion: The results indicate that several immunological parameters (mainly cellular immunity) are altered significantly by prolonged HDBR, and these changes were similar to those happened in spaceflight.
Innate Immune Responses in Leprosy
Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes
2018-01-01
Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852
Hajam, Irshad Ahmed; Lee, John Hwa
2017-06-01
Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.
Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight
Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila
2011-01-01
Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297
Th1 and Th17 hypercytokinemia as early host response signature in severe pandemic influenza.
Bermejo-Martin, Jesus F; Ortiz de Lejarazu, Raul; Pumarola, Tomas; Rello, Jordi; Almansa, Raquel; Ramírez, Paula; Martin-Loeches, Ignacio; Varillas, David; Gallegos, Maria C; Serón, Carlos; Micheloud, Dariela; Gomez, Jose Manuel; Tenorio-Abreu, Alberto; Ramos, María J; Molina, M Lourdes; Huidobro, Samantha; Sanchez, Elia; Gordón, Mónica; Fernández, Victoria; Del Castillo, Alberto; Marcos, Ma Angeles; Villanueva, Beatriz; López, Carlos Javier; Rodríguez-Domínguez, Mario; Galan, Juan-Carlos; Cantón, Rafael; Lietor, Aurora; Rojo, Silvia; Eiros, Jose M; Hinojosa, Carmen; Gonzalez, Isabel; Torner, Nuria; Banner, David; Leon, Alberto; Cuesta, Pablo; Rowe, Thomas; Kelvin, David J
2009-01-01
Human host immune response following infection with the new variant of A/H1N1 pandemic influenza virus (nvH1N1) is poorly understood. We utilize here systemic cytokine and antibody levels in evaluating differences in early immune response in both mild and severe patients infected with nvH1N1. We profiled 29 cytokines and chemokines and evaluated the haemagglutination inhibition activity as quantitative and qualitative measurements of host immune responses in serum obtained during the first five days after symptoms onset, in two cohorts of nvH1N1 infected patients. Severe patients required hospitalization (n = 20), due to respiratory insufficiency (10 of them were admitted to the intensive care unit), while mild patients had exclusively flu-like symptoms (n = 15). A group of healthy donors was included as control (n = 15). Differences in levels of mediators between groups were assessed by using the non parametric U-Mann Whitney test. Association between variables was determined by calculating the Spearman correlation coefficient. Viral load was performed in serum by using real-time PCR targeting the neuraminidase gene. Increased levels of innate-immunity mediators (IP-10, MCP-1, MIP-1beta), and the absence of anti-nvH1N1 antibodies, characterized the early response to nvH1N1 infection in both hospitalized and mild patients. High systemic levels of type-II interferon (IFN-gamma) and also of a group of mediators involved in the development of T-helper 17 (IL-8, IL-9, IL-17, IL-6) and T-helper 1 (TNF-alpha, IL-15, IL-12p70) responses were exclusively found in hospitalized patients. IL-15, IL-12p70, IL-6 constituted a hallmark of critical illness in our study. A significant inverse association was found between IL-6, IL-8 and PaO2 in critical patients. While infection with the nvH1N1 induces a typical innate response in both mild and severe patients, severe disease with respiratory involvement is characterized by early secretion of Th17 and Th1 cytokines usually
Innate Immune Responses to Cryptococcus.
Heung, Lena J
2017-09-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.
Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.
Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi
2018-04-16
While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The flip side of immune surveillance: immune dependency.
Prehn, Richmond T; Prehn, Liisa M
2008-04-01
The growths of many and perhaps all tumors may be stimulated rather than inhibited by a quantitatively low level of immunity. The reason tumors have antigens may be that tumors do not develop in vivo in the absence of at least a minimal immune reaction; in this sense, cancer may be considered an autoimmune disease. This review, based largely on the work of our own laboratory, outlines the data showing that the titration of anti-tumor immunity exhibits the phenomenon of hormesis, i.e. the dose-response curve is non-linear such that low levels of immunity are generally stimulatory but larger quantities of the same immune reactants may inhibit tumor growth. Evidence is also reviewed that suggests that the immune response may vary qualitatively and quantitatively during progression, such that there seems to be, during oncogenesis, a very low level of immune reaction that aids initial tumor growth, followed by a larger reaction that may cause remission of early neoplasms, followed, if the neoplasm survives, by a relative immunologic tolerance to the tumor that may be dependent, at least in part, on suppressor cells. This knowledge may help to explain some clinical observations concerning the relationships among tumor types and the organ distribution of metastases.
A basic mathematical model of the immune response
NASA Astrophysics Data System (ADS)
Mayer, H.; Zaenker, K. S.; an der Heiden, U.
1995-03-01
Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.
Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira
2016-01-01
ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel
Carbone, Javier
2016-01-01
Abstract The immune response to cytomegalovirus (CMV) infection is highly complex, including humoral, cellular, innate, and adaptive immune responses. Detection of CMV by the innate immune system triggers production of type I IFNs and inflammatory cytokines which initiate cellular and humoral responses that are critical during the early viremic phase of CMV infection. Sustained control of CMV infection is largely accounted for by cellular immunity, involving various T-cell and B-cell subsets. In solid organ transplant patients, global suppression of innate and adaptive immunities by immunosuppressive agents limits immunological defense, including inhibition of natural killer cell activity with ongoing lowering of Ig levels and CMV-specific antibody titers. This is coupled with a short-term suppression of CMV-specific T cells, the extent and duration of which can predict risk of progression to CMV viremia. CMV immunoglobulin (CMVIG) preparations have the potential to exert immunomodulatory effects as well as providing passive immunization. Specific CMVIG antibodies and virus neutralization might be enhanced by modulation of dendritic cell activity and by a decrease in T-cell activation, effects which are of importance during the initial phase of infection. In summary, the role of CMVIG in reconstituting specific anti-CMV antibodies may be enhanced by some degree of modulation of the innate and adaptive immune responses, which could help to control some of the direct and indirect effects of CMV infection. PMID:26900990
Carbone, Javier
2016-03-01
The immune response to cytomegalovirus (CMV) infection is highly complex, including humoral, cellular, innate, and adaptive immune responses. Detection of CMV by the innate immune system triggers production of type I IFNs and inflammatory cytokines which initiate cellular and humoral responses that are critical during the early viremic phase of CMV infection. Sustained control of CMV infection is largely accounted for by cellular immunity, involving various T-cell and B-cell subsets. In solid organ transplant patients, global suppression of innate and adaptive immunities by immunosuppressive agents limits immunological defense, including inhibition of natural killer cell activity with ongoing lowering of Ig levels and CMV-specific antibody titers. This is coupled with a short-term suppression of CMV-specific T cells, the extent and duration of which can predict risk of progression to CMV viremia. CMV immunoglobulin (CMVIG) preparations have the potential to exert immunomodulatory effects as well as providing passive immunization. Specific CMVIG antibodies and virus neutralization might be enhanced by modulation of dendritic cell activity and by a decrease in T-cell activation, effects which are of importance during the initial phase of infection. In summary, the role of CMVIG in reconstituting specific anti-CMV antibodies may be enhanced by some degree of modulation of the innate and adaptive immune responses, which could help to control some of the direct and indirect effects of CMV infection.
CHANGES IN HUMORAL IMMUNITY OCCURRING DURING THE EARLY STAGES OF EXPERIMENTAL PNEUMOCOCCUS INFECTION
Terrell, Edward E.
1930-01-01
A study was made of the changes in humoral immunity occurring during the early phases of experimental pneumococcus infection in the dog and cat. The methods devised by Robertson and Sia were employed to demonstrate the presence of anti-pneumococcus properties in the serum of animals naturally resistant to this micro-organism. It was found that with a generalized and overwhelming infection accompanied by early blood invasion, there was a prompt and rapid decrease in the concentration of natural humoral immune bodies which frequently disappeared entirely by the time of death. This same early diminution of humoral immune substances, opsonins, agglutinins, and pneumococcidal-promoting bodies was observed in animals that survived a moderately severe generalized infection but the concentration of immune bodies rose again with the onset of recovery. The decrease in concentration of humoral immune substances during a severe generalized infection appeared to be due to the combination of "S" substance with the normal immune bodies. When the pneumococcus infection was more localized as in the case of true lobar pneumonia a quite different sequence of events was observed to occur. Several animals, in which extensive lobar pneumonia was produced, showed the presence in quantity of humoral immune bodies in the blood throughout the course of an infection terminating fatally. These findings suggest that after the inception of pneumococcus infection in the dog and cat the chief function of natural anti-pneurnococcus substances in the blood is to limit or prevent blood invasion. When pneumococcic infection is localized these circulating antibodies appear to have little effect either in preventing the spread of the process or determining the outcome of the disease. PMID:19869701
Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores
Lampert, Evan
2012-01-01
Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545
Photodynamic therapy for cancer and activation of immune response
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.
2010-02-01
Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.
Proteomic contributions to our understanding of vaccine and immune responses
Galassie, Allison C.; Link, Andrew J.
2015-01-01
Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619
Early detection of disease program: Evaluation of the cellular immune response
NASA Technical Reports Server (NTRS)
Criswell, B. S.; Knight, V.; Martin, R. R.; Kasel, J. A.
1974-01-01
The early cellular responses of specific components of the leukocyte and epithelial cell populations to foreign challenges of both an infectious and noninfectious character were evaluated. Procedures for screening potential flight crews were developed, documented, and tested on a control population. Methods for preparing suitable populations of lymphocytes, polymorphonuclear leukocytes, macrophages, and epithelial cells were first established and evaluated. Epithelial cells from viral infected individuals were screened with a number of anti-viral antisera. This procedure showed the earliest indication of disease as well as providing a specific diagnosis to the physicians. Both macrophages and polymorphonuclear leukocytes were studied from normal individuals, smokers, and patients with viral infections. Newer techniques enabling better definition of lymphocyte subpopulations were then developed, namely the E and EAC rosette procedures for recognition of T (thymus-derived) and B (bone-marrow-derived) lymphocyte subpopulations. Lymphocyte and lymphocyte subpopulation response to multiple mitogens have been evaluated.
Hsp70 Regulates Immune Response in Experimental Autoimmune Encephalomyelitis
Mansilla, M. José; Costa, Carme; Eixarch, Herena; Tepavcevic, Vanja; Castillo, Mireia; Martin, Roland; Lubetzki, Catherine; Aigrot, Marie-Stéphane; Montalban, Xavier; Espejo, Carmen
2014-01-01
Heat shock protein (Hsp)70 is one of the most important stress-inducible proteins. Intracellular Hsp70 not only mediates chaperone-cytoprotective functions but can also block multiple steps in the apoptosis pathway. In addition, Hsp70 is actively released into the extracellular milieu, thereby promoting innate and adaptive immune responses. Thus, Hsp70 may be a critical molecule in multiple sclerosis (MS) pathogenesis and a potential target in this disease due to its immunological and cytoprotective functions. To investigate the role of Hsp70 in MS pathogenesis, we examined its immune and cytoprotective roles using both in vitro and in vivo experimental procedures. We found that Hsp70.1-deficient mice were more resistant to developing experimental autoimmune encephalomyelitis (EAE) compared with their wild-type (WT) littermates, suggesting that Hsp70.1 plays a critical role in promoting an effective myelin oligodendrocyte glycoprotein (MOG)-specific T cell response. Conversely, Hsp70.1-deficient mice that developed EAE showed an increased level of autoreactive T cells to achieve the same production of cytokines compared with the WT mice. Although a neuroprotective role of HSP70 has been suggested, Hsp70.1-deficient mice that developed EAE did not exhibit increased demyelination compared with the control mice. Accordingly, Hsp70 deficiency did not influence the vulnerability to apoptosis of oligodendrocyte precursor cells (OPCs) in culture. Thus, the immunological role of Hsp70 may be relevant in EAE, and specific therapies down-regulating Hsp70 expression may be a promising approach to reduce the early autoimmune response in MS patients. PMID:25153885
Innate Immune Response to Burkholderia mallei
2017-02-16
stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the
Immune Responses in Rhinovirus-Induced Asthma Exacerbations.
Steinke, John W; Borish, Larry
2016-11-01
Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.
A plant effector-triggered immunity signaling sector is inhibited by pattern-triggered immunity.
Hatsugai, Noriyuki; Igarashi, Daisuke; Mase, Keisuke; Lu, You; Tsuda, Yayoi; Chakravarthy, Suma; Wei, Hai-Lei; Foley, Joseph W; Collmer, Alan; Glazebrook, Jane; Katagiri, Fumiaki
2017-09-15
Since signaling machineries for two modes of plant-induced immunity, pattern-triggered immunity (PTI) and effector-triggered immunity (ETI), extensively overlap, PTI and ETI signaling likely interact. In an Arabidopsis quadruple mutant, in which four major sectors of the signaling network, jasmonate, ethylene, PAD4, and salicylate, are disabled, the hypersensitive response (HR) typical of ETI is abolished when the Pseudomonas syringae effector AvrRpt2 is bacterially delivered but is intact when AvrRpt2 is directly expressed in planta These observations led us to discovery of a network-buffered signaling mechanism that mediates HR signaling and is strongly inhibited by PTI signaling. We named this mechanism the ETI-Mediating and PTI-Inhibited Sector (EMPIS). The signaling kinetics of EMPIS explain apparently different plant genetic requirements for ETI triggered by different effectors without postulating different signaling machineries. The properties of EMPIS suggest that information about efficacy of the early immune response is fed back to the immune signaling network, modulating its activity and limiting the fitness cost of unnecessary immune responses. © 2017 The Authors.
Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses
van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.
2012-01-01
The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167
Mastore, Maristella; Arizza, Vincenzo; Manachini, Barbara; Brivio, Maurizio F
2015-12-01
Aim of this study was to investigate relationships between the red palm weevil (RPW) Rhynchophorus ferrugineus (Olivier) and the entomopathogenic nematode Steinernema carpocapsae (EPN); particularly, the work was focused on the immune response of the insect host in naive larvae and after infection with the EPN. Two main immunological processes have been addressed: the activity and modulation of host prophenoloxidase-phenoloxidase (proPO) system, involved in melanization of not-self and hemocytes recognition processes responsible for not-self encapsulation. Moreover, immune depressive and immune evasive strategies of the parasite have been investigated. Our results suggest that RPW possess an efficient immune system, however in the early phase of infection, S. carpocapsae induces a strong inhibition of the host proPO system. In addition, host cell-mediated mechanisms of encapsulation, are completely avoided by the parasite, the elusive strategies of S. carpocapsae seem to be related to the structure of its body-surface, since induced alterations of the parasite cuticle resulted in the loss of its mimetic properties. S. carpocapsae before the release of its symbiotic bacteria, depress and elude RPW immune defenses, with the aim to arrange a favorable environment for its bacteria responsible of the septicemic death of the insect target. © 2014 Institute of Zoology, Chinese Academy of Sciences.
Thackray, Larissa B; Shrestha, Bimmi; Richner, Justin M; Miner, Jonathan J; Pinto, Amelia K; Lazear, Helen M; Gale, Michael; Diamond, Michael S
2014-10-01
Upon activation of Toll-like and RIG-I-like receptor signaling pathways, the transcription factor IRF5 translocates to the nucleus and induces antiviral immune programs. The recent discovery of a homozygous mutation in the immunoregulatory gene guanine exchange factor dedicator of cytokinesis 2 (Dock2mu/mu) in several Irf5-/- mouse colonies has complicated interpretation of immune functions previously ascribed to IRF5. To define the antiviral functions of IRF5 in vivo, we infected backcrossed Irf5-/-×Dock2wt/wt mice (here called Irf5-/- mice) and independently generated CMV-Cre Irf5fl/fl mice with West Nile virus (WNV), a pathogenic neurotropic flavivirus. Compared to congenic wild-type animals, Irf5-/- and CMV-Cre Irf5fl/fl mice were more vulnerable to WNV infection, and this phenotype was associated with increased infection in peripheral organs, which resulted in higher virus titers in the central nervous system. The loss of IRF5, however, was associated with only small differences in the type I interferon response systemically and in the draining lymph node during WNV infection. Instead, lower levels of several other proinflammatory cytokines and chemokines, as well as fewer and less activated immune cells, were detected in the draining lymph node 2 days after WNV infection. WNV-specific antibody responses in Irf5-/- mice also were blunted in the context of live or inactivated virus infection and this was associated with fewer antigen-specific memory B cells and long-lived plasma cells. Our results with Irf5-/- mice establish a key role for IRF5 in shaping the early innate immune response in the draining lymph node, which impacts the spread of virus infection, optimal B cell immunity, and disease pathogenesis. Although the roles of IRF3 and IRF7 in orchestrating innate and adaptive immunity after viral infection are established, the function of the related transcription factor IRF5 remains less certain. Prior studies in Irf5-/- mice reported conflicting results
Nitric oxide and redox mechanisms in the immune response
Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.
2011-01-01
The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414
NASA Astrophysics Data System (ADS)
Chakravarthy, Krishnan V.
In early 2000, influenza and its associated complications were the 7 th leading cause of death in the United States[1-4]. As of today, this major health problem has become even more of a concern, with the possibility of a potentially devastating avian flu (H5N1) or swine flu pandemic (H1N1). According to the Centers for Disease Control (CDC), over 10 countries have reported transmission of influenza A (H5N1) virus to humans as of June 2006 [5]. In response to this growing concern, the United States pledged over $334 million dollars in international aid for battling influenza[1-4]. The major flu pandemic of the early 1900's provided the first evidence that secondary bacterial pneumonia (not primary viral pneumonia) was the major cause of death in both community and hospital-based settings. Secondary bacterial infections currently account for 35-40% mortality following a primary influenza viral infection [1, 6]. The first component of this work addresses the immunological mechanisms that predispose patients to secondary bacterial infections following a primary influenza viral infection. By assessing host immune responses through various immune-modulatory tools, such as use of volatile anesthetics (i.e. halothane) and Apilimod/STA-5326 (an IL-12/Il-23 transcription blocker), we provide experimental evidence that demonstrates that the overactive adaptive Th1 immune response is critical in mediating increased susceptibility to secondary bacterial infections. We also present data that shows that suppressing the adaptive Th1 immune response enhances innate immunity, specifically in alveolar macrophages, by favoring a pro anti-bacterial phenotype. The second component of this work addresses the use of nanotechnology to deliver therapeutic modalities that affect the primary viral and associated secondary bacterial infections post influenza. First, we used surface functionalized quantum dots for selective targeting of lung alveolar macrophages both in vitro and in vivo
Innate Immune Responses to Cryptococcus
Heung, Lena J.
2017-01-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464
Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata
2018-01-01
Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream
Bach, Eviatar; Chaffer, Marcelo; Lai, Wanika; Keefe, Greg; Begg, Douglas J.
2018-01-01
To establish infection, pathogens secrete virulence factors, such as protein kinases and phosphatases, to modulate the signal transduction pathways used by host cells to initiate immune response. The protein MAP3893c is annotated in the genome sequence of Mycobacterium avium subspecies paratuberculosis (MAP), the causative agent of Johne's disease, as the serine/threonine protein kinase G (PknG). In this work, we report that PknG is a functional kinase that is secreted within macrophages at early stages of infection. The antigen is able to induce an immune response from cattle exposed to MAP in the form of interferon gamma production after stimulation of whole blood with PknG. These findings suggest that PknG may contribute to the pathogenesis of MAP by phosphorylating macrophage signalling and/or adaptor molecules as observed with other pathogenic mycobacterial species. PMID:29581962
Bach, Horacio; Richard-Greenblatt, Melissa; Bach, Eviatar; Chaffer, Marcelo; Lai, Wanika; Keefe, Greg; Begg, Douglas J
2018-01-01
To establish infection, pathogens secrete virulence factors, such as protein kinases and phosphatases, to modulate the signal transduction pathways used by host cells to initiate immune response. The protein MAP3893c is annotated in the genome sequence of Mycobacterium avium subspecies paratuberculosis (MAP), the causative agent of Johne's disease, as the serine/threonine protein kinase G (PknG). In this work, we report that PknG is a functional kinase that is secreted within macrophages at early stages of infection. The antigen is able to induce an immune response from cattle exposed to MAP in the form of interferon gamma production after stimulation of whole blood with PknG. These findings suggest that PknG may contribute to the pathogenesis of MAP by phosphorylating macrophage signalling and/or adaptor molecules as observed with other pathogenic mycobacterial species.
Verification of immune response optimality through cybernetic modeling.
Batt, B C; Kompala, D S
1990-02-09
An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.
Koski, Gary K.; Koldovsky, Ursula; Xu, Shuwen; Mick, Rosemarie; Sharma, Anupama; Fitzpatrick, Elizabeth; Weinstein, Susan; Nisenbaum, Harvey; Levine, Bruce L; Fox, Kevin; Zhang, Paul; Czerniecki, Brian J
2011-01-01
Twenty-seven subjects with HER-2/neu over-expressing ductal carcinoma in situ of the breast were enrolled in a neoadjuvant immunization trial for safety and immunogenicity of DC1-polarized dendritic cells (DC1) pulsed with six HER-2/neu promiscuous MHC class II-binding peptides, plus two additional HLA-A2.1 class I-binding peptides. DC1 were generated with IFN-γ plus a special clinical-grade bacterial endotoxin (LPS) and administered directly into groin lymph nodes four times at weekly intervals prior to scheduled surgical resection of DCIS. Subjects were monitored for the induction of new or enhanced anti-peptide reactivity by IFN-γ ELIspot and ELISA assays performed on Th cells obtained from peripheral blood or excised sentinel lymph nodes. Responses by CTL against HLA-A2.1-binding peptides were measured using peptide-pulsed T2 target cells or HER-2/neu-expressing or non-expressing tumor cell lines. DC1 showed surface phenotype indistinct from “gold standard” inflammatory cocktail-activated DC, but displayed a number of distinguishing functional characteristics including the secretion of soluble factors and enhanced “killer DC” capacity against tumor cells in vitro. Post-immunization, we observed sensitization of Th cells to at least 1 class II peptide in 22 of 25 (88%, 95% exact CI 68.8 – 97.5%) evaluable subjects, while eleven of 13 (84.6%, 95% exact CI 64 – 99.8%) HLA-A2.1 subjects were successfully sensitized to class I peptides. Perhaps most importantly, anti-HER-2/neu peptide responses were observed up to 52 months post-immunization. These data show even in the presence of early breast cancer such DC1 are potent inducers of durable type I-polarized immunity, suggesting potential clinical value for development of cancer immunotherapy. PMID:22130160
Early-Life Food Nutrition, Microbiota Maturation and Immune Development Shape Life-Long Health.
Zhou, Xiaoli; Du, Lina; Shi, Ronghua; Chen, Zhidong; Zhou, Yiming; Li, Zongjie
2018-06-06
The current knowledge about early-life nutrition and environmental factors that affect the interaction between the symbiotic microbiota and the host immune system has demonstrated novel regulatory target for treating allergic diseases, autoimmune disorders and metabolic syndrome. Various kinds of food nutrients (such as dietary fiber, starch, polyphenols and proteins) can provide energy resources for both intestinal microbiota and the host. The indigestible food components are fermented by the indigenous gut microbiota to produce diverse metabolites, including short-chain fatty acids, bile acids and trimethylamine-N-oxide, which can regulate the host metabolized physiology, immunity homeostasis and health state. Therefore it is commonly believed early-life perturbation of the microbial community structure and the dietary nutrition interference on the child mucosal immunity contribute to the whole life susceptibility to chronic diseases. In all, the combined interrelationship between food ingredients nutrition, intestinal microbiota configurations and host system immunity provides new therapeutic targets to treat various kinds of pathogenic inflammations and chronic diseases.
Immune Response to Dengue and Zika.
Ngono, Annie Elong; Shresta, Sujan
2018-04-26
Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.
Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.
Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy
2018-02-01
We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.
Eosinophils in mucosal immune responses
Travers, J; Rothenberg, M E
2015-01-01
Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184
Spaceflight and Development of Immune Responses
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1996-01-01
Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.
Effect of gender and sex hormones on immune responses following shock.
Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H
2000-08-01
Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.
Choi, M; Kadara, H; Zhang, J; Parra, E R; Rodriguez-Canales, J; Gaffney, S G; Zhao, Z; Behrens, C; Fujimoto, J; Chow, C; Kim, K; Kalhor, N; Moran, C; Rimm, D; Swisher, S; Gibbons, D L; Heymach, J; Kaftan, E; Townsend, J P; Lynch, T J; Schlessinger, J; Lee, J; Lifton, R P; Herbst, R S; Wistuba, I I
2017-01-01
Lung squamous cell carcinoma (LUSC) accounts for 20–30% of non-small cell lung cancers (NSCLCs). There are limited treatment strategies for LUSC in part due to our inadequate understanding of the molecular underpinnings of the disease. We performed whole-exome sequencing (WES) and comprehensive immune profiling of a unique set of clinically annotated early-stage LUSCs to increase our understanding of the pathobiology of this malignancy. Matched pairs of surgically resected stage I-III LUSCs and normal lung tissues (n = 108) were analyzed by WES. Immunohistochemistry and image analysis-based profiling of 10 immune markers were done on a subset of LUSCs (n = 91). Associations among mutations, immune markers and clinicopathological variables were statistically examined using analysis of variance and Fisher’s exact test. Cox proportional hazards regression models were used for statistical analysis of clinical outcome. This early-stage LUSC cohort displayed an average of 209 exonic mutations per tumor. Fourteen genes exhibited significant enrichment for somatic mutation: TP53, MLL2, PIK3CA, NFE2L2, CDH8, KEAP1, PTEN, ADCY8, PTPRT, CALCR, GRM8, FBXW7, RB1 and CDKN2A. Among mutated genes associated with poor recurrence-free survival, MLL2 mutations predicted poor prognosis in both TP53 mutant and wild-type LUSCs. We also found that in treated patients, FBXW7 and KEAP1 mutations were associated with poor response to adjuvant therapy, particularly in TP53-mutant tumors. Analysis of mutations with immune markers revealed that ADCY8 and PIK3CA mutations were associated with markedly decreased tumoral PD-L1 expression, LUSCs with PIK3CA mutations exhibited elevated CD45ro levels and CDKN2A-mutant tumors displayed an up-regulated immune response. Our findings pinpoint mutated genes that may impact clinical outcome as well as personalized strategies for targeted immunotherapies in early-stage LUSC.
A multiherbal formulation influencing immune response in vitro.
Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L
2012-02-01
Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.
Pathogen recognition in the innate immune response.
Kumar, Himanshu; Kawai, Taro; Akira, Shizuo
2009-04-28
Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.
Viral evasion of DNA-stimulated innate immune responses
Christensen, Maria H; Paludan, Søren R
2017-01-01
Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP–AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. PMID:26972769
Inflammatory cytokines in the brain: does the CNS shape immune responses?
Owens, T; Renno, T; Taupin, V; Krakowski, M
1994-12-01
Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.
Drosophila blood cells and their role in immune responses.
Vlisidou, Isabella; Wood, Will
2015-04-01
Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.
Arnett, Andrea L H; Garikipati, Dilip; Wang, Zejing; Tapscott, Stephen; Chamberlain, Jeffrey S
2011-01-01
Recombinant adeno-associated viral (rAAV) vectors promote long-term gene transfer in many animal species. Significant effort has focused on the evaluation of rAAV delivery and the immune response in both murine and canine models of neuromuscular disease. However, canines provided for research purposes are routinely vaccinated against canine parvovirus (CPV). rAAV and CPV possess significant homology and are both parvoviruses. Thus, any immune response generated to CPV vaccination has the potential to cross-react with rAAV vectors. In this study, we investigated the immune response to rAAV6 delivery in a cohort of CPV-vaccinated canines and evaluated multiple vaccination regimens in a mouse model of CPV-vaccination. We show that CPV-vaccination stimulates production of neutralizing antibodies with minimal cross-reactivity to rAAV6. In addition, no significant differences were observed in the magnitude of the rAAV6-directed immune response between CPV-vaccinated animals and controls. Moreover, CPV-vaccination did not inhibit rAAV6-mediated transduction. We also evaluated the immune response to early rAAV6-vaccination in neonatal mice. The influence of maternal hormones and cytokines leads to a relatively permissive state in the neonate. We hypothesized that immaturity of the immune system would permit induction of tolerance to rAAV6 when delivered during the neonatal period. Mice were vaccinated with rAAV6 at 1 or 5 days of age, and subsequently challenged with rAAV6 exposure during adulthood via two sequential IM injections, 1 month apart. All vaccinated animals generated a significant neutralizing antibody response to rAAV6-vaccination that was enhanced following IM injection in adulthood. Taken together, these data demonstrate that the immune response raised against rAAV6 is distinct from that which is elicited by the standard parvoviral vaccines and is sufficient to prevent stable tolerization in neonatal mice.
Arnett, Andrea L. H.; Garikipati, Dilip; Wang, Zejing; Tapscott, Stephen; Chamberlain, Jeffrey S.
2011-01-01
Recombinant adeno-associated viral (rAAV) vectors promote long-term gene transfer in many animal species. Significant effort has focused on the evaluation of rAAV delivery and the immune response in both murine and canine models of neuromuscular disease. However, canines provided for research purposes are routinely vaccinated against canine parvovirus (CPV). rAAV and CPV possess significant homology and are both parvoviruses. Thus, any immune response generated to CPV vaccination has the potential to cross-react with rAAV vectors. In this study, we investigated the immune response to rAAV6 delivery in a cohort of CPV-vaccinated canines and evaluated multiple vaccination regimens in a mouse model of CPV-vaccination. We show that CPV-vaccination stimulates production of neutralizing antibodies with minimal cross-reactivity to rAAV6. In addition, no significant differences were observed in the magnitude of the rAAV6-directed immune response between CPV-vaccinated animals and controls. Moreover, CPV-vaccination did not inhibit rAAV6-mediated transduction. We also evaluated the immune response to early rAAV6-vaccination in neonatal mice. The influence of maternal hormones and cytokines leads to a relatively permissive state in the neonate. We hypothesized that immaturity of the immune system would permit induction of tolerance to rAAV6 when delivered during the neonatal period. Mice were vaccinated with rAAV6 at 1 or 5 days of age, and subsequently challenged with rAAV6 exposure during adulthood via two sequential IM injections, 1 month apart. All vaccinated animals generated a significant neutralizing antibody response to rAAV6-vaccination that was enhanced following IM injection in adulthood. Taken together, these data demonstrate that the immune response raised against rAAV6 is distinct from that which is elicited by the standard parvoviral vaccines and is sufficient to prevent stable tolerization in neonatal mice. PMID:22065964
SIRT1 and HIF1α signaling in metabolism and immune responses.
Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei
2018-04-01
SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
Influence of bedding type on mucosal immune responses.
Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E
2002-10-01
The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.
Nakaya, Helder I.; Clutterbuck, Elizabeth; Kazmin, Dmitri; Wang, Lili; Cortese, Mario; Bosinger, Steven E.; Patel, Nirav B.; Zak, Daniel E.; Aderem, Alan; Dong, Tao; Del Giudice, Giuseppe; Rappuoli, Rino; Cerundolo, Vincenzo; Pollard, Andrew J.; Pulendran, Bali; Siegrist, Claire-Anne
2016-01-01
The dynamics and molecular mechanisms underlying vaccine immunity in early childhood remain poorly understood. Here we applied systems approaches to investigate the innate and adaptive responses to trivalent inactivated influenza vaccine (TIV) and MF59-adjuvanted TIV (ATIV) in 90 14- to 24-mo-old healthy children. MF59 enhanced the magnitude and kinetics of serum antibody titers following vaccination, and induced a greater frequency of vaccine specific, multicytokine-producing CD4+ T cells. Compared with transcriptional responses to TIV vaccination previously reported in adults, responses to TIV in infants were markedly attenuated, limited to genes regulating antiviral and antigen presentation pathways, and observed only in a subset of vaccinees. In contrast, transcriptional responses to ATIV boost were more homogenous and robust. Interestingly, a day 1 gene signature characteristic of the innate response (antiviral IFN genes, dendritic cell, and monocyte responses) correlated with hemagglutination at day 28. These findings demonstrate that MF59 enhances the magnitude, kinetics, and consistency of the innate and adaptive response to vaccination with the seasonal influenza vaccine during early childhood, and identify potential molecular correlates of antibody responses. PMID:26755593
Malnutrition: Modulator of Immune Responses in Tuberculosis
Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth
2017-01-01
Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710
CELLS INVOLVED IN THE IMMUNE RESPONSE
Singhal, Sharwan K.; Richter, Maxwell
1968-01-01
Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID
Early Development of the Gut Microbiota and Immune Health
Francino, M. Pilar
2014-01-01
In recent years, the increase in human microbiome research brought about by the rapidly evolving “omic” technologies has established that the balance among the microbial groups present in the human gut, and their multipronged interactions with the host, are crucial for health. On the other hand, epidemiological and experimental support has also grown for the ‘early programming hypothesis’, according to which factors that act in utero and early in life program the risks for adverse health outcomes later on. The microbiota of the gut develops during infancy, in close interaction with immune development, and with extensive variability across individuals. It follows that the specific process of gut colonization and the microbe-host interactions established in an individual during this period have the potential to represent main determinants of life-long propensity to immune disease. Although much remains to be learnt on the progression of events by which the gut microbiota becomes established and initiates its intimate relationships with the host, and on the long-term repercussions of this process, recent works have advanced significatively in this direction. PMID:25438024
EVOLUTION OF THE IMMUNE RESPONSE
Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.
1964-01-01
1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that
Olson, Wendy; Emmenegger, Eveline; Glenn, Jolene; Simchick, Crystal; Winton, Jim; Goetz, Frederick
2013-01-01
The recently discovered strain of viral hemorrhagic septicemia virus, VHSV-IVb, represents an example of the introduction of an extremely pathogenic rhabdovirus capable of infecting a wide variety of new fish species in a new host-environment. The goal of the present study was to delineate the expression kinetics of key genes in the innate immune response relative to the very early stages of VHSV-IVb infection using the yellow perch (Perca flavescens) as a model. Administration of VHSV-IVb by IP-injection into juvenile yellow perch resulted in 84% cumulative mortality, indicating their high susceptibility to this disease. In fish sampled in the very early stages of infection, a significant up-regulation of Mx gene expression in the liver, as well as IL-1β and SAA activation in the head kidney, spleen, and liver was directly correlated to viral load. The potential down-regulation of Mx in the hematopoietic tissues, head kidney and spleen, may represent a strategy utilized by the virus to increase replication.
Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model
Cao, Yongsheng; Zhang, Qiya; Xu, Liming; Li, Shaowu; Wang, Di; Zhao, Jingzhuang; Liu, Hongbai; Feng, Jian; Lu, Tongyan
2017-01-01
Seven rainbow trout cytokine genes (interleukin (IL)-2, IL-8, IL-15, IL-17, IL-1β, intracellular interferon (iIFN) 1a, and IFN-γ2) were evaluated for their adjuvant effects on a DNA vaccine, called pG, containing the glycoprotein gene of infectious hematopoietic necrosis virus (IHNV). Distinct DNA constructs in expression plasmid pcDNA3.1 encoding a cytokine gene were generated. Immunofluorescence assays in rainbow trout gonadal cells demonstrated successful protein expression from all these constructs. Subsequently, fish were immunized with pG alone or together with a cytokine expression plasmid. Results showed that each cytokine plasmids at an appropriate dose showed notable effects on immune gene expression. IL-17 and IFN-γ2 can enhance early specific IgM response. All cytokines, except IL-8, can benefit initial neutralizing antibody (NAb) titers. At 35 days post immunization (dpi), NAb titers of fish immunized with pG and IL-2, iIFN1a, or IFN-γ2 plasmids remained at high levels (1:160). NAb titers of fish immunized with pG alone decreased to 1:40. IL-8 or IL-1β can enhance antigen-specific proliferative T-cell responses at 14 dpi. At 28 dpi, coinjection of pG with IL-2, IL-8, IL-15, or IL-17 plasmids induced considerably stronger lymphocyte proliferation than that with injection of pG alone. All cytokine plasmids delivered with pG plasmid enhanced protection of trout against IHNV-mediated mortality. These results indicate that the type and dose of trout cytokine genes injected into fish affect quality of immune response to DNA vaccination. PMID:29348820
Erwin-Cohen, Rebecca A; Porter, Aimee I; Pittman, Phillip R; Rossi, Cynthia A; DaSilva, Luis
2017-01-02
Venezuelan equine encephalitis virus (VEEV) is an important human and animal alphavirus pathogen transmitted by mosquitoes. The virus is endemic in Central and South America, but has also caused equine outbreaks in southwestern areas of the United States. In an effort to better understand the molecular mechanisms of the development of immunity to this important pathogen, we performed transcriptional analysis from whole, unfractionated human blood of patients who had been immunized with the live-attenuated vaccine strain of VEEV, TC-83. We compared changes in the transcriptome between naïve individuals who were mock vaccinated with saline to responses of individuals who received TC-83. Significant transcriptional changes were noted at days 2, 7, and 14 following vaccination. The top canonical pathways revealed at early and intermediate time points (days 2 and 7) included the involvement of the classic interferon response, interferon-response factors, activation of pattern recognition receptors, and engagement of the inflammasome. By day 14, the top canonical pathways included oxidative phosphorylation, the protein ubiquitination pathway, natural killer cell signaling, and B-cell development. Biomarkers were identified that differentiate between vaccinees and control subjects, at early, intermediate, and late stages of the development of immunity as well as markers which were common to all 3 stages following vaccination but distinct from the sham-vaccinated control subjects. The study represents a novel examination of molecular processes that lead to the development of immunity against VEEV in humans and which may be of value as diagnostic targets, to enhance modern vaccine design, or molecular correlates of protection.
The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.
Griffin, Diane E
2016-10-12
Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.
The host immune response to Clostridium difficile infection
2013-01-01
Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542
Intravital imaging of cutaneous immune responses.
Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji
2018-05-25
Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.
Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.
Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier
2009-03-23
Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.
Transcriptome landscape of a bacterial pathogen under plant immunity.
Nobori, Tatsuya; Velásquez, André C; Wu, Jingni; Kvitko, Brian H; Kremer, James M; Wang, Yiming; He, Sheng Yang; Tsuda, Kenichi
2018-03-27
Plant pathogens can cause serious diseases that impact global agriculture. The plant innate immunity, when fully activated, can halt pathogen growth in plants. Despite extensive studies into the molecular and genetic bases of plant immunity against pathogens, the influence of plant immunity in global pathogen metabolism to restrict pathogen growth is poorly understood. Here, we developed RNA sequencing pipelines for analyzing bacterial transcriptomes in planta and determined high-resolution transcriptome patterns of the foliar bacterial pathogen Pseudomonas syringae in Arabidopsis thaliana with a total of 27 combinations of plant immunity mutants and bacterial strains. Bacterial transcriptomes were analyzed at 6 h post infection to capture early effects of plant immunity on bacterial processes and to avoid secondary effects caused by different bacterial population densities in planta We identified specific "immune-responsive" bacterial genes and processes, including those that are activated in susceptible plants and suppressed by plant immune activation. Expression patterns of immune-responsive bacterial genes at the early time point were tightly linked to later bacterial growth levels in different host genotypes. Moreover, we found that a bacterial iron acquisition pathway is commonly suppressed by multiple plant immune-signaling pathways. Overexpression of a P. syringae sigma factor gene involved in iron regulation and other processes partially countered bacterial growth restriction during the plant immune response triggered by AvrRpt2. Collectively, this study defines the effects of plant immunity on the transcriptome of a bacterial pathogen and sheds light on the enigmatic mechanisms of bacterial growth inhibition during the plant immune response.
Universal immunity to influenza must outwit immune evasion
Quiñones-Parra, Sergio; Loh, Liyen; Brown, Lorena E.; Kedzierska, Katherine; Valkenburg, Sophie A.
2014-01-01
Although an influenza vaccine has been available for 70 years, influenza virus still causes seasonal epidemics and worldwide pandemics. Currently available vaccines elicit strain-specific antibody (Ab) responses to the surface haemagglutinin (HA) and neuraminidase (NA) proteins, but these can be ineffective against serologically-distinct viral variants and novel subtypes. Thus, there is a great need for cross-protective or “universal” influenza vaccines to overcome the necessity for annual immunization against seasonal influenza and to provide immunity to reduce the severity of infection with pandemic or outbreak viruses. It is well established that natural influenza infection can provide cross-reactive immunity that can reduce the impact of infection with distinct influenza type A strains and subtypes, including H1N1, H3N2, H2N2, H5N1, and H7N9. The key to generating universal influenza immunity through vaccination is to target functionally-conserved regions of the virus, which include epitopes on the internal proteins for cross-reactive T cell immunity or on the HA stem for broadly reactive Ab responses. In the wake of the 2009 H1N1 pandemic, broadly neutralizing antibodies (bnAbs) have been characterized and isolated from convalescent and vaccinated individuals, inspiring development of new vaccination techniques to elicit such responses. Induction of influenza-specific T cell responses through vaccination has also been recently examined in clinical trials. Strong evidence is available from human and animal models of influenza to show that established influenza-specific T cell memory can reduce viral shedding and symptom severity. However, the published evidence also shows that CD8+ T cells can efficiently select immune escape mutants early after influenza virus infection. Here, we discuss universal immunity to influenza viruses mediated by both cross-reactive T cells and Abs, the mechanisms of immune evasion in influenza, and propose how to counteract
Interplay of parasite-driven immune responses and autoimmunity.
Zaccone, Paola; Burton, Oliver T; Cooke, Anne
2008-01-01
As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.
Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W
2012-01-01
Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, p<0.0001). The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.
Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis
2007-03-07
The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.
Griot, Christian; Moser, Christian; Cherpillod, Pascal; Bruckner, Lukas; Wittek, Riccardo; Zurbriggen, Andreas; Zurbriggen, Rinaldo
2004-01-26
Canine distemper (CD) is a disease in carnivores caused by CD virus (CDV), a member of the morbillivirus genus. It still is a threat to the carnivore and ferret population. The currently used modified attenuated live vaccines have several drawbacks of which lack of appropriate protection from severe infection is the most outstanding one. In addition, puppies up to the age of 6-8 weeks cannot be immunized efficiently due to the presence of maternal antibodies. In this study, a DNA prime modified live vaccine boost strategy was investigated in puppies in order to determine if vaccinated neonatal dogs induce a neutralizing immune response which is supposed to protect animals from a CDV challenge. Furthermore, a single DNA vaccination of puppies, 14 days after birth and in the presence of high titers of CDV neutralizing maternal antibodies, induced a clear and significant priming effect observed as early as 3 days after the subsequent booster with a conventional CDV vaccine. It was shown that the priming effect develops faster and to higher titers in puppies preimmunized with DNA 14 days after birth than in those vaccinated 28 days after birth. Our results demonstrate that despite the presence of maternal antibodies puppies can be vaccinated using the CDV DNA vaccine, and that this vaccination has a clear priming effect leading to a solid immune response after a booster with a conventional CDV vaccine.
Anti-tumor immune response after photodynamic therapy
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.
2009-06-01
Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp
Dooley, Helen; Flajnik, Martin F
2005-03-01
The cartilaginous fish are the oldest phylogenetic group in which all of the molecular components of the adaptive immune system have been found. Although early studies clearly showed that sharks could produce an IgM-based response following immunization, evidence for memory, affinity maturation and roles for the other isotypes (notably IgNAR) in this group remained inconclusive. The data presented here illustrate that the nurse shark (Ginglymostoma cirratum) is able to produce not only an IgM response, but we also show for the first time a highly antigen-specific IgNAR response. Additionally, under appropriate conditions, a memory response for both isotypes can be elicited. Analysis of the response shows differential expression of pentameric and monomeric IgM. Pentameric IgM provides the 'first line of defense' through high-avidity, low-affinity interaction with antigen. In contrast, monomeric IgM and IgNAR seem responsible for the specific, antigen-driven response. We propose the presence of distinct lineages of B cells in sharks. As there is no conventional isotype switching, each lineage seems pre-determined to express a single isotype (IgM versus IgNAR). However, our data suggest that there may also be specific lineages for the different forms (pentameric versus monomeric) of the IgM isotype.
Radiation-induced immune responses: mechanisms and therapeutic perspectives.
Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One
2016-09-01
Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.
Alam, Shahabuddin; Amemiya, Kei; Bernhards, Robert C; Ulrich, Robert G; Waag, David M; Saikh, Kamal U
2015-01-01
Burkholderia pseudomallei infection causes melioidosis and is often characterized by severe sepsis. Although rare in humans, Burkholderia mallei has caused infections in laboratory workers, and the early innate cellular response to B. mallei in human and nonhuman primates has not been characterized. In this study, we examined the primary cellular immune response to B. mallei in PBMC cultures of non-human primates (NHPs), Chlorocebus aethiops (African Green Monkeys), Macaca fascicularis (Cynomolgus macaque), and Macaca mulatta (Rhesus macaque) and humans. Our results demonstrated that B. mallei elicited strong primary pro-inflammatory cytokines (IFN-γ, TNF-α, IL-1β, and IL-6) equivalent to the levels of B. pseudomallei in primary PBMC cultures of NHPs and humans. When we examined IL-1β and other cytokine responses by comparison to Escherichia coli LPS, African Green Monkeys appears to be most responsive to B. mallei than Cynomolgus or Rhesus. Characterization of the immune signaling mechanism for cellular response was conducted by using a ligand induced cell-based reporter assay, and our results demonstrated that MyD88 mediated signaling contributed to the B. mallei and B. pseudomallei induced pro-inflammatory responses. Notably, the induced reporter activity with B. mallei, B. pseudomallei, or purified LPS from these pathogens was inhibited and cytokine production was attenuated by a MyD88 inhibitor. Together, these results show that in the scenario of severe hyper-inflammatory responses to B. mallei infection, MyD88 targeted therapeutic intervention may be a successful strategy for therapy. Published by Elsevier Ltd.
The role of dehydroepiandrosterone on functional innate immune responses to acute stress.
Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P
2017-12-01
The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.
Opal, Steven M; Esmon, Charles T
2003-01-01
The innate immune response system is designed to alert the host rapidly to the presence of an invasive microbial pathogen that has breached the integument of multicellular eukaryotic organisms. Microbial invasion poses an immediate threat to survival, and a vigorous defense response ensues in an effort to clear the pathogen from the internal milieu of the host. The innate immune system is able to eradicate many microbial pathogens directly, or innate immunity may indirectly facilitate the removal of pathogens by activation of specific elements of the adaptive immune response (cell-mediated and humoral immunity by T cells and B cells). The coagulation system has traditionally been viewed as an entirely separate system that has arisen to prevent or limit loss of blood volume and blood components following mechanical injury to the circulatory system. It is becoming increasingly clear that coagulation and innate immunity have coevolved from a common ancestral substrate early in eukaryotic development, and that these systems continue to function as a highly integrated unit for survival defense following tissue injury. The mechanisms by which these highly complex and coregulated defense strategies are linked together are the focus of the present review. PMID:12617738
RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes
Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.
2011-01-01
Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430
Meehan, Crystal; Harms, Lauren; Frost, Jade D; Barreto, Rafael; Todd, Juanita; Schall, Ulrich; Shannon Weickert, Cynthia; Zavitsanou, Katerina; Michie, Patricia T; Hodgson, Deborah M
2017-07-01
Maternal exposure to infectious agents during gestation has been identified as a significant risk factor for schizophrenia. Using a mouse model, past work has demonstrated that the gestational timing of the immune-activating event can impact the behavioural phenotype and expression of dopaminergic and glutamatergic neurotransmission markers in the offspring. In order to determine the inter-species generality of this effect to rats, another commonly used model species, the current study investigated the impact of a viral mimetic Poly (I:C) at either an early (gestational day 10) or late (gestational day 19) time-point on schizophrenia-related behaviour and neurotransmitter receptor expression in rat offspring. Exposure to Poly (I:C) in late, but not early, gestation resulted in transient impairments in working memory. In addition, male rats exposed to maternal immune activation (MIA) in either early or late gestation exhibited sensorimotor gating deficits. Conversely, neither early nor late MIA exposure altered locomotor responses to MK-801 or amphetamine. In addition, increased dopamine 1 receptor mRNA levels were found in the nucleus accumbens of male rats exposed to early gestational MIA. The findings from this study diverge somewhat from previous findings in mice with MIA exposure, which were often found to exhibit a more comprehensive spectrum of schizophrenia-like phenotypes in both males and females, indicating potential differences in the neurodevelopmental vulnerability to MIA exposure in the rat with regards to schizophrenia related changes. Copyright © 2016. Published by Elsevier Inc.
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response
Zhong, Hong; Ma, Minjuan
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304
Subbiah, Vivek; Chuang, Hubert H; Gambhire, Dhiraj; Kairemo, Kalevi
2017-02-15
In this era of precision oncology, there has been an exponential growth in the armamentarium of genomically targeted therapies and immunotherapies. Evaluating early responses to precision therapy is essential for "go" versus "no go" decisions for these molecularly targeted drugs and agents that arm the immune system. Many different response assessment criteria exist for use in solid tumors and lymphomas. We reviewed the literature using the Medline/PubMed database for keywords "response assessment" and various known response assessment criteria published up to 2016. In this article we review the commonly used response assessment criteria. We present a decision tree to facilitate selection of appropriate criteria. We also suggest methods for standardization of various response assessment criteria. The relevant response assessment criteria were further studied for rational of development, key features, proposed use and acceptance by various entities. We also discuss early response evaluation and provide specific case studies of early response to targeted therapy. With high-throughput, advanced computing programs and digital data-mining it is now possible to acquire vast amount of high quality imaging data opening up a new field of "omics in radiology"-radiomics that complements genomics for personalized medicine. Radiomics is rapidly evolving and is still in the research arena. This cutting-edge technology is poised to move soon to the mainstream clinical arena. Novel agents with new mechanisms of action require advanced molecular imaging as imaging biomarkers. There is an urgent need for development of standardized early response assessment criteria for evaluation of response to precision therapy.
Role of muscarinic receptors in the regulation of immune and inflammatory responses
Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.
2008-01-01
Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972
A comparative study of an innate immune response in Lamprologine cichlid fishes.
O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
A comparative study of an innate immune response in Lamprologine cichlid fishes
NASA Astrophysics Data System (ADS)
O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
Limmer, Stefanie; Haller, Samantha; Drenkard, Eliana; Lee, Janice; Yu, Shen; Kocks, Christine; Ausubel, Frederick M.; Ferrandon, Dominique
2011-01-01
An in-depth mechanistic understanding of microbial infection necessitates a molecular dissection of host–pathogen relationships. Both Drosophila melanogaster and Pseudomonas aeruginosa have been intensively studied. Here, we analyze the infection of D. melanogaster by P. aeruginosa by using mutants in both host and pathogen. We show that orally ingested P. aeruginosa crosses the intestinal barrier and then proliferates in the hemolymph, thereby causing the infected flies to die of bacteremia. Host defenses against ingested P. aeruginosa included an immune deficiency (IMD) response in the intestinal epithelium, systemic Toll and IMD pathway responses, and a cellular immune response controlling bacteria in the hemocoel. Although the observed cellular and intestinal immune responses appeared to act throughout the course of the infection, there was a late onset of the systemic IMD and Toll responses. In this oral infection model, P. aeruginosa PA14 did not require its type III secretion system or other well-studied virulence factors such as the two-component response regulator GacA or the protease AprA for virulence. In contrast, the quorum-sensing transcription factor RhlR, but surprisingly not LasR, played a key role in counteracting the cellular immune response against PA14, possibly at an early stage when only a few bacteria are present in the hemocoel. These results illustrate the power of studying infection from the dual perspective of host and pathogen by revealing that RhlR plays a more complex role during pathogenesis than previously appreciated. PMID:21987808
Immune response to measles vaccine in Peruvian children.
Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.
2001-01-01
OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811
The host immune response to gastrointestinal nematode infection in sheep.
McRae, K M; Stear, M J; Good, B; Keane, O M
2015-12-01
Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.
[Bone marrow stromal damage mediated by immune response activity].
Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H
1994-01-01
The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.
The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)
King, Paul T.; Sharma, Roleen
2015-01-01
Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124
Plant innate immunity – sunny side up?
Stael, Simon; Kmiecik, Przemyslaw; Willems, Patrick; Van Der Kelen, Katrien; Coll, Nuria S.; Teige, Markus; Van Breusegem, Frank
2016-01-01
Reactive oxygen species (ROS)- and calcium- dependent signaling pathways play well-established roles during plant innate immunity. Chloroplasts host major biosynthetic pathways and have central roles in energy production, redox homeostasis, and retrograde signaling. However, the organelle’s importance in immunity has been somehow overlooked. Recent findings suggest that the chloroplast also has an unanticipated function as a hub for ROS- and calcium-signaling that affects immunity responses at an early stage after pathogen attack. In this opinion article, we discuss a chloroplastic calcium-ROS signaling branch of plant innate immunity. We propose that this chloroplastic branch acts as a light-dependent rheostat that, through the production of ROS, influences the severity of the immune response. PMID:25457110
Auto-immune hepatitis following delivery.
Saini, Vandana; Gupta, Mamta; Mishra, S K
2013-05-01
Auto-immune hepatitis first presenting in the early postpartum period is rare. Immunosuppressive effects of pregnancy result in delayed manifestation of auto-immune hepatitis, and in established cases, the spontaneous improvements are there. Auto-immune hepatitis should be considered in the differential diagnosis of liver dysfunction first presenting in the early postpartum period. A case of postpartum hepatitis of auto-immune aetiology is being presented here. It is disease of unknown aetiology, characterised by inflammation of liver (as evidenced by raised serum transaminases, presence of interface hepatitis on histological examination), hypergammaglobulinaemia (> 1.5 times normal), presence of auto-antibodies [(antinuclear antibodies (ANA)], smooth muscle antibody (SMA) and antibody to liver-kidney microsome type 1 (LKM1) in the absence of viral markers ie, hepatitis B (HBsAg) and C (AntiHCV) and excellent response to corticosteroid therapy.
Radiation induces an antitumour immune response to mouse melanoma.
Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling
2009-12-01
Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.
Adjuvant effects of saponins on animal immune responses*
Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.
2007-01-01
Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426
Ubiquitin enzymes in the regulation of immune responses.
Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo
2017-08-01
Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.
Immune responses to HTLV-I(ACH) during acute infection of pig-tailed macaques.
McGinn, Therese M; Wei, Qing; Stallworth, Jackie; Fultz, Patricia N
2004-04-01
Human T cell lymphotropic virus type 1 (HTLV-I) is causally linked to adult T cell leukemia/lymphoma (ATL) and a chronic progressive neurological disease, HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP). A nonhuman primate model that reproduces disease symptoms seen in HTLV-I-infected humans might facilitate identification of initial immune responses to the virus and an understanding of pathogenic mechanisms in HTLV-I-related disease. Previously, we showed that infection of pig-tailed macaques with HTLV-I(ACH) is associated with multiple signs of disease characteristic of both HAM/TSP and ATL. We report here that within the first few weeks after HTLV-I(ACH) infection of pig-tailed macaques, serum concentrations of interferon (IFN)-alpha increased and interleukin-12 decreased transiently, levels of nitric oxide were elevated, and activation of CD4(+) and CD8(+) lymphocytes and CD16(+) natural killer cells in peripheral blood were observed. HTLV-I(ACH) infection elicited virus-specific antibodies in all four animals within 4 to 6 weeks; however, Tax-specific lymphoproliferative responses were not detected until 25-29 weeks after infection in all four macaques. IFN-gamma production by peripheral blood cells stimulated with a Tax or Gag peptide was detected to varying degrees in all four animals by ELISPOT assay. Peripheral blood lymphocytes from one animal that developed only a marginal antigen-specific cellular response were unresponsive to mitogen stimulation during the last few weeks preceding its death from a rapidly progressive disease syndrome associated with HTLV-I(ACH) infection of pig-tailed macaques. The results show that during the first few months after HTLV-I(ACH) infection, activation of both innate and adaptive immunity, limited virus-specific cellular responses, sustained immune system activation, and, in some cases, immunodeficiency were evident. Thus, this animal model might be valuable for understanding early stages of infection
Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response
Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.
2016-01-01
Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses
Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.
Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.
Fooks, A R; Jeevarajah, D; Lee, J; Warnes, A; Niewiesk, S; ter Meulen, V; Stephenson, J R; Clegg, J C
1998-05-01
The genes encoding the measles virus (MV) haemagglutinin (H) and fusion (F) proteins were placed under the control of the human cytomegalovirus immediate early promoter in a replication-deficient adenovirus vector. Immunofluorescence and radioimmune precipitation demonstrated the synthesis of each protein and biological activity was confirmed by the detection of haemadsorption and fusion activities in infected cells. Oral as well as parenteral administration of the H-expressing recombinant adenovirus elicited a significant protective response in mice challenged with MV. While the F-expressing adenovirus failed to protect mice, cotton rats immunized with either the H- or F-expressing recombinant showed reduced MV replication in the lungs. Antibodies elicited in mice following immunization with either recombinant had no in vitro neutralizing activity, suggesting a protective mechanism involving a cell-mediated immune response. This study demonstrates the feasibility of using oral administration of adenovirus recombinants to induce protective responses to heterologous proteins.
Tobin, Erin T.; Kane, Heidi S.; Saleh, Daniel J.; Wildman, Derek E.; Breen, Elizabeth Crabb; Secord, Elizabeth; Slatcher, Richard B.
2015-01-01
Objective Stressful family environments early in life have negative effects on physical health. However, less is known about the health effects of positive aspects of families. We examined the associations between maternal responsiveness and immune markers among youth with asthma and identified youth expressions of positive affect as a potential mechanism of these associations. Methods Forty-three youths with asthma (26 males; aged 10-17) wore the Electronically Activated Recorder (EAR) for four days to assess maternal responsiveness and youth expressions of affect from audio-recordings of daily life. Trained coders rated EAR sound files for expressions of maternal responsiveness and affect displayed by the youth. Peripheral blood mononuclear cells were isolated, cultured, and assayed to determine stimulated levels of interleukin(IL)-5, IL-13, and interferon(IFN)- γ. Results Greater maternal responsiveness was associated with decreased stimulated production of IL-5 (r = −.38, p = .012) and IL-13 (r = −.33, p = .031). Greater total positive affect in youth was linked with decreased stimulated production of IL-5 (r = −.46, p = .002) and IL-13 (r = −.37, p = .014). Total negative affect among youth was unrelated to immune responses. There was a significant indirect effect of maternal responsiveness via positive affect in youth on lower levels of IL-5 (95% CI = −3.41, −.03) and IL-13 (95% CI = −2.34, −.01) when adjusting for caregiver-youth conflict and negative affect among youth. Conclusions These results indicate the importance of positive family interactions for youth and provide preliminary evidence for a mechanism through which parenting can influence immune responses in youths with asthma. PMID:26407226
Tobin, Erin T; Kane, Heidi S; Saleh, Daniel J; Wildman, Derek E; Breen, Elizabeth Crabb; Secord, Elizabeth; Slatcher, Richard B
2015-10-01
Stressful family environments early in life have negative effects on physical health. However, less is known about the health effects of positive aspects of families. We examined the associations between maternal responsiveness and immune markers among youth with asthma and identified youth expressions of positive affect as a potential mechanism of these associations. Forty-three youths with asthma (26 boys; aged 10-17 years) wore the Electronically Activated Recorder for 4 days to assess maternal responsiveness and youth expressions of affect from audio-recordings of daily life. Trained coders rated Electronically Activated Recorder sound files for expressions of maternal responsiveness and affect displayed by the youth. Peripheral blood mononuclear cells were isolated, cultured, and assayed to determine stimulated levels of interleukin (IL)-5, IL-13, and interferon-γ. Greater maternal responsiveness was associated with decreased stimulated production of IL-5 (r = -0.38, p = .012) and IL-13 (r = -0.33, p = .031). Greater total positive affect in youth was linked to decreased stimulated production of IL-5 (r = -0.46, p = .002) and IL-13 (r = -0.37, p = .014). Total negative affect among youth was unrelated to immune responses. There was a significant indirect effect of maternal responsiveness via positive affect in youth on lower levels of IL-5 (95% confidence interval = -3.41 to -0.03) and IL-13 (95% confidence interval = -2.34 to -0.01) when adjusting for caregiver-youth conflict and negative affect among youth. These results indicate the importance of positive family interactions for youth and provide preliminary evidence for a mechanism through which parenting can influence immune responses in youth with asthma.
Mycobacterium tuberculosis manipulates pulmonary APCs subverting early immune responses.
Garcia-Romo, Gina S; Pedroza-Gonzalez, Alexander; Lambrecht, Bart N; Aguilar-Leon, Diana; Estrada-Garcia, Iris; Hernandez-Pando, Rogelio; Flores-Romo, Leopoldo
2013-03-01
Alveolar macrophages (AM) and dendritic cells (DCs) are the main antigen presenting cells (APCs) in the respiratory tract. Whereas macrophages have been extensively studied in tuberculosis, in situ interactions of DC with Mycobacterium tuberculosis (Mtb) are poorly explored. We aimed to characterize lung APCs during pulmonary tuberculosis in Balb/C mice infected with Mtb H37Rv. Mtb-infection via the airways induced a delayed and continuous accumulation of DCs and AM in the lungs. While lung DCs increased after day 3 post-infection, macrophages increased after 2-3 weeks. Although both populations accumulated in lungs during the infection, DCs decreased in the late stages. Infection induced differential expression of co-stimulatory molecules in these lung APCs, decreasing to basal levels in both APCs in the late stages. A remarkable segregation was found regarding bacillary burden. Many macrophages contained numerous bacilli, but DC contained scarce mycobacteria or none. Mtb-infection also induced delayed accumulation of DC in draining lymph nodes. This delayed recruitment was not associated with a lack of IL-12p40, which was detected from day 3 post-infection. Although AM and lung DCs behave differently during pulmonary tuberculosis, Mtb apparently manipulates both lung APCs subverting early protective responses resulting in disease progression. Copyright © 2012 Elsevier GmbH. All rights reserved.
Sex-specific consequences of an induced immune response on reproduction in a moth.
Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T
2015-12-16
Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.
Seifi, Kazem; Karimi Torshizi, Mohammad Amir; Rahimi, Shaban; Kazemifard, Mohammad
2017-07-01
The aim of the present study was to investigate the efficacy of early probiotics (single dose) administered in different ways, on quails' performance, small intestine morphology, blood biochemistry, and immune response. In total, 192 day-old chicks were used in one of the following experimental groups before being transferred to a raising room: 1) Control (no probiotic administered), 2) oral gavage, 3) spray, and 4) vent lip. Four replicates of 12 chicks per cage were considered for each treatment and birds were raised up to 35 d in the same conditions. Probiotic treated birds had higher d 1 to 35 feed intake than the control group (P < 0.05). In addition, oral-gavaged birds had a higher body weight gain as compared to the control (P < 0.05). The values of duodenum length and villus height of the oral group and ileum length and villus height of the vent lip group were greater than that of the control (P < 0.01). Regardless of the method of administration, probiotics resulted in deeper crypts and in a higher number of goblet cells in the duodenum and ileum as compared to the control (P < 0.01). The administration of probiotics resulted in increased plasma uric acid (P < 0.05), glucose, and total protein (P < 0.01). The concentration of hemoglobin was slightly higher in probiotic-supplemented groups. While a decreased concentration of triglyceride was observed in vent-lip probiotic-administered birds compared to control (P < 0.05), the concentration of cholesterol was not significantly affected by treatments (P > 0.01). None of the immune-related parameters were affected by the probiotic (P > 0.05). Single dose usage of probiotics exerts its beneficial effects on quails' body weight gain, feed intake and mortality in 1 to 35 d period, regardless of the route of administration. This work generally supports the efficacy of single-dose usage of probiotics and suggests the spray of probiotics as an early, single-dose administration method. © 2017
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
Kadara, H; Choi, M; Zhang, J; Parra, E R; Rodriguez-Canales, J; Gaffney, S G; Zhao, Z; Behrens, C; Fujimoto, J; Chow, C; Yoo, Y; Kalhor, N; Moran, C; Rimm, D; Swisher, S; Gibbons, D L; Heymach, J; Kaftan, E; Townsend, J P; Lynch, T J; Schlessinger, J; Lee, J; Lifton, R P; Wistuba, I I; Herbst, R S
2017-01-01
Abstract Background Lung adenocarcinomas (LUADs) lead to the majority of deaths attributable to lung cancer. We performed whole-exome sequencing (WES) and immune profiling analyses of a unique set of clinically annotated early-stage LUADs to better understand the pathogenesis of this disease and identify clinically relevant molecular markers. Methods We performed WES of 108 paired stage I-III LUADs and normal lung tissues using the Illumina HiSeq 2000 platform. Ten immune markers (PD-L1, PD-1, CD3, CD4, CD8, CD45ro, CD57, CD68, FOXP3 and Granzyme B) were profiled by imaging-based immunohistochemistry (IHC) in a subset of LUADs (n = 92). Associations among mutations, immune markers and clinicopathological variables were analyzed using ANOVA and Fisher’s exact test. Cox proportional hazards regression models were used for multivariate analysis of clinical outcome. Results LUADs in this cohort exhibited an average of 243 coding mutations. We identified 28 genes with significant enrichment for mutation. SETD2-mutated LUADs exhibited relatively poor recurrence- free survival (RFS) and mutations in STK11 and ATM were associated with poor RFS among KRAS-mutant tumors. EGFR, KEAP1 and PIK3CA mutations were predictive of poor response to adjuvant therapy. Immune marker analysis revealed that LUADs in smokers and with relatively high mutation burdens exhibited increased levels of immune markers. Analysis of immunophenotypes revealed that LUADs with STK11 mutations exhibited relatively low levels of infiltrating CD4+/CD8+ T-cells indicative of a muted immune response. Tumoral PD-L1 was significantly elevated in TP53 mutant LUADs whereas PIK3CA mutant LUADs exhibited markedly down-regulated PD-L1 expression. LUADs with TP53 or KEAP1 mutations displayed relatively increased CD57 and Granzyme B levels indicative of augmented natural killer (NK) cell infiltration. Conclusion(s) Our study highlights molecular and immune phenotypes that warrant further analysis for their
Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit
2016-01-01
Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances.
Weckbach, Sebastian; Perl, Mario; Heiland, Tim; Braumüller, Sonja; Stahel, Philip F.; Flierl, Michael A.; Ignatius, Anita; Gebhard, Florian; Huber-Lang, Markus
2012-01-01
Background. The molecular mechanisms of the immune response after polytrauma are highly complex and far from fully understood. In this paper, we characterize a new standardized polytrauma model in rats based on the early molecular inflammatory and apoptotic response. Methods. Male Wistar rats (250 g, 6–10/group) were anesthetized and exposed to chest trauma (ChT), closed head injury (CHI), or Tib/Fib fracture including a soft tissue trauma (Fx + STT) or to the following combination of injuries: (1) ChT; (2) ChT + Fx + STT; (3) ChT + CHI; (4) CHI; (5) polytrauma (PT = ChT + CHI + Fx + STT). Sham-operated rats served as negative controls. The inflammatory response was quantified at 2 hours and 4 hours after trauma by analysis of “key” inflammatory mediators, including selected cytokines and complement components, in serum and bronchoalveolar (BAL) fluid samples. Results. Polytraumatized (PT) rats showed a significant systemic and intrapulmonary release of cytokines, chemokines, and complement anaphylatoxins, compared to rats with isolated injuries or selected combinations of injuries. Conclusion. This new rat model appears to closely mimic the early immunological response of polytrauma observed in humans and may provide a valid basis for evaluation of the complex pathophysiology and future therapeutic immune modulatory approaches in experimental polytrauma. PMID:22481866
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-01-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-03-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.
Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.
Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon
2018-01-01
Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.
Prescott, Susan L
2016-01-01
Early-life nutritional exposures are significant determinants of the development and future health of all organ systems. The dramatic rise in infant immune diseases, most notably allergy, indicates the specific vulnerability of the immune system to early environmental changes. Dietary changes are at the center of the emerging epigenetic paradigms that underpin the rise in many modern inflammatory and metabolic diseases. There is growing evidence that exposures in pregnancy and the early postnatal period can modify gene expression and disease susceptibility. Although modern dietary changes are complex and involve changing patterns of many nutrients, there is also interest in the developmental effects of specific nutrients. Oligosaccharides (soluble fiber), antioxidants, polyunsaturated fatty acids, folate and other vitamins have documented effects on immune function as well as metabolism. Some have also been implicated in modified risk of allergic diseases in observational studies. Intervention studies are largely limited to trials with polyunsaturated fatty acids and oligosaccharides, showing preliminary but yet unconfirmed benefits in allergy prevention. Understanding how environmental influences disrupt the finely balanced development of immune and metabolic programming is of critical importance. Diet-sensitive pathways are likely to be crucial in these processes. While an epigenetic mechanism provides a strong explanation of how nutritional exposures can affect fetal gene expression and subsequent disease risk, other diet-induced tissue compositional changes may also contribute directly to altered immune and metabolic function--including diet-induced changes in the microbiome. A better understanding of nutritional programming of immune health, nutritional epigenetics and the biological processes sensitive to nutritional exposures early in life may lead to dietary strategies that provide more tolerogenic conditions during early immune programming and reduce the
A cognitive computational model inspired by the immune system response.
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.
Vallejo, Alejandro; Monge-Maillo, Begoña; Gutiérrez, Carolina; Norman, Francesca F; López-Vélez, Rogelio; Pérez-Molina, José A
2016-12-01
Symptomatic chronic Chagas disease affects up to 40% of patients infected with Trypanosoma cruzi. The lack of reliable early markers of cure after therapy hinders disease management and clinical trials with new drugs. We performed a study with 18 months of follow-up to compare changes in immune parameters and T. cruzi-specific immune responses as surrogate markers of response to therapy between patients treated with benznidazole and untreated patients. This was a pilot, open-label, randomised clinical trial of treatment with benznidazole versus no treatment in patients with indeterminate chronic T. cruzi infection. In both groups we investigated changes in T-cell activation, T-cell subpopulations, regulatory T-cell counts, IL6, and sCD14 levels, and T. cruzi-specific immune responses (Th1, Th2, and Th17 responses). Fourteen patients were included in the study (seven in each group). Median age was 35 years (P 25-75 31-43), 57% were female, and 93% were Bolivian. Benznidazole was administered at 5mg/kg/day for 60days. Three patients discontinued benznidazole owing to adverse reactions and were not evaluated. At the end of the follow-up period, treated patients showed significantly less immune activation and lower regulatory T-cell counts, with an increased Th17 and Th1 response. This randomised pilot clinical trial administering benznidazole to patients with indeterminate chronic Chagas disease brings about changes in the adaptive immunity, leading to a general decrease in inflammatory status. This apparently beneficial response could act as the basis for monitoring new antiparasitic drugs. Copyright © 2016 Elsevier B.V. All rights reserved.
Marchandeau, Stéphane; Pontier, Dominique; Guitton, Jean-Sébastien; Letty, Jérôme; Fouchet, David; Aubineau, Jacky; Berger, Francis; Léonard, Yves; Roobrouck, Alain; Gelfi, Jacqueline; Peralta, Brigitte; Bertagnoli, Stéphane
2014-03-04
The role of maternal antibodies is to protect newborns against acute early infection by pathogens. This can be achieved either by preventing any infection or by allowing attenuated infections associated with activation of the immune system, the two strategies being based on different cost/benefit ratios. We carried out an epidemiological survey of myxomatosis, which is a highly lethal infectious disease, in two distant wild populations of rabbits to describe the epidemiological pattern of the disease. Detection of specific IgM and IgG enabled us to describe the pattern of immunity. We show that maternal immunity attenuates early infection of juveniles and enables activation of their immune system. This mechanism associated with steady circulation of the myxoma virus in both populations, which induces frequent reinfections of immune rabbits, leads to the maintenance of high immunity levels within populations. Thus, myxomatosis has a low impact, with most infections being asymptomatic. This work shows that infection of young rabbits protected by maternal antibodies induces attenuated disease and activates their immune system. This may play a major role in reducing the impact of a highly lethal disease when ecological conditions enable permanent circulation of the pathogen.
2014-01-01
The role of maternal antibodies is to protect newborns against acute early infection by pathogens. This can be achieved either by preventing any infection or by allowing attenuated infections associated with activation of the immune system, the two strategies being based on different cost/benefit ratios. We carried out an epidemiological survey of myxomatosis, which is a highly lethal infectious disease, in two distant wild populations of rabbits to describe the epidemiological pattern of the disease. Detection of specific IgM and IgG enabled us to describe the pattern of immunity. We show that maternal immunity attenuates early infection of juveniles and enables activation of their immune system. This mechanism associated with steady circulation of the myxoma virus in both populations, which induces frequent reinfections of immune rabbits, leads to the maintenance of high immunity levels within populations. Thus, myxomatosis has a low impact, with most infections being asymptomatic. This work shows that infection of young rabbits protected by maternal antibodies induces attenuated disease and activates their immune system. This may play a major role in reducing the impact of a highly lethal disease when ecological conditions enable permanent circulation of the pathogen. PMID:24589193
Gupta, Nancy; Kumar, Rakesh; Agrawal, Babita
2018-01-01
Tuberculosis (TB) is a highly contagious infection and devastating chronic disease, causing 10.4 million new infections and 1.8 million deaths every year globally. Efforts to control and eradicate TB are hampered by the rapid emergence of drug resistance and limited efficacy of the only available vaccine, BCG. Immunological events in the airways and lungs are of major importance in determining whether exposure to Mycobacterium tuberculosis (Mtb) results in successful infection or protective immunity. Several studies have demonstrated that the host microbiota is in constant contact with the immune system, and thus continually directs the nature of immune responses occurring during new infections. However, little is known about its role in the eventual outcome of the mycobacterial infection. In this review, we highlight the changes in microbial composition in the respiratory tract and gut that have been linked to the alteration of immune responses, and to the risk, prevention, and treatment of TB. In addition, we summarize our current understanding of alveolar epithelial cells and the innate immune system, and their interaction with Mtb during early infection. Extensive studies are warranted to fully understand the all-inclusive role of the lung microbiota, its interaction with epithelium and innate immune responses and resulting adaptive immune responses, and in the pathogenesis and/or protection from Mtb infection. Novel interventions aimed at influencing the microbiota, the alveolar immune system and innate immunity will shape future strategies of prevention and treatment for TB. PMID:29692778
Gupta, Nancy; Kumar, Rakesh; Agrawal, Babita
2018-01-01
Tuberculosis (TB) is a highly contagious infection and devastating chronic disease, causing 10.4 million new infections and 1.8 million deaths every year globally. Efforts to control and eradicate TB are hampered by the rapid emergence of drug resistance and limited efficacy of the only available vaccine, BCG. Immunological events in the airways and lungs are of major importance in determining whether exposure to Mycobacterium tuberculosis ( Mtb ) results in successful infection or protective immunity. Several studies have demonstrated that the host microbiota is in constant contact with the immune system, and thus continually directs the nature of immune responses occurring during new infections. However, little is known about its role in the eventual outcome of the mycobacterial infection. In this review, we highlight the changes in microbial composition in the respiratory tract and gut that have been linked to the alteration of immune responses, and to the risk, prevention, and treatment of TB. In addition, we summarize our current understanding of alveolar epithelial cells and the innate immune system, and their interaction with Mtb during early infection. Extensive studies are warranted to fully understand the all-inclusive role of the lung microbiota, its interaction with epithelium and innate immune responses and resulting adaptive immune responses, and in the pathogenesis and/or protection from Mtb infection. Novel interventions aimed at influencing the microbiota, the alveolar immune system and innate immunity will shape future strategies of prevention and treatment for TB.
Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery
NASA Astrophysics Data System (ADS)
Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole
2015-12-01
Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized
Dietary astaxanthin enhances immune response in dogs.
Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon
2011-04-15
No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.
Effect of nanovaccine chemistry on humoral immune response kinetics and maturation
NASA Astrophysics Data System (ADS)
Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji
2014-10-01
Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry
Phenytoin promotes Th2 type immune response in mice
Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U
2001-01-01
The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401
Ubiquitin enzymes in the regulation of immune responses
Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo
2017-01-01
Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749
IL-2 infusion abrogates humoral immune responses in humans.
Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K
1992-01-01
Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235
[Immune response to live influenza vaccine].
Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G
2002-01-01
Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.
Early-life experience affects honey bee aggression and resilience to immune challenge
Rittschof, Clare C.; Coombs, Chelsey B.; Frazier, Maryann; Grozinger, Christina M.; Robinson, Gene E.
2015-01-01
Early-life social experiences cause lasting changes in behavior and health for a variety of animals including humans, but it is not well understood how social information ‘‘gets under the skin’’ resulting in these effects. Adult honey bees (Apis mellifera) exhibit socially coordinated collective nest defense, providing a model for social modulation of aggressive behavior. Here we report for the first time that a honey bee’s early-life social environment has lasting effects on individual aggression: bees that experienced high-aggression environments during pre-adult stages showed increased aggression when they reached adulthood relative to siblings that experienced low-aggression environments, even though all bees were kept in a common environment during adulthood. Unlike other animals including humans however, high-aggression honey bees were more, rather than less, resilient to immune challenge, assessed as neonicotinoid pesticide susceptibility. Moreover, aggression was negatively correlated with ectoparasitic mite presence. In honey bees, early-life social experience has broad effects, but increased aggression is decoupled from negative health outcomes. Because honey bees and humans share aspects of their physiological response to aggressive social encounters, our findings represent a step towards identifying ways to improve individual resiliency. Pre-adult social experience may be crucial to the health of the ecologically threatened honey bee. PMID:26493190
Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids
Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe
2016-01-01
The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406
Evasion of Host Immune Defenses by Human Papillomavirus
Westrich, Joseph A.; Warren, Cody J.; Pyeon, Dohun
2016-01-01
A majority of human papillomavirus (HPV) infections are asymptomatic and self-resolving in the absence of medical interventions. Various innate and adaptive immune responses, as well as physical barriers, have been implicated in controlling early HPV infections. However, if HPV overcomes these host immune defenses and establishes persistence in basal keratinocytes, it becomes very difficult for the host to eliminate the infection. The HPV oncoproteins E5, E6, and E7 are important in regulating host immune responses. These oncoproteins dysregulate gene expression, protein-protein interactions, posttranslational modifications, and cellular trafficking of critical host immune modulators. In addition to the HPV oncoproteins, sequence variation and dinucleotide depletion in papillomavirus genomes has been suggested as an alternative strategy for evasion of host immune defenses. Since anti-HPV host immune responses are also considered to be important for antitumor immunity, immune dysregulation by HPV during virus persistence may contribute to immune suppression essential for HPV-associated cancer progression. Here, we discuss cellular pathways dysregulated by HPV that allow the virus to evade various host immune defenses. PMID:27890631
Barth, Kenneth; Genco, Caroline Attardo
2016-01-01
The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456
Trowbridge, Amy M; Bowers, M Deane; Monson, Russell K
2016-12-01
Changes in the chemical composition of plant defense compounds during herbivory can impact herbivore resource allocation patterns and thereby herbivore survival, growth, and immune response against endoparasitoid infection. Few studies have investigated folivore responses to changes in plant chemistry that occur under outbreak conditions in mature conifer systems. Using data from an earlier observational field study, we carried out laboratory bioassays to test how variation in monoterpenes in piñon pine trees (Pinus edulis, Pinaceae) during an outbreak affects growth, consumption, and immune response of a specialist herbivore, the Southwestern tiger moth (Lophocampa ingens, Arctiidae). Larvae were fed on artificial diets containing four monoterpenes at concentrations that mimicked those observed in undamaged and herbivore-damaged trees in situ during an outbreak. Damaged trees contained 30% lower total monoterpene concentrations, likely reflecting volatile losses as observed in a previous field study Trowbridge et al. (Ecology 95:1591-1603, Trowbridge et al. 2014). Herbivores reared on diets mimicking terpene concentrations in the needles of damaged trees exhibited an approximately 60% increase in consumption relative to larvae reared on diets characteristic of trees without herbivore damage. Higher consumption was accompanied by a 40% increase in immune response with no change in growth rate. These observations suggest preferential resource allocation towards immunity and/or a strong genetic component that determines growth under these conditions. These outcomes, which favor the herbivore, point to: (i) a potential positive feedback mechanism that may increase L. ingens's chance of escaping parasitism during the early phases of an outbreak; and (ii) the important role of monoterpenes in mediating conifer-folivore interactions specifically for P. edulis, which has suffered large-scale drought-induced mortality events exacerbated by the presence of insects.
Immune responses to bioengineered organs
Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.
2017-01-01
Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545
Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.
Luu, L; Coombes, J L
2015-03-01
Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.
The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides
Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria
2010-01-01
The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388
Immune response in asymptomatic smokers.
Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H
2002-09-01
It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production
CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL
Zhu, Yuwen; Yao, Sheng; Chen, Lieping
2011-01-01
Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182
Neonatal Immunization: Rationale, Current State, and Future Prospects.
Whittaker, Elizabeth; Goldblatt, David; McIntyre, Peter; Levy, Ofer
2018-01-01
Infections take their greatest toll in early life necessitating robust approaches to protect the very young. Here, we review the rationale, current state, and future research directions for one such approach: neonatal immunization. Challenges to neonatal immunization include natural concern about safety as well as a distinct neonatal immune system that is generally polarized against Th1 responses to many stimuli such that some vaccines that are effective in adults are not in newborns. Nevertheless, neonatal immunization could result in high-population penetration as birth is a reliable point of healthcare contact, and offers an opportunity for early protection of the young, including preterm newborns who are deficient in maternal antibodies. Despite distinct immunity and reduced responses to some vaccines, several vaccines have proven safe and effective at birth. While some vaccines such as polysaccharide vaccines have little effectiveness at birth, hepatitis B vaccine can prime at birth and requires multiple doses to achieve protection, whereas the live-attenuated Bacille Calmette-Guérin (BCG), may offer single shot protection, potentially in part via heterologous ("non-specific") beneficial effects. Additional vaccines have been studied at birth including those directed against pertussis, pneumococcus, Haemophilus influenza type B and rotavirus providing important lessons. Current areas of research in neonatal vaccinology include characterization of early life immune ontogeny, heterogeneity in and heterologous effects of BCG vaccine formulations, applying systems biology and systems serology, in vitro platforms that model age-specific human immunity and discovery and development of novel age-specific adjuvantation systems. These approaches may inform, de-risk, and accelerate development of novel vaccines for use in early life. Key stakeholders, including the general public, should be engaged in assessing the opportunities and challenges inherent to neonatal
Neonatal Immunization: Rationale, Current State, and Future Prospects
Whittaker, Elizabeth; Goldblatt, David; McIntyre, Peter; Levy, Ofer
2018-01-01
Infections take their greatest toll in early life necessitating robust approaches to protect the very young. Here, we review the rationale, current state, and future research directions for one such approach: neonatal immunization. Challenges to neonatal immunization include natural concern about safety as well as a distinct neonatal immune system that is generally polarized against Th1 responses to many stimuli such that some vaccines that are effective in adults are not in newborns. Nevertheless, neonatal immunization could result in high-population penetration as birth is a reliable point of healthcare contact, and offers an opportunity for early protection of the young, including preterm newborns who are deficient in maternal antibodies. Despite distinct immunity and reduced responses to some vaccines, several vaccines have proven safe and effective at birth. While some vaccines such as polysaccharide vaccines have little effectiveness at birth, hepatitis B vaccine can prime at birth and requires multiple doses to achieve protection, whereas the live-attenuated Bacille Calmette–Guérin (BCG), may offer single shot protection, potentially in part via heterologous (“non-specific”) beneficial effects. Additional vaccines have been studied at birth including those directed against pertussis, pneumococcus, Haemophilus influenza type B and rotavirus providing important lessons. Current areas of research in neonatal vaccinology include characterization of early life immune ontogeny, heterogeneity in and heterologous effects of BCG vaccine formulations, applying systems biology and systems serology, in vitro platforms that model age-specific human immunity and discovery and development of novel age-specific adjuvantation systems. These approaches may inform, de-risk, and accelerate development of novel vaccines for use in early life. Key stakeholders, including the general public, should be engaged in assessing the opportunities and challenges inherent to
Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA
Mandadi, Kranthi K.; Scholthof, Karen-Beth G.
2013-01-01
Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626
Immune response and immunopathology during toxoplasmosis1
Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.
2012-01-01
Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326
Perillyl alcohol suppresses antigen-induced immune responses in the lung
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide
Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less
Mesenchymal stem cells: a double-edged sword in regulating immune responses
Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y
2012-01-01
Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969
Innate immune responses following Kawasaki disease and toxic shock syndrome
Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181
Innate immune responses following Kawasaki disease and toxic shock syndrome.
Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.
Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.
Fins, Joseph J
2015-04-01
Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.
A Cognitive Computational Model Inspired by the Immune System Response
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131
Meurens, François; Berri, Mustapha; Auray, Gael; Melo, Sandrine; Levast, Benoît; Virlogeux-Payant, Isabelle; Chevaleyre, Claire; Gerdts, Volker; Salmon, Henri
2009-01-01
Salmonella enterica subspecies enterica serovar Typhimurium, commonly called S. Typhimurium, can cause intestinal infections in humans and various animal species such as swine. To analyze the host response to Salmonella infection in the pig we used an in vivo gut loop model, which allows the analysis of multiple immune responses within the same animal. Four jejunal gut-loops were each inoculated with 3×108 cfu of S. Typhimurium in 3 one-month-old piglets and mRNA expressions of various cytokines, chemokines, transcription factors, antimicrobial peptides, toll like and chemokine receptors were assessed by quantitative real-time PCR in the Peyer’s patch and the gut wall after 24 h. Several genes such as the newly cloned CCRL1/CCX-CKR were assessed for the first time in the pig at the mRNA level. Pro-inflammatory and T-helper type-1 (Th1) cytokine mRNA were expressed at higher levels in infected compared to non-infected control loops. Similarly, some B cell activation genes, NOD2 and toll like receptor 2 and 4 transcripts were more expressed in both tissues while TLR5 mRNA was down-regulated. Interestingly, CCL25 mRNA expression as well as the mRNA expressions of its receptors CCR9 and CCRL1 were decreased both in the Peyer’s patch and gut wall suggesting a potential Salmonella strategy to reduce lymphocyte homing to the intestine. In conclusion, these results provide insight into the porcine innate mucosal immune response to infection with entero-invasive microorganisms such as S. Typhimurium. In the future, this knowledge should help in the development of improved prophylactic and therapeutic approaches against porcine intestinal S. Typhimurium infections. PMID:18922229
Birkenbihl, Rainer P.; Kracher, Barbara; Roccaro, Mario
2017-01-01
During microbial-associated molecular pattern-triggered immunity (MTI), molecules derived from microbes are perceived by cell surface receptors and upon signaling to the nucleus initiate a massive transcriptional reprogramming critical to mount an appropriate host defense response. WRKY transcription factors play an important role in regulating these transcriptional processes. Here, we determined on a genome-wide scale the flg22-induced in vivo DNA binding dynamics of three of the most prominent WRKY factors, WRKY18, WRKY40, and WRKY33. The three WRKY factors each bound to more than 1000 gene loci predominantly at W-box elements, the known WRKY binding motif. Binding occurred mainly in the 500-bp promoter regions of these genes. Many of the targeted genes are involved in signal perception and transduction not only during MTI but also upon damage-associated molecular pattern-triggered immunity, providing a mechanistic link between these functionally interconnected basal defense pathways. Among the additional targets were genes involved in the production of indolic secondary metabolites and in modulating distinct plant hormone pathways. Importantly, among the targeted genes were numerous transcription factors, encoding predominantly ethylene response factors, active during early MTI, and WRKY factors, supporting the previously hypothesized existence of a WRKY subregulatory network. Transcriptional analysis revealed that WRKY18 and WRKY40 function redundantly as negative regulators of flg22-induced genes often to prevent exaggerated defense responses. PMID:28011690
Angiotensin converting enzyme over expression in myelocytes enhances the immune response
Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.
2015-01-01
Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750
Balsat, Cédric; Blacher, Silvia; Herfs, Michael; Van de Velde, Maureen; Signolle, Nicolas; Sauthier, Philippe; Pottier, Charles; Gofflot, Stéphanie; De Cuypere, Marjolein; Delvenne, Philippe; Goffin, Frédéric; Noel, Agnès; Kridelka, Frédéric
2017-01-01
ABSTRACT The lymph node (LN) pre-metastatic niche is faintly characterized in lymphophilic human neoplasia, although LN metastasis is considered as the strongest prognostic marker of patient survival. Due to its specific dissemination through a complex bilateral pelvic lymphatic system, early cervical cancer is a relevant candidate for investigating the early nodal metastatic process. In the present study, we analyzed in-depth both the lymphatic vasculature and the immune climate of pre-metastatic sentinel LN (SLN), in 48 cases of FIGO stage IB1 cervical neoplasms. An original digital image analysis methodology was used to objectively determine whole slide densities and spatial distributions of immunostained structures. We observed a marked increase in lymphatic vessel density (LVD) and a specific capsular and subcapsular distribution in pre-metastatic SLN when compared with non-sentinel counterparts. Such features persisted in the presence of nodal metastatic colonization. The inflammatory profile attested by CD8+, Foxp3, CD20 and PD-1expression was also significantly increased in pre-metastatic SLN. Remarkably, the densities of CD20+ B cells and PD-1 expressing germinal centers were positively correlated with LVD. All together, these data strongly support the existence of a pre-metastatic dialog between the primary tumor and the first nodal relay. Both lymphatic and immune responses contribute to the elaboration of a specific pre-metastatic microenvironment in human SLN. Moreover, this work provides evidence that, in the context of early cervical cancer, a pre-metastatic lymphangiogenesis occurs within the SLN (pre-metastatic niche) and is associated with a specific humoral immune response. PMID:28344873
Colorectal cancer prevention: Immune modulation taking the stage.
Fletcher, Rochelle; Wang, Yi-Jun; Schoen, Robert E; Finn, Olivera J; Yu, Jian; Zhang, Lin
2018-04-01
Prevention or early detection is one of the most promising strategies against colorectal cancer (CRC), the second leading cause of cancer death in the US. Recent studies indicate that antitumor immunity plays a key role in CRC prevention. Accumulating evidence suggests that immunosurveillance represents a critical barrier that emerging tumor cells have to overcome in order to sustain the course of tumor development. Virtually all of the agents with cancer preventive activity have been shown to have an immune modulating effect. A number of immunoprevention studies aimed at triggering antitumor immune response against early lesions have been performed, some of which have shown promising results. Furthermore, the recent success of immune checkpoint blockade therapy reinforces the notion that cancers including CRC can be effectively intervened via immune modulation including immune normalization, and has stimulated various immune-based combination prevention studies. This review summarizes recent advances to help better harness the immune system in CRC prevention. Copyright © 2018 Elsevier B.V. All rights reserved.
Induction of the immune response suppression in mice inoculated with Candida albicans.
Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G
1986-03-01
There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).
Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.
West, A Phillip
2017-11-01
A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.
A novel subset of helper T cells promotes immune responses by secreting GM-CSF
Zhang, J; Roberts, A I; Liu, C; Ren, G; Xu, G; Zhang, L; Devadas, S; Shi, Yufang
2013-01-01
Helper T cells are crucial for maintaining proper immune responses. Yet, they have an undefined relationship with one of the most potent immune stimulatory cytokines, granulocyte macrophage-colony-stimulating factor (GM-CSF). By depleting major cytokines during the differentiation of CD4+ T cells in vitro, we derived cells that were found to produce large amounts of GM-CSF, but little of the cytokines produced by other helper T subsets. By their secretion of GM-CSF, this novel subset of helper T cells (which we have termed ThGM cells) promoted the production of cytokines by other T-cell subtypes, including type 1 helper T cell (Th1), type 2 helper T cell (Th2), type 1 cytotoxic T cell (Tc1), type 2 cytotoxic T cell (Tc2), and naive T cells, as evidenced by the fact that antibody neutralization of GM-CSF abolished this effect. ThGM cells were found to be highly prone to activation-induced cell death (AICD). Inhibitors of TRAIL or granzymes could not block AICD in ThGM cells, whereas inhibition of FasL/Fas interaction partially rescued ThGM cells from AICD. Thus, ThGM cells are a novel subpopulation of T helper cells that produce abundant GM-CSF, exhibit exquisite susceptibility to apoptosis, and therefore play a pivotal role in the regulation of the early stages of immune responses. PMID:24076588
Pattern Recognition Receptors in Innate Immunity, Host Defense, and Immunopathology
ERIC Educational Resources Information Center
Suresh, Rahul; Mosser, David M.
2013-01-01
Infection by pathogenic microbes initiates a set of complex interactions between the pathogen and the host mediated by pattern recognition receptors. Innate immune responses play direct roles in host defense during the early stages of infection, and they also exert a profound influence on the generation of the adaptive immune responses that ensue.…
Surviving Sepsis: Taming a Deadly Immune Response
... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...
Tay, Szun Szun; Wong, Yik Chun; McDonald, David M; Wood, Nicole A W; Roediger, Ben; Sierro, Frederic; Mcguffog, Claire; Alexander, Ian E; Bishop, G Alex; Gamble, Jennifer R; Weninger, Wolfgang; McCaughan, Geoffrey W; Bertolino, Patrick; Bowen, David G
2014-06-24
CD8 T-cell responses to liver-expressed antigens range from deletional tolerance to full effector differentiation resulting in overt hepatotoxicity. The reasons for these heterogeneous outcomes are not well understood. To identify factors that govern the fate of CD8 T cells activated by hepatocyte-expressed antigen, we exploited recombinant adenoassociated viral vectors that enabled us to vary potential parameters determining these outcomes in vivo. Our findings reveal a threshold of antigen expression within the liver as the dominant factor determining T-cell fate, irrespective of T-cell receptor affinity or antigen cross-presentation. Thus, when a low percentage of hepatocytes expressed cognate antigen, high-affinity T cells developed and maintained effector function, whereas, at a high percentage, they became functionally exhausted and silenced. Exhaustion was not irreversibly determined by initial activation, but was maintained by high intrahepatic antigen load during the early phase of the response; cytolytic function was restored when T cells primed under high antigen load conditions were transferred into an environment of low-level antigen expression. Our study reveals a hierarchy of factors dictating the fate of CD8 T cells during hepatic immune responses, and provides an explanation for the different immune outcomes observed in a variety of immune-mediated liver pathologic conditions.
Cherukuri, Anu; Servat, Esteban; Woo, Jennifer
2012-01-05
Currently, a robust set of immune correlates for live attenuated influenza vaccine (LAIV) efficacy in humans has not been fully elucidated. The serum hemagglutination inhibition (HAI) assay has been historically used to measure humoral immune responses to injectable inactivated influenza vaccination. However, serum antibody titers do not reliably reflect the complete mechanism of action of LAIV, which is an intranasally delivered vaccine and is expected to induce local mucosal and cellular immune responses in addition to humoral immune responses. Therefore, we designed a study to evaluate potential immune correlates of LAIV vaccination in the ferret animal model of influenza infection. Ferrets were vaccinated with increasing doses of LAIV and four weeks later challenged with a homologous wild-type (wt) H1N1 strain. Humoral immune responses measured following LAIV vaccination included HAI, serum antibodies and antibody secreting cells (ASC); and the responses were found to correlate with the dose level of LAIV administered in this model. Protection from wt virus challenge was determined by measuring inhibition of wt viral replication in nasal washes and in lung tissue. Results demonstrated that LAIV doses ≥ 5.0 log(10) Plaque Forming Units (PFU) elicited vaccine-specific IgG and IgA ASC frequencies and induced complete protection in the lungs. Further, we developed a novel model utilizing seropositive older ferrets to demonstrate that in the background of previous wt influenza infection LAIV induces a robust vaccine-specific B-cell response even in the absence of serum antibody response, a result that suggests that effector B-cell responses generated by LAIV are not inhibited by prior viral exposure. Finally, we demonstrated that LAIV elicits strain-specific memory B-cell responses that are measurable in a background of wt influenza infections. Taken together, results from these studies identified the antigen-specific ASC frequency as a useful early biomarker of
The influence of the microbiota on the immune response to transplantation
Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa
2015-01-01
Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985
Respiratory tract immune response to microbial pathogens.
Wilkie, B N
1982-11-15
Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.
Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza
Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom
2015-01-01
The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761
Selection for avian immune response: a commercial breeding company challenge.
Fulton, J E
2004-04-01
Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.
Roy, Anirban; Bauer, Stephen M; Lawrence, B Paige
2012-01-01
Bisphenol A (BPA) is used in numerous products, such as plastic bottles and food containers, from which it frequently leaches out and is consumed by humans. There is a growing public concern that BPA exposure may pose a significant threat to human health. Moreover, due to the widespread and constant nature of BPA exposure, not only adults but fetuses and neonates are also exposed to BPA. There is mounting evidence that developmental exposures to chemicals from our environment, including BPA, contribute to diseases late in life; yet, studies of how early life exposures specifically alter the immune system are limited. Herein we report an examination of how maternal exposure to a low, environmentally relevant dose of BPA affects the immune response to infection with influenza A virus. We exposed female mice during pregnancy and through lactation to the oral reference dose for BPA listed by the US Environmental Protection Agency, and comprehensively examined immune parameters directly linked to disease outcomes in adult offspring following infection with influenza A virus. We found that developmental exposure to BPA did not compromise disease-specific adaptive immunity against virus infection, or reduce the host's ability to clear the virus from the infected lung. However, maternal exposure to BPA transiently reduced the extent of infection-associated pulmonary inflammation and anti-viral gene expression in lung tissue. From these observations, we conclude that maternal exposure to BPA slightly modulates innate immunity in adult offspring, but does not impair the anti-viral adaptive immune response, which is critical for virus clearance and survival following influenza virus infection.
Giesecke, Claudia; Meyer, Tim; Durek, Pawel; Maul, Jochen; Preiß, Jan; Jacobs, Joannes F M; Thiel, Andreas; Radbruch, Andreas; Ullrich, Reiner; Dörner, Thomas
2018-06-15
There are currently limited insights into the progression of human primary humoral immunity despite numerous studies in experimental models. In this study, we analyzed a primary and related secondary parenteral keyhole limpet hemocyanin (KLH) immunization in five human adults. The primary challenge elicited discordant KLH-specific serum and blood effector B cell responses (i.e., dominant serum KLH-specific IgG and IgM levels versus dominant KLH-specific IgA plasmablast frequencies). Single-cell IgH sequencing revealed early appearance of highly (>15 mutations) mutated circulating KLH-specific plasmablasts 2 wk after primary KLH immunization, with simultaneous KLH-specific plasmablasts carrying non- and low-mutated IgH sequences. The data suggest that the highly mutated cells might originate from cross-reactive memory B cells (mBCs) rather than from the naive B cell repertoire, consistent with previous reported mutation rates and the presence of KLH-reactive mBCs in naive vaccinees prior to immunization. Whereas upon secondary immunization, serum Ab response kinetics and plasmablast mutation loads suggested the exclusive reactivation of KLH-specific mBCs, we, however, detected only little clonal overlap between the peripheral KLH-specific secondary plasmablast IgH repertoire and the primary plasmablast and mBC repertoire, respectively. Our data provide novel mechanistic insights into human humoral immune responses and suggest that primary KLH immunization recruits both naive B cells and cross-reactive mBCs, whereas secondary challenge exclusively recruits from a memory repertoire, with little clonal overlap with the primary response. Copyright © 2018 by The American Association of Immunologists, Inc.
Differential Immune Responses to New World and Old World Mammalian Arenaviruses
Ly, Hinh
2017-01-01
Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311
Law, Jessica; McCorkell, Robert; Muench, Greg; Wynne-Edwards, Katherine; Schaetzl, Hermann M.; Solis, Cristina; Nourozieh, Narges; Waeckerlin, Regula; Eschbaumer, Michael; Horsman, Shawn; Czub, Markus
2017-01-01
The objective of this study was to test the hypothesis that porcine circovirus type-2 (PCV2) vaccination is efficacious when administered in the first week of life. Three groups of pigs were vaccinated with Circumvent either early (at the end of week 1), late (at the end of week 4), or not at all. All 3 groups were later challenged intranasally with PCV2 (at the end of week 5). Two other groups were immunized with keyhole limpet hemocyanin (KLH) as a novel antigen at the end of either week 1 or week 4. Weight, PCV2 genome copy number in serum and saliva, anti-KLH antibody titer, and serum PCV2-neutralizing antibodies were measured weekly. Early PCV2 vaccination or KLH antigen exposure resulted in earlier humoral responses that were slower to develop than in older piglets, yet converged with the responses to later vaccination within 5 wk. Both groups of vaccinated piglets had periods of higher PCV2-neutralizing antibody titers and lower viral levels shortly after weaning and PCV2 challenge, thus supporting the recent labelling of 1 Canadian PCV2 vaccine for use in week 1 and suggesting that early PCV2 vaccination can reduce piglet handling without compromising vaccine efficacy. PMID:28154456
[Effect of immune modulation on immunogenic and protective activity of a live plague vaccine].
Karal'nik, B V; Ponomareva, T S; Deriabin, P N; Denisova, T G; Mel'nikova, N N; Tugambaev, T I; Atshabar, B B; Zakarian, S B
2014-01-01
Comparative evaluation of the effect of polyoxidonium and betaleukin on immunogenic and protective activity of a live plague vaccine in model animal experiments. Plague vaccine EV, polyoxidonium, betaleukin, erythrocytic antigenic diagnosticum for determination of F1 antibodies and immune reagents for detection of lymphocytes with F1 receptors (LFR) in adhesive test developed by the authors were used. The experiments were carried out in 12 rabbits and 169 guinea pigs. Immune modulation accelerated the appearance and disappearance of LFR (early phase) and ensured a more rapid and intensive antibody formation (effector phase). Activation by betaleukin is more pronounced than by polyoxidonium. The more rapid and intensive was the development of early phase, the more effective was antibody response to the vaccine. Immune modulation in the experiment with guinea pigs significantly increased protective activity of the vaccine. The use of immune modulators increased immunogenic (in both early and effector phases of antigen-specific response) and protective activity of the EV vaccine. A connection between the acceleration of the first phase of antigen-specific response and general intensity of effector phase of immune response to the EV vaccine was detected. ,
Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses
Feng, Pinghui; Moses, Ashlee; Früh, Klaus
2015-01-01
γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334
Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke
2017-02-06
In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.
Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.
Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna
2014-01-01
Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.
Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine
Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.
1973-01-01
The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112
Modulation of Human Immune Response by Fungal Biocontrol Agents
Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane
2017-01-01
Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107
Purcell, M.K.; LaPatra, S.E.; Woodson, J.C.; Kurath, G.; Winton, J.R.
2010-01-01
The main objective of this study was to assess correlates of innate resistance in rainbow trout full-sibling families that differ in susceptibility to Infectious hematopoietic necrosis virus (IHNV). As part of a commercial breeding program, full-sibling families were challenged with IHNV by waterborne exposure at the 1 g size to determine susceptibility to IHNV. Progeny from select families (N = 7 families) that varied in susceptibility (ranging from 32 to 90% cumulative percent mortality (CPM)) were challenged again at the 10 g size by intra-peritoneal injection and overall mortality, early viral replication and immune responses were evaluated. Mortality challenges included 20–40 fish per family while viral replication and immune response studies included 6 fish per family at each time point (24, 48 and 72 h post-infection (hpi)). CPM at the 1 g size was significantly correlated with CPM at the 10 g size, indicating that inherent resistance was a stable trait irrespective of size. In the larger fish, viral load was measured by quantitative reverse-transcriptase PCR in the anterior kidney and was a significant predictor of family disease outcome at 48 hpi. Type I interferon (IFN) transcript levels were significantly correlated with an individual's viral load at 48 and 72 hpi, while type II IFN gene expression was significantly correlated with an individual's viral load at 24 and 48 hpi. Mean family type I but not type II IFN gene expression was weakly associated with susceptibility at 72 hpi. There was no association between mean family susceptibility and the constitutive expression of a range of innate immune genes (e.g. type I and II IFN pathway genes, cytokine and viral recognition receptor genes). The majority of survivors from the challenge had detectable serum neutralizing antibody titers but no trend was observed among families. This result suggests that even the most resistant families experienced sufficient levels of viral replication to trigger specific
Work stress and innate immune response.
Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L
2011-01-01
Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.
Sordo, Yusmel; Suárez, Marisela; Caraballo, Rosalina; Sardina, Talía; Brown, Emma; Duarte, Carlos; Lugo, Joanna; Gil, Lázaro; Perez, Danny; Oliva, Ayme; Vargas, Milagros; Santana, Elaine; Valdés, Rodolfo; Rodríguez, María Pilar
2018-03-01
The development of subunit vaccines against classical swine fever is a desirable goal, because it allows discrimination between vaccinated and infected animals. In this study, humoral and cellular immune response elicited in inbred BALB/c mice by immunization with a recombinant classical swine fever virus (CSFV) E2 protein fused to porcine CD154 antigen (E2CD154) was assessed. This model was used as a predictor of immune response in swine. Mice were immunized with E2CD154 emulsified in Montanide ISA50V2 or dissolved in saline on days 1 and 21. Another group received E2His antigen, without CD154, in the same adjuvant. Montanide ISA50V2 or saline served as negative controls for each experimental group. Animals immunized with 12.5 and 2.5 μg/dose of E2CD154 developed the highest titers (>1:2000) of CSFV neutralizing antibodies. Moreover, CSFV specific splenocyte gamma-interferon production, measured after seven and twenty-eight days of immunization, was significantly higher in mice immunized with 12.5 μg of E2CD154. As a conclusion, E2CD154 emulsified in Montanide ISA50 V2 was able to induce a potent humoral and an early cellular immune response in inbred BALB/c mice. Therefore, this immunogen might be an appropriate candidate to elicit immune response in swine, control CSF disease and to eliminate CSFV in swine. Copyright © 2018 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Famakin, Bolanle M.
2014-01-01
It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490
Smith, Tracey J; Wilson, Marques A; Karl, J Philip; Orr, Jeb; Smith, Carl D; Cooper, Adam D; Heaton, Kristin J; Young, Andrew J; Montain, Scott J
2018-01-01
Systemic immune function is impaired by sleep restriction. However, the impact of sleep restriction on local immune responses and to what extent any impairment can be mitigated by nutritional supplementation is unknown. We assessed the effect of 72-h sleep restriction (2-h nightly sleep) on local immune function and skin barrier restoration of an experimental wound, and determined the influence of habitual protein intake (1.5 g·kg -1 ·day -1 ) supplemented with arginine, glutamine, zinc sulfate, vitamin C, vitamin D3, and omega-3 fatty acids compared with lower protein intake (0.8 g·kg -1 ·day -1 ) without supplemental nutrients on these outcomes. Wounds were created in healthy adults by removing the top layer of less than or equal to eight forearm blisters induced via suction, after adequate sleep (AS) or 48 h of a 72-h sleep restriction period (SR; 2-h nightly sleep). A subset of participants undergoing sleep restriction received supplemental nutrients during and after sleep restriction (SR+). Wound fluid was serially sampled 48 h postblistering to assess local cytokine responses. The IL-8 response of wound fluid was higher for AS compared with SR [area-under-the-curve (log 10 ), 5.1 ± 0.2 and 4.9 ± 0.2 pg/ml, respectively; P = 0.03]; and both IL-6 and IL-8 concentrations were higher for SR+ compared with SR ( P < 0.0001), suggestive of a potentially enhanced early wound healing response. Skin barrier recovery was shorter for AS (4.2 ± 0.9 days) compared with SR (5.0 ± 0.9 days) ( P = 0.02) but did not differ between SR and SR+ ( P = 0.18). Relatively modest sleep disruption delays wound healing. Supplemental nutrition may mitigate some decrements in local immune responses, without detectable effects on wound healing rate. NEW & NOTEWORTHY The data herein characterizes immune function in response to sleep restriction in healthy volunteers with and without nutrition supplementation. We used a unique skin wound model to show that sleep
Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.
Mack, Madison R; Kim, Brian S
2016-07-19
The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.
Evasion of host immune defenses by human papillomavirus.
Westrich, Joseph A; Warren, Cody J; Pyeon, Dohun
2017-03-02
A majority of human papillomavirus (HPV) infections are asymptomatic and self-resolving in the absence of medical interventions. Various innate and adaptive immune responses, as well as physical barriers, have been implicated in controlling early HPV infections. However, if HPV overcomes these host immune defenses and establishes persistence in basal keratinocytes, it becomes very difficult for the host to eliminate the infection. The HPV oncoproteins E5, E6, and E7 are important in regulating host immune responses. These oncoproteins dysregulate gene expression, protein-protein interactions, posttranslational modifications, and cellular trafficking of critical host immune modulators. In addition to the HPV oncoproteins, sequence variation and dinucleotide depletion in papillomavirus genomes has been suggested as an alternative strategy for evasion of host immune defenses. Since anti-HPV host immune responses are also considered to be important for antitumor immunity, immune dysregulation by HPV during virus persistence may contribute to immune suppression essential for HPV-associated cancer progression. Here, we discuss cellular pathways dysregulated by HPV that allow the virus to evade various host immune defenses. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Immune Response in Mussels To Environmental Pollution.
ERIC Educational Resources Information Center
Pryor, Stephen C.; Facher, Evan
1997-01-01
Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)
Effect of rituximab on human in vivo antibody immune responses.
Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana
2011-12-01
B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights
Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.
Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna
2017-12-11
Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.
Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J
2015-01-01
Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.
The acute phase response of cod (Gadus morhua L.): expression of immune response genes.
Audunsdottir, Sigridur S; Magnadottir, Bergljot; Gisladottir, Berglind; Jonsson, Zophonias O; Bragason, Birkir Th
2012-02-01
An acute phase response (APR) was experimentally induced in Atlantic cod (Gadus morhua L.) by intramuscular injection of turpentine oil. The change in the expression of immune related genes was monitored in the anterior kidney and the spleen over a period of 7 days. The genes examined were two types of pentraxins, apolipoprotein A1 (ApoA-I), the complement component C3, interleukin-1β (IL-1β), transferrin, cathelicidin, and hepcidin. All genes were constitutively expressed in both organs and their expression amplified by the turpentine injection. A pattern of response was observed both with respect to the organ preference and to the timing of a maximum response. The increased gene expression of the pentraxins, ApoA-I and C3 was restricted to the anterior kidney, the gene expression of IL-1β, cathelicidin, and transferrin increased in both organs, while hepcidin gene expression was only significantly increased in the spleen. The pentraxins and ApoA-I appear to be early mediators of APR in cod, possibly stimulating C3 and IL-1β response, while the antimicrobial peptides may play a minor role. The increase in transferrin gene expression in both organs, and apparent indifference to cortisol release associated with the turpentine injection, suggests that this could be a typical acute phase protein in cod. Copyright © 2011 Elsevier Ltd. All rights reserved.
The Role of the Immune Response in the Pathogenesis of Bronchiectasis.
King, Paul T
2018-01-01
Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.
Kadara, H; Choi, M; Zhang, J; Parra, E R; Rodriguez-Canales, J; Gaffney, S G; Zhao, Z; Behrens, C; Fujimoto, J; Chow, C; Yoo, Y; Kalhor, N; Moran, C; Rimm, D; Swisher, S; Gibbons, D L; Heymach, J; Kaftan, E; Townsend, J P; Lynch, T J; Schlessinger, J; Lee, J; Lifton, R P; Wistuba, I I; Herbst, R S
2017-01-01
Lung adenocarcinomas (LUADs) lead to the majority of deaths attributable to lung cancer. We performed whole-exome sequencing (WES) and immune profiling analyses of a unique set of clinically annotated early-stage LUADs to better understand the pathogenesis of this disease and identify clinically relevant molecular markers. We performed WES of 108 paired stage I-III LUADs and normal lung tissues using the Illumina HiSeq 2000 platform. Ten immune markers (PD-L1, PD-1, CD3, CD4, CD8, CD45ro, CD57, CD68, FOXP3 and Granzyme B) were profiled by imaging-based immunohistochemistry (IHC) in a subset of LUADs (n = 92). Associations among mutations, immune markers and clinicopathological variables were analyzed using ANOVA and Fisher's exact test. Cox proportional hazards regression models were used for multivariate analysis of clinical outcome. LUADs in this cohort exhibited an average of 243 coding mutations. We identified 28 genes with significant enrichment for mutation. SETD2-mutated LUADs exhibited relatively poor recurrence- free survival (RFS) and mutations in STK11 and ATM were associated with poor RFS among KRAS-mutant tumors. EGFR, KEAP1 and PIK3CA mutations were predictive of poor response to adjuvant therapy. Immune marker analysis revealed that LUADs in smokers and with relatively high mutation burdens exhibited increased levels of immune markers. Analysis of immunophenotypes revealed that LUADs with STK11 mutations exhibited relatively low levels of infiltrating CD4+/CD8+ T-cells indicative of a muted immune response. Tumoral PD-L1 was significantly elevated in TP53 mutant LUADs whereas PIK3CA mutant LUADs exhibited markedly down-regulated PD-L1 expression. LUADs with TP53 or KEAP1 mutations displayed relatively increased CD57 and Granzyme B levels indicative of augmented natural killer (NK) cell infiltration. Our study highlights molecular and immune phenotypes that warrant further analysis for their roles in clinical outcomes and personalized immune
Immune Response to Marburg Virus Angola Infection in Nonhuman Primates.
Fernando, Lisa; Qiu, Xiangguo; Melito, P Leno; Williams, Kinola J N; Feldmann, Friederike; Feldmann, Heinz; Jones, Steven M; Alimonti, Judie B
2015-10-01
The 2005 outbreak of Marburg virus (MARV) infection in Angola was the most lethal MARV infection outbreak in history, with a case-fatality rate (90%) similar to that for Zaire ebolavirus (EBOV) infection. However, very little is known about the pathogenicity of MARV Angola, as few studies have been conducted to date. Therefore, the immune response was examined in MARV Angola-infected nonhuman primates. Cynomolgus macaques were infected with MARV Angola and monitored for survival. The effect of MARV Angola on the immune system was examined by immunophenotyping whole-blood and by analyzing cytokine and chemokine levels in plasma and spleen specimens, using flow cytometry. The prominent clinical findings were rapid onset of disease and death (mean time after infection, 6.7 days), fever, depression, anorexia, petechial rash, and lymphopenia. Specifically, T, B, and natural killer cells were severely depleted in the blood by day 6. The typical cytokine storm was present, with levels of interferon γ, tumor necrosis factor, interleukin 6, and CCL2 rising in the blood early during infection. MARV Angola displayed the same virulence and disease pathology as EBOV. MARV Angola appears to cause a more rapid onset and severe outcome of infection than other MARV strains. © Crown copyright 2015.
Immunity in Drosophila melanogaster--from microbial recognition to whole-organism physiology.
Buchon, Nicolas; Silverman, Neal; Cherry, Sara
2014-12-01
Since the discovery of antimicrobial peptide responses 40 years ago, the fruit fly Drosophila melanogaster has proven to be a powerful model for the study of innate immunity. Early work focused on innate immune mechanisms of microbial recognition and subsequent nuclear factor-κB signal transduction. More recently, D. melanogaster has been used to understand how the immune response is regulated and coordinated at the level of the whole organism. For example, researchers have used this model in studies investigating interactions between the microbiota and the immune system at barrier epithelial surfaces that ensure proper nutritional and immune homeostasis both locally and systemically. In addition, studies in D. melanogaster have been pivotal in uncovering how the immune response is regulated by both endocrine and metabolic signalling systems, and how the immune response modifies these systems as part of a homeostatic circuit. In this Review, we briefly summarize microbial recognition and antiviral immunity in D. melanogaster, and we highlight recent studies that have explored the effects of organism-wide regulation of the immune response and, conversely, the effects of the immune response on organism physiology.
A humoral immune response confers protection against Haemophilus ducreyi infection.
Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H
2003-12-01
Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.
Fleisher, G R; Collins, M; Fager, S
1985-11-01
The antibody response to Epstein-Barr virus (EBV) antigens in patients with infectious mononucleosis (IM) was studied to assess antibody appearance to the restricted (R) component of the early antigen (EA) complex and to determine the effect of corticosteroids on all aspects of the humoral immune response. Sixty college students with heterophil-positive clinical IM, confirmed by EBV-specific serology, were followed for a period of 4-26 weeks, Half received prednisone for six days, and the remainder received no corticosteroid therapy. Regardless of therapy, 48% of the patients developed anti-EA(R) antibodies. The response to other antigens was similar in both groups with the exception that antibodies to the EB-associated nuclear antigen (EBNA) developed later during convalescence and at lower titers in the corticosteroid-treated group. We conclude that 1) anti-EA(R) antibodies develop with considerable frequency following IM and are not a marker, as previously proposed, of unusually severe disease, and 2) corticosteroid therapy may retard the formation of anti-EBNA antibodies but it does not otherwise influence the humoral immune response to EBV.
Basso, B; Marini, V
2015-03-01
Trypanosoma cruzi is a real challenge to the host's immune system, because it requires strong humoral and cellular immune response to remove circulating trypomastigote forms, and to prevent the replication of amastigote forms in tissues, involving many regulator and effector components. This protozoan is responsible for Chagas disease, a major public health problem in Latinamerica. We have developed a model of vaccination with Trypanosoma rangeli, a parasite closely related to T. cruzi, but nonpathogenic to humans, which reduces the infectiousness in three different species of animals, mice, dogs and guinea pigs, against challenge with T. cruzi. In a previous work, we demonstrated that mice vaccinated with T. rangeli showed important soluble mediators that stimulate phagocytic activity versus only infected groups. The aim of this work was to study the innate immune response in mice vaccinated or not with T. rangeli. Different population cells and some soluble mediators (cytokines) in peritoneal fluid and plasma in mice vaccinated-infected and only infected with T. cruzi were studied. In the first hours of challenge vaccinated mice showed an increase of macrophages, NK, granulocytes, and regulation of IL6, IFNγ, TNFα and IL10, with an increase of IL12, with respect to only infected mice. Furthermore an increase was observed of Li T, Li B responsible for adaptative response. Finally the findings showed that the innate immune response plays an important role in vaccinated mice for the early elimination of the parasites, complementary with the adaptative immune response, suggesting that vaccination with T. rangeli modulates the innate response, which develops some kind of immunological memory, recognizing shared antigens with T. cruzi. These results could contribute to the knowledge of new mechanisms which would have an important role in the immune response to Chagas disease. Copyright © 2014 Elsevier GmbH. All rights reserved.
Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric
2015-10-21
Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.
Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra
2016-06-01
Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381
Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection
2000-01-01
iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT
How might infant and paediatric immune responses influence malaria vaccine efficacy?
Moormann, A M
2009-09-01
Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.
ERIC Educational Resources Information Center
Fagnan, Lyle J.; Shipman, Scott A.; Gaudino, James A.; Mahler, Jo; Sussman, Andrew L.; Holub, Jennifer
2011-01-01
Context: Little is known about rural clinicians' perspectives regarding early childhood immunization delivery, their adherence to recommended best immunization practices, or the specific barriers they confront. Purpose: To examine immunization practices, beliefs, and barriers among rural primary care clinicians for children in Oregon and compare…
Acquired immunity to amyloodiniosis is associated with an antibody response.
Cobb, C S; Levy, M G; Noga, E J
1998-10-08
The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.
Immunosuppressive activity of tilmicosin on the immune responses in mice.
Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming
2011-06-01
Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.
Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.
Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host
Lu, Yanxia; Liu, Meng; Shi, Shousen; Jiang, Hong; Yang, Lejin; Liu, Xin; Zhang, Qian; Pan, Fang
2010-06-01
Although studies have shown that psychological stress has detrimental effects on bronchial asthma, there are few objective data on whether early-life stress, as early postnatal psychosocial environment, has a long-lasting effect on adult asthma and the potential pathophysiologic mechanism. This study aims to examine the effects on immune function and hypothalamic-pituitary-adrenal (HPA) axis responses in adult asthmatic rats that experienced stress in early life and the potential ameliorative effects of music therapy on these parameters. Forty male Wistar rat pups were randomly assigned to the asthma group, the adulthood-stressed asthma group, the childhood-stressed asthma group, the music group, and the control group. Restraint stress and Mozart's Sonata K.448 were applied to ovalbumin (OVA)-induced asthmatic rats to establish psychological stress and music therapy models. The levels of serum corticosterone were examined in both childhood after stress and adulthood after OVA challenge. Immune indicators in blood, lung, and brain tissues were measured after the last OVA challenge. Stress in both childhood and adulthood resulted in increases in leukocyte and eosinophil numbers and serum interleukin (IL)-4 levels. The adulthood-stressed group demonstrated increased corticosterone levels after challenge, whereas the childhood-stressed group showed increased corticosterone concentration in childhood but decreased level in adulthood. Central IL-1beta exhibited a similar tendency. Music group rats showed reduced serum IL-4 and corticosterone. Stress in childhood and adulthood resulted in different HPA axis responsiveness in the exacerbation of markers of asthma. These data provide the first evidence of the long-term normalizing effects of music on asthmatic rats.
Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response
Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.
2013-01-01
Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Tailoring the Immune Response via Customization of Pathogen Gene Expression
Runco, Lisa M.; Stauft, Charles B.
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769
Ecosystem and immune systems: Hierarchial response provides resilience against invasions
Allen, Craig R.
2001-01-01
Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.
pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.
Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori
2017-11-04
(1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.
Reuben, C; Sundaram, K; Phondke, G P
1979-01-01
The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994
Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.
Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A
2013-04-01
A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.
Bivalve immunity and response to infections: Are we looking at the right place?
Allam, Bassem; Pales Espinosa, Emmanuelle
2016-06-01
Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S
2014-01-01
The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157
Siblings Promote a Type 1/Type 17-oriented immune response in the airways of asymptomatic neonates.
Wolsk, H M; Chawes, B L; Følsgaard, N V; Rasmussen, M A; Brix, S; Bisgaard, H
2016-06-01
Siblings have been shown to reduce the risk of childhood asthma and allergy, but the mechanism driving this association is unknown. The objective was to study whether siblings affect the airway immune response in healthy neonates, which could represent an underlying immune modulatory pathway. We measured 20 immune mediators related to the Type 1, Type 2, Type 17, or regulatory immune pathways in the airway mucosa of 571 one-month-old asymptomatic neonates from the Copenhagen Prospective Studies on Asthma in Childhood2010 birth cohort (COPSAC2010 ). The association between airway mediator levels and presence of siblings was investigated using conventional statistics and principle component analysis (PCA). Neonates with siblings had an upregulated level of airway immune mediators, with predominance of Type 1- and Type 17-related mediators. This was supported by the PCA showing a highly significant difference between children with vs without siblings: P < 10(-10) , which persisted after adjustment for potential confounders including pathogenic airway bacteria and viruses: P < 0.0001. The immune priming effect was inversely associated with time since last childbirth: P = 0.0015. Siblings mediate a Type 1/Type 17-related immune-stimulatory effect in the airways of asymptomatic neonates, also after adjustment for pathogenic bacteria and viruses, indicating that siblings exert a transferable early immune modulatory effect. These findings may represent an in utero immune priming effect of the fetal immune system caused by previous pregnancies as the effect was attenuated with time since last childbirth, or it could relate to the presence of unidentified microbes, but further studies are needed to confirm our findings. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Bombeiro, André L.; Santini, Júlio C.; Thomé, Rodolfo; Ferreira, Elisângela R. L.; Nunes, Sérgio L. O.; Moreira, Bárbara M.; Bonet, Ivan J. M.; Sartori, Cesar R.; Verinaud, Liana; Oliveira, Alexandre L. R.
2016-01-01
Injuries to peripheral nerves cause loss of motor and sensory function, greatly affecting life quality. Successful repair of the lesioned nerve requires efficient cell debris removal, followed by axon regeneration and reinnervation of target organs. Such process is orchestrated by several cellular and molecular events in which glial and immune cells actively participate. It is known that tissue clearance is largely improved by macrophages, which activation is potentiated by cells and molecules of the acquired immune system, such as T helper lymphocytes and antibodies, respectively. In the present work, we evaluated the contribution of lymphocytes in the regenerative process of crushed sciatic nerves of immunocompetent (wild-type, WT) and T and B-deficient (RAG-KO) mice. In Knockout animals, we found increased amount of macrophages under basal conditions and during the initial phase of the regenerative process, that was evaluated at 2, 4, and 8 weeks after lesion (wal). That parallels with faster axonal regeneration evidenced by the quantification of neurofilament and a growth associated protein immunolabeling. The motor function, evaluated by the sciatic function index, was fully recovered in both mouse strains within 4 wal, either in a progressive fashion, as observed for RAG-KO mice, or presenting a subtle regression, as seen in WT mice between 2 and 3 wal. Interestingly, boosting the immune response by early adoptive transference of activated WT lymphocytes at 3 days after lesion improved motor recovery in WT and RAG-KO mice, which was not ameliorated when cells were transferred at 2 wal. When monitoring lymphocytes by in vivo imaging, in both mouse strains, cells migrated to the lesion site shortly after transference, remaining in the injured limb up to its complete motor recovery. Moreover, a first peak of hyperalgesia, determined by von-Frey test, was coincident with increased lymphocyte infiltration in the damaged paw. Overall, the present results suggest
How sex and age affect immune responses, susceptibility to infections, and response to vaccination
Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix
2015-01-01
Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438
NASA Astrophysics Data System (ADS)
Aguilera, Eduardo; Amat, Juan A.
2007-11-01
Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.
Interference of Aspergillus fumigatus with the immune response.
Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A
2015-03-01
Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.
Zhang, Jie; Liu, Huan; Wei, Bin
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*
Zhang, Jie; Liu, Huan; Wei, Bin
2017-01-01
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566
Meyer, Sonja Izquierdo; Fuglsang, Katrine; Blaakaer, Jan
2014-12-01
This clinical review aims to assess the efficacy of human papillomavirus 16/18 (HPV16/18) vaccination on the cell-mediated immune response in women with existing cervical intraepithelial neoplasia or cervical cancer induced by HPV16 or HPV18. A focused and thorough literature search conducted in five different databases found 996 publications. Six relevant articles were chosen for further review. In total, 154 patients (>18 years of age) were enrolled in prospective study trials with 3-15 months of follow up. The vaccine applications were administered two to four times. The vaccines contained different combinations of HPV16 and HPV18 and early proteins, E6 and E7. The primary outcome was the cell-mediated immune response. Correlation to clinical outcome (histopathology) and human leukocyte antigen genes were secondary endpoints. All vaccines triggered a detectable cell-mediated immune response, some of which were statistically significant. Correlations between immunological response and clinical outcome (histopathology) were not significant, so neoplasms may not be susceptible to vaccine-generated cytotoxic T cells (CD8(+)). Prophylactic HPV vaccines have been introduced to reduce the incidence of cervical cancer in young women. Women already infected with HPV could benefit from a therapeutic HPV vaccination. Hence, it is important to continue the development of therapeutic HPV vaccines to lower the rate of HPV-associated malignancies and crucial to evaluate vaccine efficacy clinically. This clinical review represents an attempt to elucidate the theories supporting the development of an HPV vaccine with a therapeutic effect on human papillomavirus-induced malignancies of the cervix. © 2014 Nordic Federation of Societies of Obstetrics and Gynecology.
Seydoux, Emilie; Liang, Hong; Dubois Cauwelaert, Natasha; Archer, Michelle; Rintala, Nicholas D; Kramer, Ryan; Carter, Darrick; Fox, Christopher B; Orr, Mark T
2018-05-16
The involvement of innate receptors that recognize pathogen- and danger-associated molecular patterns is critical to programming an effective adaptive immune response to vaccination. The synthetic TLR4 agonist glucopyranosyl lipid adjuvant (GLA) synergizes with the squalene oil-in-water emulsion (SE) formulation to induce strong adaptive responses. Although TLR4 signaling through MyD88 and TIR domain-containing adapter inducing IFN-β are essential for GLA-SE activity, the mechanisms underlying the synergistic activity of GLA and SE are not fully understood. In this article, we demonstrate that the inflammasome activation and the subsequent release of IL-1β are central effectors of the action of GLA-SE, as infiltration of innate cells into the draining lymph nodes and production of IFN-γ are reduced in ASC -/- animals. Importantly, the early proliferation of Ag-specific CD4 + T cells was completely ablated after immunization in ASC -/- animals. Moreover, numbers of Ag-specific CD4 + T and B cells as well as production of IFN-γ, TNF-α, and IL-2 and Ab titers were considerably reduced in ASC -/- , NLRP3 -/- , and IL-1R -/- mice compared with wild-type mice and were completely ablated in TLR4 -/- animals. Also, extracellular ATP, a known trigger of the inflammasome, augments Ag-specific CD4 + T cell responses, as hydrolyzing it with apyrase diminished adaptive responses induced by GLA-SE. These data thus demonstrate that GLA-SE adjuvanticity acts through TLR4 signaling and NLRP3 inflammasome activation to promote robust Th1 and B cell responses to vaccine Ags. The findings suggest that engagement of both TLR and inflammasome activators may be a general paradigm for induction of robust CD4 T cell immunity with combination adjuvants such as GLA-SE. Copyright © 2018 by The American Association of Immunologists, Inc.
Birkenbihl, Rainer P; Kracher, Barbara; Somssich, Imre E
2017-01-01
During microbial-associated molecular pattern-triggered immunity (MTI), molecules derived from microbes are perceived by cell surface receptors and upon signaling to the nucleus initiate a massive transcriptional reprogramming critical to mount an appropriate host defense response. WRKY transcription factors play an important role in regulating these transcriptional processes. Here, we determined on a genome-wide scale the flg22-induced in vivo DNA binding dynamics of three of the most prominent WRKY factors, WRKY18, WRKY40, and WRKY33. The three WRKY factors each bound to more than 1000 gene loci predominantly at W-box elements, the known WRKY binding motif. Binding occurred mainly in the 500-bp promoter regions of these genes. Many of the targeted genes are involved in signal perception and transduction not only during MTI but also upon damage-associated molecular pattern-triggered immunity, providing a mechanistic link between these functionally interconnected basal defense pathways. Among the additional targets were genes involved in the production of indolic secondary metabolites and in modulating distinct plant hormone pathways. Importantly, among the targeted genes were numerous transcription factors, encoding predominantly ethylene response factors, active during early MTI, and WRKY factors, supporting the previously hypothesized existence of a WRKY subregulatory network. Transcriptional analysis revealed that WRKY18 and WRKY40 function redundantly as negative regulators of flg22-induced genes often to prevent exaggerated defense responses. © 2016 American Society of Plant Biologists. All rights reserved.
Antimicrobial autophagy: a conserved innate immune response in Drosophila.
Moy, Ryan H; Cherry, Sara
2013-01-01
Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.
Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses
Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.
2011-01-01
The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979
Feng, Min; Dai, Manman; Cao, Weisheng; Tan, Yan; Li, Zhenhui; Shi, Meiqing; Zhang, Xiquan
2017-01-01
Avian leucosis virus subgroup J (ALV-J) can cause lifelong infection and can escape from the host immune defenses in chickens. Since macrophages act as the important defense line against invading pathogens in host innate immunity, we investigated the function and innate immune responses of chicken primary monocyte-derived macrophages (MDM) after ALV-J infection in this study. Our results indicated that ALV-J was stably maintained in MDM cells but that the viral growth rate was significantly lower than that in DF-1 cells. We also found that ALV-J infection significantly increased nitric oxide (NO) production, but had no effect on MDM phagocytic capacity. Interestingly, infection with ALV-J rapidly promoted the expression levels of Myxovirus resistance 1 (Mx) (3 h, 6 h), ISG12 (6 h), and interleukin-1β (IL-1β) (3 h, 12 h) at an early infection stage, whereas it sharply decreased the expression of Mx (24 h, 36 h), ISG12 (36 h), and made little change on IL-1β (24 h, 36 h) production at a late infection stage in MDM cells. Moreover, the protein levels of interferon-β (IFN-β) and interleukin-6 (IL-6) had sharply increased in infected MDM cells from 3 to 36 h post infection (hpi) of ALV-J. And, the protein level of interleukin-10 (IL-10) was dramatically decreased at 36 hpi in MDM cells infected with ALV-J. These results demonstrate that ALV-J can induce host innate immune responses and we hypothesize that macrophages play an important role in host innate immune attack and ALV-J immune escape. © The Author 2016. Published by Oxford University Press on behalf of Poultry Science Association.
Simi, S; Peter, Valsa S; Peter, M C Subhash
2017-09-15
Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
Pereyra, Elizabet A L; Sacco, Sofía C; Duré, Andrea; Baravalle, Celina; Renna, María S; Andreotti, Carolina S; Monecke, Stefan; Calvinho, Luis F; Dallard, Bibiana E
2017-05-01
Staphylococcus aureus is one of the most frequently isolated major pathogens from intramammary infections (IMI) worldwide. The mechanisms by which S. aureus IMI are established and maintained in dairy cows involve both bacterial escape strategies and modulation of the host immune response. Moreover, it was shown that different S. aureus strains have varying effects on the immune response. The aim of this study was to investigate the immune response in a mouse mastitis model of two S. aureus strains isolated from bovine IMI with different clinical manifestation (persistent-P or non-persistent-NP), phenotypic and genotypic profile. Both strains were capable of establishing an IMI after 264h post inoculation (pi). Strain A (NP) showed a more aggressive behaviour than strain B (P) at early stages of IMI, while strain B multiplied initially at a lower rate but increased its replication capacity from 120h pi to the end of the study (264h pi). Strain A triggered a stronger initial inflammatory response compared with strain B inducing higher gene and protein expression of TLR2, NF-κB activation and higher gene expression of IL-1α at initial stage of IMI (6-12h pi) but inducing extensive mammary tissue damage. Immune cells response was different for each S. aureus strain throughout the course of infection, showing mammary glands inoculated with strain A greater initial immune cells stimulation compared with strain B and then a second immune cells stimulation (from 120 to 264h pi) represented by monocytes-macrophages, T and B lymphocytes, mainly stimulated by strain B, consistent with inflammatory process becoming chronic. Strain-specific pathogenicity observed underscores the importance of pathogen factors in the progression of the infectious process. These results contribute to increase the available information on host-pathogen interaction and point out for the need of further research to expand the knowledge about these interactions for developing new strategies to
Responses of innate immune cells to group A Streptococcus
Fieber, Christina; Kovarik, Pavel
2014-01-01
Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.
Postnatal Innate Immune Development: From Birth to Adulthood
Georgountzou, Anastasia; Papadopoulos, Nikolaos G.
2017-01-01
It is well established that adaptive immune responses are deficient in early life, contributing to increased mortality and morbidity. The developmental trajectories of different components of innate immunity are only recently being explored. Individual molecules, cells, or pathways of innate recognition and signaling, within different compartments/anatomical sites, demonstrate variable maturation patterns. Despite some discrepancies among published data, valuable information is emerging, showing that the developmental pattern of cytokine responses during early life is age and toll-like receptor specific, and may be modified by genetic and environmental factors. Interestingly, specific environmental exposures have been linked both to innate function modifications and the occurrence of chronic inflammatory disorders, such as respiratory allergies. As these conditions are on the rise, our knowledge on innate immune development and its modulating factors needs to be expanded. Improved understanding of the sequence of events associated with disease onset and persistence will lead toward meaningful interventions. This review describes the state-of-the-art on normal postnatal innate immune ontogeny and highlights research areas that are currently explored or should be further addressed. PMID:28848557
Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li
2013-02-18
The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C
2011-10-01
A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease
NASA Astrophysics Data System (ADS)
Sun, Jun; Deem, Michael
2006-03-01
The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.
The early response during the interaction of fungal phytopathogen and host plant.
Shen, Yilin; Liu, Na; Li, Chuang; Wang, Xin; Xu, Xiaomeng; Chen, Wan; Xing, Guozhen; Zheng, Wenming
2017-05-01
Plants can be infected by a variety of pathogens, most of which can cause severe economic losses. The plants resist the invasion of pathogens via the innate or acquired immune system for surviving biotic stress. The associations between plants and pathogens are sophisticated beyond imaging and the interactions between them can occur at a very early stage after their touching each other. A number of researchers in the past decade have shown that many biochemical events appeared even as early as 5 min after their touching for plant disease resistance response. The early molecular interactions of plants and pathogens are likely to involve protein phosphorylation, ion fluxes, reactive oxygen species (ROS) and other signalling transduction. Here, we reviewed the recent progress in the study for molecular interaction response of fungal pathogens and host plant at the early infection stage, which included many economically important crop fungal pathogens such as cereal rust fungi, tomato Cladosporium fulvum , rice blast and so on. By dissecting the earlier infection stage of the diseases, the avirulent/virulent genes of pathogen or resistance genes of plant could be defined more clearly and accurately, which would undoubtedly facilitate fungal pathogenesis study and resistant crop breeding. © 2017 The Authors.
The early response during the interaction of fungal phytopathogen and host plant
Shen, Yilin; Liu, Na; Li, Chuang; Wang, Xin; Xu, Xiaomeng; Chen, Wan; Xing, Guozhen
2017-01-01
Plants can be infected by a variety of pathogens, most of which can cause severe economic losses. The plants resist the invasion of pathogens via the innate or acquired immune system for surviving biotic stress. The associations between plants and pathogens are sophisticated beyond imaging and the interactions between them can occur at a very early stage after their touching each other. A number of researchers in the past decade have shown that many biochemical events appeared even as early as 5 min after their touching for plant disease resistance response. The early molecular interactions of plants and pathogens are likely to involve protein phosphorylation, ion fluxes, reactive oxygen species (ROS) and other signalling transduction. Here, we reviewed the recent progress in the study for molecular interaction response of fungal pathogens and host plant at the early infection stage, which included many economically important crop fungal pathogens such as cereal rust fungi, tomato Cladosporium fulvum, rice blast and so on. By dissecting the earlier infection stage of the diseases, the avirulent/virulent genes of pathogen or resistance genes of plant could be defined more clearly and accurately, which would undoubtedly facilitate fungal pathogenesis study and resistant crop breeding. PMID:28469008
Smirnova, Natalia P; Webb, Brett T; Bielefeldt-Ohmann, Helle; Van Campen, Hana; Antoniazzi, Alfredo Q; Morarie, Susan E; Hansen, Thomas R
2012-08-01
Transplacental viral infections are dependent upon complex interactions between feto-placental and maternal immune responses and the stage of fetal development at which the infection occurs. Bovine viral diarrhea virus (BVDV) has the ability to cross the placenta and infect the fetus. Infection early in gestation with non-cytopathic (ncp) BVDV leads to persistent infection. Establishment of fetal persistent infection results in life-long viremia, virus-specific immunotolerance, and may have detrimental developmental consequences. We have previously shown that heifers infected experimentally with ncp BVDV type 2 on d. 75 of gestation had transient robust up-regulation of the type I interferon (IFN) stimulated genes (ISGs) 3-15 days after viral inoculation. Blood from persistently infected (PI) fetuses, collected 115 days post maternal infection, demonstrated moderate chronic up-regulation of ISGs. This infection model was used to delineate timing of the development of innate immune responses in the fetus and placenta during establishment of persistent infection. It was hypothesized that: (i) chronic stimulation of innate immune responses occurs following infection of the fetus and (ii) placental production of the type I IFN contributes to up-regulation of ISGs in PI fetuses. PI fetuses, generated by intranasal inoculation of pregnant heifers with ncp BVDV, and control fetuses from uninfected heifers, were collected via Cesarean sections on d. 82, 89, 97, 192, and 245 of gestation. Fetal viremia was confirmed starting on d. 89. Significant up-regulation of mRNA encoding cytosolic dsRNA sensors -RIG-I and MDA5 - was detected on d. 82-192. Detection of viral dsRNA by cytosolic sensors leads to the stimulation of ISGs, which was reflected in significant up-regulation of ISG15 mRNA in fetal blood on d. 89, 97, and 192. No difference in IFN-α and IFN-β mRNA concentration was found in fetal blood or caruncular tissue, while a significant increase in both IFN-α and IFN
Roger, Thierry; Schneider, Anina; Weier, Manuela; Sweep, Fred C G J; Le Roy, Didier; Bernhagen, Jürgen; Calandra, Thierry; Giannoni, Eric
2016-02-23
The vulnerability to infection of newborns is associated with a limited ability to mount efficient immune responses. High concentrations of adenosine and prostaglandins in the fetal and neonatal circulation hamper the antimicrobial responses of newborn immune cells. However, the existence of mechanisms counterbalancing neonatal immunosuppression has not been investigated. Remarkably, circulating levels of macrophage migration inhibitory factor (MIF), a proinflammatory immunoregulatory cytokine expressed constitutively, were 10-fold higher in newborns than in children and adults. Newborn monocytes expressed high levels of MIF and released MIF upon stimulation with Escherichia coli and group B Streptococcus, the leading pathogens of early-onset neonatal sepsis. Inhibition of MIF activity or MIF expression reduced microbial product-induced phosphorylation of p38 and ERK1/2 mitogen-activated protein kinases and secretion of cytokines. Recombinant MIF used at newborn, but not adult, concentrations counterregulated adenosine and prostaglandin E2-mediated inhibition of ERK1/2 activation and TNF production in newborn monocytes exposed to E. coli. In agreement with the concept that once infection is established high levels of MIF are detrimental to the host, treatment with a small molecule inhibitor of MIF reduced systemic inflammatory response, bacterial proliferation, and mortality of septic newborn mice. Altogether, these data provide a mechanistic explanation for how newborns may cope with an immunosuppressive environment to maintain a certain threshold of innate defenses. However, the same defense mechanisms may be at the expense of the host in conditions of severe infection, suggesting that MIF could represent a potential attractive target for immune-modulating adjunctive therapies for neonatal sepsis.
Giannoni, Eric; Guignard, Laurence; Knaup Reymond, Marlies; Perreau, Matthieu; Roth-Kleiner, Matthias; Calandra, Thierry; Roger, Thierry
2011-01-01
Newborns are particularly susceptible to bacterial infections due to qualitative and quantitative deficiencies of the neonatal innate immune system. However, the mechanisms underlying these deficiencies are poorly understood. Given that fetuses are exposed to high concentrations of estradiol and progesterone during gestation and at time of delivery, we analyzed the effects of these hormones on the response of neonatal innate immune cells to endotoxin, bacterial lipopeptide, and Escherichia coli and group B Streptococcus, the two most common causes of early-onset neonatal sepsis. Here we show that at concentrations present in umbilical cord blood, estradiol and progesterone are as powerful as hydrocortisone for inhibition of cytokine production by cord blood mononuclear cells (CBMCs) and newborn monocytes. Interestingly, CBMCs and newborn monocytes are more sensitive to the effects of estradiol and progesterone than adult peripheral blood mononuclear cells and monocytes. This increased sensitivity is associated with higher expression levels of estrogen and membrane progesterone receptors but is independent of a downregulation of Toll-like receptor 2 (TLR2), TLR4, and myeloid differentiation primary response gene 88 in newborn cells. Estradiol and progesterone mediate their anti-inflammatory activity through inhibition of the NF-κB pathway but not the mitogen-activated protein kinase pathway in CBMCs. Altogether, these results suggest that elevated umbilical cord blood concentrations of estradiol and progesterone acting on mononuclear cells expressing high levels of steroid receptors contribute to impair innate immune responses in newborns. Therefore, intrauterine exposure to estradiol and progesterone may participate in increasing susceptibility to infection during the neonatal period. PMID:21518785
The nature of immune responses to urinary tract infections
Abraham, Soman N.; Miao, Yuxuan
2016-01-01
The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331
RNA Editing, ADAR1, and the Innate Immune Response.
Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy
2017-01-18
RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.
Ubiquitination in the antiviral immune response.
Davis, Meredith E; Gack, Michaela U
2015-05-01
Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Teixeira, Luzia; Moreira, João; Melo, Joana; Bezerra, Filipa; Marques, Raquel M; Ferreirinha, Pedro; Correia, Alexandra; Monteiro, Mariana P; Ferreira, Paula G; Vilanova, Manuel
2015-01-01
The adipose tissue can make important contributions to immune function. Nevertheless, only a limited number of reports have investigated in lean hosts the immune response elicited in this tissue upon infection. Previous studies suggested that the intracellular protozoan Neospora caninum might affect adipose tissue physiology. Therefore, we investigated in mice challenged with this protozoan if immune cell populations within adipose tissue of different anatomical locations could be differently affected. Early in infection, parasites were detected in the adipose tissue and by 7 days of infection increased numbers of macrophages, regulatory T (Treg) cells and T-bet+ cells were observed in gonadal, mesenteric, omental and subcutaneous adipose tissue. Increased expression of interferon-γ was also detected in gonadal adipose tissue of infected mice. Two months after infection, parasite DNA was no longer detected in these tissues, but T helper type 1 (Th1) cell numbers remained above control levels in the infected mice. Moreover, the Th1/Treg cell ratio was higher than that of controls in the mesenteric and subcutaneous adipose tissue. Interestingly, chronically infected mice presented a marked increase of serum leptin, a molecule that plays a role in energy balance regulation as well as in promoting Th1-type immune responses. Altogether, we show that an apicomplexa parasitic infection influences immune cellular composition of adipose tissue throughout the body as well as adipokine production, still noticed at a chronic phase of infection when parasites were already cleared from that particular tissue. This strengthens the emerging view that infections can have long-term consequences for the physiology of adipose tissue. PMID:25581844
Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.
Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura
2011-10-13
Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Immune responses of poultry to Newcastle disease virus.
Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J
2013-11-01
Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be
Mlotshwa, Mandla; Riou, Catherine; Chopera, Denis; de Assis Rosa, Debra; Ntale, Roman; Treunicht, Florette; Woodman, Zenda; Werner, Lise; van Loggerenberg, Francois; Mlisana, Koleka; Abdool Karim, Salim; Williamson, Carolyn; Gray, Clive M.
2010-01-01
Deciphering immune events during early stages of human immunodeficiency virus type 1 (HIV-1) infection is critical for understanding the course of disease. We characterized the hierarchy of HIV-1-specific T-cell gamma interferon (IFN-γ) enzyme-linked immunospot (ELISPOT) assay responses during acute subtype C infection in 53 individuals and associated temporal patterns of responses with disease progression in the first 12 months. There was a diverse pattern of T-cell recognition across the proteome, with the recognition of Nef being immunodominant as early as 3 weeks postinfection. Over the first 6 months, we found that there was a 23% chance of an increased response to Nef for every week postinfection (P = 0.0024), followed by a nonsignificant increase to Pol (4.6%) and Gag (3.2%). Responses to Env and regulatory proteins appeared to remain stable. Three temporal patterns of HIV-specific T-cell responses could be distinguished: persistent, lost, or new. The proportion of persistent T-cell responses was significantly lower (P = 0.0037) in individuals defined as rapid progressors than in those progressing slowly and who controlled viremia. Almost 90% of lost T-cell responses were coincidental with autologous viral epitope escape. Regression analysis between the time to fixed viral escape and lost T-cell responses (r = 0.61; P = 0.019) showed a mean delay of 14 weeks after viral escape. Collectively, T-cell epitope recognition is not a static event, and temporal patterns of IFN-γ-based responses exist. This is due partly to viral sequence variation but also to the recognition of invariant viral epitopes that leads to waves of persistent T-cell immunity, which appears to associate with slower disease progression in the first year of infection. PMID:20826686
Plant immunity: unravelling the complexity of plant responses to biotic stresses.
Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne
2017-03-01
Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Host Immune Status and Response to Hepatitis E Virus Infection
Krain, Lisa J.; Nelson, Kenrad E.
2014-01-01
SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-01-01
BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-12-01
Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.
Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia
2017-01-01
During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.
Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D
2002-06-21
NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.